Oligonucleotide composition and method therefor

Abstract

In particular, this disclosure provides oligonucleotide compositions and methods thereof. In some embodiments, the oligonucleotides include various chemical modifications of sugars, nucleic acid bases, and / or internucleotide bonds and their patterns, and are useful for exon skipping. In some embodiments, this disclosure provides techniques useful for skipping exon 45 of dystrophin (DMD) transcripts. In some embodiments, this disclosure provides techniques useful for modulating DMD transcript splicing. In some embodiments, this disclosure provides methods for preventing or treating conditions, disorders, or diseases, including Duchenne muscular dystrophy.

Description

[Technical Field]

[0001] Cross-reference of related applications This application claims priority to U.S. Provisional Application No. 63 / 586,371, filed on 28 September 2023, which is incorporated herein by reference in its entirety. [Background technology]

[0002] Oligonucleotides are useful in a variety of applications, such as therapy, diagnosis, and / or research. For example, oligonucleotides that target various genes may be useful in treating conditions, disorders, or diseases associated with such target genes. [Overview of the Initiative]

[0003] In particular, this disclosure encompasses the recognition that structural elements of oligonucleotides, such as nucleotide sequence, chemical modifications (e.g., modifications of sugars, bases, and / or internucleotide bonds and their patterns) and / or stereochemistry (e.g., stereochemistry of skeletal chiral centers (chiral internucleotide bonds) and / or their patterns), can have a significant impact on the properties of oligonucleotides, such as exon skipping (e.g., exon 45 of DMD), toxicity, delivery, stability, and protein binding characteristics. In some embodiments, this disclosure provides oligonucleotides having a specific number of PN bonds at certain specific positions. Such PN bonds, in combination with other structural features of such oligonucleotides (e.g., 2'-F modified sugars, 2'-OMe modified sugars, phosphorothioate internucleotide bonds, natural phosphate bonds, the stereochemistry of bound phosphorus, etc.), can provide useful therapeutic profiles, such as pharmacokinetic and pharmacodynamic profiles including delivery, distribution, stability, exon skipping efficiency, and toxicity, so that such oligonucleotides may be used to treat conditions, disorders, or diseases, including DMD.

[0004] In some embodiments, the present disclosure provides oligonucleotides or oligonucleotide compositions that can mediate the skipping of exons of the DMD gene, for example, exon 45, and are useful for the treatment of muscular dystrophy. In some embodiments, the oligonucleotides or oligonucleotide compositions are useful for the treatment of muscular dystrophy. In some embodiments, the oligonucleotides are oligonucleotides disclosed herein (e.g., Table 1, e.g., Table 1A, Table 1B, Table 1C). In some embodiments, the oligonucleotide composition is a composition comprising oligonucleotides disclosed herein (e.g., Table 1, e.g., Table 1A, Table 1B, Table 1C). In some embodiments, the oligonucleotide composition is a chiral-controlled oligonucleotide composition comprising oligonucleotides disclosed herein (e.g., Table 1, e.g., Table 1A, Table 1B, Table 1C).

[0005] In particular, this disclosure provides oligonucleotides and compositions thereof that demonstrate various advantages and improvements. For example, as demonstrated herein, certain oligonucleotides and compositions demonstrate not only high levels of exon skipping but also high levels of stability and low toxicity when evaluated in a variety of assays.

[0006] In some embodiments, the Disclosure provides oligonucleotides wherein the oligonucleotide sequence comprises 15 or more consecutive nucleic acid bases of the complement of a DMD transcript, for example, 20 consecutive nucleic acid bases, and the oligonucleotide comprises 4 or more PN (phosphorylguanidine, for example, n001) internucleotide bonds, for example, 4 PN internucleotide bonds, and the oligonucleotide comprises a PN internucleotide bond between the 5' terminal (+1) nucleoside and the immediately downstream (+2) nucleoside, and / or a PN internucleotide bond between the 3' terminal (N) nucleoside and the second to last (N-1) nucleoside, for example, the oligonucleotide comprises a PN internucleotide bond between the 5' terminal (+1) nucleoside and the immediately downstream (+2) nucleoside, and the oligonucleotide does not comprise a PN internucleotide bond between the 3' terminal (N) nucleoside and the second to last (N-1) nucleoside. In some embodiments, the PN nucleotide bond between the 5'-terminal (+1) nucleoside and the immediately downstream (+2) nucleoside is in the Rp configuration. In some embodiments, all PN nucleotide bonds are in the Rp configuration. In some embodiments, the 5'-terminal (+1) nucleoside and / or the 3'-terminal (N) nucleoside of the oligonucleotide include a modified sugar moiety, e.g., a 2'-OMe modification, for example, the 5'-terminal (+1) nucleoside includes a 2'-OMe modification, and the 3'-terminal (N) nucleoside does not. In some embodiments, the oligonucleotide includes a PN nucleotide bond between the +3 nucleoside and the +4 nucleoside, a PN nucleotide bond between the +6 nucleoside and the +7 nucleoside, and / or a PN nucleotide bond between the +17 nucleoside and the +18 nucleoside. In some embodiments, the PN nucleotide bonds between the +3 nucleoside and the +4 nucleoside, the PN nucleotide bonds between the +6 nucleoside and the +7 nucleoside, and / or the PN nucleotide bonds between the +17 nucleoside and the +18 nucleoside are in the Rp configuration.In some embodiments, oligonucleotides are linked by PS (e.g., phosphorothioate) bonds between +2 nucleoside and +3 nucleoside, PS bonds between +4 nucleoside and +5 nucleoside, PS bonds between +5 nucleoside and +6 nucleoside, PS bonds between +8 nucleoside and +9 nucleoside, PS bonds between +9 nucleoside and +10 nucleoside, and PS bonds between +10 nucleoside and +11 nucleoside. The combination includes a PS bond between the +11 nucleoside and the +12 nucleoside, a PS bond between the +13 nucleoside and the +14 nucleoside, a PS bond between the +14 nucleoside and the +15 nucleoside, a PS bond between the +15 nucleoside and the +16 nucleoside, a PS bond between the +16 nucleoside and the +17 nucleoside, and a PS bond between the +18 nucleoside and the +19 nucleoside, each independently in, for example, an Sp configuration. In some embodiments, the oligonucleotide includes a PS bond between the 3'-terminal (N) nucleoside and the second-to-last (N-1) nucleoside, for example in an Sp configuration, or a PN bond in, for example, an Rp configuration. In some embodiments, the sugar moiety of the +7 nucleoside includes a 2'-OMe modification, the sugar moiety of the +10 nucleoside includes a 2'-OMe modification, the sugar moiety of the +12 nucleoside includes a 2'-OMe modification, and / or the sugar moiety of the +13 nucleoside includes a 2'-OMe modification. In some embodiments, the sugar moiety of the 3'-terminal (N) nucleoside includes a 2'-OMe modification. In some embodiments, the sugar moiety of the 3'-terminal (N) nucleoside includes a 2'-F modification.

[0007] In some embodiments, the present disclosure provides oligonucleotides wherein the nucleotide sequence of the oligonucleotide comprises 15 or more consecutive nucleic acid bases of the complement of a DMD transcript, for example, 20 consecutive nucleic acid bases, and the oligonucleotide comprises a PN (e.g., phosphorylguanidine, e.g., n001) internucleotide bond between the (+1) nucleoside at the 5' end of the Rp configuration and the (+2) nucleoside immediately downstream, a PN internucleotide bond between the +3 nucleoside and the +4 nucleoside at the Rp configuration, a PN internucleotide bond between the +6 nucleoside and the +7 nucleoside at the Rp configuration, and a PN internucleotide bond between the +17 nucleoside and the +18 nucleoside at the Rp configuration, and the sugar moiety of the (+1) nucleoside at the 5' end comprises a 2'-OMe modification. In some embodiments, the disclosure provides oligonucleotides wherein the nucleotide sequence of the oligonucleotide comprises 15 or more consecutive nucleic acid bases of the complement of the DMD transcript, for example, 20 consecutive nucleic acid bases, and the oligonucleotide comprises a PN nucleotide bond between the (+1) nucleoside at the 5' end of the Rp configuration and the (+2) nucleoside immediately downstream, a PN nucleotide bond between the +3 nucleoside and the +4 nucleoside at the Rp configuration, a PN nucleotide bond between the +6 nucleoside and the +7 nucleoside at the Rp configuration, and a PN nucleotide bond between the +17 nucleoside and the +18 nucleoside at the Rp configuration, and the sugar moiety of the (+1) nucleoside at the 5' end comprises a 2'-F modification.In some embodiments, the oligonucleotide has PS (e.g., phosphorothioate) linkages between the Sp-configured +2 nucleoside and +3 nucleoside, PS linkages between the Sp-configured +4 nucleoside and +5 nucleoside, PS linkages between the Sp-configured +5 nucleoside and +6 nucleoside, PS linkages between the Sp-configured +8 nucleoside and +9 nucleoside, PS linkages between the Sp-configured +9 nucleoside and +10 nucleoside, and PS linkages between the Sp-configured +10 nucleoside and +11 nucleoside. The oligonucleotide includes PS bonds between osides, PS bonds between the Sp-configured +11 nucleoside and +12 nucleoside, PS bonds between the Sp-configured +13 nucleoside and +14 nucleoside, PS bonds between the Sp-configured +14 nucleoside and +15 nucleoside, PS bonds between the Sp-configured +15 nucleoside and +16 nucleoside, PS bonds between the Sp-configured +16 nucleoside and +17 nucleoside, and PS bonds between the Sp-configured +18 nucleoside and +19 nucleoside. In some embodiments, the oligonucleotide includes a PS bond between the Sp-configured 3'-terminal (N) nucleoside and the second-to-last (N-1) nucleoside. In some embodiments, the oligonucleotide includes a PN bond between the Rp-configured 3'-terminal (N) nucleoside and the second-to-last (N-1) nucleoside. In some embodiments, the sugar moiety of the +7 nucleoside includes a 2'-OMe modification, the sugar moiety of the +10 nucleoside includes a 2'-OMe modification, the sugar moiety of the +12 nucleoside includes a 2'-OMe modification, and the sugar moiety of the +13 nucleoside includes a 2'-OMe modification. In some embodiments, the sugar moiety of the 3'-terminal (N) nucleoside includes a 2'-OMe modification. In some embodiments, the sugar moiety of the 3'-terminal (N) nucleoside includes a 2'-F modification.

[0008] In some embodiments, the oligonucleotide is [fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001].[fl2r](A)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001].m(A)p.[fl2r](C)[Ssp].[fl2r](A)[Ssp].m(G)[Ssp].[fl2r](U)[Ssp].m(U)p.m(U)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](G)[n001].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)、 [fl2r](G)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[n001].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001].m(A)p.[fl2r](C)[Ssp].[fl2r](A)[Ssp].m(A)[Ssp].[fl2r](C)[Ssp].m(A)p.m(G)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](G)、 [fl2r](G)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[n001].[fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[n001].m(C)p.[fl2r](G)[Ssp].[fl2r](C)[Ssp].m(U)[Ssp].[fl2r](G)[Ssp].m(C)p.m(C)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[n001].[fl2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](C)、 [fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[n001].[fl2r](G)[Ssp].[fl2r](A)[Ssp].[fl2r](C)[n001].m(A)p.[fl2r](A)[Ssp].[fl2r](C)[Ssp].m(A)[Ssp].[fl2r](G)[Ssp].m(U)p.m(U)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[n001].[fl2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](U)、 [fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[n001].[fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](A)[n001].m(C)p.[fl2r](A)[Ssp].[fl2r](A)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp].m(G)p.m(U)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[n001].[fl2r](C)[Ssp].[fl2r](G)[Ssp].[fl2r](C)、 [fl2r](G)[n001].[fl2r](U)[Ssp].[fl2r](U)[n001].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001].m(A)p.[fl2r](C)[Ssp].[fl2r](A)[Ssp].m(A)[Ssp].[fl2r](C)[Ssp].m(A)p.m(G)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](G)、 [fl2r](U)[n001].[fl2r](U)[Ssp].[fl2r](C)[n001].[fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](A)[n001].m(C)p.[fl2r](A)[Ssp].[fl2r](A)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp].m(G)p.m(U)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[n001].[fl2r](C)[Ssp].[fl2r](G)[Ssp].[fl2r](C)、 [fl2r](U)[n001].[fl2r](C)[Ssp].[fl2r](U)[n001].[fl2r](G)[Ssp].[fl2r](A)[Ssp].[fl2r](C)[n001].m(A)p.[fl2r](A)[Ssp].[fl2r](C)[Ssp].m(A)[Ssp].[fl2r](G)[Ssp].m(U)p.m(U)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[n001].[fl2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](U)、 [fl2r](C)[n001].[fl2r](U)[Ssp].[fl2r](G)[n001].[fl2r](A)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001].m(A)p.[fl2r](C)[Ssp].[fl2r](A)[Ssp].m(G)[Ssp].[fl2r](U)[Ssp].m(U)p.m(U)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](G)[n001].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)、 [fl2r](G)[n001].[fl2r](U)[Ssp].[fl2r](U)[n001].[fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[n001].m(C)p.[fl2r](G)[Ssp].[fl2r](C)[Ssp].m(U)[Ssp].[fl2r](G)[Ssp].m(C)p.m(C)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[n001].[fl2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](C)、 [fl2r](G)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[n001].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001].m(A)p.[fl2r](C)[Ssp].[fl2r](A)[Ssp].m(A)[Ssp].[fl2r](C)[Ssp].m(A)p.m(G)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001].[fl2r](C)[Ssp].[fl2r](C)[n001].[fl2r](G)、 [fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[n001].[fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](A)[n001].m(C)p.[fl2r](A)[Ssp].[fl2r](A)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp].m(G)p.m(U)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[n001].[fl2r](C)[Ssp].[fl2r](G)[n001].[fl2r](C)、 [fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[n001].[fl2r](G)[Ssp].[fl2r](A)[Ssp].[fl2r](C)[n001].m(A)p.[fl2r](A)[Ssp].[fl2r](C)[Ssp].m(A)[Ssp].[fl2r](G)[Ssp].m(U)p.m(U)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[n001].[fl2r](G)[Ssp].[fl2r](C)[n001].[fl2r](U)、 [fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001].[fl2r](A)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001].m(A)p.[fl2r](C)[Ssp].[fl2r](A)[Ssp].m(G)[Ssp].[fl2r](U)[Ssp].m(U)p.m(U)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](G)[n001].[fl2r](C)[Ssp].[fl2r](U)[n001].[fl2r](G)、 [fl2r](G)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[n001].[fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[n001].m(C)p.[fl2r](G)[Ssp].[fl2r](C)[Ssp].m(U)[Ssp].[fl2r](G)[Ssp].m(C)p.m(C)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[n001].[fl2r](G)[Ssp].[fl2r](C)[n001].[fl2r](C)、 [fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[n001].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001].m(A)p.[fl2r](U)[Ssp].[fl2r](G)[Ssp].m(C)[Ssp].[fl2r](C)[Ssp].m(A)p.m(U)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001].[fl2r](G)[Ssp].[fl2r](A)[Ssp].[fl2r](G)、 [fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001].[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001].m(C)p.[fl2r](C)[Ssp].[fl2r](A)[Ssp].m(U)[Ssp].[fl2r](C)[Ssp].m(C)p.m(U)[Ssp].[fl2r](G)[Ssp].[fl2r](G)[Ssp].[fl2r](A)[Ssp].[fl2r](G)[n001].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](C)、 [fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001].m(U)p.[fl2r](C)[Ssp].[fl2r](C)[Ssp].m(U)[Ssp].[fl2r](G)[Ssp].m(G)p.m(A)[Ssp].[fl2r](G)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[n001].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)、 [fl2r](U)[n001].[fl2r](G)[Ssp].[fl2r](C)[n001].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001].m(A)p.[fl2r](U)[Ssp].[fl2r](G)[Ssp].m(C)[Ssp].[fl2r](C)[Ssp].m(A)p.m(U)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001].[fl2r](G)[Ssp].[fl2r](A)[Ssp].[fl2r](G)、 [fl2r](C)[n001].[fl2r](C)[Ssp].[fl2r](A)[n001].[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001].m(C)p.[fl2r](C)[Ssp].[fl2r](A)[Ssp].m(U)[Ssp].[fl2r](C)[Ssp].m(C)p.m(U)[Ssp].[fl2r](G)[Ssp].[fl2r](G)[Ssp].[fl2r](A)[Ssp].[fl2r](G)[n001].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](C)、 [fl2r](A)[n001].[fl2r](U)[Ssp].[fl2r](G)[n001].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001].m(U)p.[fl2r](C)[Ssp].[fl2r](C)[Ssp].m(U)[Ssp].[fl2r](G)[Ssp].m(G)p.m(A)[Ssp].[fl2r](G)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[n001].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)、 [fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[n001].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001].m(A)p.[fl2r](U)[Ssp].[fl2r](G)[Ssp].m(C)[Ssp].[fl2r](C)[Ssp].m(A)p.m(U)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001].[fl2r](G)[Ssp].[fl2r](A)[n001].[fl2r](G)、 [fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001].[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001].m(C)p.[fl2r](C)[Ssp].[fl2r](A)[Ssp].m(U)[Ssp].[fl2r](C)[Ssp].m(C)p.m(U)[Ssp].[fl2r](G)[Ssp].[fl2r](G)[Ssp].[fl2r](A)[Ssp].[fl2r](G)[n001].[fl2r](U)[Ssp].[fl2r](U)[n001].[fl2r](C)、 [fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001].m(U)p.[fl2r](C)[Ssp].[fl2r](C)[Ssp].m(U)[Ssp].[fl2r](G)[Ssp].m(G)p.m(A)[Ssp].[fl2r](G)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[n001].[fl2r](C)[Ssp].[fl2r](U)[n001].[fl2r](G)、 [fl2r](G)[n001R].[fl2r](U)[Ssp].[fl2r](U)[n001R].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001R].m(A)p.[fl2r](C)[Ssp].[fl2r](A)[Ssp].m(A)[Ssp].[fl2r](C)[Ssp].m(A)p.m(G)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001R].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](G)、 [fl2r](C)[n001R].[fl2r](U)[Ssp].[fl2r](G)[n001R].[fl2r](A)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001R].m(A)p.[fl2r](C)[Ssp].[fl2r](A)[Ssp].m(G)[Ssp].[fl2r](U)[Ssp].m(U)p.m(U)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](G)[n001R].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)、 [fl2r](G)[n001R].[fl2r](U)[Ssp].[fl2r](U)[n001R].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001R].m(A)p.[fl2r](C)[Ssp].[fl2r](A)[Ssp].m(A)[Ssp].[fl2r](C)[Ssp].m(A)p.m(G)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001R].[fl2r](C)[Ssp].[fl2r](C)[Ssp].m(G)、 [fl2r](C)[n001R].[fl2r](U)[Ssp].[fl2r](G)[n001R].[fl2r](A)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001R].m(A)p.[fl2r](C)[Ssp].[fl2r](A)[Ssp].m(G)[Ssp].[fl2r](U)[Ssp].m(U)p.m(U)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](G)[n001R].[fl2r](C)[Ssp].[fl2r](U)[Ssp].m(G)、 [fl2r](U)[n001R].[fl2r](G)[Ssp].[fl2r](C)[n001R].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001R].m(A)p.[fl2r](U)[Ssp].[fl2r](G)[Ssp].m(C)[Ssp].[fl2r](C)[Ssp].m(A)p.m(U)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001R].[fl2r](G)[Ssp].[fl2r](A)[Ssp].m(G)、 [fl2r](A)[n001R].[fl2r](U)[Ssp].[fl2r](G)[n001R].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001R].m(U)p.[fl2r](C)[Ssp].[fl2r](C)[Ssp].m(U)[Ssp].[fl2r](G)[Ssp].m(G)p.m(A)[Ssp].[fl2r](G)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[n001R].[fl2r](C)[Ssp].[fl2r](U)[Ssp].m(G)、 m(G)[n001R].[fl2r](U)[Ssp].[fl2r](U)[n001R].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001R].m(A)p.[fl2r](C)[Ssp].[fl2r](A)[Ssp].m(A)[Ssp].[fl2r](C)[Ssp].m(A)p.m(G)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001R].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](G)、 m(C)[n001R].[fl2r](U)[Ssp].[fl2r](G)[n001R].[fl2r](A)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001R].m(A)p.[fl2r](C)[Ssp].[fl2r](A)[Ssp].m(G)[Ssp].[fl2r](U)[Ssp].m(U)p.m(U)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](G)[n001R].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)、 m(U)[n001R].[fl2r](G)[Ssp].[fl2r](C)[n001R].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001R].m(A)p.[fl2r](U)[Ssp].[fl2r](G)[Ssp].m(C)[Ssp].[fl2r](C)[Ssp].m(A)p.m(U)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001R].[fl2r](G)[Ssp].[fl2r](A)[Ssp].[fl2r](G)、 m(A)[n001R].[fl2r](U)[Ssp].[fl2r](G)[n001R].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001R].m(U)p.[fl2r](C)[Ssp].[fl2r](C)[Ssp].m(U)[Ssp].[fl2r](G)[Ssp].m(G)p.m(A)[Ssp].[fl2r](G)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[n001R].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)、 m(G)[n001R].[fl2r](U)[Ssp].[fl2r](U)[n001R].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001R].m(A)p.[fl2r](C)[Ssp].[fl2r](A)[Ssp].m(A)[Ssp].[fl2r](C)[Ssp].m(A)p.m(G)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001R].[fl2r](C)[Ssp].[fl2r](C)[Ssp].m(G)、 m(C)[n001R].[fl2r](U)[Ssp].[fl2r](G)[n001R].[fl2r](A)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001R].m(A)p.[fl2r](C)[Ssp].[fl2r](A)[Ssp].m(G)[Ssp].[fl2r](U)[Ssp].m(U)p.m(U)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](G)[n001R].[fl2r](C)[Ssp].[fl2r](U)[Ssp].m(G)、 m(U)[n001R].[fl2r](G)[Ssp].[fl2r](C)[n001R].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001R].m(A)p.[fl2r](U)[Ssp].[fl2r](G)[Ssp].m(C)[Ssp].[fl2r](C)[Ssp].m(A)p.m(U)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001R].[fl2r](G)[Ssp].[fl2r](A)[Ssp].m(G)、 m(A)[n001R].[fl2r](U)[Ssp].[fl2r](G)[n001R].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001R].m(U)p.[fl2r](C)[Ssp].[fl2r](C)[Ssp].m(U)[Ssp].[fl2r](G)[Ssp].m(G)p.m(A)[Ssp].[fl2r](G)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[n001R].[fl2r](C)[Ssp].[fl2r](U)[Ssp].m(G)、 [fl2r](U)[n001R].[fl2r](G)[Ssp].[fl2r](C)[n001R].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001R].m(A)p.[fl2r](U)[Ssp].[fl2r](G)[Ssp].m(C)[Ssp].[fl2r](C)[Ssp].m(A)p.m(U)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001R].[fl2r](G)[Ssp].[fl2r](A)[Ssp].[fl2r](G)、 [fl2r](A)[n001R].[fl2r](U)[Ssp].[fl2r](G)[n001R].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001R].m(U)p.[fl2r](C)[Ssp].[fl2r](C)[Ssp].m(U)[Ssp].[fl2r](G)[Ssp].m(G)p.m(A)[Ssp].[fl2r](G)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[n001R].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)、 [fl2r](G)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[n001R].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001R].m(A)p.[fl2r](C)[Ssp].[fl2r](A)[Ssp].m(A)[Ssp].[fl2r](C)[Ssp].m(A)p.m(G)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001R].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](G)、 [fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001R].[fl2r](A)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001R].m(A)p.[fl2r](C)[Ssp].[fl2r](A)[Ssp].m(G)[Ssp].[fl2r](U)[Ssp].m(U)p.m(U)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](G)[n001R].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)、 [fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[n001R].[fl2r](C)[Ssp].[fl2r] (C)[Ssp].[fl2r](A)[n001R].m(A)p.[fl2r](U)[Ssp].[fl2r](G)[Ssp].m(C)[Ss p].[fl2r](C)[Ssp].m(A)pm(U)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r] (U)[Ssp].[fl2r](G)[n001R].[fl2r](G)[Ssp].[fl2r](A)[Ssp].[fl2r](G), and [fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001R].[fl2r](C)[Ssp].[fl2r](C) [Ssp].[fl2r](A)[n001R].m(U)p.[fl2r](C)[Ssp].[fl2r](C)[Ssp].m(U)[Ssp].[f l2r](G)[Ssp].m(G)pm(A)[Ssp].[fl2r](G)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[n001R].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G), or selected from its salts, In the formula, [fl2r] represents a 2'-F modified nucleoside, m represents a 2'-OMe modified nucleoside, p represents a phosphodiester, [Ssp] represents a phosphorothioate in the Sp configuration, and [n001] represents [ka] [n001R] represents [n001], and phosphorus is in the Rp configuration.

[0009] In some embodiments, as shown herein, the techniques provided (e.g., oligonucleotides, compositions, methods, etc.) are particularly useful for reducing the level of mutant mRNA (e.g., DMD transcripts containing harmful mutations) and / or the proteins encoded therein, and for increasing the level of repaired mRNA (e.g., DMD transcripts in which exon 45 is skipped to delete, correct, or compensate for harmful mutations) and / or the proteins encoded therein.

[0010] In some embodiments, the provided technique is particularly useful for regulating the splicing of DMD transcripts, for example, to increase the level of a desired splicing product and / or to decrease the level of an undesirable splicing product. In some embodiments, the provided technique is particularly useful for reducing the level of DMD transcripts (e.g., mutant DMD transcripts), such as premRNA, RNA, etc., and is often particularly useful for reducing the level of products resulting from or encoded by DMD transcripts, such as mRNA, polypeptides, proteins, etc. In some embodiments, premRNA or mRNA or RNA is transported from one cell compartment (e.g., nucleus, cytoplasm, etc.) to another cell compartment and / or modified by one or more enzymes.

[0011] For example, in some embodiments, the dystrophin gene may include an exon containing one or more mutations associated with muscular dystrophy (including, but not limited to, Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD)). In some embodiments, the disease-associated exon may include mutations within the exon (e.g., missense mutations, frameshift mutations, nonsense mutations, early stop codons, etc.). In some embodiments, the disclosure provides compositions and methods for effectively skipping disease-associated dystrophin exons while maintaining or restoring the read frame so that a shorter (e.g., truncated, e.g., internally truncated) but partially functional dystrophin (e.g., a variant) can be produced.

[0012] In some embodiments, the disclosure provides an oligonucleotide whose sequence comprises 10 or more consecutive nucleic acid bases complementary to the DMD transcript, and the oligonucleotide comprises 3 or more PN nucleotide interlinks. In some embodiments, the sequence of the oligonucleotide comprises 15 or more consecutive nucleic acid bases complementary to the DMD transcript. In some embodiments, the sequence of the oligonucleotide comprises 20 or more consecutive nucleic acid bases complementary to the DMD transcript. In some embodiments, the sequence of the oligonucleotide is the same as the equal-length portion in the DMD transcript complement. In some embodiments, the disclosure provides an oligonucleotide whose sequence comprises 10 or more consecutive nucleic acid bases complementary to the equal-length portion in the DMD transcript, and the oligonucleotide comprises 3 or more PN nucleotide interlinks. In some embodiments, the sequence of the oligonucleotide comprises 15 or more consecutive nucleic acid bases complementary to the equal-length portion in the DMD transcript. In some embodiments, the sequence of the oligonucleotide comprises 20 or more consecutive nucleic acid bases complementary to the equal-length portion in the DMD transcript. In some embodiments, the nucleotide sequence of the oligonucleotide is complementary to the nucleotide sequence of an equal-length portion in the DMD transcript. In some embodiments, the disclosure provides an oligonucleotide which can hybridize to an equal-length portion in the DMD transcript, and which comprises three or more PN nucleotide interbonds. In some embodiments, the DMD transcript is DMD mRNA. In some embodiments, the DMD transcript or its wild-type version encodes dystrophin. In some embodiments, the DMD transcript contains a mutation that allows exon 45 skipping.

[0013] In some embodiments, each nucleic acid base of the oligonucleotide is independently a nucleic acid base optionally substituted with a nucleic acid base selected from A, T, C, G, and U, or a tautomer optionally substituted with a nucleic acid base selected from A, T, C, G, and U. In some embodiments, each nucleic acid base of the oligonucleotide is independently A, T, C, 5mC, G, or U. In some embodiments, the length of the oligonucleotide is 20 or more nucleic acid bases. In some embodiments, the length of the oligonucleotide is 20 nucleic acid bases.

[0014] In some embodiments, the oligonucleotide contains 3, 4, 5, 6, or more PN nucleotide interbonds. In some embodiments, the oligonucleotide contains 4, 5, 6, or more PN nucleotide interbonds. In some embodiments, the oligonucleotide contains 3 or more PN nucleotide interbonds. In some embodiments, the oligonucleotide contains 4 or more PN nucleotide interbonds. In some embodiments, the oligonucleotide contains 5 or more PN nucleotide interbonds. In some embodiments, the oligonucleotide contains 6 or more PN nucleotide interbonds. In some embodiments, the oligonucleotide contains 3, 4, 5, 6, or more Rp PN nucleotide interbonds. In some embodiments, the oligonucleotide contains 4, 5, 6, or more Rp PN nucleotide interbonds. In some embodiments, the oligonucleotide contains 3 or more Rp PN nucleotide interbonds. In some embodiments, the oligonucleotide contains 4 or more Rp PN nucleotide interbonds. In some embodiments, the oligonucleotide contains 5 or more Rp PN nucleotide interbonds. In some embodiments, the oligonucleotide contains 6 or more Rp PN nucleotide interbonds. In some embodiments, each PN nucleotide interbond is an Rp PN nucleotide interbond. In some embodiments, the oligonucleotide contains 3, 4, 5, 6, or more phosphorylguanidine nucleotide bonds. In some embodiments, the oligonucleotide contains 4, 5, 6, or more phosphorylguanidine nucleotide bonds. In some embodiments, the oligonucleotide contains 3 or more phosphorylguanidine nucleotide bonds. In some embodiments, the oligonucleotide contains 4 or more phosphorylguanidine nucleotide bonds. In some embodiments, the oligonucleotide contains 5 or more phosphorylguanidine nucleotide bonds. In some embodiments, the oligonucleotide contains 6 or more phosphorylguanidine nucleotide bonds. In some embodiments, each PN nucleotide bond is a phosphorylguanidine nucleotide bond.In some embodiments, the oligonucleotide contains 3, 4, 5, 6, or more Rp phosphorylguanidine nucleotide interbonds. In some embodiments, the oligonucleotide contains 4, 5, 6, or more Rp phosphorylguanidine nucleotide interbonds. In some embodiments, the oligonucleotide contains 3 or more Rp phosphorylguanidine nucleotide interbonds. In some embodiments, the oligonucleotide contains 4 or more Rp phosphorylguanidine nucleotide interbonds. In some embodiments, the oligonucleotide contains 5 or more Rp phosphorylguanidine nucleotide interbonds. In some embodiments, the oligonucleotide contains 6 or more Rp phosphorylguanidine nucleotide interbonds. In some embodiments, each phosphorylguanidine nucleotide interbond is an Rp phosphorylguanidine nucleotide interbond. In some embodiments, the oligonucleotide contains 3, 4, 5, 6, or more n001 nucleotide interbonds. In some embodiments, the oligonucleotide contains 4, 5, 6, or more n001 nucleotide interbonds. In some embodiments, the oligonucleotide contains 3 or more n001 nucleotide interbonds. In some embodiments, the oligonucleotide contains four or more n001 nucleotide interbonds. In some embodiments, the oligonucleotide contains five or more n001 nucleotide interbonds. In some embodiments, the oligonucleotide contains six or more n001 nucleotide interbonds. In some embodiments, each phosphorylguanidine nucleotide interbond is an n001 nucleotide interbond. In some embodiments, the oligonucleotide contains three, four, five, six, or more Rp n001 nucleotide interbonds. In some embodiments, the oligonucleotide contains four, five, six, or more Rp n001 nucleotide interbonds. In some embodiments, the oligonucleotide contains three or more Rp n001 nucleotide interbonds. In some embodiments, the oligonucleotide contains four or more Rp n001 nucleotide interbonds.In some embodiments, the oligonucleotide contains five or more Rp n001 nucleotide interlinks. In some embodiments, the oligonucleotide contains six or more Rp n001 nucleotide interlinks. In some embodiments, each n001 nucleotide interlink is an Rp n001 nucleotide interlink.

[0015] In some embodiments, the nucleotide bonds between the first and second nucleosides of the oligonucleotide, between the third and fourth nucleosides, between the sixth and seventh nucleosides, between the seventeenth and eighteenth nucleosides, and / or between the last two nucleosides (in the 5' to 3' direction unless otherwise specified) are PN bonds. In some embodiments, the nucleotide bonds between the third and fourth nucleosides of the oligonucleotide, the sixth and seventh nucleosides, the seventeenth and eighteenth nucleosides, and the last two nucleosides are PN bonds. In some embodiments, the nucleotide bond between the first and second nucleosides of the oligonucleotide is a PN bond. In some embodiments, the nucleotide bond between the third and fourth nucleosides of the oligonucleotide is a PN bond. In some embodiments, the nucleotide bond between the sixth and seventh nucleosides of the oligonucleotide is a PN bond. In some embodiments, the nucleotide bond between the seventeenth and eighteenth nucleosides of the oligonucleotide is a PN bond. In some embodiments, the nucleotide bond between the last two nucleosides of the oligonucleotide is a PN bond.

[0016] In some embodiments, the oligonucleotide includes PS nucleotide interlinking. In some embodiments, the oligonucleotide includes 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more PS nucleotide interlinking. In some embodiments, the oligonucleotide includes PS nucleotide interlinking. In some embodiments, the oligonucleotide includes Sp PS nucleotide interlinking. In some embodiments, the oligonucleotide includes 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more Sp PS nucleotide interlinking. In some embodiments, each PS nucleotide interlinking is Sp. In some embodiments, each PS nucleotide interlinking is independently a phosphorothioate nucleotide interlinking. In some embodiments, the oligonucleotide includes phosphorothioate nucleotide interlinking. In some embodiments, the oligonucleotide includes 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more phosphorothioate nucleotide interlinking. In some embodiments, the oligonucleotide contains Sp phosphorothioate internucleotide bonds. In some embodiments, the oligonucleotide contains 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more Sp phosphorothioate internucleotide bonds. In some embodiments, each phosphorothioate internucleotide bond is independently Sp.

[0017] In some embodiments, an oligonucleotide comprises a first nucleoside and a second nucleoside, a second nucleoside and a third nucleoside, a fourth nucleoside and a fifth nucleoside, a fifth nucleoside and a sixth nucleoside, an eighth nucleoside and a ninth nucleoside, a ninth nucleoside and a tenth nucleoside, a tenth nucleoside and an eleventh nucleoside, an eleventh nucleoside and a twelfth nucleoside. The nucleotide internucleotide bonds between the rheoside, the 13th nucleoside and the 14th nucleoside, the 14th nucleoside and the 15th nucleoside, the 15th nucleoside and the 16th nucleoside, the 16th nucleoside and the 17th nucleoside, the 18th nucleoside and the 19th nucleoside, and / or the last two nucleotides (5' to 3' direction unless otherwise specified) are PS nucleotide internucleotide bonds. In some embodiments, the oligonucleotide consists of a second nucleoside and a third nucleoside, a fourth nucleoside and a fifth nucleoside, a fifth nucleoside and a sixth nucleoside, an eighth nucleoside and a ninth nucleoside, a ninth nucleoside and a tenth nucleoside, a tenth nucleoside and an eleventh nucleoside, an eleventh nucleoside and a twelfth nucleoside. The nucleotide internucleotide bonds between a nucleotide, the 13th nucleoside and the 14th nucleoside, the 14th nucleoside and the 15th nucleoside, the 15th nucleoside and the 16th nucleoside, the 16th nucleoside and the 17th nucleoside, the 18th nucleoside and the 19th nucleoside, and / or the last two nucleotides are PS nucleotide internucleotide bonds.In some embodiments, an oligonucleotide comprises a first nucleoside and a second nucleoside, a second nucleoside and a third nucleoside, a fourth nucleoside and a fifth nucleoside, a fifth nucleoside and a sixth nucleoside, an eighth nucleoside and a ninth nucleoside, a ninth nucleoside and a tenth nucleoside, a tenth nucleoside and an eleventh nucleoside The nucleotide bonds between the 11th and 12th nucleosides, the 13th and 14th nucleosides, the 14th and 15th nucleosides, the 15th and 16th nucleosides, the 16th and 17th nucleosides, and the 18th and 19th nucleosides are PS nucleotide bonds. In some embodiments, the nucleotide bond between the first and second nucleosides of the oligonucleotide is a PS nucleotide bond if it is not a PN bond. In some embodiments, the nucleotide bond between the second and third nucleosides of the oligonucleotide is a PS nucleotide bond. In some embodiments, the nucleotide bond between the fourth and fifth nucleosides of the oligonucleotide is a PS nucleotide bond. In some embodiments, the nucleotide bond between the fifth and sixth nucleosides of the oligonucleotide is a PS nucleotide bond. In some embodiments, the nucleotide bond between the eighth and ninth nucleosides of the oligonucleotide is a PS nucleotide bond. In some embodiments, the nucleotide bond between the ninth and tenth nucleosides of the oligonucleotide is a PS nucleotide bond. In some embodiments, the nucleotide bond between the tenth and eleventh nucleosides of the oligonucleotide is a PS nucleotide bond. In some embodiments, the nucleotide bond between the eleventh and twelfth nucleosides of the oligonucleotide is a PS nucleotide bond. In some embodiments, the nucleotide bond between the thirteenth and fourteenth nucleosides of the oligonucleotide is a PS nucleotide bond.In some embodiments, the nucleotide bond between the 14th and 15th nucleosides of the oligonucleotide is a PS nucleotide bond. In some embodiments, the nucleotide bond between the 15th and 16th nucleosides of the oligonucleotide is a PS nucleotide bond. In some embodiments, the nucleotide bond between the 16th and 17th nucleosides of the oligonucleotide is a PS nucleotide bond. In some embodiments, the nucleotide bond between the 18th and 19th nucleosides of the oligonucleotide is a PS nucleotide bond. In some embodiments, the nucleotide bond between the last two nucleosides of the oligonucleotide is a PS nucleotide bond if it is not a PN bond.

[0018] In some embodiments, the oligonucleotide contains PO internucleotide bonds. In some embodiments, the oligonucleotide contains two, three, four, five, or more PO internucleotide bonds. In some embodiments, each PO internucleotide bond is independently a native phosphate bond. In some embodiments, the oligonucleotide contains native phosphate internucleotide bonds. In some embodiments, the oligonucleotide contains two, three, four, five, or more native phosphate internucleotide bonds. In some embodiments, the internucleotide bond between the seventh and eighth nucleoside of the oligonucleotide is a PO internucleotide bond. In some embodiments, the internucleotide bond between the twelfth and thirteenth nucleoside of the oligonucleotide is a PO internucleotide bond.

[0019] In some embodiments, the oligonucleotides include sugar modifications. In some embodiments, the oligonucleotides include 2'-modified sugars. In some embodiments, the oligonucleotides include 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more 2'-modified sugars. In some embodiments, the oligonucleotides include 2'-F modified sugars. In some embodiments, the oligonucleotides include 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more 2'-F modified sugars. In some embodiments, the sugars of nucleosides 1, 2, 3, 4, 5, 6, 8, 9, 11, 14, 15, 16, 17, 18, 19, and 20 of the oligonucleotide are 2'-F modified sugars. In some embodiments, the oligonucleotides include 2'-OR modified sugars, where R is optionally substituted with a C1-C6 aliphatic. In some embodiments, the oligonucleotide comprises 2, 3, 4, 5, 6, 7, 8, 9, 10 or more 2'-OR modified sugars, where R is optionally substituted with a C1-C6 aliphatic molecule. In some embodiments, the sugars of nucleosides 7, 10, 12, and 13 of the oligonucleotide are independently 2'-OR modified sugars, where R is optionally substituted with a C1-C6 aliphatic molecule. In some embodiments, the oligonucleotide comprises 2'-OMe modified sugars. In some embodiments, the oligonucleotide comprises 2, 3, 4, 5, 6, 7, 8, 9, 10 or more 2'-OMe modified sugars. In some embodiments, the oligonucleotide comprises 2'-OR modified sugars that are 2'-OMe modified sugars.

[0020] In some embodiments, oligonucleotides can be hybridized to the region of the DMD transcript. In some embodiments, the region of the DMD transcript comprises GGCUUCAACUAUCUGAGUGA, where each U is optionally and independently replaced with T. In some embodiments, the region of the DMD transcript comprises CGGCAAACUGUUGUCAGAAC, where each U is optionally and independently replaced with T. In some embodiments, the region of the DMD transcript comprises GCGGCAAACUGUUGUCAGAA, where each U is optionally and independently replaced with T. In some embodiments, the region of the DMD transcript comprises AGCGGCAAACUGUUGUCAGA, where each U is optionally and independently replaced with T. In some embodiments, the region of the DMD transcript comprises CAGCGGCAAACUGUUGUCAG, where each U is optionally and independently replaced with T. In some embodiments, the region of the DMD transcript includes GGCAUUGGGCAGCGGCAAAC, where each U is optionally and independently replaced with T. In some embodiments, the region of the DMD transcript includes CUCCAGGAUGGCAUUGGGCA, where each U is optionally and independently replaced with T. In some embodiments, the region of the DMD transcript includes GAACUCCAGGAUGGCAUUGG, where each U is optionally and independently replaced with T. In some embodiments, the region of the DMD transcript includes CAGGAACUCCAGGAUGGCAU, where each U is optionally and independently replaced with T.

[0021] In some embodiments, the oligonucleotide sequence contains 10 or more consecutive nucleic acid bases complementary to 10 or more consecutive nucleic acid bases of the DMD transcript. In some embodiments, the oligonucleotide sequence contains 15 or more consecutive nucleic acid bases complementary to 10 or more consecutive nucleic acid bases of the DMD transcript. In some embodiments, the oligonucleotide sequence contains 10 or more consecutive nucleic acid bases complementary to 20 or more consecutive nucleic acid bases of the DMD transcript. In some embodiments, the oligonucleotide sequence contains 10 or more consecutive nucleic acid bases complementary to 10 or more consecutive nucleic acid bases of GGCUUCAACUAUCUGAGUGA, where each U is optionally and independently replaced with T. In some embodiments, the oligonucleotide sequence contains 15 or more consecutive nucleic acid bases complementary to 15 or more consecutive nucleic acid bases of GGCUUCAACUAUCUGAGUGA, where each U is optionally and independently replaced with T. In some embodiments, the oligonucleotide sequence contains 20 or more consecutive nucleic acid bases complementary to 20 or more consecutive nucleic acid bases of GGCUUCAACUAUCUGAGUGA, where each U is optionally and independently replaced with T. In some embodiments, the oligonucleotide sequence contains 10 or more consecutive nucleic acid bases complementary to 10 or more consecutive nucleic acid bases of CGGCAAACUGUUGUCAGAAC, where each U is optionally and independently replaced with T. In some embodiments, the oligonucleotide sequence contains 10 or more consecutive nucleic acid bases complementary to 15 or more consecutive nucleic acid bases of CGGCAAACUGUUGUCAGAAC, where each U is optionally and independently replaced with T. In some embodiments, the oligonucleotide sequence contains 20 or more consecutive nucleic acid bases complementary to 10 or more consecutive nucleic acid bases of CGGCAAACUGUUGUCAGAAC, where each U is optionally and independently replaced with T.In some embodiments, the oligonucleotide sequence contains 10 or more consecutive nucleic acid bases complementary to 10 or more consecutive nucleic acid bases of GCGGCAAACUGUUGUCAGAA, where each U is optionally and independently replaced with T. In some embodiments, the oligonucleotide sequence contains 15 or more consecutive nucleic acid bases complementary to 15 or more consecutive nucleic acid bases of GCGGCAAACUGUUGUCAGAA, where each U is optionally and independently replaced with T. In some embodiments, the oligonucleotide sequence contains 20 or more consecutive nucleic acid bases complementary to 20 or more consecutive nucleic acid bases of GCGGCAAACUGUUGUCAGAA, where each U is optionally and independently replaced with T. In some embodiments, the oligonucleotide sequence contains 10 or more consecutive nucleic acid bases complementary to 10 or more consecutive nucleic acid bases of AGCGGCAAACUGUUGUCAGA, where each U is optionally and independently replaced with T. In some embodiments, the oligonucleotide sequence contains 15 or more consecutive nucleic acid bases complementary to 15 or more consecutive nucleic acid bases of AGCGGCAAACUGUUGUCAGA, where each U is optionally and independently replaced with T. In some embodiments, the oligonucleotide sequence contains 20 or more consecutive nucleic acid bases complementary to 20 or more consecutive nucleic acid bases of AGCGGCAAACUGUUGUCAGA, where each U is optionally and independently replaced with T. In some embodiments, the oligonucleotide sequence contains 10 or more consecutive nucleic acid bases complementary to 10 or more consecutive nucleic acid bases of CAGCGGCAAACUGUUGUCAG, where each U is optionally and independently replaced with T. In some embodiments, the oligonucleotide sequence contains 15 or more consecutive nucleic acid bases complementary to 15 or more consecutive nucleic acid bases of CAGCGGCAAACUGUUGUCAG, where each U is optionally and independently replaced with T.In some embodiments, the oligonucleotide sequence contains 20 or more consecutive nucleic acid bases complementary to 20 or more consecutive nucleic acid bases of CAGCGGCAAACUGUUGUCAG, where each U is optionally and independently replaced with T. In some embodiments, the oligonucleotide sequence contains 10 or more consecutive nucleic acid bases complementary to 10 or more consecutive nucleic acid bases of GGCAUUGGGCAGCGGCAAAC, where each U is optionally and independently replaced with T. In some embodiments, the oligonucleotide sequence contains 15 or more consecutive nucleic acid bases complementary to 15 or more consecutive nucleic acid bases of GGCAUUGGGCAGCGGCAAAC, where each U is optionally and independently replaced with T. In some embodiments, the oligonucleotide sequence contains 20 or more consecutive nucleic acid bases complementary to 20 or more consecutive nucleic acid bases of GGCAUUGGGCAGCGGCAAAC, where each U is optionally and independently replaced with T. In some embodiments, the oligonucleotide sequence contains 10 or more consecutive nucleic acid bases complementary to 10 or more consecutive nucleic acid bases of CUCCAGGAUGGCAUUGGGCA, where each U is optionally and independently replaced with T. In some embodiments, the oligonucleotide sequence contains 15 or more consecutive nucleic acid bases complementary to 15 or more consecutive nucleic acid bases of CUCCAGGAUGGCAUUGGGCA, where each U is optionally and independently replaced with T. In some embodiments, the oligonucleotide sequence contains 20 or more consecutive nucleic acid bases complementary to 20 or more consecutive nucleic acid bases of CUCCAGGAUGGCAUUGGGCA, where each U is optionally and independently replaced with T. In some embodiments, the oligonucleotide sequence contains 10 or more consecutive nucleic acid bases complementary to 10 or more consecutive nucleic acid bases of GAACUCCAGGAUGGCAUUGG, where each U is optionally and independently replaced with T.In some embodiments, the oligonucleotide sequence contains 15 or more consecutive nucleic acid bases complementary to 15 or more consecutive nucleic acid bases of GAACUCCAGGAUGGCAUUGG, where each U is optionally and independently replaced with T. In some embodiments, the oligonucleotide sequence contains 20 or more consecutive nucleic acid bases complementary to 20 or more consecutive nucleic acid bases of GAACUCCAGGAUGGCAUUGG, where each U is optionally and independently replaced with T. In some embodiments, the oligonucleotide sequence contains 10 or more consecutive nucleic acid bases complementary to 10 or more consecutive nucleic acid bases of CAGGAACUCCAGGAUGGCAU, where each U is optionally and independently replaced with T. In some embodiments, the oligonucleotide sequence contains 15 or more consecutive nucleic acid bases complementary to 15 or more consecutive nucleic acid bases of CAGGAACUCCAGGAUGGCAU, where each U is optionally and independently replaced with T. In some embodiments, the oligonucleotide sequence contains 20 or more consecutive nucleic acid bases complementary to 20 or more consecutive nucleic acid bases of CAGGAACUCCAGGAUGGCAU, where each U is optionally and independently replaced with T.

[0022] In some embodiments, the oligonucleotide sequence contains 10 or more consecutive nucleic acid bases UCACUCAGAUAGUUGAAGCC, where each U is optionally and independently replaced with T. In some embodiments, the oligonucleotide sequence contains 15 or more consecutive nucleic acid bases UCACUCAGAUAGUUGAAGCC, where each U is optionally and independently replaced with T. In some embodiments, the oligonucleotide sequence contains UCACUCAGAUAGUUGAAGCC, where each U is optionally and independently replaced with T. In some embodiments, the oligonucleotide sequence is UCACUCAGAUAGUUGAAGCC. In some embodiments, the oligonucleotide sequence contains 10 or more consecutive nucleic acid bases GUUCUGACAACAGUUUGCCG, where each U is optionally and independently replaced with T. In some embodiments, the oligonucleotide sequence contains 15 or more consecutive nucleic acid bases GUUCUGACAACAGUUUGCCG, where each U is optionally and independently replaced with T. In some embodiments, the oligonucleotide sequence contains GUUCUGACAACAGUUUGCCG, where each U is optionally and independently replaced with T. In some embodiments, the oligonucleotide sequence is GUUCUGACAACAGUUUGCCG. In some embodiments, the oligonucleotide sequence contains 10 or more consecutive nucleic acid bases UUCUGACAACAGUUUGCCGC, where each U is optionally and independently replaced with T. In some embodiments, the oligonucleotide sequence contains 15 or more consecutive nucleic acid bases UUCUGACAACAGUUUGCCGC, where each U is optionally and independently replaced with T. In some embodiments, the oligonucleotide sequence contains UUCUGACAACAGUUUGCCGC, where each U is optionally and independently replaced with T. In some embodiments, the base sequence of the oligonucleotide is UUCUGACAACAGUUUGCCGC.In some embodiments, the oligonucleotide sequence contains 10 or more consecutive nucleic acid bases UCUGACAACAGUUUGCCGCU, where each U is optionally and independently replaced with T. In some embodiments, the oligonucleotide sequence contains 15 or more consecutive nucleic acid bases UCUGACAACAGUUUGCCGCU, where each U is optionally and independently replaced with T. In some embodiments, the oligonucleotide sequence contains UCUGACAACAGUUUGCCGCU, where each U is optionally and independently replaced with T. In some embodiments, the oligonucleotide sequence is UCUGACAACAGUUUGCCGCU. In some embodiments, the oligonucleotide sequence contains 10 or more consecutive nucleic acid bases CUGACAACAGUUUGCCGCUG, where each U is optionally and independently replaced with T. In some embodiments, the oligonucleotide sequence contains 15 or more consecutive nucleic acid bases CUGACACAGUUUGCCGCUG, where each U is optionally and independently replaced with T. In some embodiments, the oligonucleotide sequence contains CUGACACAGUUUGCCGCUG, where each U is optionally and independently replaced with T. In some embodiments, the oligonucleotide sequence is CUGACACAGUUUGCCGCUG. In some embodiments, the oligonucleotide sequence contains 10 or more consecutive nucleic acid bases GUUUGCCGCUGCCCAAUGCC, where each U is optionally and independently replaced with T. In some embodiments, the oligonucleotide sequence contains 15 or more consecutive nucleic acid bases GUUUGCCGCUGCCCAAUGCC, where each U is optionally and independently replaced with T. In some embodiments, the oligonucleotide sequence contains GUUUGCCGCUGCCCAAUGCC, where each U is optionally and independently replaced with T. In some embodiments, the base sequence of the oligonucleotide is GUUUGCCGCUGCCCAAUGCC.In some embodiments, the oligonucleotide sequence contains 10 or more consecutive nucleic acid bases UGCCCAAUGCCAUCCUGGAG, where each U is optionally and independently replaced with T. In some embodiments, the oligonucleotide sequence contains 15 or more consecutive nucleic acid bases UGCCCAAUGCCAUCCUGGAG, where each U is optionally and independently replaced with T. In some embodiments, the oligonucleotide sequence contains UGCCCAAUGCCAUCCUGGAG, where each U is optionally and independently replaced with T. In some embodiments, the oligonucleotide sequence is UGCCCAAUGCCAUCCUGGAG. In some embodiments, the oligonucleotide sequence contains 10 or more consecutive nucleic acid bases CCAAUGCCAUCCUGGAGUUC, where each U is optionally and independently replaced with T. In some embodiments, the oligonucleotide sequence contains 15 or more consecutive nucleic acid bases CCAAUGCCAUCCUGGAGUUC, where each U is optionally and independently replaced with T. In some embodiments, the oligonucleotide sequence contains CCAAUGCCAUCCUGGAGUUC, where each U is optionally and independently replaced with T. In some embodiments, the oligonucleotide sequence is CCAAUGCCAUCCUGGAGUUCUC. In some embodiments, the oligonucleotide sequence contains 10 or more consecutive nucleic acid bases AUGCCAUCUGGAGUUCCUG, where each U is optionally and independently replaced with T. In some embodiments, the oligonucleotide sequence contains 15 or more consecutive nucleic acid bases AUGCCAUCUGGAGUUCCUG, where each U is optionally and independently replaced with T. In some embodiments, the oligonucleotide sequence contains AUGCCAUCUGGAGUUCCUG, where each U is optionally and independently replaced with T. In some embodiments, the base sequence of the oligonucleotide is AUGCCAUCCUGGAGUUCCUG.

[0023] In some embodiments, the Disclosure provides chiral controlled oligonucleotide compositions comprising oligonucleotides described herein, wherein the compositions are concentrated compared to the preparation of substantially racemic oligonucleotides. In some embodiments, the Disclosure provides chiral controlled oligonucleotide compositions comprising a plurality of oligonucleotides, each of which oligonucleotides shares the same configuration, and at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of all oligonucleotides in the composition sharing the same configuration are the plurality of oligonucleotides. In some embodiments, the Disclosure provides chiral controlled oligonucleotide compositions comprising oligonucleotides described herein, wherein at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of all oligonucleotides in the composition sharing the same composition as the oligonucleotides are oligonucleotides. In some embodiments, the Disclosure provides oligonucleotide compositions comprising a plurality of oligonucleotides, each independently sharing 1) a common nucleotide sequence and 2) the same stereochemistry of the same binding phosphorus at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more chiral nucleotide interbondings, wherein the plurality of oligonucleotides are oligonucleotides described herein, and at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the oligonucleotides in a composition sharing a common nucleotide sequence are plurality of oligonucleotides. In some embodiments, the plurality of oligonucleotides independently share the same stereochemistry of the same binding phosphorus at each chiral nucleotide interbonding.In some embodiments, the Disclosure provides oligonucleotide compositions in which the levels of all oligonucleotides in the composition are, independently, oligonucleotides having the oligonucleotide structures described herein (e.g., in Table 1, e.g., Table 1A, Table 1B, Table 1C). In some embodiments, the levels are about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more of all oligonucleotides that share the same base sequence as the oligonucleotide having the structure or a pharmaceutically acceptable salt thereof. In some embodiments, the level is about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more of all oligonucleotides that share the same composition as the oligonucleotide having the structure or a pharmaceutically acceptable salt thereof. In some embodiments, the level is about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, based on the UV peak area at 260 nm.

[0024] In some embodiments, this disclosure provides a pharmaceutical composition comprising an oligonucleotide or oligonucleotide composition described herein. In some embodiments, the pharmaceutical composition comprises one or more pharmaceutically acceptable salts of an oligonucleotide. In some embodiments, the pharmaceutical composition is a solution.

[0025] In some embodiments, this disclosure provides methods for using oligonucleotides and compositions described herein. In some embodiments, this disclosure provides methods for altering the splicing of DMD transcripts in a system, comprising administering or delivering an effective amount of an oligonucleotide or composition described herein to the system. In some embodiments, this disclosure provides methods for providing DMD exon skipping in a system, comprising administering or delivering an effective amount of an oligonucleotide or composition described herein to the system. In some embodiments, this disclosure provides methods for increasing the level of DMD polypeptides in a system, comprising administering or delivering an effective amount of an oligonucleotide or composition described herein to the system. In some embodiments, this disclosure provides methods for increasing the level of DMD activity in a system, comprising administering or delivering an effective amount of an oligonucleotide or composition described herein to the system. In some embodiments, this disclosure provides methods. In some embodiments, this disclosure provides methods for treating muscular dystrophy, comprising administering or delivering an effective amount of an oligonucleotide or composition described herein from there to an affected subject.

[0026] In some embodiments, the present disclosure provides methods for producing or preparing oligonucleotides or compositions described herein. [Brief explanation of the drawing]

[0027] [Figure 1]The provided oligonucleotides can provide dose-dependent exon skipping. Oligonucleotides with various modifications, including binding modifications (e.g., PS, PN (e.g., phosphorylguanidine binding such as n001)), glycosylation modifications (e.g., 2'-F, 2'-OMe), and their stereochemistry and patterns, were designed and evaluated. H2K mdx cells were plated at 40,000 cells / well in 24-well plates coated with Matrigel and differentiation medium and differentiated for 4 days. After 4 days, differentiated cells were gymnotically treated with the indicated oligonucleotides targeting DMD at 3 μM, 1 μM, or 0.3 μM by refreshing the differentiation medium. After 3 hours of incubation, the oligonucleotide-containing medium was aspirated and replaced with fresh differentiation medium. Cells were differentiated for a further 4 days and then collected. RNA was recovered and transcribed to cDNA. Exon skipping was quantified by qPCR. For each oligonucleotide, the horizontal bars from top to bottom represent data from processing with the indicated oligonucleotide at concentrations of 3 μM, 1 μM, or 0.3 μM. The error bars represent SEM results. [Figure 2] The provided oligonucleotides are capable of providing exon skipping. Oligonucleotides with various modifications, including binding modifications (e.g., PS, PN (e.g., phosphorylguanidine binding such as n001)), glycosphing modifications (e.g., 2'-F, 2'-OMe), and their stereochemistry and patterns, were designed and evaluated. On day 1, patient-derived immortalized myoblasts containing deletions of DMD exons 48-50 were seeded at a predetermined density on Matrigel-coated plates in growth medium. On day 2, the medium was replaced with differentiation medium and the cells were differentiated for 4 days. On day 5, 10 μM of the indicated oligonucleotide was administered gymnotically to the cells. On day 6, the cells were collected, RNA was recovered, and transcribed to cDNA. Exon skipping was quantified using qPCR. Skipping efficiency (%) was calculated by normalizing to the housekeeper (SFRS9) and then dividing the skipped transcript by the total transcript. [Figure 3]The provided oligonucleotides are capable of providing exon skipping. Oligonucleotides with various modifications, including binding modifications (e.g., PS, PN (e.g., phosphorylguanidine binding such as n001)), glycosphing modifications (e.g., 2'-F, 2'-OMe), and their stereochemistry and patterns, were designed and evaluated. On day 1, patient-derived immortalized myoblasts containing deletions of DMD exons 48-50 were seeded at a predetermined density on Matrigel-coated plates in growth medium. On day 2, the medium was replaced with differentiation medium, and the cells were gymnotically administered with either 5 μM or 1 μM of the indicated oligonucleotide. The cells were differentiated for 4 days. On day 6, the cells were collected, RNA was recovered, and transcribed to cDNA. Exon skipping was quantified using qPCR. The left vertical bar for each oligonucleotide represents data from treatment with 5 μM of the indicated oligonucleotide, and the right vertical bar for each oligonucleotide represents data from treatment with 1 μM of the indicated oligonucleotide. Skipping efficiency (%) was calculated by normalizing to the housekeeper (SFRS9) and then dividing the skipped transcripts by the total transcripts. [Modes for carrying out the invention]

[0028] The technology of this disclosure may be more readily understood by referring to the following detailed description of a particular embodiment.

[0029] definition As used herein, unless otherwise indicated, the following definitions shall apply. For the purposes of this disclosure, chemical elements are identified according to the Periodic Table, CAS versions, and Handbook of Chemistry and Physics, 75th Ed. Furthermore, general principles of organic chemistry are described in “Organic Chemistry”, Thomas Sorrell, University Science Books, Sausalito: 1999, and “March's Advanced Organic Chemistry”, 5th Ed., Ed.: Smith, MB and March, J., John Wiley & Sons, New York: 2001.

[0030] Where used herein, unless otherwise clearly indicated by the context, (i) the term "a" or "an" may be understood to mean "at least one"; (ii) the term "or" may be understood to mean "and / or"; (iii) "comprising," "comprise," "including" (whether used with "not limited to"), and "include" (whether used with "not limited to") may be understood to encompass itemized components or processes, whether presented alone or with one or more additional components or processes; (iv) the term "another" may be understood to mean at least one additional / secondary; (v) the terms "about" and "approximately" may be understood to allow for standard variations as understood by those skilled in the art; and (vi) where a range is provided, the endpoint is included.

[0031] Unless otherwise specified, descriptions of oligonucleotides and their elements (e.g., base sequence, sugar modification, internucleotide bonding, stereochemistry of binding phosphorus, their pattern, etc.) are in the 5' to 3' direction. As those skilled in the art will understand, in some embodiments, oligonucleotides may be provided and / or utilized in salt form, particularly in pharmaceutically acceptable salt form, e.g., sodium salt. As those skilled in the art will also understand, in some embodiments, individual oligonucleotides in a composition may be considered to have the same composition and / or structure, even in such a composition (e.g., a liquid composition), and a particular such oligonucleotide may be in a different salt form (and may be dissolved, or the oligonucleotide chain may exist in an anionic form when, for example, the oligonucleotide chain is in a liquid composition). For example, those skilled in the art will understand that, at a given pH, individual internucleotide bonds along an oligonucleotide chain may be in an acid (H) form, or one of a plurality of possible salt forms (e.g., a sodium salt or a salt of a different cation, depending on which ions may be present in the preparation or composition), and that in their acid form (e.g., all cations, if present, are H) + You will understand that individual oligonucleotides can be appropriately considered to have the same composition and / or structure as long as they have the same composition and / or structure (replaced by ).

[0032] Aliphatic: As used herein, “aliphatic” means a straight (i.e., unbranched) or branched substituted or unsubstituted hydrocarbon chain that is fully saturated or contains one or more unsaturated units (but is not aromatic), or a substituted or unsubstituted monocyclic, bicyclic, or polycyclic hydrocarbon ring that is fully saturated or contains one or more unsaturated units (but is not aromatic), or a combination thereof. In some embodiments, the aliphatic group contains 1 to 50 aliphatic carbon atoms. In some embodiments, the aliphatic group contains 1 to 20 aliphatic carbon atoms. In other embodiments, the aliphatic group contains 1 to 10 aliphatic carbon atoms. In other embodiments, the aliphatic group contains 1 to 9 aliphatic carbon atoms. In other embodiments, the aliphatic group contains 1 to 8 aliphatic carbon atoms. In other embodiments, the aliphatic group contains 1 to 7 aliphatic carbon atoms. In other embodiments, the aliphatic group contains 1 to 6 aliphatic carbon atoms. In other embodiments, the aliphatic group comprises 1 to 5 aliphatic carbon atoms, and in yet another embodiment, the aliphatic group comprises 1, 2, 3, or 4 aliphatic carbon atoms. Suitable aliphatic groups include, but are not limited to, linear or branched substituted or unsubstituted alkyl, alkenyl, and alkynyl groups, as well as hybrids thereof such as (cycloalkyl)alkyl, (cycloalkenyl)alkyl, or (cycloalkyl)alkenyl.

[0033] Alkenyl: As used herein, the term "alkenyl" refers to an aliphatic group having one or more double bonds, as defined herein.

[0034] Alkyl: As used herein, the term “alkyl” is given its common meaning in the art and may include saturated aliphatic groups, including linear alkyl groups, branched alkyl groups, cycloalkyl (alicyclic) groups, alkyl-substituted cycloalkyl groups, and cycloalkyl-substituted alkyl groups. In some embodiments, alkyl groups have 1 to 100 carbon atoms. In certain embodiments, linear or branched alkyl groups have about 1 to 20 carbon atoms in their skeleton (for example, C1 to C1 for linear groups). 20Regarding the branching chain, C2~C 20 ) have, and alternatively, have about 1 to 10 carbon atoms. In some embodiments, the cycloalkyl ring has about 3 to 10 carbon atoms in its ring structure, where such a ring is monocyclic, dicyclic or polycyclic, and alternatively has about 5, 6 or 7 carbon atoms in its ring structure. In some embodiments, the alkyl group may be a lower alkyl group, which contains 1 to 4 carbon atoms (e.g., C1 to C4 in the case of a linear lower alkyl group).

[0035] Alkynyl: As used herein, the term "alkynyl" refers to an aliphatic group having one or more triple bonds, as defined herein.

[0036] Analogues: The term “analogue” includes any chemical part that is structurally different from a reference chemical part or class of parts, but is capable of performing at least one function of such reference chemical part or class of parts. Non-limiting examples include nucleotide analogues, which are structurally different from nucleotides but perform at least one function of nucleotides, and nucleic acid base analogues, which are structurally different from nucleic acid bases but perform at least one function of nucleic acid bases, and so on.

[0037] Animals: As used herein, the term “animal” refers to any member of the animal kingdom. In some embodiments, “animal” refers to a human at any developmental stage. In some embodiments, “animal” refers to a non-human animal at any developmental stage. In certain embodiments, a non-human animal is a mammal (e.g., rodents, mice, rats, rabbits, monkeys, dogs, cats, sheep, cattle, primates, and / or pigs). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, and / or insects. In some embodiments, animals may be transgenic animals, genetically modified animals, and / or clones.

[0038] Aryl: Used alone or as part of a larger phrase such as “aralkyl,” “aralkoxy,” or “aryloxyalkyl,” the term “aryl” as used herein refers to a monocyclic, bicyclic, or polycyclic ring system having a total of 5 to 30 ring members, wherein at least one ring in the system is aromatic. In some embodiments, the aryl group is a monocyclic, bicyclic, or polycyclic ring system having a total of 5 to 14 ring members, wherein at least one ring in the system is aromatic, and each ring in the system contains 3 to 7 ring members. In some embodiments, each monocyclic ring unit is aromatic. In some embodiments, the aryl group is a biaryl group. The term “aryl” may be used interchangeably with the term “aryl ring.” In certain embodiments of this disclosure, “aryl” refers to an aromatic ring system that may have one or more substituents, including but not limited to phenyl, biphenyl, naphthyl, binaphthyl, anthracyl, etc. As used herein, the term “aryl” includes groups in which an aromatic ring is condensed with one or more non-aromatic rings, such as indanyl, phthalimidyl, naphthimidyl, phenantridinyl, or tetrahydronaphthyl.

[0039] Characteristic parts: As used herein, the term “characteristic parts” means, in its broadest sense, a portion of a substance whose presence (or absence) correlates with the presence (or absence) of a particular feature, attribute, or activity of that substance. In some embodiments, a characteristic part of a substance is a portion found in the substance and in related substances that share a particular feature, attribute, or activity, but not in those that do not share that particular feature, attribute, or activity. In some particular embodiments, a characteristic part shares at least one functional feature with the intact substance. For example, in some embodiments, a “characteristic part” of a protein or polypeptide contains a sequence of amino acids, or a set of sequences of amino acids, that together are characteristic of the protein or polypeptide. In some embodiments, each of such sequences generally contains at least 2, 5, 10, 15, 20, 50, or more amino acids. Generally, a characteristic part of a substance (e.g., a protein, an antibody) shares at least one functional feature with the related intact substance, in addition to the sequence and / or structural identity specified above. In some embodiments, a characteristic part may be biologically active.

[0040] Chiral Control: As used herein, “chiral control” refers to the control of the stereochemical designation of the chiral phosphorus in the chiral internucleotide bond within an oligonucleotide. As used herein, a chiral internucleotide bond is an internucleotide bond in which the bound phosphorus is chiral. In some embodiments, control is achieved by a chiral element not present in the sugar and base portions of the oligonucleotide, for example, in some embodiments, control is achieved by the use of one or more chiral auxiliaries during oligonucleotide preparation, often being part of a chiral phosphoramidite used during oligonucleotide preparation. In contrast to chiral control, those skilled in the art will understand that conventional oligonucleotide synthesis without chiral auxiliaries cannot control the stereochemistry in the chiral internucleotide bond when such conventional oligonucleotide synthesis is used to form the chiral internucleotide bond. In some embodiments, the stereochemical designation of each chiral phosphorus in each chiral internucleotide bond within an oligonucleotide is controlled.

[0041] Chiral-controlled oligonucleotide compositions: As used herein, terms such as “chiral-controlled oligonucleotide composition” and “chiral-controlled nucleic acid composition” refer to a composition comprising multiple oligonucleotides (or nucleic acids) that share a common base sequence, wherein the multiple oligonucleotides (or nucleic acids) share the same binding phosphorus stereochemistry in one or more chiral internucleotide bonds (chiral-controlled or sterically defined internucleotide bonds, where the chiral binding phosphorus is Rp or Sp in the composition ("sterically defined") and not a random mixture of Rp and Sp as an unchiral-controlled internucleotide bond). In some embodiments, a chiral-controlled oligonucleotide composition comprises multiple oligonucleotides (or nucleic acids) that share 1) a common base sequence, 2) a common pattern of skeletal linkages, and 3) a common pattern of skeletal phosphorus modifications, wherein the multiple oligonucleotides (or nucleic acids) share the same binding phosphorus stereochemistry in one or more chiral internucleotide bonds (chiral-controlled or sterically defined internucleotide bonds, where the chiral binding phosphorus is Rp or Sp in the composition ("sterically defined") and not a random mixture of Rp and Sp as an unchiral-controlled internucleotide bond). The levels of multiple oligonucleotides (or nucleic acids) in a chiral-controlled oligonucleotide composition are predetermined / controlled or enriched compared to random levels in a non-chiral-controlled oligonucleotide composition (e.g., through chiral-controlled oligonucleotide preparation to stereoselectively form one or more chiral nucleotide bonds).In some embodiments, approximately 1% to 100% of all oligonucleotides in a chiral-controlled oligonucleotide composition (e.g., approximately 5% to 100%, 10% to 100%, 20% to 100%, 30% to 100%, 40% to 100%, 50% to 100%, 60% to 100%, 70% to 100%, 80% to 100%, 90% to 100%, 95% to 100%, 50% to 90%, or approximately 5%, 10%, 20%, 30%). %, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) are multiple oligonucleotides. In some embodiments, approximately 1% to 100% (e.g., approximately 5% to 100%, 10% to 100%, 20% to 100%, 30% to 100%, 40% to 100%, 50% to 100%, 60% to 100%, 70% to 100%, 80% to 100%, 90% to 100%, 95% to 100%, 50% to 9%) of all oligonucleotides in a chiral controlled oligonucleotide composition that share a common base sequence, a common pattern of skeletal bonding, and a common pattern of skeletal phosphorus modification. 0%, or approximately 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%), are multiple oligonucleotides.In some embodiments, the level is about 1% to 100% (e.g., about 5% to 1%) of all oligonucleotides in the composition, or all oligonucleotides in the composition that share a common base sequence (e.g., multiple oligonucleotides or oligonucleotide types), or all oligonucleotides in the composition that share a common base sequence, a common pattern of skeletal bonding, and a common pattern of skeletal phosphorus modification, or all oligonucleotides in the composition that share a common base sequence, a common pattern of base modification, a common pattern of sugar modification, a common pattern of internucleotide bond type, and / or a common pattern of internucleotide bond modification. 00%, 10%~100%, 20%~100%, 30%~100%, 40%~100%, 50%~100%, 60%~100%, 70%~100%, 80~100%, 90~100%, 95~100%, 50%~90%, or approximately 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, multiple oligonucleotides share the same stereochemistry in approximately 1 to 50 (e.g., approximately 1 to 10, 1 to 20, 5 to 10, 5 to 20, 10 to 15, 10 to 20, 10 to 25, 10 to 30, or approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) chiral nucleotide interbondings.In some embodiments, multiple oligonucleotides constitute approximately 1% to 100% of the chiral nucleotide interbonding (e.g., approximately 5% to 100%, 10% to 100%, 20% to 100%, 30% to 100%, 40% to 100%, 50% to 100%, 60% to 100%, 70% to 100%, 80% to 100%, 90% to 100%, 95% to 100%, 50% to 90%, or approximately 5%, 10%, 15%). 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% or at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%) have the same stereochemistry. In some embodiments, multiple oligonucleotides (or nucleic acids) share the same pattern of sugar and / or nucleic acid base modifications in all of them. In some embodiments, multiple oligonucleotides (or nucleic acids) are different forms of the same oligonucleotide (e.g., acids and / or different salts of the same oligonucleotide). In some embodiments, multiple oligonucleotides (or nucleic acids) are of the same composition. In some embodiments, the levels of multiple oligonucleotides (or nucleic acids) are approximately 1% to 100% (e.g., approximately 5% to 100%, 10% to 100%, 20% to 100%, 30% to 100%, 40% to 100%, 50% to 100%, 60% to 100%, 70% to 100%, 80% to 100%, 90% to 100%, 95% to 10%) of all oligonucleotides (or nucleic acids) in the composition that share the same composition as the multiple oligonucleotides (or nucleic acids). 0%, 50% to 90%, or approximately 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%).In some embodiments, each chiral nucleotide bond is a chiral-controlled nucleotide bond, and the composition is a completely chiral-controlled oligonucleotide composition. In some embodiments, multiple oligonucleotides (or nucleic acids) are structurally identical. In some embodiments, the chiral-controlled nucleotide bonds have a diastereomer purity of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%, typically at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%. In some embodiments, the chiral-controlled nucleotide bonds have a diastereomer purity of at least 95%. In some embodiments, the chiral-controlled nucleotide bonds have a diastereomer purity of at least 96%. In some embodiments, the chiral-controlled nucleotide bonds have a diastereomer purity of at least 97%. In some embodiments, the chiral-controlled internucleotide bond has at least 98% diastereomer purity. In some embodiments, the chiral-controlled internucleotide bond has at least 99% diastereomer purity. In some embodiments, the percentage of the level is (DS). nc or at least (DS) nc DS is the diastereomer purity described in this disclosure (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% or higher), and nc is the number of chiral-bound phosphorus molecules described in this disclosure (e.g., 1-50, 1-40, 1-30, 1-25, 1-20, 5-50, 5-40, 5-30, 5-25, 5-20, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or higher). In some embodiments, the percentage of the level is (DS) nc or at least (DS) nc, where DS is the diastereomeric purity described in the present disclosure (for example, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% or more), and nc is the number of chirally controlled internucleotide linkages described in the present disclosure (for example, 1 to 50, 1 to 40, 1 to 30, 1 to 25, 1 to 20, 5 to 50, 5 to 40, 5 to 30, 5 to 25, 5 to 20, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more). In some embodiments, the percentage of the level is (DS) nc or at least (DS) nc , and DS is 95% to 100%. For example, when DS is 99% and nc is 10, the percentage is 90% ((99%) 10 ≈0.90=90%), or at least that. In some embodiments, the level of the plurality of oligonucleotides in the composition is expressed as the product of the diastereomeric purity of each chiral linkage phosphorus. In some embodiments, the level of the plurality of oligonucleotides in the composition is expressed as the product of the diastereomeric purity of each chirally controlled internucleotide linkage in the oligonucleotide. In some embodiments, the diastereomeric purity of an internucleotide linkage connecting two nucleosides in an oligonucleotide (or nucleic acid) is represented by the diastereomeric purity of the internucleotide linkage of a dimer connecting the same two nucleosides, and this dimer is prepared using comparable conditions, in some instances, identical synthetic cycle conditions (for example, with respect to the linkage between Nx and Ny in an oligonucleotide....NxNy....., this dimer is NxNy). In some embodiments, not all chiral internucleotide linkages are chirally controlled internucleotide linkages, and the composition is a partially chirally controlled oligonucleotide composition. In some embodiments, non-chirally controlled internucleotide linkages are (for example, as understood by those skilled in the art, conventional oligonucleotide synthesis, e.g., phosphora The diastereomer purities are typically observed in stereorandom oligonucleotide compositions (from the Daito method) of about 80%, 75%, 70%, 65%, 60%, less than 55%, or about 50%. In some embodiments, the multiple oligonucleotides (or nucleic acids) are of the same type. In some embodiments, the chiral-controlled oligonucleotide composition contains individual oligonucleotide or nucleic acid types at non-disordered or controlled levels. For example, in some embodiments, the chiral-controlled oligonucleotide composition contains one or fewer oligonucleotide types. In some embodiments, the chiral-controlled oligonucleotide composition contains two or more oligonucleotide types. In some embodiments, the chiral-controlled oligonucleotide composition contains multiple oligonucleotide types. In some embodiments, the chiral-controlled oligonucleotide composition is a composition of oligonucleotides of a certain oligonucleotide type, and this composition contains multiple oligonucleotides of that oligonucleotide type at non-disordered or controlled levels.

[0042] Equivalent: The term “equivalent” is used herein to describe two (or more) sets of conditions or circumstances that are sufficiently similar to one another to allow for comparison of the results obtained or the phenomena observed. In some embodiments, the conditions or circumstances of an equivalent set are characterized by several substantially identical characteristics and one or a few disparate characteristics. Those skilled in the art will understand that sets of conditions are equivalent if they are characterized by a sufficient number and types of substantially identical characteristics to ensure a reasonable conclusion that the differences in the results obtained or the phenomena observed under different sets of conditions or circumstances are caused by or demonstrate variations in the characteristics that are diverse.

[0043] Alicyclic: The terms “alicyclic,” “carbocyclic,” “carbocykyl,” “carbocyclic radical,” and “carbocyclic ring” are used interchangeably and, as used herein, refer to saturated or partially unsaturated but non-aromatic cyclic aliphatic monocyclic, bicyclic, or polycyclic ring systems having 3 to 30 ring members, unless otherwise specified. Alicyclic groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl, cyclohexenyl, cycloheptyl, cycloheptenyl, cyclooctyl, cyclooctenyl, norbornyl, adamantyl, and cyclooctadienyl. In some embodiments, the alicyclic group has 3 to 6 carbons. In some embodiments, the alicyclic group is saturated and cycloalkyl. The term “alicyclic” may also include aliphatic rings condensed to one or more aromatic or non-aromatic rings, such as decahydronaphthyl or tetrahydronaphthyl. In some embodiments, the alicyclic group is bicyclic. In some embodiments, the alicyclic group is tricyclic. In some embodiments, the alicyclic group is polycyclic. In some embodiments, "alicyclic" refers to a C3-C6 monocyclic hydrocarbon or C8-C6 monocyclic hydrocarbon that is fully saturated or contains one or more unsaturated units but is not aromatic and has a single bond point to the rest of the molecule. 10 Bicyclic or polycyclic hydrocarbons, or those that are fully saturated or contain one or more unsaturated units but are not aromatic and have a single bond to the rest of the molecule, C9-C 16 This refers to polycyclic hydrocarbons.

[0044] Heteroaliphatic: As used herein, the term “heteroaliphatic” is given its common meaning in the art and refers to an aliphatic group described herein in which one or more carbon atoms are independently replaced by one or more heteroatoms (e.g., oxygen, nitrogen, sulfur, silicon, phosphorus, etc.). In some embodiments, one or more units selected from C, CH, CH2, and CH3 are independently replaced by one or more heteroatoms (including their oxidized and / or substituted forms). In some embodiments, the heteroaliphatic group is a heteroalkyl. In some embodiments, the heteroaliphatic group is a heteroalkenyl.

[0045] Heteroalkyl: As used herein, the term “heteroalkyl” is given its common meaning in the art and refers to an alkyl group described herein in which one or more carbon atoms are independently replaced by one or more heteroatoms (e.g., oxygen, nitrogen, sulfur, silicon, phosphorus, etc.). Examples of heteroalkyl groups include, but are not limited to, alkoxy, poly(ethylene glycol)-, alkyl-substituted amino, tetrahydrofuranyl, piperidinyl, and morpholinyl.

[0046] Heteroaryl: Used herein, either alone or as part of a larger term, such as "heteroaryl" or "heteroarcoxy," the terms "heteroaryl" and "heteroar-" refer to a monocyclic, bicyclic, or polycyclic ring system having a total of 5 to 30 ring members, wherein at least one ring in the system is aromatic, and at least one aromatic ring atom is a heteroatom. In some embodiments, the heteroaryl group is a group having 5 to 10 ring atoms (i.e., monocyclic, bicyclic, or polycyclic), and in some embodiments, 5, 6, 9, or 10 ring atoms. In some embodiments, each monocyclic ring unit is aromatic. In some embodiments, the heteroaryl group has 6, 10, or 14 π electrons shared in a cyclic arrangement and has 1 to 5 heteroatoms in addition to the carbon atoms. Heteroaryl groups include, but are not limited to, thienyl, furanyl, pyrrolyl, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, isothiazolyl, thiadiazolyl, pyridyl, pyridadinyl, pyrimidinyl, pyrazinyl, indolidinyl, prinyl, naphthilidinyl, and pteridinyl. In some embodiments, the heteroaryl is a heterobiaryl group, such as bipyridyl. The terms “heteroaryl” and “hetero-” also, as used herein, include groups in which a heteroaromatic ring is condensed to one or more aryl, alicyclic, or heterocyclyl rings, and the radical or bond site is located on the heteroaromatic ring. Non-limiting examples include indolyl, isoindolyl, benzothienyl, benzofuranyl, dibenzofuranyl, indazolyl, benzimidazolyl, benzthiazolyl, quinolyl, isoquinolyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 4H-quinolidinyl, carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, and pyrido[2,3-b]-1,4-oxazine-3(4H)-one. Heteroaryl groups can be monocyclic, bicyclic, or polycyclic.The term "heteroaryl" may be used interchangeably with the terms "heteroaryl ring," "heteroaryl group," or "heteroaromatic," any of which may include a optionally substituted ring. The term "heteroaralkyl" refers to an alkyl group substituted with a heteroaryl group, where the alkyl and heteroaryl moieties are independently and optionally substituted.

[0047] Heteroatoms: As used herein, the term “heteroatom” means an atom that is not carbon or hydrogen. In some embodiments, the heteroatom is boron, oxygen, sulfur, nitrogen, phosphorus, or silicon (oxidized forms of nitrogen, sulfur, phosphorus, or silicon; including nitrogen (e.g., quaternized forms, such as iminium groups), charged forms of phosphorus, sulfur, or oxygen). In some embodiments, the heteroatom is silicon, phosphorus, oxygen, sulfur, or nitrogen. In some embodiments, the heteroatom is silicon, oxygen, sulfur, or nitrogen. In some embodiments, the heteroatom is oxygen, sulfur, or nitrogen.

[0048] Heterocycle: As used herein, the terms “heterocycle,” “heterocyclyl,” “heterocyclic radical,” and “heterocyclic ring” are interchangeable and refer to monocyclic, bicyclic, or polycyclic ring moieties (e.g., 3 to 30 members) that are saturated or partially unsaturated and have one or more heteroatom ring atoms. In some embodiments, the heterocyclyl group is a stable 5 to 7-membered monocyclic or 7 to 10-membered bicyclic heterocyclic moiety that is either saturated or partially unsaturated and has one or more, preferably 1 to 4, heteroatoms in addition to the carbon atom. As used with respect to the ring atoms of a heterocycle, the term “nitrogen” includes substituted nitrogen. As an example, in saturated or partially unsaturated rings having 0 to 3 heteroatoms selected from oxygen, sulfur, or nitrogen, the nitrogen can be N (such as 3,4-dihydro-2H-pyrrolyl), NH (such as pyrrolidinyl), or +NR (such as N-substituted pyrrolidinyl). The heterocycle can be bonded to its pendant group with any heteroatom or carbon atom that results in a stable structure, and any of the ring atoms can be optionally substituted. Examples of such saturated or partially unsaturated heterocyclic radicals include, but are not limited to, tetrahydrofuranyl, tetrahydrothienyl, pyrrolidinyl, piperidinyl, pyrrolinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, decahydroquinolinyl, oxazolidinyl, piperazinyl, dioxanyl, dioxolanyl, diazepinyl, oxazepinyl, thiazepinyl, morpholinyl, and quinuclidinyl. The terms “heterocyclic,” “heterocyclyl,” “heterocyclyl ring,” “heterocyclic group,” “heterocyclic moiety,” and “heterocyclic radical” are used interchangeably herein and include groups in which a heterocyclyl ring is fused to one or more aryl, heteroaryl, or alicyclic rings, such as indolinyl, 3H-indolyl, chromanyl, phenantridinyl, or tetrahydroquinolinyl. The heterocyclyl group may be monocyclic, bicyclic, or polycyclic.The term "heterocyclylalkyl" refers to a heterocyclyl-substituted alkyl group in which the alkyl and heterocyclyl portions are independently and optionally substituted.

[0049] Identity: As used herein, the term “identity” refers to the overall relationship between polymer molecules, for example, between nucleic acid molecules (e.g., oligonucleotides, DNA, RNA, etc.) and / or polypeptide molecules. In some embodiments, polymer molecules are considered “substantially identical” to one another if their sequences are identical by at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%. The calculation of the identity percentage of two nucleic acid or polypeptide sequences can be carried out, for example, by aligning the two sequences for the purpose of best comparison (for example, gaps can be introduced in one or both of the first and second nucleic acid sequences for best alignment, and non-identical sequences can be ignored for the purpose of comparison). In certain embodiments, the length of sequences aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or substantially 100% of the length of the reference sequence. Nucleotides at corresponding positions are then compared. Molecules are identical at a position if the position in the first sequence is occupied by the same residue (e.g., a nucleotide or amino acid) as the corresponding position in the second sequence. The percentage of identity between two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps that need to be introduced for optimal alignment of the two sequences and the length of each gap. Sequence comparison and determination of the percentage of identity between two sequences can be achieved using mathematical algorithms. For example, the percentage of identity between two nucleotide sequences can be determined using the Meyers and Miller algorithm (CABIOS, 1989, 4:11-17), which is incorporated into the ALIGN program (version 2.0). In some exemplary embodiments, nucleic acid sequence comparison performed in the ALIGN program uses a PAM120 weighted residue table, a 12-gap length penalty, and a 4-gap penalty.Alternatively, the percentage of identity between two nucleotide sequences can be determined using the GAP program within the GCG software package, which employs the NWSgapdna.CMP matrix.

[0050] Nucleotide-nucleotide bond: As used herein, the term “nucleotide-nucleotide bond” generally refers to a bond that connects nucleoside units of oligonucleotides or nucleic acids. In some embodiments, the nucleotide-nucleotide bond is a phosphodiester bond (natural phosphate bond (-OP(=O)(OH)O-)) widely found in naturally occurring DNA and RNA molecules, which may exist in salt form as understood by those skilled in the art. In some embodiments, the nucleotide-nucleotide bond is a modified nucleotide-nucleotide bond (not a natural phosphate bond). In some embodiments, the nucleotide-nucleotide bond is a “modified nucleotide-nucleotide bond” in which at least one oxygen atom or -OH of the phosphodiester bond is replaced by a different organic or inorganic moiety. In some embodiments, such organic or inorganic moieties are selected from =S, =Se, =NR', -SR', -SeR', -N(R')2, B(R')3, -S-, -Se-, and -N(R')-, where each R' is independently as defined and described herein. In some embodiments, the nucleotide bond is a phosphotryster bond, a phosphorothioate bond (or phosphorothioate diester bond, -OP(=O)(SH)O-, which may exist as a salt form as understood by those skilled in the art). In some embodiments, the modified nucleotide bond is a phosphorothioate bond. In some embodiments, the nucleotide bond is, for example, one of PNA (peptide nucleic acid) or PMO (phosphodiamidate morpholino oligomer) bonds. In some embodiments, the modified nucleotide bond is a negatively charged nucleotide bond. In some embodiments, the modified nucleotide bond is a neutral nucleotide bond (e.g., n001 in a particular provided oligonucleotide). It will be understood by those skilled in the art that the nucleotide bond may exist as anion or cation at a given pH due to the presence of an acid or base moiety in the bond.In some embodiments, the modified nucleotide interbonds are modified nucleotide interbonds named s, s1, s2, s3, s4, s5, s6, s7, s8, s9, s10, s11, s12, s13, s14, s15, s16, s17, and s18, as described in WO2017 / 210647.

[0051] In vitro: As used herein, the term “in vitro” refers to an event that occurs in an artificial environment, for example, in a test tube or reaction vessel, in cell culture, etc., rather than within a living organism (e.g., an animal, plant, and / or microorganism).

[0052] In vivo: As used herein, the term “in vivo” refers to an event occurring within a living organism (e.g., an animal, a plant, and / or a microorganism).

[0053] Bound phosphorus: Where defined herein, the term “bound phosphorus” is used to indicate that the particular phosphorus atom referred to is a phosphorus atom present in an internucleotide bond, which corresponds to the phosphorus atom in phosphodiester internucleotide bonds that occur in naturally occurring DNA and RNA. In some embodiments, bound phosphorus atoms are present in modified internucleotide bonds, where each oxygen atom of the phosphodiester bond is optionally and independently replaced by an organic or inorganic moiety. In some embodiments, bound phosphorus atoms are chiral (e.g., in phosphorothioate internucleotide bonds). In some embodiments, bound phosphorus atoms are achiral (e.g., as in natural phosphate bonds).

[0054] Modified nucleic acid bases: The terms "modified nucleic acid base" and "modified base" refer to a chemical portion that is chemically distinct from a nucleic acid base but capable of performing at least one function of a nucleic acid base. In some embodiments, a modified nucleic acid base is a nucleic acid base that includes modifications. In some embodiments, a modified nucleic acid base can perform at least one function of a nucleic acid base, for example, the function of forming a portion in a polymer that can base-pair with nucleic acids, including at least a complementary sequence of bases. In some embodiments, a modified nucleic acid base is a substituted A, T, C, G, or U, or a substituted tautomer of A, T, C, G, or U. In some embodiments, a modified nucleic acid base in the context of oligonucleotides refers to a nucleic acid base that is not A, T, C, G, or U.

[0055] Modified Nucleosides: The term “modified nucleosides” refers to moieties that are derived from or chemically similar to natural nucleosides but contain chemical modifications that distinguish them from natural nucleosides. Non-limiting examples of modified nucleosides include those with modifications to bases and / or sugars. Non-limiting examples of modified nucleosides include those with 2' modifications to sugars. Non-limiting examples of modified nucleosides include debasic nucleosides (lacking nucleic acid bases). In some embodiments, modified nucleosides can perform at least one function of a nucleoside, for example, the function of forming a moiety in a polymer that can base-pair with nucleic acids containing at least a complementary sequence of bases.

[0056] Modified Nucleotides: The term “modified nucleotide” includes any chemical part that is structurally different from a natural nucleotide but is capable of performing at least one function of a natural nucleotide. In some embodiments, a modified nucleotide includes modifications in sugars, bases, and / or internucleotide bonds. In some embodiments, a modified nucleotide includes a modified sugar, a modified nucleic acid base, and / or a modified internucleotide bond. In some embodiments, a modified nucleotide can perform at least one function of a nucleotide, for example, the function of forming a subunit in a polymer that can base-pair with nucleic acids, including a complementary sequence of at least one base.

[0057] Modified sugars: The term “modified sugar” refers to a moiety that can replace a sugar. Modified sugars mimic the spatial arrangement, electronic properties, or other physicochemical properties of a sugar. In some embodiments, as described herein, the modified sugar is a substituted ribose or deoxyribose. In some embodiments, the modified sugar includes a 2'-modification. Useful examples of 2'-modifications are widely available in the art and are described herein. In some embodiments, the 2'-modification is 2'-F. In some embodiments, the 2'-modification is 2'-OR, where R is optionally substituted with C. 1~10 It is aliphatic. In some embodiments, the 2'-modification is 2'-OMe. In some embodiments, the 2'-modification is 2'-MOE. In some embodiments, the modified sugar is a bicyclic sugar (e.g., a sugar used in LNA, BNA, etc.). In some embodiments, in the context of oligonucleotides, the modified sugar is a sugar that is not ribose or deoxyribose, which are typically found in natural RNA or DNA.

[0058] Nucleic acids: As used herein, the term “nucleic acid” includes any nucleotide and polymer thereof. As used herein, the term “polynucleotide” refers to a polymeric form of nucleotides of any length, which is either ribonucleotide (RNA) or deoxyribonucleotide (DNA), or a combination thereof. These terms refer to the primary structure of a molecule and therefore include double-stranded and single-stranded DNA, as well as double-stranded and single-stranded RNA. These terms include analogues of RNA or DNA, including modified nucleotides and / or modified polynucleotides, such as methylated, protected, and / or capped nucleotides or polynucleotides. These terms encompass poly or oligoribonucleotides (RNA) and poly or oligodeoxyribonucleotides (DNA), RNA or DNA derived from N-glycosides or C-glycosides of nucleic acid bases and / or modified nucleic acid bases, nucleic acids derived from sugars and / or modified sugars, and nucleic acids derived from phosphate crosslinks and / or modified internucleotide bonds. This term encompasses nucleic acids containing any combination of nucleic acid bases, modified nucleic acid bases, sugars, modified sugars, phosphate bridges, or modified internucleotide bonds. Examples include, but are not limited to, nucleic acids containing a ribose moiety, nucleic acids containing a deoxyribose moiety, nucleic acids containing both ribose and deoxyribose moieties, and nucleic acids containing ribose and modified ribose moieties. Unless otherwise specified, the prefix "poly" refers to nucleic acids containing 2 to approximately 10,000 nucleotide monomer units, and the prefix "oligo" refers to nucleic acids containing 2 to approximately 200 nucleotide monomer units.

[0059] Nucleic acid bases: The term "nucleic acid base" refers to the portion of a nucleic acid involved in hydrogen bonding, which links one nucleic acid chain to another complementary chain in a sequence-specific manner. The most common naturally occurring nucleic acid bases are adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T). In some embodiments, the naturally occurring nucleic acid bases are modified adenine, guanine, uracil, cytosine, or thymine. In some embodiments, the naturally occurring nucleic acid bases are methylated adenine, guanine, uracil, cytosine, or thymine. In some embodiments, the nucleic acid bases comprise a heteroaryl ring (where the ring atom is nitrogen), and in the nucleoside, the nitrogen is bonded to the sugar moiety. In some embodiments, the nucleic acid bases comprise a heterocyclic ring (where the ring atom is nitrogen), and in the nucleoside, the nitrogen is bonded to the sugar moiety. In some embodiments, the nucleic acid base is a "modified nucleic acid base," a nucleic acid base other than adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T). In some embodiments, the modified nucleic acid base is a substituted A, T, C, G, or U. In some embodiments, the modified nucleic acid base is a substituted tautomer of A, T, C, G, or U. In some embodiments, the modified nucleic acid base is a methylated adenine, guanine, uracil, cytosine, or thymine. In some embodiments, the modified nucleic acid base mimics the spatial arrangement, electronic properties, or some other physicochemical properties of the nucleic acid base and retains the properties of hydrogen bonding, which binds one nucleic acid chain to the other in a sequence-specific manner. In some embodiments, the modified nucleic acid base can pair with all five naturally occurring bases (uracil, thymine, adenine, cytosine, or guanine) without substantially affecting the intracellular enzymatic or activity-mediated melting behavior or recognition of the oligonucleotide double helix. As used herein, the term “nucleic acid base” also includes modified nucleic acid bases and nucleic acid base analogues, as well as structural analogues used in place of natural or naturally occurring nucleotides.In some embodiments, the nucleic acid base is an optionally substituted A, T, C, G, or U, or an optionally substituted tautomer of A, T, C, G, or U. In some embodiments, “nucleic acid base” refers to the nucleic acid base unit in an oligonucleotide or nucleic acid (e.g., A, T, C, G, or U, as in the case of an oligonucleotide or nucleic acid).

[0060] Nucleoside: The term "nucleoside" refers to the portion of a nucleic acid base or modified nucleic acid base that is covalently bonded to a sugar or modified sugar. In some embodiments, the nucleoside is a natural nucleoside, e.g., adenosine, deoxyadenosine, guanosine, deoxyguanosine, thymidine, uridine, cytidine, or deoxycytidine. In some embodiments, the nucleoside is a substituted natural nucleoside selected from modified nucleosides, e.g., adenosine, deoxyadenosine, guanosine, deoxyguanosine, thymidine, uridine, cytidine, and deoxycytidine. In some embodiments, the nucleoside is a substituted tautomer of a natural nucleoside selected from modified nucleosides, e.g., adenosine, deoxyadenosine, guanosine, deoxyguanosine, thymidine, uridine, cytidine, and deoxycytidine. In some embodiments, "nucleoside" refers to a nucleoside unit in an oligonucleotide or nucleic acid.

[0061] Nucleotides: As used herein, the term “nucleotide” refers to the monomeric unit of a polynucleotide, which consists of a nucleic acid base, a sugar, and one or more internucleotide bonds (e.g., phosphate bonds in natural DNA and RNA). Naturally occurring bases [guanine, (G), adenine, (A), cytosine, (C), thymine, (T), and uracil (U)] are derivatives of purines or pyrimidines, but it should be understood that this also includes naturally occurring and non-naturally occurring base analogs. Naturally occurring sugars are pentose (5-carbon sugar) deoxyribose (which forms DNA) or ribose (which forms RNA), but it should be understood that this also includes naturally occurring and non-naturally occurring sugar analogs. Nucleotides are joined via internucleotide bonds to form nucleic acids or polynucleotides. Many internucleotide bonds are known in the art (e.g., phosphates, phosphorothioates, boranophosphates, etc.). Artificial nucleic acids include PNA (peptide nucleic acid), phosphotryesters, phosphorothionates, H-phosphonates, phosphoramidates, boranophosphates, methylphosphonates, phosphonoacetates, thiophosphonoacetates, and other variants of the phosphate skeleton of natural nucleic acids, such as those described herein. In some embodiments, natural nucleotides include naturally occurring bases, sugars, and internucleotide bonds. As used herein, the term “nucleotide” also includes structural analogues used in place of natural or naturally occurring nucleotides, such as modified nucleotides and nucleotide analogues. In some embodiments, “nucleotide” refers to an oligonucleotide or nucleotide unit in nucleic acids.

[0062] Oligonucleotides: The term "oligonucleotide" refers to polymers or oligomers of nucleotides, which may include any combination of natural and unnatural nucleic acid bases, sugars, and nucleotide bonds.

[0063] Oligonucleotides can be single-stranded or double-stranded. Single-stranded oligonucleotides can have a double-stranded region (formed by two parts of a single-stranded oligonucleotide), and double-stranded oligonucleotides containing two oligonucleotide chains can have a single-stranded region in a region where the two oligonucleotide chains are not complementary to each other, for example. Exemplary oligonucleotides include, but are not limited to, structural genes, genes containing regulatory and termination regions, self-replicating systems such as viruses or plasmid DNA, single-stranded and double-stranded RNAi agents, as well as other RNA interference reagents (RNAi agents or iRNA agents), shRNA, antisense oligonucleotides, ribozymes, microRNA, microRNA mimetics, spermirs, aptamers, antimirs, antagomirs, Ul adapters, triple-stranded oligonucleotides, G-quadrivalent oligonucleotides, RNA activators, immunostimulatory oligonucleotides, and decoy oligonucleotides.

[0064] The oligonucleotides of this disclosure can be of various lengths. In certain embodiments, the oligonucleotides can be in the range of about 2 to about 200 nucleosides in length. In various related embodiments, the single-stranded, double-stranded, or triple-stranded oligonucleotides can be in the range of lengths of about 4 to about 10 nucleosides, about 10 to about 50 nucleosides, about 20 to about 50 nucleosides, about 15 to about 30 nucleosides, and about 20 to about 30 nucleosides. In some embodiments, the oligonucleotides are about 9 to about 39 nucleosides long. In some embodiments, the oligonucleotides are about 25 to about 70 nucleosides long. In some embodiments, the oligonucleotides are about 26 to about 70 nucleosides long. In some embodiments, the oligonucleotides are about 27 to about 70 nucleosides long. In some embodiments, the oligonucleotides are about 28 to about 70 nucleosides long. In some embodiments, the oligonucleotide has a nucleoside length of about 29 to about 70. In some embodiments, the oligonucleotide has a nucleoside length of about 30 to about 70. In some embodiments, the oligonucleotide has a nucleoside length of about 31 to about 70. In some embodiments, the oligonucleotide has a nucleoside length of about 32 to about 70. In some embodiments, the oligonucleotide has a nucleoside length of about 25 to about 60. In some embodiments, the oligonucleotide has a nucleoside length of about 25 to about 50. In some embodiments, the oligonucleotide has a nucleoside length of about 25 to about 40. In some embodiments, the oligonucleotide has a nucleoside length of about 30 to about 40. In some embodiments, the oligonucleotide has a nucleoside length of at least 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25. In some embodiments, the oligonucleotide is at least 4 nucleosides long. In some embodiments, the oligonucleotide is at least 5 nucleosides long. In some embodiments, the oligonucleotide is at least 6 nucleosides long. In some embodiments, the oligonucleotide is at least 7 nucleosides long.In some embodiments, the oligonucleotide has a length of at least 8 nucleosides. In some embodiments, the oligonucleotide has a length of at least 9 nucleosides. In some embodiments, the oligonucleotide has a length of at least 10 nucleosides. In some embodiments, the oligonucleotide has a length of at least 11 nucleosides. In some embodiments, the oligonucleotide has a length of at least 12 nucleosides. In some embodiments, the oligonucleotide has a length of at least 15 nucleosides. In some embodiments, the oligonucleotide has a length of at least 15 nucleosides. In some embodiments, the oligonucleotide has a length of at least 16 nucleosides. In some embodiments, the oligonucleotide has a length of at least 17 nucleosides. In some embodiments, the oligonucleotide has a length of at least 18 nucleosides. In some embodiments, the oligonucleotide has a length of at least 19 nucleosides. In some embodiments, the oligonucleotide has a length of at least 20 nucleosides. In some embodiments, the oligonucleotide has a length of at least 25 nucleosides. In some embodiments, the oligonucleotide has a length of at least 26 nucleosides. In some embodiments, the oligonucleotide has a length of at least 27 nucleosides. In some embodiments, the oligonucleotide has a length of at least 28 nucleosides. In some embodiments, the oligonucleotide has a length of at least 29 nucleosides. In some embodiments, the oligonucleotide has a length of at least 30 nucleosides. In some embodiments, the oligonucleotide has a length of at least 31 nucleosides. In some embodiments, the oligonucleotide has a length of at least 32 nucleosides. In some embodiments, the oligonucleotide has a length of at least 33 nucleosides. In some embodiments, the oligonucleotide has a length of at least 34 nucleosides. In some embodiments, the oligonucleotide has a length of at least 35 nucleosides. In some embodiments, the oligonucleotide has a length of at least 36 nucleosides.In some embodiments, the oligonucleotide has a length of at least 37 nucleosides. In some embodiments, the oligonucleotide has a length of at least 38 nucleosides. In some embodiments, the oligonucleotide has a length of at least 39 nucleosides. In some embodiments, the oligonucleotide has a length of at least 40 nucleosides. In some embodiments, the oligonucleotide has a length of 25 nucleosides. In some embodiments, the oligonucleotide has a length of 26 nucleosides. In some embodiments, the oligonucleotide has a length of 27 nucleosides. In some embodiments, the oligonucleotide has a length of 28 nucleosides. In some embodiments, the oligonucleotide has a length of 29 nucleosides. In some embodiments, the oligonucleotide has a length of 30 nucleosides. In some embodiments, the oligonucleotide has a length of 31 nucleosides. In some embodiments, the oligonucleotide has a length of 32 nucleosides. In some embodiments, the oligonucleotide has a length of 33 nucleosides. In some embodiments, the oligonucleotide has a length of 34 nucleosides. In some embodiments, the oligonucleotide has a length of 35 nucleosides. In some embodiments, the oligonucleotide has a 36-nucleoside length. In some embodiments, the oligonucleotide has a 37-nucleoside length. In some embodiments, the oligonucleotide has a 38-nucleoside length. In some embodiments, the oligonucleotide has a 39-nucleoside length. In some embodiments, the oligonucleotide has a 40-nucleoside length. In some embodiments, each nucleoside counted in the oligonucleotide length independently contains a nucleic acid base comprising a ring having at least one nitrogen ring atom. In some embodiments, each nucleoside counted in the oligonucleotide length independently contains A, T, C, G, or U, or optionally substituted A, T, C, G, or U, or optionally substituted tautomers of A, T, C, G, or U.

[0065] Oligonucleotide type: As used herein, the term “oligonucleotide type” is used to define oligonucleotides having a specific base sequence, a pattern of skeletal bonding (i.e., a pattern of internucleotide bonding types, e.g., phosphate, phosphorothioate, phosphorothioate triester, etc.), a pattern of skeletal chiral centers [i.e., a pattern of the stereochemistry (Rp / Sp) of the bound phosphorus], and a pattern of skeletal phosphorus modification. In some embodiments, oligonucleotides of a commonly named “type” are structurally identical to one another.

[0066] Those skilled in the art will understand that the synthetic methods of the present disclosure provide some degree of control during the synthesis of oligonucleotide chains, such that each nucleotide unit of an oligonucleotide chain can be pre-designed and / or selected to have a specific stereochemistry at the bound phosphorus, and / or a specific modification at the bound phosphorus, and / or a specific base, and / or a specific sugar. In some embodiments, the oligonucleotide chain is pre-designed and / or selected to have a specific combination of stereocenters at the bound phosphorus. In some embodiments, the oligonucleotide chain is designed and / or determined to have a specific combination of modifications at the bound phosphorus. In some embodiments, the oligonucleotide chain is designed and / or selected to have a specific combination of bases. In some embodiments, the oligonucleotide chain is designed and / or selected to have one or more specific combinations of the above structural features. In some embodiments, the present disclosure provides a composition comprising or consisting of a plurality of oligonucleotide molecules (e.g., a chiral-controlled oligonucleotide composition). In some embodiments, all such molecules are of the same type (i.e., structurally identical to one another). However, in some embodiments, the composition provided typically comprises a plurality of oligonucleotides of different types in predetermined relative amounts.

[0067] Optionally Substituted: As described herein, the compounds of this disclosure may contain optionally substituted, substituted, and / or unsubstituted portions. Generally, the term “substituted” means that one or more hydrogens of a given portion are independently replaced by substituents. Unless otherwise indicated, an “optionally substituted” group may independently have substituents at each of its substituted positions, and if two or more positions in any given structure can be substituted by two or more substituents, the substituents may be the same at all positions or different at all positions. In some embodiments, optionally substituted groups are unsubstituted. In some embodiments, optionally substituted groups are substituted. Various substituents are described below.

[0068] Monovalent substituents are, independently, halogens;-(CH2) 0-4 R°;-(CH2) 0-4 OR°;-O(CH2) 0-4 R°, -O-(CH2) 0-4 C(O)OR°;-(CH2) 0-4 CH(OR°)2;-(CH2) 0-4 Ph(R°) can be substituted;-(CH2) 0-4 O(CH2) 0-1 Ph (can be substituted with R°); -CH=CHPh (can be substituted with R°); -(CH2) 0-4 O(CH2) 0-1 -Pyridyl (may be substituted with R°);-NO2;-CN;-N3;-(CH2) 0-4 N(R°)2;-(CH2) 0-4 N(R°)C(O)R°;-N(R°)C(S)R°;-(CH2) 0-4 N(R°)C(O)N(R°)2;-N(R°)C(S)N(R°)2;-(CH2) 0-4 N(R°)C(O)OR°;-N(R°)N(R°)C(O)R°;-N(R°)N(R°)C(O)N(R°)2;-N(R°)N(R°)C(O)OR°;-(CH2) 0-4 C(O)R°;-C(S)R°;-(CH2) 0-4 C(O)OR°;-(CH2) 0-4 C(O)SR°;-(CH2)0-4 C(O)OSi(R°)3;-(CH2) 0-4 OC(O)R°;-OC(O)(CH2) 0-4 SR°, -SC(S)SR°;-(CH2) 0-4 SC(O)R°;-(CH2) 0-4 C(O)N(R°)2;-C(S)N(R°)2;-C(S)SR°;-SC(S)SR°, -(CH2) 0-4 OC(O)N(R°)2;-C(O)N(OR°)R°;-C(O)C(O)R°;-C(O)CH2C(O)R°;-C(NOR°)R°;-(CH2) 0-4 SSR°;-(CH2) 0-4 S(O)2R°;-(CH2) 0-4 S(O)2OR°;-(CH2) 0-4 OS(O)2R°;-S(O)2N(R°)2;-(CH2) 0-4 S(O)R°;-N(R°)S(O)2N(R°)2;-N(R°)S(O)2R°;-N(OR°)R°;-C(NH)N(R°)2;-Si(R°)3;-OSi(R°)3;-P(R°)2;-P(OR °)2;-OP(R°)2;-OP(OR°)2;-N(R°)P(R°)2;-B(R°)2;-OB(R°)2;-P(O)(R°)2;-OP(O)(R°)2;-N(R°)P(O)(R°)2;-(C 1~4 (Straight-chain or branched-chain alkylene) ON(R°)2; or -(C 1~4 The linear or branched alkylene is C(O)ON(R°)2, where each R° can be independently substituted as defined below, independently of hydrogen, C 1~10 (For example, C 1~6 , C 1~4 Aliphatic elements, such as C, which independently have 1 to 5 heteroatoms selected from nitrogen, oxygen, sulfur, silicon, and phosphorus. 1~10 (For example, C 1~6 , C 1~4 (e.g.) heteroaliphatic, C 6~10 (For example, C6, C 10 (e.g.)aryls, independently, 5-10 (e.g., 5-9, 5-6, 5, 6, 9, 10, etc.) member heteroaryls having 1-4 heteroatoms selected from nitrogen, oxygen, and sulfur, -CH2-(C6~10 (For example, C6, C 10 (e.g., aryl), -O(CH2) 0~1 (C 6~10 (For example, C6, C 10 (e.g., aryl), -CH2- (a 5-10 (e.g., 5-9, 5-6, 5, 6, 9, 10, etc.) member heteroaryl having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur), -O(CH2) 0~1 (Independently, a 5-10 (e.g., 5-9, 5-6, 5, 6, 9, 10, etc.) membered heteroaryl having 1-4 heteroatoms selected from nitrogen, oxygen, and sulfur), or independently, a 3-10 (e.g., 3-6, 5-6, 3, 4, 5, 6, 7, 8, 9, 10, etc.) membered monocyclic, bicyclic, or polycyclic, saturated, or partially unsaturated ring having 0-5 heteroatoms selected from nitrogen, oxygen, sulfur, silicon, and phosphorus, or, notwithstanding the above definition, two independent entities of R°, Together with the intervening atoms(s) they form 3-10 member (e.g., 3-6 member, 5-6 member, 3, 4, 5, 6, 7, 8, 9, or 10 member, etc.) monocyclic, bicyclic, or polycyclic, saturated, partially unsaturated, or aromatic rings (for aromatic rings, in addition to the intervening atoms(s), they have 5-10 member (e.g., 5-9, 5-6, 5, 6, 9, 10, etc.) which independently have 0-5 heteroatoms selected from nitrogen, oxygen, sulfur, silicon, and phosphorus, which may be substituted as defined below).

[0069] A monovalent substituent on R° (or a ring formed by combining two independent R° atoms with their intervening atoms) is independently a halogen, -(CH2) 0~2 R ● ,-(HaroR ● ), -(CH2) 0~2 OH, -(CH2) 0~2 Ure ● ,-(CH2) 0~2 CH(OR ● )2, -O(HaroR ● ), -CN, -N3, -(CH2) 0~2 C(O)R ● ,-(CH2) 0~2C(O)OH, -(CH2) 0~2 C(O)OR ● , -(CH2) 0~2 SR ● , -(CH2) 0~2 SH, -(CH2) 0~2 NH2, -(CH2) 0~2 NHR ● , -(CH2) 0~2 NR ● 2, -NO2, -SiR ● 3, -OSiR ● 3, -C(O)SR ● , -(C 1~4 linear or branched alkylene)C(O)OR ● , or -SSR ● wherein each R ● is unsubstituted or, when preceded by "halo", substituted with only one or more halogens, and is independently selected from C 1~4 aliphatic, -CH2Ph, -O(CH2) 0~1 Ph, or independently a 3 to 6 (e.g., 3 to 5, 5 to 6, etc.) membered saturated, partially unsaturated, or aromatic ring (5 or 6 membered for aromatic rings) having 0 to 4 heteroatoms selected from nitrogen, oxygen, or sulfur. The divalent substituent on a saturated carbon atom of R° is independently =O or =S.

[0070] The divalent substituents are independently the following: =O, =S, =NNR * 2, =NNHC(O)R * , =NNHC(O)OR * , =NNHS(O)2R * , =NR * , =NOR * , -O(C(R * 2)) 2~3 O-, or -S(C(R * 2)) 2~3 S-, wherein each independent occurrence of R * is hydrogen, C which may be substituted as defined below 1~6Aliphatic, or independently, selected from unsubstituted 3-6 (e.g., 3-5, 5-6, etc.) saturated, partially unsaturated, or aromatic rings (5 or 6 members for aromatic rings) having 0-4 heteroatoms selected from nitrogen, oxygen, and sulfur. Divalent substituents bonded to adjacent substituted carbons of the "optionally substituted" group are independently -O(CR * 2) 2~3 O-, and in the formula, R * Each independent entity is a hydrogen, C which can be substituted as defined below. 1~6 Selected from aliphatic, or independently, unsubstituted 3-6 (e.g., 3-5, 5-6, etc.) saturated, partially unsaturated, or aromatic rings (5 or 6 members for aromatic rings) having 0-4 heteroatoms selected from nitrogen, oxygen, and sulfur.

[0071] R * The substituents on the aliphatic group are, independently, halogens, -R ● ,-(HaroR ● ), -OH, -OR ● ,-O(HaroR ● ), -CN, -C(O)OH, -C(O)OR ● -NH2, -NHR ● , -NR ● 2, or -NO2, and each R ● If it is unsubstituted, or if preceded by "halo", it is substituted by only one or more halogens, independently, C 1~4 Aliphatic, -CH2Ph, -O(CH2) 0~1 Ph, or independently, a 3-6 (e.g., 3-5, 5-6, etc.) saturated, partially unsaturated, or aromatic ring (5 or 6 members for aromatic rings) having 0-4 heteroatoms selected from nitrogen, oxygen, and sulfur.

[0072] Substitutable substituents on nitrogen are, independently, -R † , -NR † 2, -C(O)R † , -C(O)OR † ,-C(O)C(O)R † -C(O)CH2C(O)R †-S(O)2R † -S(O)2NR † 2, -C(S)NR † 2. -C(NH)NR † 2, or -N(R † )S(O)2R † And in the formula, each R † C can be substituted independently of hydrogen, as defined below. 1~6 Aliphatic, unsubstituted-OPh, or independently having 0-4 heteroatoms selected from nitrogen, oxygen, and sulfur, an unsubstituted 3-6 (e.g., 3-5, 5-6, etc.) member saturated, partially unsaturated, or aromatic ring (5 or 6 members for aromatic rings), or notwithstanding the above definition, R † The two independent entities, together with their intervening atom(s), independently form unsubstituted 3-12 (e.g., 3-10, 3-6, 5-10, 5-6, 3, 4, 5, 6, 7, 8, 9, 10, etc.) member saturated, partially unsaturated, or aryl monocyclic or bicyclic rings, each containing 0-4 heteroatoms selected from nitrogen, oxygen, and sulfur.

[0073] R † The substituents on the aliphatic group are, independently, halogens, -R ● ,-(HaroR ● ), -OH, -OR ● ,-O(HaroR ● ), -CN, -C(O)OH, -C(O)OR ● -NH2, -NHR ● , -NR ● 2, or -NO2, and each R ● If it is unsubstituted, or if preceded by "halo", it is substituted by only one or more halogens, independently, C 1~4 Aliphatic, -CH2Ph, -O(CH2) 0-1 Ph, or independently, a 3-6 (e.g., 3-5, 5-6, etc.) saturated, partially unsaturated, or aromatic ring (5 or 6 members for aromatic rings) having 0-4 heteroatoms selected from nitrogen, oxygen, and sulfur.

[0074] P-modification: As used herein, the term "P-modification" refers to any modification of the bound phosphorus other than stereochemical modification. In some embodiments, P-modification includes the addition, substitution, or removal of a pendant portion covalently bonded to the bound phosphorus.

[0075] Partially unsaturated: As used herein, the term “partially unsaturated” refers to a ring moiety containing at least one double or triple bond. The term “partially unsaturated” is intended to encompass rings having multiple unsaturated moies, but not to include aryl or heteroaryl moies as defined herein.

[0076] Pharmaceutical Composition: As used herein, the term “pharmaceutical composition” refers to an active agent formulated with one or more pharmaceutically acceptable carriers. In some embodiments, the active agent exists in a unit dose suitable for administration in a therapeutic regimen that shows a statistically significant potential to achieve a predetermined therapeutic effect when administered to an appropriate population. In some embodiments, the pharmaceutical composition may be specifically formulated for administration in solid or liquid form, including: oral administration, e.g., sips (aqueous or non-aqueous solutions or suspensions), tablets, e.g., those targeting buccal, sublingual and systemic absorption, boluses, powders, granules, pastes for application to the tongue; parenteral administration, e.g., by subcutaneous, intramuscular, intravenous or epidural injection, as a sterile solution or suspension or sustained-release formulation; topical application, e.g., as a cream, ointment or controlled-release patch or spray applied to the skin, lungs or oral cavity; e.g., as a pessary, cream or foam for vaginal or rectal administration; sublingual; intraocular; transdermal; or adapted for the nasal cavity, lungs and other mucosal surfaces.

[0077] Pharmacologically acceptable: As used herein, the term “pharmaceutically acceptable” means a compound, material, composition, and / or dosage form that, within reasonable medical judgment, is suitable for use in contact with human and animal tissues without excessive toxicity, irritation, allergic response, or other problems or complications, and that is commensurate with a reasonable benefit / risk ratio.

[0078] Pharmacopoeia-acceptable carrier: As used herein, the term “pharmacopoeia-acceptable carrier” means a pharmaceutically acceptable material, composition, or vehicle, such as a liquid or solid filler, diluent, excipient, or solvent encapsulation material, that is involved in transporting or delivering the compound of interest from one organ or part of the body to another organ or part of the body. Each carrier must be “acceptable” in the sense that it is compatible with the other components of the formulation and is not harmful to the patient. Some examples of materials that can function as pharmaceutically acceptable carriers include sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; cellulose, and its derivatives such as sodium carboxymethylcellulose, ethylcellulose, and cellulose acetate; tragacanth powder; malt; gelatin; talc; excipients such as cocoa butter and suppository waxes; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; glycols such as propylene glycol; polyols such as glycerin, sorbitol, mannitol, and polyethylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffers such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol; pH buffer solutions; polyesters, polycarbonates, and / or polyacid anhydrides; and other non-toxic, suitable substances used in pharmaceutical formulations.

[0079] Pharmacopoeia-acceptable salts: The term “pharmacopoeia-acceptable salt” as used herein means a salt of such a compound that is suitable for use in a pharmaceutical context, i.e., a salt that, within reasonable limits of medical judgment, is suitable for use in contact with human and lower animal tissues without excessive toxicity, irritation, allergic response, etc., and that is commensurate with a reasonable benefit / risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, SMBerge, et al. describe pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 66:1-19 (1977). In some embodiments, pharmacopoeia-acceptable salts include, but are not limited to, non-toxic acid addition salts of amino groups formed by inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid, and perchloric acid, or organic acids such as acetic acid, maleic acid, tartaric acid, citric acid, succinic acid, or malonic acid, or by using other methods used in the art, such as ion exchange. In some embodiments, pharmaceutically acceptable salts include adipine, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, and 2-hydroxyethanesulfonate. Examples include, but are not limited to, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, and valerate.In some embodiments, the provided compound comprises one or more acidic groups, for example, oligonucleotides, and pharmaceutically acceptable salts are alkali, alkaline earth metal, or ammonium salts (e.g., ammonium salts of N(R)3, where each R is independently defined and described herein). Typical alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, and magnesium. In some embodiments, the pharmaceutically acceptable salt is a sodium salt. In some embodiments, the pharmaceutically acceptable salt is a potassium salt. In some embodiments, the pharmaceutically acceptable salt is a calcium salt. In some embodiments, pharmaceutically acceptable salts include, where appropriate, non-toxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, alkyls having 1 to 6 carbon atoms, sulfonates, and arylsulfonates. In some embodiments, the provided compound comprises two or more acidic groups, for example, oligonucleotides may comprise two or more acidic groups (e.g., in natural phosphate bonds and / or modified internucleotide bonds). In some embodiments, a pharmaceutically acceptable salt of such a compound, or a salt in general, contains two or more cations, which may be the same or different. In some embodiments, in a pharmaceutically acceptable salt (or a salt in general), all ionizable hydrogens in the acidic group (e.g., in aqueous solutions having a pKa of about 11, 10, 9, 8, 7, 6, 5, 4, 3 or 2 or less, in some embodiments about 7 or less; in some embodiments about 6 or less; in some embodiments about 5 or less; in some embodiments about 4 or less; in some embodiments about 3 or less) are replaced by cations. In some embodiments, each phosphorothioate and phosphate group exists independently in its salt form (e.g., in the case of the sodium salt, -OP(O)(SNa)-O- and -OP(O)(ONa)-O-, respectively).In some embodiments, each phosphorothioate and phosphate nucleotide bond exists independently in its salt form (e.g., -OP(O)(SNa)-O- and -OP(O)(ONa)-O-, respectively, for the sodium salt). In some embodiments, the pharmaceutically acceptable salt is the sodium salt of the oligonucleotide. In some embodiments, the pharmaceutically acceptable salt is the sodium salt of the oligonucleotide, and each acidic phosphate group and modified phosphate group (e.g., phosphorothioate, phosphate, etc.) exists in salt form (all sodium salts), if present.

[0080] Predetermined: Predetermined means intentionally selected or non-random or controlled, as opposed to, for example, occurring randomly, randomly, or being achieved without control. Those skilled in the art will understand, upon reading this disclosure, that it provides techniques that enable the selection of specific chemical and / or stereochemical features to be incorporated into oligonucleotide compositions, and further enable the controlled preparation of oligonucleotide compositions having such chemical and / or stereochemical features. Such provided compositions are “predetermined” as described herein. A composition that may contain a particular oligonucleotide is not a “predetermined” composition because it is produced accidentally through a process that is not controlled to intentionally produce a particular chemical and / or stereochemical feature. In some embodiments, a predetermined composition is one that can be intentionally reproduced (for example, through iterations of a controlled process). In some embodiments, a predetermined level of multiple oligonucleotides in a composition means that the absolute and / or relative amounts (ratio, percentage, etc.) of multiple oligonucleotides in the composition are controlled. In some embodiments, a predetermined level of multiple oligonucleotides in a composition is achieved through chiral-controlled oligonucleotide preparation.

[0081] Protecting group: As used herein, the term “protecting group” is well known in the art and is incorporated herein by reference in its entirety by Protecting Groups in Organic Synthesis, TWGreene, and PGMWuts, 3 rdThis is described in detail in edition, John Wiley & Sons, 1999. It also includes protecting groups specifically adapted for nucleoside and nucleotide chemistry, as described in Current Protocols in Nucleic Acid Chemistry, edited by Beaucage et al. 06 / 2012, whose Chapter 2 is incorporated herein by reference. Suitable amino protecting groups include methyl carbamate, ethyl carbamate, 9-fluorenyl methyl carbamate (Fmoc), 9-(2-sulfo)fluorenyl methyl carbamate, 9-(2,7-dibromo)fluorenyl methyl carbamate, 2,7-di-t-butyl-[9-(10,10-dioxo-10,10,10,10-tetrahydrothioxantyl)] methyl carbamate (DBD-Tmoc), 4-methoxyphenacyl carbamate (Phenoc), 2,2,2-trichloroethyl carbamate (Troc), 2-trimethylsilylethyl carbamate (Teoc), 2- Phenylethylcarbamate (hZ), 1-(1-adamantyl)-1-methylethylcarbamate (Adpoc), 1,1-dimethyl-2-haloethylcarbamate, 1,1-dimethyl-2,2-dibromoethylcarbamate (DB-t-BOC), 1,1-dimethyl-2,2,2-trichloroethylcarbamate (TCBOC), 1-methyl-1-(4-biphenylyl)ethylcarbamate (Bpoc), 1-(3,5-di-t-butylphenyl)-1-methylethylcarbamate (t-Bumeoc), 2-(2'-and 4'-pyridyl)ethylcarbamate (Pyoc), 2-(N,N-Dicyclohexylcarboxamide) ethylcarbamate, t-butylcarbamate (BOC), 1-adamantylcarbamate (Adoc), vinylcarbamate (Voc), allylcarbamate (Alloc), 1-isopropylallylcarbamate (Ipaoc), cinnamylcarbamate (Coc), 4-nitrocinnamylcarbamate (Noc), 8-quinolylcarbamate, N-hydroxypiperidinylcarbamate, alkyldithiocarbamate, benzylcarbamate (Cbz), p-methoxybenzylcarbamate (Moz), p- Nitobenzylcarbamate, p-bromobenzylcarbamate, p-chlorobenzylcarbamate, 2,4-dichlorobenzylcarbamate, 4-methylsulfinylbenzylcarbamate (Msz), 9-anthrylmethylcarbamate, diphenylmethylcarbamate, 2-methylthioethylcarbamate, 2-methylsulfonylethylcarbamate, 2-(p-toluenesulfonyl)ethylcarbamate, [2-(1,3-dithianyl)]methylcarbamate (Dmoc), 4-methylthiophenylcarbamate (Mtpc), 2,4-dimethylthio Phenylcarbamate (Bmpc), 2-phosphonioethylcarbamate (Peoc), 2-triphenylphosphonioisopropylcarbamate (Ppoc), 1,1-dimethyl-2-cyanoethylcarbamate, m-chloro-p-acyloxybenzylcarbamate, p-(dihydroxyboryl)benzylcarbamate, 5-benzisoxazolylmethylcarbamate, 2-(trifluoromethyl)-6-chromonylmethylcarbamate (Tcroc), m-nitrophenylcarbamate, 3,5-dimethoxybenzylcarbamate, o-nitrobenz Carbamate, 3,4-dimethoxy-6-nitrobenzylcarbamate, phenyl(o-nitrophenyl)methylcarbamate, phenothiazinyl-(10)-carbonyl derivative, N'-p-toluenesulfonylaminocarbonyl derivative, N'-phenylaminothiocarbonyl derivative, t-amylcarbamate, S-benzylthiocarbamate, p-cyanobenzylcarbamate, cyclobutylcarbamate, cyclohexylcarbamate, cyclopentylcarbamate, cyclopropylmethylcarbamate, p-decyloxybenzylcarbamate, 2,2-Dimethoxycarbonylvinylcarbamate, o-(N,N-dimethylcarboxamide)benzylcarbamate, 1,1-dimethyl-3-(N,N-dimethylcarboxamide)propylcarbamate, 1,1-dimethylpropynylcarbamate, di(2-pyridyl)methylcarbamate, 2-furanylmethylcarbamate, 2-iodoethylcarbamate, isoborylcarbamate, isobutylcarbamate, isonicotinylcarbamate, p-(p'-methoxyphenylazo)benzylcarbamate, 1-methylcyclobutylcarbamate, 1-methyl Lucyclohexylcarbamate, 1-methyl-1-cyclopropylmethylcarbamate, 1-methyl-1-(3,5-dimethoxyphenyl)ethylcarbamate, 1-methyl-1-(p-phenylazophenyl)ethylcarbamate, 1-methyl-1-phenylethylcarbamate, 1-methyl-1-(4-pyridyl)ethylcarbamate, phenylcarbamate, p-(phenylazo)benzylcarbamate, 2,4,6-tri-t-butylphenylcarbamate, 4-(trimethylammonium)benzylcarbamate, 2,4,6-trimethylbenzyl Lucarbamate, formamide, acetamide, chloroacetamide, trichloroacetamide, trifluoroacetamide, phenylacetamide, 3-phenylpropanamide, picolinamide, 3-pyridylcarboxamide, N-benzoylphenylalanyl derivatives, benzamide, p-phenylbenzamide, o-nitrophenylacetamide, o-nitrophenoxyacetamide, acetamide, (N'-dithiobenzyloxycarbonylamino)acetamide, 3-(p-hydroxyphenyl)propanamide, 3-(o-nitrophenoxy (L)propanamide, 2-methyl-2-(o-nitrophenoxy)propanamide, 2-methyl-2-(o-phenylazofenoxy)propanamide, 4-chlorobutanamide, 3-methyl-3-nitrobutanamide, o-nitrocinnamide, N-acetylmethionine derivative, o-nitrobenzamide, o-(benzoyloxymethyl)benzamide, 4,5-diphenyl-3-oxazolin-2-one, N-phthalimide, N-dithiasuccinimide (Dts), N-2,3-diphenylmaleimide, N-2,5-dimethylpyrrole, N-1,1,4,4-tetramethyldisilyl azacyclopentane adduct (STABASE), 5-substituted 1,3-dimethyl-1,3,5-triazacyclohexane-2-one, 5-substituted 1,3-dibenzyl-1,3,5-triazacyclohexane-2-one, 1-substituted 3,5-dinitro-4-pyridone, N-methylamine, N-allylamine, N-[2-(trimethylsilyl)ethoxy]methylamine (SEM), N-3-acetoxypropylamine, N-(1-isopropyl-4-nitro-2-oxo-3-pyroolin-3- Il)amine, quaternary ammonium salt, N-benzylamine, N-di(4-methoxyphenyl)methylamine, N-5-dibenzosberylamine, N-triphenylmethylamine (Tr), N-[(4-methoxyphenyl)diphenylmethyl]amine (MMTr), N-9-phenylfluorenylamine (PhF), N-2,7-dichloro-9-fluorenylmethyleneamine, N-ferrocenylmethylamino (Fcm), N-2-picolylamino N'-oxide, N-1,1-dimethylthiomethyleneamine, N-benzylideneamine Np-methoxybenzylideneamine, N-diphenylmethyleneamine, N-[(2-pyridyl)mesityl]methyleneamine, N-(N',N'-dimethylaminomethylene)amine, N,N'-isopropylidenediamine, Np-nitrobenzylideneamine, N-salicylideneamine, N-5-chlorosalicylideneamine, N-(5-chloro-2-hydroxyphenyl)phenylmethyleneamine, N-cyclohexylideneamine, N-(5,5-dimethyl-3-oxo-1-cyclohexenyl)amine, N-borane derivatives, N-di Phenylboric acid derivatives, N-[phenyl(pentacarbonylchromium- or tungsten)carbonyl]amine, N-copper chelate, N-zinc chelate, N-nitroamine, N-nitrosamine, amine N-oxide, diphenylphosphinamide (Dpp), dimethylthiophosphinamide (Mpt), diphenylthiophosphinamide (Ppt), dialkylphospholamide, dibenzylphospholamide, diphenylphospholamide, benzenesulfenamide, o-nitrobenzenesulfenamide (Nps), 2,4-Dinitrobenzenesulfenamide, Pentachlorobenzenesulfenamide, 2-Nitro-4-methoxybenzenesulfenamide, Triphenylmethylsulfenamide, 3-Nitropyridinesulfenamide (Npys), p-Toluenesulfonamide (Ts), Benzenesulfonamide, 2,3,6-Trimethyl-4-methoxybenzenesulfonamide (Mtr), 2,4,6-Trimethoxybenzenesulfonamide (Mtb), 2,6-Dimethyl-4-methoxybenzenesulfonamide (Pme), 2,3,5,6-Tetramethyl-4-methoxybenzenesulfonamide (Mte), Examples include 4-methoxybenzenesulfonamide (Mbs), 2,4,6-trimethylbenzenesulfonamide (Mts), 2,6-dimethoxy-4-methylbenzenesulfonamide (iMds), 2,2,5,7,8-pentamethylchroman-6-sulfonamide (Pmc), methanesulfonamide (Ms), β-trimethylsilylethanesulfonamide (SES), 9-anthracenesulfonamide, 4-(4',8'-dimethoxynaphthylmethyl)benzenesulfonamide (DNMBS), benzylsulfonamide, trifluoromethylsulfonamide, and phenacylsulfonamide.

[0082] Suitable protected carboxylic acids include, but are not limited to, silyl, alkyl, alkenyl, aryl, and arylalkyl protected carboxylic acids. Examples of suitable silyl groups include trimethylsilyl, triethylsilyl, t-butyldimethylsilyl, t-butyldiphenylsilyl, and triisopropylsilyl. Examples of suitable alkyl groups include methyl, benzyl, p-methoxybenzyl, 3,4-dimethoxybenzyl, trityl, t-butyl, and tetrahydropyran-2-yl. An example of a suitable alkenyl group is allyl. Examples of suitable aryl groups include optionally substituted phenyl, biphenyl, or naphthyl. Examples of suitable arylalkyl groups include optionally substituted benzyl (e.g., p-methoxybenzyl (MPM), 3,4-dimethoxybenzyl, O-nitrobenzyl, p-nitrobenzyl, p-halobenzyl, 2,6-dichlorobenzyl, p-cyanobenzyl), as well as 2- and 4-picolyl.

[0083] Suitable hydroxyl protecting groups include methyl, methoxymethyl (MOM), methylthiomethyl (MTM), t-butylthiomethyl, (phenyldimethylsilyl)methoxymethyl (SMOM), benzyloxymethyl (BOM), p-methoxybenzyloxymethyl (PMBM), (4-methoxyphenoxy)methyl (p-AOM), guaiacolmethyl (GUM), t-butoxymethyl, 4-pentenyloxymethyl (POM), siloxymethyl, 2-methoxyethoxymethyl (MEM), 2,2,2-trichloroethoxymethyl, bis(2-chloroethoxy)methyl, 2-(trimethylsilyl)ethoxymethyl (SEMOR), tetrahydropyranil (THP), 3-bromotetrahydropyranil, tetrahydrothiopyranil, 1-methoxycyclohexyl, 4-methoxytetrahydropyranil (MTHP), 4-methoxytetrahydrothiopyranil, and 4-methoxytetrahydrothiopyranil. S,S-dioxide, 1-[(2-chloro-4-methyl)phenyl]-4-methoxypiperidine-4-yl (CTMP), 1,4-dioxan-2-yl, tetrahydrofuranyl, tetrahydrothiofuranyl, 2,3,3a,4,5,6,7,7a-octahydro-7,8,8-trimethyl-4,7-methanobenzofuran-2-yl, 1-ethoxyethyl, 1-(2-chloroethoxy)ethyl, 1-methyl-1-methoxyethyl, 1-methyl-1-benzyloxyethyl, 1-methyl-1-benzyloxy-2-flu Oroethyl, 2,2,2-trichloroethyl, 2-trimethylsilylethyl, 2-(phenylselenyl)ethyl, t-butyl, allyl, p-chlorophenyl, p-methoxyphenyl, 2,4-dinitrophenyl, benzyl, p-methoxybenzyl, 3,4-dimethoxybenzyl, o-nitrobenzyl, p-nitrobenzyl, p-halobenzyl, 2,6-dichlorobenzyl, p-cyanobenzyl, p-phenylbenzyl, 2-picolyl, 4-picolyl, 3-methyl-2-picolyl N-oxide, diphenylmethyl, p,p'-Dinitrobenzhydryl, 5-Dibenzosberyl, Triphenylmethyl, α-Naphthyldiphenylmethyl, p-Methoxyphenyldiphenylmethyl, Di(p-Methoxyphenyl)phenylmethyl, Tri(p-Methoxyphenyl)methyl, 4-(4'-Bromophenacyloxyphenyl)diphenylmethyl, 4,4',4''-Tris(4,5-Dichlorophthalimidophenyl)methyl, 4,4',4''-Tris(Lebrinoyloxyphenyl)methyl, 4,4',4''-Tris(Benzoyl Oxyphenyl)methyl, 3-(imidazol-1-yl)bis(4',4''-dimethoxyphenyl)methyl, 1,1-bis(4-methoxyphenyl)-1'-pyrenylmethyl, 9-anthryl, 9-(9-phenyl)xanthenyl, 9-(9-phenyl-10-oxo)anthryl, 1,3-benzodithiolan-2-yl, benzoisothiazolyl S,S-dioxide, trimethylsilyl (TMS), triethylsilyl (TES), triisopropylsilyl (TIPS), dimethylisopropylsilyl (IPDMS), diethylisopropylsilyl (DEIPS), dimethyltexylsilyl, t-butyldimethylsilyl (TBDMS), t-butyldiphenylsilyl (TBDPS), tribenzylsilyl, tri-p-xylylsilyl, triphenylsilyl, diphenylmethylsilyl (DPMS), t-butylmethoxyphenylsilyl (TBMPS), formate, benzoyl formate, acetate, chloroacetate, dichloroacetate, trichloroacetate, trifluoroacetate, methoxyacetate, triphenylmethoxy Acetates, phenoxyacetates, p-chlorophenoxyacetates, 3-phenylpropionates, 4-oxopentanoates (lebrinate), 4,4-(ethylenedithio)pentanoates (lebrinoyl dithioacetal), pivaloate, adamanoate, crotonate, 4-methoxycrotonate, benzoates, p-phenylbenzoates, 2,4,6-trimethylbenzoates (mesitoate), alkylmethyl carbonate, 9-fluorenylmethyl carbonate (Fmoc), alkylethyl carbonate, alkyl2,2,2-Trichloroethyl (Troc), 2-(trimethylsilyl)ethyl carbonate (TMSEC), 2-(phenylsulfonyl)ethyl carbonate (Psec), 2-(triphenylphosphonio)ethyl carbonate (Peoc), alkylisobutyl carbonate, alkylvinyl carbonate, alkylallyl carbonate, alkylp-nitrophenyl carbonate, alkylbenzyl carbonate, alkylp-methoxybenzyl carbonate, alkyl3,4-dimethoxybenzyl carbonate, alkylo-nitrobenzyl carbonate, alkylp-nitrobenzyl carbonate, alkylsodium-benzyl thiocarbonate, 4-ethoxy-1-naphthothyl carbonate, dithiomethyl carbonate, 2-iodobenzoate, 4-azidobutyrate, 4-nitro-4-methylpentanoate, o-(dibromomethyl)benzoate, 2-formylbenzenesulfonate, 2-(methylthiomethoxy)ethyl, 4-(methyl Examples include (Luthiomethoxy)butyrate, 2-(methylthiomethoxymethyl)benzoate, 2,6-dichloro-4-methylphenoxyacetate, 2,6-dichloro-4-(1,1,3,3-tetramethylbutyl)phenoxyacetate, 2,4-bis(1,1-dimethylpropyl)phenoxyacetate, chlorodiphenylacetate, isobutyrate, monosuccinate, (E)-2-methyl-2-butenoate, o-(methoxycarbonyl)benzoate, α-naphthoate, nitrate, alkyl N,N,N',N'-tetramethylphosphodiamide, N-phenylcarbamate alkyl, borate, dimethylphosphinoticoyl, 2,4-dinitrophenylsulfenate alkyl, sulfate, methanesulfonate (mesylate), benzylsulfonate, and tosylate (Ts). To protect 1,2- or 1,3-diols, protecting groups include methylene acetal, ethylidene acetal, 1-t-butylethylidene ketal, 1-phenylethylidene ketal, (4-methoxyphenyl)ethylidene acetal, 2,2,2-trichloroethylidene acetal, acetonide, cyclopentylidene ketal, cyclohexylidene ketal, cycloheptylidene ketal, benzylidene acetal, p-methoxybenzylidene acetal, 2,4-dimethoxybenzylidene ketal, 3,Examples include 4-dimethoxybenzylidene acetal, 2-nitrobenzylidene acetal, methoxymethylene acetal, ethoxymethylene acetal, dimethoxymethylene orthoester, 1-methoxyethylidene orthoester, 1-ethoxyethylidene orthoester, 1,2-dimethoxyethylidene orthoester, α-methoxybenzylidene orthoester, 1-(N,N-dimethylamino)ethylidene derivative, α-(N,N'-dimethylamino)benzylidene derivative, 2-oxacyclopentylidene orthoester, di-t-butylsilylene group (DTBS), 1,3-(1,1,3,3-tetraisopropyldisiloxanylidene) derivative (TIPDS), tetra-t-butoxydisiloxane-1,3-diylidene derivative (TBDS), cyclic carbonates, cyclic boronates, ethyl boronic acid, and phenyl boronic acid.

[0084] In some embodiments, the hydroxyl protecting group is acetyl, t-butyl, t-butoxymethyl, methoxymethyl, tetrahydropyranyl, 1-ethoxyethyl, 1-(2-chloroethoxy)ethyl, 2-trimethylsilylethyl, p-chlorophenyl, 2,4-dinitrophenyl, benzyl, benzoyl, p-phenylbenzoyl, 2,6-dichlorobenzyl, diphenylmethyl, p-nitrobenzyl, triphenylmethyl(trityl), 4,4'-dimethoxytrityl, trimethylsilyl, triethylsilyl, t-butyldimethylsilyl, t-butyldiphenylsilyl, triphenylsilyl, triisopropylsilyl, benzoyl formate, chloroacetyl, trichloroacetyl, trifluoroacetyl, pivaloyl, 9-fluorenylmethyl carbonate, mesylate, tosylate, triflate, trityl, monomethoxytrityl (MMTr), 4,4'-dimethoxytrityl, (DM These include Tr) and 4,4',4''-trimethoxytrityl (TMTr), 2-cyanoethyl (CE or Cne), 2-(trimethylsilyl)ethyl (TSE), 2-(2-nitrophenyl)ethyl, 2-(4-cyanophenyl)ethyl 2-(4-nitrophenyl)ethyl (NPE), 2-(4-nitrophenylsulfonyl)ethyl, 3,5-dichlorophenyl, 2,4-dimethylphenyl, 2-nitrophenyl, 4-nitrophenyl, 2,4,6-trimethylphenyl, 2-(2-nitrophenyl)ethyl, butylthiocarbonyl, 4,4',4''-tris(benzoyloxy)trityl, diphenylcarbamoyl, levlinyl, 2-(dibromomethyl)benzoyl (Dbmb), 2-(isopropylthiomethoxymethyl)benzoyl (Ptmt), 9-phenylxanthene-9-yl (Pixyl), or 9-(p-methoxyphenyl)xanthin-9-yl (MOX). In some embodiments, each of the hydroxyl protecting groups is independently selected from acetyl, benzyl, t-butyldimethylsilyl, t-butyldiphenylsilyl, and 4,4'-dimethoxytrityl. In some embodiments, the hydroxyl protecting group is selected from the group consisting of trityl, monomethoxytrityl, and 4,4'-dimethoxytrityl groups.In some embodiments, the phosphorus-protecting group is a group that is added to phosphorus bonds (e.g., internucleotide bonds) throughout the entire oligonucleotide synthesis. In some embodiments, the protecting group is bonded to the sulfur atom of the phosphorothioate group. In some embodiments, the protecting group is bonded to the oxygen atom of the internucleotide phosphorothioate bond. In some embodiments, the protecting group is bonded to the oxygen atom of the internucleotide phosphate bond. In some embodiments, the protecting group is 2-cyanoethyl (CE or Cne), 2-trimethylsilylethyl, 2-nitroethyl, 2-sulfonylethyl, methyl, benzyl, o-nitrobenzyl, 2-(p-nitrophenyl)ethyl (NPE or Npe), 2-phenylethyl, 3-(N-tert-butylcarboxamide)-1-propyl, 4-oxopentyl, 4-methylthio-l-butyl, 2-cyano-1,1-dimethylethyl, 4-N-methylaminobutyl, 3-(2-pyridyl)-1-propyl, 2-[N-methyl-N-(2-pyridyl)]aminoethyl, 2-(N-formyl,N-methyl)aminoethyl, or 4-[N-methyl-N-(2,2,2-trifluoroacetyl)amino]butyl.

[0085] Subject: As used herein, the terms “subject” or “test subject” refer to any organism to which a compound (e.g., an oligonucleotide) or composition is administered in accordance with this disclosure, for example, experimental, diagnostic, prophylactic, and / or therapeutic purposes. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans), insects, worms, etc.) as well as plants. In some embodiments, the subject is human. In some embodiments, the subject is suffering from and / or susceptible to disease, disorder, and / or condition.

[0086] Substantially: As used herein, the term “substantially” refers to a qualitative state indicating the whole or nearly whole range or degree of the desired feature or property. A base sequence that is substantially identical or complementary to a second sequence is not entirely identical or complementary to the second sequence, but is nearly identical or complementary to the second sequence. In some embodiments, an oligonucleotide having a sequence substantially complementary to another oligonucleotide or nucleic acid forms a double helix with the oligonucleotide or nucleic acid in a similar manner to an oligonucleotide having a fully complementary sequence. In addition, those skilled in the art of biology and / or chemistry will understand that it is rare, if any, for biological and chemical phenomena to terminate completely and / or progress toward complete termination, or to achieve or avoid absolute results. Thus, the term “substantially” is used herein to capture the potential lack of complete termination inherent in many biological and / or chemical phenomena.

[0087] Sugars: The term “sugar” refers to monosaccharides or polysaccharides in closed and / or open forms. In some embodiments, sugars are monosaccharides. In some embodiments, sugars are polysaccharides. Sugars include, but are not limited to, ribose, deoxyribose, pentofuranose, pentopyranose, and hexopyranose moieties. As used herein, the term “sugar” also encompasses structural analogs used in place of conventional sugar molecules, such as glycols, their polymers that form the backbone of nucleic acid analogs, and glycol nucleic acids ("GNAs"). As used herein, the term “sugar” also encompasses modified sugars and structural analogs used in place of natural or naturally occurring nucleotides, such as nucleotide sugars. In some embodiments, sugars are RNA or DNA sugars (ribose or deoxyribose). In some embodiments, sugars are modified ribose or deoxyribose sugars, e.g., 2'-modified, 5'-modified, etc. As described herein, in some embodiments, when used with oligonucleotides and / or nucleic acids, modified sugars may provide one or more desired properties, activities, etc. In some embodiments, the sugar is optionally substituted ribose or deoxyribose. In some embodiments, “sugar” refers to a sugar unit in an oligonucleotide or nucleic acid.

[0088] Susceptible to: Individuals "susceptible to" a disease, disorder, and / or condition are individuals who have a higher risk of developing a disease, disorder, and / or condition than members of the general population. In some embodiments, individuals susceptible to a disease, disorder, and / or condition have a predisposition to having the disease, disorder, and / or condition. In some embodiments, individuals susceptible to a disease, disorder, and / or condition may not be diagnosed with the disease, disorder, and / or condition. In some embodiments, individuals susceptible to a disease, disorder, and / or condition may exhibit symptoms of the disease, disorder, and / or condition. In some embodiments, individuals susceptible to a disease, disorder, and / or condition may not exhibit symptoms of the disease, disorder, and / or condition. In some embodiments, individuals susceptible to a disease, disorder, and / or condition develop the disease, disorder, and / or condition. In some embodiments, individuals susceptible to a disease, disorder, and / or condition do not develop the disease, disorder, and / or condition.

[0089] Therapeutic Agent: As used herein, the term “therapeutic agent” generally refers to any agent that, when administered to a subject, induces a desired effect (e.g., a desired biological, clinical, or pharmacological effect). In some embodiments, an agent is considered a therapeutic agent if it exhibits a statistically significant effect across an appropriate population. In some embodiments, the appropriate population is a population of subjects that suffer from and / or are susceptible to a disease, disorder, or condition. In some embodiments, the appropriate population is a population of model organisms. In some embodiments, the appropriate population may be defined by one or more criteria, such as age group, sex, genetic background, pre-existing clinical condition, or prior treatment history. In some embodiments, a therapeutic agent is a substance that, when administered to a subject in an effective dose, reduces, improves, alleviates, inhibits, prevents, delays the onset of, reduces the severity of, and / or the incidence of, one or more symptoms or characteristics of the disease, disorder, and / or condition of the subject. In some embodiments, a “therapeutic agent” is an agent that has been approved or is required to be approved by a government agency before it may be placed on the market for administration to humans. In some embodiments, the “therapeutic agent” is a drug for which a prescription is required for administration to a human. In some embodiments, the therapeutic agent is a compound provided, for example, a provided oligonucleotide.

[0090] Therapeutic dose: As used herein, the term “therapeutic dose” means the amount of a substance (e.g., a therapeutic agent, composition, and / or formulation) that, when administered as part of a therapeutic regimen, elicits a desired biological response. In some embodiments, the therapeutic dose of a substance is an amount sufficient, when administered to a subject suffering from or susceptible to a disease, disorder, and / or condition, to treat, diagnose, prevent, and / or delay the onset of the disease, disorder, and / or condition. As will be understood by those skilled in the art, the effective dose of a substance may vary depending on factors such as the desired biological endpoint, the substance being delivered, and the target cells or tissues. For example, the effective dose of a compound in a formulation for treating a disease, disorder, and / or condition is an amount that reduces, improves, alleviates, inhibits, prevents, delays the onset of, reduces the severity of, and / or reduces the incidence of one or more symptoms or characteristics of the disease, disorder, and / or condition. In some embodiments, the therapeutic dose is administered in a single dose, and in some embodiments, multiple unit doses are required to deliver the therapeutic dose.

[0091] To treat: As used herein, the terms “to treat,” “treatment,” or “to treat” mean any method used to partially or completely reduce, improve, alleviate, inhibit, prevent, delay the onset of, reduce the severity of, and / or reduce the incidence of one or more symptoms or characteristics of a disease, disorder, and / or condition. Treatment may be administered to subjects who show no signs of a disease, disorder, and / or condition. In some embodiments, treatment may be administered to subjects who show only early signs of a disease, disorder, and / or condition, for example, to reduce the risk of developing a pathology associated with the disease, disorder, and / or condition.

[0092] Unsaturated: As used herein, the term "unsaturated" means that a part has one or more unsaturated units.

[0093] Wild-type: As used herein, the term “wild-type” has the meaning understood in the art of referring to an entity having a structure and / or activity that is found naturally in a “normal” state or circumstances (as opposed to mutation, pathology, degeneration, etc.). Those skilled in the art will understand that wild-type genes and polypeptides often exist in multiple different forms (e.g., alleles).

[0094] As those skilled in the art will understand, the methods and compositions described herein relating to the compounds provided (e.g., oligonucleotides) are generally also applicable to pharmaceutically acceptable salts of such compounds.

[0095] Description of a specific embodiment Oligonucleotides are useful in a variety of therapeutic, diagnostic, and research applications. The use of naturally occurring nucleic acids is limited, for example, by their sensitivity to endo- and exonucleases. Therefore, various synthetic counterparts have been developed to circumvent these drawbacks and / or to further improve various properties and activities. These include synthetic oligonucleotides with chemical modifications, such as base modifications, sugar modifications, and skeletal modifications, which, among other things, make these molecules less susceptible to degradation and improve other properties and / or activities.

[0096] From a structural standpoint, modifications to internucleotide bonds can introduce chirality, and certain properties and activities may be influenced by the arrangement of the bound phosphorus atoms of oligonucleotides. For example, binding affinity, sequence-specific binding to complementary RNA, stability to nucleases, activity, delivery, and pharmacokinetics may be influenced, in particular, by the chirality of the skeletal bound phosphorus atoms.

[0097] Dystrophin In some embodiments, the present disclosure provides technologies, such as oligonucleotides, compositions, methods, etc., related to the dystrophin (DMD) gene or its gene products (e.g., nucleic acids (e.g., DNA, RNA), transcripts (e.g., DMD transcripts), proteins encoded thereby (e.g., DMD polypeptides), etc.

[0098] In some embodiments, the present disclosure provides oligonucleotides and compositions thereof for the treatment of muscular dystrophy, including but not limited to Duchenne muscular dystrophy (also abbreviated as DMD) and Becker muscular dystrophy (BMD), as well as techniques for the use thereof. In some embodiments, DMD comprises one or more mutations. In some embodiments, such mutations are associated with a reduction in the biological function of the dystrophin protein in subjects suffering from or susceptible to muscular dystrophy.

[0099] In some embodiments, the DMD gene or its gene product, or variants or parts thereof, may be referred to as DMD, BMD, CMD3B, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272, MRX85, dystrophin, and so on. Various DMD sequences, including variants thereof, including sequences associated with the following identification numbers, are readily available to those skilled in the art: (i) for humans: OMIM:300377, GeneCards:DMD, Entrez ID:1756, Ensembl:ENSG00000198947, UniProt:P11532, RefSeq(mRNA):NM_000109, NM_004006, NM_004007, NM_004009, and NM_004010; RefSeq(protein):NP_000100, NP_003997, NP_004000, NP_004001, and NP_004002; location (UCSC):Chr X:31.1~33.34Mb; (ii) for mice: MGI:94909, Entrez ID:13405, Ensembl:ENSMUSG00000045103, UniProt:P11531, RefSeq(mRNA):NM_007868,NM_001314034,NM_001314035,NM_001314036, and NM_001314037;RefSeq(protein):NP_001300963,NP_001300964,NP_001300965,NP_001300966, and NP_001300967;Location (UCSC):Chr X:82.95~85.21Mb, and (iii)For multiple species:HomoloGene:20856.

[0100] The DMD gene reportedly contains 79 exons distributed across 2.3 million bp of the genetic space on the X chromosome; however, only approximately 14,000 bp (<1%) is reported to be used for translation into the protein (coding sequence). The intron sequence, which accounts for about 99.5% of the gene sequence, is reported to be spliced ​​from the initial 2.3 million bp heconuclear RNA DMD transcript to yield a mature 14,000 bp mRNA containing all the essential information for the production of the dystrophin protein. In some embodiments, subjects with DMD have mutations in the DMD gene that prevent proper construction of wild-type DMD mRNA and / or production of wild-type dystrophin protein, and subjects with DMD often exhibit marked dystrophin deficiency in their muscles.

[0101] In some embodiments, dystrophin DMD transcripts, e.g., mRNA or proteins, include those associated with or produced from alternative splicing. For example, 16 alternative DMD transcripts of the dystrophin gene were reported in accordance with an analysis of the splicing patterns of the DMD gene in skeletal muscle, brain, and cardiac tissue (Sironi et al. 2002 FEBS Letters 517:163-166).

[0102] Dystrophin has been reported to have several isoforms. In some embodiments, dystrophin refers to a specific isoform. At least three full-length dystrophin isoforms have been reported, each controlled by a tissue-specific promoter (Klamut et al. 1990 Mol.Cell.Biol.10:193-205, Nudel et al. 1989 Nature 337:76-78, Gorecki et al. 1992 Hum.Mol.Genet.1:505-510). Muscle isoforms are mainly expressed in skeletal muscle, but have also been reported to be expressed in smooth muscle and cardiac muscle (Bies, RD, Phelps, SF, Cortez, MD, Roberts, R., Caskey, CT and Chamberlain, JS 1992 Nucleic Acids Res. 20: 1725-1731). Brain dystrophin is specific to cortical neurons, but has also been reported to be detectable in cardiac and cerebellar neurons. On the other hand, Purkinje cell type has been reported to account for almost all cerebellar dystrophin (Gorecki et al. 1992 Hum. Mol. Genet. 1: 505-510). Alternative splicing has been reported to provide a means for dystrophin diversification, with the 3' region of genes undergoing alternative splicing resulting in tissue-specific DMD transcripts in brain neurons, cardiac Purkinje fibers, and smooth muscle cells (Bies et al. 1992 Nucleic Acids Res. 20:1725-1731, and Feener et al. 1989 Nature 338:509-511). Meanwhile, 12 alternative splicing patterns have been reported in the 5' region of genes in skeletal muscle (Surono et al. 1997 Biochem. Biophys. Res. Commun. 239:895-899).

[0103] In some embodiments, the dystrophin gene, transcript (e.g., mRNA), or protein is a reverted version. In particular, relapsed dystrophin has been reported, for example, in the following: Hoffman et al. 1990 J.Neurol.Sci. 99:9-25, Klein et al. 1992 Am.J.Hum.Genet. 50:950-959, and Chelly et al. 1990 Cell 63:1239-1348, Arahata et al. 1998 Nature 333:861-863, Bonilla et al. 1988 Cell 54:447-452, Fanin et al. 1992 Neur.Disord. 2:41-45, Nicholson et al. 1989 J.Neurol.Sci. 94:137-146, Shimizu et al. 1988 Proc.Jpn.Acad.Sci. 64:205-208, Sicinzki et al. al.1989 Science 244:1578-1580, and Sherratt et al.Am.J.Hum.Genet.53:1007-1015.

[0104] Various mutations in the DMD gene have been reported to be able to cause and / or induce muscular dystrophy. The diverse mutations in the DMD gene are outlined, for example, in Flanigan et al. 2009 Hum Mutat. 30(12):1657-1666. Mutations in the form of large deletions (one or more exons) are reported to account for approximately two-thirds of all DMD gene mutations, while remaining mutations are reported to result from duplications and small deletions, insertions, point mutations, or splicing mutations. According to specific reports, deletions are typically clustered in the hotspot region between exons 45 and 55, interfering with dystrophin translation. The absence or deficiency of the dystrophin protein resulting from DMD gene mutations has been reported to disrupt the dystrophin-glycoprotein complex, leading to increased fascial fragility, chronic muscle damage, inflammation, replacement of muscle fibers by adipose and fibrous tissue, and subsequent loss of muscle function. Various databases of DMD gene mutations have been constructed, including those described in Aartsma-Rus et al. 2006 Muscle Nerve. 34(2):135-44 and Bladen et al. 2015 Hum Mutat. 36(4):395-402. In some embodiments, mutations in the DMD gene or its gene product (e.g., DMD transcript) include deletions. In some embodiments, mutations in the DMD gene or its gene product (e.g., DMD transcript) include point mutations. In some embodiments, mutations in the DMD gene or its gene product (e.g., DMD transcript) include insertions. In some embodiments, mutations in the DMD gene or its gene product (e.g., DMD transcript) include duplications. In some embodiments, mutations in the DMD gene or its gene product (e.g., DMD transcript) are mutations that allow exon skipping. In some embodiments, mutations in the DMD gene or its gene product (e.g., DMD transcript) are mutations that allow exon 45 skipping.

[0105] oligonucleotides In particular, this disclosure provides oligonucleotides of various designs, which may include various nucleic acid bases and their patterns, sugars and their patterns, internucleotide bonds and their patterns, and / or additional chemical parts and their patterns, as described herein.

[0106] In some embodiments, the Disclosure provides oligonucleotides and / or oligonucleotide compositions useful for a variety of purposes, such as regulating skipping, reducing the level of DMD transcripts, improving the level of beneficial proteins, and treating conditions, diseases, and disorders. In some embodiments, the Disclosure provides oligonucleotide compositions having improved properties, such as increased skipping of exon 45 or reduced toxicity. In particular, the oligonucleotides of the Disclosure include chemical modifications, stereochemistry, and / or combinations thereof, which can improve various properties and activities of the oligonucleotides. Non-limiting examples of oligonucleotides are listed in Table 1 (e.g., Tables 1A, 1B, and 1C).

[0107] Base sequence As will be understood by those skilled in the art, structural features of the present disclosure, such as nucleic acid base modification, sugar modification, internucleotide bond modification, and the stereochemistry of bound phosphorus, and combinations thereof, can be used with various suitable base sequences to provide oligonucleotides and compositions having desired properties and / or activities.

[0108] In some embodiments, the oligonucleotide has a nucleotide sequence or a portion thereof as described herein (e.g., in the table) having 0 to 5 mismatches (e.g., 0, 1, 2, 3, 4, or 5), where each T can be independently substituted with U, and vice versa. In some embodiments, the oligonucleotide comprises a nucleotide sequence or a portion thereof as described herein, where the portion is a range of at least 10 consecutive nucleic acid bases, or a range of at least 15 consecutive nucleic acid bases having 0 to 5 mismatches. In some embodiments, the oligonucleotides provided have a nucleotide sequence or a portion thereof as described herein, the portion of which is a range of at least 10 consecutive nucleic acid bases, or a range of at least 10 consecutive nucleic acid bases having 1 to 5 mismatches, where each T can be independently substituted with U, and vice versa.

[0109] In some embodiments, the base sequence of the oligonucleotide is 10 to 60 (for example, about or at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 45, 50, 55, 60; in some embodiments, at least 15; in some embodiments, at least 16; in some embodiments, at least 17; in some embodiments, at least 18; in some embodiments, at least 19; in some embodiments, at least 20; in some embodiments, at least 21; in some embodiments, at least 22; in some embodiments, The sequence of the oligonucleotides comprises, optionally, a sequence of nucleic acids (at least 23; in some embodiments, at least 24; in some embodiments, at least 25; in some embodiments, at least 26; in some embodiments, at least 27; in some embodiments, at least 28; in some embodiments, at least 29; in some embodiments, at least 30; in some embodiments, at least 31; in some embodiments, at least 32; in some embodiments, at least 33; in some embodiments, at least 34; in some embodiments, at least 35) bases, optionally consecutive, comprising a sequence identical to or complementary to the sequence of a DMD gene or its transcript. In some embodiments, the sequence of the oligonucleotides comprises, or comprises, a sequence complementary to the target sequence in the gene or its transcript.

[0110] In some embodiments, the target sequence is a characteristic sequence of a nucleic acid sequence (e.g., a gene or its transcript) in that it defines the nucleic acid sequence more than others in the organism in question; for example, the characteristic sequence is not present in other genomic nucleic acid sequences (e.g., genes) or their transcripts in the organism in question, or at least has various mismatches. In some embodiments, the characteristic sequence of a transcript defines that transcript more than other transcripts in the organism in question; for example, in some embodiments, the characteristic sequence is not present in transcripts transcribed from different nucleic acid sequences (e.g., different genes). In some embodiments, transcript variants from a nucleic acid sequence (e.g., mRNA variants of a gene) may share common characteristic sequences that define them, for example, from transcripts of other genes.

[0111] As will be understood by those skilled in the art, the sequences of oligonucleotides provided are typically of sufficient length and complementarity with their target nucleic acids (e.g., RNA transcripts (e.g., pre-mRNA, mature mRNA, etc.)) for, for example, exon skipping. As will be understood by those skilled in the art, in many cases the target nucleic acids are longer than the oligonucleotides of this disclosure, and complementarity can be appropriately assessed based on the shorter of the two oligonucleotides. In some embodiments, the sequences of oligonucleotides have 90% or more identity with the sequences of oligonucleotides disclosed in the table, and each T can be independently substituted with U, and vice versa. In some embodiments, the sequences of oligonucleotides have 95% or more identity with the sequences of oligonucleotides disclosed in the table, and each T can be independently substituted with U, and vice versa. In some embodiments, the base sequence of the oligonucleotide includes 15, 16, 17, 18, 19, 20, or more adjacent spans of the oligonucleotides disclosed in the table (each T can be independently substituted with U and vice versa), except in cases where one or more bases within a span are absent (e.g., a certain nucleic acid base is not present in the nucleotide).

[0112] In some embodiments, the disclosure relates to oligonucleotides having a nucleotide sequence comprising the nucleotide sequence of any oligonucleotide disclosed herein (each T may be independently replaced by U, and vice versa).

[0113] In some embodiments, the present disclosure relates to an oligonucleotide having a base sequence which is the base sequence of any oligonucleotide disclosed herein, where each T can be independently replaced with U, and vice versa.

[0114] In some embodiments, the disclosure relates to oligonucleotides having a nucleotide sequence comprising at least 15 adjacent bases of the nucleotide sequence of any oligonucleotide disclosed herein (each T may be independently replaced by U, and vice versa).

[0115] In some embodiments, the disclosure relates to oligonucleotides having a nucleotide sequence that is at least 90% identical to the nucleotide sequence of any oligonucleotide disclosed herein (each T may be independently replaced by U, and vice versa).

[0116] In some embodiments, the disclosure relates to oligonucleotides having a nucleotide sequence that is at least 95% identical to the nucleotide sequence of any oligonucleotide disclosed herein (each T may be independently replaced by U, and vice versa).

[0117] In some embodiments, the nucleotide sequence of the oligonucleotide is or contains 10 to 40 consecutive nucleotides (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40) of the nucleotide sequence of any oligonucleotide described herein, or contains such nucleotides, where each T can be independently replaced by a U, and vice versa.

[0118] In some embodiments, the oligonucleotide is one of the oligonucleotides listed in the table herein.

[0119] In some embodiments, the oligonucleotide sequence is complementary to the sequence of the target nucleic acid, for example, the dystrophin gene or its transcript. In some embodiments, the oligonucleotide sequence is at least about 50%, 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or 100%, complementary to the target sequence in the DMD transcript. In some embodiments, the oligonucleotide sequence is completely complementary to the target sequence in the DMD transcript.

[0120] In some embodiments, the oligonucleotide has a base sequence containing at least 15 consecutive bases (e.g., 15, 16, 17, 18, 19, or 20) of the oligonucleotide in the table, where each T can be independently replaced by U, and vice versa.

[0121] In some embodiments, the oligonucleotide comprises a base sequence or a portion thereof as listed in any of the tables (e.g., 10 to 40 bases, e.g., a portion containing 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 nucleic acid bases), where each T can be independently replaced by U, and vice versa, and / or comprises sugars, nucleic acid bases, and / or internucleotide bond modifications and / or stereochemistry and / or patterns, and / or additional chemical parts (in addition to the oligonucleotide chain, e.g., target part, lipid part, carbohydrate part, etc.) as listed in any of the tables.

[0122] In some embodiments, the terms “complementary,” “fully complementary,” and “substantially complementary” may be used with respect to the matching bases between the oligonucleotide and the target sequence, as will be understood by those skilled in the art in connection with their use. It should be noted that the substitution of T with U, or vice versa, generally does not change the amount of complementarity. As used herein, an oligonucleotide that is “substantially complementary” to the target sequence is largely or almost complementary, but not necessarily 100% complementary. In some embodiments, a substantially complementary sequence (e.g., oligonucleotide) has one or more mismatches (e.g., 1, 2, 3, 4, or 5) when maximally aligned with its target sequence. In some embodiments, the oligonucleotide has a base sequence that is substantially complementary to the target sequence of the target nucleic acid. In some embodiments, the oligonucleotide has a base sequence that is substantially complementary to the complement of the oligonucleotide sequence disclosed herein. As will be understood by those skilled in the art, in some embodiments, the oligonucleotide sequence does not need to be 100% complementary to its target for the oligonucleotide to perform its function. In some embodiments, the nucleotide sequences of the provided oligonucleotides are fully complementary to their target sequences (AT / U and CG base pairing).

[0123] In some embodiments, the oligonucleotide comprises an oligonucleotide having a sequence complementary to a characteristic portion of the nucleic acid. In some embodiments, the oligonucleotide comprises a sequence complementary to a characteristic portion of the DMD transcript. In some embodiments, the nucleotide sequence of the oligonucleotide is complementary to a characteristic portion of the nucleic acid. In some embodiments, the nucleotide sequence of the oligonucleotide is complementary to a characteristic portion of the DMD transcript. In some embodiments, the characteristic portion is a characteristic sequence. In some embodiments, the characteristic sequence of the DMD transcript is a complementary sequence of the oligonucleotide sequence in Table 1 (e.g., Table 1A, Table 1B, Table 1C), or comprises the same. In some embodiments, the characteristic sequence is GGCUUCAACUAUCUGAGUGA, or comprises the same, where each U can be independently replaced with T. In some embodiments, the characteristic sequence is CGGCAAACUGUUGUCAGAAC, or comprises the same, where each U can be independently replaced with T. In some embodiments, the characteristic sequence is GCGGCAAACUGUUGUCAGAA, or comprises the same, where each U can be independently replaced with T. In some embodiments, the characteristic sequence is AGCGCAAACUGUUGUCAGA or includes it, and each U can be independently replaced with T. In some embodiments, the characteristic sequence is CAGCGGCAAACUGUUGUCAG or includes it, and each U can be independently replaced with T. In some embodiments, the characteristic sequence is GGCAUUGGGCAGCGGCAAAC or includes it, and each U can be independently replaced with T. In some embodiments, the characteristic sequence is CUCCAGGAUGGCAUUGGGCA or includes it, and each U can be independently replaced with T. In some embodiments, the characteristic sequence is GAACUCCAGGAUGGCAUUGG or includes it, and each U can be independently replaced with T. In some embodiments, the characteristic sequence is CAGGAACUCCAGGAUGGCAU or includes it, and each U can be independently replaced with T.

[0124] In some embodiments, oligonucleotides can hybridize to a region of nucleic acid. In some embodiments, the region has a length of about 20 to 200 nucleic acid bases (e.g., about 20 to 150, 20 to 100, 30 to 200, 30 to 150, 40 to 200, 40 to 150, 50 to 100, or about 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 nucleic acid bases). In some embodiments, the region has a length of about 30 nucleic acid bases. In some embodiments, the region has a length of about 40 nucleic acid bases. In some embodiments, the region has a length of about 50 nucleic acid bases. In some embodiments, the region has a length of about 60 nucleic acid bases. In some embodiments, the region has a length of about 70 nucleic acid bases. In some embodiments, the region has a length of about 80 nucleic acid bases. In some embodiments, the region has a length of about 90 nucleic acid bases. In some embodiments, the region has a length of about 100 nucleic acid bases. In some embodiments, the region has a length of about 120 nucleic acid bases. In some embodiments, the region has a length of about 150 nucleic acid bases. In some embodiments, the region has a length of about 200 nucleic acid bases. In some embodiments, the region includes, in some embodiments, a complementary sequence of the oligonucleotide sequence in Table 1 (e.g., Table 1A, Table 1B, Table 1C) located in the center of the region. For example, in some embodiments, the region is GGCUUCAACUAUCUGAGUGA or includes it. In some embodiments, the region is CGGCAAACUGUUGUCAGAAC or includes it. In some embodiments, the region is GCGGCAAACUGUUGUCAGAA or includes it. In some embodiments, the region is AGCGGCAAACUGUUGUCAGA or includes it. In some embodiments, the region is CAGCGGCAAACUGUUGUCAG or includes it. In some embodiments, the region is GGCAUUGGGCAGCGGCAAAC or includes it.In some embodiments, the region is CUCCAGGAUGGCAUUGGGCA or includes it. In some embodiments, the region is GAACUCCAGGAUGGCAUUGG or includes it. In some embodiments, the region is CAGGAACUCCAGGAUGGCAU or includes it.

[0125] In some embodiments, the Disclosure provides oligonucleotides comprising sequences found in the oligonucleotides listed in the Table, wherein one or more Us are independently and optionally replaced by Ts, and vice versa. In some embodiments, the oligonucleotide may comprise at least one T and / or at least one U. In some embodiments, the Disclosure provides oligonucleotides comprising sequences found in the oligonucleotides listed in the Table herein, wherein the sequences have more than 50% identity with the sequences of the oligonucleotides listed in the Table. In some embodiments, the Disclosure provides oligonucleotides whose nucleotide sequences are the sequences of the oligonucleotides disclosed in the Table, wherein each T may be independently replaced by a U, and vice versa. In some embodiments, the Disclosure provides oligonucleotides comprising sequences found in the oligonucleotides of the Table, wherein the oligonucleotides have the same or different patterns of skeletal bonding, chiral centers, and / or phosphorus modifications as the same or different oligonucleotides in the Table herein.

[0126] In some embodiments, the present disclosure provides oligonucleotides that are part of, contain, or have a sequence containing an oligonucleotide disclosed herein (e.g., in the table), where each T can be independently replaced by a U, and vice versa, and the oligonucleotides optionally further include chemical modifications, stereochemistry, form, additional chemical parts (e.g., targeting parts, lipid parts, carbohydrate parts, etc.), and / or other structural features as described herein.

[0127] In some embodiments, “part” (e.g., a base sequence or modification or pattern of other structural elements) consists of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 monomer unit lengths.

[0128] As an example, a particular oligonucleotide, including the base sequence of a specific example, nucleic acid base modifications and their patterns, sugar modifications and their patterns, internucleotide bonds and their patterns, the stereochemistry and patterns of bound phosphorus, linkers, and / or additional chemical parts, is presented in Table 1 below. In particular, these oligonucleotides may be used for exon skipping. In some embodiments, stereorandom oligonucleotide compositions are listed in the table. In some embodiments, the disclosure provides chiral-controlled oligonucleotide compositions.

[0129] In some embodiments, the nucleotide sequence is a specific sequence or includes it. In some embodiments, the nucleotide sequence is a nucleotide sequence complementary to a specific sequence or complementary to a nucleotide sequence containing it. In some embodiments, the nucleotide sequence is a sequence different from a specific sequence within positions 1, 2, 3, 4, or 5, or includes it. In some embodiments, the nucleotide sequence is a sequence different from about 15 to 30 consecutive nucleic acid bases (e.g., 15-25, 15-20, 20-30, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) of a specific sequence within positions 1, 2, 3, 4, or 5, or includes it. In some embodiments, the nucleotide sequence is a sequence different from a specific sequence within position 1, or includes it. In some embodiments, the nucleotide sequence is a sequence different from a specific sequence within position 2, or includes it. In some embodiments, the nucleotide sequence is different from, or includes, a specific sequence within three positions. In some embodiments, the nucleotide sequence is different from, or includes, a specific sequence within four positions. In some embodiments, the nucleotide sequence is different from, or includes, a specific sequence within five positions. In some embodiments, the specific sequence is a nucleotide sequence selected from Table 1, or includes one. In some embodiments, the specific sequence is a sequence of 5 to 20, 10 to 20, or 15 to 20 (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) consecutive bases in a nucleotide sequence selected from Table 1, or includes one. In some embodiments, the specific sequence is a sequence of 10 consecutive bases in a nucleotide sequence selected from Table 1, or includes one. In some embodiments, the specific sequence is a sequence of 11 consecutive bases in a nucleotide sequence selected from Table 1, or includes one. In some embodiments, a particular sequence is or includes 12 consecutive bases in a nucleotide sequence selected from Table 1. In some embodiments, a particular sequence is or includes 13 consecutive bases in a nucleotide sequence selected from Table 1.In some embodiments, a particular sequence is or includes 14 consecutive bases in a nucleotide sequence selected from Table 1. In some embodiments, a particular sequence is or includes 15 consecutive bases in a nucleotide sequence selected from Table 1. In some embodiments, a particular sequence is or includes 16 consecutive bases in a nucleotide sequence selected from Table 1. In some embodiments, a particular sequence is or includes 17 consecutive bases in a nucleotide sequence selected from Table 1. In some embodiments, a particular sequence is or includes 18 consecutive bases in a nucleotide sequence selected from Table 1. In some embodiments, a particular sequence is or includes 19 consecutive bases in a nucleotide sequence selected from Table 1. In some embodiments, a particular sequence is or includes 20 consecutive bases in a nucleotide sequence selected from Table 1. In some embodiments, the nucleotide sequence selected from Table 1 is the nucleotide sequence selected from Table 1A. In some embodiments, the nucleotide sequence selected from Table 1 is the nucleotide sequence selected from Table 1B. In some embodiments, the nucleotide sequence selected from Table 1 is the nucleotide sequence selected from Table 1C. In some embodiments, a particular sequence is UCACUCAGAAUAGUUGAAGCC or includes it, where each U can be independently replaced by T and vice versa. In some embodiments, a particular sequence is UCACUCAGAAUAGUUGAAGCC or includes it. In some embodiments, a particular sequence is GUUCUGACAACAGUUUGCCG or includes it, where each U can be independently replaced by T and vice versa. In some embodiments, a particular sequence is GUUCUGACAACAGUUUGCCG or includes it. In some embodiments, a particular sequence is UUCUGACAACAGUUUGCCGC or includes it, where each U can be independently replaced by T and vice versa. In some embodiments, a particular sequence is UUCUGACAACAGUUUGCCGC or includes it.In some embodiments, a particular sequence is or includes UCUGACAACAGUUUGCCGCU, where each U can be independently replaced by T and vice versa. In some embodiments, a particular sequence is or includes UCUGACAACAGUUUGCCGCU. In some embodiments, a particular sequence is or includes CUGACACAGUUUGCCGCUG, where each U can be independently replaced by T and vice versa. In some embodiments, a particular sequence is or includes CUGACACAGUUUGCCGCUG. In some embodiments, a particular sequence is or includes GUUUGCCGCUGCCCAAUGCC, where each U can be independently replaced by T and vice versa. In some embodiments, a particular sequence is or includes GUUUGCCGCUGCCCAAUGCC. In some embodiments, a particular sequence is or includes UGCCCAAUGCCAUCCUGGAG, where each U can be independently replaced by T and vice versa. In some embodiments, a particular sequence is UGCCCAAUGCCAUCCUGGAG or includes it. In some embodiments, a particular sequence is CCAAUGCCAUCCUGGAGUUC, or includes it, where each U can be independently replaced by T and vice versa. In some embodiments, a particular sequence is CCAAUGCCAUCCUGGAGUUCUC, or includes it. In some embodiments, a particular sequence is AUGCCAUCUGGAGUUCCUG, or includes it, where each U can be independently replaced by T and vice versa. In some embodiments, a particular sequence is AUGCCAUCUGGAGUUCCUG, or includes it. [Table 1-1] [Table 1-2] [Table 1-3] Table 2-1 Table 2-2 Table 2-3 Table 2-4 Table 2-5 Table 2-6 Table 2-7 Table 2-8 Table 2-9 Table 3-1 Table 3-2 Note: The HELM descriptions and sequences may be divided into multiple rows in Table 1 (e.g., Table 1A, Table 1B, and Table 1C) due to their lengths. Unless otherwise specified, all oligonucleotides in Table 1 are single-stranded. As will be understood by those skilled in the art, unless otherwise indicated (e.g., m, [fl2r]), nucleoside units are unmodified and contain unmodified nucleic acid bases and 2'-deoxy sugars, bonds are naturally phosphate bonds unless otherwise indicated, and acidic / basic groups may exist independently in their salt forms. If sugars are not specified, they are naturally DNA sugars, and if internucleotide bonds are not specified, internucleotide bonds are naturally phosphate bonds. Natural DNA sugars may be denoted by "d", such as d(G), d(A), d(C), d(T), etc., and naturally phosphate bonds may be denoted by "p" in Table 1. The oligonucleotides in Table 1 (e.g., Table 1A, Table 1B, and Table 1C) are described using the Hierarchical Editing Language for Macromolecules (HELM), as described, for example, in Zhang, T. et al. J Chem Inf Model. 2012 Oct 22;52(10):2796-806 and Milton, J. et al. J Chem Inf Model. 2017 Jun 26;57(6):1233-1239. Parts and modifications: m:2'-OMe(for example, m(G), m(A), m(C), m(U)); [m5C]: The methyl group at position 5 of carbon (the nucleic acid base is 5-methylcytosine); [fl2r]:2'-F; r:2'-OH (for example, r(G), r(A), r(C), r(U)); [moe]:2'-MOE(2'-OCH2CH2OCH3); [moe]([m5C]):5-methyl-2'-O-methoxyethyl C; p: Phosphodiester (phosphate). It can be a bond, or a terminal group (or its component), such as a bond between a linker and an oligonucleotide chain, or an internucleotide bond (natural phosphate bond). *: Phosphothioate. This can be a terminal group (or a component thereof), or a bond, such as a bond between a linker and an oligonucleotide chain, or an internucleotide bond (phosphorothioate internucleotide bond). [Rsp]: Phosphothioates with Rp configuration; [Ssp]: Phosphothioates in the sp configuration; [sp]: Stereorandom phosphorothioates; n001: [ka] ; [n001]: A three-dimensional random n001; [n001R]: n001 in Rp configuration; [n001S]: n001 in Sp configuration. In some embodiments, the sugar is bonded to the nucleotide bond via an oxygen atom (e.g., an oxygen atom in a natural phosphate bond, such as in a typical native DNA molecule). In some embodiments, the sugar is bonded to the nucleotide bond via an atom other than oxygen. In some embodiments, the sugar is bonded to the nucleotide bond via a nitrogen atom of the sugar. In some embodiments, the sugar is bonded to the nucleotide bond via a ring nitrogen atom of the sugar, in which case the ring nitrogen atom of the sugar may directly form a bond with the bound phosphorus atom, and those skilled in the art will understand that the oxygen atom may be removed from the bond. Methods utilizing certain reagents (e.g., phosphoramidites, nucleosides, etc.) and various modifications (e.g., modified sugars, modified nucleic acid bases, etc., as illustrated in the table herein) are described in the examples or in WO2021 / 071858 or WO2022 / 099159, each incorporated herein by reference. As those skilled in the art will understand, oligonucleotides may be referred to by their HELM description, for example, in the table above, with or without "RNA1{}$$$$V2.0".

[0130] Nucleic acid bases Various nucleic acid bases can be used in oligonucleotides provided pursuant to this disclosure. In some embodiments, the nucleic acid base is a native nucleic acid base, most commonly occurring being A, T, C, G, and U. In some embodiments, the nucleic acid base is a modified nucleic acid base in that it is not A, T, C, G, or U. In some embodiments, the nucleic acid base is an optionally substituted A, T, C, G, or U, or a substituted tautomer of A, T, C, G, or U. In some embodiments, the nucleic acid base is an optionally substituted A, T, C, G, or U, e.g., 5mC, 5-hydroxymethyl C. In some embodiments, the nucleic acid base is alkyl-substituted A, T, C, G, or U. In some embodiments, the nucleic acid base is A. In some embodiments, the nucleic acid base is T. In some embodiments, the nucleic acid base is C. In some embodiments, the nucleic acid base is G. In some embodiments, the nucleic acid base is U. In some embodiments, the nucleic acid base is 5mC. In some embodiments, the nucleic acid base is a substituted A, T, C, G, or U. In some embodiments, the nucleic acid base is a substituted tautomer of A, T, C, G, or U. In some embodiments, the substitution protects certain functional groups in the nucleic acid base to minimize undesirable reactions during oligonucleotide synthesis. Preferred techniques for protecting nucleic acid bases in oligonucleotide synthesis are widely known in the art and may be utilized in accordance with this disclosure. In some embodiments, the modified nucleic acid base improves the properties and / or activity of the oligonucleotide. For example, 5mC may often be used in place of C to modulate certain undesirable biological effects, such as an immune response. In some embodiments, when determining sequence identity, substituted nucleic acid bases having the same hydrogen bonding pattern are treated as the same as unsubstituted nucleic acid bases; for example, 5mC may be treated as C [for example, an oligonucleotide having 5mC instead of C (e.g., AT5mCG) is considered to have the same base sequence (e.g., ATCG) as an oligonucleotide having C at the corresponding position(s)].In some embodiments, the nucleic acid base is or comprises an optionally substituted ring having at least one nitrogen atom. In some embodiments, the nucleic acid base comprises a ring BA as described herein, wherein at least one monocyclic ring of ring BA contains a nitrogen ring atom.

[0131] In some embodiments, the oligonucleotide comprises one or more A, T, C, G, or U. In some embodiments, the oligonucleotide comprises one or more optionally substituted A, T, C, G, or U. In some embodiments, the oligonucleotide comprises one or more 5-methylcytidine, 5-hydroxymethylcytidine, 5-formylcytosine, or 5-carboxylcytosine. In some embodiments, the oligonucleotide comprises one or more 5-methylcytidine. In some embodiments, each nucleic acid base in the oligonucleotide is selected from the group consisting of optionally substituted A, T, C, G, and U, and optionally substituted tautomers of A, T, C, G, and U. In some embodiments, each nucleic acid base in the oligonucleotide is optionally protected A, T, C, G, and U. In some embodiments, each nucleic acid base in the oligonucleotide is optionally substituted A, T, C, G, or U. In some embodiments, each nucleic acid base in the oligonucleotide is selected from the group consisting of A, T, C, G, U, and 5mC.

[0132] As will be understood by those skilled in the art, various nucleic acid bases are known in the art and can be used in accordance with this disclosure, for example, each sugar, base, and internucleotide bond modification is independently incorporated herein by reference, US9394333, US9744183, US9605019, US9982257, US2017 / 0037399, US2018 / 0216108, US2018 / 0216107, US9598458, WO2017 / 062862, WO2018 / 067973, WO2017 / 160741, WO2017 / 192679, W This is described in O2017 / 210647, WO2018 / 098264, WO2018 / 022473, WO2018 / 223056, WO2018 / 223073, WO2018 / 223081, WO2018 / 237194, WO2019 / 032607, WO2019 / 032612, WO2019 / 055951, WO2019 / 075357, WO2019 / 200185, WO2019 / 217784, WO2019 / 032612, WO2020 / 191252, WO2021 / 071858, and / or WO2022 / 099159. In some embodiments, the nucleic acid bases are protected and useful for oligonucleotide synthesis.

[0133] In some embodiments, the nucleic acid bases are native nucleic acid bases or modified nucleic acid bases derived from native nucleic acid bases. Examples include uracil, thymine, adenine, cytosine, and guanine, pyrimidine analogs such as 2-fluorouracil, 2-fluorocytosine, 5-bromouracil, 5-iodouracil, 2,6-diaminopurine, azacytosine, pseudoisocytosine, and pseudouracil, each optionally having an amino group protected by an acyl protecting group, as well as other modified nucleic acid bases such as 8-substituted purines, xanthine, or hypoxanthine (the latter two being natural degradation products). Specific examples of modified nucleic acid bases are disclosed in Chiu and Rana, RNA, 2003, 9, 1034-1048, Limbach et al., Nucleic Acids Research, 1994, 22, 2183-2196, and Revankar and Rao, Comprehensive Natural Products Chemistry, vol. 7, 313. In some embodiments, the modified nucleic acid base is a substituted uracil, thymine, adenine, cytosine, or guanine. In some embodiments, the modified nucleic acid base is, for example, a functional substitution relating to hydrogen bonding and / or base pairing of uracil, thymine, adenine, cytosine, or guanine. In some embodiments, the nucleic acid base is an optionally substituted uracil, thymine, adenine, cytosine, 5-methylcytosine, or guanine. In some embodiments, the nucleic acid base is uracil, thymine, adenine, cytosine, 5-methylcytosine, or guanine.

[0134] In some embodiments, the oligonucleotides provided comprise one or more 5-methylcytosines. In some embodiments, the disclosure provides oligonucleotides whose nucleotide sequences are disclosed herein, for example in Table 1, where each T can be independently replaced with U, and vice versa, and each cytosine can be optionally and independently replaced with 5-methylcytosine, or vice versa. As will be understood by those skilled in the art, in some embodiments, 5mC can be treated as C with respect to the nucleotide sequence of the oligonucleotide, and such oligonucleotides contain nucleic acid base modifications at the C position (see, for example, the various oligonucleotides in Table 1). In the descriptions of oligonucleotides, typically, unless otherwise stated, the nucleic acid bases, sugars, and internucleotide bonds are unmodified.

[0135] In some embodiments, the modified base is an optionally substituted adenine, cytosine, guanine, thymine, or uracil, or a tautomer thereof. In some embodiments, the modified nucleic acid base is modified by one or more of the following modifications: Nucleic acid bases are independently modified by one or more optionally substituted groups selected from acyl, halogen, amino, azide, alkyl, alkenyl, alkynyl, aryl, heteroalkyl, heteroalkenyl, heteroalkynyl, heterocyclyl, heteroaryl, carboxyl, hydroxyl, biotin, avidin, streptavidin, substituted silyl, and combinations thereof. One or more atoms of a nucleic acid base are independently replaced by different atoms selected from carbon, nitrogen, and sulfur, One or more double bonds in a nucleic acid base are independently hydrogenated, or A modified adenine, cytosine, guanine, thymine, or uracil is modified by one or more modifications, where one or more aryl or heteroaryl rings are independently inserted into a nucleic acid base.

[0136] In some embodiments, the base is optionally substituted A, T, C, G, or U. In some embodiments, the modified base is substituted A, T, C, G, or U, and the modified base is different from the natural A, T, C, G, and U. In some embodiments, the modified base is a substituted tautomer of A, T, C, G, or U.

[0137] In some embodiments, the modified nucleic acid base is a modified nucleic acid base known in the art, for example, in WO2017 / 210647. In some embodiments, the modified nucleic acid base is a nucleic acid base whose size has been increased by the addition of one or more aryl and / or heteroaryl rings, such as a phenyl ring. Certain examples of modified nucleic acid bases, including substitutions of nucleic acid bases, are described in the Glen Research catalog (Glen Research, Sterling, Virginia), Krueger AT et al., Acc. Chem. Res., 2007, 40, 141-150, Kool, ET, Acc. Chem. Res., 2002, 35, 936-943, Benner SA, et al., Nat. Rev. Genet., 2005, 6, 553-543, Romesberg, FE, et al., Curr. Opin. Chem. Biol., 2003, 7, 723-733, or Hirao, I., Curr. Opin. Chem. Biol., 2006, 10, 622-627. In some embodiments, the enlarged-size nucleic acid base is, for example, the enlarged-size nucleic acid base described in WO2017 / 210647. In some embodiments, the modified nucleic acid base is a portion such as a ring derived from a colline or porphyrin. Substitutions of bases derived from certain porphyrins are, for example, described in Morales-Rojas, H and Kool, ET, Org. Lett., 2002, 4, 4377-4380. In some embodiments, the ring derived from a porphyrin is, for example, the ring derived from a porphyrin described in WO2017 / 219647. In some embodiments, the modified nucleic acid base is, for example, the modified nucleic acid base described in WO2017 / 219647. In some embodiments, the modified nucleic acid base is fluorescent.Examples of such fluorescently modified nucleic acid bases include phenanthrene, pyrene, stilbene, isoxanthine, isozanthopterin, terphenyl, terthiophene, benzoterthiophene, coumarin, lumazine, tetherstilbene, benzouracil, naphthouracil, and others, as described in WO2017 / 210647, for example. In some embodiments, the nucleic acid base or modified nucleic acid base is selected from C5-propyne T, C5-propyne C, C5-thiazole, phenoxazine, 2-thio-thymine, 5-triazolylphenyl-thymine, diaminopurine, and N2-aminopropylguanine.

[0138] In some embodiments, the modified nucleic acid bases are selected from 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl-substituted pyrimidines, alkyl-substituted purines, and N-2, N-6, and O-6-substituted purines. In certain embodiments, the modified nucleic acid bases are 2-aminopropyladenine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl(-C≡C-CH3)uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azocymine, 5-ribosyluracil (pseudracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8 - Substituted purines, 5-halos, in particular 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl4-N-benzoylcytosine, 5-methyl4-N-benzoyluracil, universal bases, hydrophobic bases, messy bases, enlarged bases, and fluorinated bases are selected. In some embodiments, the modified nucleic acid base is a tricyclic pyrimidine such as 1,3-diazaphenoxazine-2-one, 1,3-diazaphenothiazine-2-one, or 9-(2-aminoethoxy)-1,3-diazaphenoxazine-2-one (G-clamp). In some embodiments, the modified nucleic acid base is one in which the purine or pyrimidine base is replaced by another heterocycle, such as 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine, or 2-pyridone.In some embodiments, modified nucleic acid bases include those disclosed in US3687808, The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, JI, Ed., John Wiley & Sons, 1990, 858-859, Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, Sanghvi, YS, Chapter 15, Antisense Research and Applications, Crooke, ST and Lebleu, B., Eds., CRC Press, 1993, 273-288, or those disclosed in Chapters 6 and 15, Antisense Drug Technology, Crooke ST, Ed., CRC Press, 2008, 163-166 and 442-443.

[0139] In some embodiments, modified nucleic acid bases and methods thereof are those described in US200 / 30158403, US3687808, US4845205, US5130302, US5134066, US5175273, US5367066, US5432272, US5434257, US5457187, US5459255, US5484908, US5502177, US5525711, US5552540, US5587469, US5594121, US5596091, US5614617, US5645985, US5681941, US5750692, US5763588, US5830653, or US6005096.

[0140] In some embodiments, the modified nucleic acid base is substituted. In some embodiments, the modified nucleic acid base is substituted to include, for example, a heteroatom, an alkyl group, or a fluorescent moiety, a biotin or avidin moiety, or a binding moiety linked to another protein or peptide. In some embodiments, the modified nucleic acid base is not a nucleic acid base in the most classical sense, but is a "universal base" that functions similarly to a nucleic acid base. An example of a universal base is 3-nitropyrrole.

[0141] In some embodiments, the nucleosides available in the provided technology are modified nucleic acid bases and / or modified sugars, e.g., 4-acetylcytidine; 5-(carboxyhydroxylmethyl)uridine; 2'-O-methylcytidine; 5-carboxymethylaminomethyl-2-thiouridine; 5-carboxymethylaminomethyluridine; dihydrouridine; 2'-O-methylpseudridine; beta,D-galactosylqueosin; 2'-O-methylguanosine; N 6 -Isopentenyladenosine; 1-Methyladenosine; 1-Methylpsuduridine; 1-Methylguanosine; l-Methylinosine; 2,2-Dimethylguanosine; 2-Methyladenosine; 2-Methylguanosine; N 7 -Methylguanosine; 3-methylcytidine; 5-methylcytidine; 5-hydroxymethylcytidine; 5-formylcytosine; 5-carboxycytosine; N 6 -Methyladenosine; 7-methylguanosine; 5-methylaminoethyluridine; 5-methoxyaminomethyl-2-thiouridine; beta,D-mannosylquosine; 5-methoxycarbonylmethyluridine; 5-methoxyuridine; 2-methylthio-N 6-Isopentenyladenosine; N-((9-beta,D-ribofuranosyl-2-methylthiopurine-6-yl)carbamoyl)threonine; N-((9-beta,D-ribofuranosylpurine-6-yl)-N-methylcarbamoyl)threonine; Uridine-5-oxyacetate methyl ester; Uridine-5-oxyacetate(v); Pseudouridine; Quosin; 2-thiocytidine; 5-methyl-2-thiouridine; 2-thiouridine; 4-thiouridine; 5-methyluridine; 2'-O-methyl-5-methyluridine; and 2'-O-methyluridine.

[0142] In some embodiments, the nucleic acid base (e.g., a modified nucleic acid base) includes one or more biomolecule-binding moieties, such as antibodies, antibody fragments, biotin, avidin, streptavidin, receptor ligands, or chelated moieties. In other embodiments, the nucleic acid base is 5-bromouracil, 5-iodouracil, or 2,6-diaminopurine. In some embodiments, the nucleic acid base includes substitution with a fluorescent or biomolecule-binding moiety. In some embodiments, the substituent is a fluorescent moiety. In some embodiments, the substituent is biotin or avidin.

[0143] Certain examples of nucleic acid bases and related methods are US3687808, 4845205, US513030, US5134066, US5175273, US5367066, US5432272, US5457187, US5457191, US5459255, US5484908, US5502177, US5525711, US5552540, US5587469, US55941 As described in 21, US5596091, US5614617, US5681941, US5750692, US6015886, US6147200, US6166197, US6222025, US6235887, US6380368, US6528640, US6639062, US6617438, US7045610, US7427672, US or US7495088.

[0144] Gryaznov,S;Chen,J.-KJAm.Chem.Soc.1994,116,3143、Hendrix et al. al.1997 Chem.Eur.J.3:110、Hyrup et al.1996 Bioorg.Med.Chem.4:5、Jepsen et al.2004 Oligo.14:130-146、Jones et al.J.Org.Chem.1993,58,2983、Koizumi et al.2003 Nuc.Acids Res.12:3267-3273、Koshkin et al.1998 Tetrahedron 54:3607-3630、Kumar et al.1998 Bio.Med.Chem.Let.8:2219-2222、Lauritsen et al.2002 Chem.Comm.5:530-531、Lauritsen et al.2003 Bio.Med.Chem.Lett.13:253-256、Mesmaeker et al.Angew.Chem.,Int.Ed.Engl.1994,33,226、Morita et al.2001 Nucl.Acids Res.Supp.1:241-242、Morita et al.2002 Bioo.Med.Chem.Lett.12:73-76, Morita et al. 2003; Bioo.Med.Chem.Lett.2211-2226, Nielsen et al. 1997; Chem.Soc.Rev.73, Nielsen et al. 1997; J.Chem.Soc.Perkins Transl.1:3423-3433, Obika et al. 1997; Tetrahedron Lett.38(50):8735-8, Obika et al. 1998; Tetrahedron Lett.39:5401-5404, Pallan et al. 2012; Chem.Comm.48:8195-8197, Petersen et al. 2003; TRENDS Biotech.21:74-81、Rajwanshi et al.1999 Chem.Commun.1395-1396、Schultz et al.1996 Nucleic Acids Res.24:2966, Seth et al.2009 J.Med.Chem.52:10-13, Seth et al.2010 J.Med.Chem.53:8309-8318, Seth et al.2010 J.Org.Chem.75:1569-1581, Seth et al.2012 Bioo.Med.Chem.Lett.22:296-299, Seth et al.2012 Mol.Ther-Nuc.Acids.1,e47;Seth,Punit P;Siwkowski,Andrew;Allerson,Charles R;Vasquez, Guillermo;Lee,Sam;Prakash,Thazha P;Kinberger,Garth;Migawa,Michael T;Gaus,Hans;Bhat, Balkrishen;et al.From Nucleic Acids Symposium Series (2008),52(1),553-554, Singh et al.1998 Chem.Comm.1247-1248, Singh et al.1998 J.Org.Chem.63:10035-39, Singh et al.1998 J.Org.Chem.63:6078-6079, Sorensen 2003 Chem.Comm.2130-2131, Ts'o et al.Ann.NYAcad.Sci.1988,507,220, Van Aerschot et al.1995 Angew.Chem.Int.Ed.Engl.34:1338, Vasseur et al. It contains nucleic acid bases, sugars, nucleosides, and / or nucleotide bonds as described in either al.J.Am.Chem.Soc.1992,114,4006, WO2007090071, or WO2016 / 079181.

[0145] In some embodiments, the oligonucleotides are Feldman et al.2017 J.Am.Chem.Soc.139:11427-11433, Feldman et al.2017 Proc.Natl.Acad.Sci.USA 114:E6478-E6479, Hwang et al.2009 Nucl.Acids Res.37:4757-4763, Hwang et al.2008 J.Am.Chem.Soc.130:14872-14882, Lavergne et al.2012 Chem.Eur.J.18:1231-1239, Lavergne et al.2013 J.Am.Chem.Soc.135:5408-5419, Ledbetter et al.2018 J.Am.Chem.Soc.140:758-765, Malyshev et al.2009 J.Am.Chem.Soc.131:14620-14621, Seo et al.2009 Modified nucleic acid bases, nucleosides, or nucleotides as described in any of Chem.Bio.Chem.10:2394-2400, such as d3FB, d2Py analogues, d2Py, d3MPy, d4MPy, d5MPy, d34DMPy, d35DMPy, d45DMPy, d5FM, d5PrM, d5SICS, dFEMO, dMMO2, dNaM, dNM01, dTPT3, nucleotides having 2'-azide, 2'-chloro, 2'-amino, or arabinose sugars, isocarbostyryl-, naphthyl-, and azaindole-nucleotides, as well as their modifications and derivatives and functionalized versions, such as those containing 2'-modifications and / or other modifications of sugars, and dMMO2 derivatives having meta-chlorine, -bromine, -iodine, -methyl, or -propynyl substituents.

[0146] In some embodiments, the nucleic acid base comprises at least one optionally substituted ring containing a heteroatom ring atom. In some embodiments, the nucleic acid base comprises at least one optionally substituted ring containing a nitrogen ring atom. In some embodiments, such rings are aromatic. In some embodiments, the nucleic acid base is bonded to the sugar via a heteroatom. In some embodiments, the nucleic acid base is bonded to the sugar via a nitrogen atom. In some embodiments, the nucleic acid base is bonded to the sugar via a ring nitrogen atom.

[0147] In some embodiments, the oligonucleotides are incorporated herein by reference, with each base and modified nucleic acid base independently included: WO2018 / 022473, WO2018 / 098264, WO2018 / 223056, WO2018 / 223073, WO2018 / 223081, WO2018 / 237194, WO2019 / 0 Contains nucleic acid bases or modified nucleic acid bases as described in 32607, WO2019 / 055951, WO2019 / 075357, WO2019 / 200185, WO2019 / 217784, WO2019 / 032612, WO2020 / 191252, WO2021 / 071858, and / or WO2022 / 099159.

[0148] In some embodiments, the nucleic acid base is an optionally substituted purine base residue. In some embodiments, the nucleic acid base is a protected purine base residue. In some embodiments, the nucleic acid base is an optionally substituted adenine residue. In some embodiments, the nucleic acid base is a protected adenine residue. In some embodiments, the nucleic acid base is an optionally substituted guanine residue. In some embodiments, the nucleic acid base is a protected guanine residue. In some embodiments, the nucleic acid base is an optionally substituted cytosine residue. In some embodiments, the nucleic acid base is a protected cytosine residue. In some embodiments, the nucleic acid base is an optionally substituted thymine residue. In some embodiments, the nucleic acid base is a protected thymine residue. In some embodiments, the nucleic acid base is an optionally substituted uracil residue. In some embodiments, the nucleic acid base is a protected uracil residue. In some embodiments, the nucleic acid base is an optionally substituted 5-methylcytosine residue. In some embodiments, the nucleic acid base is a protected 5-methylcytosine residue.

[0149] In some embodiments, the oligonucleotides provided are, for example, US5552540, US6222025, US6528640, US4845205, US5681941, US5750692, US6015886, US5614617, US6147200, US5457187, US6639062, US7427672, US5459255, US5484908, US7045610, US3687808, US5502177, US5525711 The modified nucleic acid bases described in 6235887, US5175273, US6617438, US5594121, US6380368, US5367066, US5587469, US6166197, US5432272, US7495088, US5134066, or US5596091 include modified nucleic acid bases as described in 6235887, US5175273, US6617443, US6617438, US7495088, US5134066, or US5596091. In some embodiments, the nucleic acid bases are described in WO2020 / 154344, WO2020 / 154343, WO2020 / 154342, WO2020 / 165077, WO2020 / 201406, WO2020 / 216637, or WO2020 / 252376 and can be used in accordance with this disclosure.

[0150] In some embodiments, the nucleic acid base is a protected base residue used in oligonucleotide preparation. In some embodiments, the nucleic acid base is a protected base residue as used in oligonucleotide preparation. Each base residue is incorporated herein by independent reference from US2011 / 0294124, US2015 / 0211006, US2015 / 0197540, WO2015 / 107425, WO2017 / 192679, WO2018 / 022473, WO2018 / 098264, WO2018 / 223056, WO2018 / 223073. These are the base residues indicated in WO2018 / 223081, WO2018 / 237194, WO2019 / 032607, WO2019 / 055951, WO2019 / 075357, WO2019 / 200185, WO2019 / 217784, WO2019 / 032612, WO2020 / 191252, WO2021 / 071858, and / or WO2022 / 099159.

[0151] sugar Various sugars, including modified sugars, can be utilized in accordance with this disclosure. In some embodiments, this disclosure provides sugar modifications and patterns in optional combination with other structural elements (e.g., nucleotide interbonding modifications and their patterns, patterns of their skeletal chiral centers, etc.) that, when incorporated into oligonucleotides, can provide improved properties and / or activity.

[0152] The most common naturally occurring nucleosides include ribose sugars (e.g., in RNA) or deoxyribose sugars (e.g., in DNA) bound to the nucleic acid bases adenosine (A), cytosine (C), guanine (G), thymine (T), or uracil (U). In some embodiments, sugars, for example, the various sugars in many of the oligonucleotides in Table 1 (unless otherwise noted), [ka] A natural DNA sugar (in DNA nucleic acid or oligonucleotide) having the structure, where the nucleic acid base is attached at the 1' position, and the 3' and 5' positions are connected to the internucleotide bond (as understood by those skilled in the art), and in the case of the 5' end of an oligonucleotide, the 5' position may be connected to the 5' end group (e.g., -OH), and in the case of the 3' end of an oligonucleotide, the 3' position may be connected to the 3' end group (e.g., -OH). In some embodiments, the sugar is [ka] A natural RNA sugar (in RNA nucleic acid or oligonucleotide) having the structure, where the nucleic acid base is attached at the 1' position, and the 3' and 5' positions are attached to the internucleotide bond (as understood by those skilled in the art), and in the case of the 5' end of an oligonucleotide, the 5' position may be attached to a 5' terminal group (e.g., -OH), and in the case of the 3' end of an oligonucleotide, the 3' position may be attached to a 3' terminal group (e.g., -OH). In some embodiments, the sugar is a modified sugar in that it is not a natural DNA sugar or a natural RNA sugar. In particular, the modified sugar may provide improved stability. In some embodiments, the modified sugar can be used to alter and / or optimize one or more hybridization features. In some embodiments, the modified sugar can be used to alter and / or optimize target nucleic acid recognition. In some embodiments, the modified sugar can be used to optimize Tm. In some embodiments, the modified sugar can be used to improve oligonucleotide activity.

[0153] In particular, this disclosure demonstrates that various non-natural RNA sugars, such as natural DNA sugars and various modified sugars (e.g., 2'-F modified sugars, 2'-OMe modified sugars), can be used in accordance with this disclosure.

[0154] Sugars can bind to nucleotide internucleotide bonds at various positions. In non-limiting examples, nucleotide internucleotide bonds can bind to the 2', 3', 4', or 5' positions of the sugar. In some embodiments, unless otherwise indicated, as is most common in natural nucleic acids, the nucleotide internucleotide bond is linked to one sugar at the 5' position and to the other sugar at the 3' position.

[0155] In some embodiments, the sugar is a naturally occurring DNA or RNA sugar that has been optionally substituted. [ka] In some embodiments, the 2' position is optionally substituted. In some embodiments, the sugar is [ka] In some embodiments, sugar is [ka] It has the structure, in the formula, R 1s , R 2s , R 3s , R 4s , and R 5s Each of these is independently -H, a preferred substituent, or a preferred sugar modification (e.g., US9394333, US9744183, US9605019, US9982257, US2017 / 0037399, US2018 / 0216108, US2018 / 0216107, US9598458, WO2017 / 062862, WO2018 / 067973, WO2017 / 160741, WO2017 / 192679, WO2017 / 210647, WO2018 / 098264, WO2018 / 022473, WO As described in 2018 / 223056, WO2018 / 223073, WO2018 / 223081, WO2018 / 237194, WO2019 / 032607, WO2019 / 032612, WO2019 / 055951, WO2019 / 075357, WO2019 / 200185, WO2019 / 217784, WO2019 / 032612, WO2020 / 191252, WO2021 / 071858, and / or WO2022 / 099159, each of these substituents, sugar modifications, substituents, sugar modifications, R 1s , R 2s , R 3s , R 4s , and R 5s The description of and modified sugars are incorporated herein by reference independently. In some embodiments, R 1s , R 2s , R 3s , R 4s , and R 5s Each of these independently, R s And each Rs These are independently -F, -Cl, -Br, -I, -CN, -N3, -NO, -NO2, -L s -R', -L s -OR', -L s -SR', -L s -N(R')2, -OL s -OR', -OL s -SR' or -OL s -N(R')2, where each R' is independently as described herein, and each L s Independently, divalent carbon atoms are optionally substituted with covalent bonds or 1 to 4 heteroatoms. 1~6 It is aliphatic or heteroaliphatic, or has two R's s By combining them, cross-linking-L s - forms. In some embodiments, R' is optionally replaced by C 1~10 It is aliphatic. In some embodiments, sugars are [ka] It has the structure. In some embodiments, the sugar is [ka] It has the structure. In some embodiments, the sugar is [ka] It has the structure. In some embodiments, the sugar is [ka] It has the structure. In some embodiments, the sugar is [ka] It has the structure. In some embodiments, the sugar is [ka] It has the structure. In some embodiments, the sugar is [ka] It has the structure. In some embodiments, the sugar is [ka] It has the structure. In some embodiments, the sugar is [ka] It has the structure of R 5s This is C, which has been replaced by an optional substitution. 1~6 It is aliphatic. In some embodiments, R 5s This is C, which has been replaced by an optional substitution. 1~6 It is alkyl. In some embodiments, R 5s R is an optionally substituted methyl group. In some embodiments, R 5s is methyl. In some embodiments, the sugar is [ka] It has the structure. In some embodiments, the sugar is [ka] It has the structure. In some embodiments, the sugar is [ka] It has the following structure. Various such sugars are used in Table 1. In some embodiments, the sugar is [ka] It has the structure. In some embodiments, the 2'-modified sugar is [ka] It has the structure, in the formula, R 2s This is a 2'-modification. In some embodiments, the sugar is [ka] It has the structure, in the formula, R 2s is -H, halogen, or -OR, where R is optionally substituted with C 1~6 It is aliphatic. In some embodiments, R 2s is -H. In some embodiments, R 2s is -F. In some embodiments, R 2s is -OMe. In some embodiments, the modified nucleoside is mA, mT, mC, m5mC, mG, mU, etc., where R 2s is -OMe. In some embodiments, R 2s is -OCH2CH2OMe. In some embodiments, the modified nucleoside is Aeo, Teo, Ceo, m5Ceo, Geo, Ueo, etc., where R 2s is -OCH2CH2OMe. In some embodiments, R 2s It is -OCH2CH2OH. In some embodiments, the oligonucleotide is [ka] The 2'-F modified sugar having the structure (e.g., fA, fT, fC, f5mC, fG, fU, [fl2r](A), [fl2r](T), [fl2r](C), [fl2r](5mC), [fl2r](G), [fl2r](U), etc.) comprises the oligonucleotide, [ka] The oligonucleotide comprises a 2'-OMe modified sugar having the structure (e.g., mA, mT, mC, m5mC, mG, mU, m(A), m(T), m(C), m(5mC), m(G), m(U), etc.). In some embodiments, the oligonucleotide is [ka] This includes 2'-MOE modified sugars having the structure (e.g., Aeo, Teo, Ceo, m5Ceo, Geo, Ueo, [moe](A), [moe](T), [moe](C), [moe](5mC), [moe](G), [moe](U), etc.).

[0156] In some embodiments, sugar is [ka] It has the structure, in the formula, R 2s and R 4s Together, -L s - forms, in the formula, L s This is a divalent carbon atom that is covalently bonded or optionally substituted with 1 to 4 heteroatoms. 1~6 It is aliphatic or heteroaliphatic. In some embodiments, each heteroatom is independently selected from nitrogen, oxygen, or sulfur. In some embodiments, L s is a C2-O-CH2-C4 that has been optionally substituted. In some embodiments, L s It is C2-O-CH2-C4. In some embodiments, L s It is C2-O-(R)-CH(CH2CH3)-C4. In some embodiments, L s It is C2-O-(S)-CH(CH2CH3)-C4.

[0157] In some embodiments, sugar is [ka] It has the structure, and each variable element is independently as described herein. In some embodiments, the sugar is [ka] The structure is such that each variable element is independently as described herein. In some embodiments, R 5s is -H. In some embodiments, the sugar is [ka] The structure is such that each variable element is independently as described herein. In some embodiments, R 3s is -OH. In some embodiments, R 3s is -H. In some embodiments, the sugar is [ka] In some embodiments, sugar is [ka] That is the case.

[0158] In some embodiments, the sugar is optionally substituted. [ka] And in the formula, X s is -S-, -Se-, or optionally substituted -CH2-. In some embodiments, the 2' position is optionally substituted. In some embodiments, the sugar is [ka] In some embodiments, sugar is [ka] It has the structure, in the formula, R 1s , R 2s , R 3s , R 4s , and R 5sEach of these is independently -H, a preferred substituent, or a preferred sugar modification (e.g., US9394333, US9744183, US9605019, US9982257, US2017 / 0037399, US2018 / 0216108, US2018 / 0216107, US9598458, WO2017 / 062862, WO2018 / 067973, WO2017 / 160741, WO2017 / 192679, WO2017 / 210647, WO2018 / 098264, WO2018 / 022 As described in 473, WO2018 / 223056, WO2018 / 223073, WO2018 / 223081, WO2018 / 237194, WO2019 / 032607, WO2019 / 032612, WO2019 / 055951, WO2019 / 075357, WO2019 / 200185, WO2019 / 217784, WO2019 / 032612, WO2020 / 191252, WO2021 / 071858, and / or WO2022 / 099159, each of these substituents, R 1s , R 2s , R 3s , R 4s , and R 5s The description of and modified sugars are incorporated herein by reference independently. In some embodiments, R 1s , R 2s , R 3s , R 4s , and R 5s Each of these independently, R s And each R s These are independently -F, -Cl, -Br, -I, -CN, -N3, -NO, -NO2, -L s -R', -L s -OR', -L s -SR', -L s -N(R')2, -OL s -OR', -OL s -SR' or -OL s -N(R')2, where each R' is independently as described herein, and each L s Independently, divalent carbon atoms are optionally substituted with covalent bonds or 1 to 4 heteroatoms. 1~6It is aliphatic or heteroaliphatic, or has two R's s By combining them, cross-linking-L s - forms. In some embodiments, R' is optionally replaced by C 1~10 It is aliphatic. In some embodiments, sugars are [ka] It has the structure. In some embodiments, the sugar is [ka] It has the structure. In some embodiments, the sugar is [ka] It has the structure. In some embodiments, the sugar is [ka] It has the structure. In some embodiments, the sugar is [ka] It has the structure. In some embodiments, the sugar is [ka] It has the structure. In some embodiments, the sugar is [ka] It has the structure. In some embodiments, the sugar is [ka] It has the structure. In some embodiments, the sugar is [ka] It has the structure of R 5s This is C, which has been replaced by an optional substitution. 1~6It is aliphatic. In some embodiments, R 5s This is C, which has been replaced by an optional substitution. 1~6 It is alkyl. In some embodiments, R 5s R is an optionally substituted methyl group. In some embodiments, R 5s is methyl. In some embodiments, the sugar is [ka] It has the structure. In some embodiments, the sugar is [ka] It has the structure. In some embodiments, the sugar is [ka] It has the following structure. Various such sugars are used in Table 1. In some embodiments, the sugar is [ka] It has the structure. In some embodiments, the 2'-modified sugar is [ka] It has the structure, in the formula, R 2s This is a 2'-modification. In some embodiments, the sugar is [ka] It has the structure, in the formula, R 2s is -H, halogen, or -OR, where R is optionally substituted with C 1~6 It is aliphatic. In some embodiments, R 2s is -H. In some embodiments, R 2s is -F. In some embodiments, R 2s is -OMe. In some embodiments, R 2s is -OCH2CH2OMe. In some embodiments, R 2sIt is -OCH2CH2OH. In some embodiments, the modified sugar is [ka] It has the structure. In some embodiments, the modified sugar is [ka] It has a structure. In some embodiments, [ka] A modified sugar having the structure of a modified sugar. In some embodiments, [ka] A modified sugar having the structure X s is -S-. In some embodiments, X s is -CH2- which is optionally replaced. In some embodiments, X s is -CH2-. In some embodiments, [ka] A modified sugar having the structure of a modified sugar. In some embodiments, [ka] A modified sugar having the following structure.

[0159] In some embodiments, sugar is [ka] It has the structure, in the formula, each R 2s These are independently -H, -F, -OH, or -OR ak And R ak This is C, which has been replaced by an optional substitution. 1~6 It is aliphatic, and each of the other variable elements is independently as described herein. In some embodiments, R 1s , R3s , R 4s , and R 5s Each of them is independently -H. In some embodiments, R 1s , R 3s and R 4s Each of and R 5s One of them is independently -H, and the other is R 5s Independently, C 1~6 It is aliphatic. In some embodiments, R 5s The appearance of C 1~6 Aliphatic, for example, methyl. In some embodiments, R 2s is -H. In some embodiments, R 2s is -F. In some embodiments, R 2s is, --OR ak In some embodiments, R 2s is -OMe. In some embodiments, R 2s is -OCH2CH2CH3. In some embodiments, R 2s At least one occurrence of is -H. In some embodiments, R 2s At least one occurrence of is not -H. In some embodiments, X s is -O-. In some embodiments, X s is -S-. In some embodiments, X s is -CH2- which is optionally replaced. In some embodiments, X s It is -CH2-.

[0160] In some embodiments, sugar is [ka] It has the structure, in the formula, R 2s and R 4s Together, -L s - forms, in the formula, L s This is a divalent carbon atom that is covalently bonded or optionally substituted with 1 to 4 heteroatoms. 1~6It is aliphatic or heteroaliphatic. In some embodiments, each heteroatom is independently selected from nitrogen, oxygen, or sulfur. In some embodiments, L s is a C2-O-CH2-C4 that has been optionally substituted. In some embodiments, L s It is C2-O-CH2-C4. In some embodiments, L s It is C2-O-(R)-CH(CH2CH3)-C4. In some embodiments, L s This is C2-O-(S)-CH(CH2CH3)-C4. In some embodiments, X s is -S-. In some embodiments, X s is -CH2- which is optionally replaced. In some embodiments, X s is -CH2-. In some embodiments, X s It is -Se-.

[0161] In some embodiments, sugar is [ka] It has the structure, and each variable element is independently as described herein. In some embodiments, the sugar is [ka] The structure is such that each variable element is independently as described herein. In some embodiments, R 5s is -H. In some embodiments, the sugar is [ka] The structure is such that each variable element is independently as described herein. In some embodiments, R 3s is -OH. In some embodiments, R 3s is -H. In some embodiments, X s is -S-. In some embodiments, X sis -CH2- which is optionally replaced. In some embodiments, X s It is -CH2-.

[0162] In some embodiments, nucleosides containing modified sugars are [ka] Having the structure or a salt form thereof, BA s R is a nucleic acid base that is -H or optionally substituted or protected (e.g., BA), and 2s This is as described herein. In some embodiments, R 2s is a C1-C6 alkoxy substituted with an -OH group, a halogen, or optionally. In some embodiments, BA s is -H. In some embodiments, BA s is an optionally substituted or protected nucleic acid base. In some embodiments, BA s is BA. In some embodiments, R 2s is -F. In some embodiments, the nucleoside containing the modified sugar is [ka] The formula has the structure or a salt form thereof, where each variable element is independently as described herein. In some embodiments, R 2s is a C1-C6 alkoxy substituted with -H, -OH, a halogen, or optionally. In some embodiments, R 2s is -H. In some embodiments, R 2s is -F. In some embodiments, the nucleoside containing the modified sugar is [ka] The structure is as described herein, where each variable element is as described herein. In some embodiments, the nucleoside containing the modified sugar is [ka] The formula has the structure or a salt form thereof, where each variable element is independently as described herein. In some embodiments, R 2s is a C1-C6 alkoxy substituted with -H, -OH, a halogen, or optionally. In some embodiments, R 2s is -H. In some embodiments, R 2s is -F. In some embodiments, the nucleoside containing the modified sugar is [ka] Having the structure or a salt form thereof, R 2s’ R s And R s , R 2s and BA s Each of these is independently as described herein. In some embodiments, R 2s and R 2s’ Each of these is independently a -H, -OH, halogen, or optionally substituted C1-C6 alkoxy. In some embodiments, R 2s is -H. In some embodiments, R 2s is -OH. In some embodiments, R 2s is a halogen. In some embodiments, R 2s is -F. In some embodiments, R 2s R is an optionally substituted C1-C6 alkoxy. In some embodiments, R 2s’ is -H. In some embodiments, R 2s’ is -OH. In some embodiments, R 2s’ is a halogen. In some embodiments, R 2s’ is -F. In some embodiments, R 2s’ is an optionally substituted C1-C6 alkoxy. In some embodiments, BA s is -H. In some embodiments, BA sis an optionally substituted or protected nucleic acid base. In some embodiments, BA s is BA. In some embodiments, nucleic acid bases such as BA are optionally substituted or protected for oligonucleotide synthesis. Certain such nucleosides, including sugars and nucleic acid bases, and their uses are described in WO2020 / 154342. In some embodiments, oligonucleotides include arabinosides, 2'-deoxy-2'-fluoroarabinosides, 2'-OR arabinosides, adeoxycytidines, DNA-debased, RNA-debased, or 2'-OR debased, where R is not hydrogen (e.g., optionally substituted C). 1~6 Aliphatic). In some embodiments, 2'-OR is 2'-OMe. In some embodiments, 2'-OR is 2'-MOE. In some embodiments, the oligonucleotide comprises 2'-O-methylarabinocytidine (amC). In some embodiments, the oligonucleotide comprises such a nucleoside. In some embodiments, the monomer comprises such a nucleoside. In some embodiments, the phosphoramidite comprises such a nucleoside (in some embodiments, one linkage site (e.g., -CH2- linkage site) is bound to an optionally substituted -OH, e.g., (-ODMTr), and one linkage site (e.g., ring linkage site) is bound to the O, which is also bound to the P of the phosphoramidite). In some embodiments, the sugar is [ka] It has the structure, where each variable element is as described herein, and C1' is bonded to a nucleic acid base. In some embodiments, the sugar is arabinose. In some embodiments, the sugar is [ka] It has the structure shown in the formula, where C1' is bound to a nucleic acid base.

[0163] In some embodiments, the sugar is optionally substituted. [ka] The nucleic acid bases are bonded at the 1' position. In some embodiments, the sugar is [ka] Nucleic acid bases are bonded at the 1' position.

[0164] In some embodiments, the sugar is optionally substituted. [ka] In the formula, position a is bonded to a nucleic acid base, and X s is -O-, -S-, -Se-, or optionally substituted -CH2-. In some embodiments, the sugar is [ka] In some embodiments, the sugar is optionally substituted. [ka] In the formula, position a is bound to a nucleic acid base, and X s is -O-, -S-, -Se-, or optionally substituted -CH2-. In some embodiments, the sugar is [ka] In some embodiments, X s is -O-. In some embodiments, X s is -S-. In some embodiments, X s is -Se-. In some embodiments, X s is -CH2- which is optionally replaced. In some embodiments, X sis -CH2-. In some embodiments, n is 0. In some embodiments, n is 1. In some embodiments, n is 2. In some embodiments, n is 3.

[0165] In some embodiments, the modified sugar comprises an optionally substituted six-membered ring having 0 to 1 oxygen atoms. In some embodiments, the modified sugar comprises an optionally substituted six-membered ring having oxygen atoms. For example, in some embodiments, the modified sugar comprises an optionally substituted [ka] It has the structure, where position a is bonded to a nucleic acid base. In some embodiments, the modified sugar is [ka] It has the structure, where position a is bonded to a nucleic acid base. In some embodiments, the modified sugar is optionally substituted. [ka] It has the structure, where position a is bonded to a nucleic acid base. In some embodiments, the modified sugar is [ka] It has the structure, where position a is bonded to a nucleic acid base. In some embodiments, the modified sugar is [ka] It has the structure, where position a is bonded to a nucleic acid base. In some embodiments, the modified sugar is optionally substituted. [ka] It has the structure, where position a is bonded to a nucleic acid base. In some embodiments, the modified sugar is [ka] It has the structure, where position a is bonded to a nucleic acid base. In some embodiments, the modified sugar is optionally substituted. [ka] It has the structure, where position a is bonded to a nucleic acid base. In some embodiments, the modified sugar is [ka] It has the structure, where position a is bonded to a nucleic acid base. In some embodiments, the modified sugar is optionally substituted. [ka] It has the structure, where position a is bonded to a nucleic acid base. In some embodiments, the modified sugar is [ka] It has the structure shown in the formula, where position a is bound to a nucleic acid base.

[0166] In some embodiments, nucleosides containing modified sugars are [ka] It has the structure or a salt form thereof, in which R 6s and R 7s Each of these independently, R s And BA s R is a nucleic acid base that is -H or optionally substituted or protected (e.g., BA), and s This is independently as described herein. In some embodiments, R 6s is -H, -OH, or halogen, and R 7s is a C1-C6 alkoxy substituted with -H, -OH, halogen, or optionally. In some embodiments, BA s is -H. In some embodiments, BAs is an optionally substituted or protected nucleic acid base. In some embodiments, BA s is BA. In some embodiments, a nucleoside containing a modified sugar is [ka] It has the structure or a salt form thereof, in which R 8s and R 9s Each of these independently, R s And R s and BA s Each of these is independently as described herein. In some embodiments, R 8s is -H or halogen, and R 9s is a C1-C6 alkoxy substituted with -H, -OH, halogen, or optionally. In some embodiments, the nucleoside containing the modified sugar is [ka] It has the structure or a salt form thereof, in which R 10s and R 11s Each of these independently, R s And R s and BA s Each of these is independently as described herein. In some embodiments, R 10s is -H or halogen, and R 11s is a C1-C6 alkoxy substituted with -H, -OH, halogen, or optionally. In some embodiments, the nucleoside containing the modified sugar is [ka] It has the structure or a salt form thereof, in the formula BA s This is as described herein. In some embodiments, the nucleoside containing the modified sugar is [ka] It has the structure or a salt form thereof, in which BAs This is as described herein. Those skilled in the art will understand that in some embodiments, nitrogen may be directly bonded to the bound phosphorus. In some embodiments, the halogen is -F. In some embodiments, BA s is -H. In some embodiments, BA s is an optionally substituted or protected nucleic acid base. In some embodiments, BA s BA is present. In some embodiments, nucleic acid bases such as BA are optionally substituted or protected for oligonucleotide synthesis. In some embodiments, the oligonucleotide comprises an alpha-homo-DNA, beta-homo-DNA moiety. In some embodiments, the oligonucleotide comprises an alpha- or beta-homo-DNA sugar. In some embodiments, the oligonucleotide comprises an alpha-homo-DNA sugar. In some embodiments, the oligonucleotide comprises a beta-homo-DNA sugar. Certain such nucleosides comprising sugars and nucleic acid bases, and their use, are described in WO2020 / 154343. In some embodiments, the oligonucleotide comprises such a nucleoside. In some embodiments, the monomer comprises such a nucleoside. In some embodiments, the phosphoramidite includes such a nucleoside (in some embodiments, one linkage site (e.g., -CH2- linkage site) is optionally substituted with an -OH, e.g., -ODMTr, and one linkage site (e.g., ring linkage site) is bound to the phosphoramidite's P (e.g., when the linking ring atom is N) or to the O (e.g., when the linking ring atom is C) which is also bound to the phosphoramidite's P).

[0167] In some embodiments, the modified sugar is [ka] It has the structure, where position a is bonded to a nucleic acid base. In some embodiments, the modified sugar is [ka] It has the structure, where position a is bonded to a nucleic acid base. In some embodiments, the modified sugar is [ka] The structure is such that, in the formula, position a is bound to a nucleic acid base, position b is bound to an internucleoside bond, and R'' is -H or optionally substituted with C 1~6 It is aliphatic. In some embodiments, the modified sugar is [ka] The structure is such that, in the formula, position a is bound to a nucleic acid base, position b is bound to an internucleoside bond, and R'' is -H or C 1~6 It is aliphatic. In some embodiments, the modified sugar is [ka] The structure is such that, in the formula, position a is bound to a nucleic acid base, position b is bound to an internucleoside bond, and R'' is -H or C 1~6 It is aliphatic. In some embodiments, R'' is methyl.

[0168] In some embodiments, nucleosides containing modified sugars are [ka] Having the structure or a salt form thereof, where each variable element is as described herein. In some embodiments, the nucleoside containing a modified sugar is [ka] Having the structure or a salt form thereof, where each variable element is as described herein. In some embodiments, the nucleoside containing a modified sugar is [ka] Having the structure or a salt form thereof, where each variable element is as described herein. In some embodiments, the nucleoside containing a modified sugar is [ka] It has the structure or a salt form thereof, in which R 12s R s And R s and BA s Each of these is independently as described herein. In some embodiments, R 12s C is substituted with -H, -OH, halogen, or optionally. 1~6 Alkyl, optionally substituted C 1~6 Heteroalkyl or optionally substituted C 1~6 It is an alkoxy. In some embodiments, the halogen is -F. In some embodiments, the nucleoside containing a modified sugar is [ka] The formula has the structure or a salt form thereof, where each variable element is as described herein. In some embodiments, the nucleotide containing the modified sugar is [ka] It has the structure or a salt form thereof, in which R 13s R s And R s and BA s Each of these is independently as described herein. In some embodiments, R 13s is a C1-C6 alkyl group substituted with -H or optionally. In some embodiments, the nucleoside containing the modified sugar is [ka] The formula has the structure or a salt form thereof, where each variable element is as described herein. In some embodiments, the nucleotide containing the modified sugar is [ka] The formula has the structure or a salt form thereof, where each variable element is as described herein. In some embodiments, the bond is an amide bond. In some embodiments, BA s is -H. In some embodiments, BA s is an optionally substituted or protected nucleic acid base. In some embodiments, BA s is BA. In some embodiments, nucleic acid bases such as BA are optionally substituted or protected for oligonucleotide synthesis. Certain such nucleosides and nucleotides, including sugars and nucleic acid bases, and their uses are described in WO2020 / 154344. In some embodiments, the oligonucleotide comprises such nucleosides. In some embodiments, the oligonucleotide comprises such nucleosides (in some embodiments, one linkage site (e.g., -CH2- linkage site) is optionally substituted with -OH, e.g., (-ODMTr), and one linkage site (e.g., ring linkage site) is bound to O, which is also bound to P in phosphoramidites).

[0169] In some embodiments, the sugar is an acyclic sugar, e.g., a UNA sugar. In some embodiments, the sugar is optionally substituted. [ka] In some embodiments, the 2' position is optionally substituted. In some embodiments, the sugar is [ka] In some embodiments, sugar is [ka] It has the structure of R 2s It is -OH. In some embodiments, the sugar is [ka] In the formula, "*" represents a carbon atom bonded to a nucleic acid base. In some embodiments, the sugar is [ka] In the formula, "*" indicates a carbon atom bonded to a nucleic acid base. In some embodiments, the carbon atom bonded to the nitrogen atom of the nucleic acid base is in the R configuration (e.g., sm18). In some embodiments, the oligonucleotide comprises a sugar as described herein.

[0170] In some embodiments, the sugar is optionally substituted. [ka] In the formula, position a is bound to a nucleic acid base, and X s is -O-, -S-, -Se-, or optionally substituted -CH2-. In some embodiments, the sugar is [ka] In some embodiments, X s is -O-. In some embodiments, X s is -S-. In some embodiments, X s is -Se-. In some embodiments, X s is -CH2- which is optionally replaced. In some embodiments, X s is -CH2-. In some embodiments, n is 0. In some embodiments, n is 1. In some embodiments, n is 2. In some embodiments, n is 3.

[0171] In some embodiments, the sugars are connected without 5' and 3' positions. Those skilled in the art will understand that, with respect to such sugars, 5' can refer to the side / direction toward the 5' end of the oligonucleotide, and 3' can refer to the side / direction toward the 3' end of the oligonucleotide.

[0172] In some embodiments, R 1s , R 2s , R 3s , R 4s , and R 5s Each of these independently, R s And R s These are independently -H, halogen, -CN, -N3, -NO, -NO2, and -L s -R', -L s -Si(R')3, -L s -OR', -L s -SR', -L s -N(R')2, -OL s -R', -OL s -Si(R)3, -OL s -OR', -OL s -SR' or -OL s -N(R')2, and in the formula, L s As described herein, L B Each of the other variable elements is independently as described herein. In some embodiments, R 1s and R 2s Each of these independently, R s In some embodiments, R s is -H. In some embodiments, R s is not -H. In some embodiments, L s It is a covalent bond. In some embodiments, R 2s and R 4s Each of these is independently -H, -F, -OR, and -N(R)². In some embodiments, R 2s These are -H, -F, -OR, and -N(R)2. In some embodiments, R 4s is -H. In some embodiments, R 2sand R 4s , 2'-OL s - forms, in the formula, L s This is C, which has been replaced by an optional substitution. 1~6 It is an alkylene. s is -CH2- which is optionally substituted. In some embodiments, L s This is -CH2- which has been substituted by choice.

[0173] In some embodiments, R is hydrogen. In some embodiments, R is not hydrogen. In some embodiments, R is C 1~10 Aliphatic carbon atoms, independently containing 1 to 10 heteroatoms selected from oxygen, nitrogen, sulfur, phosphorus, and silicon. 1~10 Heteroliphatic, C 6~20 Aryls are optionally substituted groups, which are independently selected from 5-20 membered heteroaryl rings having 1-10 heteroatoms selected from oxygen, nitrogen, sulfur, phosphorus, and silicon, and 3-20 membered heterocyclic rings having 1-10 heteroatoms selected from oxygen, nitrogen, sulfur, phosphorus, and silicon.

[0174] In some embodiments, R is optionally replaced by C 1~30 It is aliphatic. In some embodiments, R is optionally replaced by C. 1~20 It is aliphatic. In some embodiments, R is optionally replaced by C. 1~15 It is aliphatic. In some embodiments, R is optionally replaced by C. 1~10 It is aliphatic. In some embodiments, R is optionally replaced by C. 1~6 It is aliphatic. In some embodiments, R is optionally replaced by C. 1~6It is alkyl. In some embodiments, R is optionally substituted hexyl, pentyl, butyl, propyl, ethyl, or methyl. In some embodiments, R is optionally substituted hexyl. In some embodiments, R is optionally substituted pentyl. In some embodiments, R is optionally substituted butyl. In some embodiments, R is optionally substituted propyl. In some embodiments, R is optionally substituted ethyl. In some embodiments, R is optionally substituted methyl. In some embodiments, R is hexyl. In some embodiments, R is pentyl. In some embodiments, R is butyl. In some embodiments, R is propyl. In some embodiments, R is ethyl. In some embodiments, R is methyl. In some embodiments, R is isopropyl. In some embodiments, R is n-propyl. In some embodiments, R is tert-butyl. In some embodiments, R is sec-butyl. In some embodiments, R is n-butyl. In some embodiments, R is -(CH2)2OCH3.

[0175] In some embodiments, R is optionally substituted phenyl.

[0176] In some embodiments, R 2s is a 2'-modification as described in this disclosure, and R 4s is -H. In some embodiments, R 2s is -OR, where R is not hydrogen. In some embodiments, R 2s is -F. In some embodiments, R 2s is -OMe. In some embodiments, R 2s For example, the various X used in Table 1 eo In this case, it is -OCH2CH2CH3 (where X is m5C, T, G, A, etc.). In some embodiments, R 2sis selected from -H, -F, and -OR, where R is optionally replaced by C. 1~6 It is alkyl. In some embodiments, R 2s The -H, -F, and -OMe options are selected.

[0177] In some embodiments, the sugar is a bicyclic sugar, for example, R 2s and R 4s However, the sugar is taken to form the optionally substituted ring as described herein. In some embodiments, the sugar is selected from LNA sugars, BNA sugars, cEt sugars, etc. In some embodiments, the bridge is between the 2' carbon atom and the 4' carbon atom (together with the intervening atoms, R to form the optionally substituted ring as described herein). 2s and R 4s It is located between (corresponding to). In some embodiments, the crosslinking is between 2'-L a -L b -4', and in the formula, L a is -O-, -S-, or N(R), L b This is C, which has been replaced by an optional substitution. 1~4 Divalent aliphatic chains, such as methylene.

[0178] In some embodiments, the sugar is 2'-OMe, 2'-MOE, 2'-F, LNA (locked nucleic acid) sugar, ENA (ethylene-bridged nucleic acid) sugar, BNA (NMe) (methylamino-bridged nucleic acid) sugar, 2'-F ANA (2'-F arabinose), alpha-DNA (alpha-D-ribose), 2' / 5'ODN (e.g., 2' / 5' linked oligonucleotide), Inv (inverted sugar, e.g., inverted deoxyribose), AmR (amino-ribose), ThioR (thio-ribose), HNA (hexose nucleic acid), CeNA (cyclohexene nucleic acid), or MOR (morpholino) sugar.

[0179] A person skilled in the art, after reading this disclosure, will understand that various types of sugar modifications are known and can be utilized in accordance with this disclosure. In some embodiments, the sugar modification is a 2'-modification (e.g., R 2s) In some embodiments, the 2'-modification is 2'-F. In some embodiments, the 2'-modification is 2'-OR, where R is not hydrogen. In some embodiments, the 2'-modification is 2'-OR, where R is optionally substituted C. 1~6 It is aliphatic. In some embodiments, the 2'-modification is 2'-OR, where R is optionally substituted with C. 1~6 It is alkyl. In some embodiments, the 2'-modification is 2'-OMe. In some embodiments, the 2'-modification is 2'-MOE. In some embodiments, the 2'-modification is -OL, which connects the 2'-carbon of the sugar moiety to another carbon of the sugar moiety. b - or -L b -L b -In some embodiments, the 2'-modification is 2'-OL, which connects the 2'-carbon of the sugar moiety to the 4'-carbon of the sugar moiety. b -4' or 2'-L b -L b -4'. In some embodiments, the 2'-modification is S-cEt. In some embodiments, the modified sugar is LNA sugar. In some embodiments, -L b - is -C(R)2-. In some embodiments, the 2'-modification is (C2-OC(R)2-C4), where each R is independently as described in this disclosure. In some embodiments, the 2'-modification is LNA sugar modification (C2-O-CH2-C4). In some embodiments, the 2'-modification is (C2-O-CHR-C4), where R is as described in this disclosure. In some embodiments, the 2'-modification is (C2-O-(R)-CHR-C4), where R is as described in this disclosure and is not hydrogen. In some embodiments, the 2'-modification is (C2-O-(S)-CHR-C4), where R is as described in this disclosure and is not hydrogen. In some embodiments, R is optionally substituted C 1~6 It is aliphatic. In some embodiments, R is optionally replaced by C. 1~6 It is alkyl. In some embodiments, R is unsubstituted C 1~6It is alkyl. In some embodiments, R is methyl. In some embodiments, R is ethyl. In some embodiments, the 2'-modification is (C2-O-CHR-C4), where R is optionally substituted with C 1~6 It is aliphatic. In some embodiments, the 2'-modification is (C2-O-CHR-C4), where R is optionally substituted with C. 1~6 It is alkyl. In some embodiments, the 2'-modification is (C2-O-CHR-C4), where R is methyl. In some embodiments, the 2'-modification is (C2-O-CHR-C4), where R is ethyl. In some embodiments, the 2'-modification is (C2-O-(R)-CHR-C4), where R is optionally substituted C 1~6 It is aliphatic. In some embodiments, the 2'-modification is (C2-O-(R)-CHR-C4), where R is optionally substituted with C. 1~6 It is alkyl. In some embodiments, the 2'-modification is (C2-O-(R)-CHR-C4), where R is methyl. In some embodiments, the 2'-modification is (C2-O-(R)-CHR-C4), where R is ethyl. In some embodiments, the 2'-modification is (C2-O-(S)-CHR-C4), where R is optionally substituted C 1~6 It is aliphatic. In some embodiments, the 2'-modification is (C2-O-(S)-CHR-C4), where R is optionally substituted with C. 1~6It is alkyl. In some embodiments, the 2'-modification is (C2-O-(S)-CHR-C4), where R is methyl. In some embodiments, the 2'-modification is (C2-O-(S)-CHR-C4), where R is ethyl. In some embodiments, the 2'-modification is C2-O-(R)-CH(CH2CH3)-C4. In some embodiments, the 2'-modification is C2-O-(S)-CH(CH2CH3)-C4. In some embodiments, the sugar is a natural DNA sugar. In some embodiments, the sugar is a natural RNA sugar. In some embodiments, the sugar is a naturally substituted natural DNA sugar. In some embodiments, the sugar is a naturally substituted natural DNA sugar at 2'. In some embodiments, the sugar is a 2'-substituted (2'-modified) natural DNA sugar. In some embodiments, the sugar is a 2'-modified (2'-modified) natural DNA sugar.

[0180] In some embodiments, the sugar is optionally substituted ribose or deoxyribose. In some embodiments, the sugar is optionally modified ribose or deoxyribose, and one or more hydroxyl groups of the ribose or deoxyribose moiety are optionally and independently replaced with a halogen, R', -N(R')2, -OR', or -SR', each R' as described herein. In some embodiments, the sugar is optionally substituted deoxyribose, and the 2' position of the deoxyribose is optionally substituted. In some embodiments, the sugar is optionally substituted deoxyribose, and the 2' position of the deoxyribose is optionally substituted with a halogen, R', -N(R')2, -OR', or -SR', each R' as described herein. In some embodiments, the sugar is optionally substituted deoxyribose, and the 2' position of the deoxyribose is optionally substituted with a halogen. In some embodiments, the sugar is optionally substituted deoxyribose, where the 2' position of the deoxyribose is optionally substituted with one or more -F groups. In some embodiments, the sugar is optionally substituted deoxyribose, where the 2' position of the deoxyribose is optionally substituted with -OR' groups, where each R' is independently one of the groups described herein. In some embodiments, the sugar is optionally substituted deoxyribose, where the 2' position of the deoxyribose is optionally substituted with -OR' groups, where each R' is independently one of the groups optionally substituted with C1-C6 aliphatic groups. In some embodiments, the sugar is optionally substituted deoxyribose, where the 2' position of the deoxyribose is optionally substituted with -OR' groups, where each R' is independently one of the groups optionally substituted with C1-C6 alkyl groups. In some embodiments, the sugar is optionally substituted deoxyribose, where the 2' position of the deoxyribose is optionally substituted with -OMe. In some embodiments, the sugar is optionally substituted deoxyribose, where the 2' position of the deoxyribose is optionally substituted with -O-methoxyethyl.

[0181] In some embodiments, the oligonucleotide provided comprises one or more modified sugars. In some embodiments, the oligonucleotide provided comprises one or more modified sugars and one or more natural sugars.

[0182] Examples of bicyclic sugars include alpha-L-methyleneoxy(4'-CH2-O-2')LNA, beta-D-methyleneoxy(4'-CH2-O-2')LNA, ethyleneoxy(4'-(CH2)2-O-2')LNA, aminooxy(4'-CH2-ON(R)-2')LNA, and oxyamino(4'-CH2-N(R)-O-2')LNA. In some embodiments, the bicyclic sugar, e.g., LNA or BNA sugar, is a sugar having at least one bridge between two sugar carbons. In some embodiments, the bicyclic sugar in the nucleoside may have the stereochemical configuration of alpha-L-ribofuranose or beta-D-ribofuranose.

[0183] In some embodiments, bicyclic sugars may be further defined by their isomer configuration. For example, sugars containing a 4'-(CH2)-O-2' bridge may exist in either an alpha-L configuration or a beta-D configuration. In some embodiments, the 4'-to-2' crosslinks are -L-4'-(CH2)-O-2', bD-4'-CH2-O-2', 4'-(CH2)2-O-2', 4'-CH2-ON(R')-2', 4'-CH2-N(R')-O-2', 4'-CH(R')-O-2', 4'-CH(CH3)-O-2', 4'-CH2-S-2', 4'-CH2-N(R')-2', 4'-CH2-CH(R')-2', 4'-CH2-CH(CH3)-2', and 4'-(CH2)3-2', where each R' is as described in this disclosure. In some embodiments, R' is -H, a protecting group, or optionally substituted C1-C 12 It is alkyl. In some embodiments, R' is -H, or optionally substituted with C1-C 12 It is alkyl.

[0184] In some embodiments, the bicyclic sugar is alpha-L-methyleneoxy(4'-CH2-O-2')BNA, beta-D-methyleneoxy(4'-CH2-O-2')BNA, ethyleneoxy(4'-(CH2)2-O-2')BNA, aminooxy(4'-CH2-ON(R)-2')BNA, oxyamino(4'-CH2-N(R)-O-2')BNA, methyl(methylene) It is a sugar derived from (4'-CH(CH3)-O-2')BNA (also called restricted ethyl or cEt), methylene-thio(4'-CH2-S-2')BNA, methylene-amino(4'-CH2-N(R)-2')BNA, methyl carboncyclic(4'-CH2-CH(CH3)-2')BNA, propylene carboncyclic(4'-(CH2)3-2')BNA, or vinyl BNA.

[0185] In some embodiments, the sugar modification is the modification described in US9006198. In some embodiments, the modified sugar is the modification described in US9006198. In some embodiments, the sugar modification is the modification described in US9006198. Each sugar modification and the modified sugar are incorporated herein by reference independently of the following: US9394333, US9744183, US9605019, US9982257, US2017 / 0037399, US2018 / 0216108, US2018 / 0216107, US9598458, WO2017 / 062862, WO2018 / 067973, WO2017 / 160741, WO2017 / 192679, WO2017 / 210647, WO2018 / 09826. 4. The modifications described in WO2018 / 022473, WO2018 / 223056, WO2018 / 223073, WO2018 / 223081, WO2018 / 237194, WO2019 / 032607, WO2019 / 032612, WO2019 / 055951, WO2019 / 075357, WO2019 / 200185, WO2019 / 217784, WO2019 / 032612, WO2020 / 191252, WO2021 / 071858, and / or WO2022 / 099159.

[0186] In some embodiments, the modified sugars are US5658873, US5118800, US5393878, US5514785, US5627053, US7034133, 7084125, US7399845, US5319080, US5591722, US5597909, US5466786, US6268490, US6525191, US5519134, US5576427, US6794499, US6998484, US7053207, US4981957, US5359044, US6770748, US7427672, US5446137, US6670461, US7569686, US774 1457, US8022193, US8030467, US8278425, US5610300, US5646265, US8278426, US556 7811, US5700920, US8278283, US5639873, US5670633, US8314227, US2008 / 0039618, U This refers to the documents listed in S2009 / 0012281, WO2021 / 030778, WO2020 / 154344, WO2020 / 154343, WO2020 / 154342, WO2020 / 165077, WO2020 / 201406, WO2020 / 216637, or WO2020 / 252376.

[0187] In some embodiments, the sugar modification is 2'-OMe, 2'-MOE, 2'-LNA, 2'-F, 5'-vinyl, or S-cEt. In some embodiments, the modified sugar is a sugar of FRNA, FANA, or morpholino. In some embodiments, the oligonucleotide includes nucleic acid analogs, e.g., GNA, LNA, PNA, TNA, F-HNA (F-THP or 3'-fluorotetrahydropyran), MNA (mannitol nucleic acid, e.g., Leumann 2002 Bioorg.Med.Chem.10:841-854), ANA (anitol nucleic acid), or morpholino, or a portion thereof. In some embodiments, the sugar is similar to a mobile nucleic acid or serinol nucleic acid. In some embodiments, the sugar modification replaces the natural sugar with another cyclic or acyclic moiety. Examples of such moieties are widely known in the art, such as morpholino, used in glycol nucleic acids, and may be utilized in accordance with this disclosure. As will be understood by those skilled in the art, when used with modified sugars, in some embodiments the internucleotide bond may be modified, for example, in morpholino, PNA, etc. In some embodiments, the sugar is a (R)-GNA sugar. In some embodiments, the sugar is a (S)-GNA sugar. In some embodiments, the sugar is a bicyclic sugar. In some embodiments, the sugar is an LNA sugar. In some embodiments, the sugar is an acyclic sugar. In some embodiments, the sugar is a UNA sugar. In some embodiments, the nucleoside is debased.

[0188] In some embodiments, the sugar is a 6'-modified bicyclic sugar having (R) or (S) chirality at the 6-position, as described, for example, in US7399845. In some embodiments, the sugar is a 5'-modified bicyclic sugar having (R) or (S) chirality at the 5-position, as described, for example, in US2007 / 0287831.

[0189] In some embodiments, the modified sugars are independently -F;-CF3, -CN, -N3, -NO, -NO2, -OR', -SR', or -N(R')2 (wherein each R' is independently described herein);-O-(C1~C 10 Alkyl), -S-(C1~C 10 Alkyl), -NH-(C1~C 10 Alkyl), or -N(C1~C 10 Alkyl)2;-O-(C2~C 10 Alkenyl), -S-(C2~C 10 Alkenyl), -NH-(C2~C 10 Alkenyl), or -N(C2~C 10 Alkenyl)2;-O-(C2~C 10 Alkinyl), -S-(C2~C 10 Alkinyl), -NH-(C2~C 10 Alkinyl) or -N(C2~C 10 Alkinyl)2; or -O--(C1~C 10 Alkylene)-O--(C1~C 10 Alkyl), -O-(C1~C 10 Alkylene)-NH-(C1~C 10 Alkyl), or -O-(C1~C 10 Alkylene)-NH(C1~C 10 Alkyl)2,-NH-(C1~C 10 Alkylene)-O-(C1~C 10 Alkyl), or -N(C1~C 10 Alkyl)-(C1~C 10 Alkylene)-O-(C1~C 10 It contains one or more substituents selected from alkyl) (wherein each of alkyl, alkylene, alkenyl, and alkynyl is independently and optionally substituted) at the 2' position (typically one substituent, and often in an axial position). In some embodiments, the substituent is -O(CH2) n OCH3, -O(CH2) nThe modified sugar is NH2, MOE, DMAOE, or DMAEOE, where n is 1 to about 10. In some embodiments, the modified sugar is one described in WO2001 / 088198; and Martin et al., Helv. Chim. Acta, 1995, 78, 486-504. In some embodiments, the modified sugar comprises one or more groups selected from a substituted silyl group, an RNA cleavage group, a reporter group, a fluorescent label, an interferant, a group for improving the pharmacokinetic properties of a nucleic acid, a group for improving the pharmacodynamic properties of a nucleic acid, or other substituents having similar properties. In some embodiments, the modification is made at one or more of the 2', 3', 4', or 5' positions, including the 3' position of the sugar of the 3'-terminal nucleoside or the 5' position of the 5'-terminal nucleoside.

[0190] In some embodiments, the 2'-OH group of ribose is -H, -F;-CF3, -CN, -N3, -NO, -NO2, -OR', -SR', or -N(R')2 (wherein each R' is independently described herein);-O-(C1~C 10 Alkyl), -S-(C1~C 10 Alkyl), -NH-(C1~C 10 Alkyl), or -N(C1~C 10 Alkyl)2;-O-(C2~C 10 Alkenyl), -S-(C2~C 10 Alkenyl), -NH-(C2~C 10 Alkenyl), or -N(C2~C 10 Alkenyl)2;-O-(C2~C 10 Alkinyl), -S-(C2~C 10 Alkinyl), -NH-(C2~C 10 Alkinyl) or -N(C2~C 10 Alkinyl)2; or -O-(C1~C 10 Alkylene)-O--(C1~C 10 Alkyl), -O-(C1~C 10 Alkylene)-NH-(C1~C 10 Alkyl), or -O-(C1~C 10 Alkylene)-NH(C1~C 10Alkyl)2,-NH-(C1~C 10 Alkylene)-O-(C1~C 10 Alkyl), or -N(C1~C 10 Alkyl)-(C1~C 10 Alkylene)-O-(C1~C 10 The 2'-OH group is replaced with a group selected from alkyl (wherein each of alkyl, alkylene, alkenyl, and alkynyl is independently and optionally substituted). In some embodiments, the 2'-OH group is replaced with -H (deoxyribose). In some embodiments, the 2'-OH group is replaced with -F. In some embodiments, the 2'-OH group is replaced with -OR'. In some embodiments, the 2'-OH group is replaced with -OMe. In some embodiments, the 2'-OH group is replaced with -OCH2CH2OMe.

[0191] In some embodiments, the sugar modification is a 2'-modification. Commonly used 2'-modifications include, but are not limited to, 2'-OR, where R is not hydrogen, but as described in this disclosure. In some embodiments, the modification is a 2'-OR, where R is optionally substituted with C 1~6 It is aliphatic. In some embodiments, the modification is 2'-OR, where R is optionally substituted with C. 1~6 It is alkyl. In some embodiments, the modification is 2'-OMe. In some embodiments, the modification is 2'-MOE. In some embodiments, the 2'-modification is S-cEt. In some embodiments, the modified sugar is LNA sugar. In some embodiments, the 2'-modification is -F. In some embodiments, the 2'-modification is FANA. In some embodiments, the 2'-modification is FRNA. In some embodiments, the sugar modification is a 5'-modification, e.g., 5'-Me. In some embodiments, the sugar modification changes the size of the sugar ring. In some embodiments, the sugar modification is the sugar moiety in FHNA.

[0192] In some embodiments, sugar modification involves replacing the sugar moiety with another cyclic or acyclic moiety. Examples of such moieties, which are widely known in the art, include, but are not limited to, those used in morpholinos (optionally having their phosphorodiamidate linkage), glycol nucleic acids, and the like.

[0193] In some embodiments, one or more sugars of the oligonucleotide are modified. In some embodiments, the modified sugars include a 2'-modification. In some embodiments, each modified sugar independently includes a 2'-modification. In some embodiments, the 2'-modification is 2'-OR. In some embodiments, the 2'-modification is 2'-OMe. In some embodiments, the 2'-modification is 2'-MOE. In some embodiments, the 2'-modification is LNA sugar modification. In some embodiments, the 2'-modification is 2'-F. In some embodiments, each sugar modification is independently a 2'-modification. In some embodiments, each sugar modification is independently 2'-OR or 2'-F. In some embodiments, each sugar modification is independently 2'-OR or 2'-F, where R is optionally substituted with C. 1~6 It is alkyl. In some embodiments, each sugar modification is independently 2'-OR or 2'-F, and at least one is 2'-F. In some embodiments, each sugar modification is independently 2'-OR or 2'-F, where R is optionally substituted with C 1~6 It is alkyl and at least one is 2'-OR. In some embodiments, each sugar modification is independently 2'-OR or 2'-F, where at least one is 2'-F and at least one is 2'-OR. In some embodiments, each sugar modification is independently 2'-OR or 2'-F, where R is optionally substituted with C 1~6It is alkyl, at least one of which is 2'-F, and at least one of which is 2'-OR. In some embodiments, each sugar modification is independently 2'-OR. In some embodiments, each sugar modification is independently 2'-OR, where R is optionally substituted with C. 1~6 It is alkyl. In some embodiments, each sugar modification is 2'-OMe. In some embodiments, each sugar modification is 2'-MOE. In some embodiments, each sugar modification is independently 2'-OMe or 2'-MOE. In some embodiments, each sugar modification is independently 2'-OMe, 2'-MOE, or LNA sugar.

[0194] Modified sugars contain cyclobutyl or cyclopentyl moieties instead of pentofuranosyl sugars. Representative examples of such modified sugars are described in US4,981,957, US5,118,800, US5,319,080, or US5,359,044. In some embodiments, the oxygen atom in the ribose ring is replaced with nitrogen, sulfur, selenium, or carbon. In some embodiments, -O- is replaced with -N(R')-, -S-, -Se-, or -C(R')2-. In some embodiments, the modified sugar is modified ribose, in which the oxygen atom in the ribose ring is replaced with nitrogen, and the nitrogen is optionally replaced with an alkyl group (e.g., methyl, ethyl, isopropyl, etc.).

[0195] Non-limiting examples of modified sugars include glycerol, which is part of glycerol nucleic acid (GNA), as described, for example, by Zhang, R et al., J.Am. Chem. Soc., 2008, 130, 5846-5847, Zhang L, et al., J.Am. Chem. Soc., 2005, 127, 4174-4175, and Tsai CH et al., PNAS, 2007, 14598-14603.

[0196] Mobile nucleic acids (FNAs) are based on mixed acetal aminals of formylglycerol, as described, for example, by Joyce GF et al., PNAS, 1987, 84, 4398-4402 and by Heuberger BD and Switzer C, J.Am.Chem.Soc., 2008, 130, 412-413.

[0197] In some embodiments, oligonucleotides and / or modified nucleosides are incorporated herein by reference, with each sugar and modified sugar independently referred to in WO2018 / 022473, WO2018 / 098264, WO2018 / 223056, WO2018 / 223073, WO2018 / 223081, and WO2018 / 237. Contains sugars or modified sugars as described in 194, WO2019 / 032607, WO2019 / 055951, WO2019 / 075357, WO2019 / 200185, WO2019 / 217784, WO2019 / 032612, WO2020 / 191252, WO2021 / 071858, and / or WO2022 / 099159.

[0198] In some embodiments, one or more hydroxyl groups in the sugar are optionally and independently replaced with a halogen, R'-N(R')2, -OR', or -SR', where each R' is independently described herein.

[0199] In some embodiments, each modified nucleoside is independently incorporated herein by reference in WO2018 / 022473, WO2018 / 098264, WO2018 / 223056, WO2018 / 223073, WO2018 / 223081, WO2018 / 237194, WO201 Any modified nucleoside as described in 9 / 032607, WO2019 / 055951, WO2019 / 075357, WO2019 / 200185, WO2019 / 217784, WO2019 / 032612, WO2020 / 191252, WO2021 / 071858, and / or WO2022 / 099159.

[0200] In some embodiments, the sugar modification is 5'-vinyl(R or S), 5'-methyl(R or S), 2'-SH, 2'-F, 2'-OCH3, 2'-OCH2CH3, 2'-OCH2CH2F, or 2'-O(CH2) 20 In some embodiments, the substituent at the 2' position, for example, the 2' modification, is allyl, amino, azide, thio, O-allyl, O-C1-C 10 Alkyl, OCF3, OCH2F, O(CH2)2SCH3, O(CH2)2-ON(R m )(R n ), O-CH2-C(=O)-N(R m )(R n ), and O-CH2-C(=O)-N(R1)-(CH2)2-N(R m )(R n ) and each allyl, amino, and alkyl is optionally substituted, R l , R m , and R n Each of these is independently R' as described herein. In some embodiments, R l , R m , and R n Each of these is independently replaced by -H or C1~C 10 It is alkyl.

[0201] In some embodiments, the bicyclic sugar is bridged between two sugar carbons, for example, between the 4' and 2' ribosyl ring carbon atoms, e.g., -L b -L b -, -L- etc. In some embodiments, the crosslinking includes 4'-(CH2)-O-2' (e.g., LNA sugar), 4'-(CH2)-S-2', 4'-(CH2)2-O-2' (e.g., ENA sugar), 4'-CH(R')-O-2' (e.g., 4'-CH(CH3)-O-2', 4'-CH(CH2OCH3)-O-2', and examples such as US7399845), 4'-CH(R')2-O-2' (e.g., 4'-C(CH3)( CH3)-O-2' and examples such as WO2009 / 006478, 4'-CH2-N(OR')-2' (e.g., 4'-CH2-N(OCH3)-2', examples such as WO2008 / 150729), 4'-CH2-ON(R')-2' (e.g., 4'-CH2-ON(CH3)-2', examples such as US2004 / 017570), 4'-CH2-N(R')-O-2' [e.g., R is -H, C1-C] 12 The protecting group is an alkyl group or a protecting group (see, for example, US7427672), 4'-C(R')2-C(H)(R')-2' (e.g., 4'-CH2-C(H)(CH3)-2', as seen in examples such as Chattopadhyaya et al., J.Org.Chem., 2009, 74, 118-134), or 4'-C(R')2-C(=C(R')2)-2' (e.g., 4'-CH2-C(=CH2)-2', as seen in examples such as WO2008 / 154401).

[0202] In some embodiments, the sugar is a tetrahydropyran or THP sugar. In some embodiments, the modified nucleoside is a tetrahydropyran nucleoside or THP nucleoside, which is a nucleoside having a six-membered tetrahydropyran sugar substituted with respect to a pentofuranosyl residue in a typical natural nucleoside. Examples of THP sugars and / or nucleosides include those used in hexitol nucleic acid (HNA), anitol nucleic acid (ANA), mannitol nucleic acid (MNA) (e.g., Leumann, Bioorg. Med. Chem., 2002, 10, 841-854) or fluoroHNA (F-HNA).

[0203] In some embodiments, the sugar comprises a ring having more than five atoms and / or two or more heteroatoms, and includes morpholino sugars as described, for example, Braasch et al., Biochemistry, 2002, 41, 4503-4510; US5698685; US5166315; US5185444; US5034506.

[0204] As those skilled in the art will understand, modifications such as sugars, nucleic acid bases, and internucleotide bonds can and often be used in combination with oligonucleotides; see, for example, the various oligonucleotides in Table 1.

[0205] In some embodiments, the nucleoside has a 6-membered cyclohexenyl instead of the pentofuranosyl residue found in naturally occurring nucleosides. Examples of cyclohexenyl nucleosides and their preparation and use can be found, for example, in WO2010036696, Robeyns et al., J.Am.Chem.Soc., 2008, 130(6), 1979-1984, Horvath et al., Tetrahedron Letters, 2007, 48, 3621-3623, Nauwelaerts et al., J.Am.Chem.Soc., 2007, 129(30), 9340-9348, Gu et al., Nucleosides, Nucleotides & Nucleic Acids, 2005, 24(5-7), 993-998, Nauwelaerts et al., Nucleic Acids Research, 2005, 33(8), 2452-2463, Robeyns et al., Acta Crystallographica,Section F:Structural Biology and Crystallization Communications,2005,F61(6),585-586, Gu et al.,Tetrahedron,2004,60(9),2111-2123, Gu et al.,Oligonucleotides,2003,13(6),479-489,Wang et al. al.,J.Org.Chem.,2003,68,4499-4505, Verbeure et al.,Nucleic Acids Research,2001,29(24),4941-4947,Wang et al.,J.Org.Chem.,2001,66,8478-82,Wang et al.,Nucleosides,Nucleotides & Nucleic This is explained in Acids, 2001, 20(4-7), 785-788; Wang et al., J.Am.Chem., 2000, 122, 8595-8602; WO2006 / 047842; WO2001 / 049687, etc.

[0206] Many monocyclic, bicyclic, and tricyclic ring systems are suitable as substitute sugars (modified sugars) and may be used in accordance with this disclosure. See, for example, Leumann, Christian J. Bioorg. & Med. Chem., 2002, 10, 841-854. Such ring systems may undergo various additional substitutions to further enhance their properties and / or activity.

[0207] In some embodiments, the 2'-modified sugar is a furanosyl sugar modified at the 2' position. In some embodiments, the 2'-modification is a halogen, -R' (wherein R' is not -H), -OR' (wherein R' is not -H), -SR', -N(R')2, optionally substituted -CH2-CH=CH2, optionally substituted alkenyl, or optionally substituted alkynyl. In some embodiments, the 2'-modification is -O[(CH2) n O] m CH3, -O(CH2) n NH2, -O(CH2) n CH3, -O(CH2) n F, -O(CH2) n ONH2, -OCH2C(=O)N(H)CH3, and -O(CH2) n ON[(CH2) n Selected from CH3]2, each n and m is independently 1 to about 10. In some embodiments, the 2'-modification is optionally replaced with C1-C 12Alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted alkalyl, optionally substituted aralkyl, optionally substituted -O-alkalyl, optionally substituted -O-aralkyl, -SH, -SCH3, -OCN, -Cl, -Br, -CN, -F, -CF3, -OCF3, -SOCH3, -SO2CH3, -ONO2, -NO2, -N3, -NH2, optionally substituted heterocycloalkyl, optionally substituted heterocycloalkalyl, optionally substituted aminoalkylamino, optionally substituted polyalkylamino, substituted silyl, reporter group, interfering substance, group for improving pharmacokinetic properties, group for improving pharmacodynamic properties, and other substituents. In some embodiments, the 2'-modification is a 2'-MOE modification (e.g., Baker et al., J. Biol. Chem., 1997, 272, 11944-12000). In some cases, the 2'-MOE modification has been reported to have improved binding affinity compared to unmodified sugars and several other modified nucleosides such as 2'-O-methyl, 2'-O-propyl, and 2'-O-aminopropyl. Oligonucleotides with 2'-MOE modifications have also been reported to inhibit gene expression with features promising for in vivo use (see, for example, Martin, Helv. Chim. Acta, 1995, 78, 486-504; Altmann et al., Chimia, 1996, 50, 168-176; Altmann et al., Biochem. Soc. Trans., 1996, 24, 630-637; and Altmann et al., Nucleosides Nucleotides, 1997, 16, 917-926).

[0208] In some embodiments, a 2'-modified or 2'-substituted sugar or nucleoside is a sugar or nucleoside that contains a substituent at the 2' position of a sugar other than -H (which is not typically considered a substituent) or -OH. In some embodiments, a 2'-modified sugar is a bicyclic sugar that includes a bridge linking two carbon atoms of a sugar ring, one of which is the 2' carbon. In some embodiments, the 2'-modification is non-bridged, e.g., allyl, amino, azide, thio, optionally substituted -O-allyl, optionally substituted -O-C1~C 10 Alkyl, -OCF3, -O(CH2)2OCH3, 2'-O(CH2)2SCH3, -O(CH2)2ON(R m )(R n ), or -OCH2C(=O)N(R m )(R n ) and in the formula, each R m and R n These are independently replaced by -H or optionally by C1~C 10 It is alkyl.

[0209] Certain modified sugars, their preparation and use are described in US4981957, US5118800, US5319080, US5359044, US5393878, US5446137, US5466786, US5514785, US5519134, US5567811, US5576427, US5591722, US5597909, US5610300, US5627053, US5639873, US5646265, US5670633, US5700920, US5792847, US6600032, and WO2005 / 121371.

[0210] In some embodiments, the sugar is N-methanocarba, LNA, cMOE BNA, cEt BNA, α-L-LNA or related analogues, HNA, Me-ANA, MOE-ANA, Ara-FHNA, FHNA, R-6'-Me-FHNA, S-6'-Me-FHNA, ENA, or c-ANA. In some embodiments, the modified internucleotide bond is a C3-amide (e.g., a sugar with an amide modification attached to C3', Mutisya et al. 2014 Nucleic Acids Res. 2014 Jun 1;42(10):6542-6551), formacetal, thioformacetal, MMI [e.g., methylene (methylimino), Peoc'h et al. 2006 Nucleosides and Nucleotides 16(7-9)], PMO (phosphodiamic acid-linked morpholino) bond (linking two sugars), or PNA (peptide nucleic acid) bond. In some embodiments, examples of internucleotide bonds and / or sugars are cited in Allerson et al. 2005 J.Med.Chem. 48:901-4; BMCL 2011 21:1122; BMCL 2011 21:588; BMCL 2012 22:296, Chattopadhyaya et al. 2007 J.Am.Chem.Soc. 129:8362, Chem.Bio.Chem. 2013 14:58, Curr.Prot.Nucl.Acids Chem. 2011 1.24.1, Egli et al. 2011 J.Am.Chem.Soc. 133:16642, Hendrix et al. 1997 Chem.Eur.J. 3:110, Hyrup et al. 1996 Bioorg.Med.Chem.4:5, Imanishi 1997 Tet.Lett.38:8735;J.Am.Chem.Soc.1994,116,3143;J.Med.Chem.2009 52:10;J.Org.Chem.2010 75:1589, Jepsen et al.2004 Oligo.14:130-146, Jones et al.J.Org.Chem.1993,58,2983, Jung et al.2014 ACIEE 53:9893, Kodama et al.2014 AGDS, Koizumi 2003 BMC 11:2211, Koizumi et al. 2003 Nuc.Acids Res. 12:3267-3273, Koshkin et al. 1998 Tetrahedron 54:3607-3630, Kumar et al. 1998 Bioo.Med.Chem.Let. 8:2219-2222, Lauritsen et al. 2002 Chem.Comm. 5:530-531, Lauritsen et al. 2003 Bioo.Med.Chem.Let. 13:253-256, Lima et al. 2012 Cell 150:883-894, Mesmaeker et al.Angew.Chem.,Int.Ed.Engl.1994,33,226、Migawa et al.2013 Org.Lett.15:4316;Mol.Ther.Nucl.Acids 2012 1:e47、Morita et al.2001 Nucl.Acids Res.Supp.1:241-242、Morita et al.2002 Bio.Med.Chem.Lett.12:73-76、Morita et al.2003 Bio.Med.Chem.Lett.2211-2226、Murray et al.2012 Nucl.Acids Res.40:6135、Nielsen et al.1997 Chem.Soc.Rev.73、Nielsen et al.1997 J.Chem.Soc.Perkins Transl.1:3423-3433、Obika et al.1997 Tetrahedron Lett.38(50):8735-8、Obika et al.1998 Tetrahedron Lett.39:5401-5404、Obika et al.2008 J.Am.Chem.Soc.130:4886、Obika et al.2011、Org.Lett.13:6050、Oestergaard et al.2014 JOC 79:8877、Pallan et al.2012 Biochem.51:7、Pallan et al.2012 Chem.Comm.48:8195-8197、Petersen et al.2003 TRENDS Biotech.21:74-81、Prakash et al.2010 J.Med.Chem.53:1636、Prakash et al.2015 Nucl.Acids Res.43:2993-3011、Prakash et al.2016 Bioorg.Med.Chem.Lett.26:2817-2820、Rajwanshi et al.1999 Chem.Commun.1395-1396、Schultz et al.1996 Nucleic Acids Res.24:2966、Seth et al.2008 Nucl.Acid Sym.Ser.52: 553、Seth et al.2009 J.Med.Chem.52:10-13、Seth et al.2010 J.Am.Chem.Soc.132:14942、Seth et al.2010 J.Med.Chem.53:8309-8318、Seth et al.2010 J.Org.Chem.75:1569-1581、Seth et al.2011 BMCL 21:4690、Seth et al.2012 Bioo.Med.Chem.Lett.22:296-299、Seth et al.2012 Mol.Ther-Nuc.Acids.1,e47、Seth et al.,Nucleic Acids Symposium Series(2008),52(1),553-554、Singh et al.1998 Chem.Comm.1247-1248、Singh et al.1998 J.Org.Chem.63:10035 -39、Singh et al.1998 J.Org.Chem.63:6078-6079、Sorensen 2003 Chem.Comm.2130-2131、Starrup et al.2010 Nucl.Acids Res.38:7100、Swayze et al.2007 Nucl.Acids Res.35:687、Ts’o et al.Ann.N.Y.Acad.Sci.1988,507,220、Van Aerschot et al.1995 Angew.Chem.Int.Ed.Engl.34:1338、Vasseur et al.J.Am.Chem.Soc.This is described in 1992,114,4006, WO2007090071, WO2016079181, US6326199, US6066500, or US6440739.

[0211] In some embodiments, the oligonucleotide or a portion thereof (e.g., a domain, subdomain, etc.) contains a high level of 2'-F modified sugar, for example, about 10% to 100% (e.g., about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more, or about 100%) of the sugar in the oligonucleotide or a portion thereof (e.g., a domain, subdomain, etc.) contains 2'-F. In some embodiments, about 50% or more of the sugar in the oligonucleotide or a portion thereof contains 2'-F. In some embodiments, about 60% or more of the sugar in the oligonucleotide or a portion thereof contains 2'-F. In some embodiments, about 70% or more of the sugar in the oligonucleotide or a portion thereof contains 2'-F. In some embodiments, about 80% or more of the sugar in the oligonucleotide or a portion thereof contains 2'-F. In some embodiments, about 90% or more of the sugars in an oligonucleotide or a portion thereof contain 2'-F. In some embodiments, about 1 to 20 or more sugars (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more) in an oligonucleotide or a portion thereof (e.g., a domain, a subdomain, etc.) contain 2'-F. In some embodiments, one or more sugars in an oligonucleotide or a portion thereof contain 2'-F. In some embodiments, two or more sugars in an oligonucleotide or a portion thereof contain 2'-F. In some embodiments, three or more sugars in an oligonucleotide or a portion thereof contain 2'-F. In some embodiments, four or more sugars in an oligonucleotide or a portion thereof contain 2'-F. In some embodiments, five or more sugars in an oligonucleotide or a portion thereof contain 2'-F. In some embodiments, six or more sugars in an oligonucleotide or a portion thereof contain 2'-F. In some embodiments, seven or more sugars in the oligonucleotide or a portion thereof contain 2'-F. In some embodiments, eight or more sugars in the oligonucleotide or a portion thereof contain 2'-F.In some embodiments, nine or more sugars in the oligonucleotide or a portion thereof contain 2'-F. In some embodiments, ten or more sugars in the oligonucleotide or a portion thereof contain 2'-F. In some embodiments, eleven or more sugars in the oligonucleotide or a portion thereof contain 2'-F. In some embodiments, twelve or more sugars in the oligonucleotide or a portion thereof contain 2'-F. In some embodiments, thirteen or more sugars in the oligonucleotide or a portion thereof contain 2'-F. In some embodiments, fourteen or more sugars in the oligonucleotide or a portion thereof contain 2'-F. In some embodiments, fifteen or more sugars in the oligonucleotide or a portion thereof contain 2'-F. In some embodiments, sixteen or more sugars in the oligonucleotide or a portion thereof contain 2'-F. In some embodiments, seventeen or more sugars in the oligonucleotide or a portion thereof contain 2'-F. In some embodiments, eighteen or more sugars in the oligonucleotide or a portion thereof contain 2'-F. In some embodiments, nineteen or more sugars in the oligonucleotide or a portion thereof contain 2'-F. In some embodiments, twenty or more sugars in the oligonucleotide or a portion thereof contain 2'-F. In some embodiments, the oligonucleotide or a portion thereof also includes one or more sugars that do not contain 2'-F (e.g., unmodified sugars and / or sugars with other modifications).

[0212] In some embodiments, about 1% to 95% (e.g., about 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or less, etc.) of the sugars in the oligonucleotide or a portion thereof contains 2'-OMe. In some embodiments, about 50% or less of the sugars in the oligonucleotide or a portion thereof contains 2'-OMe. In some embodiments, none of the sugars in the oligonucleotide or a portion thereof contain 2'-OMe. In some embodiments, 1, 2, 3, 4, or 5 or fewer sugars in the oligonucleotide or a portion thereof contain 2'-OMe. In some embodiments, 1 or fewer sugars in the oligonucleotide or a portion thereof contain 2'-OMe. In some embodiments, 2 or fewer sugars in the oligonucleotide or a portion thereof contain 2'-OMe. In some embodiments, three or fewer sugars in the oligonucleotide or a portion thereof contain 2'-OMe. In some embodiments, four or fewer sugars in the oligonucleotide or a portion thereof contain 2'-OMe. In some embodiments, five or fewer sugars in the oligonucleotide or a portion thereof contain 2'-OMe.

[0213] In some embodiments, about 1 to 20 or more sugars (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more) in an oligonucleotide or a portion thereof (e.g., a domain, subdomain, etc.) contain 2'-F, and 1, 2, 3, 4, or 5 or fewer sugars in an oligonucleotide or a portion thereof contain 2'-OMe.

[0214] Various additional sugars useful for preparing oligonucleotides or their analogues are known in the art and may be utilized in accordance with this disclosure.

[0215] Nucleotide inter-nucleotide bonding In particular, this disclosure provides various internucleotide bonds (e.g., various modified internucleotide bonds) that can be used in conjunction with other structural elements (e.g., various sugars described herein) to provide oligonucleotides and compositions thereof.

[0216] In some embodiments, the oligonucleotide includes base modification, sugar modification, and / or nucleotide internucleotide bond modification. Various nucleotide internucleotide bonds can be utilized in accordance with this disclosure to bond units comprising nucleic acid bases, e.g., nucleosides. In some embodiments, the oligonucleotide provided includes both one or more modified nucleotide internucleotide bonds and one or more native phosphate bonds. In some embodiments, the oligonucleotide includes one or more types of nucleotide internucleotide bonds. In some embodiments, the oligonucleotide includes two or more types of nucleotide internucleotide bonds. In some embodiments, the oligonucleotide includes at least three types of nucleotide internucleotide bonds. In some embodiments, the bond contains a bound phosphorus atom ("PO bond," e.g., native phosphate bond) in which an oxygen atom is bonded to an oxygen atom that is not bonded to or part of a skeletal sugar. In some embodiments, the bond contains a bound phosphorus atom ("PS bond," e.g., phosphorothioate nucleotide internucleotide bond) in which a sulfur atom is bonded to a sulfur atom that is not bonded to or part of a skeletal sugar. In some embodiments, the bond contains a bound phosphorus atom ("PN bond," e.g., n001) in which a nitrogen atom is bonded to a nitrogen atom that is not bonded to or part of a skeletal sugar. In some embodiments, the oligonucleotide contains one or more PS bonds. In some embodiments, the oligonucleotide contains one or more PO bonds. In some embodiments, the oligonucleotide contains one or more PN bonds. In some embodiments, the oligonucleotide contains one or more PS bonds and one or more PO bonds. In some embodiments, the oligonucleotide contains one or more PS bonds and one or more PN bonds. In some embodiments, the oligonucleotide contains one or more PS bonds, one or more PN bonds and one or more PO bonds. In some embodiments, the PS bonds are phosphorothioate bonds. In some embodiments, each PS bond is independently a phosphorothioate bond. In some embodiments, the PO bonds are native phosphate bonds. In some embodiments, each PO bond is independently a native phosphate bond.In some embodiments, the PN bond is a phosphorylguanidine bond. In some embodiments, each PN bond is independently a phosphorylguanidine bond.

[0217] As is widely known to those skilled in the art, natural phosphate bonds are widely found in natural DNA and RNA molecules, and they have the structure -OP(O)(OH)O-, linking sugars at nucleosides in DNA and RNA, and can exist in various salt forms, for example at physiological pH (about 7.4), with natural phosphate bonds mainly existing in salt form, where the anion is -OP(O)(O-)O-. Modified internucleotide bonds or non-natural phosphate bonds are internucleotide bonds that are not natural phosphate bonds or their salt forms. Modified internucleotide bonds can also be their salt forms, depending on their structure. For example, as understood by those skilled in the art, a phosphorothioate internucleotide bond having the structure -OP(O)(SH)O- has the anion -OP(O)(S - It is )O-, and can be various salt forms, for example, at physiological pH (approximately 7.4).

[0218] In some embodiments, the oligonucleotide comprises a modified nucleotide bond, such as a phosphorothioate, phosphorodithioate, methylphosphonate, phosphoramidate, thiophosphate, 3'-thiophosphate, or 5'-thiophosphate. In some embodiments, the modified nucleotide bond is a PN bond. In some embodiments, the modified nucleotide bond is a PS bond. In some embodiments, the modified nucleotide bond is a PO bond (other than, for example, a natural phosphate bond). In some embodiments, each modified nucleotide bond is independently a PN nucleotide bond or a PS nucleotide bond. In some embodiments, the oligonucleotide comprises one or more PN nucleotide bonds, one or more PS nucleotide bonds, and one or more PO nucleotide bonds. In some embodiments, one or more PN nucleotide bonds are independently phosphorylguanidine nucleotide bonds. In some embodiments, one or more PN nucleotide bonds are independently n001. In some embodiments, one or more PS nucleotide bonds are independently phosphorothioate nucleotide bonds. In some embodiments, each PS nucleotide bond is independently a phosphorothioate nucleotide bond. In some embodiments, one or more PO nucleotide bonds are independently native phosphate bonds. In some embodiments, each PO nucleotide bond is independently a native phosphate bond.

[0219] In some embodiments, the modified nucleotide bond is a chiral nucleotide bond containing chiral-bound phosphorus. In some embodiments, the chiral nucleotide bond is a phosphorothioate bond. In some embodiments, the chiral nucleotide bond is a negatively charged nucleotide bond. In some embodiments, the chiral nucleotide bond is a neutral nucleotide bond. In some embodiments, the chiral nucleotide bond is chiral-controlled with respect to its chiral-bound phosphorus. In some embodiments, the chiral nucleotide bond is stereochemically pure with respect to its chiral-bound phosphorus. In some embodiments, the chiral nucleotide bond is not chiral-controlled. In some embodiments, the pattern of the skeletal chiral centers includes, or consists of, the positions of the chiral-controlled nucleotide bond and the arrangement of the bound phosphorus (Rp or Sp), as well as the positions of the achiral nucleotide bond (e.g., a natural phosphate bond).

[0220] In some embodiments, the nucleotide interbonding includes a phosphorus modification, which is a modification with bound phosphorus. In some embodiments, the modified nucleotide interbonding is a portion that does not contain phosphorus, such as in peptide nucleic acids (PNAs), but serves to link two sugars or two parts, each independently containing nucleic acid bases.

[0221] In some embodiments, the oligonucleotide has a modified internucleotide bond, for example, a structure of formula I, Ia, Ib, or Ic, and each of these internucleotide bonds (e.g., those of formula I, Ia, Ib, Ic) is incorporated herein by independent reference as described herein, WO2018 / 022473, WO2018 / 098264, WO2018 / 223056, WO2018 / This includes those described in 223073, WO2018 / 223081, WO2018 / 237194, WO2019 / 032607, WO2019 / 055951, WO2019 / 075357, WO2019 / 200185, WO2019 / 217784, WO2019 / 032612, WO2020 / 191252, WO2021 / 071858, and / or WO2022 / 099159. In some embodiments, the modified nucleotide bond is a chiral nucleotide bond. In some embodiments, the modified nucleotide bond is a phosphorothioate nucleotide bond.

[0222] In some embodiments, the modified nucleotide bond is a negatively charged nucleotide bond. In some embodiments, the oligonucleotide provided comprises one or more negatively charged nucleotide bonds. In some embodiments, the negatively charged nucleotide bond is a positively charged nucleotide bond. In some embodiments, the negatively charged nucleotide bond is a neutral nucleotide bond. In some embodiments, the present disclosure provides an oligonucleotide comprising one or more neutral nucleotide bonds. In some embodiments, the negatively charged nucleotide bond is referred to herein and / or each negatively charged nucleotide bond (e.g., those of formulas In-1, In-2, In-3, In-4, II, II-a-1, II-a-2, II-b-1, II-b-2, II-c-1, II-c-2, II-d-1, II-d-2, etc., or a preferred salt form thereof) independently by reference. The following are incorporated herein by US9394333, US9744183, US9605019, US9982257, US2017 / 0037399, US2018 / 0216108, US2018 / 0216107, US9598458, WO2017 / 062862, WO2018 / 067973, WO2017 / 160741, WO2017 / 192679, WO2017 / 210647, WO2018 / 098264, WO2018 / 022473, WO2018 / 223056, WO2018 / 223073, WO2018 / 223081, WO2018 / 23 7194, WO2019 / 032607, WO2019 / 032612, WO2019 / 055951, WO2019 / 075357, WO2019 / 200185, WO2019 / 21778 4, having the structure of formulas In-1, In-2, In-3, In-4, II, II-a-1, II-a-2, II-b-1, II-b-2, II-c-1, II-c-2, II-d-1, II-d-2, or salt forms thereof, as described in WO2019 / 032612, WO2020 / 191252, WO2021 / 071858, and / or WO2022 / 099159.

[0223] In some embodiments, uncharged internucleotide bonds can improve delivery and / or activity (e.g., exon skipping activity).

[0224] In some embodiments, the modified nucleotide bond (e.g., a negatively charged nucleotide bond) comprises an optionally substituted triazolyl. In some embodiments, the modified nucleotide bond (e.g., a negatively charged nucleotide bond) comprises an optionally substituted alkynyl. In some embodiments, the modified nucleotide bond comprises a triazole or alkyne moiety. In some embodiments, the triazole moiety, e.g., a triazolyl group, is optionally substituted. In some embodiments, the triazole moiety, e.g., a triazolyl group, is substituted. In some embodiments, the triazole moiety is unsubstituted. In some embodiments, the modified nucleotide bond comprises an optionally substituted cyclic guanidine moiety. In some embodiments, the modified nucleotide bond is [ka] It has a structure that is optionally chiral-controlled, and in the formula, R 1 is -L-R', where L is L as described herein. B And R' is as described herein. In some embodiments, each R 1 R' is independent of R'. In some embodiments, each R' is independently of R'. In some embodiments, two R's are 1 R is, together with other elements, to form the ring described herein. In some embodiments, two R atoms on two different nitrogen atoms 1 R is R, and together they form the ring described herein. In some embodiments, R 1 C is independently replaced by any of the options described herein. 1~6 It is aliphatic. In some embodiments, R 1is methyl. In some embodiments, two R' atoms on the same nitrogen atom are R, and together they form the ring described herein. In some embodiments, the modified internucleotide bond is [ka] It has a structure that is optionally chiral-controlled. In some embodiments, [ka] teeth, [ka] In some embodiments, the modified nucleotide bond includes an optionally substituted cyclic guanidine moiety. [ka] It has the structure shown in the formula, where W is either O or S. In some embodiments, W is O. In some embodiments, W is S. In some embodiments, the non-negatively charged internucleotide bond is stereochemically controlled.

[0225] In some embodiments, a negatively charged or neutral nucleotide bond is a nucleotide bond containing a triazole moiety. In some embodiments, a negatively charged or negatively charged nucleotide bond contains an optionally substituted triazolyl group. In some embodiments, a nucleotide bond containing a triazole moiety (e.g., an optionally substituted triazolyl group) is [ka] It has the structure. In some embodiments, the nucleotide bond containing the triazole moiety is [ka] It has the structure. In some embodiments, the nucleotide bond containing the triazole moiety is [ka] It has the formula, where W is O or S. In some embodiments, the internucleotide bond containing an alkyne moiety (e.g., an optionally substituted alkynyl group) [ka] It has the formula, where W is O or S. In some embodiments, the internucleotide bond, for example, the negatively charged internucleotide bond, the neutral internucleotide bond, includes a cyclic guanidine moiety. In some embodiments, the internucleotide bond including the cyclic guanidine moiety is [ka] It has the following structure. In some embodiments, the negatively charged or neutral nucleotide bonds are [ka] The structure is selected from or includes such a structure, where W is either O or S.

[0226] In some embodiments, the internucleotide bond is a Tmg group ( [ka] ) includes. In some embodiments, the internucleotide bond includes a Tmg group, [ka] It has the structure ("Tmg nucleotide internucleotide bond"). In some embodiments, the neutral nucleotide internucleotide bond includes the nucleotide internucleotide bonds of PNA and PMO, as well as the Tmg nucleotide internucleotide bond.

[0227] In some embodiments, the negatively charged internucleotide bond has a structure such as formula I, Ia, Ib, Ic, In-1, In-2, In-3, In-4, II, II-a-1, II-a-2, II-b-1, II-b-2, II-c-1, II-c-2, II-d-1, II-d-2, or a salt form thereof. In some embodiments, the negatively charged internucleotide bond comprises an optionally substituted 3-20 membered heterocyclyl or heteroaryl group having 1-10 heteroatoms. In some embodiments, the negatively charged internucleotide bond comprises an optionally substituted 3-20 membered heterocyclyl or heteroaryl group having 1-10 heteroatoms, where at least one heteroatom is nitrogen. In some embodiments, such heterocyclyl or heteroaryl group is a 5-membered ring. In some embodiments, such heterocyclyl or heteroaryl group is a 6-membered ring.

[0228] In some embodiments, the negatively charged internucleotide bond comprises an optionally substituted 5-20 member heteroaryl group having 1-10 heteroatoms. In some embodiments, the negatively charged internucleotide bond comprises an optionally substituted 5-20 member heteroaryl group having 1-10 heteroatoms, with at least one heteroatom being nitrogen. In some embodiments, the negatively charged internucleotide bond comprises an optionally substituted 5-6 member heterocyclyl or heteroaryl group having 1-4 heteroatoms, with at least one heteroatom being nitrogen. In some embodiments, the negatively charged internucleotide bond comprises an optionally substituted 5 member heteroaryl group having 1-4 heteroatoms, with at least one heteroatom being nitrogen. In some embodiments, the heteroaryl group is directly bonded to the phosphate group. In some embodiments, the negatively charged internucleotide bond comprises an optionally substituted triazolyl group. In some embodiments, the negatively charged internucleotide bond comprises an unsubstituted triazolyl group, for example, [ka] Includes. In some embodiments, the non-negatively charged internucleotide bond is a substituted triazolyl group, for example, [ka] Includes.

[0229] In some embodiments, the negatively charged internucleotide bond comprises an optionally substituted 5-20 member heterocyclyl group having 1-10 heteroatoms. In some embodiments, the negatively charged internucleotide bond comprises an optionally substituted 5-20 member heterocyclyl group having 1-10 heteroatoms, with at least one heteroatom being nitrogen. In some embodiments, the negatively charged internucleotide bond comprises an optionally substituted 5-6 member heterocyclyl group having 1-4 heteroatoms, with at least one heteroatom being nitrogen. In some embodiments, the negatively charged internucleotide bond comprises an optionally substituted 5 member heteroc...

Claims

1. Oligonucleotides, wherein the oligonucleotide is [fl2r] (C) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (G) [n001]. [fl2r] (A) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (A) [n001]. m(A)p. [fl2r] (C) [Ssp]. [fl2r] (A) [Ssp]. m(G)[Ssp]. [fl2r] (U) [Ssp]. m(U)p. m(U)[Ssp]. [fl2r] (G) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (G) [n001]. [fl2r] (C) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (G), [fl2r] (G) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (U) [n001]. [fl2r] (C) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (G) [n001]. m(A)p. [fl2r] (C) [Ssp]. [fl2r] (A) [Ssp]. m(A)[Ssp]. [fl2r] (C) [Ssp]. m(A)p. m(G)[Ssp]. [fl2r] (U) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (G) [n001]. [fl2r] (C) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (G), [fl2r] (G) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (U) [n001]. [fl2r] (U) [Ssp]. [fl2r] (G) [Ssp]. [fl2r] (C) [n001]. m(C)p. [fl2r] (G) [Ssp]. [fl2r] (C) [Ssp]. m(U)[Ssp]. [fl2r] (G) [Ssp]. m(C)p. m(C)[Ssp]. [fl2r] (C) [Ssp]. [fl2r] (A) [Ssp]. [fl2r] (A) [Ssp]. [fl2r] (U) [n001]. [fl2r] (G) [Ssp]. [fl2r] (C) [Ssp]. [fl2r](C), [fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[n001].[fl2r](G)[Ssp].[fl2r](A)[Ssp].[fl2r](C)[n001].m(A)p.[fl2r](A)[Ssp].[fl2r](C)[Ssp].m(A)[Ssp].[fl2r](G)[Ssp].m(U)p.m(U)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[n001].[fl2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](U)、 [fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[n001].[fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](A)[n001].m(C)p.[fl2r](A)[Ssp].[fl2r](A)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp].m(G)p.m(U)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[n001].[fl2r](C)[Ssp].[fl2r](G)[Ssp].[fl2r](C)、 [fl2r](G)[n001].[fl2r](U)[Ssp].[fl2r](U)[n001].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001].m(A)p.[fl2r](C)[Ssp].[fl2r](A)[Ssp].m(A)[Ssp].[fl2r](C)[Ssp].m(A)p.m(G)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](G)、 [fl2r](U)[n001].[fl2r](U)[Ssp].[fl2r](C)[n001].[fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](A)[n001].m(C)p.[fl2r](A)[Ssp].[fl2r](A)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp].m(G)p.m(U)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[n001].[fl2r](C)[Ssp].[fl2r](G)[Ssp].[fl2r](C)、 [fl2r](U)[n001].[fl2r](C)[Ssp].[fl2r](U)[n001].[fl2r](G)[Ssp].[fl2r](A)[Ssp].[fl2r](C)[n001].m(A)p.[fl2r](A)[Ssp].[fl2r](C)[Ssp].m(A)[Ssp].[fl2r](G)[Ssp].m(U)p.m(U)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[n001].[fl2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](U)、 [fl2r](C)[n001].[fl2r](U)[Ssp].[fl2r](G)[n001].[fl2r](A)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001].m(A)p.[fl2r](C)[Ssp].[fl2r](A)[Ssp].m(G)[Ssp].[fl2r](U)[Ssp].m(U)p.m(U)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](G)[n001].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)、 [fl2r](G)[n001].[fl2r](U)[Ssp].[fl2r](U)[n001].[fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[n001].m(C)p.[fl2r](G)[Ssp].[fl2r](C)[Ssp].m(U)[Ssp].[fl2r](G)[Ssp].m(C)p.m(C)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[n001].[fl2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](C)、 [fl2r](G)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[n001].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001].m(A)p.[fl2r](C)[Ssp].[fl2r](A)[Ssp].m(A)[Ssp].[fl2r](C)[Ssp].m(A)p.m(G)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001].[fl2r](C)[Ssp].[fl2r](C)[n001].[fl2r](G)、 [fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[n001].[fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](A)[n001].m(C)p.[fl2r](A)[Ssp].[fl2r](A)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp].m(G)p.m(U)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[n001].[fl2r](C)[Ssp].[fl2r](G)[n001].[fl2r](C)、 [fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[n001].[fl2r](G)[Ssp].[fl2r](A)[Ssp].[fl2r](C)[n001].m(A)p.[fl2r](A)[Ssp].[fl2r](C)[Ssp].m(A)[Ssp].[fl2r](G)[Ssp].m(U)p.m(U)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[n001].[fl2r](G)[Ssp].[fl2r](C)[n001].[fl2r](U)、 [fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001].[fl2r](A)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001].m(A)p.[fl2r](C)[Ssp].[fl2r](A)[Ssp].m(G)[Ssp].[fl2r](U)[Ssp].m(U)p.m(U)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](G)[n001].[fl2r](C)[Ssp].[fl2r](U)[n001].[fl2r](G)、 [fl2r](G)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[n001].[fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[n001].m(C)p.[fl2r](G)[Ssp].[fl2r](C)[Ssp].m(U)[Ssp].[fl2r](G)[Ssp].m(C)p.m(C)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[n001].[fl2r](G)[Ssp].[fl2r](C)[n001].[fl2r](C)、 [fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[n001].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001].m(A)p.[fl2r](U)[Ssp].[fl2r](G)[Ssp].m(C)[Ssp].[fl2r](C)[Ssp].m(A)p.m(U)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001].[fl2r](G)[Ssp].[fl2r](A)[Ssp].[fl2r](G)、 [fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001].[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001].m(C)p.[fl2r](C)[Ssp].[fl2r](A)[Ssp].m(U)[Ssp].[fl2r](C)[Ssp].m(C)p.m(U)[Ssp].[fl2r](G)[Ssp].[fl2r](G)[Ssp].[fl2r](A)[Ssp].[fl2r](G)[n001].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](C)、 [fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001].m(U)p.[fl2r](C)[Ssp].[fl2r](C)[Ssp].m(U)[Ssp].[fl2r](G)[Ssp].m(G)p.m(A)[Ssp].[fl2r](G)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[n001].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)、 [fl2r](U)[n001].[fl2r](G)[Ssp].[fl2r](C)[n001].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001].m(A)p.[fl2r](U)[Ssp].[fl2r](G)[Ssp].m(C)[Ssp].[fl2r](C)[Ssp].m(A)p.m(U)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001].[fl2r](G)[Ssp].[fl2r](A)[Ssp].[fl2r](G)、 [fl2r](C)[n001].[fl2r](C)[Ssp].[fl2r](A)[n001].[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001].m(C)p.[fl2r](C)[Ssp].[fl2r](A)[Ssp].m(U)[Ssp].[fl2r](C)[Ssp].m(C)p.m(U)[Ssp].[fl2r](G)[Ssp].[fl2r](G)[Ssp].[fl2r](A)[Ssp].[fl2r](G)[n001].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](C)、 [fl2r](A)[n001].[fl2r](U)[Ssp].[fl2r](G)[n001].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001].m(U)p.[fl2r](C)[Ssp].[fl2r](C)[Ssp].m(U)[Ssp].[fl2r](G)[Ssp].m(G)p.m(A)[Ssp].[fl2r](G)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[n001].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)、 [fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[n001].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001].m(A)p.[fl2r](U)[Ssp].[fl2r](G)[Ssp].m(C)[Ssp].[fl2r](C)[Ssp].m(A)p.m(U)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001].[fl2r](G)[Ssp].[fl2r](A)[n001].[fl2r](G)、 [fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001].[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001].m(C)p.[fl2r](C)[Ssp].[fl2r](A)[Ssp].m(U)[Ssp].[fl2r](C)[Ssp].m(C)p.m(U)[Ssp].[fl2r](G)[Ssp].[fl2r](G)[Ssp].[fl2r](A)[Ssp].[fl2r](G)[n001].[fl2r](U)[Ssp].[fl2r](U)[n001].[fl2r](C)、 [fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001].m(U)p.[fl2r](C)[Ssp].[fl2r](C)[Ssp].m(U)[Ssp].[fl2r](G)[Ssp].m(G)p.m(A)[Ssp].[fl2r](G)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[n001].[fl2r](C)[Ssp].[fl2r](U)[n001].[fl2r](G)、 [fl2r](G)[n001R].[fl2r](U)[Ssp].[fl2r](U)[n001R].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001R].m(A)p.[fl2r](C)[Ssp].[fl2r](A)[Ssp].m(A)[Ssp].[fl2r](C)[Ssp].m(A)p.m(G)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001R].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](G)、 [fl2r](C)[n001R].[fl2r](U)[Ssp].[fl2r](G)[n001R].[fl2r](A)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001R].m(A)p.[fl2r](C)[Ssp].[fl2r](A)[Ssp].m(G)[Ssp].[fl2r](U)[Ssp].m(U)p.m(U)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](G)[n001R].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)、 [fl2r](G)[n001R].[fl2r](U)[Ssp].[fl2r](U)[n001R].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001R].m(A)p.[fl2r](C)[Ssp].[fl2r](A)[Ssp].m(A)[Ssp].[fl2r](C)[Ssp].m(A)p.m(G)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001R].[fl2r](C)[Ssp].[fl2r](C)[Ssp].m(G)、 [fl2r](C)[n001R].[fl2r](U)[Ssp].[fl2r](G)[n001R].[fl2r](A)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001R].m(A)p.[fl2r](C)[Ssp].[fl2r](A)[Ssp].m(G)[Ssp].[fl2r](U)[Ssp].m(U)p.m(U)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](G)[n001R].[fl2r](C)[Ssp].[fl2r](U)[Ssp].m(G)、 [fl2r](U)[n001R].[fl2r](G)[Ssp].[fl2r](C)[n001R].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001R].m(A)p.[fl2r](U)[Ssp].[fl2r](G)[Ssp].m(C)[Ssp].[fl2r](C)[Ssp].m(A)p.m(U)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001R].[fl2r](G)[Ssp].[fl2r](A)[Ssp].m(G)、 [fl2r](A)[n001R].[fl2r](U)[Ssp].[fl2r](G)[n001R].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001R].m(U)p.[fl2r](C)[Ssp].[fl2r](C)[Ssp].m(U)[Ssp].[fl2r](G)[Ssp].m(G)p.m(A)[Ssp].[fl2r](G)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[n001R].[fl2r](C)[Ssp].[fl2r](U)[Ssp].m(G)、 m(G)[n001R].[fl2r](U)[Ssp].[fl2r](U)[n001R].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001R].m(A)p.[fl2r](C)[Ssp].[fl2r](A)[Ssp].m(A)[Ssp].[fl2r](C)[Ssp].m(A)p.m(G)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001R].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](G)、 m(C)[n001R].[fl2r](U)[Ssp].[fl2r](G)[n001R].[fl2r](A)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001R].m(A)p.[fl2r](C)[Ssp].[fl2r](A)[Ssp].m(G)[Ssp].[fl2r](U)[Ssp].m(U)p.m(U)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](G)[n001R].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)、 m(U)[n001R].[fl2r](G)[Ssp].[fl2r](C)[n001R].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001R].m(A)p.[fl2r](U)[Ssp].[fl2r](G)[Ssp].m(C)[Ssp].[fl2r](C)[Ssp].m(A)p.m(U)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001R].[fl2r](G)[Ssp].[fl2r](A)[Ssp].[fl2r](G)、 m(A)[n001R].[fl2r](U)[Ssp].[fl2r](G)[n001R].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001R].m(U)p.[fl2r](C)[Ssp].[fl2r](C)[Ssp].m(U)[Ssp].[fl2r](G)[Ssp].m(G)p.m(A)[Ssp].[fl2r](G)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[n001R].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)、 m(G)[n001R].[fl2r](U)[Ssp].[fl2r](U)[n001R].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001R].m(A)p.[fl2r](C)[Ssp].[fl2r](A)[Ssp].m(A)[Ssp].[fl2r](C)[Ssp].m(A)p.m(G)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001R].[fl2r](C)[Ssp].[fl2r](C)[Ssp].m(G)、 m(C)[n001R].[fl2r](U)[Ssp].[fl2r](G)[n001R].[fl2r](A)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001R].m(A)p.[fl2r](C)[Ssp].[fl2r](A)[Ssp].m(G)[Ssp].[fl2r](U)[Ssp].m(U)p.m(U)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](G)[n001R].[fl2r](C)[Ssp].[fl2r](U)[Ssp].m(G)、 m(U)[n001R].[fl2r](G)[Ssp].[fl2r](C)[n001R].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001R].m(A)p.[fl2r](U)[Ssp].[fl2r](G)[Ssp].m(C)[Ssp].[fl2r](C)[Ssp].m(A)p.m(U)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001R].[fl2r](G)[Ssp].[fl2r](A)[Ssp].m(G)、 m(A)[n001R].[fl2r](U)[Ssp].[fl2r](G)[n001R].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001R].m(U)p.[fl2r](C)[Ssp].[fl2r](C)[Ssp].m(U)[Ssp].[fl2r](G)[Ssp].m(G)p.m(A)[Ssp].[fl2r](G)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[n001R].[fl2r](C)[Ssp].[fl2r](U)[Ssp].m(G)、 [fl2r](U)[n001R].[fl2r](G)[Ssp].[fl2r](C)[n001R].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001R].m(A)p.[fl2r](U)[Ssp].[fl2r](G)[Ssp].m(C)[Ssp].[fl2r](C)[Ssp].m(A)p.m(U)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001R].[fl2r](G)[Ssp].[fl2r](A)[Ssp].[fl2r](G)、 [fl2r](A)[n001R].[fl2r](U)[Ssp].[fl2r](G)[n001R].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001R].m(U)p.[fl2r](C)[Ssp].[fl2r](C)[Ssp].m(U)[Ssp].[fl2r](G)[Ssp].m(G)p.m(A)[Ssp].[fl2r](G)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[n001R].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)、 [fl2r](G)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[n001R].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001R].m(A)p.[fl2r](C)[Ssp].[fl2r](A)[Ssp].m(A)[Ssp].[fl2r](C)[Ssp].m(A)p.m(G)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001R].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](G)、 [fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001R].[fl2r](A)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001R].m(A)p.[fl2r](C)[Ssp].[fl2r](A)[Ssp].m(G)[Ssp].[fl2r](U)[Ssp].m(U)p.m(U)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](G)[n001R].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)、 [fl2r] (U) [Ssp]. [fl2r] (G) [Ssp]. [fl2r] (C) [n001R]. [fl2r] (C) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (A) [n001R]. m(A)p. [fl2r] (U) [Ssp]. [fl2r] (G) [Ssp]. m(C)[Ssp]. [fl2r] (C) [Ssp]. m(A)p. m(U)[Ssp]. [fl2r] (C) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (G) [n001R]. [fl2r](G)[Ssp]. [fl2r](A)[Ssp]. [fl2r](G), and [fl2r] (A) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (G) [n001R]. [fl2r] (C) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (A) [n001R]. m(U)p. [fl2r] (C) [Ssp]. [fl2r] (C) [Ssp]. m(U)[Ssp]. [fl2r] (G) [Ssp]. m(G)p. m(A)[Ssp]. [fl2r] (G) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (C) [n001R]. [fl2r](C)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G), or selected from their salts, in the formula, [fl2r] represents a 2'-F modified nucleoside, m represents a nucleoside modified with 2'-OMe, p represents a phosphodiester, [Ssp] represents a phosphorothioate in the Sp configuration. [n001] is 【Chemistry 1】 This represents, An oligonucleotide in which [n001R] represents [n001] and phosphorus is in the Rp configuration.

2. The oligonucleotides are [fl2r](C)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G)[n001]. [fl2r](A)[Ssp]. [fl2r](C)[Ssp]. [fl2r](A)[n001]. m(A)p. [fl2r](C)[Ssp]. [fl2r](A)[Ssp]. m(G)[Ssp]. [fl2r](U)[Ssp]. m(U)p. m(U)[Ssp]. [fl2r](G)[Ssp]. [fl2r](C)[Ssp]. [fl2r](C)[Ssp]. [fl2r](G)[n001]. The oligonucleotide according to claim 1, which is [fl2r](C)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G), or a salt thereof.

3. The oligonucleotides are [fl2r](G)[Ssp]. [fl2r](U)[Ssp]. [fl2r](U)[n001]. [fl2r](C)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G)[n001]. m(A)p. [fl2r](C)[Ssp]. [fl2r](A)[Ssp]. m(A)[Ssp]. [fl2r](C)[Ssp]. m(A)p. m(G)[Ssp]. [fl2r](U)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G)[n001]. The oligonucleotide according to claim 1, which is [fl2r](C)[Ssp]. [fl2r](C)[Ssp]. [fl2r](G), or a salt thereof.

4. The oligonucleotides are [fl2r](G)[Ssp]. [fl2r](U)[Ssp]. [fl2r](U)[n001]. [fl2r](U)[Ssp]. [fl2r](G)[Ssp]. [fl2r](C)[n001]. m(C)p. [fl2r](G)[Ssp]. [fl2r](C)[Ssp]. m(U)[Ssp]. [fl2r](G)[Ssp]. m(C)p. m(C)[Ssp]. [fl2r](C)[Ssp]. [fl2r](A)[Ssp]. [fl2r](A)[Ssp]. [fl2r](U)[n001]. The oligonucleotide according to claim 1, which is [fl2r](G)[Ssp]. [fl2r](C)[Ssp]. [fl2r](C), or a salt thereof.

5. The oligonucleotides are [fl2r](U)[Ssp]. [fl2r](C)[Ssp]. [fl2r](U)[n001]. [fl2r](G)[Ssp]. [fl2r](A)[Ssp]. [fl2r](C)[n001]. m(A)p. [fl2r](A)[Ssp]. [fl2r](C)[Ssp]. m(A)[Ssp]. [fl2r](G)[Ssp]. m(U)p. m(U)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G)[Ssp]. [fl2r](C)[Ssp]. [fl2r](C)[n001]. The oligonucleotide according to claim 1, which is [fl2r](G)[Ssp]. [fl2r](C)[Ssp]. [fl2r](U), or a salt thereof.

6. The oligonucleotides are [fl2r](U)[Ssp]. [fl2r](U)[Ssp]. [fl2r](C)[n001]. [fl2r](U)[Ssp]. [fl2r](G)[Ssp]. [fl2r](A)[n001]. m(C)p. [fl2r](A)[Ssp]. [fl2r](A)[Ssp]. m(C)[Ssp]. [fl2r](A)[Ssp]. m(G)p. m(U)[Ssp]. [fl2r](U)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G)[Ssp]. [fl2r](C)[n001]. The oligonucleotide according to claim 1, which is [fl2r](C)[Ssp]. [fl2r](G)[Ssp]. [fl2r](C), or a salt thereof.

7. The oligonucleotides are [fl2r](G)[n001]. [fl2r](U)[Ssp]. [fl2r](U)[n001]. [fl2r](C)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G)[n001]. m(A)p. [fl2r](C)[Ssp]. [fl2r](A)[Ssp]. m(A)[Ssp]. [fl2r](C)[Ssp]. m(A)p. m(G)[Ssp]. [fl2r](U)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G)[n001]. The oligonucleotide according to claim 1, which is [fl2r](C)[Ssp]. [fl2r](C)[Ssp]. [fl2r](G), or a salt thereof.

8. The oligonucleotides are [fl2r](U)[n001]. [fl2r](U)[Ssp]. [fl2r](C)[n001]. [fl2r](U)[Ssp]. [fl2r](G)[Ssp]. [fl2r](A)[n001]. m(C)p. [fl2r](A)[Ssp]. [fl2r](A)[Ssp]. m(C)[Ssp]. [fl2r](A)[Ssp]. m(G)p. m(U)[Ssp]. [fl2r](U)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G)[Ssp]. [fl2r](C)[n001]. The oligonucleotide according to claim 1, which is [fl2r](C)[Ssp]. [fl2r](G)[Ssp]. [fl2r](C), or a salt thereof.

9. The oligonucleotides are [fl2r](U)[n001]. [fl2r](C)[Ssp]. [fl2r](U)[n001]. [fl2r](G)[Ssp]. [fl2r](A)[Ssp]. [fl2r](C)[n001]. m(A)p. [fl2r](A)[Ssp]. [fl2r](C)[Ssp]. m(A)[Ssp]. [fl2r](G)[Ssp]. m(U)p. m(U)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G)[Ssp]. [fl2r](C)[Ssp]. [fl2r](C)[n001]. The oligonucleotide according to claim 1, which is [fl2r](G)[Ssp]. [fl2r](C)[Ssp]. [fl2r](U), or a salt thereof.

10. The oligonucleotides are [fl2r](C)[n001]. [fl2r](U)[Ssp]. [fl2r](G)[n001]. [fl2r](A)[Ssp]. [fl2r](C)[Ssp]. [fl2r](A)[n001]. m(A)p. [fl2r](C)[Ssp]. [fl2r](A)[Ssp]. m(G)[Ssp]. [fl2r](U)[Ssp]. m(U)p. m(U)[Ssp]. [fl2r](G)[Ssp]. [fl2r](C)[Ssp]. [fl2r](C)[Ssp]. [fl2r](G)[n001]. The oligonucleotide according to claim 1, which is [fl2r](C)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G), or a salt thereof.

11. The oligonucleotides are [fl2r](G)[n001]. [fl2r](U)[Ssp]. [fl2r](U)[n001]. [fl2r](U)[Ssp]. [fl2r](G)[Ssp]. [fl2r](C)[n001]. m(C)p. [fl2r](G)[Ssp]. [fl2r](C)[Ssp]. m(U)[Ssp]. [fl2r](G)[Ssp]. m(C)p. m(C)[Ssp]. [fl2r](C)[Ssp]. [fl2r](A)[Ssp]. [fl2r](A)[Ssp]. [fl2r](U)[n001]. The oligonucleotide according to claim 1, which is [fl2r](G)[Ssp]. [fl2r](C)[Ssp]. [fl2r](C), or a salt thereof.

12. The oligonucleotides are [fl2r](G)[Ssp]. [fl2r](U)[Ssp]. [fl2r](U)[n001]. [fl2r](C)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G)[n001]. m(A)p. [fl2r](C)[Ssp]. [fl2r](A)[Ssp]. m(A)[Ssp]. [fl2r](C)[Ssp]. m(A)p. m(G)[Ssp]. [fl2r](U)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G)[n001]. The oligonucleotide according to claim 1, which is [fl2r](C)[Ssp], [fl2r](C)[n001], [fl2r](G), or a salt thereof.

13. The oligonucleotides are [fl2r](U)[Ssp]. [fl2r](U)[Ssp]. [fl2r](C)[n001]. [fl2r](U)[Ssp]. [fl2r](G)[Ssp]. [fl2r](A)[n001]. m(C)p. [fl2r](A)[Ssp]. [fl2r](A)[Ssp]. m(C)[Ssp]. [fl2r](A)[Ssp]. m(G)p. m(U)[Ssp]. [fl2r](U)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G)[Ssp]. [fl2r](C)[n001]. The oligonucleotide according to claim 1, wherein [fl2r](C)[Ssp]. [fl2r](G)[n001]. [fl2r](C), or a salt thereof.

14. The oligonucleotides are [fl2r](U)[Ssp]. [fl2r](C)[Ssp]. [fl2r](U)[n001]. [fl2r](G)[Ssp]. [fl2r](A)[Ssp]. [fl2r](C)[n001]. m(A)p. [fl2r](A)[Ssp]. [fl2r](C)[Ssp]. m(A)[Ssp]. [fl2r](G)[Ssp]. m(U)p. m(U)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G)[Ssp]. [fl2r](C)[Ssp]. [fl2r](C)[n001]. The oligonucleotide according to claim 1, which is [fl2r](G)[Ssp], [fl2r](C)[n001], [fl2r](U), or a salt thereof.

15. The oligonucleotides are [fl2r](C)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G)[n001]. [fl2r](A)[Ssp]. [fl2r](C)[Ssp]. [fl2r](A)[n001]. m(A)p. [fl2r](C)[Ssp]. [fl2r](A)[Ssp]. m(G)[Ssp]. [fl2r](U)[Ssp]. m(U)p. m(U)[Ssp]. [fl2r](G)[Ssp]. [fl2r](C)[Ssp]. [fl2r](C)[Ssp]. [fl2r](G)[n001]. The oligonucleotide according to claim 1, which is [fl2r](C)[Ssp], [fl2r](U)[n001], [fl2r](G), or a salt thereof.

16. The oligonucleotides are [fl2r](G)[Ssp]. [fl2r](U)[Ssp]. [fl2r](U)[n001]. [fl2r](U)[Ssp]. [fl2r](G)[Ssp]. [fl2r](C)[n001]. m(C)p. [fl2r](G)[Ssp]. [fl2r](C)[Ssp]. m(U)[Ssp]. [fl2r](G)[Ssp]. m(C)p. m(C)[Ssp]. [fl2r](C)[Ssp]. [fl2r](A)[Ssp]. [fl2r](A)[Ssp]. [fl2r](U)[n001]. The oligonucleotide according to claim 1, wherein [fl2r](G)[Ssp]. [fl2r](C)[n001]. [fl2r](C), or a salt thereof.

17. The oligonucleotides are [fl2r](U)[Ssp]. [fl2r](G)[Ssp]. [fl2r](C)[n001]. [fl2r](C)[Ssp]. [fl2r](C)[Ssp]. [fl2r](A)[n001]. m(A)p. [fl2r](U)[Ssp]. [fl2r](G)[Ssp]. m(C)[Ssp]. [fl2r](C)[Ssp]. m(A)p. m(U)[Ssp]. [fl2r](C)[Ssp]. [fl2r](C)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G)[n001]. The oligonucleotide according to claim 1, which is [fl2r](G)[Ssp]. [fl2r](A)[Ssp]. [fl2r](G), or a salt thereof.

18. The oligonucleotides are [fl2r](C)[Ssp]. [fl2r](C)[Ssp]. [fl2r](A)[n001]. [fl2r](A)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G)[n001]. m(C)p. [fl2r](C)[Ssp]. [fl2r](A)[Ssp]. m(U)[Ssp]. [fl2r](C)[Ssp]. m(C)p. m(U)[Ssp]. [fl2r](G)[Ssp]. [fl2r](G)[Ssp]. [fl2r](A)[Ssp]. [fl2r](G)[n001]. The oligonucleotide according to claim 1, wherein [fl2r](U)[Ssp]. [fl2r](U)[Ssp]. [fl2r](C), or a salt thereof.

19. The oligonucleotides are [fl2r](A)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G)[n001]. [fl2r](C)[Ssp]. [fl2r](C)[Ssp]. [fl2r](A)[n001]. m(U)p. [fl2r](C)[Ssp]. [fl2r](C)[Ssp]. m(U)[Ssp]. [fl2r](G)[Ssp]. m(G)p. m(A)[Ssp]. [fl2r](G)[Ssp]. [fl2r](U)[Ssp]. [fl2r](U)[Ssp]. [fl2r](C)[n001]. The oligonucleotide according to claim 1, which is [fl2r](C)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G), or a salt thereof.

20. The oligonucleotides are [fl2r](U)[n001]. [fl2r](G)[Ssp]. [fl2r](C)[n001]. [fl2r](C)[Ssp]. [fl2r](C)[Ssp]. [fl2r](A)[n001]. m(A)p. [fl2r](U)[Ssp]. [fl2r](G)[Ssp]. m(C)[Ssp]. [fl2r](C)[Ssp]. m(A)p. m(U)[Ssp]. [fl2r](C)[Ssp]. [fl2r](C)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G)[n001]. The oligonucleotide according to claim 1, which is [fl2r](G)[Ssp]. [fl2r](A)[Ssp]. [fl2r](G), or a salt thereof.

21. The oligonucleotides are [fl2r](C)[n001]. [fl2r](C)[Ssp]. [fl2r](A)[n001]. [fl2r](A)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G)[n001]. m(C)p. [fl2r](C)[Ssp]. [fl2r](A)[Ssp]. m(U)[Ssp]. [fl2r](C)[Ssp]. m(C)p. m(U)[Ssp]. [fl2r](G)[Ssp]. [fl2r](G)[Ssp]. [fl2r](A)[Ssp]. [fl2r](G)[n001]. The oligonucleotide according to claim 1, wherein [fl2r](U)[Ssp]. [fl2r](U)[Ssp]. [fl2r](C), or a salt thereof.

22. The oligonucleotides are [fl2r](A)[n001]. [fl2r](U)[Ssp]. [fl2r](G)[n001]. [fl2r](C)[Ssp]. [fl2r](C)[Ssp]. [fl2r](A)[n001]. m(U)p. [fl2r](C)[Ssp]. [fl2r](C)[Ssp]. m(U)[Ssp]. [fl2r](G)[Ssp]. m(G)p. m(A)[Ssp]. [fl2r](G)[Ssp]. [fl2r](U)[Ssp]. [fl2r](U)[Ssp]. [fl2r](C)[n001]. The oligonucleotide according to claim 1, which is [fl2r](C)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G), or a salt thereof.

23. The oligonucleotides are [fl2r](U)[Ssp]. [fl2r](G)[Ssp]. [fl2r](C)[n001]. [fl2r](C)[Ssp]. [fl2r](C)[Ssp]. [fl2r](A)[n001]. m(A)p. [fl2r](U)[Ssp]. [fl2r](G)[Ssp]. m(C)[Ssp]. [fl2r](C)[Ssp]. m(A)p. m(U)[Ssp]. [fl2r](C)[Ssp]. [fl2r](C)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G)[n001]. The oligonucleotide according to claim 1, which is [fl2r](G)[Ssp], [fl2r](A)[n001], [fl2r](G), or a salt thereof.

24. The oligonucleotides are [fl2r](C)[Ssp]. [fl2r](C)[Ssp]. [fl2r](A)[n001]. [fl2r](A)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G)[n001]. m(C)p. [fl2r](C)[Ssp]. [fl2r](A)[Ssp]. m(U)[Ssp]. [fl2r](C)[Ssp]. m(C)p. m(U)[Ssp]. [fl2r](G)[Ssp]. [fl2r](G)[Ssp]. [fl2r](A)[Ssp]. [fl2r](G)[n001]. The oligonucleotide according to claim 1, wherein [fl2r](U)[Ssp], [fl2r](U)[n001], [fl2r](C), or a salt thereof.

25. The oligonucleotides are [fl2r](A)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G)[n001]. [fl2r](C)[Ssp]. [fl2r](C)[Ssp]. [fl2r](A)[n001]. m(U)p. [fl2r](C)[Ssp]. [fl2r](C)[Ssp]. m(U)[Ssp]. [fl2r](G)[Ssp]. m(G)p. m(A)[Ssp]. [fl2r](G)[Ssp]. [fl2r](U)[Ssp]. [fl2r](U)[Ssp]. [fl2r](C)[n001]. The oligonucleotide according to claim 1, which is [fl2r](C)[Ssp], [fl2r](U)[n001], [fl2r](G), or a salt thereof.

26. The oligonucleotides are [fl2r](G)[n001R], [fl2r](U)[Ssp], [fl2r](U)[n001R], [fl2r](C)[Ssp], [fl2r](U)[Ssp], [fl2r](G)[n001R], m(A)p, [fl2r](C)[Ssp], [fl2r](A)[Ssp], m(A)[Ssp], [fl2r](C)[Ssp], m(A)p, m(G)[Ssp], [fl2r](U)[Ssp], [fl2r](U)[Ssp], [fl2r](G)[n001R]. The oligonucleotide according to claim 1, which is [fl2r](C)[Ssp]. [fl2r](C)[Ssp]. [fl2r](G), or a salt thereof.

27. The oligonucleotides are [fl2r](C)[n001R], [fl2r](U)[Ssp], [fl2r](G)[n001R], [fl2r](A)[Ssp], [fl2r](C)[Ssp], [fl2r](A)[n001R], m(A)p, [fl2r](C)[Ssp], [fl2r](A)[Ssp], m(G)[Ssp], [fl2r](U)[Ssp], m(U)p, m(U)[Ssp], [fl2r](G)[Ssp], [fl2r](C)[Ssp], [fl2r](C)[Ssp], [fl2r](G)[n001R]. The oligonucleotide according to claim 1, which is [fl2r](C)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G), or a salt thereof.

28. The oligonucleotides are [fl2r](G)[n001R], [fl2r](U)[Ssp], [fl2r](U)[n001R], [fl2r](C)[Ssp], [fl2r](U)[Ssp], [fl2r](G)[n001R], m(A)p, [fl2r](C)[Ssp], [fl2r](A)[Ssp], m(A)[Ssp], [fl2r](C)[Ssp], m(A)p, m(G)[Ssp], [fl2r](U)[Ssp], [fl2r](U)[Ssp], [fl2r](G)[n001R]. The oligonucleotide according to claim 1, which is [fl2r](C)[Ssp].[fl2r](C)[Ssp].m(G), or a salt thereof.

29. The oligonucleotides are [fl2r](C)[n001R], [fl2r](U)[Ssp], [fl2r](G)[n001R], [fl2r](A)[Ssp], [fl2r](C)[Ssp], [fl2r](A)[n001R], m(A)p, [fl2r](C)[Ssp], [fl2r](A)[Ssp], m(G)[Ssp], [fl2r](U)[Ssp], m(U)p, m(U)[Ssp], [fl2r](G)[Ssp], [fl2r](C)[Ssp], [fl2r](C)[Ssp], [fl2r](G)[n001R]. The oligonucleotide according to claim 1, which is [fl2r](C)[Ssp].[fl2r](U)[Ssp].m(G), or a salt thereof.

30. The oligonucleotides are [fl2r](U)[n001R], [fl2r](G)[Ssp], [fl2r](C)[n001R], [fl2r](C)[Ssp], [fl2r](C)[Ssp], [fl2r](A)[n001R], m(A)p, [fl2r](U)[Ssp], [fl2r](G)[Ssp], m(C)[Ssp], [fl2r](C)[Ssp], m(A)p, m(U)[Ssp], [fl2r](C)[Ssp], [fl2r](U)[Ssp], [fl2r](G)[n001R]. The oligonucleotide according to claim 1, which is [fl2r](G)[Ssp]. [fl2r](A)[Ssp]. m(G), or a salt thereof.

31. The oligonucleotides are [fl2r](A)[n001R], [fl2r](U)[Ssp], [fl2r](G)[n001R], [fl2r](C)[Ssp], [fl2r](C)[Ssp], [fl2r](A)[n001R], m(U)p, [fl2r](C)[Ssp], [fl2r](C)[Ssp], m(U)[Ssp], [fl2r](G)[Ssp], m(G)p, m(A)[Ssp], [fl2r](G)[Ssp], [fl2r](U)[Ssp], [fl2r](U)[Ssp], [fl2r](C)[n001R]. The oligonucleotide according to claim 1, which is [fl2r](C)[Ssp].[fl2r](U)[Ssp].m(G), or a salt thereof.

32. The oligonucleotides are m(G)[n001R]. [fl2r](U)[Ssp]. [fl2r](U)[n001R]. [fl2r](C)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G)[n001R]. m(A)p. [fl2r](C)[Ssp]. [fl2r](A)[Ssp]. m(A)[Ssp]. [fl2r](C)[Ssp]. m(A)p. m(G)[Ssp]. [fl2r](U)[Ssp]. [fl2r](U)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G)[n001R]. The oligonucleotide according to claim 1, which is [fl2r](C)[Ssp]. [fl2r](C)[Ssp]. [fl2r](G), or a salt thereof.

33. The oligonucleotides are m(C)[n001R]. [fl2r](U)[Ssp]. [fl2r](G)[n001R]. [fl2r](A)[Ssp]. [fl2r](C)[Ssp]. [fl2r](A)[n001R]. m(A)p. [fl2r](C)[Ssp]. [fl2r](A)[Ssp]. m(G)[Ssp]. [fl2r](U)[Ssp]. m(U)p. m(U)[Ssp]. [fl2r](G)[Ssp]. [fl2r](C)[Ssp]. [fl2r](C)[Ssp]. [fl2r](G)[n001R]. The oligonucleotide according to claim 1, which is [fl2r](C)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G), or a salt thereof.

34. The oligonucleotides are m(U)[n001R]. [fl2r](G)[Ssp]. [fl2r](C)[n001R]. [fl2r](C)[Ssp]. [fl2r](C)[Ssp]. [fl2r](A)[n001R]. m(A)p. [fl2r](U)[Ssp]. [fl2r](G)[Ssp]. m(C)[Ssp]. [fl2r](C)[Ssp]. m(A)p. m(U)[Ssp]. [fl2r](C)[Ssp]. [fl2r](C)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G)[n001R]. The oligonucleotide according to claim 1, which is [fl2r](G)[Ssp]. [fl2r](A)[Ssp]. [fl2r](G), or a salt thereof.

35. The oligonucleotide is m(A)[n001R]. [fl2r](U)[Ssp]. [fl2r](G)[n001R]. [fl2r](C)[Ssp]. [fl2r](C)[Ssp]. [fl2r](A)[n001R]. m(U)p. [fl2r](C)[Ssp]. [fl2r](C)[Ssp]. m(U)[Ssp]. [fl2r](G)[Ssp]. m(G)p. m(A)[Ssp]. [fl2r](G)[Ssp]. [fl2r](U)[Ssp]. [fl2r](U)[Ssp]. [fl2r](C)[n001R]. The oligonucleotide according to claim 1, which is [fl2r](C)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G), or a salt thereof.

36. The oligonucleotides are m(G)[n001R]. [fl2r](U)[Ssp]. [fl2r](U)[n001R]. [fl2r](C)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G)[n001R]. m(A)p. [fl2r](C)[Ssp]. [fl2r](A)[Ssp]. m(A)[Ssp]. [fl2r](C)[Ssp]. m(A)p. m(G)[Ssp]. [fl2r](U)[Ssp]. [fl2r](U)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G)[n001R]. The oligonucleotide according to claim 1, which is [fl2r](C)[Ssp].[fl2r](C)[Ssp].m(G), or a salt thereof.

37. The oligonucleotides are m(C)[n001R]. [fl2r](U)[Ssp]. [fl2r](G)[n001R]. [fl2r](A)[Ssp]. [fl2r](C)[Ssp]. [fl2r](A)[n001R]. m(A)p. [fl2r](C)[Ssp]. [fl2r](A)[Ssp]. m(G)[Ssp]. [fl2r](U)[Ssp]. m(U)p. m(U)[Ssp]. [fl2r](G)[Ssp]. [fl2r](C)[Ssp]. [fl2r](C)[Ssp]. [fl2r](G)[n001R]. The oligonucleotide according to claim 1, which is [fl2r](C)[Ssp].[fl2r](U)[Ssp].m(G), or a salt thereof.

38. The oligonucleotides are m(U)[n001R]. [fl2r](G)[Ssp]. [fl2r](C)[n001R]. [fl2r](C)[Ssp]. [fl2r](C)[Ssp]. [fl2r](A)[n001R]. m(A)p. [fl2r](U)[Ssp]. [fl2r](G)[Ssp]. m(C)[Ssp]. [fl2r](C)[Ssp]. m(A)p. m(U)[Ssp]. [fl2r](C)[Ssp]. [fl2r](C)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G)[n001R]. The oligonucleotide according to claim 1, which is [fl2r](G)[Ssp]. [fl2r](A)[Ssp]. m(G), or a salt thereof.

39. The oligonucleotide is m(A)[n001R]. [fl2r](U)[Ssp]. [fl2r](G)[n001R]. [fl2r](C)[Ssp]. [fl2r](C)[Ssp]. [fl2r](A)[n001R]. m(U)p. [fl2r](C)[Ssp]. [fl2r](C)[Ssp]. m(U)[Ssp]. [fl2r](G)[Ssp]. m(G)p. m(A)[Ssp]. [fl2r](G)[Ssp]. [fl2r](U)[Ssp]. [fl2r](U)[Ssp]. [fl2r](C)[n001R]. The oligonucleotide according to claim 1, which is [fl2r](C)[Ssp].[fl2r](U)[Ssp].m(G), or a salt thereof.

40. The oligonucleotides are [fl2r](U)[n001R], [fl2r](G)[Ssp], [fl2r](C)[n001R], [fl2r](C)[Ssp], [fl2r](C)[Ssp], [fl2r](A)[n001R], m(A)p, [fl2r](U)[Ssp], [fl2r](G)[Ssp], m(C)[Ssp], [fl2r](C)[Ssp], m(A)p, m(U)[Ssp], [fl2r](C)[Ssp], [fl2r](U)[Ssp], [fl2r](G)[n001R]. The oligonucleotide according to claim 1, which is [fl2r](G)[Ssp]. [fl2r](A)[Ssp]. [fl2r](G), or a salt thereof.

41. The oligonucleotides are [fl2r](A)[n001R], [fl2r](U)[Ssp], [fl2r](G)[n001R], [fl2r](C)[Ssp], [fl2r](C)[Ssp], [fl2r](A)[n001R], m(U)p, [fl2r](C)[Ssp], [fl2r](C)[Ssp], m(U)[Ssp], [fl2r](G)[Ssp], m(G)p, m(A)[Ssp], [fl2r](G)[Ssp], [fl2r](U)[Ssp], [fl2r](U)[Ssp], [fl2r](C)[n001R]. The oligonucleotide according to claim 1, which is [fl2r](C)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G), or a salt thereof.

42. The oligonucleotides are [fl2r](G)[Ssp], [fl2r](U)[Ssp], [fl2r](U)[n001R], [fl2r](C)[Ssp], [fl2r](U)[Ssp], [fl2r](G)[n001R], m(A)p, [fl2r](C)[Ssp], [fl2r](A)[Ssp], m(A)[Ssp], [fl2r](C)[Ssp], m(A)p, m(G)[Ssp], [fl2r](U)[Ssp], [fl2r](U)[Ssp], [fl2r](G)[n001R]. The oligonucleotide according to claim 1, which is [fl2r](C)[Ssp]. [fl2r](C)[Ssp]. [fl2r](G), or a salt thereof.

43. The oligonucleotides are [fl2r](C)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G)[n001R]. [fl2r](A)[Ssp]. [fl2r](C)[Ssp]. [fl2r](A)[n001R]. m(A)p. [fl2r](C)[Ssp]. [fl2r](A)[Ssp]. m(G)[Ssp]. [fl2r](U)[Ssp]. m(U)p. m(U)[Ssp]. [fl2r](G)[Ssp]. [fl2r](C)[Ssp]. [fl2r](C)[Ssp]. [fl2r](G)[n001R]. The oligonucleotide according to claim 1, which is [fl2r](C)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G), or a salt thereof.

44. The oligonucleotides are [fl2r](U)[Ssp]. [fl2r](G)[Ssp]. [fl2r](C)[n001R]. [fl2r](C)[Ssp]. [fl2r](C)[Ssp]. [fl2r](A)[n001R]. m(A)p. [fl2r](U)[Ssp]. [fl2r](G)[Ssp]. m(C)[Ssp]. [fl2r](C)[Ssp]. m(A)p. m(U)[Ssp]. [fl2r](C)[Ssp]. [fl2r](C)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G)[n001R]. The oligonucleotide according to claim 1, which is [fl2r](G)[Ssp]. [fl2r](A)[Ssp]. [fl2r](G), or a salt thereof.

45. The oligonucleotides are [fl2r](A)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G)[n001R]. [fl2r](C)[Ssp]. [fl2r](C)[Ssp]. [fl2r](A)[n001R]. m(U)p. [fl2r](C)[Ssp]. [fl2r](C)[Ssp]. m(U)[Ssp]. [fl2r](G)[Ssp]. m(G)p. m(A)[Ssp]. [fl2r](G)[Ssp]. [fl2r](U)[Ssp]. [fl2r](U)[Ssp]. [fl2r](C)[n001R]. The oligonucleotide according to claim 1, which is [fl2r](C)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G), or a salt thereof.

46. It is an oligonucleotide, The base sequence of the oligonucleotide contains 10 or more consecutive nucleic acid bases that are complementary to the DMD transcript, The oligonucleotide is an oligonucleotide containing three or more PN nucleotide interbonds.

47. The oligonucleotide according to claim 1, wherein the base sequence of the oligonucleotide comprises 15, 20 or more consecutive nucleic acid bases that complement the DMD transcript.

48. The oligonucleotide according to any one of the prior claims, wherein the base sequence of the oligonucleotide is the same as the equal-length portion in the complement of the DMD transcript.

49. It is an oligonucleotide, The base sequence of the oligonucleotide contains 10 or more consecutive nucleic acid bases that are complementary to equal-length portions in the DMD transcript. The oligonucleotide is an oligonucleotide containing three or more PN nucleotide interbonds.

50. The oligonucleotide according to claim 49, wherein the base sequence of the oligonucleotide comprises 15, 20 or more consecutive nucleic acid bases that are complementary to equal-length portions in the DMD transcript.

51. The oligonucleotide according to any one of the prior claims, wherein the base sequence of the oligonucleotide is complementary to the base sequence of a portion of equal length in the DMD transcript.

52. It is an oligonucleotide, The aforementioned oligonucleotide can hybridize to equal-length portions in the DMD transcript. The oligonucleotide is an oligonucleotide containing three or more PN nucleotide interbonds.

53. Oligonucleotides wherein the base sequence of the oligonucleotide comprises 15 or more consecutive nucleic acid bases of the complement of a DMD transcript, the oligonucleotide comprises 4 or more PN nucleotide interbonds, and the oligonucleotide comprises a PN nucleotide interbond between the 5' terminal (+1) nucleoside and the immediately downstream (+2) nucleoside, and / or a PN nucleotide interbond between the 3' terminal (N) nucleoside and the second-to-last (N-1) nucleoside.

54. The oligonucleotide according to claim 53, wherein the oligonucleotide includes a PN nucleotide bond between the 5'-terminal (+1) nucleoside and the immediately downstream (+2) nucleoside, and the oligonucleotide does not include a PN nucleotide bond between the 3'-terminal (N) nucleoside and the second-to-last (N-1) nucleoside.

55. The oligonucleotide according to claim 53 or 54, wherein the internucleotide bond between the 5'-terminal (+1) nucleoside and the immediately downstream (+2) nucleoside is in the Rp configuration.

56. The oligonucleotide according to any one of claims 53 to 55, wherein all of the PN nucleotide interbonds are in the Rp configuration.

57. The oligonucleotide according to any one of claims 53 to 56, wherein the oligonucleotide comprises only four internucleotide bonds of PN nucleotides.

58. The oligonucleotide according to any one of claims 53 to 57, wherein the (+1) nucleoside at the 5' terminus and / or the (N) nucleoside at the 3' terminus of the oligonucleotide comprises a modified sugar moiety, and optionally the modified sugar moiety comprises a 2'-OMe modification.

59. The oligonucleotide according to any one of claims 53 to 58, wherein the oligonucleotide includes a PN nucleotide bond between a +3 nucleoside and a +4 nucleoside, a PN nucleotide bond between a +6 nucleoside and a +7 nucleoside, and / or a PN nucleotide bond between a +17 nucleoside and a +18 nucleoside.

60. The oligonucleotide according to claim 59, wherein the PN nucleotide bond between the +3 nucleoside and the +4 nucleoside, the PN nucleotide bond between the +6 nucleoside and the +7 nucleoside, and / or the PN nucleotide bond between the +17 nucleoside and the +18 nucleoside are in the Rp configuration.

61. Oligonucleotides wherein the base sequence of the oligonucleotide includes 15 or more consecutive nucleic acid bases of the complement of the DMD transcript, and the oligonucleotide includes a PN nucleotide bond between the (+1) nucleoside at the 5' end of the Rp configuration and the (+2) nucleoside immediately downstream, a PN nucleotide bond between the +3 nucleoside and the +4 nucleoside of the Rp configuration, a PN nucleotide bond between the +6 nucleoside and the +7 nucleoside of the Rp configuration, and / or a PN nucleotide bond between the +17 nucleoside and the +18 nucleoside of the Rp configuration.

62. The oligonucleotide according to claim 61, wherein the sugar portion of the 5'-terminal (+1) nucleoside includes a 2'-OMe modification, or the sugar portion of the 5'-terminal (+1) nucleoside includes a 2'-F modification.

63. The oligonucleotides are PS bonds between the +2 nucleoside and the +3 nucleoside, PS bonds between the +4 nucleoside and the +5 nucleoside, PS bonds between the +5 nucleoside and the +6 nucleoside, PS bonds between the +8 nucleoside and the +9 nucleoside, PS bonds between the +9 nucleoside and the +10 nucleoside, PS bonds between the +10 nucleoside and the +11 nucleoside, and PS bonds between the +11 nucleoside and the +1 The oligonucleotide according to claim 61 or 62, comprising a PS bond between two nucleosides, a PS bond between a +13 nucleoside and a +14 nucleoside, a PS bond between the +14 nucleoside and a +15 nucleoside, a PS bond between the +15 nucleoside and a +16 nucleoside, a PS bond between the +16 nucleoside and a +17 nucleoside, and / or a PS bond between the +18 nucleoside and a +19 nucleoside.

64. The oligonucleotide according to claim 63, wherein the oligonucleotide includes a PS bond between the 3'-terminal (N) nucleoside and the second-to-last (N-1) nucleoside.

65. The oligonucleotide according to claim 63 or 64, wherein all of the PS bonds are in the Sp configuration.

66. The oligonucleotide according to any one of claims 61 to 65, wherein the sugar portion of the +7 nucleoside includes a 2'-OMe modification, the sugar portion of the +10 nucleoside includes a 2'-OMe modification, the sugar portion of the +12 nucleoside includes a 2'-OMe modification, and / or the sugar portion of the +13 nucleoside includes a 2'-OMe modification.

67. The oligonucleotide according to claim 66, wherein the sugar portion of the 3'-terminal (N) nucleoside includes a 2'-OMe modification, or the sugar portion of the 3'-terminal (N) nucleoside includes a 2'-F modification.

68. The oligonucleotide according to any one of the prior claims, wherein the DMD transcript is DMD mRNA, the DMD transcript or its wild-type version encodes dystrophin, and / or the DMD transcript contains a mutation that allows exon 45 skipping.

69. The oligonucleotide according to any one of the prior claims, wherein each nucleic acid base is independently substituted with a nucleic acid base of any choice selected from A, T, C, G, and U, or is a tautomer substituted with a nucleic acid base of any choice selected from A, T, C, G, and U, and optionally each nucleic acid base is independently A, T, C, 5mC, G, or U.

70. The oligonucleotide according to any one of the prior claims, wherein the length of the oligonucleotide is 20 or more nucleic acid bases, and optionally the length of the oligonucleotide is 20 nucleic acid bases.

71. The oligonucleotide according to any one of the prior claims, wherein the oligonucleotide comprises 4, 5, 6 or more PN nucleotide interbonds.

72. The oligonucleotide according to any one of the prior claims, wherein the oligonucleotide comprises RpPN nucleotide internucleotide bonds, and optionally, the oligonucleotide comprises 4, 5, 6 or more RpPN nucleotide internucleotide bonds.

73. The oligonucleotide according to any one of the prior claims, wherein each PN nucleotide bond is independently a phosphorylguanidine nucleotide bond.

74. The oligonucleotide according to any one of the prior claims, wherein the oligonucleotide comprises phosphorylguanidine nucleotide interbonding, and optionally comprises 4, 5, 6, or more phosphorylguanidine nucleotide interbonding.

75. The oligonucleotide according to any one of the prior claims, wherein the oligonucleotide comprises Rp phosphorylguanidine nucleotide internucleotide bonds, and optionally, the oligonucleotide comprises 4, 5, 6 or more Rp phosphorylguanidine nucleotide internucleotide bonds.

76. The oligonucleotide according to any one of the prior claims, wherein each phosphorylguanidine nucleotide bond is independently an n001 nucleotide bond.

77. The oligonucleotide according to any one of the prior claims, wherein the oligonucleotide comprises an n001 nucleotide bond, and optionally, the oligonucleotide comprises 4, 5, 6 or more n001 nucleotide bonds.

78. The oligonucleotide according to any one of the prior claims, wherein the oligonucleotide comprises an Rp n001 nucleotide internucleotide bond, and optionally, the oligonucleotide comprises 4, 5, 6 or more Rp n001 nucleotide internucleotide bonds.

79. The oligonucleotide according to any one of the prior claims, wherein each n001 is Rp, optionally each phosphorylguanidine nucleotide bond is Rp, and optionally each PN nucleotide bond is Rp.

80. The oligonucleotide according to any one of the prior claims, wherein the internucleotide bonds between the third nucleoside and the fourth nucleoside, between the sixth nucleoside and the seventh nucleoside, and / or between the seventeenth nucleoside and the eighteenth nucleoside are PN bonds (in the 5' to 3' direction unless otherwise specified).

81. The oligonucleotide according to any one of the prior claims, wherein the internucleotide bond between the first nucleoside and the second nucleoside is a PN bond, or the internucleotide bond between the last two nucleosides is a PN bond.

82. The oligonucleotide according to any one of the prior claims, wherein the number of Rp n001 nucleotide interbonds, the number of n001 nucleotide interbonds, the number of Rp phosphorylguanidine nucleotide interbonds, the number of phosphorylguanidine nucleotide interbonds, the number of Rp PN nucleotide interbonds, and / or the number of PN nucleotide interbonds in the oligonucleotide is 4.

83. The oligonucleotide according to claim 81, wherein the internucleotide bond between the last two nucleosides is a PN bond.

84. The oligonucleotide according to any one of the prior claims, wherein the oligonucleotide comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more PS nucleotide interbonds.

85. The oligonucleotide according to any one of the prior claims, wherein the oligonucleotide comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more SpPS nucleotide interbonds.

86. The oligonucleotide according to any one of the prior claims, wherein each PS nucleotide bond is Sp and / or each PS nucleotide bond is independently a phosphorothioate nucleotide bond.

87. The oligonucleotide according to any one of the prior claims, wherein the oligonucleotide comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more phosphorothioate nucleotide interbonds.

88. The oligonucleotide according to any one of the prior claims, wherein the oligonucleotide comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more Sp phosphorothioate nucleotide interbondings.

89. The oligonucleotide according to any one of the prior claims, wherein each phosphorothioate nucleotide bond is independently Sp.

90. The oligonucleotide according to any one of the prior claims, wherein the internucleotide bond between the first nucleoside and the second nucleoside is a PS internucleotide bond if it is not a PN bond, and / or the internucleotide bond between the last two nucleosides is a PS internucleotide bond if it is not a PN bond.

91. Between the second nucleoside and the third nucleoside, between the fourth nucleoside and the fifth nucleoside, between the fifth nucleoside and the sixth nucleoside, between the eighth nucleoside and the ninth nucleoside, between the ninth nucleoside and the tenth nucleoside, between the tenth nucleoside and the eleventh nucleoside, between the eleventh nucleoside and the twelfth nucleoside, the thirteenth nucleoside The oligonucleotide according to any one of the prior claims, wherein the internucleotide bonds between the rheoside and the 14th nucleoside, between the 14th nucleoside and the 15th nucleoside, between the 15th nucleoside and the 16th nucleoside, between the 16th nucleoside and the 17th nucleoside, and / or between the 18th nucleoside and the 19th nucleoside are PS internucleotide bonds.

92. The oligonucleotide according to any one of the prior claims, wherein the oligonucleotide comprises one, two, three, four, five or more PO nucleotide interbonds.

93. The oligonucleotide according to any one of the prior claims, wherein each internucleotide bond is independently a natural phosphate bond.

94. The oligonucleotide according to any one of the prior claims, wherein the oligonucleotide comprises one, two, three, four, five, or more natural phosphate nucleotide bonds.

95. The oligonucleotide according to any one of the prior claims, wherein the internucleotide bond between the seventh nucleoside and the eighth nucleoside is a PO internucleotide bond, and / or the internucleotide bond between the twelfth nucleoside and the thirteenth nucleoside is a PO internucleotide bond.

96. The oligonucleotide according to any one of the prior claims, wherein the oligonucleotide includes sugar modification.

97. The oligonucleotide according to any one of the prior claims, wherein the oligonucleotide comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more 2'-modified sugars.

98. The oligonucleotide according to any one of the prior claims, wherein the oligonucleotide comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more 2'-F modified sugars.

99. The oligonucleotide according to any one of the prior claims, wherein the sugar of nucleosides 2, 3, 4, 5, 6, 8, 9, 11, 14, 15, 16, 17, 18, and 19 is a 2'-F modified sugar, the sugar of nucleosides 2, 3, 4, 5, 6, 8, 9, 11, 14, 15, 16, 17, 18, 19, and 20 is a 2'-F modified sugar, the sugar of nucleosides 1, 2, 3, 4, 5, 6, 8, 9, 11, 14, 15, 16, 17, 18, and 19 is a 2'-F modified sugar, or the sugar of nucleosides 1, 2, 3, 4, 5, 6, 8, 9, 11, 14, 15, 16, 17, 18, 19, and 20 is a 2'-F modified sugar.

100. The oligonucleotide comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more 2'-OR modified sugars, wherein R is optionally substituted with C. １ ~C ６ An oligonucleotide according to any one of the prior claims, wherein the oligonucleotide is aliphatic.

101. The sugars of nucleosides 7, 10, 12, and 13 are independently 2'-OR modified sugars, the sugars of nucleosides 1, 7, 10, 12, and 13 are independently 2'-OR modified sugars, the sugars of nucleosides 1, 7, 10, 12, 13, and 20 are independently 2'-OR modified sugars, or the sugars of nucleosides 7, 10, 12, 13, and 20 are independently 2'-OR modified sugars, In the formula, R is replaced by C of any choice. １ ~C ６ An oligonucleotide according to any one of the prior claims, wherein the oligonucleotide is aliphatic.

102. The oligonucleotide according to any one of the prior claims, wherein the oligonucleotide comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more 2'-OMe modified sugars.

103. The oligonucleotide according to any one of the prior claims, wherein each 2'-OR modified sugar is a 2'-OMe modified sugar.

104. The oligonucleotide according to any one of the prior claims, wherein the oligonucleotide can hybridize to the region of the DMD transcript.

105. The oligonucleotide according to claim 104, wherein the region of the DMD transcript includes CGGCAAAACUGUUGUCAGAAC, GCGGCCAAAACUGUUGUCAGAA, AGCGGGCAAACUGUUGUCAGA, CAGCGGGCAAACUGUUGUCAGAG, GGCAAUUGGGGCAGCGGCAAAAAC, CUCCAGAUGGGCAUUGGGCCA, GAACUCCAGGGAAUGGGCAUUGG, or CAGGAACUCCAGGGAAUGGGCAU, each U being optionally and independently connected by T.

106. The oligonucleotide according to any one of the prior claims, wherein the base sequence comprises 10, 15, 20, or more consecutive nucleic acid bases complementary to 10 or more consecutive nucleic acid bases of the DMD transcript.

107. The oligonucleotide according to any one of claims 1 to 106, wherein the base sequence comprises 10, 15, 20 or more consecutive nucleic acid bases complementary to 10, 15, 20 or more consecutive nucleic acid bases of CGGCAAAACUGUUGUCACAGAA, AGCGGCAAAACUGUUGUCACAG, CAGCGGCAAAACUGUUGUCACAG, GGCAAUUGGGCAAGGGGCAAAAAC, CUCCAGAUUGGCAUUUGGGCA, GAACUCCAGGGAAUUGGCAUUUG, or CAGGAACUCCAGGGAAUUGGCAU, and each U is optionally and independently replaced with T.

108. The oligonucleotide according to any one of the prior claims, wherein the base sequence comprises 10 or more consecutive nucleic acid bases of GUUCUGACACAGUUUGGCCG, UUCUGACACAGUUUGGCGC, UCUGACAACAGUUUGCCGCCU, CUGACAACAGUUUGCCGCUG, GUUUGCCGCCUGCCCCAAUUGCC, UGCCCAAUUGCCCAAUCCUGGAG, CCAAUUGCCCAAUCCUGGAGUUC, or AUGCCAAUCCUGGAGUUCUG, and each U is optionally and independently replaced with T.

109. The oligonucleotide according to claim 108, wherein the base sequence comprises 15 or more consecutive nucleic acid bases of GUUCUGACACAGUUUGGCCG, UUCUGACACAGUUUGGCGC, UCUGACAACAGUUUGGCGCCU, CUGACAACAGUUUGGCGCUG, GUUUGCCGCCUGCCAAUUGCC, UGCCCAAUUGCCCAAUCCUGGAG, CCAAUUGCCCAAUCCUGGAGUUC, or AUGCCAAUCCUGGAGUUCUG, and each U is optionally and independently replaced with T.

110. The oligonucleotide according to claim 109, wherein the base sequence includes GUUCUGACACAGUUUGGCCG, UUCUGACACAGUUUGGCGC, UCUGACAACAGUUUGGCGCCU, CUGACAACAGUUUGGCGCUG, GUUUGCCGCCUGCCCCAAUUGCC, UGCCCAAUUGCCCAAUCCUGGAG, CCAAUUGCCCAAUCCUGGAGUUC, or AUGCCAAUCCUGGAGUUCG, and each T is optionally and independently supplemented with U.

111. The oligonucleotide according to claim 110, wherein the base sequence is GUUCUGACACAGUUUGGCCG, UUCUGACACAGUUUGGCGC, UCUGACAACAGUUUGGCGCCU, CUGACAACAGUUUGGCGCUG, GUUUGCCGCCUGCCCCAAUUGCC, UGCCCAAUUGCCCAAUCCUGGAG, CCAAAUUGCCCAAUCCUGGAGUUC, or AUGCCAAUCCUGGAGUUCCUG.

112. The oligonucleotide according to any one of the prior claims, wherein each chiral nucleotide bond of the oligonucleotide independently has a diastereomer purity of at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, and 99%.

113. The oligonucleotide according to any one of the prior claims, wherein the oligonucleotide is a pharmaceutically acceptable salt, optionally, the oligonucleotide is a sodium salt, and optionally, the number of sodium ions in the sodium salt is equal to the total number of phosphorothioate nucleotide bonds and natural phosphate nucleotide bonds in the oligonucleotide.

114. A chiral-controlled oligonucleotide composition comprising the oligonucleotide according to any one of the prior claims, wherein the composition is concentrated compared to a substantially racemic preparation of the oligonucleotide.

115. A chiral-controlled oligonucleotide composition comprising a plurality of oligonucleotides, wherein each of the plurality of oligonucleotides is an oligonucleotide according to any one of claims 1 to 113, the plurality of oligonucleotides share the same configuration, and at least 5% of all oligonucleotides in the composition sharing the same configuration are the plurality of oligonucleotides.

116. A chiral-controlled oligonucleotide composition comprising the oligonucleotide according to any one of claims 1 to 113, wherein at least 5% of all oligonucleotides in the composition that share the same configuration as the oligonucleotide are the oligonucleotide.

117. At least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of all oligonucleotides in the composition sharing the same configuration are the plurality of oligonucleotides, or The composition according to claim 115 or 116, wherein at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of all oligonucleotides in the composition that share the same base sequence are the plurality of oligonucleotides.

118. An oligonucleotide composition comprising a plurality of oligonucleotides, wherein the plurality of oligonucleotides 1) Common base sequence, and 2) Independently sharing the same stereochemistry of the same binding phosphorus in the inter-chiral nucleotide bond, The plurality of oligonucleotides are oligonucleotides according to any one of claims 1 to 113, An oligonucleotide composition in which at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the oligonucleotides in the composition sharing the common base sequence are the plurality of oligonucleotides.

119. The oligonucleotide composition according to claim 118, wherein multiple oligonucleotides independently share the same stereochemistry of the same bounding phosphorus at each chiral nucleotide bond.

120. An oligonucleotide composition wherein all oligonucleotide levels in the composition are oligonucleotides, and each independently has the following structure: [fl2r] (C) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (G) [n001]. [fl2r] (A) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (A) [n001]. m(A)p. [fl2r] (C) [Ssp]. [fl2r] (A) [Ssp]. m(G)[Ssp]. [fl2r] (U) [Ssp]. m(U)p. m(U)[Ssp]. [fl2r] (G) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (G) [n001]. [fl2r](C)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G), or a pharmaceutically acceptable salt thereof, wherein the formula includes, [fl2r] represents a 2'-F modified nucleoside, m represents a nucleoside modified with 2'-OMe, p represents a phosphodiester, [Ssp] represents a phosphorothioate in the Sp configuration. [n001] is 【Chemistry 2】 An oligonucleotide composition representing this.

121. An oligonucleotide composition wherein all oligonucleotide levels in the composition are oligonucleotides, and each independently has the following structure: [fl2r] (G) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (U) [n001]. [fl2r] (C) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (G) [n001]. m(A)p. [fl2r] (C) [Ssp]. [fl2r] (A) [Ssp]. m(A)[Ssp]. [fl2r] (C) [Ssp]. m(A)p. m(G)[Ssp]. [fl2r] (U) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (G) [n001]. [fl2r](C)[Ssp]. [fl2r](C)[Ssp]. [fl2r](G), or a pharmaceutically acceptable salt thereof, wherein the formula includes, [fl2r] represents a 2'-F modified nucleoside, m represents a nucleoside modified with 2'-OMe, p represents a phosphodiester, [Ssp] represents a phosphorothioate in the Sp configuration. [n001] is 【Transformation 3】 An oligonucleotide composition representing this.

122. An oligonucleotide composition wherein all oligonucleotide levels in the composition are oligonucleotides, and each independently has the following structure: [fl2r] (G) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (U) [n001]. [fl2r] (U) [Ssp]. [fl2r] (G) [Ssp]. [fl2r] (C) [n001]. m(C)p. [fl2r] (G) [Ssp]. [fl2r] (C) [Ssp]. m(U)[Ssp]. [fl2r] (G) [Ssp]. m(C)p. m(C)[Ssp]. [fl2r] (C) [Ssp]. [fl2r] (A) [Ssp]. [fl2r] (A) [Ssp]. [fl2r] (U) [n001]. [fl2r](G)[Ssp]. [fl2r](C)[Ssp]. [fl2r](C), or a pharmaceutically acceptable salt thereof, wherein the formula includes, [fl2r] represents a 2'-F modified nucleoside, m represents a nucleoside modified with 2'-OMe, p represents a phosphodiester, [Ssp] represents a phosphorothioate in the Sp configuration. [n001] is 【Chemistry 4】 An oligonucleotide composition representing this.

123. An oligonucleotide composition wherein all oligonucleotide levels in the composition are oligonucleotides, and each independently has the following structure: [fl2r] (U) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (U) [n001]. [fl2r] (G) [Ssp]. [fl2r] (A) [Ssp]. [fl2r] (C) [n001]. m(A)p. [fl2r] (A) [Ssp]. [fl2r] (C) [Ssp]. m(A)[Ssp]. [fl2r] (G) [Ssp]. m(U)p. m(U)[Ssp]. [fl2r] (U) [Ssp]. [fl2r] (G) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (C) [n001]. [fl2r](G)[Ssp]. [fl2r](C)[Ssp]. [fl2r](U), or a pharmaceutically acceptable salt thereof, wherein the formula includes, [fl2r] represents a 2'-F modified nucleoside, m represents a nucleoside modified with 2'-OMe, p represents a phosphodiester, [Ssp] represents a phosphorothioate in the Sp configuration. [n001] is 【Transformation 5】 An oligonucleotide composition representing this.

124. An oligonucleotide composition wherein all oligonucleotide levels in the composition are oligonucleotides, and each independently has the following structure: [fl2r] (U) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (C) [n001]. [fl2r] (U) [Ssp]. [fl2r] (G) [Ssp]. [fl2r] (A) [n001]. m(C)p. [fl2r] (A) [Ssp]. [fl2r] (A) [Ssp]. m(C)[Ssp]. [fl2r] (A) [Ssp]. m(G)p. m(U)[Ssp]. [fl2r] (U) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (G) [Ssp]. [fl2r] (C) [n001]. [fl2r](C)[Ssp]. [fl2r](G)[Ssp]. [fl2r](C), or a pharmaceutically acceptable salt thereof, wherein the formula includes, [fl2r] represents a 2'-F modified nucleoside, m represents a nucleoside modified with 2'-OMe, p represents a phosphodiester, [Ssp] represents a phosphorothioate in the Sp configuration. [n001] is 【Transformation 6】 An oligonucleotide composition representing this.

125. An oligonucleotide composition wherein all oligonucleotide levels in the composition are oligonucleotides, and each independently has the following structure: [fl2r] (G) [n001]. [fl2r] (U) [Ssp]. [fl2r] (U) [n001]. [fl2r] (C) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (G) [n001]. m(A)p. [fl2r] (C) [Ssp]. [fl2r] (A) [Ssp]. m(A)[Ssp]. [fl2r] (C) [Ssp]. m(A)p. m(G)[Ssp]. [fl2r] (U) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (G) [n001]. [fl2r](C)[Ssp]. [fl2r](C)[Ssp]. [fl2r](G), or a pharmaceutically acceptable salt thereof, wherein the formula includes, [fl2r] represents a 2'-F modified nucleoside, m represents a nucleoside modified with 2'-OMe, p represents a phosphodiester, [Ssp] represents a phosphorothioate in the Sp configuration. [n001] is 【Transformation 7】 An oligonucleotide composition representing this.

126. An oligonucleotide composition wherein all oligonucleotide levels in the composition are oligonucleotides, and each independently has the following structure: [fl2r] (U) [n001]. [fl2r] (U) [Ssp]. [fl2r] (C) [n001]. [fl2r] (U) [Ssp]. [fl2r] (G) [Ssp]. [fl2r] (A) [n001]. m(C)p. [fl2r] (A) [Ssp]. [fl2r] (A) [Ssp]. m(C)[Ssp]. [fl2r] (A) [Ssp]. m(G)p. m(U)[Ssp]. [fl2r] (U) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (G) [Ssp]. [fl2r] (C) [n001]. [fl2r](C)[Ssp]. [fl2r](G)[Ssp]. [fl2r](C), or a pharmaceutically acceptable salt thereof, wherein the formula includes, [fl2r] represents a 2'-F modified nucleoside, m represents a nucleoside modified with 2'-OMe, p represents a phosphodiester, [Ssp] represents a phosphorothioate in the Sp configuration. [n001] is 【Transformation 8】 An oligonucleotide composition representing this.

127. An oligonucleotide composition wherein all oligonucleotide levels in the composition are oligonucleotides, and each independently has the following structure: [fl2r] (U) [n001]. [fl2r] (C) [Ssp]. [fl2r] (U) [n001]. [fl2r] (G) [Ssp]. [fl2r] (A) [Ssp]. [fl2r] (C) [n001]. m(A)p. [fl2r] (A) [Ssp]. [fl2r] (C) [Ssp]. m(A)[Ssp]. [fl2r] (G) [Ssp]. m(U)p. m(U)[Ssp]. [fl2r] (U) [Ssp]. [fl2r] (G) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (C) [n001]. [fl2r](G)[Ssp]. [fl2r](C)[Ssp]. [fl2r](U), or a pharmaceutically acceptable salt thereof, wherein the formula includes, [fl2r] represents a 2'-F modified nucleoside, m represents a nucleoside modified with 2'-OMe, p represents a phosphodiester, [Ssp] represents a phosphorothioate in the Sp configuration. [n001] is 【Chemistry 9】 An oligonucleotide composition representing this.

128. An oligonucleotide composition wherein all oligonucleotide levels in the composition are oligonucleotides, and each independently has the following structure: [fl2r] (C) [n001]. [fl2r] (U) [Ssp]. [fl2r] (G) [n001]. [fl2r] (A) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (A) [n001]. m(A)p. [fl2r] (C) [Ssp]. [fl2r] (A) [Ssp]. m(G)[Ssp]. [fl2r] (U) [Ssp]. m(U)p. m(U)[Ssp]. [fl2r] (G) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (G) [n001]. [fl2r](C)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G), or a pharmaceutically acceptable salt thereof, wherein the formula includes, [fl2r] represents a 2'-F modified nucleoside, m represents a nucleoside modified with 2'-OMe, p represents a phosphodiester, [Ssp] represents a phosphorothioate in the Sp configuration. [n001] is 【Chemistry 10】 An oligonucleotide composition representing this.

129. An oligonucleotide composition wherein all oligonucleotide levels in the composition are oligonucleotides, and each independently has the following structure: [fl2r] (G) [n001]. [fl2r] (U) [Ssp]. [fl2r] (U) [n001]. [fl2r] (U) [Ssp]. [fl2r] (G) [Ssp]. [fl2r] (C) [n001]. m(C)p. [fl2r] (G) [Ssp]. [fl2r] (C) [Ssp]. m(U)[Ssp]. [fl2r] (G) [Ssp]. m(C)p. m(C)[Ssp]. [fl2r] (C) [Ssp]. [fl2r] (A) [Ssp]. [fl2r] (A) [Ssp]. [fl2r] (U) [n001]. [fl2r](G)[Ssp]. [fl2r](C)[Ssp]. [fl2r](C), or a pharmaceutically acceptable salt thereof, wherein the formula includes, [fl2r] represents a 2'-F modified nucleoside, m represents a nucleoside modified with 2'-OMe, p represents a phosphodiester, [Ssp] represents a phosphorothioate in the Sp configuration. [n001] is 【Chemistry 11】 An oligonucleotide composition representing this.

130. An oligonucleotide composition wherein all oligonucleotide levels in the composition are oligonucleotides, and each independently has the following structure: [fl2r] (G) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (U) [n001]. [fl2r] (C) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (G) [n001]. m(A)p. [fl2r] (C) [Ssp]. [fl2r] (A) [Ssp]. m(A)[Ssp]. [fl2r] (C) [Ssp]. m(A)p. m(G)[Ssp]. [fl2r] (U) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (G) [n001]. [fl2r](C)[Ssp]. [fl2r](C)[n001]. [fl2r](G), or a pharmaceutically acceptable salt thereof, wherein the formula includes, [fl2r] represents a 2'-F modified nucleoside, m represents a nucleoside modified with 2'-OMe, p represents a phosphodiester, [Ssp] represents a phosphorothioate in the Sp configuration. [n001] is 【Chemistry 12】 An oligonucleotide composition representing this.

131. An oligonucleotide composition wherein all oligonucleotide levels in the composition are oligonucleotides, and each independently has the following structure: [fl2r] (U) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (C) [n001]. [fl2r] (U) [Ssp]. [fl2r] (G) [Ssp]. [fl2r] (A) [n001]. m(C)p. [fl2r] (A) [Ssp]. [fl2r] (A) [Ssp]. m(C)[Ssp]. [fl2r] (A) [Ssp]. m(G)p. m(U)[Ssp]. [fl2r] (U) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (G) [Ssp]. [fl2r] (C) [n001]. [fl2r](C)[Ssp]. [fl2r](G)[n001]. [fl2r](C), or a pharmaceutically acceptable salt thereof, comprising the formula, [fl2r] represents a 2'-F modified nucleoside, m represents a nucleoside modified with 2'-OMe, p represents a phosphodiester, [Ssp] represents a phosphorothioate in the Sp configuration. [n001] is 【Chemistry 13】 An oligonucleotide composition representing this.

132. An oligonucleotide composition wherein all oligonucleotide levels in the composition are oligonucleotides, and each independently has the following structure: [fl2r] (U) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (U) [n001]. [fl2r] (G) [Ssp]. [fl2r] (A) [Ssp]. [fl2r] (C) [n001]. m(A)p. [fl2r] (A) [Ssp]. [fl2r] (C) [Ssp]. m(A)[Ssp]. [fl2r] (G) [Ssp]. m(U)p. m(U)[Ssp]. [fl2r] (U) [Ssp]. [fl2r] (G) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (C) [n001]. [fl2r](G)[Ssp]. [fl2r](C)[n001]. [fl2r](U), or a pharmaceutically acceptable salt thereof, wherein the formula includes, [fl2r] represents a 2'-F modified nucleoside, m represents a nucleoside modified with 2'-OMe, p represents a phosphodiester, [Ssp] represents a phosphorothioate in the Sp configuration. [n001] is 【Chemistry 14】 An oligonucleotide composition representing this.

133. An oligonucleotide composition wherein all oligonucleotide levels in the composition are oligonucleotides, and each independently has the following structure: [fl2r] (C) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (G) [n001]. [fl2r] (A) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (A) [n001]. m(A)p. [fl2r] (C) [Ssp]. [fl2r] (A) [Ssp]. m(G)[Ssp]. [fl2r] (U) [Ssp]. m(U)p. m(U)[Ssp]. [fl2r] (G) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (G) [n001]. [fl2r](C)[Ssp]. [fl2r](U)[n001]. [fl2r](G), or a pharmaceutically acceptable salt thereof, wherein the formula includes, [fl2r] represents a 2'-F modified nucleoside, m represents a nucleoside modified with 2'-OMe, p represents a phosphodiester, [Ssp] represents a phosphorothioate in the Sp configuration. [n001] is 【Chemistry 15】 An oligonucleotide composition representing this.

134. An oligonucleotide composition wherein all oligonucleotide levels in the composition are oligonucleotides, and each independently has the following structure: [fl2r] (G) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (U) [n001]. [fl2r] (U) [Ssp]. [fl2r] (G) [Ssp]. [fl2r] (C) [n001]. m(C)p. [fl2r] (G) [Ssp]. [fl2r] (C) [Ssp]. m(U)[Ssp]. [fl2r] (G) [Ssp]. m(C)p. m(C)[Ssp]. [fl2r] (C) [Ssp]. [fl2r] (A) [Ssp]. [fl2r] (A) [Ssp]. [fl2r] (U) [n001]. [fl2r](G)[Ssp]. [fl2r](C)[n001]. [fl2r](C), or a pharmaceutically acceptable salt thereof, comprising the formula, [fl2r] represents a 2'-F modified nucleoside, m represents a nucleoside modified with 2'-OMe, p represents a phosphodiester, [Ssp] represents a phosphorothioate in the Sp configuration. [n001] is 【Chemistry 16】 An oligonucleotide composition representing this.

135. An oligonucleotide composition wherein all oligonucleotide levels in the composition are oligonucleotides, and each independently has the following structure: [fl2r] (U) [Ssp]. [fl2r] (G) [Ssp]. [fl2r] (C) [n001]. [fl2r] (C) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (A) [n001]. m(A)p. [fl2r] (U) [Ssp]. [fl2r] (G) [Ssp]. m(C)[Ssp]. [fl2r] (C) [Ssp]. m(A)p. m(U)[Ssp]. [fl2r] (C) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (G) [n001]. [fl2r](G)[Ssp]. [fl2r](A)[Ssp]. [fl2r](G), or a pharmaceutically acceptable salt thereof, wherein the formula includes, [fl2r] represents a 2'-F modified nucleoside, m represents a nucleoside modified with 2'-OMe, p represents a phosphodiester, [Ssp] represents a phosphorothioate in the Sp configuration. [n001] is 【Chemistry 17】 An oligonucleotide composition representing this.

136. An oligonucleotide composition wherein all oligonucleotide levels in the composition are oligonucleotides, and each independently has the following structure: [fl2r] (C) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (A) [n001]. [fl2r] (A) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (G) [n001]. m(C)p. [fl2r] (C) [Ssp]. [fl2r] (A) [Ssp]. m(U)[Ssp]. [fl2r] (C) [Ssp]. m(C)p. m(U)[Ssp]. [fl2r] (G) [Ssp]. [fl2r] (G) [Ssp]. [fl2r] (A) [Ssp]. [fl2r] (G) [n001]. [fl2r](U)[Ssp]. [fl2r](U)[Ssp]. [fl2r](C), or a pharmaceutically acceptable salt thereof, wherein the formula includes, [fl2r] represents a 2'-F modified nucleoside, m represents a nucleoside modified with 2'-OMe, p represents a phosphodiester, [Ssp] represents a phosphorothioate in the Sp configuration. [n001] is [Chemistry 18] An oligonucleotide composition representing this.

137. An oligonucleotide composition wherein all oligonucleotide levels in the composition are oligonucleotides, and each independently has the following structure: [fl2r] (A) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (G) [n001]. [fl2r] (C) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (A) [n001]. m(U)p. [fl2r] (C) [Ssp]. [fl2r] (C) [Ssp]. m(U)[Ssp]. [fl2r] (G) [Ssp]. m(G)p. m(A)[Ssp]. [fl2r] (G) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (C) [n001]. [fl2r](C)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G), or a pharmaceutically acceptable salt thereof, wherein the formula includes, [fl2r] represents a 2'-F modified nucleoside, m represents a nucleoside modified with 2'-OMe, p represents a phosphodiester, [Ssp] represents a phosphorothioate in the Sp configuration. [n001] is 【Chemistry 19】 An oligonucleotide composition representing this.

138. An oligonucleotide composition wherein all oligonucleotide levels in the composition are oligonucleotides, and each independently has the following structure: [fl2r] (U) [n001]. [fl2r] (G) [Ssp]. [fl2r] (C) [n001]. [fl2r] (C) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (A) [n001]. m(A)p. [fl2r] (U) [Ssp]. [fl2r] (G) [Ssp]. m(C)[Ssp]. [fl2r] (C) [Ssp]. m(A)p. m(U)[Ssp]. [fl2r] (C) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (G) [n001]. [fl2r](G)[Ssp]. [fl2r](A)[Ssp]. [fl2r](G), or a pharmaceutically acceptable salt thereof, wherein the formula includes, [fl2r] represents a 2'-F modified nucleoside, m represents a nucleoside modified with 2'-OMe, p represents a phosphodiester, [Ssp] represents a phosphorothioate in the Sp configuration. [n001] is 【Chemistry 20】 An oligonucleotide composition representing this.

139. An oligonucleotide composition wherein all oligonucleotide levels in the composition are oligonucleotides, and each independently has the following structure: [fl2r] (C) [n001]. [fl2r] (C) [Ssp]. [fl2r] (A) [n001]. [fl2r] (A) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (G) [n001]. m(C)p. [fl2r] (C) [Ssp]. [fl2r] (A) [Ssp]. m(U)[Ssp]. [fl2r] (C) [Ssp]. m(C)p. m(U)[Ssp]. [fl2r] (G) [Ssp]. [fl2r] (G) [Ssp]. [fl2r] (A) [Ssp]. [fl2r] (G) [n001]. [fl2r](U)[Ssp]. [fl2r](U)[Ssp]. [fl2r](C), or a pharmaceutically acceptable salt thereof, wherein the formula includes, [fl2r] represents a 2'-F modified nucleoside, m represents a nucleoside modified with 2'-OMe, p represents a phosphodiester, [Ssp] represents a phosphorothioate in the Sp configuration. [n001] is 【Chemistry 21】 An oligonucleotide composition representing this.

140. An oligonucleotide composition wherein all oligonucleotide levels in the composition are oligonucleotides, and each independently has the following structure: [fl2r] (A) [n001]. [fl2r] (U) [Ssp]. [fl2r] (G) [n001]. [fl2r] (C) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (A) [n001]. m(U)p. [fl2r] (C) [Ssp]. [fl2r] (C) [Ssp]. m(U)[Ssp]. [fl2r] (G) [Ssp]. m(G)p. m(A)[Ssp]. [fl2r] (G) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (C) [n001]. [fl2r](C)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G), or a pharmaceutically acceptable salt thereof, wherein the formula includes, [fl2r] represents a 2'-F modified nucleoside, m represents a nucleoside modified with 2'-OMe, p represents a phosphodiester, [Ssp] represents a phosphorothioate in the Sp configuration. [n001] is 【Chemistry 22】 An oligonucleotide composition representing this.

141. An oligonucleotide composition wherein all oligonucleotide levels in the composition are oligonucleotides, and each independently has the following structure: [fl2r] (U) [Ssp]. [fl2r] (G) [Ssp]. [fl2r] (C) [n001]. [fl2r] (C) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (A) [n001]. m(A)p. [fl2r] (U) [Ssp]. [fl2r] (G) [Ssp]. m(C)[Ssp]. [fl2r] (C) [Ssp]. m(A)p. m(U)[Ssp]. [fl2r] (C) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (G) [n001]. [fl2r](G)[Ssp]. [fl2r](A)[n001]. [fl2r](G), or a pharmaceutically acceptable salt thereof, comprising the formula, [fl2r] represents a 2'-F modified nucleoside, m represents a nucleoside modified with 2'-OMe, p represents a phosphodiester, [Ssp] represents a phosphorothioate in the Sp configuration. [n001] is 【Chemistry 23】 An oligonucleotide composition representing this.

142. An oligonucleotide composition wherein all oligonucleotide levels in the composition are oligonucleotides, and each independently has the following structure: [fl2r] (C) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (A) [n001]. [fl2r] (A) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (G) [n001]. m(C)p. [fl2r] (C) [Ssp]. [fl2r] (A) [Ssp]. m(U)[Ssp]. [fl2r] (C) [Ssp]. m(C)p. m(U)[Ssp]. [fl2r] (G) [Ssp]. [fl2r] (G) [Ssp]. [fl2r] (A) [Ssp]. [fl2r] (G) [n001]. [fl2r](U)[Ssp]. [fl2r](U)[n001]. [fl2r](C), or a pharmaceutically acceptable salt thereof, wherein the formula includes, [fl2r] represents a 2'-F modified nucleoside, m represents a nucleoside modified with 2'-OMe, p represents a phosphodiester, [Ssp] represents a phosphorothioate in the Sp configuration. [n001] is 【Chemistry 24】 An oligonucleotide composition representing this.

143. An oligonucleotide composition wherein all oligonucleotide levels in the composition are oligonucleotides, and each independently has the following structure: [fl2r] (A) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (G) [n001]. [fl2r] (C) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (A) [n001]. m(U)p. [fl2r] (C) [Ssp]. [fl2r] (C) [Ssp]. m(U)[Ssp]. [fl2r] (G) [Ssp]. m(G)p. m(A)[Ssp]. [fl2r] (G) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (C) [n001]. [fl2r](C)[Ssp]. [fl2r](U)[n001]. [fl2r](G), or a pharmaceutically acceptable salt thereof, wherein the formula includes, [fl2r] represents a 2'-F modified nucleoside, m represents a nucleoside modified with 2'-OMe, p represents a phosphodiester, [Ssp] represents a phosphorothioate in the Sp configuration. [n001] is 【Chemistry 25】 An oligonucleotide composition representing this.

144. An oligonucleotide composition wherein all oligonucleotide levels in the composition are oligonucleotides, and each independently has the following structure: [fl2r] (G) [n001R]. [fl2r] (U) [Ssp]. [fl2r] (U) [n001R]. [fl2r] (C) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (G) [n001R]. m(A)p. [fl2r] (C) [Ssp]. [fl2r] (A) [Ssp]. m(A)[Ssp]. [fl2r] (C) [Ssp]. m(A)p. m(G)[Ssp]. [fl2r] (U) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (G) [n001R]. [fl2r](C)[Ssp]. [fl2r](C)[Ssp]. [fl2r](G), or a pharmaceutically acceptable salt thereof, wherein the formula includes, [fl2r] represents a 2'-F modified nucleoside, m represents a nucleoside modified with 2'-OMe, p represents a phosphodiester, [Ssp] represents a phosphorothioate in the Sp configuration. [n001R] is 【Chemistry 26】 An oligonucleotide composition in which phosphorus is in the Rp configuration.

145. An oligonucleotide composition wherein all oligonucleotide levels in the composition are oligonucleotides, and each independently has the following structure: [fl2r] (C) [n001R]. [fl2r] (U) [Ssp]. [fl2r] (G) [n001R]. [fl2r] (A) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (A) [n001R]. m(A)p. [fl2r] (C) [Ssp]. [fl2r] (A) [Ssp]. m(G)[Ssp]. [fl2r] (U) [Ssp]. m(U)p. m(U)[Ssp]. [fl2r] (G) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (G) [n001R]. [fl2r](C)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G), or a pharmaceutically acceptable salt thereof, wherein the formula includes, [fl2r] represents a 2'-F modified nucleoside, m represents a nucleoside modified with 2'-OMe, p represents a phosphodiester, [Ssp] represents a phosphorothioate in the Sp configuration. [n001R] is 【Chemistry 27】 An oligonucleotide composition in which phosphorus is in the Rp configuration.

146. An oligonucleotide composition wherein all oligonucleotide levels in the composition are oligonucleotides, and each independently has the following structure: [fl2r] (G) [n001R]. [fl2r] (U) [Ssp]. [fl2r] (U) [n001R]. [fl2r] (C) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (G) [n001R]. m(A)p. [fl2r] (C) [Ssp]. [fl2r] (A) [Ssp]. m(A)[Ssp]. [fl2r] (C) [Ssp]. m(A)p. m(G)[Ssp]. [fl2r] (U) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (G) [n001R]. [fl2r](C)[Ssp]. [fl2r](C)[Ssp]. m(G), or a pharmaceutically acceptable salt thereof, wherein the formula contains, [fl2r] represents a 2'-F modified nucleoside, m represents a nucleoside modified with 2'-OMe, p represents a phosphodiester, [Ssp] represents a phosphorothioate in the Sp configuration. [n001R] is 【Chemistry 28】 An oligonucleotide composition in which phosphorus is in the Rp configuration.

147. An oligonucleotide composition wherein all oligonucleotide levels in the composition are oligonucleotides, and each independently has the following structure: [fl2r] (C) [n001R]. [fl2r] (U) [Ssp]. [fl2r] (G) [n001R]. [fl2r] (A) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (A) [n001R]. m(A)p. [fl2r] (C) [Ssp]. [fl2r] (A) [Ssp]. m(G)[Ssp]. [fl2r] (U) [Ssp]. m(U)p. m(U)[Ssp]. [fl2r] (G) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (G) [n001R]. [fl2r](C)[Ssp]. [fl2r](U)[Ssp]. m(G), or a pharmaceutically acceptable salt thereof, wherein the formula contains, [fl2r] represents a 2'-F modified nucleoside, m represents a nucleoside modified with 2'-OMe, p represents a phosphodiester, [Ssp] represents a phosphorothioate in the Sp configuration. [n001R] is 【Chemistry 29】 An oligonucleotide composition in which phosphorus is in the Rp configuration.

148. An oligonucleotide composition wherein all oligonucleotide levels in the composition are oligonucleotides, and each independently has the following structure: [fl2r] (U) [n001R]. [fl2r] (G) [Ssp]. [fl2r] (C) [n001R]. [fl2r] (C) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (A) [n001R]. m(A)p. [fl2r] (U) [Ssp]. [fl2r] (G) [Ssp]. m(C)[Ssp]. [fl2r] (C) [Ssp]. m(A)p. m(U)[Ssp]. [fl2r] (C) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (G) [n001R]. [fl2r](G)[Ssp]. [fl2r](A)[Ssp]. m(G), or a pharmaceutically acceptable salt thereof, wherein the formula contains, [fl2r] represents a 2'-F modified nucleoside, m represents a nucleoside modified with 2'-OMe, p represents a phosphodiester, [Ssp] represents a phosphorothioate in the Sp configuration. [n001R] is 【Transformation 30】 An oligonucleotide composition in which phosphorus is in the Rp configuration.

149. An oligonucleotide composition wherein all oligonucleotide levels in the composition are oligonucleotides, and each independently has the following structure: [fl2r] (A) [n001R]. [fl2r] (U) [Ssp]. [fl2r] (G) [n001R]. [fl2r] (C) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (A) [n001R]. m(U)p. [fl2r] (C) [Ssp]. [fl2r] (C) [Ssp]. m(U)[Ssp]. [fl2r] (G) [Ssp]. m(G)p. m(A)[Ssp]. [fl2r] (G) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (C) [n001R]. [fl2r](C)[Ssp]. [fl2r](U)[Ssp]. m(G), or a pharmaceutically acceptable salt thereof, wherein the formula contains, [fl2r] represents a 2'-F modified nucleoside, m represents a nucleoside modified with 2'-OMe, p represents a phosphodiester, [Ssp] represents a phosphorothioate in the Sp configuration. [n001R] is 【Chemistry 31】 An oligonucleotide composition in which phosphorus is in the Rp configuration.

150. An oligonucleotide composition wherein all oligonucleotide levels in the composition are oligonucleotides, and each independently has the following structure: m(G)[n001R]. [fl2r] (U) [Ssp]. [fl2r] (U) [n001R]. [fl2r] (C) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (G) [n001R]. m(A)p. [fl2r] (C) [Ssp]. [fl2r] (A) [Ssp]. m(A)[Ssp]. [fl2r] (C) [Ssp]. m(A)p. m(G)[Ssp]. [fl2r] (U) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (G) [n001R]. [fl2r](C)[Ssp]. [fl2r](C)[Ssp]. [fl2r](G), or a pharmaceutically acceptable salt thereof, wherein the formula includes, [fl2r] represents a 2'-F modified nucleoside, m represents a nucleoside modified with 2'-OMe, p represents a phosphodiester, [Ssp] represents a phosphorothioate in the Sp configuration. [n001R] is 【Chemistry 32】 An oligonucleotide composition in which phosphorus is in the Rp configuration.

151. An oligonucleotide composition wherein all oligonucleotide levels in the composition are oligonucleotides, and each independently has the following structure: m(C) [n001R]. [fl2r] (U) [Ssp]. [fl2r] (G) [n001R]. [fl2r] (A) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (A) [n001R]. m(A)p. [fl2r] (C) [Ssp]. [fl2r] (A) [Ssp]. m(G)[Ssp]. [fl2r] (U) [Ssp]. m(U)p. m(U)[Ssp]. [fl2r] (G) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (G) [n001R]. [fl2r](C)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G), or a pharmaceutically acceptable salt thereof, wherein the formula includes, [fl2r] represents a 2'-F modified nucleoside, m represents a nucleoside modified with 2'-OMe, p represents a phosphodiester, [Ssp] represents a phosphorothioate in the Sp configuration. [n001R] is 【Transformation 33】 An oligonucleotide composition in which phosphorus is in the Rp configuration.

152. An oligonucleotide composition wherein all oligonucleotide levels in the composition are oligonucleotides, and each independently has the following structure: m(U)[n001R]. [fl2r] (G) [Ssp]. [fl2r] (C) [n001R]. [fl2r] (C) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (A) [n001R]. m(A)p. [fl2r] (U) [Ssp]. [fl2r] (G) [Ssp]. m(C)[Ssp]. [fl2r] (C) [Ssp]. m(A)p. m(U)[Ssp]. [fl2r] (C) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (G) [n001R]. [fl2r](G)[Ssp]. [fl2r](A)[Ssp]. [fl2r](G), or a pharmaceutically acceptable salt thereof, wherein the formula includes, [fl2r] represents a 2'-F modified nucleoside, m represents a nucleoside modified with 2'-OMe, p represents a phosphodiester, [Ssp] represents a phosphorothioate in the Sp configuration. [n001R] is 【Transformation 34】 An oligonucleotide composition in which phosphorus is in the Rp configuration.

153. An oligonucleotide composition wherein all oligonucleotide levels in the composition are oligonucleotides, and each independently has the following structure: m(A)[n001R]. [fl2r] (U) [Ssp]. [fl2r] (G) [n001R]. [fl2r] (C) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (A) [n001R]. m(U)p. [fl2r] (C) [Ssp]. [fl2r] (C) [Ssp]. m(U)[Ssp]. [fl2r] (G) [Ssp]. m(G)p. m(A)[Ssp]. [fl2r] (G) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (C) [n001R]. [fl2r](C)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G), or a pharmaceutically acceptable salt thereof, wherein the formula includes, [fl2r] represents a 2'-F modified nucleoside, m represents a nucleoside modified with 2'-OMe, p represents a phosphodiester, [Ssp] represents a phosphorothioate in the Sp configuration. [n001R] is 【Chemistry 35】 An oligonucleotide composition in which phosphorus is in the Rp configuration.

154. An oligonucleotide composition wherein all oligonucleotide levels in the composition are oligonucleotides, and each independently has the following structure: m(G)[n001R]. [fl2r] (U) [Ssp]. [fl2r] (U) [n001R]. [fl2r] (C) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (G) [n001R]. m(A)p. [fl2r] (C) [Ssp]. [fl2r] (A) [Ssp]. m(A)[Ssp]. [fl2r] (C) [Ssp]. m(A)p. m(G)[Ssp]. [fl2r] (U) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (G) [n001R]. [fl2r](C)[Ssp]. [fl2r](C)[Ssp]. m(G), or a pharmaceutically acceptable salt thereof, wherein the formula contains, [fl2r] represents a 2'-F modified nucleoside, m represents a nucleoside modified with 2'-OMe, p represents a phosphodiester, [Ssp] represents a phosphorothioate in the Sp configuration. [n001R] is 【Transformation 36】 An oligonucleotide composition in which phosphorus is in the Rp configuration.

155. An oligonucleotide composition wherein all oligonucleotide levels in the composition are oligonucleotides, and each independently has the following structure: m(C) [n001R]. [fl2r] (U) [Ssp]. [fl2r] (G) [n001R]. [fl2r] (A) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (A) [n001R]. m(A)p. [fl2r] (C) [Ssp]. [fl2r] (A) [Ssp]. m(G)[Ssp]. [fl2r] (U) [Ssp]. m(U)p. m(U)[Ssp]. [fl2r] (G) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (G) [n001R]. [fl2r](C)[Ssp]. [fl2r](U)[Ssp]. m(G), or a pharmaceutically acceptable salt thereof, wherein the formula contains, [fl2r] represents a 2'-F modified nucleoside, m represents a nucleoside modified with 2'-OMe, p represents a phosphodiester, [Ssp] represents a phosphorothioate in the Sp configuration. [n001R] is 【Chemistry 37】 An oligonucleotide composition in which phosphorus is in the Rp configuration.

156. An oligonucleotide composition wherein all oligonucleotide levels in the composition are oligonucleotides, and each independently has the following structure: m(U)[n001R]. [fl2r] (G) [Ssp]. [fl2r] (C) [n001R]. [fl2r] (C) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (A) [n001R]. m(A)p. [fl2r] (U) [Ssp]. [fl2r] (G) [Ssp]. m(C)[Ssp]. [fl2r] (C) [Ssp]. m(A)p. m(U)[Ssp]. [fl2r] (C) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (G) [n001R]. [fl2r](G)[Ssp]. [fl2r](A)[Ssp]. m(G), or a pharmaceutically acceptable salt thereof, wherein the formula contains, [fl2r] represents a 2'-F modified nucleoside, m represents a nucleoside modified with 2'-OMe, p represents a phosphodiester, [Ssp] represents a phosphorothioate in the Sp configuration. [n001R] is 【Transformation 38】 An oligonucleotide composition in which phosphorus is in the Rp configuration.

157. An oligonucleotide composition wherein all oligonucleotide levels in the composition are oligonucleotides, and each independently has the following structure: m(A)[n001R]. [fl2r] (U) [Ssp]. [fl2r] (G) [n001R]. [fl2r] (C) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (A) [n001R]. m(U)p. [fl2r] (C) [Ssp]. [fl2r] (C) [Ssp]. m(U)[Ssp]. [fl2r] (G) [Ssp]. m(G)p. m(A)[Ssp]. [fl2r] (G) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (C) [n001R]. [fl2r](C)[Ssp]. [fl2r](U)[Ssp]. m(G), or a pharmaceutically acceptable salt thereof, wherein the formula contains, [fl2r] represents a 2'-F modified nucleoside, m represents a nucleoside modified with 2'-OMe, p represents a phosphodiester, [Ssp] represents a phosphorothioate in the Sp configuration. [n001R] is 【Chemistry 39】 An oligonucleotide composition in which phosphorus is in the Rp configuration.

158. An oligonucleotide composition wherein all oligonucleotide levels in the composition are oligonucleotides, and each independently has the following structure: [fl2r] (U) [n001R]. [fl2r] (G) [Ssp]. [fl2r] (C) [n001R]. [fl2r] (C) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (A) [n001R]. m(A)p. [fl2r] (U) [Ssp]. [fl2r] (G) [Ssp]. m(C)[Ssp]. [fl2r] (C) [Ssp]. m(A)p. m(U)[Ssp]. [fl2r] (C) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (G) [n001R]. [fl2r](G)[Ssp]. [fl2r](A)[Ssp]. [fl2r](G), or a pharmaceutically acceptable salt thereof, wherein the formula includes, [fl2r] represents a 2'-F modified nucleoside, m represents a nucleoside modified with 2'-OMe, p represents a phosphodiester, [Ssp] represents a phosphorothioate in the Sp configuration. [n001R] is 【Chemistry 40】 An oligonucleotide composition in which phosphorus is in the Rp configuration.

159. An oligonucleotide composition wherein all oligonucleotide levels in the composition are oligonucleotides, and each independently has the following structure: [fl2r] (A) [n001R]. [fl2r] (U) [Ssp]. [fl2r] (G) [n001R]. [fl2r] (C) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (A) [n001R]. m(U)p. [fl2r] (C) [Ssp]. [fl2r] (C) [Ssp]. m(U)[Ssp]. [fl2r] (G) [Ssp]. m(G)p. m(A)[Ssp]. [fl2r] (G) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (C) [n001R]. [fl2r](C)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G), or a pharmaceutically acceptable salt thereof, wherein the formula includes, [fl2r] represents a 2'-F modified nucleoside, m represents a nucleoside modified with 2'-OMe, p represents a phosphodiester, [Ssp] represents a phosphorothioate in the Sp configuration. [n001R] is 【Chemistry 41】 An oligonucleotide composition in which phosphorus is in the Rp configuration.

160. An oligonucleotide composition wherein all oligonucleotide levels in the composition are oligonucleotides, and each independently has the following structure: [fl2r] (G) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (U) [n001R]. [fl2r] (C) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (G) [n001R]. m(A)p. [fl2r] (C) [Ssp]. [fl2r] (A) [Ssp]. m(A)[Ssp]. [fl2r] (C) [Ssp]. m(A)p. m(G)[Ssp]. [fl2r] (U) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (G) [n001R]. [fl2r](C)[Ssp]. [fl2r](C)[Ssp]. [fl2r](G), or a pharmaceutically acceptable salt thereof, wherein the formula includes, [fl2r] represents a 2'-F modified nucleoside, m represents a nucleoside modified with 2'-OMe, p represents a phosphodiester, [Ssp] represents a phosphorothioate in the Sp configuration. [n001R] is 【Chemistry 42】 An oligonucleotide composition in which phosphorus is in the Rp configuration.

161. An oligonucleotide composition wherein all oligonucleotide levels in the composition are oligonucleotides, and each independently has the following structure: [fl2r] (C) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (G) [n001R]. [fl2r] (A) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (A) [n001R]. m(A)p. [fl2r] (C) [Ssp]. [fl2r] (A) [Ssp]. m(G)[Ssp]. [fl2r] (U) [Ssp]. m(U)p. m(U)[Ssp]. [fl2r] (G) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (G) [n001R]. [fl2r](C)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G), or a pharmaceutically acceptable salt thereof, wherein the formula includes, [fl2r] represents a 2'-F modified nucleoside, m represents a nucleoside modified with 2'-OMe, p represents a phosphodiester, [Ssp] represents a phosphorothioate in the Sp configuration. [n001R] is 【Chemistry 43】 An oligonucleotide composition in which phosphorus is in the Rp configuration.

162. An oligonucleotide composition wherein all oligonucleotide levels in the composition are oligonucleotides, and each independently has the following structure: [fl2r] (U) [Ssp]. [fl2r] (G) [Ssp]. [fl2r] (C) [n001R]. [fl2r] (C) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (A) [n001R]. m(A)p. [fl2r] (U) [Ssp]. [fl2r] (G) [Ssp]. m(C)[Ssp]. [fl2r] (C) [Ssp]. m(A)p. m(U)[Ssp]. [fl2r] (C) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (G) [n001R]. [fl2r](G)[Ssp]. [fl2r](A)[Ssp]. [fl2r](G), or a pharmaceutically acceptable salt thereof, wherein the formula includes, [fl2r] represents a 2'-F modified nucleoside, m represents a nucleoside modified with 2'-OMe, p represents a phosphodiester, [Ssp] represents a phosphorothioate in the Sp configuration. [n001R] is 【Chemistry 44】 An oligonucleotide composition in which phosphorus is in the Rp configuration.

163. An oligonucleotide composition wherein all oligonucleotide levels in the composition are oligonucleotides, and each independently has the following structure: [fl2r] (A) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (G) [n001R]. [fl2r] (C) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (A) [n001R]. m(U)p. [fl2r] (C) [Ssp]. [fl2r] (C) [Ssp]. m(U)[Ssp]. [fl2r] (G) [Ssp]. m(G)p. m(A)[Ssp]. [fl2r] (G) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (C) [n001R]. [fl2r](C)[Ssp]. [fl2r](U)[Ssp]. [fl2r](G), or a pharmaceutically acceptable salt thereof, wherein the formula includes, [fl2r] represents a 2'-F modified nucleoside, m represents a nucleoside modified with 2'-OMe, p represents a phosphodiester, [Ssp] represents a phosphorothioate in the Sp configuration. [n001R] is 【Chemistry 45】 An oligonucleotide composition in which phosphorus is in the Rp configuration.

164. The level is approximately 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more of all oligonucleotides that share the same base sequence as the oligonucleotide having the aforementioned structure or a pharmaceutically acceptable salt thereof. The level is approximately 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or higher of all oligonucleotides that share the same composition as the oligonucleotide having the aforementioned structure or a pharmaceutically acceptable salt thereof. The composition according to any one of claims 120 to 163, wherein the levels are approximately 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, and 95%, based on the UV peak area at 260 nm.

165. The level or percentage is approximately or at least approximately (DS). ｎｃ And DS is approximately or at least approximately 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%, and nc is the number of chiral controlled internucleotide bonds (e.g., 1–50, 1–40, 1–30, 1–25, 1–20, 5–50, 5–40, 5–30, 5–25, 5–20, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more), or The level or percentage is approximately or at least approximately (DS). ｎｃ The composition according to any one of claims 114 to 163, wherein DS is about or at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%, and nc is the number of chiral-bound phosphorus molecules in the plurality of oligonucleotides (e.g., 1 to 50, 1 to 40, 1 to 30, 1 to 25, 1 to 20, 5 to 50, 5 to 40, 5 to 30, 5 to 25, 5 to 20, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more).

166. A pharmaceutical composition comprising an oligonucleotide or oligonucleotide composition according to any one of the prior claims, and a pharmaceutically acceptable carrier.

167. The pharmaceutical composition according to claim 166, wherein the pharmaceutical composition comprises one or more pharmaceutically acceptable salts of oligonucleotides and / or the pharmaceutical composition is a solution.

168. A method for altering the splicing of a DMD transcript in a system, comprising administering or delivering an effective amount of an oligonucleotide or composition according to any one of the prior claims to the system.

169. A method for providing DMD exon skipping within a system, comprising administering or delivering an effective amount of an oligonucleotide or composition according to any one of the prior claims to the system.

170. A method for increasing the level of a DMD polypeptide in a system, comprising administering or delivering an effective amount of an oligonucleotide or composition according to any one of the prior claims to the system.

171. The method according to claim 170, wherein the DMD polypeptide is cleaved dystrophin.

172. A method for increasing the level of dystrophin in a system, comprising administering or delivering an effective amount of an oligonucleotide or composition according to any one of the prior claims to the system.

173. A method for increasing the level of a dystrophin polypeptide encoded by an exon 45-skipped DMD transcript in a system, comprising administering or delivering an effective amount of an oligonucleotide or composition according to any one of the prior claims to the system.

174. A method for increasing the level of DMD activity in a system, comprising administering or delivering an effective amount of an oligonucleotide or composition according to any one of the prior claims to the system.

175. The method according to any one of claims 168 to 174, wherein the system expresses a DMD transcript and / or the system includes a mutation in the DMD gene, wherein the mutation optionally allows exon 45 skipping.

176. The aforementioned system includes, or is composed of, cells, tissues, organs, animals, humans, or other objects. The method according to any one of claims 168 to 175, wherein optionally the cells include or are skeletal muscle cells, cardiomyocytes, or neurons, the tissue includes or is muscle tissue, and / or the animal includes a mouse or a non-human primate.

177. A method for treating muscular dystrophy, comprising administering or delivering an effective amount of an oligonucleotide or composition according to any one of the prior claims to a subject suffering from the same.

178. The method according to claim 176 or 177, wherein the subject is suffering from Duchenne muscular dystrophy or Becker muscular dystrophy, and / or the subject has a mutation in the DMD gene that allows exon 45 skipping.

179. The oligonucleotide, composition, or method according to any one of the prior claims, wherein the mutation of the DMD gene is Δ7-44, Δ12-44, Δ18-44, Δ44, Δ46, Δ46-47, Δ46-48, Δ46-49, Δ46-51, Δ46-53, Δ46-55, Δ46-57, Δ46-59, Δ46-60, Δ46-67, Δ46-69, Δ46-75, or Δ46-78, and optionally the mutation includes Δ44 or Δ46.

180. The method according to any one of the prior claims, wherein exon 45 is skipped in DMD mRNA.

181. The method according to any one of the prior claims, wherein the level of exon 45 skipped DMD mRNA increases compared to the absence of the oligonucleotide or composition and / or compared to administering or delivering the reference oligonucleotide or composition.

182. The method according to any one of the prior claims, wherein a cleaved DMD polypeptide is produced compared to a wild-type DMD protein, and optionally, the cleaved DMD polypeptide performs one or more functions of wild-type dystrophin.

183. The method according to any one of the prior claims, wherein the level of cleaved DMD polypeptide increases compared to the absence of the oligonucleotide or composition and / or compared to administering or delivering the reference oligonucleotide or composition.

184. The method according to claim 181 or 183, wherein the reference oligonucleotide targets DMD, or the reference composition comprises an oligonucleotide that targets DMD.

185. An oligonucleotide or composition according to any one of the prior claims, for use in the method according to any one of the prior claims.

186. An oligonucleotide or composition according to any one of the prior claims, for use in the manufacture of a pharmaceutical product according to the method of any one of the prior claims.

187. Use of an oligonucleotide or composition according to any one of the prior claims in the method according to any one of the prior claims.

188. Use of the oligonucleotide or composition according to any one of the prior claims in the manufacture of a pharmaceutical product according to the method of any one of the prior claims.

189. A method for producing an oligonucleotide or composition according to any one of the prior claims, according to the method described herein.

190. An oligonucleotide, composition, method, or use as described in any one of Embodiments 1 to 359.

Images