Novel engineered capsid serotypes of recombinant adeno-associated virus vectors with reduced hepatotropy

Abstract

Manipulated adeno-associated virus vectors and methods of using them are disclosed herein.

Description

Detailed Description of the Invention

[0001] [Technical Field] Cross-Reference to Related Applications This PCT application claims priority and the benefit of U.S. Provisional Patent Application No. 63 / 583,110, filed on September 15, 2023, entitled "NOVEL ENGINEERED CAPSID SEROTYPES OF RECOMBINANT ADENO-ASSOCIATED VIRAL VECTOR WITH REDUCED LIVER TROPISM", which is hereby incorporated by reference in its entirety herein.

[0002] Statement Regarding Federally Funded Research This invention was made with government support under Grant No. CA166590 awarded by the National Institutes of Health. The government has certain rights in this invention.

[0003] Reference to Sequence Listing The Sequence Listing submitted on September 16, 2024 in XML format, created on September 16, 2024, entitled "103361-377WO1_ST26.xml" and having a file size of 88,211 bytes, is incorporated herein by reference in accordance with 37 C.F.R. § 1.52(e)(5).

[0004] Field The present disclosure relates to engineered adeno-associated viral vectors and methods of use thereof.

[0005] [Background Art] Recombinant adeno-associated virus (rAAV) vectors, being non-pathogenic with low immunogenicity and long-lasting transgene expression, have found successful applications in clinical trials for the treatment of a range of diseases. In addition, rAAV has extensive applications in basic research for gene delivery to multiple tissues, including the liver, heart, skeletal muscle, brain, and eyes. However, the application of rAAV to target certain tissues by systemic delivery is limited due to the low transduction efficiency and high hepatotropy of naturally occurring AAV serotypes. Overcoming rAAV hepatotropy to reach target tissues requires large doses of rAAV, which can result in a narrow therapeutic window and raise safety concerns.

[0006] Modifications to the capsid or expression cassette are used to improve the efficiency of gene delivery and restricted expression of transgenes, either locally or systemically. For example, the selection of more efficient spontaneously occurring serotypes plus the use of tissue-specific promoters or microRNA target sequences enables specific tissue transduction, but requires high doses to achieve therapeutic effects. Furthermore, the expression of recombinant therapies in off-target tissues, particularly the liver, can have undesirable consequences and adverse effects. What is needed is a novel, highly transduction-efficient viral vector that can avoid these adverse off-target effects.

[0007] [Overview of the prefecture] A manipulated adeno-associated virus vector and its use are disclosed.

[0008] In one embodiment, an engineered AAV capsid protein is disclosed herein, wherein one or more amino acid substitutions occur at residues that promote intrahepatic AAV degradation, eliminate hepatotropy, and / or disrupt AAV binding to hepatocytes.

[0009] In one embodiment, an engineered adeno-associated virus (AAV) capsid protein is disclosed herein, wherein one or more amino acid substitutions correspond to residues 503, 708, and / or 709 of SEQ ID NO: 1 or SEQ ID NO: 6, or any combination thereof, and includes, but is not limited to, one or more amino acid substitutions at residues 501, 713, and / or 714 of SEQ ID NO: 31. In one embodiment, the amino acid substitutions include F503Y, F503T, F503K, Y708D, Y708E, K709I, K709L, and / or K709G, or any combination thereof, for SEQ ID NO: 1 or SEQ ID NO: 6. In one embodiment, the amino acid substitutions include F501Y, Y713D, and / or K714I, or any combination thereof, for SEQ ID NO: 31. For example, in one embodiment, the engineered AAV capsid protein is an engineered AAV capsid protein in which the substitutions include F503Y, Y708D, and / or K709I. In some embodiments, the vector does not transduce liver tissue. For example, in one embodiment, the engineered AAV capsid protein includes the sequence described in SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, or SEQ ID NO: 44. In one embodiment, the AAV capsid protein may include recombinant 2 (Rec2), AAV8, or AAV9 capsid protein.

[0010] Also disclosed herein are manipulated AAVs of any prior art in which one or more amino acid substitutions are encoded by nucleic acid substitutions corresponding to positions 1508, 2127, 2124, or any combination thereof in SEQ ID NO: 2 or SEQ ID NO: 5.

[0011] Furthermore, vectors comprising engineered AAV capsid proteins from any of the prior embodiments are disclosed herein. For example, engineered AAV vectors from any of the prior embodiments are disclosed herein, wherein the vector comprises the nucleic acid sequences described in SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 18, or variants thereof.

[0012] In one embodiment, a vector of any prior embodiment is disclosed herein, wherein the vector further comprises a transgene (e.g., a leptin gene, an IL-15 gene, an IL-15 / IL-15R complex gene, an FGF21 gene, an adiponectin gene, a therapeutic gene linking leptin and adiponectin by a 2A sequence, or a synthetic microRNA targeting leptin). In some embodiments, the vector does not transduce into liver tissue.

[0013] In one embodiment, a method for reducing the hepatotropy of an adeno-associated virus (AAV) vector is disclosed herein, wherein the AAV vector encodes an engineered AAV capsid protein, and the method comprises substituting one or more amino acids corresponding to amino acid residues 503, 708, and / or 709 of SEQ ID NO: 1 or SEQ ID NO: 6, and including, but not limited to, one or more amino acid substitutions in residues 501, 713, and / or 714 of SEQ ID NO: 31.

[0014] Also disclosed herein are methods for reducing the hepatotropy of any prior embodiment of an adeno-associated virus (AAV) vector, wherein the amino acid substitution comprises F503Y, F503T, F503K, Y708D, Y708E, K709I, K709L, and / or K709G, or any combination thereof, relative to SEQ ID NO: 1 or SEQ ID NO: 6 (for example, a method comprising F501Y, Y713D, and / or K714I, relative to SEQ ID NO: 31). In some embodiments, the method further comprises introducing SEQ ID NO: 2 or SEQ ID NO: 5 into the AAV vector, wherein SEQ ID NO: 2 or SEQ ID NO: 5 comprises a nucleic acid substitution at codon positions 1508, 2127, 2124, or any combination thereof, the nucleic acid substitution occurring at a nucleotide that causes abolition of hepatotropy or disrupts AAV binding to hepatocytes. In some embodiments, the capsid protein is recombinant 2 (Rec2), AAV8, or AAV9 capsid protein.

[0015] In one embodiment, an AAV capsid protein prepared by a method of any of the prior embodiments is disclosed herein.

[0016] Also disclosed herein are methods for delivering genes to target adipose tissue, methods for treating, inhibiting, reducing, decreasing, relieving, and / or preventing metabolic disorders or diseases in a subject (e.g., diabetes mellitus, obesity, metabolic syndromes, congenital leptin deficiency, or lipodystrophy), and / or methods for treating, inhibiting, reducing, decreasing, relieving, and / or preventing cancer in a subject, comprising administering the modified AAV vectors of any of the prior art embodiments (e.g., Rec2, AAV8, or AAV9 vectors, including but not limited to Rec2, AAV8, or AAV9 capsid proteins). For example, a method for delivering a gene of any prior embodiment to target adipose tissue; a method for treating, inhibiting, reducing, decreasing, relieving and / or preventing a metabolic disorder or disease of any prior embodiment (e.g., diabetes, obesity, metabolic syndrome, congenital leptin deficiency, or lipodystrophy); and / or a method for treating, inhibiting, reducing, decreasing, relieving and / or preventing a cancer of any prior embodiment, wherein amino Methods are disclosed herein in which the acid substitution occurs at a residue that eliminates hepatotropy or disrupts AAV binding to hepatocytes, and which include, but are not limited to, F503Y, F503T, F503K, Y708D, Y708E, K709I, K709L, and / or K709G, or any combination thereof, for SEQ ID NO: 1 or SEQ ID NO: 6 (for example, a method in which the amino acid substitution includes F501Y, Y713D, and / or K714I for SEQ ID NO: 31).In one embodiment, a method for delivering a gene of any prior embodiment to target adipose tissue, a method for treating, inhibiting, reducing, decreasing, relieving and / or preventing a metabolic disorder or disease of any prior embodiment (e.g., diabetes mellitus, obesity, metabolic syndrome, congenital leptin deficiency, or lipodystrophy), and / or a method for treating, inhibiting, reducing, decreasing, relieving and / or preventing cancer of any prior embodiment, wherein the AAV capsid protein comprises the sequence described in SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, or SEQ ID NO: 44 is disclosed herein. In some embodiments, AAV vectors encode a transgene or a therapeutic agent.

[0017] The accompanying figures incorporated herein and constituting part of this specification illustrate some of the embodiments described below. [Brief explanation of the drawing]

[0018] [Figure 1A] A schematic diagram of Rec2 variant V7, which has three amino acid residue substitutions in the Rec2 capsid, is shown. [Figure 1B] The amino acid sequence of Rec2 variant V7 (SEQ ID NO: 3) is shown. [Figure 2A]This shows in vivo screening of Rec2 capsid variants. Figures 2A and 2B show GFP fluorescence in eWAT (Figure 2A) and liver (Figure 2B) 2 weeks after ip injection of Rec-2-GFP or V1-7-GFP vector at a dose of 2E10vg / mouse. Figure 2C shows the GFP fluorescence ratio (fat / liver). Data are mean ± SEM. Sample size: Rec2-GFP n=5, V1-GFP n=3, V2-GFP n=3, V4-GFP n=3, V5-GFP n=7, V6-GFP n=5, V7-GFP n=7, V8-GFP n=5. [Figure 2B] This shows in vivo screening of Rec2 capsid variants. Figures 2A and 2B show GFP fluorescence in eWAT (Figure 2A) and liver (Figure 2B) 2 weeks after ip injection of Rec-2-GFP or V1-7-GFP vector at a dose of 2E10vg / mouse. Figure 2C shows the GFP fluorescence ratio (fat / liver). Data are mean ± SEM. Sample size: Rec2-GFP n=5, V1-GFP n=3, V2-GFP n=3, V4-GFP n=3, V5-GFP n=7, V6-GFP n=5, V7-GFP n=7, V8-GFP n=5. [Figure 2C] This shows in vivo screening of Rec2 capsid variants. Figures 2A and 2B show GFP fluorescence in eWAT (Figure 2A) and liver (Figure 2B) 2 weeks after ip injection of Rec-2-GFP or V1-7-GFP vector at a dose of 2E10vg / mouse. Figure 2C shows the GFP fluorescence ratio (fat / liver). Data are mean ± SEM. Sample size: Rec2-GFP n=5, V1-GFP n=3, V2-GFP n=3, V4-GFP n=3, V5-GFP n=7, V6-GFP n=5, V7-GFP n=7, V8-GFP n=5. [Figure 3A]Intraperitoneal administration of the V7 vector selectively transduces visceral adipose tissue, non-targeting the liver. Figure 3A shows eWAT and GFP fluorescence in the liver two weeks after ip injection of Rec2-GFP or V7-GFP vector. Figure 3B shows Western blotting in a separate experiment two weeks after AAV injection. Figure 3C shows GFP fluorescence in a drug-dosing experiment two weeks after ip injection. Figure 3D shows Western blotting in mice receiving high doses of V7-GFP. Figure 3E shows the vector genome copy number in mice receiving high doses of V7-GFP. Doses are shown in each graph. Data are mean ± SEM. Sample size (biological replicate): Rec2-GFP 2E10vg / mouse n=3~8, V7-GFP 2E10vg / mouse n=8, V7-GFP 4E10 / mouse n=5, V7-GFP 8E10vg / mouse n=4. [Figure 3B] Intraperitoneal administration of the V7 vector selectively transduces visceral adipose tissue, non-targeting the liver. Figure 3A shows eWAT and GFP fluorescence in the liver two weeks after ip injection of Rec2-GFP or V7-GFP vector. Figure 3B shows Western blotting in a separate experiment two weeks after AAV injection. Figure 3C shows GFP fluorescence in a drug-dosing experiment two weeks after ip injection. Figure 3D shows Western blotting in mice receiving high doses of V7-GFP. Figure 3E shows the vector genome copy number in mice receiving high doses of V7-GFP. Doses are shown in each graph. Data are mean ± SEM. Sample size (biological replicate): Rec2-GFP 2E10vg / mouse n=3~8, V7-GFP 2E10vg / mouse n=8, V7-GFP 4E10 / mouse n=5, V7-GFP 8E10vg / mouse n=4. [Figure 3C]Intraperitoneal administration of the V7 vector selectively transduces visceral adipose tissue, non-targeting the liver. Figure 3A shows eWAT and GFP fluorescence in the liver two weeks after ip injection of Rec2-GFP or V7-GFP vector. Figure 3B shows Western blotting in a separate experiment two weeks after AAV injection. Figure 3C shows GFP fluorescence in a drug-dosing experiment two weeks after ip injection. Figure 3D shows Western blotting in mice receiving high doses of V7-GFP. Figure 3E shows the vector genome copy number in mice receiving high doses of V7-GFP. Doses are shown in each graph. Data are mean ± SEM. Sample size (biological replicate): Rec2-GFP 2E10vg / mouse n=3~8, V7-GFP 2E10vg / mouse n=8, V7-GFP 4E10 / mouse n=5, V7-GFP 8E10vg / mouse n=4. [Figure 3D] Intraperitoneal administration of the V7 vector selectively transduces visceral adipose tissue, non-targeting the liver. Figure 3A shows eWAT and GFP fluorescence in the liver two weeks after ip injection of Rec2-GFP or V7-GFP vector. Figure 3B shows Western blotting in a separate experiment two weeks after AAV injection. Figure 3C shows GFP fluorescence in a drug-dosing experiment two weeks after ip injection. Figure 3D shows Western blotting in mice receiving high doses of V7-GFP. Figure 3E shows the vector genome copy number in mice receiving high doses of V7-GFP. Doses are shown in each graph. Data are mean ± SEM. Sample size (biological replicate): Rec2-GFP 2E10vg / mouse n=3~8, V7-GFP 2E10vg / mouse n=8, V7-GFP 4E10 / mouse n=5, V7-GFP 8E10vg / mouse n=4. [Figure 3E]It shows that intraperitoneal administration of the V7 vector selectively transduces visceral adipose tissue and does not target the liver. Figure 3A shows GFP fluorescence in eWAT and liver 2 weeks after i.p. injection of Rec2-GFP or V7-GFP vector. Figure 3B shows Western blotting in a separate experiment 2 weeks after AAV injection. Figure 3C shows GFP fluorescence in a dosing experiment 2 weeks after i.p. injection. Figure 3D shows Western blotting in mice that received a high dose of V7-GFP. Figure 3E shows vector genome copy numbers in mice that received a high dose of V7-GFP. Doses are indicated in each graph. Data are mean ± SEM. Sample size (biological replicates): Rec2-GFP 2E10 vg / mouse n=3~8, V7-GFP 2E10 vg / mouse n=8, V7-GFP 4E10 / mouse n=5, V7-GFP 8E10 vg / mouse n=4. [Figure 4A] It shows that intravenous injection of the V7 vector preferentially transduces subcutaneous white adipose tissue and brown adipose tissue while not targeting the liver. Figure 4A shows Western blotting 2 weeks after tail vein injection of AAV8-GFP or V7-GFP. Figure 4B shows Western blotting of tissues from mice that received V7-GFP (8E10 vg / mouse). Molecular weight markers are shown in kDa. Figure 4C shows vector genome copy numbers in mice that received a high dose of AAV8 or V7-GFP. Doses are indicated in each graph. Data are mean ± SEM. Sample size (biological replicates): n=3 per group. [Figure 4B]Intravenous injection of the V7 vector preferentially transduces subcutaneous white and brown adipose tissue, while non-targeting the liver. Figure 4A shows Western blotting two weeks after tail vein injection of AAV8-GFP or V7-GFP. Figure 4B shows Western blotting of tissue from mice receiving V7-GFP (8E10vg / mouse). Molecular weight markers are shown in kDa. Figure 4C shows vector genome copy number in mice receiving high doses of AAV8 or V7-GFP. Dose is shown in each graph. Data are mean ± SEM. Sample size (biological replicate): n=3 per group. [Figure 4C] Intravenous injection of the V7 vector preferentially transduces subcutaneous white and brown adipose tissue, while non-targeting the liver. Figure 4A shows Western blotting two weeks after tail vein injection of AAV8-GFP or V7-GFP. Figure 4B shows Western blotting of tissue from mice receiving V7-GFP (8E10vg / mouse). Molecular weight markers are shown in kDa. Figure 4C shows vector genome copy number in mice receiving high doses of AAV8 or V7-GFP. Dose is shown in each graph. Data are mean ± SEM. Sample size (biological replicate): n=3 per group. [Figure 5A]Intraperitoneal administration of the V7-LEP / ADIPOQ vector rescues excessive weight gain and impaired glycemic control in ob / ob mice. Figure 5A shows a schematic diagram of an AAV vector containing a human leptin and human adiponectin linkage via a 2A sequence. Figure 5B shows body weight measurements. Figure 5C shows the area under the curve for body weight. Figure 5D shows body weight gain measurements. Figure 5E shows the area under the curve for body weight gain. Figure 5F shows the glucose tolerance test 8 weeks after AAV injection. Figure 5G shows the area under the curve for the glucose tolerance test. Data are mean ± SEM. Sample size (biological replicates): ob / + buffer n=5, ob / ob GFP 8E10 n=5, ob / ob LEP / ADIPOQ 4E10 n=4, ob / ob LEP / ADIPOQ 8E10 n=4. *P<0.05, **P<0.01 from one-way ANOVA followed by Tukey's multiple comparisons test. [Figure 5B] Intraperitoneal administration of the V7-LEP / ADIPOQ vector rescues excessive weight gain and impaired glycemic control in ob / ob mice. Figure 5A shows a schematic diagram of an AAV vector containing a human leptin and human adiponectin linkage via a 2A sequence. Figure 5B shows body weight measurements. Figure 5C shows the area under the curve for body weight. Figure 5D shows body weight gain measurements. Figure 5E shows the area under the curve for body weight gain. Figure 5F shows the glucose tolerance test 8 weeks after AAV injection. Figure 5G shows the area under the curve for the glucose tolerance test. Data are mean ± SEM. Sample size (biological replicates): ob / + buffer n=5, ob / ob GFP 8E10 n=5, ob / ob LEP / ADIPOQ 4E10 n=4, ob / ob LEP / ADIPOQ 8E10 n=4. *P<0.05, **P<0.01 from one-way ANOVA followed by Tukey's multiple comparisons test. [Figure 5C]This study demonstrates that intraperitoneal administration of the V7-LEP / ADIPOQ vector rescues ob / ob mice from excessive weight gain and impaired blood glucose control. Figure 5A shows a schematic diagram of the AAV vector containing human leptin and human adiponectin ligations via 2A sequences. Figure 5B shows weight measurement. Figure 5C shows the area under the curve for weight. Figure 5D shows weight gain measurement. Figure 5E shows the area under the curve for weight gain. Figure 5F shows the glucose tolerance test 8 weeks after AAV injection. Figure 5G shows the area under the curve for the glucose tolerance test. Data are mean ± SEM. Sample size (biological replicate): ob / + buffer n=5, ob / ob GFP 8E10 n=5, ob / ob LEP / ADIPOQ 4E10 n=4, ob / ob LEP / ADIPOQ 8E10 n=4. One-way ANOVA, followed by Tukey multiple comparison tests, yielded *P<0.05 and **P<0.01. [Figure 5D] This study demonstrates that intraperitoneal administration of the V7-LEP / ADIPOQ vector rescues ob / ob mice from excessive weight gain and impaired blood glucose control. Figure 5A shows a schematic diagram of the AAV vector containing human leptin and human adiponectin ligations via 2A sequences. Figure 5B shows weight measurement. Figure 5C shows the area under the curve for weight. Figure 5D shows weight gain measurement. Figure 5E shows the area under the curve for weight gain. Figure 5F shows the glucose tolerance test 8 weeks after AAV injection. Figure 5G shows the area under the curve for the glucose tolerance test. Data are mean ± SEM. Sample size (biological replicate): ob / + buffer n=5, ob / ob GFP 8E10 n=5, ob / ob LEP / ADIPOQ 4E10 n=4, ob / ob LEP / ADIPOQ 8E10 n=4. One-way ANOVA, followed by Tukey multiple comparison tests, yielded *P<0.05 and **P<0.01. [Figure 5E]This study demonstrates that intraperitoneal administration of the V7-LEP / ADIPOQ vector rescues ob / ob mice from excessive weight gain and impaired blood glucose control. Figure 5A shows a schematic diagram of the AAV vector containing human leptin and human adiponectin ligations via 2A sequences. Figure 5B shows weight measurement. Figure 5C shows the area under the curve for weight. Figure 5D shows weight gain measurement. Figure 5E shows the area under the curve for weight gain. Figure 5F shows the glucose tolerance test 8 weeks after AAV injection. Figure 5G shows the area under the curve for the glucose tolerance test. Data are mean ± SEM. Sample size (biological replicate): ob / + buffer n=5, ob / ob GFP 8E10 n=5, ob / ob LEP / ADIPOQ 4E10 n=4, ob / ob LEP / ADIPOQ 8E10 n=4. One-way ANOVA, followed by Tukey multiple comparison tests, yielded *P<0.05 and **P<0.01. [Figure 5F] This study demonstrates that intraperitoneal administration of the V7-LEP / ADIPOQ vector rescues ob / ob mice from excessive weight gain and impaired blood glucose control. Figure 5A shows a schematic diagram of the AAV vector containing human leptin and human adiponectin ligations via 2A sequences. Figure 5B shows weight measurement. Figure 5C shows the area under the curve for weight. Figure 5D shows weight gain measurement. Figure 5E shows the area under the curve for weight gain. Figure 5F shows the glucose tolerance test 8 weeks after AAV injection. Figure 5G shows the area under the curve for the glucose tolerance test. Data are mean ± SEM. Sample size (biological replicate): ob / + buffer n=5, ob / ob GFP 8E10 n=5, ob / ob LEP / ADIPOQ 4E10 n=4, ob / ob LEP / ADIPOQ 8E10 n=4. One-way ANOVA, followed by Tukey multiple comparison tests, yielded *P<0.05 and **P<0.01. [Figure 5G]This study demonstrates that intraperitoneal administration of the V7-LEP / ADIPOQ vector rescues ob / ob mice from excessive weight gain and impaired blood glucose control. Figure 5A shows a schematic diagram of the AAV vector containing human leptin and human adiponectin ligations via 2A sequences. Figure 5B shows weight measurement. Figure 5C shows the area under the curve for weight. Figure 5D shows weight gain measurement. Figure 5E shows the area under the curve for weight gain. Figure 5F shows the glucose tolerance test 8 weeks after AAV injection. Figure 5G shows the area under the curve for the glucose tolerance test. Data are mean ± SEM. Sample size (biological replicate): ob / + buffer n=5, ob / ob GFP 8E10 n=5, ob / ob LEP / ADIPOQ 4E10 n=4, ob / ob LEP / ADIPOQ 8E10 n=4. One-way ANOVA, followed by Tukey multiple comparison tests, yielded *P<0.05 and **P<0.01. [Figure 6A] Intraperitoneal administration of the V7-LEP / ADIPOQ vector normalizes body temperature and body composition in ob / ob mice. Figure 6A shows rectal temperature 8 weeks after AAV injection. Figure 6B shows body composition by EchoMRI 9 weeks after AAV injection. Figure 6C shows relative tissue mass calibrated to body weight at sacrifice 9 weeks after AAV injection. Data are mean ± SEM. Sample size (biological replicate): ob / + buffer n=5, ob / ob GFP 8E10 n=5, ob / ob LEP / ADIPOQ 4E10 n=4, ob / ob LEP / ADIPOQ 8E10 n=4. One-way ANOVA, followed by Tukey multiple comparison test: *P<0.05, **P<0.01. [Figure 6B]Intraperitoneal administration of the V7-LEP / ADIPOQ vector normalizes body temperature and body composition in ob / ob mice. Figure 6A shows rectal temperature 8 weeks after AAV injection. Figure 6B shows body composition by EchoMRI 9 weeks after AAV injection. Figure 6C shows relative tissue mass calibrated to body weight at sacrifice 9 weeks after AAV injection. Data are mean ± SEM. Sample size (biological replicate): ob / + buffer n=5, ob / ob GFP 8E10 n=5, ob / ob LEP / ADIPOQ 4E10 n=4, ob / ob LEP / ADIPOQ 8E10 n=4. One-way ANOVA, followed by Tukey multiple comparison test: *P<0.05, **P<0.01. [Figure 6C] Intraperitoneal administration of the V7-LEP / ADIPOQ vector normalizes body temperature and body composition in ob / ob mice. Figure 6A shows rectal temperature 8 weeks after AAV injection. Figure 6B shows body composition by EchoMRI 9 weeks after AAV injection. Figure 6C shows relative tissue mass calibrated to body weight at sacrifice 9 weeks after AAV injection. Data are mean ± SEM. Sample size (biological replicate): ob / + buffer n=5, ob / ob GFP 8E10 n=5, ob / ob LEP / ADIPOQ 4E10 n=4, ob / ob LEP / ADIPOQ 8E10 n=4. One-way ANOVA, followed by Tukey multiple comparison test: *P<0.05, **P<0.01. [Figure 7] This shows the in vivo distribution of transgene mRNA in a representative mouse of the V7-LEP / ADIPOQ 8E10 group (n=1). [Figure 8A]Intraperitoneal administration of V7-LEP / ADIPOQ reverses hyperinsulinemia, hyperglycemia, and fatty liver in ob / ob mice. Figure 8A shows serum levels of human leptin and human adiponectin. No significant difference between low and high doses. Figure 8B shows serum insulin levels. Figure 8C shows serum glucose levels. Figure 8D shows liver triglyceride content. Data are mean ± SEM. Sample size (biological replicate): ob / + buffer n=5, ob / ob GFP 8E10 n=5, ob / ob LEP / ADIPOQ 4E10 n=4, ob / ob LEP / ADIPOQ 8E10 n=4. One-way ANOVA, followed by Tukey multiple comparison test: *P<0.05, **P<0.01. [Figure 8B] Intraperitoneal administration of V7-LEP / ADIPOQ reverses hyperinsulinemia, hyperglycemia, and fatty liver in ob / ob mice. Figure 8A shows serum levels of human leptin and human adiponectin. No significant difference between low and high doses. Figure 8B shows serum insulin levels. Figure 8C shows serum glucose levels. Figure 8D shows liver triglyceride content. Data are mean ± SEM. Sample size (biological replicate): ob / + buffer n=5, ob / ob GFP 8E10 n=5, ob / ob LEP / ADIPOQ 4E10 n=4, ob / ob LEP / ADIPOQ 8E10 n=4. One-way ANOVA, followed by Tukey multiple comparison test: *P<0.05, **P<0.01. [Figure 8C]Intraperitoneal administration of V7-LEP / ADIPOQ reverses hyperinsulinemia, hyperglycemia, and fatty liver in ob / ob mice. Figure 8A shows serum levels of human leptin and human adiponectin. No significant difference between low and high doses. Figure 8B shows serum insulin levels. Figure 8C shows serum glucose levels. Figure 8D shows liver triglyceride content. Data are mean ± SEM. Sample size (biological replicate): ob / + buffer n=5, ob / ob GFP 8E10 n=5, ob / ob LEP / ADIPOQ 4E10 n=4, ob / ob LEP / ADIPOQ 8E10 n=4. One-way ANOVA, followed by Tukey multiple comparison test: *P<0.05, **P<0.01. [Figure 8D] Intraperitoneal administration of V7-LEP / ADIPOQ reverses hyperinsulinemia, hyperglycemia, and fatty liver in ob / ob mice. Figure 8A shows serum levels of human leptin and human adiponectin. No significant difference between low and high doses. Figure 8B shows serum insulin levels. Figure 8C shows serum glucose levels. Figure 8D shows liver triglyceride content. Data are mean ± SEM. Sample size (biological replicate): ob / + buffer n=5, ob / ob GFP 8E10 n=5, ob / ob LEP / ADIPOQ 4E10 n=4, ob / ob LEP / ADIPOQ 8E10 n=4. One-way ANOVA, followed by Tukey multiple comparison test: *P<0.05, **P<0.01. [Figure 9A] This shows that the AAV8 capsid with the F503Y / Y708D / K709I substitution loses hepatotropy. Figure 9A shows a schematic diagram of the AAV8 mutant transplasmid. Figure 9B shows GFP fluorescence in the liver and eWAT two weeks after ip injection of AAV8 or AAV8 mutant vector in 2E10vg / mouse. Data are mean ± SEM. Sample size (biological replicate): AAV8 n=3, AAV8 mutant n=4. Figure 9C shows Western blotting of GFP in various tissues during extended exposure. Molecular weight markers are shown in kDa. [Figure 9B] This shows that the AAV8 capsid with the F503Y / Y708D / K709I substitution loses hepatotropy. Figure 9A shows a schematic diagram of the AAV8 mutant transplasmid. Figure 9B shows GFP fluorescence in the liver and eWAT two weeks after ip injection of AAV8 or AAV8 mutant vector in 2E10vg / mouse. Data are mean ± SEM. Sample size (biological replicate): AAV8 n=3, AAV8 mutant n=4. Figure 9C shows Western blotting of GFP in various tissues during extended exposure. Molecular weight markers are shown in kDa. [Figure 9C] This shows that the AAV8 capsid with the F503Y / Y708D / K709I substitution loses hepatotropy. Figure 9A shows a schematic diagram of the AAV8 mutant transplasmid. Figure 9B shows GFP fluorescence in the liver and eWAT two weeks after ip injection of AAV8 or AAV8 mutant vector in 2E10vg / mouse. Data are mean ± SEM. Sample size (biological replicate): AAV8 n=3, AAV8 mutant n=4. Figure 9C shows Western blotting of GFP in various tissues during extended exposure. Molecular weight markers are shown in kDa. [Modes for carrying out the invention]

[0019] The following description of the disclosure is provided as effective teaching of the disclosure in the best known embodiment(s). In light of this, those skilled in the art will recognize and appreciate that many modifications can be made to various embodiments of the invention described herein, and that the beneficial results of this disclosure can be obtained. Furthermore, it will be apparent that some desirable advantages of this disclosure can also be obtained by selecting certain features of this disclosure without utilizing other features. Therefore, those skilled in the art will recognize that many modifications and adaptations are possible to this disclosure, which are desirable in certain circumstances and constitute part of this disclosure. Accordingly, the following description illustrates, but is not limited to, the principles of this disclosure.

[0020] Specific embodiments of the present invention are shown in detail with reference to the drawings and examples. However, the present invention may be embodied in many different forms and should not be construed as being limited to the embodiments described herein.

[0021] term Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art to which this disclosure belongs. Where used herein, the term “comprising” and its variations are used synonymously with the term “including” and its variations, and are open, non-restrictive terms. While the terms “comprising” and “including” are used herein to describe various embodiments, the terms “essentially consisting of” and “consisting of” may be used instead of “comprising” and “including,” and are also disclosed. Where used herein and in the appended claims, the singular forms “a,” “an,” and “the” include plural references unless explicitly indicated otherwise in the context.

[0022] For a complete understanding of the terms used in this specification, the following definitions are provided.

[0023] The terms “approximately” and “about” are defined as “approximate” as understood by those skilled in the art. In one non-limiting embodiment, the term is defined as within 10%. In another non-limiting embodiment, the term is defined as within 5%. In yet another non-limiting embodiment, the term is defined as within 1%.

[0024] A range may be expressed herein as “about” one particular value and / or “about” another particular value. Where such a range is expressed, another embodiment includes from that particular value and / or to another particular value. Similarly, where a value is expressed as an approximation, it will be understood that by using the preceding “about,” the particular value forms another embodiment. It will be further understood that each endpoint of a range is important both in relation to and independently of the other endpoints. There are several values ​​disclosed herein, and each value is disclosed herein as “about” that particular value, in addition to the value itself. For example, where the value “10” is disclosed, “about 10” is also disclosed. As will be well understood by those skilled in the art, where a value is disclosed as “less than or equal to that value,” it will also be understood that “greater than or equal to that value” and the possible range between that value are also disclosed. For example, where the value “10” is disclosed, “less than or equal to 10” and “greater than or equal to 10” are also disclosed. Furthermore, throughout this application, the data is provided in several different formats, and it is understood that this data also represents endpoints and starting points, as well as ranges of any combination of data points. For example, if a specific data point "10" and a specific data point 15 are disclosed, it is understood that, in addition to the range between 10 and 15, the values ​​greater than 10, 10 or greater, less than 10, 10 or less, and equal to 10, greater than 15, 15 or greater, less than 15, 15 or less, and equal to 15 are disclosed. It is also understood that each unit between two specific units is disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed.

[0025] As used herein, the terms “may,” “optionally,” and “optionally may” are used interchangeably and mean both when the condition arises and when it does not. Therefore, for example, the statement that a formulation “may contain excipients” means both when the formulation contains excipients and when the formulation does not.

[0026] "Composition" refers to any agent having beneficial biological effects. Beneficial biological effects include therapeutic effects, e.g., treatment of disorders or other undesirable physiological conditions, and preventive effects, e.g., prevention of disorders or other undesirable physiological conditions. These terms also encompass, but are not limited to, pharmaceutically acceptable, pharmacologically active derivatives of beneficial agents specifically referred to herein, including vectors, polynucleotides, cells, salts, esters, amides, precursors, active metabolites, isomers, fragments, analogs, etc. When the term "Composition" is used, or when a particular composition is specifically identified, it should be understood that this term includes the composition itself, as well as pharmaceutically acceptable, pharmacologically active vectors, polynucleotides, salts, esters, amides, precursors, conjugates, active metabolites, isomers, fragments, analogs, etc.

[0027] "Increase" can refer to any change that results in a greater amount of symptom, disease, composition, condition, or activity. An increase can be a statistically significant increase in any individual value, median, or mean of a condition, symptom, activity, or composition. Thus, an increase can be an increase of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100%, insofar as the increase is statistically significant.

[0028] "Reduction" can refer to any change that results in a smaller amount of symptom, disease, composition, condition, or activity. A substance is also understood to decrease the genetic output of a gene if the genetic output of the gene product containing that substance is less than the genetic output of the gene product without that substance. Also, for example, a reduction can be a change in the symptoms of a disorder, such that the symptoms are less than previously observed. A reduction can be a statistically significant decrease in any individual value, median, or mean of a condition, symptom, activity, or composition. Thus, a reduction can be a decrease of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100%, insofar as the reduction is statistically significant.

[0029] "Inhibit," "to inhibit," and "inhibition" mean reducing activity, response, state, disease, or other biological parameters. This may include, but is not limited to, the complete disappearance of activity, response, state, or disease. This may include, for example, a 10% reduction of activity, response, state, or disease compared to natural or control levels. Thus, a reduction may be 10, 20, 30, 40, 50, 60, 70, 80, 90, 100%, or any amount in between, compared to natural or control levels.

[0030] "To reduce," or other forms of the word "reduce," such as "to reduce" or "reduction," means a decrease in an event or characteristic (e.g., tumor growth). This is typically related to some standard or expected value, in other words, it is relative, but it is understood that it is not always necessary to refer to a standard or relative value. For example, "to reduce tumor growth" means to reduce the rate of tumor growth compared to a standard or control.

[0031] "Prevent," or other forms of the word "prevent," such as "preventing" or "prevention," means to stop a particular event or characteristic, to stabilize or delay the development or progression of a particular event or characteristic, or to minimize the chance of a particular event or characteristic occurring. Prevention is typically more absolute than reduction, for example, and therefore does not require comparison with a contrast. Where used herein, something may be reduced but not preventable, while something that is reduced may be prevented. Similarly, something may be prevented but not reduced, while something that is prevented may be reduced. Where reduction or prevention is used, the use of other words is also expressly disclosed unless otherwise specifically indicated.

[0032] The term "subject" refers to any individual that is the target of administration or treatment. A subject may be a vertebrate, e.g., a mammal. In one embodiment, a subject may be a human, a non-human primate, a cattle, a horse, a pig, a dog, or a cat. A subject may also be a guinea pig, a rat, a hamster, a rabbit, a mouse, or a mole. Therefore, a subject may be a human or a veterinary patient. The term "patient" refers to a subject under the treatment of a clinician, e.g., a physician.

[0033] The term "therapeutically effective" means that the amount of the composition used is sufficient to relieve one or more causes or symptoms of a disease or disorder. Such relief may require only reduction or modification, and does not necessarily have to be elimination.

[0034] The term “treatment” refers to the medical management of a patient with the intention of curing, relieving, stabilizing, or preventing a disease, pathological condition, or disorder. This term includes active treatment, i.e., treatment specifically directed toward improvement of a disease, pathological condition, or disorder, and also includes causal treatment, i.e., treatment directed toward the elimination of the cause of the associated disease, pathological condition, or disorder. In addition, this term includes palliative treatment, i.e., treatment designed to alleviate symptoms rather than cure a disease, pathological condition, or disorder; preventive treatment, i.e., treatment directed toward minimizing, partially or completely inhibiting, the onset of the associated disease, pathological condition, or disorder; and adjunct treatment, i.e., treatment used to supplement another specific therapy directed toward improvement of the associated disease, pathological condition, or disorder.

[0035] "Biocompatibility" generally refers to the fact that a material, any of its metabolites, or their degradation products are generally non-toxic to the recipient and do not cause significant adverse effects.

[0036] "Contains" is intended to mean that a composition, method, etc., includes the enumerated elements but does not exclude others. When used to define a composition and method, "essentially consisting of" shall mean including the enumerated elements but excluding other elements that have any essential importance to the combination. Thus, a composition consisting essentially of the elements defined herein does not exclude trace contaminants and pharmaceutically acceptable carriers, e.g., phosphate-buffered saline, preservatives, etc., from isolation and purification methods. "Contains" shall mean excluding anything beyond trace elements of other components for administering the composition provided and / or claimed in this disclosure, and substantial method steps. Embodiments defined by each of these transitional terms are within the scope of this disclosure.

[0037] A "control" is a substitute subject or sample used for comparison purposes in an experiment. A control can be "positive" or "negative."

[0038] Nucleic acids are chemical compounds that function as primary signaling molecules in cells and constitute the cellular genetic material. Nucleic acids include nucleotides, which are monomers composed of a five-carbon sugar (usually ribose or deoxyribose), a phosphate group, and a nitrogenous base. Nucleic acids can also be deoxyribonucleic acid (DNA) or ribonucleic acid (RNA). Chimeric nucleic acids consist of two or more nucleic acids of the same type that fuse together to form a single compound containing genetic material.

[0039] When applied to polynucleotide sequences, the terms “percent identity” and “% identity” refer to the percentage of residue matches between at least two polynucleotide sequences aligned using a standard algorithm. Such algorithms may optimize the alignment between two sequences by inserting gaps in the sequences being compared in a standard, reproducible manner, thereby achieving a more meaningful comparison of the two sequences. Percent identity for nucleic acid sequences may be determined as understood in the art. (See, for example, U.S. Patent No. 7,396,664, which is incorporated herein by reference in its entirety.) A set of commonly used and freely available sequence comparison algorithms is provided by the National Center for Biotechnology Information (NCBI) Basic Local Alignment Search Tool (BLAST) (Altschul, SF et al. (1990) J.Mol. Biol. 215:403 410), which is available on the websites of several sources, including NCBI, Bethesda, Md. The BLAST software suite includes various sequence analysis programs, including "blastn," which is used to align known polynucleotide sequences with other polynucleotide sequences from various databases. A tool called "BLAST 2 Sequences" is also available, used for direct pairwise comparison of two nucleotide sequences. "BLAST 2 Sequences" is interactively accessible and usable on the NCBI website. The "BLAST 2 Sequences" tool can be used for both blastn and blastp (discussed above).

[0040] Percentage identity may be measured over the length of the entire defined polynucleotide sequence, or over a shorter length, for example, over the length of a fragment taken from a larger defined sequence, e.g., a fragment of at least 20, at least 30, at least 40, at least 50, at least 70, at least 100, or at least 200 consecutive nucleotides. Such lengths are illustrative only, and it should be understood that any fragment length may be used to describe the length over which percentage identity may be measured.

[0041] A "full-length" polynucleotide sequence contains at least a translation start codon (e.g., methionine), followed by an open reading frame and a translation stop codon. A "full-length" polynucleotide sequence encodes a "full-length" polypeptide sequence.

[0042] The term "amino acid" includes, but is not limited to, the amino acids contained within the group consisting of alanine (Ala or A), cysteine ​​(Cys or C), aspartic acid (Asp or D), glutamic acid (Glu or E), phenylalanine (Phe or F), glycine (Gly or G), histidine (His or H), isoleucine (Ile or I), lysine (Lys or K), leucine (Leu or L), methionine (Met or M), asparagine (Asn or N), proline (Pro or P), glutamine (Gln or Q), arginine (Arg or R), serine (Ser or S), threonine (Thr or T), valine (Val or V), tryptophan (Trp or W), and tyrosine (Tyr or Y) residues. The term "amino acid residue" may also include amino acid residues contained within the group consisting of homocysteine, 2-aminoadipic acid, N-ethylasparagine, 3-aminoadipic acid, hydroxylysine, β-alanine, β-aminopropionic acid, allohydroxylysine, 2-aminobutyric acid, 3-hydroxyproline, 4-aminobutyric acid, 4-hydroxyproline, piperidine acid, 6-aminocaproic acid, isodesmosine, 2-aminoheptanoic acid, alloisoleucine, 2-aminoisobutyric acid, N-methylglycine, sarcosine, 3-aminoisobutyric acid, N-methylisoleucine, 2-aminopimelic acid, 6-N-methyllysine, 2,4-diaminobutyric acid, N-methylvaline, desmosine, norvaline, 2,2'-diaminopimelic acid, norleucine, 2,3-diaminopropionic acid, ornithine, and N-ethylglycine. Typically, peptide amide links are formed from an amino group on the backbone of one amino acid and a carboxyl group on the backbone of another amino acid.

[0043] Furthermore, peptides, polypeptides, proteins, and compositions comprising peptides, polypeptides, and proteins are referred to herein. As used herein, polypeptides and / or proteins are defined as polymers of amino acids, typically having a length of 100 or more amino acids (Garrett & Grisham, Biochemistry, 2nd edition, 1999, Brooks / Cole, 110). Peptides are defined as short polymers of amino acids, typically having a length of 20 or fewer amino acids, more typically 12 or fewer amino acids (Garrett & Grisham, Biochemistry, 2nd edition, 1999, Brooks / Cole, 110).

[0044] When applied to polypeptide sequences, the terms “percent identity” and “% identity” refer to the percentage of residue matches between at least two polypeptide sequences aligned using standard algorithms. Methods for polypeptide sequence alignment are well known. Some alignment methods take into account conserved amino acid substitutions. Such conserved substitutions, described in more detail above, generally preserve the charge and hydrophobicity at the site of substitution, and thus preserve the structure (and therefore the function) of the polypeptide. Percent identity for amino acid sequences may be determined as understood in the art. (See, for example, U.S. Patent No. 7,396,664, which is incorporated herein by reference in its entirety.) A commonly used and freely available set of sequence comparison algorithms is provided by the National Center for Biotechnology Information (NCBI) Basic Local Alignment Search Tool (BLAST) (Altschul, SF et al. (1990) J.Mol.Biol.215:403 410), which is available on the website of several sources, including NCBI, Bethesda, Md. The BLAST software suite includes various sequence analysis programs, including "blastp," which is used to align known amino acid sequences with other amino acid sequences from various databases.

[0045] Percent identity may be measured over the entire length of the defined polypeptide sequence, or over a shorter length, for example, over the length of a fragment taken from a larger defined polypeptide sequence, e.g., a fragment of at least 15, at least 20, at least 30, at least 40, at least 50, at least 70, or at least 150 consecutive residues. Such lengths are illustrative only, and it should be understood that any fragment length may be used to describe a length over which percentage identity may be measured.

[0046] The term “variant” means a polypeptide derived from a parent polypeptide by one or more changes at one or more positions, i.e., substitution, insertion, and / or deletion. Substitution means replacing an amino acid occupying a position with a different amino acid; deletion means removing an amino acid occupying a position; and insertion means adding one or more amino acids, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, preferably 1 to 3, immediately adjacent to the amino acid occupying the position. With respect to substitution, “immediately adjacent” can be on the N side (“upstream”) or C side (“downstream”) of the amino acid occupying the position (“named amino acid”). Thus, for an amino acid named / numbered “X”, the insertion may be at position “X+1” (“downstream”) or position “X-1” (“upstream”).

[0047] A “variant” of a particular polypeptide sequence may be defined using blastp in the “BLAST 2 Sequences” tool, available on the National Center for Biotechnology Information website, as a polypeptide sequence that has at least 50% sequence identity with a particular polypeptide sequence over a certain length of one of the polypeptide sequences. (See Tatiana A. Tatusova, Thomas L. Madden (1999), “Blast 2 sequences—a new tool for comparing protein and nucleotide sequences”, FEMS Microbiol Lett. 174:247-250). In some embodiments, the variant polypeptide is over a certain defined length relative to the reference polypeptide, e.g., SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, or SEQ ID NO: 44, for example, at least Both may exhibit sequence identity of 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, or higher.

[0048] Variant polypeptides may have substantially the same functional activity as reference polypeptides. For example, variant polypeptides may exhibit more biological activity related to ligand binding and / or DNA binding at specific binding sites.

[0049] The “effective dose” of a drug refers to the amount of drug sufficient to provide the desired effect. The “effective” amount of drug will vary from subject to subject, depending on many factors such as the subject’s age and general condition, and the specific drug. Therefore, it is not always possible to specify a quantifiable “effective dose.” However, the appropriate “effective dose” for any subject may be determined by those skilled in the art using routine experiments. Also, as used herein, unless otherwise specifically stated, the “effective dose” of a drug may also refer to an amount that covers both the therapeutic effective dose and the prophylactic effective dose. The “effective dose” of a drug required to achieve a therapeutic effect may vary depending on factors such as the subject’s age, sex, and weight. The drug regimen may be adjusted to provide the optimal therapeutic response. For example, the dose may be divided into several doses and administered daily, or the dose may be reduced proportionally as indicated by the urgency of the treatment situation.

[0050] A “pharmaceutically acceptable” component can mean a component that is not biologically or otherwise undesirable, i.e., a component may be incorporated into a pharmaceutical formulation provided herein and administered to a subject as described herein, without causing a significant undesirable biological effect or interacting in an adverse manner with any of the other components of the formulation containing the component. When used in reference to administration to humans, this term generally means that the component meets the required standards for toxicity and manufacturing testing or is included in the Inactive Ingredients Guide prepared by the U.S. Food and Drug Administration.

[0051] "Pharmacopoeia-acceptable carrier" (often referred to as "carrier") means a carrier or excipient that is generally safe and non-toxic and useful in the preparation of pharmaceutical or therapeutic compositions, and includes carriers that are acceptable for veterinary and / or human pharmaceutical or therapeutic use. The term "carrier" or "pharmacopoeia-acceptable carrier" may include, but is not limited to, phosphate-buffered saline, water, emulsions (such as oil / water or water / oil emulsions), and / or various types of wetting agents. As used herein, the term "carrier" includes, but is not limited to, any excipient, diluent, filler, salt, buffer, stabilizer, solubilizer, lipid, stabilizer, or material well known in the art for use in pharmaceutical formulations, and materials further described herein.

[0052] In the case of a "pharmacologically active" derivative or analogue, "pharmacologically active" (or simply "active") may mean that the derivative or analogue (e.g., salt, ester, amide, conjugate, metabolite, isomer, fragment, etc.) has the same type of pharmacological activity as the parent compound and is approximately equivalent in degree.

[0053] "Therapeutic agent" refers to any composition having beneficial biological effects. Beneficial biological effects include both therapeutic effects, e.g., treatment of disorders or other undesirable physiological conditions, and preventive effects, e.g., prevention of disorders or other undesirable physiological conditions (e.g., non-immunogenic cancers). These terms also encompass, but are not limited to, pharmaceutically acceptable, pharmacologically active derivatives of beneficial agents specifically referred to herein, including salts, esters, amides, precursors, active metabolites, isomers, fragments, analogs, etc. When the term "therapeutic agent" is used, or when a particular agent is specifically identified, it should be understood that this term includes the agent itself, as well as pharmaceutically acceptable, pharmacologically active salts, esters, amides, precursors, conjugates, active metabolites, isomers, fragments, analogs, etc.

[0054] The “therapeutic effective amount” or “therapeutic effective dose” of a composition (e.g., a composition containing a drug) refers to the amount effective in achieving a desired therapeutic outcome. In some embodiments, the desired therapeutic outcome is the control of a neurological disorder or disability. A given therapeutic effective amount of a therapeutic agent will typically vary with respect to the type and severity of the disorder or disease being treated, as well as factors such as the age, sex, and weight of the subject. The term can also refer to the amount of a therapeutic agent, or the rate of delivery of the therapeutic agent (e.g., amount over time), that is effective in promoting a desired therapeutic effect, such as pain relief. The exact desired therapeutic effect will vary according to the condition being treated, the subject's tolerance, the drug and / or drug formulation being administered (e.g., the potency of the therapeutic agent, the concentration of the drug in the formulation, etc.), as well as various other factors understood by those skilled in the art. In some cases, the desired biological or medical response may be achieved after multiple administrations of the composition over several days, weeks, or years.

[0055] Methods to prevent vector hepatotropy Obesity and body fat distribution are important risk factors for type II diabetes, fatty liver, and other metabolic syndromes. Visceral adipose tissue (VAT) plays a unique role in metabolic homeostasis and impairment. Obesity characterized by increased VAT is strongly associated with adverse metabolic outcomes, while subcutaneous fat accumulation is thought to have neutral or even beneficial effects on metabolism. This is related to intrinsic functional differences in adipocytes in different depots, which include insulin sensitivity, glucose uptake, rate of lipolysis, and adipokin and cytokine secretion.

[0056] Several compositions and methods exist that can be used to deliver nucleic acids to cells, either in vitro or in vivo. These methods and compositions can be broadly classified into two classes: virus-based delivery systems and non-virus-based delivery systems. For example, nucleic acids can be delivered through several direct delivery systems such as electroporation, lipofection, calcium phosphate precipitation, plasmids, viral vectors, viral nucleic acids, phage nucleic acids, phages, and cosmids, or through the transfer of genetic material in cells or carriers, such as cationic liposomes.

[0057] Adeno-associated virus (AAV) vectors are the mainstream delivery platform in gene therapy due to their safety profile and promising results in clinical trials. Today, AAV vectors are being utilized in at least 176 clinical trials (Phase I, II, and III). AAV has been successfully used to deliver transgenes to the liver, heart, skeletal muscle, brain, and eyes. However, the use of AAV-mediated gene transfer into adipose tissue is limited due to the low transduction efficiency of naturally occurring AAV serotypes. The challenge of the lack of an efficient AAV platform for adipose gene delivery can be overcome by manipulating the viral capsid through DNA shuffling and specific point mutations. Our previous research demonstrates that, among the family of manipulated hybrid capsid serotypes (Rec1-4), the Rec2 capsid serotype transduces adipose tissue with far greater efficiency than naturally occurring AAV serotypes. One point to note is that the Rec2 capsid vector also efficiently transduces the liver via intravenous or intraperitoneal administration. In the current study, in order to generate a new serotype with enhanced lipotropy while eliminating hepatotropy, the inventors made several mutations in the Rec2 capsid by analyzing the amino acid sequences of the capsids of AAV9, AAV8, Rec2, Rec3, and AAV2. Eight capsid variants (named LC.V1, 2, 3, 4, 5, 6, 7, and 8) have been generated, packaged, and tested in vivo. Rec2 variant 7 showed the greatest tropism to adipose tissue and no tropism to liver tissue. In contrast, Rec2 variants V2, V4, V5, and V6 all showed significant tropism to liver tissue in addition to tropism to adipose tissue. Variant 8 showed no tropism to adipose tissue or liver tissue.

[0058] composition Components for use in preparing the disclosed compositions, and the compositions themselves for use in the methods disclosed herein, are disclosed. When these and other materials are disclosed herein, and combinations, subsets, interactions, groups, etc., of these materials are disclosed, specific references to each of the various individual and collective combinations and sortings of these compounds may not be expressly disclosed, but it is understood that each is specifically intended and described herein. For example, when a particular engineered adeno-associated virus capsid or vector is disclosed and considered, and several modifications that can be made to several molecules containing the engineered adeno-associated virus capsid or vector are considered, all combinations and sortings of the engineered adeno-associated virus capsid or vector and each possible modification are expressly intended unless expressly directed to the contrary. Therefore, if classes A, B, and C are disclosed, and classes D, E, and F, as well as examples of combined molecules A-D, are disclosed, even if each is not described individually, each is intended individually and collectively, meaning that combinations of A-E, A-F, B-D, B-E, B-F, C-D, C-E, and C-F are considered disclosed. Similarly, any subset or combination of these is also disclosed. Thus, for example, the subgroups AE, BF, and CE would be considered disclosed. This concept applies to all aspects of this application, including but not limited to steps in methods for preparing and using the disclosed compositions. Thus, where various additional steps that can be implemented exist, it is understood that each of these additional steps can be implemented in any particular embodiment or combination of embodiments of the disclosed method.

[0059] In one embodiment, an engineered AAV capsid protein is disclosed herein, wherein one or more amino acid substitutions occur at residues that promote intrahepatic AAV degradation, eliminate hepatotropy, and / or disrupt AAV binding to hepatocytes.

[0060] In one embodiment, an engineered adeno-associated virus (AAV) capsid protein is disclosed herein, which includes, but is not limited to, an engineered AAV capsid protein in which one or more amino acid substitutions correspond to residues 503, 708, and / or 709 of SEQ ID NO: 1 or SEQ ID NO: 6, or any combination thereof, and includes, but is not limited to, an engineered AAV capsid protein in which one or more amino acid substitutions correspond to residues 501, 713, and / or 714 of SEQ ID NO: 31. The disclosed engineered AAV capsid protein may include variants of SEQ ID NO: 1, SEQ ID NO: 6, or SEQ ID NO: 31, provided, however, that the variant also includes, but is not limited to, an amino acid substitution in which one or more amino acid substitutions correspond to residues 503, 708, and / or 709 of SEQ ID NO: 1 or SEQ ID NO: 6, or any combination thereof, and includes, but is not limited to, an amino acid substitution in which one or more amino acid substitutions correspond to residues 501, 713, and / or 714 of SEQ ID NO: 31.

[0061] A “variant” of a particular polypeptide sequence may be defined using blastp in the “BLAST 2 Sequences” tool, available on the National Center for Biotechnology Information website, as a polypeptide sequence that has at least 50% sequence identity with a particular polypeptide sequence over a certain length of one of the polypeptide sequences. (See Tatiana A. Tatusova, Thomas L. Madden (1999), “Blast 2 sequences—a new tool for comparing protein and nucleotide sequences”, FEMS Microbiol Lett. 174:247-250). In some embodiments, a variant polypeptide may exhibit, for example, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, or more sequence identity with respect to a reference polypeptide, e.g., sequence number 1, sequence number 6, and sequence number 31, over a certain defined length.

[0062] As used herein, an amino acid residue is described as corresponding to or equivalent to another residue when it occupies the same position in a sequence alignment. For example, as shown in the sequence alignment below, residues 501, 713, and 714 of SEQ ID NO: 31 correspond to (i.e., are equivalent to) residues 503, 708, and 709 of SEQ ID NO: 1 and SEQ ID NO: 6. CLUSTAL O(1.2.4) Multiple Sequence Alignment

[0063] [ka]

[0064]

change

[0065]

change

[0066]

change

[0067]

change

[0068]

change

[0069]

change

[0070]

change

[0071]

change

[0072]

change

[0073]

change

[0074] [ka]

[0075] [ka]

[0076] In one embodiment, the amino acid substitutions include F503Y, F503T, F503K, Y708D, Y708E, K709I, K709L, and / or K709G for SEQ ID NO: 1 or SEQ ID NO: 6, or any combination thereof. In one embodiment, the amino acid substitutions include F501Y, Y713D, and / or K714I, or any combination thereof for SEQ ID NO: 31. For example, in one embodiment, an engineered AAV capsid protein in which the substitutions include F503Y, Y708D, and / or K709I. In some embodiments, the vector does not transduce liver tissue. For example, in one embodiment, the manipulated AAV capsid protein contains the sequence described in SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, or SEQ ID NO: 44. In one embodiment, the AAV capsid protein may contain recombinant 2 (Rec2), AAV8, or AAV9 capsid protein.

[0077] Also disclosed herein are engineered AAV capsid proteins in which one or more amino acid substitutions are encoded by nucleic acid substitutions corresponding to positions 1508, 2127, 2124, or any combination thereof in SEQ ID NO: 2 or SEQ ID NO: 5.

[0078] In one embodiment, a vector comprising any of the manipulated AAV capsid proteins disclosed herein is disclosed herein. In particular, an adeno-associated virus (AAV) recombinant 2 (Rec2), AAV8, or AAV9 vector is disclosed herein. AAV Rec2, AAV8, or AAV9 vectors are disclosed herein, which include a capsid protein, the capsid protein containing one or more amino acid substitutions that reduce hepatotropy (e.g., nucleic acid substitutions at positions 1508, 2124, and / or 2127 of SEQ ID NO: 2 or SEQ ID NO: 5, the nucleic acid substitutions resulting in substitutions at residues 503, 708, and / or 709 (or, for AAV9, equivalent residues 501, 713, and / or 714), the substitutions including, but not limited to, F503Y, F503T, F503X, Y708D, Y708E, K709I, K709L, and / or K709G substitutions for Rec2 and AAV8, and including, but not limited to, F501Y, Y713D, and / or K714I for AAV9). For example, in one embodiment, the manipulated AAV vector capsid protein contains substitutions F503Y, Y708D, and / or K709I. In some embodiments, the vector does not transduce liver tissue. For example, in one embodiment, the manipulated AAV capsid protein contains the sequence described in SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, or SEQ ID NO: 44.

[0079] In one embodiment, an AAV capsid protein or a vector comprising said capsid protein is disclosed herein, wherein one or more amino acid substitutions occur at residues that promote intrahepatic AAV degradation or disrupt AAV binding to hepatocytes.

[0080] Also disclosed herein are engineered AAV vectors further comprising a transgene (e.g., leptin gene, IL-15 gene, IL-15 / IL-15R complex gene, FGF21 gene, adiponectin gene, therapeutic gene linking leptin and adiponectin by a 2A sequence, or synthetic microRNA targeting leptin). In some embodiments, the vector does not transduce into liver tissue.

[0081] In some embodiments, the transgene can be operably ligated to a promoter or tissue-specific promoter operably ligated to an RNA silencing element.

[0082] As used herein, plasmids or viral vectors are agents that transport a nucleic acid of interest, such as leptin or IL-15, into a cell without degradation, and contain a promoter that brings about the expression of the gene in the cell to which it is delivered. Viral vectors include, for example, adenoviruses, adeno-associated viruses, herpesviruses, vaccinia viruses, polioviruses, AIDS viruses, neurotrophic viruses, Sindbis virus, and other RNA viruses, including these viruses with an HIV backbone. Virus families that share the properties of these viruses and are suitable for use as vectors are also preferred. Retroviruses include mouse Maloney's leukemia virus, MMLV, and retroviruses that express the desired properties of MMLV as vectors. Retroviral vectors are commonly used because they can carry larger gene payloads, i.e., transgenes or marker genes, than other viral vectors. However, they are less useful in non-proliferating cells. Adenovirus vectors are relatively stable, easy to handle, have high titers, can be delivered in aerosol formulations, and can be transfected into non-dividing cells. Poxvirus vectors are large, have several sites for gene insertion, are heat-stable, and can be stored at room temperature.

[0083] Viral vectors can have a higher delivery capability than chemical or physical methods for introducing genes into cells. Typically, viral vectors contain a non-structural early gene, a structural late gene, an RNA polymerase III transcript, reverse terminal repeats necessary for replication and capsidation, and a promoter that controls transcription and replication of the viral genome. When designed as a vector, a virus usually has one or more early genes removed, and a gene or gene / promoter cassette is inserted into the viral genome in place of the removed viral DNA. This type of structure can carry up to approximately 8kb of foreign genetic material. The required function of the removed early gene is usually supplied by a cell line designed to express the gene product of the early gene in trans.

[0084] Another type of viral vector is based on adeno-associated virus (AAV). This defective parvovirus is a preferred vector because it can infect many cell types and is nonpathogenic to humans. AAV-type vectors can transport approximately 4–5 kb, and wild-type AAV is known to stably insert into chromosome 19. Vectors containing this site-specific insertion property are preferred. A particularly preferred embodiment of this type of vector is the P4.1C vector manufactured by Avigen (San Francisco, CA), which may contain the herpes simplex virus thymidine kinase gene, HSV-tk, and / or a marker gene, such as the gene encoding green fluorescent protein (GFP).

[0085] In other types of AAV viruses, AAV has a pair of reverse terminal repeats (ITRs) adjacent to at least one cassette containing a promoter that induces cell-specific expression ligated to heterologous genes. In this context, heterologous refers to any nucleotide sequence or gene that is not native to AAV or B19 parvovirus.

[0086] Typically, deletion of the AAV and B19 coding regions yields a safe, cytotoxic vector. AAV ITR, or modifications thereof, confer infectivity and site-specific embedding ability without cytotoxicity, and the promoter induces cell-specific expression. U.S. Patent No. 6,261,834 is incorporated herein by reference to materials related to AAV vectors.

[0087] Disclosed herein is a novel engineered hybrid serotype Rec2 vector that, when directly injected into adipose pads at doses one to two orders of magnitude lower than those previously reported in studies, results in superior transduction of adipose tissue compared to naturally occurring serotypes (AAV1 and AAV8) and other engineered serotypes (Rec1, Rec3, Rec4). Interestingly, the route of administration substantially affects the tropism and efficacy of the Rec2 vector. Intravenous administration of the Rec2 vector primarily targets the liver, at 2 × 10⁶ per mouse. 9 ~2×10 10 Transduction is performed at doses in the vg range. In contrast, oral administration of the Rec2 vector results in preferential transduction of brown fat, with the absence of transduction in the gastrointestinal track, at 2 × 10⁶ mice. 10This is achieved at doses of less than vg. To improve gene delivery to VAT, it was first determined whether the Rec2 vector could efficiently transduce VAT via IP administration, a simpler, less invasive procedure. Accordingly, in one embodiment, a method is disclosed herein for a nucleic acid-based therapy to target visceral adipose tissue in a subject, comprising administering to the subject one of the engineered adeno-associated virus (AAV) vectors disclosed herein (e.g., the disclosed Rec2 vector). For example, a method is disclosed herein for a nucleic acid-based therapy to target visceral adipose tissue in a subject, comprising administering to the subject an engineered adeno-associated virus (AAV) vector, wherein the engineered AAV vector comprises two expression cassettes, the first cassette comprising a regulatory element and a leptin transgene or IL-15 transgene operably linked to a promoter, and the AAV vector is administered intraperitoneally.

[0088] To prevent transgene expression in tissues, a novel AAV expression plasmid was generated. This novel AAV expression plasmid contained two expression cassettes: one containing the transgene (e.g., leptin, adiponectin, or IL-15), and the other cassette used a tissue-specific promoter to drive specific RNA silencing elements (e.g., microRNAs including, but not limited to, smRNA, shRNA, RNAi, siRNA, and / or piRNA) that targeted regulatory element sequences (e.g., WPRE) present only in the transgene expression cassette.

[0089] The inserted gene in viruses and retroviruses typically contains a promoter and / or enhancer (e.g., chicken β-actin (CBA) promoter) to help control the expression of the desired gene product. A promoter is generally a DNA sequence that functions when it is fixed relative to the transcription start site. A promoter may contain core elements necessary for the fundamental interaction between RNA polymerase and transcription factors, and may also contain upstream and response elements.

[0090] Preferred promoters for controlling transcription from vectors in mammalian host cells may be obtained from a variety of sources, e.g., viruses, e.g., polyomas, monkey virus 40 (SV40), adenoviruses, retroviruses, hepatitis B viruses, most preferably cytomegalovirus genomes, or from heterologous mammalian promoters, e.g., □-actin promoters, e.g., chicken □-actin promoters. Early and late promoters of SV40 virus can be conveniently obtained as SV40 restriction fragments that also contain the SV40 virus replication origin (Fiers et al., Nature, 273:113 (1978)). The earliest promoter of human cytomegalovirus can be conveniently obtained as HindIII E restriction fragment (Greenway, PJ et al., Gene 18:355-360 (1982)). Naturally, promoters from host cells or related species are also useful herein. Accordingly, in one embodiment, an engineered adeno-associated virus (AAV) vector is disclosed herein, wherein the engineered AAV vector comprises two expression cassettes, the first cassette comprising a regulatory element and a transgene operably ligated to a promoter (e.g., a chicken □-actin promoter), and the second cassette comprising tissue-specific and microRNAs (e.g., smRNA, shRNA, RNAi, siRNA, and / or piRNA) that target the regulatory element in the first expression cassette.

[0091] Enhancers generally refer to DNA sequences that function even if they are not a certain distance from the transcription start site and can be either 5' (Laimins, L. et al., Proc. Natl. Acad. Sci. 78:993 (1981)) or 3' (Lusky, ML, et al., Mol. Cell Bio. 3:1108 (1983)) relative to the transcription unit. Furthermore, enhancers can be located within introns (Banerji, J. Let al., Cell 33:729 (1983)) or within the coding sequence itself (Osborne, TF, et al., Mol. Cell Bio. 4:1293 (1984)). They are typically 10–300 bp in length and function in cis. Enhancers function to increase transcription from nearby promoters. Enhancers also often contain response elements that mediate the regulation of transcription. Promoters can also contain response elements that mediate transcriptional regulation. Enhancers often determine the regulation of gene expression. Many enhancer sequences are now known from mammalian genes (globin, elastase, albumin, fetoprotein, and insulin), but typically, for gene expression, enhancers derived from eukaryotic viruses will be used for general expression. Preferred examples include the SV40 enhancer (bp100-270) on the late side of the origin of replication, the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the origin of replication, and the adenovirus enhancer.

[0092] Promoters and / or enhancers may be specifically activated by either light or a specific chemical event that triggers their function. The system can be modified with reagents such as tetracycline and dexamethasone. There are also methods to enhance gene expression in viral vectors by exposure to irradiation, such as gamma irradiation, or by alkylating chemotherapeutic agents.

[0093] In certain embodiments, the promoter and / or enhancer region can act as a constitutive promoter and / or enhancer to maximize the expression of the region of the transcription unit being transcribed. In certain constructs, the promoter and / or enhancer region is active in all eukaryotic cell types, even if it is expressed only in specific types of cells at specific times. A preferred promoter of this type is the CMV promoter (650 base pairs). Other preferred promoters include the SV40 promoter, cytomegalovirus (full-length promoter), and the LTR of retroviral vectors.

[0094] All specific regulatory elements can be cloned and shown to be used to construct expression vectors that are selectively expressed in specific cell types, such as melanoma cells. The glial fibrillary acetate protein (GFAP) promoter has been used to selectively express genes in glial-derived cells. In the second cassette of the engineered AAV vector disclosed herein, by using a tissue-specific promoter operably linked to an RNA silencing element, the expression of RNA silencing elements (e.g., microRNAs including, but not limited to, smRNA, shRNA, RNAi, siRNA, and / or piRNA) targeting the regulatory elements in the first cassette can be used to restrict off-target transduction of transgenes (e.g., leptin, adiponectin, and / or IL-15). For example, an engineered AAV vector comprising a first expression cassette comprising a first expression cassette comprising a regulatory element (e.g., a woodchuck post-transcriptional regulatory element (WPRE) sequence) and a transgene operably linked to a promoter (e.g., a leptin gene, an IL-15 gene, an IL-15 / IL-15R complex gene, an FGF21 gene, an adiponectin gene, a therapeutic gene linking leptin and adiponectin by a 2A sequence, or a synthetic microRNA targeting leptin) and a second expression cassette comprising a tissue-specific promoter An engineered AAV vector is disclosed herein, further comprising an expression cassette and a second cassette, wherein the first cassette comprises a regulatory element and a transgene (e.g., leptin, adiponectin, and / or IL-15) operably linked to a promoter (e.g., CBA), and the second cassette comprises a tissue-specific promoter and an RNA silencing element (e.g., microRNAs including, but not limited to, smRNA, shRNA, RNAi, siRNA, and / or piRNA) that targets the regulatory element in the first expression cassette.The tissue-specific promoter in the second cassette is operably ligated to the RNA silencing element, thereby ensuring, as intended herein, that transcription of the RNA silencing element occurs only when it is in a suitable tissue for the tissue-specific promoter. Accordingly, in one embodiment, a method for expressing a transgene in a VAT while restricting off-target transduction of the transgene is disclosed herein, the method comprising administering to a subject an engineered adeno-associated virus (AAV) vector, the engineered AAV vector comprising two expression cassettes, the first cassette comprising a regulatory element and a transgene (e.g., leptin, adiponectin, and / or IL-15) operably ligated to a promoter (e.g., CBA), and the second cassette comprising a tissue-specific promoter and an RNA silencing element (e.g., microRNA including, but not limited to, smRNA, shRNA, RNAi, siRNA, and / or piRNA) targeting the regulatory element in the first expression cassette, the RNA silencing element being operably ligated to the tissue-specific promoter.

[0095] Expression vectors used in eukaryotic host cells (yeast, fungi, insects, plants, animals, humans, or nucleated cells) may also contain sequences necessary for transcription termination that can affect mRNA expression. These regions are transcribed as polyadenylated segments in the untranslated portion of mRNA encoding tissue factor proteins. The 3' untranslated region also includes the transcription termination site. It is preferable that the transcription unit also contains the polyadenylated region. One advantage of this region is that it increases the likelihood that the transcription unit will be processed and transported like mRNA. The identification and use of polyadenylated signals in expression constructs are well established. It is preferable that homologous polyadenylated signals are used in the transgene construct. In a particular transcription unit, the polyadenylated region is derived from the SV40 initial polyadenylated signal and consists of approximately 400 bases. It is also preferable that the transcription unit contains other standard sequences, either alone or in combination with the above sequences, that improve expression or stability from the construct.

[0096] Viral vectors can contain nucleic acid sequences that encode marker products. These marker products are used to determine whether a gene is delivered to a cell and, upon delivery, expressed. Preferred marker genes are the E. coli lacZ gene (encoding β-galactosidase) and green fluorescent protein.

[0097] In some embodiments, the marker can be a selectable marker. Examples of selectable markers suitable for mammalian cells include dihydrofolate reductase (DHFR), thymidine kinase, neomycin, neomycin analog G418, hydromycin, and puromycin. Once such a selectable marker is successfully transferred to mammalian host cells, the transformed mammalian host cells can survive under selective pressure. There are two distinct categories of selective regimes that are widely used. The first category is based on the use of mutant cell lines that lack cellular metabolism and the ability to grow independently of supplemental medium. Two examples are CHO DHFR-cells and mouse LTK-cells. These cells lack the ability to grow without the addition of nutrients such as thymidine or hypoxanthine. These cells lack certain genes necessary for the complete nucleotide synthesis pathway and therefore cannot survive unless the missing nucleotides are provided in supplemental medium. An alternative method for supplementing the culture medium is to alter the growth requirements of cells lacking the respective genes by introducing intact DHFR or TK genes. Individual cells that are not transformed with the DHFR or TK genes will not be able to survive in unsupplemented medium.

[0098] The second category refers to selection schemes used in any cell type and are dominant selections that do not require the use of mutant cell lines. These schemes typically use drugs to halt the growth of host cells. Those cells with novel genes will express proteins that transmit drug resistance and will survive selection. Examples of such dominant selections use the drugs neomycin (Southern P. and Berg, P., J. Molec. Appl. Genet. 1:327 (1982)), mycophenolic acid (Mulligan, R. and Berg, P. Science 209:1422 (1980)), or hygromycin (Sugden, B. et al. Mol. Cell. Biol. 5:410-413 (1985)). Three examples use bacterial genes under eukaryotic control to transmit resistance to the appropriate drugs, G418 or neomycin (genethecin), xgpt (mycophenolic acid), or hygromycin, respectively. Other compounds include neomycin analog G418 and puramycin.

[0099] In one embodiment, the disclosed AAV vector may also include a regulatory element (e.g., a woodchuck post-transcriptional regulatory element (WPRE)) which is not endogenously found in the host and is present only in the first cassette. The regulatory element may be operably ligated to a promoter and / or transgene in the first cassette, thereby turning off the expression of the transgene by disrupting the regulatory element (e.g., via the use of microRNAs including, but not limited to, smRNA, shRNA, RNAi, siRNA, and / or piRNA). In one embodiment, the disruption of the regulatory element may be mediated via an RNA silencing element (e.g., a microRNA including, but not limited to, smRNA, shRNA, RNAi, siRNA, and / or piRNA) that is specific to the regulatory element. By ligating the RNA silencing element to a tissue-specific promoter, the expression of the transgene can be prevented from occurring in tissues where the expression of the transgene is detrimental. Accordingly, in one embodiment, an engineered adeno-associated virus (AAV) vector is disclosed herein, wherein the engineered AAV vector comprises two expression cassettes, the first cassette comprising a regulatory element (e.g., WPRE) and a transgene (e.g., leptin, adiponectin, and / or IL-15) operably ligated to a promoter (e.g., chicken β-actin promoter), and the second cassette comprising a tissue-specific promoter and an RNA silencing element (e.g., microRNA including, but not limited to, smRNA, shRNA, RNAi, siRNA, and / or piRNA) that targets the regulatory element in the first expression cassette (see, for example, Figure 2A), the RNA silencing element being operably ligated to the tissue-specific promoter.

[0100] homology / identity It should be understood that one way of defining any known variants and derivatives or possible variants of the genes and proteins disclosed herein is by defining variants and derivatives in terms of homology to a particular known sequence. Specifically, variants of these and other genes and proteins disclosed herein that have at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, and 99.9 percent sequence identity with the described sequence are disclosed. How homology / sequence identity of two proteins or nucleic acids, for example, genes, is determined will be readily understood by those skilled in the art. For example, homology can be calculated after sorting two sequences so that they have the highest level of homology.

[0101] Another method for calculating homology can be performed using publicly available algorithms. Optimal alignment of sequences for comparison may be performed using the local homology algorithm of Smith and Waterman Adv.Appl.Math.2:482(1981), the homology alignment algorithm of Needleman and Wunsch, J.MoL Biol.48:443(1970), the similarity search method of Pearson and Lipman, Proc.Natl.Acad.Sci.USA85:2444(1988), computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA at Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI), or by inspection.

[0102] For example, the same kind of homology can be obtained for nucleic acids by algorithms disclosed in Zuker, M. Science 244:48-52, 1989, Jaeger et al. Proc. Natl. Acad. Sci. USA 86:7706-7710, 1989, and Jaeger et al. Methods Enzymol. 183:281-306, 1989, which are incorporated herein by reference at least for materials related to nucleic acid alignment.

[0103] Delivery of composition to cells Several compositions and methods exist that can be used to deliver nucleic acids to cells, either in vitro or in vivo. These methods and compositions can be broadly classified into two classes: virus-based delivery systems and non-virus-based delivery systems. For example, nucleic acids can be delivered through several direct delivery systems such as electroporation, lipofection, calcium phosphate precipitation, plasmids, viral vectors, viral nucleic acids, phage nucleic acids, phages, and cosmids, or through the transfer of genetic material in cells or carriers, such as cationic liposomes. Suitable means for transfection, including viral vectors, chemical transfectants, or physico-mechanical methods such as electroporation and direct diffusion of DNA, are described, for example, in Wolff, JA, et al., Science, 247, 1465-1468, (1990) and Wolff, JANature, 352, 815-818, (1991). Such methods are well known in the art and are readily adaptable for use with the compositions and methods described herein. In certain cases, this method may be modified to function specifically with large DNA molecules. Furthermore, by using these methods and leveraging the carrier's targeting properties, it may be possible to target specific diseases and cell populations.

[0104] nucleic acid-based delivery systems A transfer vector can be any nucleotide construct used to deliver a gene to a cell (e.g., a plasmid) or as part of a general strategy for gene delivery, such as being used as part of a recombinant retrovirus or adenovirus (Ram et al. Cancer Res. 53:83-88, (1993)).

[0105] As used herein, a viral vector is a drug that delivers a transgene to a cell (e.g., a brain cell) without degradation and includes a promoter that brings the gene to expression within the cell to which it is delivered. In some embodiments, the engineered viral vectors disclosed herein are derived from adeno-associated vectors (AAVs).

[0106] Adeno-associated virus vector Another type of viral vector is based on adeno-associated virus (AAV). This defective parvovirus is a preferred vector because it can infect many cell types and is non-pathogenic to humans. AAV-type vectors can transport approximately 4–5 kb of DNA, and wild-type AAV is known to stably insert into chromosome 19 (e.g., AAV integration site 1 (AAVS1)). In one embodiment, the disclosed AAV vector may contain a gene encoding a selectable marker, such as green fluorescent protein, GFP, or highly sensitive GFP (EGFP).

[0107] In one embodiment, the AAV contains a pair of inverted terminal repeats (ITRs) adjacent to at least one cassette containing a promoter that directs cell-specific expression ligated to a heterologous gene. In this context, heterologous refers to any nucleotide sequence or gene that is not native to the AAV or B19 parvovirus.

[0108] Typically, the AAV and B19 coding regions are deleted, resulting in a safe, non-cytotoxic vector. AAV ITRs (typically derived from AAV2), or modifications thereof, confer infectivity and site-specific integration rather than cytotoxicity, and the promoter directs cell-specific expression. U.S. Patent No. 6,261,834 is incorporated herein by reference to materials related to AAV vectors.

[0109] Therefore, the disclosed vectors are designed to persist in the nucleus as extrachromosomal cells and not integrate into the human genome. This ability to persist without integration enhances the safety of these vectors.

[0110] Inserted genes in viruses and retroviruses typically contain promoters and / or enhancers that help control the expression of the desired gene product. A promoter is generally a DNA sequence that functions when it is fixed relative to the transcription start site. Promoters contain core elements necessary for the fundamental interaction between RNA polymerase and transcription factors, and may also contain upstream and response elements.

[0111] In vivo / Ex vivo As described above, the composition can be administered within a pharmaceutically acceptable carrier and delivered in vivo and / or ex vivo to target cells by various mechanisms known in the art (e.g., naked DNA uptake, liposome fusion, intramuscular injection of DNA via gene gun, endocytosis, etc.).

[0112] When using the ex vivo method, cells or tissues can be removed and maintained outside the body according to standard protocols well known in the art. The composition can be introduced into cells via any gene transfer mechanism, such as calcium phosphate-mediated gene delivery, electroporation, microinjection, or proteoliposomes. Transduced cells can then be injected into the target (e.g., in a pharmaceutically acceptable carrier) or orthotopically transplanted and returned, according to standard methods for the cell or tissue type. Standard methods are known for the transplantation or injection of various cells into the target.

[0113] Expression system Nucleic acids delivered to cells typically contain gene expression regulatory systems. For example, inserted genes in viruses and retroviral systems usually contain promoters and / or enhancers that help control the expression of the desired gene product. A promoter is generally a DNA sequence that functions when it is fixed in a position relative to the transcription start site. Promoters contain core elements necessary for the basic interaction between RNA polymerase and transcription factors, and may contain upstream and response elements.

[0114] Virus promoter and enhancer Preferred promoters for controlling transcription from vectors in mammalian host cells may be obtained from a variety of sources, e.g., viruses, e.g., polyomas, simian virus 40 (SV40), adenoviruses, retroviruses, hepatitis B viruses, most preferably cytomegalovirus genomes, or from heterologous mammalian promoters, e.g., beta-actin promoters. Early and late promoters of SV40 virus are conveniently obtained as SV40 restriction fragments that also contain the SV40 virus replication origin (Fiers et al., Nature, 273:113 (1978)). The earliest promoter of human cytomegalovirus is conveniently obtained as HindIII E restriction fragment (Greenway, PJ et al., Gene 18:355-360 (1982)). Naturally, promoters from host cells or related species are also useful herein.

[0115] Enhancers generally refer to DNA sequences that function even if they are not a certain distance from the transcription start site and can be either 5' (Laimins, L. et al., Proc. Natl. Acad. Sci. 78:993 (1981)) or 3' (Lusky, ML, et al., Mol. Cell Bio. 3:1108 (1983)) relative to the transcription unit. Furthermore, enhancers can be located within introns (Banerji, J. Let al., Cell 33:729 (1983)) or within the coding sequence itself (Osborne, TF, et al., Mol. Cell Bio. 4:1293 (1984)). They are typically 10–300 bp in length and function in cis. Enhancers function to increase transcription from nearby promoters. Enhancers also often contain response elements that mediate the regulation of transcription. Promoters can also contain response elements that mediate transcriptional regulation. Enhancers often determine the regulation of gene expression. Many enhancer sequences are now known from mammalian genes (globin, elastase, albumin, fetoprotein, and insulin), but typically, for gene expression, enhancers derived from eukaryotic viruses will be used for general expression. Preferred examples include the SV40 enhancer (bp100-270) on the late side of the origin of replication, the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the origin of replication, and the adenovirus enhancer.

[0116] Promoters and / or enhancers may be specifically activated by either light or a specific chemical event that triggers their function. The system can be modified with reagents such as tetracycline and dexamethasone. There are also methods to enhance gene expression in viral vectors by exposure to irradiation, such as gamma irradiation, or by alkylating chemotherapeutic agents.

[0117] In certain embodiments, the promoter and / or enhancer region can act as a constitutive promoter and / or enhancer to maximize the expression of the region of the transcription unit being transcribed. In certain constructs, the promoter and / or enhancer region is active in all eukaryotic cell types, even if it is expressed only in specific types of cells at specific times. A preferred promoter of this type is the CMV promoter (650 base pairs). Other preferred promoters include the SV40 promoter, cytomegalovirus (full-length promoter), and the LTR of retroviral vectors.

[0118] All specific regulatory elements can be cloned and used to construct expression vectors that are selectively expressed in specific cell types, such as melanoma cells. The glial fibrillary acetate protein (GFAP) promoter has been used to selectively express genes in glial-derived cells.

[0119] Expression vectors used in eukaryotic host cells (yeast, fungi, insects, plants, animals, humans, or nucleated cells) may also contain sequences necessary for transcription termination that can affect mRNA expression. These regions are transcribed as polyadenylated segments in the untranslated portion of mRNA encoding tissue factor proteins. The 3' untranslated region also includes the transcription termination site. It is preferable that the transcription unit also contains the polyadenylated region. One advantage of this region is that it increases the likelihood that the transcription unit will be processed and transported like mRNA. The identification and use of polyadenylated signals in expression constructs are well established. It is preferable that homologous polyadenylated signals are used in the transgene construct. In a particular transcription unit, the polyadenylated region is derived from the SV40 initial polyadenylated signal and consists of approximately 400 bases. It is also preferable that the transcription unit contains other standard sequences, either alone or in combination with the above sequences, that improve expression or stability from the construct.

[0120] marker Viral vectors can contain nucleic acid sequences that encode marker products. These marker products are used to determine whether a gene is delivered to a cell and, upon delivery, expressed. Preferred marker genes are the E. coli lacZ gene (encoding β-galactosidase) and green fluorescent protein.

[0121] In some embodiments, the marker can be a selectable marker. Examples of selectable markers suitable for mammalian cells include dihydrofolate reductase (DHFR), thymidine kinase, neomycin, neomycin analog G418, hydromycin, and puromycin. Once such a selectable marker is successfully transferred to mammalian host cells, the transformed mammalian host cells can survive under selective pressure. There are two distinct categories of selective regimes that are widely used. The first category is based on the use of mutant cell lines that lack cellular metabolism and the ability to grow independently of supplemental medium. Two examples are CHO DHFR-cells and mouse LTK-cells. These cells lack the ability to grow without the addition of nutrients such as thymidine or hypoxanthine. These cells lack certain genes necessary for the complete nucleotide synthesis pathway and therefore cannot survive unless the missing nucleotides are provided in supplemental medium. An alternative method for supplementing the culture medium is to alter the growth requirements of cells lacking the respective genes by introducing intact DHFR or TK genes. Individual cells that are not transformed with the DHFR or TK genes will not be able to survive in unsupplemented medium.

[0122] The second category refers to selection schemes used in any cell type and are dominant selections that do not require the use of mutant cell lines. These schemes typically use drugs to halt the growth of host cells. Those cells with novel genes will express proteins that transmit drug resistance and will survive selection. Examples of such dominant selections use the drugs neomycin (Southern P. and Berg, P., J. Molec. Appl. Genet. 1:327 (1982)), mycophenolic acid (Mulligan, R. and Berg, P. Science 209:1422 (1980)), or hygromycin (Sugden, B. et al. Mol. Cell. Biol. 5:410-413 (1985)). Three examples use bacterial genes under eukaryotic control to transmit resistance to the appropriate drugs, G418 or neomycin (genethecin), xgpt (mycophenolic acid), or hygromycin, respectively. Other compounds include neomycin analog G418 and puramycin.

[0123] peptide protein variant As discussed herein, numerous variants of the AAV capsid proteins (VP1, VP2, and VP3) are known and intended herein. In addition to the known functional strain variants, derivatives of the AAV capsid proteins also exist that function in the disclosed methods and compositions. Protein variants and derivatives are well understood by those skilled in the art and, in some examples, may involve amino acid sequence modifications. For example, amino acid sequence modifications are typically classified into one or more of three classes: substitution variants, insertion variants, or deletion variants. Insertions include fusions of the amino-terminus and / or carboxyl-terminus, as well as intrasequential insertions of one or more amino acid residues. Insertions are usually smaller than insertions of amino-terminus or carboxyl-terminus fusions, for example, of about 1 to 4 residues. Derivatives of immunogenic fusion proteins, such as those described in the examples, are prepared by fusion of a polypeptide of sufficient size to confer immunogenicity to a target sequence, either by crosslinking in vitro or by recombinant cell cultures transformed with DNA encoding the fusion. A deletion is characterized by the removal of one or more amino acid residues from a protein sequence. Typically, approximately 2 to 6 residues are deleted at any single site within the protein molecule. These variants are usually prepared by site-directed mutagenesis of nucleotides in the protein-coding DNA, thereby producing variant-coding DNA, which is then expressed in recombinant cell cultures. Techniques for producing substitutional mutations at predetermined sites in DNA with known sequences, such as M13 primer mutagenesis and PCR mutagenesis, are well known. Amino acid substitutions are typically single-residue but can occur at several different sites at once, insertions are usually around 1 to 10 amino acid residues, and deletions range from approximately 1 to 30 residues. Deletions or insertions are preferably carried out in adjacent pairs, i.e., deletions or insertions of two residues. Substitutions, deletions, insertions, or any combination thereof can be combined to arrive at the final construct.Mutations must not cause the sequence to deviate from the reading frame and, preferably, do not generate a complementary region capable of producing a secondary mRNA structure. A substitutional variant is one in which at least one residue is removed and a different residue is inserted in its place. Such substitutions are generally made according to Tables 1 and 2 below and are referred to as conservative substitutions.

[0124] Substantial changes in functional or immunological identity are made by selecting substitutions that are less conserved than those shown in Table 2, i.e., by selecting residues that are more significantly different in (a) the structure of the polypeptide backbone in the region of substitution, e.g., as a sheet or helical structure, (b) the molecular charge or hydrophobicity at the target site, or (c) the effect on maintaining the bulk of the side chain. Substitutions that are generally expected to bring about the greatest changes in protein properties are (a) a hydrophilic residue, e.g., ceryl or threonyl, being replaced by (or thereby) a hydrophobic residue, e.g., leucyl, isoleucyl, phenylalanyl, valyl, or alanyl; (b) cysteine ​​or proline being replaced by (or thereby) any other residue; (c) a residue with an electropositive side chain, e.g., lysyl, arginyl, or histidyl, being replaced by (or thereby) an electronegative residue, e.g., glutamyl or aspar; or (d) a residue with a bulky side chain, e.g., phenylanine, being replaced by a residue without a side chain, e.g., glycine in this case; or (e) an increase in the number of sites for sulfylation and / or glycosylation.

[0125] For example, replacing one amino acid residue with another that is biologically and / or chemically similar is known to those skilled in the art as a conserved substitution. For example, a conserved substitution is replacing one hydrophobic residue with another hydrophobic residue, or replacing one polar residue with another polar residue. Substitutions include, for example, combinations of Gly, Ala, Val, Ile, Leu, Asp, Glu, Asn, Gln, Ser, Thr, Lys, Arg, and Phe, Tyr. Such conserved substituted variations of each explicitly disclosed sequence are included in the mosaic polypeptides provided herein.

[0126] Substitution or deletion mutagenesis can be used to insert sites for N-glycosylation (Asn-X-Thr / Ser) or O-glycosylation (Ser or Thr). Deletion of cysteine ​​or other unstable residues may also be desirable. Deletion or substitution of potential proteolytic sites, such as Arg, can be achieved, for example, by deleting one of the basic residues or substituting one with a glutaminyl or histidyl residue.

[0127] Certain post-translational derivatizations are the result of the recombinant host cell's action on the expressed polypeptide. Glutaminyl and asparaginyl residues are often deamidated post-translation to their corresponding glutamyl and asparyl residues. Alternatively, these residues are deamidated under weakly acidic conditions. Other post-translational modifications include hydroxylation of proline and lysine, phosphorylation of hydroxyl groups of ceryl or threonyl residues, methylation of the o-amino groups of lysine, arginine, and histidine side chains (TECreighton, Proteins: Structure and Molecular Properties, WH Freeman & Co., San Francisco pp 79-86

[1983] ), acetylation of N-terminal amines, and, in some cases, amidation of C-terminal carboxyls.

[0128] It is understood that one way of defining variants and derivatives of the proteins disclosed herein is to define the variants and derivatives in terms of homology / identity with a specific known sequence. These and other protein variants disclosed herein are specifically disclosed having at least 70%, 75%, 80%, 85%, 90%, or 95% homology to the stated sequence. Those skilled in the art will readily understand how to determine the homology of two proteins. For example, homology can be calculated after aligning the two sequences to the highest level of homology.

[0129] Another method for calculating homology can be performed using publicly available algorithms. Optimal alignment of sequences for comparison may be performed using the local homology algorithm of Smith and Waterman Adv.Appl.Math.2:482(1981), the homology alignment algorithm of Needleman and Wunsch, J.MoL Biol.48:443(1970), the similarity search method of Pearson and Lipman, Proc.Natl.Acad.Sci.USA85:2444(1988), computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA at Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI), or by inspection.

[0130] Similar types of homology can be obtained for nucleic acids by algorithms disclosed, for example, in Zuker, M. Science 244:48-52, 1989, Jaeger et al. Proc. Natl. Acad. Sci. USA 86:7706-7710, 1989, and Jaeger et al. Methods Enzymol. 183:281-306, 1989.

[0131] It is understood that descriptions of conserved variants and homology can be combined in any combination, for example, an embodiment having at least 70% homology with a particular sequence, wherein the variant is a conserved variant.

[0132] Where this specification considers various proteins and protein sequences, it is understood that nucleic acids capable of encoding these protein sequences are also disclosed. This would include all degenerate sequences associated with a particular protein sequence, i.e., all nucleic acids having sequences encoding one particular protein sequence, as well as all nucleic acids including degenerate nucleic acids encoding disclosed variants and derivatives of protein sequences. Thus, while each particular nucleic acid sequence may not be described herein, it is understood that each sequence and all sequences are, in fact, disclosed and described herein through the disclosed protein sequences. While an amino acid sequence does not indicate which particular DNA sequence encodes that protein in an organism, it is understood that if a particular variant of a disclosed protein is disclosed herein, the known nucleic acid sequences that encode that protein, in which that protein appears, are also known and are disclosed and described herein.

[0133] It is understood that there are numerous amino acids and peptide analogs that can be incorporated into the disclosed compositions. For example, there are numerous D amino acids or amino acids having functional substituents different from those shown in Tables 1 and 2. Opposite stereoisomers of naturally occurring peptides, as well as stereoisomers of peptide analogs, are disclosed. These amino acids can be readily incorporated into polypeptide chains by loading tRNA molecules with selected amino acids and manipulating gene constructs to insert the analog amino acids into the peptide chain in a site-specific manner, for example, by utilizing amber codons.

[0134] It can produce molecules that are similar to peptides but are not linked via natural peptide bonds. For example, bonds for amino acids or amino acid analogs can include CH2NH--, --CH2S--, --CH2--CH2--, --CH=CH-- (cis and trans), --COCH2--, --CH(OH)CH2--, and --CHH2SO-- (these and others are also mentioned in *Chemistry and Biochemistry of Amino Acids, Peptides, and Proteins*, B. Weinstein, eds., Marcel Dekker, New York, p.267 (1983), Spatola, AF, *Vega Data* (March 1983), Vol.1, Issue 3, Peptide Backbone Modifications (general review), Morley, Trends Pharm Sci (1980) pp.463-468, and Hudson, D. et al., Int J Pept Prot Res 14:177-185 (1979) (--CH2NH--, CH2CH2--), Spatola et al. Life Sci 38:1243-1249 (1986) (--CH H2--S), Hann J. Chem. Soc Perkin Trans. I 307-314 (1982) (--CH--CH--, cis and trans), Almquist et al. J. Med. Chem. 23:1392-1398 (1980) (--COCH2--), Jennings-White et al. Tetrahedron Lett 23:2533 (1982) (--COCH2--), Szelke et al. European Appln, EP 45665 This can be found in CA(1982):97:39405(1982)(--CH(OH)CH2--), Holladay et al. Tetrahedron. Lett 24:4401-4404(1983)(--C(OH)CH2--), and Hruby Life Sci 31:189-199(1982)(--CH2--S--), each of which is incorporated herein by reference.A particularly preferred non-peptide bond is --CH2NH--. It is understood that peptide analogs, such as β-alanine and γ-aminobutyric acid, can have two or more atoms between the bonded atoms.

[0135] Amino acid analogs and peptide analogs often possess enhanced or desirable properties, such as more economical production, greater chemical stability, enhanced pharmacological properties (half-life, absorption, potency, efficacy, etc.), altered specificity (e.g., broad-spectrum biological activity), reduced antigenicity, and others.

[0136] Because D-amino acids are not recognized by peptidases, they can be used to produce more stable peptides. More stable peptides can be produced by systematically substituting one or more amino acids in a consensus sequence with the same type of D-amino acid (e.g., D-lysine instead of L-lysine). Cysteine ​​residues can be used to cyclize or bond two or more peptides together. This can be beneficial for constraining peptides to a specific three-dimensional structure.

[0137] Delivery of pharmaceutical carriers / pharmaceutical products As described above, the composition may also be administered in vivo on a pharmaceutically acceptable carrier. "Pharmacologically acceptable" means a material that is not biologically or otherwise undesirable, i.e., a material that can be administered to a subject together with nucleic acids or vectors, without causing any undesirable biological effects or interacting in a harmful manner with any other components of the pharmaceutical composition with which it comes into contact. The carrier may necessarily be selected to minimize any degradation of the active ingredient and minimize any adverse side effects in the subject, as is well known to those skilled in the art.

[0138] The compositions (i.e., the manipulated AAV vectors disclosed herein) may be administered orally, parenterally (e.g., intravenously), intramuscularly, intraperitoneally, percutaneously, by cerebrospinal fluid injection, extracorporeally, topically, or topically, including intranasal administration or administration by inhalation. As used herein, “topically, intranasally” means delivery of the composition to the nose and nasal passages through one or both nostrils, and may include delivery by a spray or droplet mechanism, or by aerosolization of the nucleic acid or vector. Administration of the composition by inhalation can be done through the nose or mouth via delivery by spray or droplet mechanism. Delivery may also be delivered directly to any area of ​​the respiratory system (e.g., the lungs) via intubation. The exact amount of composition required will vary depending on the subject, depending on the species, age, weight, and general condition of the subject, the severity of the allergic disorder being treated, the specific nucleic acid or vector used, and the mode of administration. Therefore, it is impossible to specify an exact amount for all compositions. However, an appropriate amount can be determined by those skilled in the art using only routine experiments that give rise to the teachings herein.

[0139] Parenteral administration of compositions, when used, is generally characterized by injection. Injectable preparations can be prepared in conventional forms, such as liquid solutions or suspensions, solid forms suitable for solutions of suspensions in liquids before injection, or emulsions. Recently revised parenteral administration approaches involve the use of sustained or prolonged release so that a constant dose is maintained. See, for example, U.S. Patent No. 3,610,795, incorporated herein by reference.

[0140] The materials may be in solution or suspension form (e.g., microparticles, liposomes, or incorporated into cells). These can target specific cell types via antibodies, receptors, or receptor ligands. The following references illustrate the use of this technology to target specific proteins in tumor tissue (Senter, et al., Bioconjugate Chem., 2:447-451, (1991), Bagshawe, KD, Br.J. Cancer, 60:275-281, (1989), Bagshawe, et al., Br.J. Cancer, 58:700-703, (1988), Senter, et al., Bioconjugate Chem., 4:3-9, (1993), Battelli, et al., Cancer Immunol.Immunother., 35:421-425, (1992), Pietersz and McKenzie, Immunolog.Reviews, 129:57-80, (1992), and Roffler, et al. al., Biochem.Pharmacol, 42:2062-2065, (1991). Vehicles such as "Stealth" and other antibody-coupled liposomes (including lipid-mediated drugs targeting colon cancer), receptor-mediated targeting of DNA via cell-specific ligands, lymphocyte-directed tumor targeting, and highly specific therapeutic retroviral targeting of mouse glioma cells in vivo. The following references illustrate the use of this technology to target specific proteins in tumor tissue (Hughes et al., Cancer Research, 49:6214-6220, (1989), and Litzinger and Huang, Biochimica et Biophysica Acta, 1104:179-187, (1992)). Generally, receptors are involved in either constitutive or ligand-induced endocytosis pathways. These receptors cluster within clathrin-coated pits, enter the cell via clathrin-coated vesicles, pass through acidified endosomes where the receptors are sorted, and are then either recycled to the cell surface, stored within the cell, or degraded in lysosomes.Internal translocation pathways perform a variety of functions, including nutrient uptake, removal of activated proteins, clearance of macromolecules, opportunistic entry of viruses and toxins, ligand dissociation and degradation, and regulation at the receptor level. Many receptors follow two or more intracellular pathways depending on cell type, receptor concentration, ligand type, ligand titer, and ligand concentration. The molecular and cellular mechanisms of receptor-mediated endocytosis have been reviewed (Brown and Greene, DNA and Cell Biology 10:6, 399-409 (1991)).

[0141] Pharmacologically acceptable carriers Compositions containing antibodies can be used therapeutically in combination with pharmaceutically acceptable carriers.

[0142] Suitable carriers and their formulations are described in Remington: The Science and Practice of Pharmacy (19th ed.), Argennaro, Mack Publishing Company, Easton, PA 1995. Typically, an appropriate amount of a pharmaceutically acceptable salt is used in the formulation to make it isotonic. Examples of pharmaceutically acceptable carriers include, but are not limited to, physiological saline, Ringer's solution, and dextrose solution. The pH of the solution is preferably about 5 to about 8, and more preferably about 7 to about 7.5. Further carriers include sustained-release preparations such as a semipermeable matrix of a solid hydrophobic polymer containing an antibody, the matrix in the form of a molded article, e.g., a film, liposomes, or microparticles. It will be apparent to those skilled in the art that certain carriers may be more preferred, for example, depending on the route of administration and the concentration of the composition being administered.

[0143] Pharmaceutical carriers are known to those skilled in the art. These are, most typically, standard carriers for drug administration to humans, including solutions such as sterile water, saline, and buffers at physiological pH. These compositions can be administered intramuscularly or subcutaneously. Other compounds will be administered according to standard procedures used by those skilled in the art.

[0144] The pharmaceutical composition may include, in addition to the selected molecule, a carrier, a thickener, a diluent, a buffer, a preservative, and a surfactant. The pharmaceutical composition may also include one or more active ingredients such as an antimicrobial agent, an anti-inflammatory agent, or an anesthetic.

[0145] The pharmaceutical composition may be administered in several forms depending on whether topical or systemic treatment is desired and the area to be treated. Administration may be topical (including ophthalmic, vaginal, rectal, and intranasal), oral, by inhalation, or parenterally by, for example, intravenous infusion, cerebrospinal fluid injection, subcutaneous injection, intraperitoneal injection, or intramuscular injection. The disclosed engineered viral vectors may be administered intravenously, intraperitoneally, intramuscularly, subcutaneously, intracavitarially, or percutaneously.

[0146] Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic / aqueous solutions, emulsions, or suspensions, including saline and buffer media. Parenteral vehicles include sodium chloride solutions, ringer's dextrose, dextrose and sodium chloride, lactated Ringer's solution, or fixative oils. Intravenous vehicles include fluids and nutritional supplements, electrolyte supplements (such as those based on ringer's dextrose), etc. Preservatives and other additives, such as antimicrobial agents, antioxidants, chelating agents, and inert gases, may also be present.

[0147] Formulations for topical administration may include ointments, lotions, creams, gels, drops, suppositories, sprays, liquids, and powders. Conventional pharmaceutical carriers, aqueous, powder, or oily bases, thickeners, etc., may be required or desirable.

[0148] Compositions for oral administration include powders or granules, suspensions or solutions in water or a non-aqueous medium, capsules, sachets, or tablets. Thickeners, flavorings, diluents, emulsifiers, dispersing agents, or binders may be desirable.

[0149] Some of the compositions may potentially be administered as pharmaceutically acceptable acids or base addition salts, which are formed by the reaction of inorganic acids, such as hydrochloric acid, hydrobromic acid, perchloric acid, nitric acid, thiocyanic acid, sulfuric acid, and phosphoric acid, with organic acids, such as formic acid, acetic acid, propionic acid, glycolic acid, lactic acid, pyruvic acid, oxalic acid, malonic acid, succinic acid, maleic acid, and fumaric acid, or by the reaction of inorganic bases, such as sodium hydroxide, ammonium hydroxide, and potassium hydroxide, with organic bases, such as mono, di, trialkyl, and arylamines, as well as substituted ethanolamines.

[0150] therapeutic use The effective dosage and schedule for administering a composition may be determined empirically, and making such a determination is within the scope of skill in the art. The dosage range for administering a composition should be large enough to produce the desired effect in which the symptoms of the disorder are affected. The dosage should not be so large as to cause adverse side effects, such as undesirable cross-reactions or anaphylactic reactions. In general, the dosage will vary depending on the patient's age, condition, sex, and the severity of the disease, the route of administration, or whether other drugs are included in the regimen, and can be determined by those skilled in the art. The dosage may be adjusted by the individual physician in the event of any contraindications. The dosage may vary and may be administered in doses once or twice daily over a day or several days. Guidelines for appropriate dosages for a given class of medicinal products can be found in the literature. For example, guidance on selecting an appropriate dosage for an antibody can be found in the literature on the therapeutic use of antibodies, such as Handbook of Monoclonal Antibodies, Ferrone et al., eds., Noges Publications, Park Ridge, NJ, (1985) ch.22 and pp.303-357, and Smith et al., Antibodies in Human Diagnosis and Therapy, Haber et al., eds., Raven Press, New York (1977) pp.365-389. A typical daily dose of an antibody used alone may range from approximately 1 μg / kg body weight to over 100 mg / kg body weight per day, depending on the factors mentioned above.

[0151] Methods for treating metabolic diseases and / or disorders or cancer The disclosed AAV vectors can be used for any of the events in animals that may be subjected to targeted gene disruption, repair, and modification. Gene modification and gene disruption refer to methods, techniques, and compositions that involve the selective removal, incorporation, or alteration of a stretch of genes or chromosomes in an animal. Generally, cells are transformed with vectors designed for homologous recombination in specific chromosomal regions contained within the cell, e.g., those described herein. This homologous recombination event can produce chromosomes in which exogenous DNA is introduced, for example, in frame with surrounding DNA. This type of protocol allows highly specific mutations to be introduced into the genome contained within the cell.

[0152] In one embodiment, a method for reducing the hepatotropy of an adeno-associated virus (AAV) vector is disclosed herein, wherein the AAV vector encodes an engineered AAV capsid protein, and the method comprises substituting one or more amino acids corresponding to amino acid residues 503, 708, and / or 709 of SEQ ID NO: 1 or SEQ ID NO: 6, and including, but not limited to, one or more amino acid substitutions in residues 501, 713, and / or 714 of SEQ ID NO: 31.

[0153] Also disclosed herein are methods for reducing the hepatotropy of an adeno-associated virus (AAV) vector, wherein the amino acid substitution comprises F503Y, F503T, F503K, Y708D, Y708E, K709I, K709L, and / or K709G, or any combination thereof, relative to SEQ ID NO: 1 or SEQ ID NO: 6 (for example, a method comprising F501Y, Y713D, and / or K714I, relative to SEQ ID NO: 31). In some embodiments, the method further comprises introducing SEQ ID NO: 2 or SEQ ID NO: 5 into the AAV vector, wherein SEQ ID NO: 2 or SEQ ID NO: 5 comprises a nucleic acid substitution at codon positions 1508, 2127, 2124, or any combination thereof, the nucleic acid substitution occurring at a nucleotide that causes abolition of hepatotropy or disrupts AAV binding to hepatocytes. In some embodiments, the capsid protein is recombinant 2 (Rec2), AAV8, or AAV9 capsid protein. In one embodiment, an AAV capsid protein prepared by any of the methods disclosed herein is disclosed herein.

[0154] In one embodiment, it is understood that the disclosed vectors can be used to rescue disease-causing gene / protein expression deficiencies. In one embodiment, the AAV vectors disclosed herein can be used to treat obesity, diabetes, congenital leptin deficiency, lipodystrophy (e.g., congenital generalized lipodystrophy (also known as Belladinelli-Sipe syndrome), familial partial lipodystrophy, acquired partial lipodystrophy (also known as Baracel-Simons syndrome), acquired generalized lipodystrophy, centrifugal abdominal lipodystrophy, annular lipodystrophy, localized lipodystrophy, and HIV-associated lipodystrophy), or metabolic syndromes. Accordingly, in one embodiment, a method for delivering a gene to adipose tissue of a subject is disclosed herein, comprising administering to the subject one of the engineered AAV vectors disclosed herein. Also disclosed herein are methods for treating, inhibiting, reducing, mitigating, relieving, and / or preventing diabetes, obesity, metabolic syndromes, or lipodystrophy in a subject, comprising administering to the subject one of the engineered AAV vectors disclosed herein.For example, a method for treating, inhibiting, reducing, mitigating, and / or preventing diabetes, obesity, metabolic syndrome, or lipodystrophy in a subject, the method comprising administering to the subject an AAV vector containing an engineered AAV capsid protein (e.g., an AAV vector containing Rec2, AAV8, or AAV9 capsid protein, but not limited to Rec2, AAV8, or AAV9 vector), the engineered AAV capsid A method is disclosed herein (for example, a method in which the amino acid substitution occurs at a residue that causes a loss of hepatotropy or disrupts AAV binding to hepatocytes, and includes F503Y, F503T, F503K, Y708D, Y708E, K709I, K709L, and / or K709G for SEQ ID NO: 1 or SEQ ID NO: 6, or any combination thereof). In some embodiments, the AAV capsid protein contains the sequence described in SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, or SEQ ID NO: 44. In some embodiments, the manipulated vector encodes a therapeutic agent.

[0155] Activation of NK precursor cells and NK cells present in adipose tissue can facilitate cancer treatment, which is further understood to be because NK cells attack cancer, and is intended herein. Activation of NK precursor cells and NK cells in adipose tissue can be achieved by providing IL-15 to NK cells. The tissue-specific engineered AAV vectors disclosed herein can provide this IL-15.

[0156] The disclosed compositions can be used to treat any disease in which uncontrolled cell proliferation occurs, such as cancer. A representative but non-limiting list of cancers in which the disclosed compositions can be used to treat is: lymphoma, e.g., B-cell lymphoma and T-cell lymphoma; mycosis fungoides; Hodgkin's disease; myeloid leukemia (including, but not limited to, acute myeloid leukemia (AML) and / or chronic myeloid leukemia (CML)); bladder cancer; brain cancer; nervous system cancer; head and neck cancer; squamous cell carcinoma of the head and neck; kidney cancer; lung cancer, e.g., small cell lung cancer, non-small cell lung cancer (NSCLC), squamous cell carcinoma of the lung (LUSC), and adenocarcinoma of the lung (LUAD); neuroblastoma / glioblastoma; ovarian cancer; pancreatic cancer; prostate cancer; skin cancer; liver cancer; melanoma; squamous cell carcinoma of the oral cavity, pharynx, larynx, and lung; cervical cancer; Carcinoma; breast cancer, including but not limited to triple-negative breast cancer; genitourinary cancer; lung cancer; esophageal cancer; head and neck carcinoma; colorectal cancer; hematopoietic cancer; testicular cancer; and colon and rectal cancer.

[0157] Furthermore, the study covers cancers and / or metastases in the target population (e.g., lymphoma, B-cell lymphoma, T-cell lymphoma, mycosis fungoides, Hodgkin's disease, myeloid leukemia, bladder cancer, brain cancer, nervous system cancer, head and neck cancer, head and neck squamous cell carcinoma, lung cancer, e.g., small cell lung cancer and non-small cell lung cancer, neuroblastoma / glioblastoma, ovarian cancer, pancreatic cancer, prostate cancer, skin cancer, liver cancer, melanoma, oral, pharyngeal, laryngeal, and lung squamous cell carcinoma, colon cancer, cervical cancer, cervical carcinoma, breast cancer, and epithelial cancer, kidney cancer, genitourinary cancer, lung cancer, esophageal cancer, head and neck cancer). Methods for treating, inhibiting, reducing, lessening, relieving, and / or preventing carcinoma, colorectal cancer, hematopoietic cancer, testicular cancer, colon cancer, and / or rectal cancer, comprising administering to a subject one of the engineered AAV vectors disclosed herein. For example, a method for treating, inhibiting, reducing, decreasing, relieving, and / or preventing cancer in a subject is disclosed herein, the method comprising administering to the subject an AAV vector containing an engineered AAV capsid protein (e.g., an AAV vector containing Rec2, AAV8, or AAV9 capsid protein, but not limited to Rec2, AAV8, or AAV9 vector), wherein the engineered AAV capsid protein comprises amino acid substitutions occurring at residues that cause abolition of hepatotropy or disruption of AAV binding to hepatocytes, and comprising F503Y, F503T, F503K, Y708D, Y708E, K709I, K709L, and / or K709G for SEQ ID NO: 1 or SEQ ID NO: 6, or any combination thereof (e.g., a method in which the amino acid substitution comprises F501Y, Y713D, and / or K714I for SEQ ID NO: 31).In some embodiments, the AAV capsid protein contains the sequence described in SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, or SEQ ID NO: 44. In some embodiments, the manipulated vector encodes a therapeutic agent.

[0158] Accordingly, in one embodiment, the AAV vector disclosed herein can be used to treat cancer in a subject by administering the IL-15 coded AAV vector described herein. Accordingly, in one embodiment, a method for treating obesity, diabetes, cancer, lipodystrophy, and / or metabolic syndrome in a subject is disclosed herein, the method comprising administering to the subject an engineered adeno-associated virus (AAV) vector, the engineered AAV vector comprising two expression cassettes, the first cassette comprising a regulatory element (e.g., WPRE) and a leptin transgene and / or IL-15 transgene operably ligated to a promoter (e.g., CBA promoter), and the second cassette comprising a tissue-specific promoter and an RNA silencing element (e.g., smRNA, shRNA, RNAi, siRNA, and / or piRNA, including but not limited to these microRNAs) that targets the regulatory element in the first expression cassette, the RNA silencing element being operably ligated to the tissue-specific promoter.

[0159] Also disclosed herein is a method for a nucleic acid-based therapy to target visceral adipose tissue in a subject, the method comprising administering to the subject an engineered adeno-associated virus (AAV) vector, the engineered AAV vector comprising two expression cassettes, the first cassette comprising a regulatory element and a leptin transgene operably ligated to a promoter, the second cassette comprising a tissue-specific promoter (e.g., albumin) and an RNA silencing element (e.g., microRNA including, but not limited to, smRNA, shRNA, RNAi, siRNA, and / or piRNA) that targets the regulatory element in the first expression cassette, the RNA silencing element being operably ligated to the tissue-specific promoter, and the AAV vector being administered intraperitoneally.

[0160] Throughout this application, various publications are referenced. The disclosures of these publications, in their entirety, are incorporated herein by reference to provide a more complete description of the state of the art relating to this application. The disclosed references are also discussed in the texts relating thereto, and the materials contained therein are incorporated herein by reference individually and specifically.

[0161] Several embodiments of this disclosure have been described. However, it is understood that various modifications may be made without departing from the spirit and scope of the invention. Accordingly, other embodiments are within the scope of the following claims.

[0162] As a non-limiting example, an embodiment of a particular part of this disclosure is shown below.

[0163] [Examples] The following examples are provided to those skilled in the art to provide a complete disclosure and description of how the compounds, compositions, articles, devices, and / or methods claimed herein are made and evaluated, and are intended to be purely illustrative and not to limit the disclosure. Although efforts have been made to ensure accuracy with respect to numerical values ​​(e.g., quantity, temperature, etc.), some error and deviation should be taken into account. Unless otherwise indicated, parts are parts by weight, temperature is °C or ambient temperature, and pressure is atmospheric pressure or near atmospheric pressure.

[0164] Example 1: Development of a lipotropic AAV capsid that eliminates hepatotropy. AAV vectors are the mainstream delivery platform in gene therapy, but AAV-mediated gene transfer into adipose tissue remains underdeveloped due to the low efficiency of natural AAVs. This disclosure demonstrates that the engineered capsid Rec2 exhibited improved lipotropy, but with the caveat of hepatic transduction. To generate a highly lipotropic capsid, the Rec2 capsid was modified by site-directed mutagenesis, and variant V7, with F503Y, Y708D, and K709I substitutions, was found to possess highly selective lipotropy while reducing hepatic transduction. Intraperitoneal injection was favorable for transduction into visceral fat, while intravenous administration was favorable for subcutaneous fat. Intraperitoneal administration of the V7 vector, containing human leptin and adiponectin as single transcripts, normalized metabolic dysfunction in ob / ob mice at low doses. Furthermore, introducing the same mutagenesis into the AAV8 capsid reduced hepatic transduction, suggesting that F503, Y708, and K709 are important for hepatic transduction. The Rec2.V7 vector provides a powerful tool for basic research and a potent vehicle for adipose-targeted gene therapy.

[0165] Adeno-associated viruses (AAVs) are single-stranded DNA viruses with non-enveloped capsids. Recombinant AAV vectors are replication-deficient AAV particles that serve as a valuable tool for genetic manipulation of specific tissues and are safely used in clinical trials. Due to their non-pathogenicity and broad tropism, AAVs have become the most common delivery system for gene therapy and are being used in more than 200 ongoing clinical trials. AAV vectors have successfully delivered transgenes to the liver, heart, skeletal muscle, brain, and eyes. In contrast, adipose tissue, one of the largest organs in the body and playing a crucial role in the physiology and pathology of several diseases, is under investigation in the field of AAV gene therapy, largely due to the low transduction efficiency of natural AAV serotypes in adipose tissue. A comprehensive literature review finds AAV8 to be the most efficient capsid for transducing adipose tissue among the natural AAV serotypes being evaluated. However, AAV8 transduces the liver far more efficiently than adipose tissue, which necessitates methods to restrict off-target transgene expression in the liver.

[0166] It is known that modulating AAV capsids affects viral histotropy and the functional role of the delivered transgene. To specifically manipulate adipose tissue, recombinant AAV (rAAV) vectors were generated to achieve highly efficient transduction of adipose tissue. The engineered hybrid capsid Rec2, generated by AAV8 and rhesus macaque 20 (rh20) capsid shuffling, can transduce white adipose tissue (WAT) and brown adipose tissue (BAT) via direct fat pad injection far more efficiently than the comparison of native capsids (AAV1, 8, and 9) and engineered capsids (Rec1, Rec3, Rec4). One limitation is hepatic transduction when the Rec2 vector is injected systemically. To prevent transgene expression in the liver, the AAV vector genome was engineered to contain two expression cassettes. One side uses a ubiquitous hybrid cytomegalovirus enhancer / chicken β-actin (CBA) promoter to drive the transgene, while the other side uses a liver-specific albumin promoter to drive a specific microRNA that targets a woodchuck post-transcriptional regulatory element (WPRE) sequence present only in the transgene expression cassette. The effectiveness of this fat-specific (AS) dual cassette design (named AS / Rec2) has been demonstrated.

[0167] Despite significant advances in AAV technology targeting adipose tissue, the AS / Rec2 system has the following drawbacks: 1) The Rec2 vector resides in the liver, and therefore carries the risk of viral vector-associated toxicity at extremely high doses; 2) The dual cassette design cannot restrict transgene expression in the liver if the transgene is miRNA and shRNA; 3) Introducing a second cassette further worsens the transgene size limitation (less than 1750 bp in the current dual cassette design), thereby excluding its use for many genes and CRISPR / Cas9 genome editing; 4) Restriction of hepatic transgene expression is less efficient under conditions where the albumin promoter is weakened. For example, AS / Rec2-Fgf21 was found to result in a 4.5-fold increase in transgene Fgf21 expression in the liver of 24-month-old mice. In contrast, the same AS / Rec2-Fgf21 vector did not alter Fgf21 expression in the liver of younger mice. Therefore, a capsid that has improved lipotropy and truly reduces hepatotropy is highly desirable.

[0168] To overcome the limitations of the AS / Rec2 system, Rec2 was used herein as a template for capsid manipulation to generate a truly adipose-oriented AAV while eliminating hepatotropy. The AAV capsid mediates intracellular translocation and post-translocation processing (intracellular transport), which can dictate the vector's tropism and the level of transgene expression. Capsid modifications in many serotypes have been reported to achieve tropic changes. Herein, the Rec2 capsid was modified by site-directed mutagenesis to generate eight variants of the Rec2 capsid. In vivo screening found that Rec2 capsid variants with F503Y, Y708D, and K709I substitutions (referred to as Rec2.V7, V7) resulted in substantial transduction of adipose tissue, and no transgene expression was detected in the liver. We further characterized the V7 capsid through different administration routes and doses, and conducted proof-of-concept studies in the congenital leptin deficiency model ob / ob mouse.

[0169] result Rec2 capsid modification results in a lipotropic V7 vector with loss of hepatotropy. In search of adipose-oriented vectors while eliminating hepatotropy, eight variants were generated by mutagenesis of the Rec2 capsid sequence (Table 3) and named V1-8. V3 was unsuccessful in packaging and was discarded. For in vivo screening, a pseudo-AAV vector, which is a cis-plasmid containing the AAV2 ITR and a single cassette for expressing highly sensitive green fluorescent protein (referred to as GFP), was packaged with the native Rec2 and Rec2 capsid variants using the same triple transfection and purification method. To screen the variants, tissue lysates were used for direct GFP fluorescence count readout at an excitation wavelength of 485 nm and a cutoff emission wavelength of 528 nm. Adipose tissue is distributed in a variety of locations, including visceral, intraperitoneal, and subcutaneous fat depots. In rodents, commonly referred to visceral fat depots include epididymal (male) or gonadal (female) white adipose tissue (eWAT or gWAT), mesenteric white adipose tissue (mWAT), and retroperitoneal white adipose tissue (rWAT). Subcutaneous fat depots include inguinal white adipose tissue (iWAT) and scapular brown adipose tissue (BAT).

[0170] intraperitoneal (ip) delivery During initial in vivo screening with 2E10 viral genome (vg) / mouse doses via ip injection, the V7 capsid vector (Figure 1) resulted in substantial GFP expression in eWAT (Figure 2A), and GFP fluorescence was not detected in the liver (Figure 2B). Other variants or vectors at the same dose either failed to alter hepatic tropism or lost adipose transduction (Figures 2A-C). For example, variant 1, Rec2.V1 capsid, reduced transduction efficiency to adipose tissue by 76% via intrafat injection and 83% via intraperitoneal injection compared to the natural Rec2 capsid. The V1 capsid also showed a hepatic transduction efficiency less than 50% lower compared to the natural Rec2 capsid. These variants were considered failures of the original intention to generate adipose-specific AAV serotypes and were subsequently screened for transduction to other tissues. Surprisingly, robust transduction in the rat brain was observed in many brain structures, including the striatum (target structure), cortex, septum, hippocampus, thalamus, subthalamic nucleus, and substantia nigra. Therefore, the V7 capsid was selected for further characterization. The mutation in V7 is shown in Figure 1A and highlighted in its capsid amino acid sequence in Figure 1B.

[0171] Next, the ip experiment was repeated at a dose of 2E10vg / mouse, demonstrating that GFP fluorescence was detected in the eWAT of mice receiving the V7 vector but not in the liver (Figure 3A). In contrast, GFP fluorescence was detected in both the eWAT and liver of mice receiving the same dose of the parental Rec2 vector. Consistent with the GFP fluorescence readings, Western blotting also confirmed V7 vector-mediated transgene expression in adipose tissue but not in the liver, while Rec2 resulted in transgene expression in both the WAT and liver (Figure 3B). Since the V7 vector resulted in lower GFP expression in the WAT at a dose of 2E10vg / mouse compared to that of native Rec2 (Figures 3A and 3B), drug-dosing experiments were performed to verify the alipidemia of V7 and estimate its adipose transduction efficiency. Increasing the dose of the V7 vector to 4E10vg / mouse improved transgene expression in eWAT, with transgene expression in eWAT reaching approximately 40% of that of native Rec2 at 2E10vg / mouse (Figure 3C). Notably, ip injection of the V7 vector resulted in similar GFP expression in mesenteric WAT (mWAT) compared to native Rec2. Importantly, the V7 vector via ip injection showed specific WAT transgene expression, and GFP fluorescence was not detected in the liver, pancreas, heart, skeletal muscle, spleen, and kidney, even at higher doses of 8E10vg / mouse (Figure 3C). In contrast, the Rec2 vector resulted in potent GFP expression in both WAT and liver, and a significant amount of GFP in the pancreas (Figure 3C). The adipophilicity of the V7 vector was confirmed by different researchers who packaged the V7 vector and repeated high-dose experiments (Figure 3D). Next, the viral vector genome copy number was quantified in eWAT, liver, and other peripheral tissues from mice that received high-dose (8E10vg / mouse) intravenous injections of the V7 vector. The V7 vector genome was largely detected in eWAT (56791±1302 copies / 50ng of genomic DNA) and found in small amounts in the liver (629±8 copies / 50ng of genomic DNA) (Figure 3E).

[0172] Intravenous (IV) administration Next, the in vivo distribution of the V7 vector was investigated by IV administration. AAV8 has been reported to be the most efficient native serotype for liver-directed gene transfer. AAV8 was used as a positive control in this experiment. Two doses (a low dose of 4E10 and a high dose of 8E10vg / mouse) were administered via tail vein injection. Western blotting showed V7 vector-transduced inguinal WAT (iWAT) and BAT in both low and high doses. High-dose AAV8 resulted in GFP protein levels in iWAT and BAT comparable to those of low-dose V7 (Figure 4A). As expected, AAV8 resulted in robust GFP expression in the liver at high doses (Figure 4A). In contrast, liver transgene expression was not detected even at high doses in mice receiving the V7 vector (Figure 4A). Interestingly, neither the V7 nor AAV8 vectors resulted in GFP expression in eWAT. Next, the intracellular distribution of V7 was further investigated by Western blotting in additional tissues from mice that received high-dose V7 vectors. GFP expression was detected in fat depots (iWAT, BAT, and rWAT) but not in the liver, spleen, pancreas, lungs, intestines, heart, and kidneys (Figure 4B). To further confirm the reduced hepatic tropism of the V7 vector, total RNA was isolated from iWAT and liver, and transgene GFP mRNA levels were quantified by qRT-PCR. Saline injection served as a negative control. The cycle threshold (Ct) of GFP from mice that received V7 and AAV8 vectors was subtracted from that of the saline control. β-actin was a housekeeping gene for qRT-PCR. As shown in Table 4, GFP mRNA expression was detected in iWAT in V7-receiving mice but not in the liver. In contrast, GFP mRNA was detected in both the liver and iWAT for AAV8. In addition, the vector genome copy number was measured in the iWAT and liver of mice that received an IV injection of either the V7 or AAV8 vector at a high dose (8E10vg / mouse).The V7 vector genome was mostly detected in iWAT (127,216 ± 14,778 genome copies / 50 ng of genomic DNA) and found in small amounts in the liver (1,034 ± 16 genome copies / 50 ng of genomic DNA) (Figure 4C). Consistent with protein and mRNA data, the overwhelming majority of AAV8 vectors were found in iWAT (25,111 ± 3,332 genome copies / 50 ng of genomic DNA) and accumulated in the liver (1,990,999 ± 3,877 genome copies / 50 ng of genomic DNA) (Figure 4C).

[0173] V7-based dual adipokine gene therapy rescues metabolic syndromes in congenital leptin deficiency. To investigate the therapeutic potential of the V7 vector, a proof-of-concept study was conducted in ob / ob mice, a model for congenital leptin deficiency in humans. Previously, a single injection of AS / Rec2-leptin (4E10vg / mouse, ip) was reported to completely rescue metabolic abnormalities, including obesity, bulimia, low energy expenditure, fatty liver, glucose intolerance, and hyperinsulinemia. To facilitate clinical translation, a novel gene therapy was developed based on the V7 capsid. Because the V7 vector eliminates hepatic tropism, the hepatic restriction cassette in the AS / Rec2 system becomes unnecessary; therefore, this avoids concerns about introducing exogenous regulatory elements that interfere with endogenous microRNA mechanisms, particularly at high expression levels. Furthermore, the absence of transduction to the liver by the V7 vector can minimize severe adverse events associated with hepatotoxicity, a major challenge in the field of systemic gene therapy. In addition, AAV gene therapy allows for the delivery of two or more therapeutic genes. Adiponectin is a major adipokine produced exclusively by adipocytes and plays a crucial role in glucose and lipid metabolism, inflammation, and oxidative stress. Adiponectin levels are reduced in obesity and lipodystrophy. Gene therapy delivering both leptin and adiponectin was expected to alleviate metabolic abnormalities in lipodystrophy more efficiently than leptin delivery alone. The LEP / ADIPOQ transgene was constructed by ligating human leptin cDNA and human adiponectin cDNA using a 2A sequence. The 2A sequence allows for the expression of two adipokines from a single transcript.Such a design has been successfully applied to IL-15 / IL-15Rα gene therapy in previous studies (Xiao, R., Mansour, AG, Huang, W., Chrislip, LA, Wilkins, RK, Queen, NJ, Youssef, Y., Mao, HC, Caligiuri, MA, and Cao, L. (2019). Adipocytes: A Novel Target for IL-15 / IL-15Ralpha Cancer Gene Therapy. Mol Ther 27, 922-932.10.1016 / j.ymthe.2019.02.011). The LEP / ADIPOQ gene was cloned into a ubiquitous CBA expression plasmid and packaged into a V7 capsid (Figure 5A).

[0174] Seven-week-old male ob / ob mice were randomized to receive either ip administration of V7-LEP / ADIPOQ (4E10vg or 8E10vg / mouse) or V7-GFP (8E10vg / mouse). Heterozygous male ob mice (ob / +) from the colonies were used as controls for the normal metabolic phenotype. Body weight of ob / ob mice receiving V7-GFP was observed to increase rapidly over the 9-week period of the study (Figures 5B and 5C). In contrast, the body weight gain of ob / ob mice flattened out two weeks after injection of V7-LEP / ADIPOQ at both doses (4E10 and 8E10vg / mouse) (Figures 5B, 5C, 5D, and 5E). High doses (8E10vg / mouse) of V7-LEP / ADIPOQ nearly returned body weight to its starting point (Figures 5B and 5C). When comparing weekly weight gain among the four groups, LEP / ADIPOQ gene delivery showed a dose-dependent effect on limiting weight gain in ob / ob mice (Figure 5E). The high-dose (8E10vg / mouse) ob / ob group was comparable to the heterozygous group over the duration of the study (Figures 5D and 5E), indicating complete rescue of excessive weight gain in ob / ob mice. Glucose loading tests were performed 7 weeks after AAV injection. Both low-dose and high-dose V7-LEP / ADIPOQ treatment completely normalized fast-state glucose processing (Figures 5F and 5G). Abnormal hypothermia is a known feature of ob / ob mice and can be reversed by leptin supplementation. While ob / ob mice do not exhibit reduced BAT fever capacity, a downward shift in thermoregulatory threshold has been reported. Leptin supplementation can normalize ob / ob body temperature to wild-type mouse levels by reducing heat loss. V7-LEP / ADIPOQ treatment corrected abnormal hypothermia in ob / ob mice in a dose-independent manner (Figure 6A). Body composition was determined by echoMRI 9 weeks after AAV injection. V7-LEP / ADIPOQ treatment significantly reduced steatosis and increased lean body mass compared to ob / ob mice treated with V7-GFP, and higher doses tended to lead to greater changes in body composition (Figure 6B).Consistent with echoMRI data, at sacrifice 9 weeks after V7 vector administration, the relative weights of fat depots, e.g., eWAT, iWAT, rWAT, and BAT, in V7-LEP / ADIPOQ mice (both doses) were all significantly reduced compared to ob / ob mice treated with V7-GFP, ranging from 40% to 70% (Figure 6C). Relative liver mass was reduced by 50% in both doses of V7-LEP / ADIPOQ (Figure 6C).

[0175] The in vivo distribution of the V7-LEP / ADIPOQ vector was investigated by qRT-PCR in major peripheral organs / tissues plus the brain of representative mice from the ob / ob V7-LEP / ADIPOQ 8E10vg / mouse group. Primers were designed to detect the human ADIPOQ transgene without cross-reactivity with mouse Adipoq. Human ADIPOQ transgene expression was detected exclusively in intraperitoneal adipose tissue, including eWAT, mWAT, and rWAT (Figure 7). Transgene mRNA was not detected in the brain, liver, or other peripheral organs / tissues (Figure 7). Serum levels of human adipokines were measured by ELISA without cross-reactivity with mouse counterparts. Serum levels of human leptin and adiponectin showed dose-dependent effects, but these were not statistically significant (Figure 8A). Human leptin levels reached 0.86±0.15 ng / ml and 1.65±0.6 ng / ml at low and high doses, respectively (Figure 8A), which are comparable to wild-type mouse serum levels or those from the Rec2 dual-cassette leptin vector, and exceed the serum mouse leptin levels in ob / + control mice (0.70±0.05 ng / ml). Human adiponectin serum levels were 2.5±0.8 ng / ml and 4.4±2.0 ng / ml at low and high doses, respectively (Figure 8A). ob / ob mice exhibited hyperinsulinemia, and their serum insulin levels were robustly reduced by V7-LEP / ADIPOQ treatment, ranging from 3 to 9 times in a dose-dependent manner (Figure 8B). Notably, high-dose V7-LEP / ADIPOQ reduced serum insulin in ob / ob mice to levels comparable to those in ob heterozygous mice. Furthermore, serum glucose levels were significantly reduced in both doses of V7-LEP / ADIPOQ compared to ob / ob V7-GFP mice. In particular, the higher dose completely normalized serum glucose to the levels of ob heterozygous mice (Figure 8C). Liver triglyceride content was significantly reduced in both doses of V7-LEP / ADIPOQ mice compared to ob / ob V7-GFP controls, indicating a significant reduction in fatty liver.High doses reduced liver lipid content to levels comparable to those of ob heterozygous mice (Figure 8D).

[0176] AAV8 capsids with F503Y, Y708D, and K709I substitutions eliminate hepatic tropism. To investigate whether mutations in V7 capsid generation are important for hepatotropy in other AAV capsids, F503Y, Y708D, and K709I substitutions were made in AAV8 capsids (Figure 9A). The GFP reporter vector was packaged into the resulting AAV8 mutant capsid, similar to the V7 experiment, and administered to wild-type mice via ip injection at a dose of 2E10vg / mouse. Robust GFP fluorescence was detected in the livers of mice receiving the natural AAV8 vector, while only very slight GFP fluorescence was found in the livers of mice receiving the AAV8 mutant vector (Figure 9B). The in vivo distribution was further assessed by Western blotting. Strong GFP expression in the liver was observed in mice receiving natural AAV8, which was completely reduced even with prolonged exposure in mice receiving the AAV8 mutant vector (Figure 9C). In contrast, GFP was detected in eWAT of mice receiving the AAV8 mutant, but at reduced levels compared to natural AAV8 (Figure 9C).

[0177] Consideration The Rec2 platform has become the leading AAV vector system for adipose gene delivery and is used by multiple laboratories worldwide (with or without liver-restricted dual cassette designs). However, recognizing its shortcomings, this disclosure devotes considerable effort to generating a novel capsid with improved adipose tropism while non-targeting the liver and other tissues. Herein, the V7 capsid, possessing three mutations in the Rec2 capsid (F503Y, Y708D, and K709I), achieved selective transduction of adipose tissue while eliminating transgene expression in the liver and other tissues when using a non-restrictive expression cassette. The adipose tropism of the V7 vector was validated by assessment of the vector genome, transgene mRNA, and transgene protein. Based on current knowledge, no AAV capsid that exclusively transduces adipose tissue while eliminating hepatotropy has been reported. Therefore, the V7 capsid may represent the first of this new class of AAV capsids.

[0178] The Rec2 vector exhibits differential tropism based on the delivery route. IV administration primarily results in hepatic transduction. IP injection transdoses both hepatic and visceral WAT. Surprisingly, oral administration of Rec2 transdoses intrascapular BAT but not gastrointestinal track or hepatic transduction. The V7 vector clearly showed a different in vivo distribution compared to the parent Rec2 capsid. Systemic administration of the V7 vector did not result in hepatic transduction, and transduction of adipose depots was route-dependent. IP delivery is favorable for visceral adipose depots, while IV administration is favorable for subcutaneous WAT and BAT. The different patterns of adipose transduction by IV vs. IP administration may be due to the mouse anatomical structure of adipose tissue and its vascular structures. Previous studies have reported that intravenous administration of AAV8- or AAV9-GFP resulted in varying transduction efficiencies to adipose depots, with the highest GFP expression in mWAT, BAT, and iWAT, and the lowest in eWAT. Notably, the dose used for the AAV8 or AAV9 vector was 5E12vg / mouse, which was significantly higher than the 8E10vg / mouse dose used in the V7 study. Increasing the dose of the V7 vector may improve transduction of visceral adipose tissue by intravenous injection. Alternatively, combining intravenous and intravenous administration may achieve systemic adipose transduction, which warrants further investigation.

[0179] One of the primary objectives of this disclosure was to eliminate the hepatotropy of the Rec2 capsid. Rec2 is a chimeric capsid produced via shuffling between the capsids of AAV8 and rh20. AAV8 and rh20 have been shown to efficiently transduce liver and brain tissue, respectively. The amino acid sequences of the capsids of AAV2, AAV8, AAV9, Rec2, and Rec3 were analyzed, and sites for point mutations or insertion mutations in the Rec2 capsid were selected based on functional readout data from publications for AAV2 capsid residues. The capsid (cap) gene encodes the structural viral proteins VP1-3 via alternative splicing and initiation. All three VP proteins share the same carboxyl-terminal amino acid. The tissue tropism of AAV depends on the capsid-specific structure and the specific interactions between cellular glycans and receptors. AAV2 enters cells by using membrane-associated heparan sulfate proteoglycans (HSPGs) as its primary receptor. Other candidates have also been reported to be involved in AAV adhesion. The atomic structure of the AAV2 capsid has been determined at a resolution of 3.0 microns. Based on computer modeling, several gene capsid modifications may be acceptable for AAV2 serotypes. For example, previous studies have identified a heparin-binding locus containing a cluster at positions 561–591, which has been reconfirmed by a recent comprehensive AAV capsid fitness landscape study. Further studies identify residues R585 and R588 as two primary residues involved in HSPG binding. Additional studies have reported gene mutations at position 587 and surrounding residues for vector retargeting and map some of the polar C-terminal amino acid residues essential for hepatic transduction by AAV2 and AAV9. Therefore, we screened for novel alipotropic, liver-non-targeting capsids by making mutations in the Rec2 capsid in a region equivalent to the region surrounding R585 and R588 of the AAV2 capsid. The additional modifications were extended beyond the R585-R588 region (Table 3).Regarding hepatic transduction, the F503Y, Y708D, and K709I substitutions resulted in the loss of hepatic tropism in both Rec2 and AAV8 capsids, suggesting that F503, Y708, and K709 together play a crucial role in hepatic transduction of Rec2 and AAV8 vectors. Further investigation is needed to determine if these substitutions can be applied to additional commonly used AAV capsids, such as AAV9. The AAV9 capsid shares 85% amino acid homology with Rec2 or AAV8. Importantly, F503, Y708, and K709 are conserved among the Rec2, AAV8, and AAV9 capsids. In particular, while lipotropism could be maintained, the efficiency of the V7 capsid was lower than that of the Rec2 capsid but still higher than that of AAV8. The domain in the Rec2 capsid, which is crucial for vector entry into adipose tissue and the liver, may be located at the C-terminus of the VP of the Rec2 capsid, and is likely to partially overlap. Therefore, the three-residue substitution (F503Y / Y708D / K709I) may also affect the adipose-binding domain when disrupting liver binding.

[0180] In addition to serving as a tool for basic research in adipose biology, alipotropic AAV vectors can provide avenues for developing gene therapies for genetic disorders and disease conditions, including those affecting adipose tissue. Adipose tissue pathologies are most frequently associated with obesity or diabetes in humans. Six forms of human monogenic obesity are primarily due to inactivating mutations in leptin-melanocortin signaling. Congenital leptin deficiency is a monogenic deletion found in adipose tissue, which causes severe obesity, bulimia, and hyperinsulinemia. Leptin deficiency also shares many symptoms with lipodystrophy. Leptin replacement therapy is necessary in patients with homozygous leptin mutations or acquired leptin deficiency resulting from congenital or acquired lipodystrophy. Recombinant leptin protein analog (methreleptin) is an approved drug, but requires frequent lifelong injections and costs an average of $565,000 per patient per year. Gene therapy based on lipotropic AAV vectors may offer significant advantages compared to current standard treatments. This lipotropic AAV platform allows for lower overall systemic doses to patients, which results in less toxicity for systemically delivered gene therapies and much lower costs for those items.

[0181] Previous preclinical studies have demonstrated the use of Rec2 / dual cassette vectors in ob / ob mice (Huang, W., Liu, X., Queen, NJ, and Cao, L. (2017). Targeting Visceral Fat by Intraperitoneal Delivery of Novel AAV Serotype Vector Restricting Off-Target Transduction in Liver. Mol Ther Methods Clin Dev 6, 68-78.10.1016 / j.omtm.2017.06.002). Here, we performed a proof-of-concept for V7-based gene therapy in ob / ob mice, reflecting the published study. A single intravenous injection of a V7 vector containing human leptin and human adiponectin normalized excessive weight gain, glucose intolerance, abnormally low core body temperature, hyperinsulinemia, and fatty liver in ob / ob mice. Notably, the low dose of 4E10vg / mouse of the V7 vector resulted in circulating levels of human leptin comparable to normal levels of mouse leptin in WT mice. Importantly, the V7 vector dose was 50–100 times lower than that of standard gene therapy, yet it achieved higher levels of leptin expression. Since restoring circulating leptin levels to 10% of normal levels is sufficient to mitigate metabolic syndromes associated with congenital leptin deficiency, the dose of V7-LEP / ADIPOQ can be further reduced. Furthermore, gene therapy delivering both leptin and adiponectin was expected to mitigate metabolic abnormalities more efficiently in lipodystrophy models than leptin alone, as adiponectin promotes adipogenesis.

[0182] Research is underway to determine the percentage of adipocytes transduced by the V7 vector and to determine whether the V7 vector can transduce other cell populations present in adipose tissue (e.g., immune cells, precursor cells). These findings are important for several applications, such as knockdown of endogenous adipocyte genes and investigations into the interaction between mature adipocytes and stromal vascular cells (SVFs). In a preliminary study, mature adipocytes were isolated, and qRT-PCR was performed to quantify SVFs and GFP mRNA from eWATs of mice that received IP injection of V7-GFP (8E10vg / mouse). The majority of GFP mRNA was detected in mature adipocytes, and GFP expression in SVFs was 4.4% of that in mature adipocytes, indicating that the V7 vector primarily transduces mature adipocytes. Furthermore, the elimination of the hepatotropy of the V7 capsid presumably reduces viral vector-associated toxicity. Severe adverse events were rarely observed in clinical and nonclinical studies, and most occurred after administration of very high doses (1–3E14 vg / kg > iv); therefore, this disclosure does not allow for assessment of toxicity using low doses (less than 3E12 vg / kg). Clearly, the in vivo distribution of transgene mRNA was obtained from one representative mouse in the V7-LEP / ADIPOQ 8E10 group (Figure 7).

[0183] In summary, the data demonstrate that the manipulated Rec2 capsid variant V7, with F503Y, Y708D, and K709I substitutions, achieved selective transduction to adipose tissue and abolition of hepatic tropism upon systemic administration in mice. These substitutions could be applied to the AAV8 capsid to make the liver non-targeting, indicating that F503, Y708, and K709 are crucial for hepatic transduction. A single dose of V7-LEP / ADIPOQ resulted in reversal of metabolic abnormalities in a mouse model of congenital leptin deficiency at substantially lower doses than those commonly used for AAV systemic gene therapy. Further characterization and refinement of the V7 vector platform will provide a powerful toolkit enabling genetic manipulation of adipose tissue in basic research and gene therapy for adipose-derived diseases and other applications.

[0184] Details of experimental models and participating animals mouse Wild-type C57 / BL6 mice aged 12–18 weeks were purchased from Charles River Laboratories. Seven-week-old ob / ob mice in a C57 / BL6 background were purchased from Jackson Laboratories. All mice were housed in a temperature-controlled chamber (20–23°C) with a 12-hour light / 12-hour dark cycle. Mice were maintained on a standard diet (7912 rodent diet, Teklad) and with free access to food and water as needed. Male mice were used in all studies. All use of animals was approved and in accordance with Ohio State University Animal Care and Use Committee (IACUC) protocol approval 2012A00000060-R3.

[0185] Method details Capsid modification by site-directed mutagenesis Rec2 capsid V7 mutagenesis The Rec2 capsid was mutagenesized at the site shown in Figure 1A. The complete capsid sequences are listed in Figure 1B. The inventors named the Rec2 variants V1 to V8 in numerical order. The specified mutagenesis was performed using the GeneArt Site-Directed Mutagenesis Plus Kit (A14604, Invitrogen). The Rec2 capsid sequence is based on publicly available data (Charbel Issa, P., De Silva, SR, Lipinski, DM, Singh, MS, Mouravlev, A., You, Q., Barnard, AR, Hankins, MW, During, MJ, and Maclaren, RE (2013). Assessment of tropism and effectiveness of new primate-derived hybrid recombinant AAV serotypes in the mouse and primate retina. PLoS One 8, e60361.10.1371 / journal.pone.0060361). The following mutagenesis primers were synthesized using Sigma-Aldrich. F503Y(ACAACAATAGCAACTATGCCTGGACTGCTGG(SEQ ID NO: 32), CCAGCAGTCCAGGCATAGTTGCTATTGTTGT(SEQ ID NO: 33));Y708D and K709I(TACACCTCCAACTACGACATATCTACAAGTGTGGA(SEQ ID NO: 34), TCCACACTTGTAGATATGTCGTAGTTGGAGGTGTA(SEQ ID NO: 35)).

[0186] Mutagenesis was induced and carried out according to the manufacturer's instructions, and nucleotide substitutions at each site were confirmed by sequencing at the Core Facility of the Comprehensive Cancer Center, The Ohio State University. Furthermore, all capsids were sequenced to confirm the absence of unintended mutations.

[0187] AAV8 capsid mutation The Rec2 capsid was generated from capsid domain shuffling between rh20 and AAV8. The C-terminus of these three mutagenic amino acids, as shown for V7, is identical to that of the AAV8 capsid C-terminus. Therefore, AAV8 capsid mutagenesis of F503Y, Y708D, and K709I was performed in the same manner as described for V7 mutagenesis.

[0188] AAV Vector Packaging The rAAV vector skeleton contains a CBA (hybrid cytomegalovirus-chicken β-actin) promoter, a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE), and a bovine growth hormone polyadenylation signal adjacent to the AAV2 inverted terminal repeat. A reporter gene, referred to as high-sensitivity green fluorescent protein (GFP), or a therapeutic gene, consisting of 2A-linked human leptin cDNA and human adiponectin cDNA (referred to as LEP / ADIPOQ), was cloned into the polylinker region of the cis-plasmid. The LEP / ADIPOQ sequence was synthesized using IDT's gBlock. Plasmids used for viral packaging were prepared using EndoFree plasmid Maxi and Mega Kit (Qiagen). 293 human fetal kidney cells were co-transfected using standard CaPO4 transfection with three plasmids: an rAAV plasmid or cis plasmid, an AAV transplasmid encoding rep and cap genes including Rec2, Rec2.V1-V8, AAV8, and AAV8 variants, and the adenovirus helper pF Δ6. AAV was purified from cell lysates by ultracentrifugation via an iodixanol density gradient (OptiPrep density gradient medium, D1556, Sigma). AAV was titrated using quantitative PCR with a Step OnePlus real-time PCR system (Applied Biosystems) and Power SYBR Green PCR Master Mix (Applied Biosystems no. A25742).

[0189] Administration of AAV vector The AAV vector was administered to mice either by intravenous injection in 150 μL of diluted AAV buffer or by tail vein injection in 50 μL of diluted AAV buffer. Doses ranging from 2E10 to 8E10 vg / mouse were used and specified in each experiment in Figure Legend.

[0190] GFP content measurement GFP content was measured. Briefly, tissue was homogenized in ice-cold RIPA buffer (25 mM Tris-HCl pH 7.6, 150 mM NaCl, 1% NP-40, 1% sodium deoxycholate, 0.1% SDS) supplemented with a protease inhibitor cocktail, followed by brief sonication. The mixture was then spun at 13,000 rpm for 15 minutes at 4°C. The supernatant was collected. GFP fluorescence in 150 μL of supernatant was measured using a microreader (Synergy H1, Bio Tek Instrument) with an excitation wavelength of 485 nm and a cutoff emission wavelength of 528 nm. GFP content was expressed as a reading after subtracting autofluorescence from tissue corresponding to GFP-free tissue, and calibrated by either protein content or wet tissue weight in the sample.

[0191] ob / ob mouse experiment 7-week-old male homozygous ob / ob mouse (JAX 000632 B6.Cg-Lep ob Mice were randomly assigned to receive either V7-GFP or V7-LEP / ADIPOQ. Heterozygous ob / + mice of the same sex and age received AAV buffer as a separate control. Body weight and food intake were monitored weekly for a period of 9 weeks. One mouse from the V7-LEP / ADIPOQ 4E10 group and one mouse from the V7-LEP / ADIPOQ 8E10 group were excluded due to technical errors in administration.

[0192] Glucose tolerance test (GTT) Eight weeks after intravenous administration of the AAV vector, mice were injected with a glucose solution (1 mg of glucose per gram of body weight) via intravenous injection after an overnight fast and adequate water intake. Blood was collected from the tail at various time points, and blood glucose concentrations were measured using a portable glucose meter (Bayer Contour Next).

[0193] rectal temperature measurement Rectal temperature in ob / ob mice 8 weeks after ip administration of AAV vector was measured using a temperature probe (Physitemp, model BAT-12) with a lubricant (white petrolatum) at its tip.

[0194] Body composition analysis using EchoMRI Body composition of fat and lean mass was measured in unanesthetized, surviving mice 9 weeks after AAV injection using EchoMRI. EchoMRI imaging was performed at the Small Animal Imaging Core of The Dorothy M. Davis Heart & Lung Research Institute, Ohio State University, using a 3-in-1 Analyzer (EchoMRI LLC, Houston, TX) according to the manufacturer's instructions. Mice were subjected to a 5 Gauss magnetic field, and total body mass of fat, lean mass, free water, and total water was determined in separate cycles by comparison with a canola oil standard using the manufacturer's software.

[0195] Serum collection and analysis Trunk blood was collected during euthanasia, coagulated on ice, and centrifuged at 12,000 rpm for 15 minutes at 4°C. Serum was collected and stored at -20°C until further analysis. Serum human leptin (R&D Systems, no. DY398) and human adiponectin / Acrp30 (R&D Systems, no. DY1065) were assayed using the R&D Systems DuoSet ELISA kit. Mouse serum insulin was measured using the ALPCO ELISA kit (ALPCO no. 80-INSMSU-E01). Serum glucose levels were determined using the Caymen Chemical colorimetric assay (no. 10009582).

[0196] Liver lipid extraction and triglyceride assay Liver lipids were extracted from 50 mg of liver tissue from each animal using chloroform / methanol (2:1 v / v), followed by rinsing in 50 mM NaCl and CaCl2 (0.36 M) / methanol (1:1 v / v). Aliquots of the extracts were mixed with Triton X100 and cold acetone, then dried and redissolved in PBS. Liver triglyceride quantification was performed using the Caymen Chemical Triglyceride Assay Kit (Caymen Chemical, No. 10010303).

[0197] Immunoblot The tissue was homogenized in ice-cold Pierce RIPA buffer containing 1× Roche Phosstop and Calbiochem protease inhibitor cocktail III, and then subjected to brief sonication on ice. The tissue lysates were spun at 13,000 rpm for 15 minutes at 4°C. The supernatant was collected, and the protein concentration was assayed using the BCA protein assay kit (Piece). 20 μg of protein from each sample was loaded, separated by gradient gel (4–20%, Mini-PROTEAN TGX, Bio-Rad), and then transferred to a nitrocellulose membrane (BIO-RAD). The blots were incubated overnight at 4°C with the following primary antibodies: β-actin (Cell Signaling No. 4970, 1:1000) and GFP (Santa Cruz Biotechnology, sc-9986 HRP, 1:1000). Chemiluminescent signals were detected and visualized using the LI-COR Odyssey Fc imaging system (LI-COR Biotechnology, Lincoln, NE). Quantitative analysis was performed using Image Studio software version 5.2 (LI-COR Biotechnology).

[0198] Quantitative RT-PCR Total RNA was isolated using the RNeasy Mini kit (QIAGEN) by RNase-free DNase treatment. cDNA was reverse transcribed using Taqman reverse transcription reagent (Applied Biosystems). qPCR was performed on the StepOnePlus real-time PCR system using Power SYBR Green PCR Master Mix (Applied Biosystems). Primers were designed to detect GFP (GACTTCTTCAAGTCCGCCAT (SEQ ID NO: 36), TGTGGCTGTTGTAGTTGTACTC (SEQ ID NO: 37)), ADIPOQ (AGGCAGGAAAGGAGAACCT (SEQ ID NO: 38), GTGGAGCCATCATAGTGGT (SEQ ID NO: 39)), Gapdh (TCCCACTCTTCCACCTTCGA (SEQ ID NO: 40), TGCTGTAGCCGTATTCATTGTCA (SEQ ID NO: 41)), and Actinb (ACCCGCGAGCACAGCTT (SEQ ID NO: 42), ATATCGTCATCCATGGCGAACT (SEQ ID NO: 43)). The data was calibrated to Actinb, and 2 -ΔΔCT The method was used for quantification.

[0199] Viral vector copy number measurement To assess the intracellular distribution of the vector, the viral vector copy number was measured as previously described. Briefly, whole DNA from various tissues was isolated using the DNesay Blood and Tissue kit (Qiagen). GFP fragments were amplified and quantified by qPCR to determine the copy number of viral particles. 50 ng of DNA from each sample was used in either duplex or triplex form for real-time PCR. A mouse nuclear genomic DNA fragment of the GAPDH gene was used as a control for mouse gene DNA. Genomic DNA from untreated animals was also used as a negative control for comparison. Data are expressed as V7-GFP copies / 50 ng of genomic DNA.

[0200] Quantification and statistical analysis Data are expressed as mean ± SEM. Data were analyzed using GraphPad Prism 9. One-way ANOVA with Tukey post-hoc test was used for comparisons between three or four groups. Time-course data (BW, GTT) were analyzed using mixed ANOVA, and area under the curve was calculated where applicable. Normality was tested using the Shapiro-Wilk method. In the figures, * indicates a p-value < 0.05, and ** indicates a p-value < 0.01.

[0201] It will be apparent to those skilled in the art that various modifications and variations are possible in this disclosure without departing from the scope or spirit of the invention. Other embodiments of this disclosure will also be apparent to those skilled in the art, given the specification and practice of the methods disclosed herein. This specification and examples are intended to be illustrative only, and the true scope and spirit of the invention are set forth by the following claims.

[0202] [Table 1]

[0203] [Table 2]

[0204] [Table 3]

[0205] A yield of over 1E11 per 150mm plate is considered good packaging, while a yield of less than 1E10 per 150mm plate is considered insufficient packaging.

[0206] [Table 4]

[0207] array The nucleotides and amino acids in bold indicate the location of the substitution mutation.

[0208] [ka]

[0209] [ka] TIFF2026534123000021.tif81170

[0210] [ka]

[0211] [ka] TIFF2026534123000024.tif82170

[0212] [ka] TIFF2026534123000026.tif77170

[0213] [ka]

[0214] [ka]

[0215] [ka]

[0216] [ka]

[0217]

Chemical formula

[0218]

Chemical formula

[0219]

Chemical formula

[0220]

Chemical formula

[0221]

Chemical formula

[0222]

Chemical formula

[0223]

Chemical formula

[0224]

Chemical formula

[0225]

Chemical formula

[0226] Nucleotides in bold font indicate positions where the amino acid code is altered by mutagenesis. 1) 1508T->A (TTT->TAT) or Phe(F)->Tyr(Y) (F503Y) 2) 2124T->G (TAC->GAC) or Tyr(Y)->Asp(D) (Y708D) 3) 2127A->T (AAA->ATA) or Lys(K)->Iso-Ile(I) (K709I)

[0227]

Chem.

[0228]

Chem.

[0229]

Chem.

[0230]

Chem.

[0231]

Chem.

[0232]

Chem.

[0233]

Chem.

[0234]

Chem.

[0235]

Chem.

[0236]

change

[0237]

change

[0238]

change

[0239]

change

[0240]

change

Claims

1. An engineered adeno-associated virus (AAV) capsid protein comprising amino acid substitutions at one or more amino acid residues that cause abolition of hepatotropy or disruption of AAV binding to hepatocytes.

2. The manipulated AAV capsid protein according to claim 1, wherein the one or more amino acid substitutions correspond to residues 503, 708, and / or 709 of SEQ ID NO: 1 or SEQ ID NO: 6, or any combination thereof.

3. The manipulated AAV capsid protein according to claim 1 or 2, wherein the amino acid substitution comprises F503Y, F503T, F503K, Y708D, Y708E, K709I, K709L, and / or K709G, or any combination thereof.

4. The manipulated AAV capsid protein according to claim 3, wherein the amino acid substitution comprises F503Y, Y708D or Y708E, and K709I.

5. The manipulated AAV capsid protein according to any one of claims 1 to 4, wherein the one or more amino acid substitutions are encoded by nucleic acid substitutions corresponding to positions 1508, 2127, 2124, or any combination thereof in SEQ ID NO: 2 or SEQ ID NO:

5.

6. The manipulated AAV capsid protein according to any one of claims 1 to 4, wherein the capsid protein is recombinant 2 (Rec2) or AAV8 capsid protein.

7. The manipulated capsid protein according to any one of claims 1 to 4, wherein the capsid protein comprises the AAV9 capsid protein, and the amino acid substitutions corresponding to residues 503, 708, and / or 709 of SEQ ID NO: 1 or SEQ ID NO: 6 comprises residues 501, 713, and / or 714 of SEQ ID NO:

31.

8. The manipulated AAV9 capsid protein according to claim 7, wherein the amino acid substitution comprises F501Y, Y713D, and / or K714I, or any combination thereof.

9. The manipulated AAV capsid protein according to any one of claims 1 to 8, wherein the capsid protein comprises the sequence described in SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 44 or a variant thereof.

10. An adeno-associated virus (AAV) vector encoding the capsid protein according to any one of claims 1 to 9.

11. The AAV vector according to claim 9, wherein the vector comprises the nucleic acid sequence described in SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 18, or a variant thereof.

12. The AAV vector according to claim 10 or 11, wherein the AAV vector does not transduce into liver tissue.

13. The AAV vector according to any one of claims 10 to 12, wherein the AAV vector comprises a transgene.

14. The AAV vector according to claim 13, wherein the introduced gene is a leptin gene.

15. The AAV vector according to claim 13, wherein the introduced gene is the IL-15 gene or the IL-15 / IL15R complex gene.

16. The AAV vector according to claim 13, wherein the introduced gene is the FGF21 gene.

17. The AAV vector according to claim 13, wherein the introduced gene is a therapeutic gene that links leptin and adiponectin by a 2A sequence.

18. The AAV vector according to claim 13, wherein the introduced gene is a synthetic microRNA that targets leptin.

19. A method for reducing the hepatotropy of an adeno-associated virus (AAV) vector, wherein the AAV vector encodes an engineered AAV capsid protein, and the method comprises substituting one or more amino acids corresponding to amino acid residues 503, 708, and / or 709 of SEQ ID NO: 1 or SEQ ID NO:

6.

20. The method according to claim 19, wherein the amino acid substitution includes F503Y, F503T, F503K, Y708D, Y708E, K709I, K709L, and / or K709G, or any combination thereof.

21. The method according to claim 20, wherein the amino acid substitution comprises F503Y, Y708D or Y708E, and K709I.

22. The method according to any one of claims 19 to 21, further comprising introducing SEQ ID NO: 2 or SEQ ID NO: 5 into the AAV vector, wherein SEQ ID NO: 2 or SEQ ID NO: 5 comprises a nucleic acid substitution at codon position 1508, 2127, 2124, or any combination thereof, and the nucleic acid substitution occurs at a nucleotide that causes a loss of hepatotropy or disrupts AAV binding to hepatocytes.

23. The method according to claim 22, wherein the capsid protein is recombinant 2 (Rec2) or AAV8 capsid protein.

24. The method according to claim 19, wherein the AAV vector encodes an engineered adeno-associated virus (AAV) 9 (AAV9) capsid protein, and the amino acid substitutions corresponding to residues 503, 708, and / or 709 of SEQ ID NO: 1 or SEQ ID NO: 6 include residues 501, 713, and / or 714 of SEQ ID NO:

31.

25. The method according to claim 24, wherein the amino acid substitution includes F501Y, Y713D, or K714I, or any combination thereof.

26. AAV capsid protein prepared by the method described in any one of claims 19 to 25.

27. A method for delivering a gene to target adipose tissue, comprising administering to the target a modified AAV vector according to any one of claims 10 to 18.

28. A method for treating a metabolic disorder or disease in a subject, comprising administering to the subject an engineered AAV vector according to any one of claims 10 to 18.

29. A method for treating cancer in a subject, comprising administering to an engineered AAV vector as described in any one of claims 10 to 18.

30. The method according to any one of claims 27 to 29, wherein the manipulated AAV vector encodes a manipulated adeno-associated virus (AAV) recombinant 2 (Rec2), AAV8, or AAV9 capsid protein.

31. The method according to any one of claims 27 to 30, wherein the manipulated adeno-associated virus (AAV) capsid protein comprises amino acid substitutions to one or more amino acids corresponding to amino acid residues 503, 708, and / or 709 of SEQ ID NO: 1 or SEQ ID NO:

6.

32. The method according to claim 31, wherein the amino acid substitution includes F503Y, F503T, F503K, Y708D, Y708E, K709I, K709L, and / or K709G, or any combination thereof.

33. The method according to claim 32, wherein the amino acid substitution comprises F503Y, Y708D or Y708E, and K709I.

34. The method according to claim 33, wherein the capsid protein is recombinant 2 (Rec2) or AAV8 capsid protein.

35. The method according to claim 31, wherein the capsid protein comprises the AAV9 capsid protein, and the amino acid substitutions corresponding to residues 503, 708, and / or 709 of SEQ ID NO: 1 or SEQ ID NO: 6 comprises residues 501, 713, and / or 714 of SEQ ID NO:

31.

36. The method according to claim 35, wherein the amino acid substitution includes F501Y, Y713D, and / or K714I, or any combination thereof.

37. The method according to any one of claims 27 to 36, wherein the amino acid substitution occurs at a residue that eliminates hepatotropy or disrupts AAV binding to hepatocytes.

38. The method according to any one of claims 27 to 37, wherein the AAV capsid protein includes the sequence described in SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, or SEQ ID NO:

44.

39. The method according to any one of claims 27 to 38, wherein the AAV vector encodes a transgene or a therapeutic agent.

40. The method according to claim 39, wherein the metabolic disorder or disease includes diabetes mellitus, obesity, metabolic syndrome, congenital leptin deficiency, or lipodystrophy.

Images