Pharmaceutical composition for the treatment of inflammatory bowel disease

Abstract

The present invention relates to a pharmaceutical composition for the prevention or treatment of inflammatory bowel disease, comprising glycol chitosan-thioketal-mesalazine or a pharmaceutically acceptable salt thereof as an active ingredient. The pharmaceutical composition for the treatment of inflammatory bowel disease of the present invention can be adsorbed to the intestinal mucosa and selectively release the mesalazine drug only at the site of inflammation, thereby effectively treating inflammatory bowel disease.

Description

[Technical Field]

[0001] This invention relates to a pharmaceutical composition for the treatment of inflammatory bowel disease. [Background technology]

[0002] Inflammatory bowel disease (IBD) is a chronic disease characterized by the interaction of environmental and genetic factors that trigger an immune response and inflammation in the intestines. IBD is broadly classified into Crohn's disease, which affects the entire gastrointestinal tract, and ulcerative colitis, which affects only the large intestine, with ulcerative colitis having a higher incidence. The exact cause of the disease is still not fully understood, but dysregulation of the immune response is considered to be a key etiology.

[0003] Currently, there are various therapeutic agents for treating inflammatory bowel disease, including aminosalicylates, steroids, immunosuppressants, and biological agents. Of these, mesalazine, an aminosalicylate that is actually prescribed to patients, is known to suppress inflammation by inhibiting Nuclear Factor-κB (NF-κB) signaling. However, it has the problem that it is absorbed more into normal tissues than into inflamed tissues and is rapidly excreted from the body before it can act on the inflamed area.

[0004] Therefore, examples of using mesalazine to selectively release the drug in the intestines for the treatment of inflammatory bowel disease can be broadly classified into two categories.

[0005] Firstly, there is Asacol, a mesalazine drug coated on a capsule that is broken down by the pH of the intestines. However, because it releases the drug to the entire intestine rather than just the inflamed site, it cannot solve the problem of unwanted absorption into normal areas compared to the inflamed site. Furthermore, because it has the characteristic of releasing a large dose of the drug all at once rather than continuously, it is accompanied by various side effects such as bone marrow suppression and dizziness. Therefore, it requires the delivery of a larger amount of drug than is effective in restoring inflammation, and there is a limitation in that a large amount is excreted due to saturation compared to the amount actually absorbed.

[0006] Sulfasalazine, developed to address this issue, is a drug in which intestinal microorganisms release mesalazine. However, it has the drawback of causing side effects due to the byproducts released when mesalazine is broken down, making it undesirable for patients to take.

[0007] To address these problems, the inventors conducted extensive research and designed a pharmaceutical composition for the treatment of inflammatory bowel disease.

[0008] The present invention relates to a pharmaceutical composition GC-M (Glycol chitosan-Thioketal-Mesalamine) for the treatment of inflammatory bowel disease, and more specifically, to a therapeutic agent that can be adsorbed to the intestinal mucosa and selectively release a mesalazine drug only at the site of inflammation, in order to improve the above-mentioned problems.

[0009] The glycol chitosan of the present invention has a large amount of cation-rich amine groups, and therefore exhibits high binding affinity to the anionic mucin layer of the intestinal mucosa through various interactions, resulting in a long retention time in the intestines. Thus, it plays a role in enabling the therapeutic agent of the present invention to remain in the intestinal mucosal layer for an extended period.

[0010] Furthermore, by utilizing the characteristic that inflamed areas of the intestines have a larger amount of ROS (Reactive Oxygen Species) than normal areas of the intestines, a linker called thioketal, which can be broken down by various ROS, is used to bind mesalazine, a therapeutic drug for inflammatory bowel disease, with glycol chitosan. This plays a role in enabling the selective release of mesalazine only at the inflamed area. [Overview of the project] [Problems that the invention aims to solve]

[0011] In order to improve these problems, the inventors conducted diligent research, We designed a pharmaceutical composition (Glycol chitosan-Thioketal-Mesalamine, GC-M) for the treatment of inflammatory bowel disease.

[0012] Therefore, the present invention is The objective is to provide a pharmaceutical composition for the prevention or treatment of inflammatory bowel disease, containing glycol chitosan-thioketal-mesalamine or a pharmaceutically acceptable salt thereof as an active ingredient.

[0013] Furthermore, the present invention is The objective is to provide a pharmaceutical formulation for the prevention or treatment of inflammatory bowel disease, which contains the aforementioned composition.

[0014] Furthermore, the present invention is The objective is to provide a health functional food for the prevention or improvement of inflammatory bowel disease, which contains the aforementioned composition. [Means for solving the problem]

[0015] To achieve the above objective, the present invention Provided is a pharmaceutical composition for the prevention or treatment of inflammatory bowel disease, comprising glycol chitosan-thioketal-mesalamine (Glycol chitosan-Thioketal-Mesalamine) or a pharmaceutically acceptable salt thereof as an active ingredient.

[0016] In one embodiment of the present invention, the glycol chitosan may be adsorbable to the intestinal mucosa.

[0017] In another embodiment of the present invention, the thioketal may be degraded by ROS at the inflammatory site to selectively release the drug.

[0018] In still another embodiment of the present invention, the drug may be mesalamine.

[0019] In still another embodiment of the present invention, the composition may inhibit the production of at least one selected from the group consisting of intracellular reactive oxygen species (ROS), reactive nitrogen species (RNS), and nitric oxide (NO).

[0020] In still another embodiment of the present invention, the composition may restore intercellular tight junctions.

[0021] In still another embodiment of the present invention, the composition may inhibit macrophage M1 polarization.

[0022] In still another embodiment of the present invention, the composition may suppress the expression of at least one inflammatory cytokine selected from the group consisting of TNF-α (tumor necrosis factor-α), IL-6 (Interleukin 6), and IL-1β (Interleukin-1β).

[0023] In yet another embodiment of the present invention, the composition may restore a damaged colon.

[0024] In yet another embodiment of the present invention, the inflammatory bowel disease may be at least one selected from the group consisting of Crohn's disease, ulcerative colitis, intestinal Behcet's disease, and enteritis.

[0025] Furthermore, the present invention is The present invention provides a pharmaceutical preparation for the prevention or treatment of inflammatory bowel disease, which contains the aforementioned composition.

[0026] In one embodiment of the present invention, the formulation may be an orally administered preparation, an injectable preparation, an injection preparation, a spray preparation, or a liquid preparation.

[0027] Furthermore, the present invention is The present invention provides a health functional food for the prevention or improvement of inflammatory bowel disease, which contains the aforementioned composition.

[0028] Furthermore, the present invention is This invention provides a pharmaceutical composition containing glycol chitosan-thioketal-mesalamine or a pharmaceutically acceptable salt thereof as an active ingredient for use in the prevention or treatment of inflammatory bowel disease.

[0029] Furthermore, the present invention is The present invention provides a method for preventing or treating inflammatory bowel disease, comprising the step of administering to an individual a pharmaceutical composition containing glycol chitosan-thioketal-mesalamine or a pharmaceutically acceptable salt thereof as an active ingredient. [Effects of the Invention]

[0030] The pharmaceutical composition for treating inflammatory bowel disease of the present invention can be adsorbed to the intestinal mucosa and selectively releases the mesalazine drug only at the site of inflammation, thereby effectively treating inflammatory bowel disease.

[0031] The effects of the present invention are not limited to those described above, but should be understood to include all effects that can be inferred from the detailed description of the present invention or the configuration of the invention as described in the claims. [Brief explanation of the drawing]

[0032] [Figure 1] This is a schematic diagram illustrating the synthesis of glycol chitosan-thioketal-mesalamine. [Figure 2] This is the result of 1H-NMR analysis performed to confirm whether each component of glycol chitosan-thioketal-mesalamine possesses its own unique chemical properties. [Figure 3] This is a comparative measurement of particle size and zeta potential to evaluate the stability of glycol chitosan-thioketal-mesalamine as it progresses from oral administration to the intestines, taking into account pH changes. [Figure 4] These are TEM microscope images taken to confirm whether or not glycol chitosan-thioketal-mesalamine is degraded at the site of intestinal inflammation. [Figure 5] This is an analysis of Beer-Lambert's Law based on an absorbance graph of wavelength values ​​with respect to mesalamine concentration. [Figure 6]To measure the amount of mesalazine released by glycol chitosan-thioketal-mesalamine in response to the H2O2 concentration at the site of intestinal inflammation, the absorbance of the released mesalazine under ROS (H2O2) conditions was measured, and the concentration was determined based on the results. [Figure 7] This is the result of quantifying the binding ratio (w / w) between glycol chitosan-thioketal and mesalamine. [Figure 8] This graph analyzes the amount of mesalazine released when treated with 0.1, 1, and 10 mM H2O2. [Figure 9] This is the result of liquid chromatography-mass spectrometry performed to confirm whether the substance released by glycol chitosan-thioketal-mesalamine is mesalamine in its complete form. [Figure 10] This is a schematic diagram of the mechanism by which mesalamine is released in its complete form without the portion containing the thioketal active group. [Figure 11] This is the result of a CCK assay performed to evaluate the cytotoxicity of GC-M against immune cells (RAW 264.7) and intestinal epithelial cells (Caco-2 cells). [Figure 12] This study measured the degree to which GC-M suppressed extracellular NO production when cells in an LPS-induced inflammatory environment were treated with GC, GC-TK, mesalamine, and GC-M, in order to confirm the RNS scavenging activity of GC-M. [Figure 13]This study aimed to confirm the intracellular ROS scavenging activity of GC-M by measuring the degree to which it suppressed the production of extracellular ROS released when cells in a ROS environment were treated with GC, GC-TK, mesalamine, and GC-M. [Figure 14] This study quantifies mesalamine cellular uptake in an inflammatory environment by treating cells in an inflammatory environment with GC-M. The amount of mesalamine released when thioketals are cleaved by ROS in the inflammatory environment is then measured and absorbed by the cells. [Figure 15] This is the result of measuring the TEER value over time in an intestinal cell model to confirm whether or not the intestinal cells formed a complete tight junction. [Figure 16] This is the result of measuring TEER values ​​in a ROS environment of an intestinal cell model to assess the recovery capacity of tight junctions. [Figure 17] These are the results of immunofluorescence staining performed to evaluate the tight junction restoration efficacy of GC-M in an environment of intestinal epithelial cell damage. [Figure 18] This is the result of a FACS analysis to confirm the inhibitory effect of GC-M on macrophage M1 polarization in an inflammatory environment. [Figure 19] These are the qPCR results to confirm the inflammatory cytokine-suppressing effect of GC-M in an inflammatory environment. [Figure 20] These are ELISA results to confirm the inhibitory effect of GC-M on inflammatory cytokines in an inflammatory environment. [Figure 21] This is the result of FITC staining to confirm the intestinal mucosal adsorption effect of GC-M. [Figure 22]This figure shows the construction of an inflammatory bowel disease (IBD) animal model by supplying mice with 2.5% DSS (Dextran sodium sulfate) drinking water to confirm the anti-inflammatory effect of GC-M treatment at different concentrations in a DSS-induced IBD mouse model. [Figure 23] This report describes the results of measuring body weight changes in IBD (Inflammatory Bowel Disease) mouse models induced with DSS (Dextran sodium sulfate) to confirm the anti-inflammatory effect of treatment with GC-M at different concentrations. [Figure 24] This report describes the results of measuring the survival rate of IBD mouse models treated with different concentrations of GC-M to confirm the anti-inflammatory effect in IBD mouse models induced with DSS (Dextran sodium sulfate). [Figure 25] This report presents the results of measuring the DAI (Disease Activity Index) of IBD mouse models induced with DSS (Dextran sodium sulfate) to confirm the anti-inflammatory effect of treatment with GC-M at different concentrations. [Figure 26] This report describes the results of measuring the colon length of IBD (inflammable dysplasia) mouse models treated with different concentrations of GC-M to confirm the anti-inflammatory effect in IBD-induced IBD mouse models using DSS (Dextran sodium sulfate). [Figure 27] This is the result of H&E staining to observe the presence or absence of damage and recovery of intestinal tissue. [Figure 28] This is the result of immunofluorescence staining to confirm the recovery of mesenteric proteins and mucin proteins. [Figure 29] These are the results of a qRT-PCR experiment to confirm the anti-inflammatory effect of GC-M in a DSS drinking water model. [Modes for carrying out the invention]

[0033] The present invention will be described in detail below.

[0034] The present invention The present invention provides a pharmaceutical composition for the prevention or treatment of inflammatory bowel disease, containing glycol chitosan-thioketal-mesalamine or a pharmaceutically acceptable salt thereof as an active ingredient.

[0035] The term "glycol chitosan" refers to a water-soluble derivative of chitosan produced by the bonding of chitosan and ethylene glycol. This glycol chitosan is non-cytotoxic, biocompatible, and can increase intestinal mucosal adsorption or drug persistence, and is represented by the following chemical formula 1.

[0036] [ka]

[0037] The term "thioketal" refers to a compound formed by the bonding of a thioether and a carbonyl compound, which is reactive and can be broken down into a carbonyl compound and a thiol compound when the double bond is oxidized. In this invention, focusing on the fact that a large amount of reactive oxygen species (ROS) are present in intestinal inflammation sites compared to normal intestinal areas, a thioketal that can be broken down by various ROS is used as a linker to conjugate glycol chitosan and mesalamine. The thioketal of this invention plays a role in enabling the selective release of the mesalamine drug only at the site of inflammation.

[0038] The term "Mesalamine" refers to 5-aminosalicylic acid (5-ASA), also known as mesalazine. It is a drug used to treat inflammatory bowel diseases, including ulcerative colitis and Crohn's disease. Common side effects include headache, nausea, abdominal pain, and fever, while serious side effects include pericarditis, liver disease, and renal failure. In order to minimize these side effects, the present invention aims to administer only the therapeutically effective amount, which is represented by the following chemical formula 2.

[0039] [ka]

[0040] The aforementioned term "inflammatory bowel disease" refers to a variety of diseases characterized by chronic and recurrent inflammation in the intestines, including the small and large intestines. While it has emerged as a global public health issue, the exact cause of the disease remains unknown.

[0041] The term "prevention" can mean all actions that suppress inflammatory bowel disease in an individual or delay the progression of disease caused by inflammatory bowel disease by administering the pharmaceutical composition according to the present invention.

[0042] The term "treatment" may mean all actions by which the administration of a pharmaceutical composition according to the present invention improves or beneficially alters the symptoms of an individual's inflammatory bowel disease.

[0043] The term "administration" refers to introducing a specific substance into an individual using an appropriate method, and "individual" refers to all living organisms, including humans, rats, mice, and livestock, that may carry inflammatory bowel disease. Specific examples include mammals, including humans.

[0044] In one embodiment of the present invention, the glycol chitosan may be adsorbable to the intestinal mucosa.

[0045] In another embodiment of the present invention, the thioketal may be degraded by ROS at the site of inflammation, selectively releasing the drug.

[0046] In yet another embodiment of the present invention, the drug may be mesalamine.

[0047] In yet another embodiment of the present invention, the composition may suppress the generation of at least one selected from the group consisting of intracellular reactive oxygen species (ROS), reactive nitrogen species (RNS), and nitric oxide (NO).

[0048] In yet another embodiment of the present invention, the composition may restore tight junctions between cells.

[0049] The term "tight junction" refers to one of the intercellular junctions observed in the human epidermis. Located between cells in the epidermal granular cell layer, it connects adjacent cells and performs a variety of biological functions, including a barrier function that regulates the movement of electrolytes and water.

[0050] In yet another embodiment of the present invention, the composition may suppress macrophage M1 polarization.

[0051] The term "macrophage M1 polarization" refers to the process by which macrophages are activated into a pro-inflammatory phenotype. Induced by stimuli such as LPS, this process increases the production of inflammatory cytokines (TNF-α, IL-1β, IL-6), and the expression of iNOS, an enzyme that produces nitric oxide (NO), increases NO production, which plays a role in pathogen removal, antigen presentation, and tissue destruction.

[0052] In the early stages of infection, M1 polarization occurs, initiating an inflammatory response that eliminates the pathogen. However, if the M1 phenotype persists, excessive inflammation can lead to tissue damage.

[0053] In yet another embodiment of the present invention, the composition may suppress the expression of at least one inflammatory cytokine selected from the group consisting of TNF-α (tumor necrosis factor-α), IL-6 (Interleukin 6), and IL-1β (Interleukin-1β).

[0054] The term "cytokine" refers to a relatively small immune protein found in the blood. It plays a crucial role in cell signaling and is a broad and sparse protein secreted by immune cells. After being secreted, cytokines can affect other cells and even the cells that secreted them.

[0055] In yet another embodiment of the present invention, the composition may be used to restore a damaged colon.

[0056] In inflammatory bowel disease (inflammatory bowel disease), colon length is used as an important indicator of recovery. However, when inflammatory bowel disease worsens, the colon shortens and thickens due to inflammation, edema, spasms, and fibrosis. Severe inflammation can reduce colon length and impair bowel function. Therefore, recovery of colon length indicates a reduction in inflammation and a recovery in bowel function.

[0057] In yet another embodiment of the present invention, the inflammatory bowel disease may be at least one selected from the group consisting of Crohn's disease, ulcerative colitis, intestinal Behcet's disease, and enteritis.

[0058] Furthermore, the pharmaceutical composition may be provided as a pharmaceutical composition containing the active ingredient alone, or containing at least one pharmaceutically acceptable carrier, excipient, or diluent.

[0059] Specifically, the carrier may be, for example, a colloidal suspension, powder, saline solution, lipid, liposome, microspheres, or nanospherical particles. These can form a complex with or be associated with a delivery means and can be delivered in vivo using delivery systems known in the art, such as lipids, liposomes, microparticles, gold, nanoparticles, polymers, condensation reagents, polysaccharides, polyamino acids, dendrimers, saponins, adsorption enhancers, or fatty acids.

[0060] When the aforementioned pharmaceutical composition is formulated, it can be prepared using commonly used diluents or excipients such as lubricants, sweeteners, flavorings, emulsifiers, suspending agents, preservatives, fillers, bulking agents, binders, wetting agents, disintegrants, and surfactants. Solid formulations for oral administration may include tablets, pills, powders, granules, and capsules. These solid formulations can be prepared by mixing the aforementioned composition with at least one excipient, such as starch, calcium carbonate, sucrose, lactose, or gelatin. In addition to simple excipients, lubricants such as magnesium stearate and talc can also be used. Liquid formulations for oral administration include suspensions, oral solutions, emulsions, and syrups. In addition to commonly used simple diluents such as water and liquid paraffin, various excipients, such as wetting agents, sweeteners, fragrances, and preservatives, may be included. Preparations for parenteral administration may include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, and suppositories. Non-aqueous solvents and suspensions can include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. Suppository bases can include witepsol, macrogol, tween 61, cocoa butter, lauric acid butter, and glycerogenous gelatin. When manufactured in the form of eye drops, known diluents or excipients can be used.

[0061] The pharmaceutical composition may be provided by mixing it with the other pharmaceutical composition for the prevention or treatment of inflammatory bowel disease, the other pharmaceutical composition for the prevention or treatment of inflammatory bowel disease may be a conventionally known pharmaceutical composition for the prevention or treatment of inflammatory bowel disease, or a newly developed pharmaceutical composition for the prevention or treatment of inflammatory bowel disease.

[0062] If the pharmaceutical composition further comprises the other pharmaceutical composition for the prevention or treatment of inflammatory bowel disease, or is provided in mixture with the other pharmaceutical composition for the prevention or treatment of inflammatory bowel disease, it is important that the mixture is in an amount that allows for the maximum effect to be obtained with the minimum amount without side effects, which can be easily determined by those skilled in the art.

[0063] The aforementioned pharmaceutical composition may not be mixed with other pharmaceutical compositions for the prevention or treatment of inflammatory bowel disease, and may be administered in parallel, simultaneously, separately, or sequentially, and may be administered as a single or multiple dose. It is important to administer the amount that provides the maximum effect with the minimum amount without side effects, taking all of the above factors into consideration, and this can be easily determined by those skilled in the art.

[0064] The pharmaceutical composition can be administered orally or parenterally. In the case of parenteral administration, the method of injection can be selected from topical application to the skin, intraperitoneal injection, rectal injection, subcutaneous injection, intravenous injection, intramuscular injection, intra-arterial injection, intra-bone marrow injection, intracardiac injection, intradural injection, transdermal injection, intranasal injection, intra-intestinal injection, local injection, sublingual injection, or intrathoracic injection.

[0065] The pharmaceutical composition is administered in a pharmaceutically effective amount. The term "pharmaceutically effective amount" means an amount sufficient to treat the disease with a reasonable benefit-risk ratio applicable to medical treatment, and the effective dose level can be determined by factors including the type and severity of the patient's disease, the activity of the drug, the patient's sensitivity to the drug, the time of administration, the route of administration and elimination ratio, the duration of treatment, any drugs used concurrently, and other factors well known in the medical field.

[0066] The pharmaceutical composition may be administered once a day or in several divided doses. For example, it may be administered every other day or once a week. The administration may be carried out once a day or in several divided doses.

[0067] Furthermore, the present invention is The present invention provides a pharmaceutical preparation for the prevention or treatment of inflammatory bowel disease, which contains the aforementioned composition.

[0068] The terms used in this invention may correspond to the terms described in the above-mentioned pharmaceutical compositions.

[0069] In one embodiment of the present invention, the formulation may be an orally administered preparation, an injectable preparation, an injection preparation, a spray preparation, or a liquid preparation.

[0070] The pharmaceutical preparation may further contain a pharmaceutically acceptable carrier that can be added to a pharmaceutical preparation. The pharmaceutically acceptable carrier includes additives such as excipients, disintegrants, binders, lubricants, emulsifiers, suspending agents, stabilizers, and pH adjusters commonly used in the field of pharmaceutics, and may further contain sweeteners, flavorings and / or colorings as needed. The excipients include microcrystalline cellulose, starch, silicon dioxide (SiO2), sugar esters, and Ludipress. (R) The excipients include lactose, sucrose, maltose, fructose, sorbitol, etc. Preferably, a mixture of lactose and silicon dioxide can be used. The amount of the excipient used may be about 90% by weight or less of the total weight of the pharmaceutical preparation, but is not limited thereto. The disintegrant includes carboxymethylcellulose calcium (CMC-Ca), carboxymethylcellulose sodium (CMC-Na), crospovidone, alginic acid, etc. The amount of the disintegrant used may be in the range of 3 to 16% by weight of the total weight of the pharmaceutical preparation, but is not limited thereto. The lubricant includes stearic acid, magnesium stearate, zinc stearate, glyceryl behenate, glyceryl palmitostearate, talc, etc., and can be used in an amount of about 3% by weight or less of the total weight of the pharmaceutical preparation, but is not limited thereto.

[0071] Furthermore, the aforementioned pharmaceutical preparations can be formulated for oral administration and can be formulated in a variety of forms, such as tablets, films, suspensions, granules, gels, pills, tinctures, decoctions, infusions, spirits, fluid extracts, elixirs, extracts, syrups, powders, aromatic waters, and lemonades. The tablets can be formulated into a variety of forms, such as orally disintegrating tablets, mucoadhesive tablets, dispersible tablets, sublingual tablets, buccal tablets, chewable tablets, dispensing tablets, multilayered tablets, press-coated tablets, effervescent tablets, and solution tablets. Furthermore, a skilled technician can modify these various tablets in various ways as needed. More preferably, the tablets may be in dosage forms that disintegrate (dissolve) in the mouth (i.e., orally disintegrating, or orally soluble), such as orally dispersible (soluble) dosage forms, such as orally soluble films, orally disintegrating tablets, suspensions, suspension tablets, fast-acting disintegrating tablets, orally disintegrating granules, orally disintegrating trochymes, sublingual tablets, powders, and / or chewable tablets.

[0072] The dosage of the aforementioned pharmaceutical preparation may vary depending on the patient's condition (age, sex, weight, etc.) and the severity of the condition being treated. If necessary, for convenience, the total daily dose may be divided and administered in multiple doses throughout the day.

[0073] Furthermore, the present invention is The present invention provides a health functional food for the prevention or improvement of inflammatory bowel disease, which contains the aforementioned composition.

[0074] The term "improvement" may mean all actions that at least reduce the severity of symptoms, for example, parameters related to the condition being treated. In this case, the health functional food may be used for the prevention or improvement of inflammatory bowel disease, either before or after the onset of the disease, simultaneously with or separately from therapeutic agents.

[0075] In the aforementioned functional health food, the active ingredient may be added directly to the food, used together with other foods or food ingredients, or used appropriately by conventional methods. The amount of active ingredient mixed can be suitably determined according to its intended use (prevention or improvement). Generally, when manufacturing food or beverages, the functional health food can be added in an amount of approximately 15% by weight or less, more specifically approximately 10% by weight or less, relative to the raw materials. However, in the case of long-term intake for the purpose of health and hygiene, or for the purpose of health regulation, the above amount may be less than the above range.

[0076] The aforementioned health functional food further comprises at least one of a carrier, diluent, excipient, and additive, and can be formulated into one of the dosage forms selected from the group consisting of tablets, pills, powders, granules, powders, capsules, and liquids. Foods to which the compound according to the present invention can be added include various foods, powders, granules, tablets, capsules, syrups, beverages, chewing gum, tea, vitamin complexes, and health functional foods.

[0077] Specific examples of the carrier, excipient, diluent, and additive may be at least one selected from the group consisting of lactose, dextrose, sucrose, sorbitol, mannitol, erythritol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium phosphate, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, polyvinylpyrrolidone, methylcellulose, water, sugar syrup, methylcellulose, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, and mineral oil.

[0078] In addition to containing the active ingredient, the aforementioned health functional food may contain other ingredients as essential components without any special restrictions. For example, like ordinary beverages, it may contain various flavorings or natural carbohydrates as additional ingredients. Examples of the natural carbohydrates mentioned above may include ordinary sugars such as monosaccharides such as glucose and fructose; disaccharides such as maltose and sucrose; and polysaccharides such as dextrin and cyclodextrin, as well as sugar alcohols such as xylitol, sorbitol, and erythritol. As flavorings other than those mentioned above, natural flavorings (thaumatin, stevia extract (e.g., rebaudioside A, glycyrrhizin, etc.)) and synthetic flavorings (saccharin, aspartame, etc.) may be advantageously used. The proportion of the natural carbohydrates can be appropriately determined by those skilled in the art.

[0079] In addition to the above, the health functional foods according to the present invention may contain various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic and natural flavoring agents, coloring agents and enhancers (such as cheese and chocolate), pectinic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, and carbonating agents used in carbonated beverages. These components can be used independently or in combination, and the proportions of such additives can be appropriately selected by those skilled in the art.

[0080] The aforementioned health functional food may be provided in combination with a conventionally known health functional food for the prevention or improvement of inflammatory bowel disease or a newly developed health functional food for the prevention or improvement of inflammatory bowel disease.

[0081] If the aforementioned health functional food further includes a health functional food for the prevention or improvement of inflammatory bowel disease, it is important that the mixture contains an amount that allows for the maximum effect to be obtained with the minimum amount without side effects, which can be easily determined by those skilled in the art.

[0082] The present invention will be described in more detail below with reference to examples to aid in understanding the present invention. However, the following examples are merely illustrative and do not limit the scope of the present invention. The examples of the present invention are provided to give a more complete explanation of the present invention to those who have ordinary skill in the art to which the invention pertains. [Examples]

[0083] Example 1. Synthesis method of glycol chitosan-thioketal-mesalamine Figure 1 is a schematic diagram illustrating the synthesis of glycol chitosan-thioketal-mesalamine.

[0084] (1) Method for synthesizing thioketal 3-Mercaptopropionic acid (5.054 ml, 8.050 M), acetone (2.129 ml, 4.025 M), and trifluoroacetic acid (TFA) (0.022 ml, 0.004 M) were reacted together at 37°C for 6 hours, and the crystal structure formation of the reactants was confirmed after being placed on ice for 12 hours.

[0085] The crystalline material was washed with n-hexane (15 ml) and cold water (15 ml), with each washing process involving a 5-minute reaction using an orbital shaker (250 rpm), followed by a 3-minute centrifuge (800 rpm) process to remove the liquid other than the crystals. This process was repeated three times.

[0086] After washing the filter paper once with cold water, it was vacuum-dried for 24 hours to obtain a final white solid thioketal.

[0087] (2) Methods for synthesizing glycol chitosan, thioketal, and mesalamine Thioketal (2.524 mg, 1 mM), 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) (4.657 mg, 3 mM), and N-hydroxysuccinimide (NHS) (3.453 mg, 3 mM) were dissolved in 10 mL of DMSO and reacted at 23°C for 6 hours.

[0088] After dissolving mesalazine (15.314 mg, 1 mM) in 10 mL of DMSO, it was added dropwise and reacted for 24 hours. Then, EDC (4.657 mg, 3 mM) and NHS (3.453 mg, 3 mM) were added, and the mixture was reacted at 23°C for 6 hours.

[0089] An aqueous solution of glycol chitosan (0.4%, w / v) was added dropwise to an H2O / DMSO mixture (6 mL / 4 mL, v / v), and the mixture was allowed to react for 2 days. After that, dialysis was performed for 2 days in the presence of DW using a 2000 Molecular Weight Cut Off (MWCO) dialysis membrane. The mixture was frozen in a deep freezer for 1 day, and then freeze-dried to obtain a powder.

[0090] (3) Confirmation of whether or not glycol chitosan-thioketal-mesalamine has been synthesized. To confirm whether each component of glycol chitosan-thioketal-mesalamine possesses its own unique chemical properties, 1 1H-NMR analysis was performed.

[0091] For this purpose, after dissolving each of glycol chitosan, thioketal, mesalamine, glycol chitosan-thioketal, and glycol chitosan-thioketal-mesalamine (GC-M) in deuterium (D2O) at a concentration of 125 μg / ml, 1 The unique peaks of the synthesized product were confirmed using 1H-NMR (Nuclear Magnetic Resonance, VNMRS 600MHz, Agilent Technologies).

[0092] As a result, as shown in Figure 2, a peak specific to thioketal was confirmed at 1.6 ppm, and this peak was maintained in subsequent experiments with glycol chitosan-thioketal-mesalamine synthesized using thioketal. Furthermore, the specific peaks of glycol chitosan, thioketal, and mesalamine, which are components of glycol chitosan-thioketal-mesalamine, were confirmed in conjugation form (Thioketal: 1.6 ppm, Mesalazine: 6.9, 7.3, 7.7 ppm, Glycol chitosan: formed at 3-4 ppm, amine bond: 2.3 ppm).

[0093] This result indicates that glycol chitosan-thioketal-mesalamine was successfully synthesized, as it contains all the characteristic peaks of each component.

[0094] Example 2. Confirmation of the physicochemical characteristics of glycol chitosan-thioketal-mesalamine (1) Results of comparative stability measurements based on pH To evaluate the stability of glycol chitosan-thioketal-mesalamine as a drug by pH changes from oral administration to the intestines, particle size and zeta potential were measured and compared at different pH levels. Data are presented as Mean ± SEM (n=5).

[0095] First, 1 mg / ml of glycol chitosan-thioketal-mesalamine was dissolved in PBS, and 800 μl was placed in a cuvette for measurement. Subsequently, the hydrodynamic diameter and zeta potential were analyzed using a zetasizer (Nano ZS, Malvern Panalytical, Worcestershire, UK).

[0096] As a result, as shown on the left side of Figure 3, no specific change in particle size due to pH was observed, and as shown on the right side of Figure 3, although the zeta potential value decreased slightly as the pH increased, no significant particle deformation was observed.

[0097] This result indicates that there is no deformation of glycol chitosan-thioketal-mesalamine due to pH changes upon intestinal administration during oral administration.

[0098] (2) Measurement of particle size changes of glycol chitosan-thioketal-mesalamine in a ROS environment using TEM microscopy To determine whether glycol chitosan-thioketal-mesalamine degrades in a ROS environment, the size of glycol chitosan-thioketal-mesalamine particles was measured via TEM microscopy.

[0099] For this purpose, 1 mg / ml of glycol chitosan-thioketal-mesalamine was loaded onto a Cu-TEM grid and dried at room temperature for 24 hours. Then, using a TEM (Transmission Electron Microscope, JEM 2100F, JEOL, NC) system, it was confirmed whether the nanoparticles had taken on a particle form, and their size and image were measured.

[0100] As a result, as shown on the left side of Figure 4, we confirmed that the normal particle size under conditions without ROS (GC-M) was 463 nm, while the particle size under ROS conditions (GC-M + H2O2) was divided into 260 nm and 20 nm.

[0101] Furthermore, as shown on the right side of Figure 4, we confirmed that the particle size decreased under the ROS condition (H2O2O) compared to the image of normal particles under the ROS-free condition (H2O2X).

[0102] This result indicates that glycol chitosan-thioketal-mesalamine was broken down by reactive oxygen species (ROS) that are present in large quantities at sites of intestinal inflammation.

[0103] Example 3. Confirmation of the presence and amount of mesalazine release by ROS. (1) Confirmation of the mesalamine concentration contained in glycol chitosan-thioketal-mesalamine. To determine the correlation graph between mesalamine concentration and absorbance, H2O2 of different concentrations was added to 1 ml of PBS containing 1 mg of mesalamine, and the mixture was reacted in a shaking incubator (200 rpm, 37°C). Subsequently, the absorbance values ​​corresponding to each concentration of mesalamine solution were determined using a UV-visible spectrophotometer.

[0104] As a result, as shown in Figure 5, we were able to obtain Beer-Lambert's Law analysis results based on an absorbance graph of wavelength values ​​with respect to mesalamine concentration. Absorbance was measured using UV-vis spectrometry for concentrations from 0 to 100 μg / ml, and a linear relationship was obtained by substituting the absorbance values ​​for each concentration into Beer-Lambert's Law. This was then used as a basis to determine the concentration based on the absorbance of mesalamine.

[0105] (2) Measurement results and quantitative calculation of mesalamine absorbance under 10 mM H2O2 conditions To measure the amount of mesalamine released by glycol chitosan-thioketal-mesalamine in response to H2O2 concentration at intestinal inflammation sites, 1 mg / ml of glycol chitosan-thioketal-mesalamine was dissolved in PBS. Then, H2O2 of different concentrations was added to 1 ml of PBS containing 1 mg of mesalamine, and the mixture was reacted in a shaking incubator (200 rpm, 37°C).

[0106] The reaction was carried out in a centrifugal tube (3000MWCO) at 4000 rpm for 20 minutes, and the absorbance of the lower filtrate was measured at different time points using UV-vis spectrometry to obtain the results.

[0107] Based on the Beer-Lambert's Law equation for mesalazine obtained in Figure 4, the concentration value based on the absorbance was calculated to quantify the concentration of mesalazine released for each time period. mesalamine = Absorbance 測定 - Absorbance blank The calculation was performed using ).

[0108] As shown in Figure 6, the UV-vis of the lower layer liquid under 10 mM H2O2 conditions was measured, and an absorbance value of 0.604 was confirmed at 214 nm.

[0109] As shown in Figure 8, the 10 mM H2O2 condition is the H2O2 condition that maximizes mesalazine release when treated with different H2O2 solutions. Therefore, assuming that the total amount of mesalazine bound to GC-M is the amount obtained when treated with 10 mM H2O2, the binding ratio of glycol chitosan-thioketal to mesalamine in Figure 7 was determined based on these experimental results.

[0110] (3) Determination of the binding ratio (w / w) of glycol chitosan-thioketal and mesalamine. In Figure 7, the binding ratio of mesalamine and its delivery agent, glycol chitosan-thioketal, was calculated based on the experiment described above. Based on the absorbance value of 0.604 at 214 Nm, the concentration was determined using the mesalamine Beer Lambert law in Figure 5, confirming a binding ratio of 0.0435 mg / ml. Since the total concentration of GC-M added was 1 mg / ml, when 1 ml is used as the reference, 1 mg of GC-M contains 0.0435 mg of mesalamine. Therefore, it can be interpreted that 0.9565 mg of glycol chitosan-thioketal and 0.0435 mg of mesalamine bound together to form a total GC-M of 1 mg / ml.

[0111] As a result, as shown in Figure 7, we confirmed that the binding ratio (w / w) of GC-thioketal:mesalazine was 22:1.

[0112] (4) Analysis of mesalazine release under various H2O2 concentration conditions To analyze the amount of mesalazine released under various H2O2 concentration conditions, experiments were conducted using 0.1 mM, 1 mM, and 10 mM H2O2.

[0113] As a result, the absorbance of mesalazine was calculated in terms of concentration based on the Beer-Lambert formula for mesalazine obtained in Figure 6, and the amount of mesalazine released at each time point was quantified. Furthermore, as previously mentioned, the maximum amount of mesalazine released was 0.0435 mg when 1 mg of GC-M was treated with 10 mM H2O2. This was assumed to be the total mesalazine content and expressed as 100%, and the amount of mesalazine released at each time point was quantified.

[0114] As a result, as shown in Figure 8, the maximum mesalazine release was 43.25 μg, the ROS concentration at which all mesalazine is degraded is 10 mM, and the treatment time is 12 hours.

[0115] The experimental results showed that mesalazine was not released under low ROS conditions, confirming that mesalazine is selectively released only under high ROS conditions in an inflammatory environment. This suggests that it may be possible to reduce mesalazine drug delivery in normal sites.

[0116] (5) LC-MS analysis of released mesalazine To confirm whether the substance released by GC-M was mesalazine in its complete form, a liquid chromatography-mass spectrometry experiment was performed.

[0117] The analytical conditions were set as follows: (1) Column: Agilent Xorbac Eclipse XDB C8 reversed-phase column (150 × 4.6 mm, inner diameter: 5 μm), (2) Mobile phase: A (15%) ACN (0.1% Formic acid), B (85%) Water (0.1% Formic acid), (3) Flow rate: 1 mL / min, (4) Injection volume: 10 μL, (5) Ion polarity mode: Positive, (6) Fragmentor: 135 V.

[0118] As a result, as shown in Figure 9, the molecular weight of mesalazine was 153 g / mol, and proton cleavage was confirmed to occur at 154, 136, and 108 (m / z). In addition, a new peak at 226 or 227 (m / z) was observed in the cleaved form. The ratio of the two substances was new peak:mesalamine = 12:88, confirming that mesalamine, conjugated to thioketal while cleaving, is released as mesalamine in its original form, without containing any of the thioketal acting as a linker.

[0119] Figure 10 is a schematic diagram of the mechanism by which the thioketal is released in its complete mesalamine form without the portion containing the active group.

[0120] Example 4. Evaluation of GC-M cytotoxicity by CCK assay To evaluate the cytotoxicity of GC-M on immune cells (RAW 264.7) and intestinal epithelial cells (Caco-2 cells), a CCK assay was performed to measure cell viability after treatment with different concentrations of the substance. Data are presented as Mean ± SEM (n=4).

[0121] RAW 264.7, Caco-2 cells in a 96-well plate (10 4 The cells were incubated for 24 hours until the desired number was reached, and then seeded.

[0122] After washing once with PBS, 100 μl of complete media containing different drugs (glycol chitosan, glycol chitosan-thioketal, mesalamine, GC-M) at concentrations of 0, 12.5, 25, 50, 100, 200, and 400 μg / ml) was treated, followed by incubation for 24 hours, and the supernatant was removed by aspiration.

[0123] Wash twice with PBS, then add 100 μl of complete media + 10 μl of Cell Counting Kit-8 (CCK-8) to each well, and incubate in the dark for 2 hours.

[0124] The absorbance at 450 nm was measured using a plate reader instrument, and the absorbance of the blank was subtracted from the total absorbance. Cytotoxicity (%) was calculated using the formula (A.sample-A.background) / (A.maximum-A.spontaneous)×100.

[0125] As a result, as shown in Figure 11, it was confirmed that administering drugs at concentrations of 200 μg / ml or less did not affect cell viability. Based on this, the concentration of the drug used in subsequent cell experiments was set to 100 μg / ml.

[0126] Example 5. In vitro test: Confirmation of GC-M's ROS / RNS scavenging activity. (1) Confirmation of GC-M's RNS scavenging activity. This study aimed to determine the degree to which LPS-induced inflammatory cells (RAW 264.7 cells) were treated with GC, GC-TK, mesalazine, and GC-M to suppress the production of extracellular NO (nitrite oxide) release. When LPS-stimulated RAW 264.7 cells were treated with both LPS and gold nanoparticles, the secretion concentration of NO was quantified using Griess reagent. Data are presented as Mean ± SEM (n=4).

[0127] To do this, first, we plate RAW 264.7 cells in a 48-well plate in 5 × 10⁶ units. 5After incubation for 24 hours to reach the target cell count and seeding, the cells were washed once with PBS and then treated with 200 μl of complete media containing different concentrations of drugs (glycol chitosan, glycol chitosan-thioketal, mesalamine, GC-M) at concentrations of 88 and 176 μg / ml, 95.5 and 191 μg / ml, mesalamine at 4.5 and 9 μg / ml, GC-M at 100 and 200 μg / ml, and the same concentration as the GC-M reference level), followed by incubation for 5 hours.

[0128] After washing twice with PBS, the NC group was treated with 200 μl of general complete media, and the drug-treated group was treated with 200 μl of media containing LPS (1 μg / ml), followed by incubation for 20 hours.

[0129] After transferring 100 μl of the supernatant to a new 96-well plate, it was reacted with 100 μl of Griess reagent for 10 minutes.

[0130] The absorbance at 546 nm was measured using a plate reader. The concentration was then calculated via absorbance using a standard curve based on the molar concentration of NO (0-10 μM).

[0131] As a result, as shown in Figure 12, the GC-M group treated with the same amount of mesalamine showed a greater RNS scavenging effect than that of mesalamine.

[0132] (2) Confirmation of intracellular ROS scavenging activity When GC, GC-TK, and mesalamine, GC-M are applied to cells in a ROS environment, to confirm the extent to which they suppress the production of extracellular ROS that is released, H2O2 was treated together with gold nanoparticles, and a DCF-DA assay was performed to confirm the ROS scavenging ability of gold nanoparticles in intestinal epithelial cells. Data are expressed as Mean±SEM (n=4).

[0133] Caco-2 cells were seeded in a 96-well plate at 1×10 4 cell density and incubated for 48 hours.

[0134] After washing once with PBS, 100 μl of complete medium containing different concentrations of drugs (Glycol chitosan, Glycol chitosan-Thioketal, mesalamine, GC-M) (Glycol chitosan (88, 176 μg / ml), Glycol chitosan (95.5, 191 μg / ml), mesalamine (4.5, 9 μg / ml), GC-M (100, 200 μg / ml), concentration equivalent to the reference amount of GC-M) and H2O2 (100 μM) was added, followed by incubation for 4 hours.

[0135] 100 μl of complete medium containing DCFH-DA (Dichloro-dihydro-fluorescein diacetate) (2 μM) was added and incubated for 15 minutes.

[0136] After washing once with PBS, measurement was performed using a plate reader, and the intracellular ROS level was calculated as the excitation / emission value using the values of excitation: 490 nm and emission: 520 nm.

[0137] As a result, as shown in Figure 13, the GC-M group treated with the same amount of mesalamine showed a greater ROS scavenging effect than that of mesalamine.

[0138] The results can be interpreted as a combined effect of GC-M's thioketal and mesalamine, considering that thioketal reacts with and cleaves ROS, thereby suppressing the production of ROS.

[0139] Example 6. Confirmation of mesalamine cellular uptake in an inflammatory environment. When GC-M was applied to cells in an inflammatory environment, the amount of mesalamine released by thioketal cleavage due to ROS in the inflammatory environment and absorbed by the cells was measured. Data are represented as Mean ± SEM (n=3).

[0140] For this purpose, Caco-2 cells are placed in 12-well plates in a quantity of 0.5 × 10⁶. 6 The seeds were incubated for 48 hours until the desired cell count was reached, and then seeded.

[0141] After washing once with PBS, the samples were treated with 500 μl of complete medium containing 100 μg / ml of the drug mesalamine and GC-M, along with 100 μM of H2O2, and incubated for 4 hours.

[0142] 100 μl of supernatant and 900 μl of mobile phase were mixed and analyzed using an LC instrument. The amount of mesalamine absorbed by the cells was calculated as "amount of treated mesalamine - amount of mesalamine in supernatant".

[0143] As a result, as shown in Figure 14, we confirmed that in the case of GC-M, when ROS was present, it was absorbed by cells in amounts similar to or greater than that of mesalazine.

[0144] These results indicate that thioketal is broken down under inflammatory conditions (ROS conditions), and that the broken-down mesalazine is normally absorbed by cells.

[0145] Example 7. Confirmation of the tight junction recovery effect of GC-M. To determine whether tight junctions (ZO-1, Occludin) are restored in Caco-2 cells stimulated with H2O2 when treated with gold nanoparticles, the following experiment was conducted.

[0146] Caco-2 cells (2 × 10⁻¹⁰) in Transwell 5 After laying down the cells (per well), they were incubated for 3 weeks.

[0147] After treating the cells with H2O2 when the TEER value exceeded 400Ω, the Caco-2 cells were briefly washed with PBS and fixed in 4% paraformaldehyde.

[0148] After washing the cells twice with PBS-Tween20 for approximately 2 minutes each time, the cells were incubated at room temperature for 30 minutes using PBS-Tween20 as the solvent in a 20% goat serum solution for blocking.

[0149] Goat serum (20% in PBST-20) and the primary antibodies anti-mouse occludin and anti-rabbit ZO-1, diluted 100:1, were incubated at room temperature for 1 hour.

[0150] After washing with PBS, the cells were incubated with secondary antibodies (goat anti mouse-488, goat anti rabbit-594) diluted in PBS at a ratio of 1:200.

[0151] After protecting the cells from light, they were washed twice with PBS for 3 minutes each.

[0152] Two drops of DAPI mounting solution were added, the cover slide was placed over it, and then the image was examined under a fluorescence microscope.

[0153] As a result, as shown in Figure 15, a TEER value of 400Ω or more was obtained after 21 days, and this was used as an experimental model.

[0154] This result indicates that the intestinal cells formed a perfect tight junction, as a TEER value of 400Ω or higher means that the cell layer is capable of performing a reliable barrier function in the experiment.

[0155] Furthermore, inflammation was induced in the aforementioned model by treating it with ROS, and the recovery of tight junctions was confirmed by TEER values ​​after drug treatment.

[0156] As a result, as shown in Figure 16, we confirmed that the damage to the tight junction was restored when treated with GC-M.

[0157] Furthermore, to evaluate the tight junction restoration efficacy of GC-M in an intestinal epithelial cell damage environment, Occludin (green) and ZO-1 (red), which are tight junction proteins between intestinal epithelial cells, were observed by immunofluorescence staining.

[0158] As a result, as shown in Figure 17, we confirmed that when GC-M was used, the fluorescence levels of Occludin and ZO-1 were all improved compared to the positive control (H2O2 group).

[0159] These results indicate that GC-M treatment is effective in mitigating tight bond damage caused by oxidative stress.

[0160] Example 8. In vitro experiment: Confirmation of GC-M's anti-inflammatory activity. (1) Inhibitory effect of GC-M on macrophage M1 polarization in an inflammatory environment Flow cytometry was performed to determine the M1 and M2 polarization ratios in Raw 264.7 cells treated with LPS, and in groups treated with LPS, mesalazine, and GC-M. Data are presented as Mean ± SEM (n=3).

[0161] For this purpose, Raw 264.7 cells are placed in a 100 mm dish (2.0 × 10 6 The cells were seeded and incubated for 24 hours. After washing the cells with PBS, they were incubated with mesalamine and GC-M at a concentration of 100 μg / ml or without for 5 hours. Subsequently, the cells were detached with a scraper and separated by centrifugation at 12,000 rpm for 3 minutes.

[0162] After removing the supernatant, the cells were redispersed in PBS and incubated at room temperature for 20 minutes with or without antibody. The antibody type used was CD206 APC-eFluor 780 / iNOS-PE (eBioscience). TM )) was used.

[0163] Experiments were conducted using negative control (CD206 APC-eFluor 780, iNOS-PE co-staining), positive control (unstained), raw cells with CD206 marker (stained), raw cells with iNOS marker (stained), raw cells with CD206 and iNOS marker co-staining, mesalazine-treated raw cells with CD206 and iNOS marker co-staining, and GC-M-treated raw cells with CD206 and iNOS marker co-staining.

[0164] As a result, as shown in Figure 18, M1 macrophages tended to decrease when treated with mesalazine compared to when treated with LPS alone. The decrease was even more pronounced when treated with GC-M.

[0165] These results indicate that mesalamine itself has an anti-inflammatory effect, and that thioketal present in GC-M plays a role in ROS scavenging.

[0166] (2) Confirmation of the inflammatory cytokine suppression effect of GC-M in an inflammatory environment using qPCR. To determine the extent to which pro-inflammatory cytokine secretion in macrophages in an inflammatory environment is suppressed by GC-M, raw cells stimulated with LPS were treated with mesalazine and GC-M as drugs, and qPCR analysis was performed to measure the expression levels of inflammatory cytokines. Data are expressed as Mean ± SEM (n=3).

[0167] Raw 264.7 cells in a 12-well plate (1.0 × 10⁶ cells per well) 5 The cells are seeded, cultured in complete medium for 24 hours, washed with PBS, and then incubated with mesalamine and GC-M for 5 hours.

[0168] The cells were washed with PBS before incubating them for 20 hours in medium with or without LPS (1 μg / ml).

[0169] The factors analyzed were TNF-α, IL-6, and IL-1β. Total RNA from cells was extracted using QIAzol Lysis Reagent and the RNeasy Mini Kit (QIAGEN, Germany), and then 1 μg of RNA was reverse transcribed into cDNA using the iScript cNDA synthesis Kit (BIO RAD Laboratories, USA).

[0170] Next, at Applied Biosystems Instrument (USA), SYBR Green PCR Master Mix (Applied BioScript TM qRT-PCR was performed using (USA). GAPDH was used as an endogenous control to normalize the relative mRNA expression levels of the following genes, and the primer sequences used are as follows.

[0171] GAPDH: Forward CAGGAGGCATTGCTGATGAT / Reverse: GAAGGCTGGGGCTCATTT TNFα: Forward CCCTCACACTCAGATCATCTTCT / Reverse: GCTACGACGTGGGCTACAG IL-6: Forward TAGTCCTTCCTACCCCAATTTCC / Reverse: TTGGTCCTTAGCCACTCCTTC IL-1β: Forward GCAACTGTTCCTGAACTCAACT / Reverse: ATCTTTTGGGGTCCGTCAACT

[0172] As a result, as shown in Figure 19, we confirmed that the expression levels of inflammatory cytokines were suppressed in both the group treated with mesalamine and the GC-M group compared to the group treated with LPS alone.

[0173] These results demonstrate the anti-inflammatory effects of GC-M.

[0174] (3) ELISA-mediated inhibitory effect of GC-M on inflammatory cytokines in an inflammatory environment To determine the extent to which pro-inflammatory cytokine secretion in macrophages in an inflammatory environment is suppressed by GC-M, raw cells stimulated with LPS were treated with mesalazine and GC-M as drugs, and ELISA was performed to measure the expression levels of inflammatory cytokines. Data are presented as Mean ± SEM (n=4).

[0175] Raw 264.7 cells in a 12-well plate (1.0 × 10⁶ cells per well) 5 The cells were seeded and incubated in complete media (DMEM, 10% FBS, 1% PS) for 24 hours, then washed with PBS and incubated with AuNP (125 μg / ml) for 5 hours.

[0176] Before incubating the cells in medium with or without LPS (1 μg / ml) for 20 hours, the cells were washed with PBS, and the cell supernatant was harvested and stored at -20°C before analysis.

[0177] Following the protocol provided with the purchased ELISA kit, the factors analyzed were TNF-α (Elikine TM Mouse TNF-α ELISA Kit, Abbkine), IL-6 (IL-6 Mouse ELISA Kit, Invitrogen), IL-1β (IL-1β Mouse ELISA Kit, Invitrogen), and iNOS (Mouse NOS2 / iNOS (Nitric Oxide Synthase 2, Inducible, ELISA Kit).

[0178] As a result, as shown in Figure 20, compared to treatment with LPS alone, the group treated with mesalamine showed an inhibitory effect on the expression of inflammatory cytokines, and the group treated with GC-M showed an even greater inhibitory effect on cytokine expression.

[0179] These results indicate that GC-M has superior anti-inflammatory effects compared to mesalamine alone.

[0180] Example 9. Confirmation of the intestinal mucosal adsorption effect of GC-M To confirm the intestinal mucosal adsorption properties of GC-M glycol chitosan, FITC was bound to GC-M glycol chitosan, and then the intestines were separated at different times, and the degree of intestinal retention was confirmed using fluorescence.

[0181] 10 mg of FITC (Fluorescein isothiocyanate) was dissolved in 5 ml of ethanol, and 50 mg of glycol chitosan (GC-M) was dissolved in 5 ml of ethanol containing acetic acid (0.1 M). Then, the FITC solution prepared in step (1) above was added dropwise, and the mixture was reacted under dark conditions for 2 hours.

[0182] After dialysis was performed for two days in the presence of dead water using a 14000MWCO dialysis membrane, a powder-like compound was obtained by freeze-drying.

[0183] Finally, Bagg Albino (BALB / c) mice were orally administered a solution of glycol chitosan, GC-M 100 mg / kg dissolved in PBS. After 1, 3, 6, 12, and 24 hours, organs (heart, liver, gallbladder, kidney, and intestines (small and large intestines)) were sacrificed, and FITC was observed using an in vivo imaging system.

[0184] As a result, as shown in Figure 21, GC-M (bottom panel) remained in the intestines for 6 hours and 12 hours, similar to glycol chitosan (top panel), which is known to have intestinal mucosal adsorption properties, confirming that it exhibits almost equivalent intestinal adsorption capacity.

[0185] These results indicate that, despite the binding of thioketal and mesalamine to GC-M, the intestinal mucosal adsorption capacity of glycol chitosan is not affected, and that it can be maintained in the intestinal mucosa for a long period of time while continuously releasing the mesalamine drug.

[0186] Example 10. Confirmation of the anti-inflammatory effect of GC-M using in vivo experiments. (1) Construction of an animal model of inflammatory bowel disease using DSS drinking water To confirm the anti-inflammatory effects of GC-M treatment at different concentrations in a DSS (Dextran sodium sulfate)-induced IBD mouse model, an inflammatory bowel disease animal model was constructed by supplying 2.5% DSS drinking water.

[0187] As shown in Figure 22, inflammatory bowel disease was induced by supplying DSS drinking water for 7 days, and then the drug was administered orally daily for 7 days to confirm the anti-inflammatory efficacy of the drug in the inflammatory state model.

[0188] (2) Confirmation of weight changes in the IBD mouse model To confirm the anti-inflammatory effects of GC-M at different concentrations in IBD mouse models induced with DSS (Dextran sodium sulfate), body weight changes in the IBD mouse models were measured to determine whether or not IBD had recovered. Data are presented as Mean ± SEM (n=5).

[0189] As a result, as shown in Figure 23, both mesalamine and GC-M were found to promote recovery from IBD, with weight increasing around 10 days after a period of weight loss. In particular, GC-M (4.5 equivalents) was found to promote a better degree of weight recovery.

[0190] (3) Measurement of survival rate of IBD mouse model To confirm the anti-inflammatory effects of GC-M treatment at different concentrations in IBD mouse models induced with DSS (Dextran sodium sulfate), the survival rate of IBD mouse models was measured. Data are presented as Mean ± SEM (n=5).

[0191] As a result, as shown in Figure 24, in the group administered DSS, one animal died on day 12 and another died on day 13, resulting in survival rates of 80% and 60%, respectively. However, in the mesalamine and GC-M groups, no deaths occurred, and the survival rate was maintained at 100%.

[0192] (4) Measurement of DAI (disease activity index) values ​​in IBD mouse models To confirm the anti-inflammatory effects of GC-M treatment at different concentrations in IBD mouse models induced with DSS (Dextran sodium sulfate), the DAI (Disease Activity Index) values ​​of the IBD mouse models were measured. Data are presented as Mean ± SEM (n=5).

[0193] The DAI index was evaluated based on stool consistency (hardness of stool) (hard: 0 points, soft: 2 points, diarrhea: 4 points), the degree of bleeding in the stool using Hemoccult Sensa (Beckman Coulter) (none: 0 points, present: 2 points, macroscopically visible: 4 points), and weight loss (less than 1% loss: 0 points, between 1% and 5%: 1 point, between 5% and 10%: 2 points, between 10% and 20%: 3 points, over 20%: 4 points).

[0194] As a result, as shown in Figure 25, we confirmed that the degree of inflammation was alleviated by observing the lowest DAI values ​​in the mesalazine and GC-M (4.5 equivalents) groups.

[0195] (5) Measurement of colon length in IBD mouse models To confirm the anti-inflammatory effects of GC-M at different concentrations in IBD mouse models induced with DSS (Dextran sodium sulfate), colon length was measured in IBD mouse models. Data are expressed as Mean ± SEM (n=5).

[0196] As a result, as shown in Figure 26, the colon tissue length of mice administered DSS on day 14 to induce IBD was approximately 5 cm, which was shorter than that of the control group. However, the colon tissue length of mice that took GC-M (4.5 equivalents) recovered to a length similar to that of the control group.

[0197] Example 11. Confirmation of the anti-inflammatory effect of GC-M using colon tissue staining in an IBD mouse model. (1) Pretreatment process for H&E staining and immunofluorescence staining The previously separated organs were placed in 4% paraformaldehyde (PFA) in a volume equivalent to 5 to 10 times the volume of the organs. This was then placed in an embedded cassette to match its size, and the embedded cassette was placed in a beaker and sealed with gauze. The PFA was then thoroughly rinsed out for 4 to 5 hours using running tap water.

[0198] For paraffin embedding, the specimens were dehydrated by immersion in 70%, 80%, and 95% ethanol for one hour each, twice each. Subsequently, they were dehydrated again by immersion in 100% ethanol for one hour each, three times.

[0199] The temperature was set to 56-58°C, and the material was immersed in paraffin for 90 minutes twice. Then, paraffin at 56-58°C was poured directly into a cassette, and the cassette was placed on ice to perform the molding process, which allowed the paraffin to solidify. The paraffin block, containing the tissue and solidified in the cassette, was stored frozen.

[0200] (2) Comparison of intestinal tissue staining results after oral drug administration to IBD mouse models To observe the presence or absence of damage and recovery of intestinal tissue using H&E staining, parraffin blocks were first cut into 7 μm thick sections using a Leica TP1020 semi-enclosed benchtop tissue processor. These sections were then placed on slide glass and allowed to air dry for 2-3 days.

[0201] After melting the paraffin in the slide by placing it in a 55°C oven for one hour, the slide was placed in a container and the subsequent steps were carried out.

[0202] Before the paraffin hardened, it was washed by immersing it in xylene 10 times, and this process was repeated 3 times with other xylene solutions.

[0203] The item was washed by immersing it in 100% ethanol 10 times, and this process was repeated twice with other 100% ethanol.

[0204] After immersing the item in 90%, 80%, and 70% ethanol 10 times in that order, it was rinsed with tap water for 1 minute.

[0205] I soaked it in Mayer's Hematoxylin for 30 seconds and then rinsed it with tap water for 5 minutes.

[0206] Immersed it in EosinY for 1 minute, then rinsed it with tap water for 30 seconds.

[0207] The item was washed by immersing it in 70%, 80%, and 90% ethanol 10 times in that order, alternating between top and bottom.

[0208] The item was washed by immersing it in 100% ethanol 10 times, and then the process was repeated twice with other 100% ethanol.

[0209] After immersing and washing 10 times in xylene, the process was repeated 3 times with other xylene solutions.

[0210] After mounting the cells in DAPI mounting solution, a coverslip was placed over the sample to prepare it. Using a light microscope, the cell nucleus (blue, hematoxylin), cytoplasm, and extracellular matrix (pink, eosin Y) were observed.

[0211] As a result, as shown in Figure 27, we were able to observe intestinal tissue damage in the DSS group (PBS), and all M50 and GC-M (4.5 equivalents) groups showed a more relaxed intestinal condition compared to the DSS group.

[0212] (3) Results of immunofluorescence staining of intercellular proteins and mucin layer in intestinal tissue after oral administration of drugs to IBD mouse model To confirm the recovery of intercellular proteins and mucin proteins by immunofluorescence staining, Occludin, ZO-1, and MUC-2, which correspond to intercellular proteins in intestinal tissue, as well as the mucin layer, were immunofluorescently stained.

[0213] To achieve this, the parraffin block was cut into 7 μm thick sections using a Leica TP1020 semi-enclosed benchtop tissue processor. These sections were then placed on a glass slide and air-dried for 2-3 days.

[0214] The slide was placed in a 55°C oven for 1 hour to melt the paraffin.

[0215] The process of immersing and washing the slide glass in xylene for 3 minutes was repeated three times with different xylene solutions, and the solution was poured into a Coplin jar.

[0216] The process of immersing and washing with 100% ethanol for 3 minutes was repeated twice, each time using a different type of 100% ethanol.

[0217] After immersing in 90% ethanol and then 80% ethanol for 1 minute each to wash, immerse in primary distilled water for 1 minute.

[0218] After washing twice with a PBST solution containing 0.2% Tween20, the samples were dried.

[0219] Afterward, a tissue was moistened with water, and the slide glass was placed on the moistened tissue in a Coplin jar, and the following steps were performed in a moist environment.

[0220] A solution containing 80% PBST and 20% goat serum was sprayed onto each slide in 50 μl portions. The slides were then covered with Parafilm to ensure they were in close contact with the glass slides, preventing air bubbles from forming, and allowed to react for 30 minutes.

[0221] After removing the Parafilm and drying the samples, 50 μl each of a solution of Occludin and ZO-1 antibody (PBST 80% + Goat Serum 20%) = 1:100 was sprayed onto each sample (the primary antibodies were anti-mouse occludin and anti-rabbit ZO-1).

[0222] After covering with Parafilm and allowing to react at 4°C for 24 hours, the Parafilm was removed, and the mixture was placed in a Coplin jar and washed twice with PBS for 2 minutes each.

[0223] Mouse antibody and rabbit antibody: 50 μl each of a PBS = 1:200 solution was sprayed (the secondary antibodies were goat anti-rabbit-488 (anti-rabbit occludin) and goat anti-human RITC (anti-human ZO-1)).

[0224] The samples were covered with Parafilm and allowed to react at room temperature under dark conditions for 1 hour. After washing three times with PBS, 50 μl of DAPI solution was sprayed onto each sample, a coverslip was placed over the sample, and the results were observed using a fluorescence microscope (the green in the upper panel of Figure 28 represents Occludin, the red represents ZO-1, and the red in the lower panel of Figure 28 represents the MUC-2 protein).

[0225] As a result, as shown in Figure 28, we confirmed that the fluorescence intensity increased in the mesalamine and GC-M (M4.5 equivalent) groups compared to the DSS group.

[0226] These results indicate that the GC-M drug alleviated the degree of inflammation due to its tight junction and mucin-restoring effects.

[0227] Example 12. Confirmation of the anti-inflammatory effect of GC-M by evaluating the expression levels of inflammatory cytokines in an IBD mouse model. To confirm the anti-inflammatory effect of GC-M in a DSS drinking water model, animal tissues were prepared and qRT-PCR experiments were performed. Data are presented as Mean±SEM (n=3).

[0228] After cutting the end portion of the colon tissue, 600 μl of RLT buffer (RNeasy Mini Kit, QIAGEN, Germany) was added per 30 mg of tissue, and 10 μl of 2-mercaptoethanol (Sigma) was added per 1 ml of RLT buffer.

[0229] After homogenization using a homogenizer (FastPrep-24 5G, MP Biomedicals, LLC, USA), the supernatant was collected by centrifugation at 14,800 rpm for 3 minutes at 4°C. The supernatant was then collected, and the same volume of 70% EtOH was added. The supernatant was immediately pipetted, and then mRNA was extracted from the tissue using the RNeasy Mini Kit (QIAGEN, Germany).

[0230] 1 μg RNA was reverse transcribed into cDNA using the iScript cNDA synthesis Kit (BIO RAD Laboratories, USA).

[0231] Applied Biosystems Instrument (USA) offers SYBR Green PCR Master Mix (Applied BioScript TM qRT-PCR was performed using (USA) materials.

[0232] GAPDH was used as an endogenous control to normalize the relative mRNA expression levels of the TNFα, IL-6, IL-1β, MCP-1, and iNOS genes. The primer sequences used were as follows:

[0233] GAPDH: Forward CAGGAGGCATTGCTGATGAT / Reverse: GAAGGCTGGGGCTCATTT TNFα: Forward CCCTCACACTCAGATCATCTTCT / Reverse: GCTACGACGTGGGCTACAG IL-6: Forward TAGTCCTTCCTACCCCAATTTCC / Reverse: TTGGTCCTTAGCCACTCCTTC IL-1β: Forward GCAACTGTTCCTGAACTCAACT / Reverse: ATCTTTTGGGGTCCGTCAACT MCP-1: Forward direction TTAAAAACCTGGATCGGAACC / Reverse direction: GCATTAGCTTCAGATTTACGGGT iNOS: Forward CCCCGCTACTACTCCATCAG / Reverse: CCACTGACACTTCGCACAAA

[0234] As a result, as shown in Figure 29, mRNA levels of inflammatory cytokines were significantly increased in DSS drinking water mice, while mRNA levels of inflammatory cytokines were lower in the mesalamine and GC-M (M4.5 equivalent) groups.

[0235] The above description of the present invention is illustrative, and a person with ordinary skill in the art to which the present invention pertains will understand that it can be easily modified in other specific forms without altering the technical idea or essential features of the present invention. Therefore, the embodiments described above should be understood in all respects as illustrative and not limiting.

Claims

1. A pharmaceutical composition for the prevention or treatment of inflammatory bowel disease, comprising glycol chitosan-thioketal-mesalazine or a pharmaceutically acceptable salt thereof as an active ingredient.

2. The composition according to claim 1, characterized in that the glycol chitosan is adsorbable to the intestinal mucosa.

3. The composition according to claim 1, characterized in that the thioketal is degraded by ROS at the site of inflammation, selectively releasing the drug.

4. The composition according to claim 3, characterized in that the drug is mesalazine.

5. The composition according to claim 1, characterized in that the composition suppresses the generation of at least one selected from the group consisting of reactive oxygen species (ROS), reactive nitrogen species (RNS), and nitrate (NO) in cells.

6. The composition according to claim 1, characterized in that the composition restores tight junctions between cells.

7. The composition according to claim 1, characterized in that the composition suppresses macrophage M1 polarization.

8. The composition according to claim 1, characterized in that the composition suppresses the expression of at least one inflammatory cytokine selected from the group consisting of TNF-α (tumor necrosis factor-α), IL-6 (Interleukin 6), and IL-1β (Interleukin-1β).

9. The composition according to claim 1, characterized in that the composition restores a damaged colon.

10. The composition according to claim 1, characterized in that the inflammatory bowel disease is at least one selected from the group consisting of Crohn's disease, ulcerative colitis, intestinal Behcet's disease, and enteritis.

11. A pharmaceutical preparation for the prevention or treatment of inflammatory bowel disease, comprising the composition described in any one of claims 1 to 10.

12. The pharmaceutical preparation according to claim 11, wherein the preparation is an oral preparation, an injectable preparation, an injection preparation, a spray preparation, or a liquid preparation.

13. A health functional food for the prevention or improvement of inflammatory bowel disease, comprising the composition described in any one of claims 1 to 10.

14. Pharmaceutical compositions containing glycol chitosan-thioketal-mesalazine or a pharmaceutically acceptable salt thereof as an active ingredient for the prevention or treatment of inflammatory bowel disease.

15. A method for preventing or treating inflammatory bowel disease, comprising the step of administering to an individual a pharmaceutical composition containing glycol chitosan-thioketal-mesalazine or a pharmaceutically acceptable salt thereof as an active ingredient.

Images