Therapeutic macrophages

Abstract

The present invention relates to macrophages genetically engineered to overexpress interleukin-10 (IL-10) or to overexpress IL-10 in combination with matrix metallopeptidase 9 (MMP9). Such macrophages may be used for the treatment of cirrhosis in subjects. Specifically, subjects may be treated after experiencing an initial hepatic decompensation event requiring hospitalization. Subjects may have experienced subsequent decompensation events prior to treatment.

Description

[Technical Field]

[0001] The present invention relates to macrophages genetically engineered to express interleukin-10 (IL-10) for use in a method of treating cirrhosis in subjects. Specifically, the subjects may have experienced an initial hepatic decompensation event requiring hospitalization, or may have refractory ascites. The subjects may have experienced subsequent decompensation events prior to treatment. Alternatively, the subjects may have recovered from an initial hepatic decompensation event and have not experienced subsequent hepatic decompensation events since recovering from the initial event. The present invention further relates to a population of such macrophages for use in the method of the present invention, and to compositions comprising such macrophages. [Background technology]

[0002] Fibrosis is the ultimate common pathway for chronic diseases with various etiologies, including toxic injury, viral infections, metabolic disorders, genetic disorders, and autoimmune diseases. Acute self-limited fibrosis likely evolved as a reversible and protective response to injury. The balance between self-limited fibrosis and excessive fibrosis is finely regulated by multiple pathways and systems and essentially depends on the duration and repetition of the injury. The biological paradigm of fibrosis development and reconstruction is mediated by the liver. End-stage chronic hepatic fibrosis, also known as cirrhosis, is a life-threatening condition. 1,2 Liver disease-related mortality is the only leading cause of death in the UK that has steadily increased every year since the 1970s, and it remains a significant health burden worldwide. 3 Hepatic decompensation (HD) is defined by the acute onset of one or more major complications of cirrhosis (i.e., ascites, encephalopathy, gastrointestinal variceal bleeding, and spontaneous bacterial peritonitis) and represents the progression of the disease during the clinical course of cirrhosis [Trebicka 2020]. 43 ] is the most common cause of hospitalization in patients with cirrhosis [Moreau 2013] 46 ] HD patients are at high risk of short-term death [Moreau 2013] 46. The first episode of HD (also referred to herein as the first hepatic decompensation event) often requires hospitalization and indicates the transition from compensated cirrhosis to decompensated cirrhosis. Decompensated cirrhosis is characterized by recurrent episodes of HD 42 . HD has two distinct clinical manifestations depending on the presence or absence of other organ failures and the degree of systemic inflammation. The presence of multiple organ failure and severe systemic inflammation is a hallmark of acute-on-chronic liver failure (ACLF), a syndrome with a very high 28-day mortality rate. HD with moderate systemic inflammation without additional organ involvement has a low 28-day mortality rate (approximately 2%, though it increases to 10% by 90 days, suggesting heterogeneity in the clinical course of HD patients) [Trebicka 2020 43 , but it is suggested that the prognosis over the subsequent several years remains poor.

[0003] The only treatments for liver injury are removal of harmful stimuli (e.g., administration of effective antiviral therapy) and liver transplantation. Treatment of liver failure resulting from acute or chronic injury is limited to supportive care and / or transplantation, and the latter requires a donor. There is currently a shortage of organ donors, and surgery carries significant morbidity and mortality risks. In addition, patients also commit to lifelong immunosuppression. Furthermore, even though therapeutic interventions for specific etiologies have been relatively successful (e.g., novel antiviral therapies for hepatitis C virus infection, abstinence from alcohol for alcoholic liver disease), many diseases (e.g., NASH) have no approved treatments, and patients often delay seeking medical attention when cirrhosis and associated complications have already developed [Starkey 2019 44 . Accordingly, there are no specific therapies for treating cirrhosis, and thus providing effective antifibrotic therapies for both chronic and acute liver injury represents a large unmet clinical need 4~6 .

[0004] Macrophages (MΦ) play a crucial role in the inflammatory response of a damaged liver. The liver contains two main populations of MΦ: (i) resident macrophages (Kupffer cells, KCs) and (ii) infiltrating macrophages. Under homeostatic conditions, KCs circulate within the sinusoidal capillaries of the liver to phagocytose microbial debris that reaches the liver via these capillaries. In the early stages of liver injury, KCs express chemokines such as CCL2 and CCL5, thus contributing to the recruitment of monocytes from the bloodstream. 2,7 The number of KCs decreases during fibrosis and then regrows in the liver during the recovery phase of self-limiting fibrosis. 8 Infiltrating monocyte-derived macrophages (MΦ) (MDM) play a crucial role in the response to liver injury. Recruited via the CCR2 / CCL2 axis, MΦ enter the liver parenchyma and, in the early stages of hepatic fibrosis, may promote fibrosis by releasing factors such as TGF-β, IL-1, PDGF, and CCL2, locating along fibrotic septa and activating hepatic stellate cells, thereby exacerbating inflammation. This suggests a detrimental role of MΦ in progressive fibrosis. However, if MΦ are depleted at the onset of fibrotic remodeling, the remodeling process fails, and hepatic fibrosis persists. It is now widely recognized that macrophages play a dual role in the establishment and resolution of fibrosis. 2,8~11 .

[0005] Given the suggested role of macrophages in the healing of fibrosis, macrophage cell therapy is considered potentially effective in alleviating chronic liver fibrosis. Mouse bone marrow-derived macrophages (BMDMs) have been shown to reduce liver fibrosis when injected into a mouse model of chronic liver fibrosis. 12 Similar results have been reproduced using human monocyte-derived macrophages (hMDMs) in an immunodeficient mouse model of chronic liver fibrosis. 13 Furthermore, GMP-compliant cell culture protocols 14It is currently being used in an ongoing Phase II trial (MATCH, macrophage therapy for liver disease, ISRCTN10368050, see EudraCT 2015-000963-15) to generate hMDM for autologous transplantation in patients with cirrhosis. Macrophages are also extremely important in resolving acute conditions. 38 .

[0006] However, no therapy (macrophage cell therapy or other therapies) has been proven to efficiently treat patients with cirrhosis by acting through four crucial mechanisms: the recruitment of immune system cells to the liver (paracrine effect), the conversion of recruited monocytes into pro-restorative macrophages (polarization) effective in propagating the treatment effect, phagocytosis of fibrous scars, and reconstitution. In particular, no therapy has yet been found that acts through all of these mechanisms efficiently enough to treat patients with decompensated cirrhosis who have experienced one or more hepatic decompensation events. Effective treatment for this clinically vulnerable population is needed. [Prior art documents] [Patent Documents]

[0007] [Patent Document 1] International Publication No. 2019 / 118888A1 [Patent Document 2] International Publication No. 2022 / 047119A1 [Patent Document 3] International Publication No. 2019 / 175595 [Patent Document 4] International Publication No. 2012 / 062930 [Patent Document 5] International Publication No. 2019175595 [Patent Document 6] U.S. Patent No. 8,058,069 [Patent Document 7] U.S. Patent No. 8,492,359 [Patent Document 8] U.S. Patent No. 8,822,668

Patent document 9

Patent document 10

Patent document 11

Patent document 12

Patent document 13

Patent document 14

Patent document 15

Patent document 16

Non-licensed literature

[0008] [Non-licensed document 1] Roth, IL-10 Is an Autocrine Inhibitor of Human Placental Cytotrophoblast MMP-9 Production and Invasion, Developmental Biology, Volume 205, 1st Edition, 1999, Pages 194~204 [Non-licensed document 2] Krishnamurthy, IL-10 inhibits inflammation and attenuates left ventricular remodeling after myocardial infarction via activation of STAT3 and suppression of HuR, Circ Res., 2009 Jan 30;104(2) [Non-licensed document 3] Balcar et al., United European Gastroenterol J. 2021; 9(4): pp. 427~437

Non-Patent Document 4

Non-Patent Document 5

Non-Patent Document 6

Non-Patent Document 7

Non-Patent Document 8

Non-Patent Document 9

Summary of the Invention

[0009] Introduction to the present invention Typically, human macrophages (hMDMs) induced in vitro from monocytes express IL-10, but as shown in the results in Figure 1, it is not secreted by macrophages in significant amounts. Here, the inventors demonstrate that transient transfection of IL-10 and MMP9 enhances the anti-fibrotic and anti-inflammatory properties of macrophages, demonstrating the principle of how further expression of these genes delivers IL-10 and active MMP-secreting macrophages, thereby delivering promising products that aid in inflammatory states such as the dissipation of acute and chronic organ injury.

[0010] IL-10 is known for its anti-inflammatory properties, and some MMPs play a role in aiding fibrosis reconstruction. However, the effects of further expression of a combination of IL-10 and MMP9 are currently unknown. In addition, we have demonstrated that macrophages engineered to overexpress IL-10 can be used in the effective treatment of liver cirrhosis in particular. Specifically, without being bound by theory or mechanism, the engineered macrophages described herein (specifically, engineered macrophages expressing both IL-10 and MMP9) show activity and / or improvement in each of the four mechanisms of action (i.e., 1) reconstruction of fibrous scars, 2) phagocytosis, 3) paracrine effects, and 4) polarization) that are considered to be the basis of therapeutic macrophage efficacy. Figure 32 illustrates how these mechanisms contribute to the therapeutic effect of macrophages, specifically showing how the therapeutic effect can be amplified through the recruitment of endogenous monocytes and their polarization into regenerative macrophages (this amplification is also referred to as a "virtuous cycle").

[0011] The inventors demonstrate that human monocyte-derived macrophages (hMDMs) transfected (Trx) with mRNA expressing IL-10 or IL-10-p2A-MMP9 (referred to herein as IL-10+MMP9) can be polarized into a regenerative phenotype based on the expression of CD14, CD206high, 25F9, CD163, CCR2low / neg, CD86low, and HLA class II low. Furthermore, in the examples, the inventors have demonstrated that IL-10 Trx and IL-10-MMP9 Trx hMDMs, when tested in peripheral blood mononuclear cell (PBMC) migration assays, can recruit significantly more monocytes compared to hMDMs currently used in the MATCH clinical trial (trial registration numbers: ISRCTN10368050 and EudraCT; reference 2015-000963-15. Trial protocol: A multicenter, open-label, parallel-group, phase 2, randomized controlled trial of autologous macrophage therapy for cirrhosis). Recruitment can be tested by any preferred method, such as Boyden chamber-based techniques. In the examples, the inventors tested immune cell migration in the Transwell cell migration and infiltration assay (Boyden chamber assay). While not wishing to be bound by theory or mechanism, IL-10-Trx macrophages can specifically recruit monocytes without substantially recruiting other immune cell types. Surprisingly, IL-10-MMP9 Trx hMDM exhibits superior monocyte recruitment ability compared to MMP9-Trx and IL-10-Trx. This process suggests a synergistic effect between the two proteins. Indeed, macrophages transfected with MMP9 alone have shown little to no ability to attract monocytes (Figure 12), and matrix metalloproteinase activity generally increases in such cells (data not shown). Furthermore, IL-10 and MMP9 Trx hMDM demonstrate superior anti-inflammatory profiles and phagocytic activity.

[0012] Finally, the inventors discovered that overexpression of IL-10 alone reduced overall matrix metalloproteinase (MMP) activity and the level of MMP9 secreted into the supernatant of genetically engineered macrophages. The metalloproteinase assay for determining activity levels is as described in the examples. The adverse effect of IL-10 on MMP activity is consistent with literature findings (e.g., Roth et al., IL-10 Is an Autocrine Inhibitor of Human Placental Cytotrophoblast MMP-9 Production and Invasion, Developmental Biology, Vol. 205, 1st edition, 1999, pp. 194-204; and Krishnamurthy et al., IL-10 inhibits inflammation and attenuates left ventricular remodeling after myocardial infarction via activation of STAT3 and suppression of HuR, Circ Res., January 30, 2009; 104(2)).

[0013] Therefore, the inventors also provide macrophages engineered with sequences encoding a specific MMP, MMP9. Interestingly, when comparing non-Trx hMDM with IL-10+MMP9 Trx hMDM, MMP9 expression does not increase dramatically, but the overall matrix metalloproteinase activity of IL-10+MMP9 Trx hMDM is significantly increased.

[0014] In summary, these data support the use of IL-10 + MMP9 Trx hMDM as a therapeutic agent in the treatment and / or prevention of inflammatory conditions (e.g., those associated with organ damage), and it is predicted to be effective in patients with severe disease, such as those with cirrhosis who have experienced one or more (e.g., multiple) hepatic decompensation events. Although IL-10 is known as an anti-inflammatory cytokine, previous data have shown that IL-4-stimulated macrophages are regenerative in animal models of acute liver disease, while IL-10-stimulated macrophages are not. 15 This is somewhat surprising. To enhance the anti-fibrotic function (by increased matrix metalloproteinase activity) and pro-recovery function (by increased monocyte migration) of macrophage-based therapeutics, additional IL-10 and MMP9 expression (e.g., by transfection) combinations may also be considered. Therefore, since the macrophages of the present invention recruit monocytes in situ to provide further therapeutic effects, the recruitment of monocytes to the inflammatory site by such IL-10 and MMP9-expressing macrophages is important. The recruited monocytes can be converted into pro-recovery macrophages, thereby enhancing the therapeutic effect of the macrophage. Pro-recovery phenotypes are extensively described herein.

[0015] Chronic inflammation-induced organ damage is often accompanied by fibrosis, such as in chronic liver disease. Such fibrosis can lead to cirrhosis and, consequently, to decompensated hepatic events, which can become severe enough to require hospitalization and / or be fatal. Therefore, therapeutic macrophages with anti-inflammatory and anti-fibrotic properties would be beneficial, particularly in patients who have experienced one or more (e.g., multiple) decompensated hepatic events.

[0016] As described above, the inventors have found that macrophages engineered to overexpress IL-10 exhibit a decrease in overall MMP activity. In contrast, macrophages engineered to further express MMP9, for example by engineering with a nucleic acid encoding MMP9, exhibit not only enhanced MMP9 activity but also enhanced overall MMP activity. Here, for the first time, the inventors found that combined expression of IL-10 and MMP9 significantly enhanced the overall MMP activity of engineered macrophages more than would be expected from data of macrophages transfected with IL-10 or MMP9 individually. Thus, the inventors demonstrate a remarkable synergistic effect of combined expression of IL-10 and MMP9 on overall MMP activity. For this reason, macrophages are designed to be provided with additional / exogenous encoding sequences of IL-10 and MMP9, in addition to those naturally present in the cell. Such combinations are neither taught nor suggested in the prior art. The inventors demonstrate that macrophages transfected with a complex mRNA construct expressing IL-10 and MMP9 can be polarized into macrophages with a pro-recovery phenotype, as described herein.

[0017] Furthermore, the inventors have demonstrated that IL-10-MMP9-Trx hMDM localizes to the liver in a disease model of hepatic inflammation / fibrosis. Equally demonstrated is the ability of engineered macrophages to recruit significantly more monocytes compared to hMDM (non-engineered) currently used in MATCH. Such recruitment tests were performed in vitro using the standard assays described herein. In summary, these data support the use of IL-10 and MMP9-Trx hMDM as improved therapeutic agents in the treatment and / or prevention of inflammatory conditions (e.g., those associated with organ damage). Indeed, the improved cellular properties described herein suggest that it may be possible to treat patients with particularly severe disease (e.g., hospitalized patients due to an initial hepatic decompensation event, and subsequently those experiencing further decompensation events) for whom liver transplantation has previously been the only treatment option.

[0018] As used herein, “first hepatic decompensation event” or “first hepatic decompensation event” refers to a decompensation event that is not preceded by a previous decompensation event within the past six months. For example, a first decompensation event cannot be preceded by a previous decompensation event within the past twelve months. In certain embodiments, the first decompensation event is not preceded by any previous decompensation event in the subject, and in such embodiments, the subject has never experienced a previous decompensation event prior to the first decompensation event.

[0019] Matrix metalloproteinases (MMPs), also known as matrix metalloproteinases or matrixins, are a family of zinc-dependent polypeptidases that collectively degrade various proteins within the extracellular matrix (ECM). MMPs play numerous roles in vivo, making them quite complex to understand. While MMPs have been reported as a contributing factor to fibrosis, their ability to reconstruct the matrix also makes them crucial in fibrosis regression. This dual role in fibrosis progression and regression can be understood to some extent through their complex in vivo activities, ranging from cytokine and chemokine activation and immune cell recruitment to the degradation of the extracellular matrix. Furthermore, in vivo MMP activation and subsequent activity are highly regulated, primarily by tissue inhibitors of metalloproteinases (TIMPS), further complicating the understanding of MMP activity in fibrosis. In experimental models of pulmonary fibrosis, increased MMP9 (collagen-targeting type IV collagenase) activity has been shown, which is associated with the destruction of alveolar epithelial membranes, suggesting a putative pro-fibrotic effect of MMP9 in lung injury. However, in bleomycin-induced models of pulmonary fibrosis, while the lungs of MMP9-deficient mice showed limited alveolar bronchiolization, MMP9-deficient mice developed pulmonary fibrosis similar to that of wild-type littermates. Overall, the precise role of MMPs in fibrosis is not fully understood. Furthermore, in vitro-derived hMDM expresses only very small levels of MMPs, and their activity is barely detectable in the conditioned medium of these cells.

[0020] The field of MMP gene manipulation has been largely unreported. MMP9 transfection in THP1 cells has been used as a research tool to understand the inflammatory response of macrophages in atherosclerosis. Therapeutologically, overexpression of MMP9 in lentiviral transduced iPSCs has been used to enhance the repair of damaged myocardium. MMP12 (an elastase that targets soluble and insoluble elastin) is overexpressed in endothelial progenitor cells for use in melanoma cell therapy. To the best of our knowledge, previous studies using MMP transfection in human macrophages have not yielded macrophages with anti-fibrotic properties. Cabrera et al. demonstrated that overexpression of MMP9 in macrophages from bleomycin-loaded transgenic mice reduces fibrosis. 45 Differences in TIMP-1 levels were also observed between transgenic mice and wild-type mice. However, no differences in the expression levels and activity of other matrix metalloproteinases were reported.

[0021] MMPs possess a complex biology, which is often specific to organs and diseases. For example, MMP9 exhibits significant anti-fibrotic effects in models of chronic liver and lung disease. However, MMP9 appears to be harmful in renal fibrosis.

[0022] International Publication No. 2019 / 118888A1 (TREATMENT OF FIBROSIS WITH GENETICALLY-ENGINEERED MACROPHAGES) describes macrophages engineered for the treatment of fibrosis. For example, genetically engineered macrophages containing recombinant extracellular matrix (ECM) targeting proteins and / or recombinant proteases. The recombinant protease may be a matrix metalloproteinase (MMP), and may be any one of a long list of possible MMPs such as MMP9 and MMP12. However, IL-10 or cytokines are not mentioned in relation to the manipulation of cells.

[0023] International Publication No. 2022 / 047119A1 (MODIFIED IMMUNE CELLS FOR FIBROSIS AND INFLAMMATION) describes modified immune cells comprising one or more nucleic acid sequences encoding (i) at least one exogenous fibrollytic agent and / or (ii) at least one exogenous anti-inflammatory agent. The at least one exogenous fibrollytic agent may include matrix metallopeptidases (MMPs), e.g., one or more from a long list of possible MMPs such as MMP9 and MMP12. The at least one exogenous anti-inflammatory agent may include, for example, cytokines, chemokines, or pentraxin, and the cytokines may include, for example, IL-10, IL-4, IL-13, and / or TGF-beta. These modified immune cells may include macrophages. However, specific combinations of these possible genes and cell types are not disclosed, and furthermore, combinations are not illustrated in this application, and only single genes are tested. Furthermore, the applicant has not attempted to determine the effect of IL-10 expression on the expression of other proteins, such as MMPs. Moreover, the data provided in the application International Publication No. 2022 / 047119A1 shows that IL-10 transfected macrophages produce CD-80, at least one pro-inflammatory marker on the macrophages, which is undesirable for treating inflammatory conditions.

[0024] International Publication No. 2019 / 175595 describes the use of autologous, isolated, unprocessed human macrophages in the treatment of liver diseases such as cirrhosis. However, the macrophages of this application are not polarized and are unprocessed. Therefore, such cells are not very useful in the treatment of inflammatory conditions and conditions involving fibrotic elements.

[0025] International Publication No. 2012 / 062930 describes the use of a composition comprising macrophages overexpressing IL-10 from transfected mRNA as a pharmaceutical. However, this application does not disclose the combination of IL-10 and MMP9, or the treatment of cirrhosis. The inventors have demonstrated the beneficial effects of macrophages engineered to express specific combinations of IL-10 and MMP9, for example, in the treatment of inflammatory and fibrotic diseases.

[0026] Importantly, none of the cells described in the Art have been demonstrated to be effective in human cirrhotic patients experiencing hepatic decompensation events requiring hospitalization. We are the first to evaluate the safety and efficacy of IL-10 and MMP9-overexpressing macrophages in human subjects hospitalized due to hepatic decompensation events. Specifically, we are evaluating a specific patient population that is clinically stable after an initial hepatic decompensation event but has experienced further decompensation events prior to administration of therapeutically engineered macrophages. Understandably, subjects experiencing subsequent decompensation events are at higher risk of morbidity and mortality compared to subjects not experiencing further decompensation events and subjects stable after a single decompensation event.

[0027] As is evident from the above discussion of the latest technologies, no therapy (macrophage cell therapy or other therapy) has been shown to effectively treat this patient population. Data presented in the examples demonstrate that the macrophages described herein act through four crucial mechanisms: recruitment of immune system cells to the liver (paracrine effect), conversion of recruited monocytes into regenerative macrophages effective in propagating the therapeutic effect (polarization), phagocytosis of fibrous scars, and reconstitution. In particular, no therapy has been found to date that can treat patients with decompensated cirrhosis who have experienced an initial hepatic decompensation event requiring hospitalization, as well as subsequent decompensation events. The macrophages described herein are expected to be effective in this particularly vulnerable patient population because the inventors have demonstrated that the macrophages can act through at least four mechanisms described herein.

[0028] One or more aspects or embodiments of the claimed invention aim to solve one or more of the problems described above. [Means for solving the problem]

[0029] Macrophages for use in disease treatment The present invention provides engineered macrophages for use in the treatment of subjects (particularly cell therapy) where such treatment is needed. Subjects may have conditions, diseases, or disorders that would benefit from administration of the macrophages of the present invention. Such conditions, diseases, or disorders may have inflammatory and / or fibrotic elements. Such conditions, diseases, or disorders may be acute or chronic, or may experience acute exacerbations. Such conditions, diseases, or disorders may cause organ damage. The organs may be any suitable organs, such as the liver, lungs, or kidneys.

[0030] In some embodiments, the condition is a chronic inflammatory state, such as, for example, a chronic liver disease / injury, but not limited to these. In preferred embodiments, the condition is not an acute inflammatory state without cirrhosis. In other words, if the condition is an acute inflammatory state, the subject preferably has cirrhosis. In some embodiments, the condition, disease, or disorder in the subject is a chronic inflammatory state with fibrotic elements. In some embodiments, the condition is a chronic organ injury associated with chronic inflammation. In some embodiments, the condition is an acute inflammatory state. In some embodiments, the condition is an acute exacerbation of a chronic inflammatory state.

[0031] In some embodiments, the condition relates to the kidneys, liver, or lungs. For example, the condition may be liver injury, kidney injury, or lung injury.

[0032] In some embodiments, the condition may be acute exacerbation of chronic liver failure (ACLF). ACLF is a syndrome characterized by acute decompensation of chronic liver disease with organ failure and a high short-term mortality rate. An excessive systemic inflammatory response appears to play a significant role in the development of ACLF.

[0033] In some embodiments, the condition may be liver injury. In preferred embodiments, the liver injury is chronic liver injury, and optionally inflammatory liver injury. In preferred embodiments, the inflammatory liver injury has fibrotic elements. In preferred embodiments, the condition is chronic inflammatory liver injury with fibrotic elements, and preferably cirrhosis. Preferably, the liver injury is not acute liver injury. Specifically, the liver injury is preferably not acute liver injury without cirrhosis as an underlying disease. In other words, if the condition is acute liver injury, the subject preferably has cirrhosis. In preferred embodiments, the liver injury is not drug-induced liver injury (DILI).

[0034] Cirrhosis, regardless of the underlying etiology, represents the final stage of chronic liver injury and progressive fibrosis (scarring). It is characterized by severe hepatic fibrosis leading to the breakdown of liver structure, hepatocyte dysfunction, and portal hypertension. Various etiologies can lead to cirrhosis. Liver damage with fibrotic components that can lead to fibrosis includes, but is not limited to, non-alcoholic fatty liver disease (NAFL) (e.g., non-alcoholic fatty liver disease (NAFLD) or non-alcoholic steatohepatitis (NASH)) or alcoholic liver disease (e.g., alcoholic fatty liver disease (AFLD) or alcoholic steatohepatitis (ASH)). Subjects may be examined before treatment to diagnose cirrhosis.

[0035] In a preferred embodiment, the present invention provides a method for treating cirrhosis in a subject, comprising the step of administering to the subject engineered macrophages engineered to overexpress IL-10. The present invention also provides engineered macrophages for use in a method for treating cirrhosis in a subject, the method comprising administering the engineered macrophages to a subject, the engineered macrophages engineered to overexpress IL-10. The engineered macrophages are optionally further engineered to overexpress MMP9.

[0036] Transient elastography (TE), also known as FibroScan, can be used to diagnose individuals with cirrhosis. Transient elastography uses ultrasound to provide a measurement of "liver stiffness," which can be measured in units of pressure such as kilopascals (kPa). In some embodiments, individuals may be diagnosed with cirrhosis based on a liver stiffness score greater than 15 kPa, as measured using transient elastography.

[0037] The diagnosis of cirrhosis can also be made based on clinical and / or radiological features and / or laboratory values ​​that correlate with cirrhosis. Clinical features that correlate with cirrhosis may include, for example, jaundice, pruritus, ascites, edema, hepatic encephalopathy, hepatorenal syndrome / acute kidney injury (HRS / AKI), variceal bleeding, gastrointestinal bleeding, and spontaneous bacterial peritonitis (SBP). Detectable radiological features of the liver that correlate with cirrhosis may include hypertrophy of the caudate lobe and the lateral segment of the left lobe, and / or atrophy of the posterior segment of the right lobe of the liver. Laboratory values ​​that correlate with cirrhosis may include elevated INR or PR, decreased platelet count (<150K × 10EE⁹ / L), elevated bilirubin, and / or decreased serum albumin.

[0038] The diagnosis of cirrhosis can also be made based on a liver biopsy to confirm the histological characteristics of the cirrhosis. Cirrhotic tissue can be identified by the presence of fibrous tissue, for example, by staining for the presence of collagen.

[0039] In a preferred embodiment, the subject is (a) Clinical or radiological features consistent with cirrhosis; (b) Liver stiffness measurements (LSM) measured using transient elastography with a pressure greater than 15 kPa; and (c) Support for the histological characteristics of cirrhosis based on past liver biopsies A diagnosis of cirrhosis is made based on the presence of at least one of the following:

[0040] Possible causes of fibrosis include, but are not limited to, fatty liver diseases (SLDs) such as metabolic dysregulation-associated fatty liver disease (MASLD), metabolic steatohepatitis (MASH), or Met-ALD. In some cases, the cause of the fatty liver disease is unknown, and this may be called idiopathic SLD.

[0041] Metabolic dysfunction-related fatty liver disease refers to non-alcoholic fatty liver disease, and may therefore also be known as NAFLD. Metabolic-related steatohepatitis refers to a more severe form of MASLD and may also be known as NASH (non-alcoholic steatohepatitis). "Met-ALD" refers to individuals who have fatty liver disease and also drink alcohol moderately. In other words, individuals with a non-alcoholic steatohepatitis etiology may, in some cases, also have some degree of alcoholic liver disease (ALD) caused by alcohol consumption. Patients with NASH who also consume alcohol may also be said to have a NASH etiology caused by some degree of ALD. "Idiopathic SLD" refers to SLD of unknown cause, such as individuals who do not have any known metabolic risk factors for SLD.

[0042] In some embodiments, the condition is NASH with or without some degree of ALD, or cirrhosis with an etiology of ALD. In some embodiments, the subject may have NASH with or without some degree of ALD. In some embodiments, the subject may have ALD. In preferred embodiments, if the subject has ALD, there is currently no alcohol abuse, preferably no alcohol abuse for at least three months prior to screening the subject for treatment or prior to the start of treatment. "Alcohol abuse" is defined as consuming more than 3 units / day of alcohol for women, more than 4 units / day of alcohol for men, or heavy drinking (more than 14 units / day). One unit is equivalent to 14g of alcohol: half a pint of beer (approximately 240mL), one glass of wine (125mL), or one (25mL) unit of distilled spirits. According to some embodiments, alcohol abuse can take on a variety of values, and for example, when measured according to NIAID values ​​or UK values, alcohol intake exceeding 14 g / day for women or exceeding 21 g / day for men may be considered to correlate with ALD.

[0043] Examples of fibrotic diseases, disorders, and conditions include mechanical trauma, biliary obstruction, autoimmune hepatitis, iron overload, hepatitis B infection (HBV), and / or hepatitis C infection (HCV). Genetically engineered macrophages according to the present invention can treat cirrhosis regardless of the underlying etiology. However, in preferred embodiments, the fibrosis of the subject is not caused by any viral hepatitis other than hepatitis C. In other words, if the etiology of the fibrosis or cirrhosis of the subject is viral, the causative virus is preferably hepatitis C virus (HCV). If the etiology of the condition is viral, the viral infection is preferably treated, and as a result, a sustained virological response may be observed in the subject. If the causative agent is HCV, the subject preferably has a sustained virological response to HCV, accompanied by ongoing cirrhosis. In some embodiments, HCV RNA is present in the subject's serum at a concentration of less than 25 IU / mL for at least 12 weeks after HCV treatment. In a more preferred embodiment, the etiology of fibrosis or cirrhosis is neither autoimmune nor cholestatic. Cirrhotic cirrhosis refers to cirrhosis caused by a delay in the flow of bile through the biliary system, leading to inflammation of the liver. Cholestasis can result from an autoimmune reaction that damages the bile ducts. Examples of cirrhotic cirrhosis include primary biliary cholangitis (PBC) and primary sclerosing cholangitis (PSC). Therefore, the subjects are preferably those who do not have, or are not known to have, autoimmune hepatitis, primary biliary cholangitis (PBC), and / or primary sclerosing cholangitis (PSC). In preferred embodiments, subjects are diagnosed with cirrhosis and further have a liver disease etiology that is either pure metabolic dysfunction-related fatty liver disease (MASLD), or metabolism and alcohol-related liver disease (Met-ALD), or HCV sustained virological response (HCV SVR) with progressing cirrhosis, or pure ALD (not Met-ALD) only when confirmed to be free from alcohol abuse as described above. According to some embodiments, subjects have a MELD 3.0 score of 12-20 when measured within two weeks of an eligible decompensated event.

[0044] Cirrhosis can be either compensated cirrhosis or decompensated cirrhosis (also referred herein as hepatic decompensation or HD). Decompensated cirrhosis is defined as a rapid decline in liver function in a patient with cirrhosis and is characterized by symptoms including, but not limited to, jaundice, ascites, hepatic encephalopathy, hepatorenal syndrome, variceal bleeding, gastrointestinal bleeding, and any combination thereof. In other embodiments, the liver disease is decompensated cirrhosis. In some embodiments, the liver disease is compensated cirrhosis. In some embodiments, the patient had compensated cirrhosis and had at least one event (or exactly one event) of decompensated cirrhosis.

[0045] In some embodiments, subjects may have experienced their first hepatic decompensation event or have refractory ascites. In preferred embodiments, the refractory ascites began within six months prior to macrophage administration. In preferred embodiments, subjects are hospitalized after or due to their first hepatic decompensation event. Hospitalization after a hepatic decompensation event is a measure of disease severity and indicates a specific clinical situation. While certain symptoms of hepatic decompensation are similar to those of less severe cirrhosis, if a patient is hospitalized after their first hepatic decompensation event, this indicates that the disease is severe enough to particularly benefit from the present invention.

[0046] The subjects may exhibit, or have recovered from, one or more clinical signs of hepatic decompensation selected from a list consisting of jaundice, ascites, hepatic encephalopathy, hepatorenal syndrome, variceal bleeding, and gastrointestinal bleeding. In certain embodiments, the subjects may exhibit, have recovered from, or be hospitalized due to, ascites, hepatic encephalopathy, variceal bleeding (variceal discharge), hepatorenal syndrome / acute kidney injury (HRS / AKI), and / or spontaneous bacterial peritonitis (SBP). Therefore, the procedure may include a step of detecting clinical signs of hepatic decompensation in the subjects (e.g., ascites, hepatic encephalopathy, variceal bleeding (variceal discharge), hepatorenal syndrome / acute kidney injury (HRS / AKI), and / or spontaneous bacterial peritonitis (SBP)).

[0047] In some embodiments, subjects are initially hospitalized for a hepatic decompensation event defined as the presence of ascites, hepatic encephalopathy, variceal bleeding (variceal vasoconstriction), hepatorenal syndrome / acute kidney injury (HRS / AKI), and / or spontaneous bacterial peritonitis (SBP). In some embodiments, subjects are confirmed to be clinically stable after the initial hepatic decompensation event requiring hospitalization and before administration of manipulated macrophages to the subjects.

[0048] In a preferred embodiment, the manipulated macrophages are administered to the subject only if they are judged to be clinically stable after the first hepatic decompensation event, preferably within six weeks of this first visit (the subject's MELD score has been measured for the first time and the subject has undergone informed screening), provided that the subject remains clinically stable prior to administration. In a preferred embodiment, the patient is clinically stable for at least six weeks prior to G-CSF mobilization.

[0049] As used herein, “clinically stable” (also referred to herein as “recompensated”) means (i) A reduction in the Model for End Stage Liver Disease 3.0 score in two separate MELD score assessments conducted within two weeks of each other (e.g., a reduction of at least 1 point); and (ii) A physician's assessment of the subject, including a documented review of MELD, that the subject is stable enough to safely undergo cell mobilization (with G-CSF such as filgrastim), apheresis, and / or treatment with manipulated macrophages without imposing a substantial risk to patient safety. It is defined as either or both of the above.

[0050] In a more preferred embodiment, after being determined to be clinically stable, the subject may experience subsequent further decompensation events before administration of manipulated macrophages according to the treatment of the present invention. Thus, in certain embodiments, a subject treated with manipulated macrophages of the present invention may have experienced a second hepatic decompensation event after being determined to be clinically stable after the first hepatic decompensation event and before administration of the manipulated macrophages. For example, according to the preferred embodiment described above, the subject has experienced an initial hepatic decompensation event requiring hospitalization and is clinically stable, but then experiences at least another hepatic decompensation event (after G-CSF mobilization, after apheresis, or after the production of manipulated macrophages), and therefore, the manipulated macrophages are administered only after the subject has been clinically stable after at least two hepatic decompensation events. In a preferred embodiment, the patient is clinically stable for at least six weeks prior to G-CSF mobilization.

[0051] Accordingly, in some embodiments, the subject to be treated has experienced multiple hepatic decompensation events prior to administration of macrophages manipulated according to the treatment of the present invention; preferably, the subject is administered the manipulated macrophages only after becoming clinically stable following multiple hepatic decompensation events; preferably, the subject is clinically stable within 6 weeks after the initial visit (when the subject's MELD score is measured for the first time and the subject undergoes informed screening). In preferred embodiments, the patient is clinically stable for at least 6 weeks prior to G-CSF mobilization.

[0052] The macrophages, compositions, and methods of the present invention are expected to be effective in treating patients hospitalized after an initial hepatic decompensation event (particularly those experiencing further subsequent decompensation events). As is known in the art, when a subject experiences multiple decompensation events, the severity of decompensated cirrhosis and mortality increase. 42Therefore, although not bound by theory or mechanism, patients who have experienced multiple hepatic decompensation events are at particular risk, and it is preferable to treat this population to minimize the number of further decompensation events and increase survival rates without transplantation. Furthermore, the data presented in the examples demonstrate that the cells, compositions, and methods of the present invention are suitable for treating these specific patients with severe diseases that are difficult to treat.

[0053] Therefore, in preferred embodiments, the subject has experienced a subsequent, further hepatic decompensation event following the initial decompensation event. As used herein, the reference to a “further” decompensation event refers to a decompensation event that follows the initial hepatic decompensation event and may also be referred to as a “subsequent” decompensation event. In preferred embodiments, the subject is treated with manipulated macrophages after the subsequent decompensation event. In other words, the subject may have experienced a further decompensation event prior to treatment. In some embodiments, the subject has not recovered from the subsequent decompensation event, i.e., remains decompensated, when administered with manipulated macrophages. Therefore, the subject may still exhibit one or more clinical signs of decompensation at the time of treatment (e.g., ascites, hepatic encephalopathy, variceal bleeding (variceal vasoconstriction), hepatorenal syndrome / acute kidney injury (HRS / AKI), and / or spontaneous bacterial peritonitis (SBP)). In other embodiments, subjects have recovered from subsequent decompensatory events and do not show clinical signs of decompensation when macrophages are administered to them. In some embodiments, subjects are deemed clinically stable before administration of the manipulated macrophages.

[0054] In some embodiments, if the manipulated macrophages are autologous to the subject and generated from the subject's own monocytes collected by apheresis, the subsequent decompensation event occurs after the collection of monocytes from the subject. In some embodiments, the subsequent decompensation event occurs after the manipulated macrophages have been generated. In other words, the apheresis and manipulation steps may be performed before the subsequent decompensation event.

[0055] Accordingly, in certain embodiments, the present invention provides engineered macrophages and compositions comprising engineered macrophages for use in a method of treating a patient exhibiting one or more clinical signs of a hepatic decompensation event selected from the list consisting of jaundice, ascites, hepatic encephalopathy, hepatorenal syndrome, variceal bleeding, and gastrointestinal bleeding, wherein one or more clinical signs require hospitalization.

[0056] In some embodiments, the present invention relates to engineered macrophages and compositions comprising engineered macrophages for use in a method of treating a patient diagnosed with cirrhosis, wherein the patient optionally has a liver disease etiology of alcohol-related liver disease (ALD or Met-ALD), which is (1) pure metabolic dysfunction-related fatty liver disease (MASLD) or metabolic and alcohol-related liver disease (Met-ALD), or (2) persistent virological response to HCV with progressive cirrhosis (HCV SVR), or (3) only when it has been confirmed that the patient does not drink alcohol above abusive levels and the PEth alcohol test value is less than 25 mg / l, and the patient (a) The patient has been hospitalized for the first time within the last six months as a patient with a severe hepatic decompensation event defined as ascites, hepatic encephalopathy (HE), variceal bleeding, hepatorenal syndrome / acute kidney injury (HRS / AKI), spontaneous bacterial peritonitis (SBP), or a combination thereof; or (b) Provided are manipulated macrophages and compositions having refractory ascites (also referred to herein as medically refractory ascites) that began within 6 months prior to treatment with the manipulated macrophages (second massive paracentesis).

[0057] As used herein, the terms “refractory ascites” or “medically refractory ascites” refer to ascites that cannot be mobilized or that recur and consequently require repeated (more than two) massive paracentesis (LVP) (i.e., treatment, not diagnosis) at least once every eight weeks (in this case, the onset date of refractory ascites is defined as the date of the second LVP). As used herein, the term “refractory ascites” refers to ascites that requires repeated (more than one) massive paracentesis (treatment, not diagnosis) despite best medical efforts to control the ascites with the use of diuretics and restriction of sodium from the diet. As used herein, the term “recurrent ascites” refers to ascites that recurs within six months (i.e., a second massive paracentesis). In a preferred embodiment, the patient’s refractory ascites began within six months prior to the procedure.

[0058] In some embodiments, the present invention provides engineered macrophages and compositions comprising engineered macrophages for use in a method of treating a patient diagnosed with cirrhosis, wherein the patient has experienced a qualifying decompensation event and optionally has a liver disease etiology of alcohol-related liver disease (ALD or Met-ALD), only if the patient has (1) pure metabolic dysfunction-related fatty liver disease (MASLD) or metabolic and alcohol-related liver disease (Met-ALD), or (2) persistent virological response to HCV with progressive cirrhosis (HCV SVR), or (3) the patient has been confirmed not to be drinking alcohol above abusive levels and has a PEth alcohol test value of less than 25 mg / l.

[0059] According to several embodiments, provided herein are engineered macrophages of the present invention for the treatment of cirrhosis in subjects experiencing an eligible event. As used herein, an "eligible event" (also referred herein as an "eligible decompensated event" or "eligible serious decompensated event") in a subject refers to a recent serious hepatic decompensated event selected from the group consisting of: (a) A recent severe hepatic decompensation event requiring hospitalization of the subject, which is the first hospitalization within six months following a previous decompensation event, and which includes at least one of the following: ascites (recurrent or medically refractory), hepatic encephalopathy, variceal bleeding, hepatorenal syndrome / acute kidney injury (HRS / AKI), and spontaneous bacterial peritonitis (SBP). Such subjects experiencing such a severe hepatic decompensation event may also be referred to herein as hospitalized subjects or subjects currently hospitalized; and (b) Intractable ascites within the past six months. Subjects with such intractable ascites may also be referred to as outpatients in this specification.

[0060] In some embodiments, the present invention provides engineered macrophages and compositions comprising engineered macrophages for use in a method of treating a patient exhibiting one or more clinical signs of a hepatic decompensation event selected from the group consisting of ascites, hepatic encephalopathy, variceal bleeding, hepatorenal syndrome / acute kidney injury (HRS / AKI), spontaneous bacterial peritonitis (SBP), or a combination thereof, wherein the subject has previously been hospitalized for another first hepatic decompensation event. The subject may exhibit ascites, hepatic encephalopathy, variceal bleeding (variceal bleeding), hepatorenal syndrome / acute kidney injury (HRS / AKI), and / or spontaneous bacterial peritonitis (SBP), or a combination thereof, as the first hepatic decompensation event requiring hospitalization. In other embodiments, the present invention provides engineered macrophages and compositions comprising engineered macrophages for use in a method of treating patients exhibiting one or more clinical signs of hepatic decompensation events selected from the group consisting of ascites, hepatic encephalopathy, variceal bleeding, hepatorenal syndrome / acute kidney injury (HRS / AKI), spontaneous bacterial peritonitis (SBP), or a combination thereof, the subject being engineered macrophages and compositions for patients previously diagnosed with refractory ascites.

[0061] Hospitalization refers to entering a hospital for treatment. Therefore, hospitalization typically requires the patient to stay in the hospital for at least 24 hours. Since symptoms cannot be managed outside the hospital, hospitalization is a measure of disease severity. Hospitalization is a recognized measure of disease severity and the patient's condition in liver cirrhosis. 42 (See, for example, Balcar et al., United European Gastroenterol J.2021; 9(4): pp. 427-437). In preferred embodiments, subjects treated with the methods and manipulated macrophages described herein are admitted as first-time patients with a severe hepatic decompensation event, which may be referred to herein as an eligible event. A severe hepatic decompensation event requiring hospitalization may be characterized by the presence of at least one of the following: ascites, hepatic encephalopathy, variceal bleeding (variceal extirpation), hepatorenal syndrome / acute kidney injury (HRS / AKI), and / or spontaneous bacterial peritonitis (SBP).

[0062] In other embodiments, subjects are treated with manipulated macrophages when they have recovered (recompensated) from an initial hepatic decompensation event, and optionally, subjects were hospitalized after the initial hepatic decompensation event. In some embodiments, subjects are treated with the cells, compositions, or cell populations of the present invention after discharge from the hospital. According to some embodiments, recovery (recompensation) from a hepatic decompensation event is defined by a physician's clinical assessment and / or no significant increase in the MELD score between discharge and treatment. In some embodiments, subjects exhibit and / or have recovered from one or more clinical signs of hepatic decompensation selected from the list consisting of jaundice, ascites, hepatic encephalopathy, hepatorenal syndrome, variceal bleeding, and gastrointestinal bleeding.

[0063] According to some embodiments, subjects are treated after recovery from an initial hepatic decompensation event requiring hospitalization and before experiencing any further hepatic decompensation events.

[0064] Further criteria may be used to select patients who are likely to particularly benefit from the treatment. In a preferred embodiment, the subjects represent any combination of the inclusion criteria described in Example 25. In a preferred embodiment, the subjects do not represent any of the exclusion criteria described in Example 25.

[0065] In some embodiments, the method includes a step of evaluating a subject with respect to an indicator of whether the treatment would be particularly beneficial to the subject, or the subject to be treated has been evaluated with respect to such an indicator. In a preferred embodiment, the subjects have one or more, or preferably all, of the following characteristics: no known contraindications to treatment with G-CSF (especially filgrastim) and no known contraindications to experiencing apheresis (especially leukocyte apheresis); preferably, within 6 months prior to treatment or apheresis, the patient has been admitted as a first-time hospitalized patient for a hepatic decompensation event (an eligible event) as defined by the presence of ascites, hepatic encephalopathy, variceal bleeding (variceal extirpation), hepatorenal syndrome / acute kidney injury (HRS / AKI), and / or spontaneous bacterial peritonitis (SBP), or preferably, within 6 months prior to treatment or apheresis, the patient has visited the outpatient clinic for refractory ascites; a MELD 3.0 score of 12-20 measured within 2 weeks of an eligible event requiring hospitalization, or measured at the time of visit in the case of an outpatient; and a Chronic Liver Failure Consortium Acute Decompensation Score (CLIF-C) greater than 45 points obtained within 2 weeks of an eligible hepatic decompensation event requiring hospitalization. AD score); etiology of liver disease such as pure metabolic dysfunction-related fatty liver disease (MASLD), or metabolic and alcohol-related liver disease (Met-ALD), or “pure” ALD (i.e., not Met-ALD) without alcohol abuse and negative PEth test before administration of manipulated macrophages, or HCV persistent virological response (HCV SVR) with progressing cirrhosis; and diagnosis of cirrhosis based on at least one of the following: (i) clinical and radiological features correlating with the diagnosis of cirrhosis, (ii) liver stiffness score measured by transient elastography > 15 kPa, or (iii) past liver biopsy supporting the histological features of cirrhosis. According to some embodiments, if a subject has refractory ascites, this refractory ascites is considered an eligible event.

[0066] Sustained virological response refers to the absence of virus in the serum over a long period following the treatment program. Therefore, sustained virological response can be determined by measuring the viral load, for example, by quantifying viral RNA in blood or serum over a certain period (e.g., 12 weeks) after the completion of treatment. In some embodiments, the sustained virological response in question is defined as a viral load of less than 25 international units of RNA per milliliter of blood, measured over or at the 12-week mark after the completion of treatment.

[0067] In some embodiments, the method includes a step of evaluating the subject for comorbidities and / or risk-increasing indicators prior to treatment. In preferred embodiments, the subject does not have, is not known to have, and / or is not suspected to have, any combination of the following comorbidities or risk-increasing indicators at the start of treatment: cirrhosis due to any viral hepatitis other than HCV SVR; cirrhosis due to autoimmune and cholestatic etiologies (e.g., but not limited to primary biliary cholangitis and primary sclerosing cholangitis); any current organ failure requiring more than outpatient supportive care, not associated with a hepatic decompensation event (an eligible event); known splenomegaly, optionally, the subject's spleen is greater than 16 cm; thrombocytopenia, optionally, thrombocytopenia is 50 × 10 9Platelet count less than 1 platelets / L (as defined); history of liver or other organ transplantation, e.g., having received at least one previous liver or organ transplant; acute exacerbation of chronic liver failure (ACLF); recent sepsis, positive for microbial culture or as defined by a physician, except when stable and at least 5 weeks after completion of a full course of IV antibiotics; known human immunodeficiency virus (HIV) infection; pulmonary embolism; hepatocellular carcinoma (HCC) or active malignancy (excluding non-melanoma skin cancer, cervical carcinoma in situ, or superficial bladder cancer) within 5 years prior to the initiation of treatment. ;hepatic comorbidities such as hepatic pleural effusion (resistant to medical treatment) or portal vein thrombosis; chronic renal impairment (subjects may require dialysis); unresolved acute kidney injury (AKI); acute heart failure; chronic heart failure; portal pulmonary hypertension; severe chronic lung disease, e.g., chronic obstructive pulmonary disease (COPD) or interstitial lung disease, where the forced expiratory capacity (FEV1) is less than 50% or 60% and / or the forced vital capacity (FVC) is less than 60%; hepatopulmonary syndrome; a history of or current chronic albumin treatment; and / or severe untreated or unstable mental illness. In preferred embodiments, the subject does not have any of the aforementioned comorbidities or indicators of increased risk. In other embodiments, the subject has no evidence of any life-threatening comorbidity and / or has clinical significance for cirrhosis.

[0068] In a preferred embodiment, the subject does not have any of the aforementioned comorbidities or indicators of increased risk, the subject has been treated (recompensated) after recovering from or becoming clinically stable following the first hepatic decompensation event that required hospitalization, and the subject has not experienced any further hepatic decompensation events after recovering from the first hepatic decompensation event (or after becoming clinically stable following the first hepatic decompensation event). In another preferred embodiment, the subject does not have any of the aforementioned comorbidities or indicators of increased risk, the subject has experienced a first hepatic decompensation event that required hospitalization, and has experienced further or subsequent hepatic decompensation events, and has been treated after further or subsequent hepatic decompensation events.

[0069] Forced expiratory vital capacity (FEV1) refers to the amount of air exhaled by an individual during forced exhalation, expressed as a percentage of a baseline value. Forced vital capacity (FVC) refers to the maximum amount of air exhaled by an individual during forced exhalation after a complete inhalation. Baselines can be based on measured values ​​of forced expiratory vital capacity in a population of healthy individuals (i.e., individuals without restrictive lung disease). As used herein, the baseline values ​​for FEV1 or FVC expressed as percentages refer to the baseline values ​​that would be expected in a healthy individual.

[0070] Thrombocytopenia refers to a condition in which the platelet count is low (for example, a lower platelet count compared to a reference sample taken from a healthy individual). The condition is defined as a case where the platelet count of the subject is low compared to a given reference point (for example, 150,000 platelets / mm³). 3 Less than 100,000 platelets / mm³ 3 Less than 50,000 platelets / mm³ 3 A platelet count (less than 50,000 platelets / mm³) may be considered thrombocytopenia. In certain embodiments, the subject is a platelet count of 50,000 platelets / mm³. 3 If the value is less than this, it may be considered thrombocytopenia.

[0071] In a preferred embodiment, the patient has a MELD 3.0 score of 10 to 20, more preferably 10 to 16, 12 to 18, or 12 to 20. In the most preferred embodiment, the subject has a MELD 3.0 score of 12 to 20.

[0072] MELD consists of the following three components: bilirubin (BIL), creatinine (CRE), and the internationally normalized ratio (INR), and the MELD score is obtained by combining these using the following formula.

[0073] Relevant scores that may be used in accordance with the present invention include MELD, MELD 3.0, MELD 3.0 without albumin, and MELDNa, as discussed in Kim et al., Gastroenterology 2021;161:1887-1895 and summarized below.

[0074] MELD = 9.57 × log e (Creatinine) + 3.78 × log e (Bilirubin) + 11.20 × log e (INR)+6.43 (In the formula, creatinine (mg / dL), bilirubin (mg / dL), and INR values ​​less than 1.0 are set to 1.0, and if serum creatinine was 4 mg / dL or higher or if the patient underwent dialysis two or more times in the previous week, the creatinine value is set to 4.0 mg / dL and rounded to the nearest integer).

[0075] MELD 3.0 = 1.33 (for women) + [4.56 × log e (bilirubin) + [0.82 × (137-Na)] - [0.24 × (137-Na) × log e (Bilirubin) + [9.09 × log e (INR)] + [11.14 × log e (Creatinine) + [1.85 × (3.5-albumin)] - [1.83 × (3.5-albumin) × log e (Creatinine)] + 6 (rounded to the nearest integer).

[0076] MELD 3.0 (without albumin) = 1.40 (for women) + 4.85 * log e (Bilirubin) + 0.88 * (137-Na) - 0.25 (137-Na) * log e (Bilirubin) + 9.66 * log e (INR) + 10.47 * log e (Creatinine) +6.

[0077] MELDNa = MELD + 1.32 * (137 - Na) - [0.033 * MELD * (137 - Na)] (wherein serum sodium concentration (Na) is in the range of 125 to 137 mmol / L as defined by OPTN (Peng et al., Y, Khaled T, Liu J, et al. Data Request from the MELD Enhancement Subcommittee of the Liver and Intestinal Organ Transplantation Committee. Data Request ID: HR2011_02. June 7, 2011)).

[0078] In some embodiments, the subjects are those with a Chronic Liver Failure Consortium Acute Decompensation Score (CLIF-C AD) greater than 45. The CLIF-AD can be used to predict the prognosis of patients with acute decompensation but without acute exacerbations of chronic liver failure, and to predict the survival rate of this patient group. The CLIF-C AD score can be calculated as follows: CLIF-C AD = 10 × [0.03 × age + 0.66 × Ln (creatinine mg / dL) + 1.71 × Ln (INR) + 0.88 × Ln (WBC 10 9 [Individual cells / L) - 0.05 × (sodium mmol / L) + 8].

[0079] In some embodiments, the liver disease is one in which cirrhosis is caused by damage to liver cells, and is a liver cell-derived disease such as viral diseases (including treated (persistent viral response) hepatitis C (HCV) and hepatitis B), alcohol-related damage (alcohol-associated liver disease (ALD)), or non-alcoholic fatty liver disease (NAFLD) (including non-alcoholic steatohepatitis (NASH) (including NASH caused by diabetes or obesity), idiopathic cirrhosis, hemochromoposis, or alpha-1-antitrypsin deficiency). In some embodiments, the underlying etiology is eliminated (for example, a patient with alcohol-related damage is no longer abstaining from alcohol, or a patient with HCV-related damage no longer has HCV). In preferred embodiments, if the etiology of the disease is HCV, the subject shows a sustained virological response to HCV. In some embodiments, patients with liver disease are at risk of end-stage renal disease.

[0080] In some embodiments, the condition is a liver disease, i.e., an inflammatory liver disease. In some embodiments, the liver disease is fatty liver disease (SLD). In some embodiments, the fatty liver disease is metabolic dysfunction-related fatty liver disease (MASLD), Met-ALD, or idiopathic SLD. In some embodiments, metabolic dysfunction-related fatty liver disease (MASLD) is metabolic steatohepatitis (MASH). In some embodiments, the liver disease is non-alcoholic fatty liver disease with or without some degree of alcoholic liver disease (ALD). Preferably, if the liver disease is ALD, there is no current alcohol abuse and no alcohol abuse for at least 6 months prior to screening for treatment or initiation of treatment. In some embodiments, the liver disease is either pure metabolic dysfunction-related fatty liver disease (MASLD), metabolic and alcohol-related liver disease (Met-ALD), persistent virological response to HCV with progressive cirrhosis (HCV SVR), or alcohol-related liver disease (ALD or Met-ALD) only if the patient is confirmed not to be drinking at abusive levels and has a PEth alcohol test value of less than 25 mg / l.

[0081] Cirrhosis can lead to acute exacerbations of chronic liver failure (ACLF). In some embodiments, the liver disease is ACLF. ACLF is a distinct condition from hepatic decompensation, which is characterized by the occurrence of ascites, hepatic encephalopathy, gastrointestinal bleeding, or any combination of these conditions in patients with cirrhosis. In contrast, ACLF is associated with organ failure and has a high short-term mortality rate of over 15% at 28 days. Three main characteristics characterize this syndrome: ACLF occurs in a context of severe systemic inflammation; ACLF frequently occurs in a close temporal relationship with pro-inflammatory exacerbating events (e.g., infection or alcoholic hepatitis); and ACLF is associated with single or multiple organ failure. In some embodiments, manipulated macrophages are used to treat cirrhosis in subjects with ACLF.

[0082] Patients suitable for treatment or use according to any aspect or embodiment of the present invention may be patients with the relevant disease and severity.

[0083] In some embodiments, macrophages engineered to express human IL-10 and human MMP9 may be used to treat ACLF.

[0084] The manipulated macrophages may be autologous or allogeneic to the target being treated. In a preferred embodiment, the manipulated macrophages are autologous to the target. Autologous macrophages can be obtained by differentiating monocytes obtained from the target by apheresis. Prior to the apheresis step, the target may be treated with G-CSF, preferably with filgrastim. Treatment with G-CSF may be referred to as "mobilization." Therefore, in some embodiments, the method for treating the inflammatory state of the target is: (a) A process of treating the subject with G-CSF, optionally treating with filgrastim (e.g., but not limited to Neupogen®), and optionally treating with a dose of 10 μg / kg / day for four consecutive days; (b) Apheresis followed by monocyte isolation to obtain monocytes from the subject; (c) A step of differentiating the monocytes into macrophages, and selectively differentiating them by incubation of monocytes in the presence of M-CSF; (d) A step of manipulating macrophages to overexpress IL-10 and / or MMP9; and (e) The process of administering the manipulated macrophages. It may include.

[0085] In some embodiments, macrophages are cryopreserved and thawed before administration. According to some embodiments, macrophages are reformulated before administration to the subject or before cryopreservation.

[0086] In some embodiments, the subjects to be treated with the manipulated macrophages of the present invention have already been treated with G-CSF (preferably recombinant G-CSF, preferably filgrastim), and preferably, monocytes have been collected from the subjects after treatment with G-CSF. In such embodiments, the collected monocytes can be differentiated to obtain manipulated macrophages for use in the treatment of the present invention.

[0087] In a particular embodiment, the present invention relates to an engineered macrophage disclosed herein for use in a method of treating cirrhosis of the liver in a subject, the method being: (a) A process of treating the subject with G-CSF, optionally treating with filgrastim (e.g., but not limited to Neupogen®), and optionally treating with a dose of 10 μg / kg / day for four consecutive days; (b) Apheresis followed by monocyte isolation to obtain monocytes from the subject; (c) A step of differentiating the monocytes into macrophages, and selectively differentiating them by incubation of monocytes in the presence of M-CSF; (d) A step of manipulating macrophages to overexpress IL-10 and / or MMP9; and (e) The process of administering the manipulated macrophages. Provides manipulated macrophages, including [specific example].

[0088] In certain embodiments, the present invention relates to engineered macrophages and G-CSF (preferably recombinant G-CSF, optionally filgrastim, e.g., Neupogen®) disclosed herein, for use in a method of treating cirrhosis of the liver in a subject, wherein the method is: (f) A step in which the subjects are treated with G-CSF, and optionally treated with a dose of 10 μg / kg / day for four consecutive days; (g) Apheresis followed by monocyte isolation to obtain monocytes from the subject; (h) A step of differentiating the monocytes into macrophages, and selectively differentiating them by incubation of monocytes in the presence of M-CSF; (i) a step of manipulating macrophages to overexpress IL-10 and / or MMP9; and (j) The process of administering the manipulated macrophages. This provides engineered macrophages and G-CSF, including those mentioned above.

[0089] Prior to treatment with G-CSF, subjects may undergo screening to determine their suitability for the treatment.

[0090] In some embodiments, if the macrophages are autologous to the subject and the subject has experienced subsequent or further decompensated events following the initial hepatic decompensation event that required hospitalization, the step of obtaining monocytes from the subject by apheresis is preferably performed before the subsequent or further decompensated event. In other words, the subsequent or further decompensated event is performed after obtaining monocytes from the subject by apheresis. In some embodiments, one or more of the following steps are performed before the subsequent or further decompensated event: a G-CSF treatment step, a monocyte acquisition step, a monocyte differentiation step, and a macrophage overexpression of IL-10 and / or MMP9.

[0091] As described in detail below, macrophages generated from monocytes can be manipulated before administration to the target. In a preferred embodiment, the macrophages are manipulated to overexpress IL-10 and MMP9.

[0092] The manipulated macrophages are administered to a subject according to the method of the present invention. In a preferred embodiment, the manipulated macrophages are administered to the subject after the subject has experienced a further or subsequent decompensation event, and the subject has already been or has been hospitalized in the past for another previous initial decompensation event.

[0093] In some embodiments, at least one dose of manipulated macrophages is administered to the target. In preferred embodiments, up to four doses of manipulated macrophages are administered to the target. Appropriately, one, two, three, or four doses may be administered to the target. In preferred embodiments, all doses of manipulated macrophages are derived from monocytes obtained from a single apheresis. Therapeutic macrophages can be formulated, preferably as a dispersion for infusion, such as intravenous infusion. In some embodiments, macrophages are administered in doses of 70 to 130 million cells (i.e., 7 × 10⁶ macrophages) per dose. 7 ~1.3 × 10 8 It can be administered in units of 1 × 10. In a preferred embodiment, therapeutic macrophages are administered in units of 1 × 10. 8 Administer in individual doses. The manipulated macrophages may be formulated into a pharmaceutical composition further comprising one or more pharmaceutically acceptable excipients when administered to a subject. In embodiments where multiple doses are administered to a subject, these doses are preferably administered at 6-week intervals. In preferred embodiments, the manipulated macrophages, or a pharmaceutical composition containing manipulated macrophages, are administered at 6-week intervals (i.e., at 6-week intervals) with 1 × 10 macrophages. 8 The drug will be administered to the subject in four individual doses.

[0094] Appropriately, the present invention may also provide a pharmaceutical composition that can be used in any of the methods of the present invention. This pharmaceutical composition may comprise engineered macrophages and one or more pharmaceutically acceptable excipients. This pharmaceutical composition may have the following excipient formulation: 33.13% saline, 0.17% human serum albumin, and 66.7% Cryostor-10, resulting in a final DMSO concentration of 6.7%. This pharmaceutical composition may be frozen.

[0095] Manipulated macrophages According to one aspect of the present invention, engineered macrophages are provided that are engineered to overexpress IL-10. Engineered macrophages according to any of the embodiments described herein can be used according to any of the methods for treating inflammatory diseases. In a particular embodiment, the macrophages are 4 × 10⁶ 6 When cultured in vitro at a cell concentration of cells / ml, these cells secrete IL-10 at a culture supernatant concentration of at least 10,000 pg / ml. As described herein, engineered macrophages that overexpress only IL-10 exhibit a remarkable ability to recruit monocytes, which are the anti-inflammatory secretome, and to convert non-polarized or pro-inflammatory macrophages into a pro-recovery phenotype. Examples have demonstrated the usefulness of such macrophages for therapeutic purposes (particularly in the treatment of cirrhosis).

[0096] According to another aspect of the present invention, engineered macrophages that overexpress IL-10 and MMP9 are provided, resulting in engineered macrophages expressing higher levels of IL-10 and MMP9 compared to untransfected macrophages. According to one aspect of the present invention, engineered macrophages are provided which are engineered to express IL-10 and MMP9, preferably by providing additional or exogenous sequences encoding these proteins. Such IL-10 and MMP9 engineered macrophages may have therapeutic utility, for example, for use in the treatment of inflammatory and / or fibrotic conditions in subjects.

[0097] In other aspects of the present invention, engineered macrophages are provided that are engineered to overexpress IL-10 and IL-4; IL-10 and MMP12; IL-4, IL-13, and MMP9; or IL-4, IL-13, and MMP12.

[0098] The manipulated macrophages according to any aspect of the present invention may have certain structural and advantageous functional properties as described herein.

[0099] Exemplary structural and functional characteristics of the manipulated macrophages are listed in Table 4, compared to unpolarized, untransfected cells used in the MATCH study described in International Publication No. 2019175595. In some embodiments, the manipulated macrophages of the present invention exhibit any combination of the characteristics listed in Table 4.

[0100] Further structural and functional properties of the manipulated macrophages are described in Table 5. In some embodiments, the manipulated macrophages of the present invention exhibit any combination of the properties described in Table 5. According to some embodiments, the manipulated macrophages of the present invention exhibit at least all of the properties described in Table 5.

[0101] In preferred embodiments, when exposed to unmanipulated macrophages, manipulated macrophages polarize the unmanipulated macrophages into a pro-recovery phenotype. When administered to a subject, manipulated macrophages can polarize host macrophages (such as macrophages derived from endogenous monocytes migrating to the liver) into a pro-recovery phenotype. In some embodiments, manipulated macrophages can convert unpolarized host macrophages into pro-recovery macrophages. In some embodiments, manipulated macrophages can convert pro-inflammatory host macrophages into pro-recovery macrophages. In some embodiments, a conditioned medium from manipulated macrophages can convert unmanipulated macrophages into a pro-recovery phenotype. Therefore, the manipulated macrophages of the present invention can convert unmanipulated macrophages into a pro-recovery phenotype in vitro or in vivo. Conversion to a pro-recovery phenotype may increase the expression of CD206 and CD163 and decrease the expression of CD86 and HLA-DR on the cell surface.

[0102] In some embodiments, manipulated macrophages have at least half the expression of CD86 compared to unmanipulated nonpolarized cells. In some embodiments, manipulated macrophages have at least half the expression of HLA-DR compared to unmanipulated nonpolarized cells. In some embodiments, manipulated macrophages secrete at least 1000-fold more IL-10 compared to unmanipulated nonpolarized cells. In some embodiments, manipulated macrophages secrete at least 10-fold more MMP3 compared to unmanipulated nonpolarized cells. In some embodiments, manipulated macrophages secrete at least 20-fold more MMP10 compared to unmanipulated nonpolarized cells.

[0103] In some embodiments, the macrophages of the present invention are 4 × 10 6 When cultured in vitro at a cell concentration of cells / ml, the macrophages secrete IL-10 at a culture supernatant concentration of at least 10,000 pg / ml. In some embodiments, the macrophages of the present invention are 4 × 10 6 When cultured in vitro at a cell concentration of cells / ml, the cells secrete MMP9 at a culture supernatant concentration of at least 200 ng / ml. In some embodiments, the manipulated macrophages express at least 5 times more CD206 than monocytes. In some embodiments, the manipulated macrophages express at least 5 times more 25F9 than monocytes. In some embodiments, the manipulated macrophages express at least 1 / 10 or less CD80 than unmanipulated cells. In some embodiments, the macrophages of the present invention express 4 × 10⁶ cells. 6 When cultured in vitro at a cell concentration of cells / ml, the cells secrete TNF-α at a culture supernatant concentration of at least 40 pg / ml. In some embodiments, the manipulated macrophages have the same phagocytic capacity as unmanipulated, nonpolarized cells.

[0104] In one embodiment, the present invention provides an engineered macrophage comprising one or more exogenous coding sequences of IL-10 and MMP9. The exogenous coding sequence may be any suitable nucleic acid sequence. The exogenous coding sequence may be present in the cytoplasm or nucleus as an extrachromosomal nucleic acid, or it may be incorporated into the macrophage genome. The exogenous coding sequence may encode IL-10 and MMP9, or multiple exogenous coding sequences may each encode IL-10 or MMP9.

[0105] In some embodiments, the expression of endogenous IL-10 and / or MMP9 genes can be stimulated by genetic engineering. For example, endogenous genes encoding IL-10 and / or MMP9 can be switched on and off using gene editing techniques such as CRISPR, generating engineered macrophages that express IL-10 and / or MMP9 under conditions where these proteins would not otherwise be expressed. This can be done, for example, by modifying promoter sequences.

[0106] While naturally occurring, unmanipulated macrophages can express IL-10 and / or MMP9 under relevant physiological conditions, naturally occurring macrophages generally do not secrete significant levels of IL-10. However, the present invention does not relate to naturally occurring, unmanipulated macrophages, but rather to engineered macrophages in which the expression level of IL-10, in particular, is elevated above physiological levels, thereby improving the anti-inflammatory properties of the therapeutic macrophages. As used herein, the inventors describe this as "overexpression" of IL-10. To overexpress IL-10, macrophages can be engineered to possess additional or exogenous coding sequences for IL-10. In some embodiments, cells are transfected with mRNA encoding IL-10 / MMP9.

[0107] Cells that overexpress IL-10 and / or MMP9 contain coding sequences that express IL-10 and / or MMP9 at higher levels compared to unmanipulated cells. As described above, overexpression can be achieved by introducing exogenous nucleic acids encoding IL-10 and / or MMP9, such as mRNA, or by gene modification that stimulates the expression of IL-10 and / or MMP9 from endogenous coding sequences. Manipulated macrophages that overexpress IL-10 and / or MMP9 may not necessarily secrete larger amounts of IL-10 and / or MMP9 compared to unmanipulated macrophages.

[0108] In other embodiments, macrophages may be engineered to activate endogenous genes encoding IL-10 and / or MMP9. In any case, the macrophages of the present disclosure are modified by altering the expression levels of IL-10 and / or MMP9 by any means and are therefore referred to as engineered macrophages.

[0109] Overexpression of IL-10 leads to a decrease in the innate activity levels of MMPs such as MMP9.

[0110] Therefore, engineered macrophages are provided with additional or exogenous MMP coding sequences to maintain at least “physiological” levels of MMP9 expression, or slightly above physiological levels. In some embodiments, MMP9 expression is modified to rescue, restore, or return macrophages to equivalent or elevated MMP9 expression levels compared to macrophages not transfected with IL-10. Thus, engineered macrophages exhibit MMP9 expression levels equivalent to or slightly above wild-type / natural expression, despite the fact that they are engineered with additional / exogenous MMP9 coding sequences. Slightly above means an enhancement of expression that is 1.2 to 1.5 times (e.g., 1.2, 1.3, 1.4, or 1.5 times the natural level) above natural expression levels.

[0111] Macrophages can be engineered to express both IL-10 and MMP9. In some embodiments, this expression can be induced from endogenous genes. In other embodiments, macrophages are engineered to contain exogenous coding sequences for IL-10 and MMP9. It may be preferable for macrophages to overexpress IL-10. It may be preferable for macrophages to overexpress MMP9. Alternatively, macrophages can be engineered to overexpress both IL-10 and MMP9. The expression levels of IL-10 and / or MMP9 are elevated compared to untransfected macrophages. The expression level of MMP9 is elevated compared to macrophages transfected with IL-10 only.

[0112] In some embodiments, the macrophages being manipulated are human monocyte-derived macrophages. In some embodiments, macrophages are induced from monocytes by culturing them in the presence of MCSF. Preferred culture conditions are discussed further below.

[0113] In some embodiments, baseline macrophages (i.e., pre-engineered or native) are referred to as unpolarized human monocyte-derived macrophages, also known as “resting” macrophages.

[0114] In some embodiments, the manipulated macrophages are macrophages derived from iPSCs. Various methods for inducing macrophages from iPSCs are known in the art. At baseline, these will also be unpolarized or in a quiescent state. Thus, in certain embodiments, the manipulated macrophages are derived from pluripotent stem cells cultured in vitro. Preferably, such pluripotent stem cell-derived or iPSC-derived macrophages are low immunogenic due to the knockout or knockdown of at least one gene associated with either HLA class I and / or HLA class II cell surface molecules. For example, genes associated with HLA class I may be the HLA-A, HLA-B, HLA-C genes, or B2M genes. Genes associated with HLA class II may be HLA-DP, DM, DO, DQ, and DR, or CIITA. This knockout or knockdown is evident in macrophages, but can be introduced into any progenitor cell as macrophages differentiate from stem cells. In an exemplary method, the manipulated macrophages of the present invention may be generated by preparing stem cells such as induced pluripotent stem cells, optionally knocking out or down the expression of at least one sequence encoding a unit within the HLA I or HLA II complex, optionally differentiating the stem cells into embryoid bodies using BMP4, SCF, VEGF, and / or a Rock inhibitor (Y-27632), optionally differentiating the embryoid bodies into macrophage progenitor cells using M-CSF and IL-3, and optionally maturing the macrophage progenitor cells into functional macrophages using M-CSF.

[0115] As used herein, overexpression refers to the artificial expression of an increased amount of a gene.

[0116] When used in the examples, protein expression levels were quantified 16–24 hours after transfection. The expression levels listed herein are 4 × 10⁶. 6 pieces / ml(1cm 2 2x10 6This is obtained for a macrophage population at a concentration equivalent to that of a single cell. In the example, macrophages were transfected, isolated by centrifugation, supplemented with IL-3 and IL-14, resuspended in TexMACs buffer, and incubated at 37°C under 5% CO2. Those skilled in the art will know of equivalent conditions suitable for determining secreted protein concentrations.

[0117] In some embodiments, macrophages are engineered to overexpress IL-10, and the secreted IL-10 protein level exceeds approximately 300 pg / ml. Preferably, the secreted IL-10 protein level exceeds approximately 300 pg / ml, or 400 pg / ml, or 500 pg / ml, or 600 pg / ml, or 700 pg / ml, or 800 pg / ml, or 900 pg / ml, or 1,000 pg / ml, or 2,000 pg / ml, or 3,000 pg / ml, or 4,000 pg / ml, or 5,000 pg / ml, or 6,000 pg / ml, or 7,000 pg / ml, or 8,000 pg / ml, or 9,000 pg / ml, or 10,000 pg / ml, or 11,000 pg / ml. Preferably, these IL-10 protein levels are achieved by culturing macrophages as described above, with a macrophage concentration in the culture medium of 4 × 10⁻⁶ 6 cells / ml (2 × 10⁻⁶) 6 cells / cm 2 This can be measured by culturing (corresponding to) and measuring the concentration of protein in the culture medium. In a preferred embodiment, macrophages are 4 × 10 6When cultured in vitro at a cell concentration of cells / ml, IL-10 is secreted at culture supernatant concentrations of at least 10,000 pg / ml, 15,000 pg / ml, or 20,000 pg / ml. In a particularly preferred embodiment, IL-10 is secreted at a culture supernatant concentration of 49,000 pg / ml or higher. In some embodiments, manipulated macrophages can secrete IL-10 at levels 1000 times higher than unmanipulated nonpolarized hMDM. Unmanipulated nonpolarized hMDM is described in the Art, for example, in International Publication No. 2019175595.

[0118] In some embodiments, macrophages are engineered to overexpress MMP9, and the secreted MMP9 protein level exceeds approximately 200 ng / ml. Preferably, the secreted MMP9 protein level exceeds approximately 300 ng / ml, or 400 ng / ml, or 500 ng / ml, or 600 ng / ml, or 700 ng / ml, or 800 ng / ml, or 900 ng / ml, or 1,000 ng / ml. Preferably, the secreted MMP9 protein level is approximately 200 ng / ml to 2000 ng / ml. In preferred embodiments, the secreted MMP9 protein level exceeds 200 ng / ml. In one embodiment, the secreted MMP9 protein level exceeds 1500 ng / ml. Preferably, engineered macrophages (containing IL-10 and MMP9) have a higher secreted MMP9 protein level compared to the average secreted MMP9 protein level in macrophages engineered with IL-10 alone. In some embodiments, engineered macrophages (containing IL-10 and MMP9) have secreted MMP9 protein levels at least equal to the average level of secreted MMP9 protein in untransfected, non-polarized macrophages. Preferably, the overall MMP activity of the engineered macrophages of the present invention is also higher than the overall MMP activity of macrophages engineered with IL-10 alone. In other embodiments, the overall MMP activity of engineered macrophages is greater than the MMP activity of untransfected macrophages. In preferred embodiments, the MMP activity of engineered macrophages is at least 1.5 times greater than the MMP activity of untransfected macrophages. Preferably, these IL-10 and MMP9 protein levels are achieved by culturing macrophages as described above, with a macrophage concentration in the culture medium of 4 × 10⁻⁶. 6 cells / ml (2 × 10⁻⁶) 6 cells / cm 2This can be measured by culturing (corresponding to), and by measuring the concentration of proteins in the culture medium. In some embodiments, engineered macrophages may secrete larger amounts of other matrix metalloproteinases. In certain embodiments, engineered macrophages may secrete 10 times more matrix metalloproteinase-3 (MMP3) than unengineered, nonpolarized cells. In certain embodiments, engineered macrophages may secrete 10 times more matrix metalloproteinase-10 (MMP10) than unengineered, nonpolarized cells.

[0119] In some embodiments, macrophages have a regenerative phenotype, which is anti-inflammatory and anti-fibrotic. Such phenotypes are further defined herein.

[0120] Macrophages engineered to express IL-10 and MMP9 can be genetically engineered in any preferred manner. For example, using viral or non-viral vectors, DNA or RNA constructs, or gene editing using any preferred technique. Thus, in some embodiments, macrophages can be engineered using one or more exogenous coding sequences. These exogenous coding sequences may encode IL-10 and / or MMP9, and / or gene editing proteins such as CRISPR or nickase that can modify the cell genome to increase the expression of endogenous IL-10 and / or endogenous MMP9. This can be achieved, for example, by editing promoter or enhancer sequences.

[0121] Known viral vectors for transfecting macrophages include lentiviruses, adenoviruses, and adeno-associated viruses (AAVs).

[0122] As used herein, “coding” refers to the ability of a nucleotide sequence, such as a gene, cDNA, or mRNA, to function as a template for the synthesis of a macromolecule in a biological process, such as a defined amino acid sequence. Therefore, a coding sequence can be any suitable nucleic acid sequence that provides instructions for the synthesis of the relevant entity (e.g., IL-10 or MMP9). A coding sequence may be contained within the same vector / construct or in different vectors / constructs.

[0123] As used herein, “exogenous” refers to any substance (in particular, genetic material) that is introduced from or produced outside of a particular cell. As used herein, in some embodiments, the exogenous coding sequence or engineered macrophage encodes / expresses IL-10 or MMP9. In some embodiments, IL-10 and / or MMP9 are human. Those skilled in the art will understand that variations in the sequences of these gene / coding sequences are also encompassed in the invention. Ideally, the gene / coding sequence is human. The gene / coding sequence can be codon-optimized. The gene / coding sequence can be modified, and different nucleotides may be present in the DNA vector if the reference sequence is RNA.

[0124] Preferably, the provided IL-10 coding sequence is at least 80% similar or homologous to the NCBI reference sequence: NM_000572.3 (human IL-10 mRNA sequence), and preferably at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% similar to the natural sequence.

[0125] Preferably, the provided MMP9 coding sequence is at least 80% similar or homologous to the NCBI reference sequence: NM_004994.3 (human matrix metallopeptidase 9 (MMP9), mRNA), and preferably at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% similar to the natural sequence.

[0126] Preferably, the expressed IL-10 protein is at least 80% similar to or homologous to the sequence presented as SEQ ID NO: 4, and preferably at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% similar to SEQ ID NO: 4.

[0127] Preferably, the expressed MMP9 protein is at least 80% similar to or homologous to the sequence presented as SEQ ID NO: 6, and preferably at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% similar to SEQ ID NO: 6.

[0128] In some embodiments, macrophages are nonvirally manipulated and manipulated using nucleic acid vectors. In some embodiments, macrophages are transfected with a DNA vector (e.g., a naked DNA vector). Preferably, the DNA vector can encode both IL-10 and MMP9 on a single vector. In some embodiments, the nucleic acid vector is not derived from a viral genome. In some embodiments, macrophages are transfected with one or more free nucleic acids or vectors. In some embodiments, macrophages are transfected with an RNA vector. In some embodiments, macrophages are transfected with mRNA. Preferably, macrophages are transfected with a single mRNA construct expressing IL-10 and MMP9.

[0129] In some embodiments, IL-10 and MMP9 are provided to macrophages as mRNA. Therefore, the manipulated cells are provided with exogenous mRNA molecules. MMP9 and IL-10 may reside on the same mRNA molecule or on separate mRNA molecules. Preferably, MMP9 and IL-10 reside on the same mRNA molecule. More preferably, the mRNA is a bicistronic vector encoding both MMP9 and IL-10. Preferably, the mRNA molecule contains the sequence described in any one of SEQ ID NOs: 1-3, 10, 13, or 14.

[0130] In some embodiments, the mRNA contains a sequence encoding IL-10. In some embodiments, the mRNA contains a sequence identical to at least 80% of SEQ ID NO: 13. In some embodiments, the mRNA contains a sequence identical to at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of SEQ ID NO: 13. In preferred embodiments, the mRNA contains the sequence described in SEQ ID NO: 13.

[0131] In some embodiments, the mRNA contains a sequence encoding MMP9. In some embodiments, the mRNA contains a sequence that is at least 80% identical to sequence number 14. In some embodiments, the mRNA contains a sequence that is at least 85%, at least 90%, at least 96%, at least 97%, at least 98%, or at least 99% identical to sequence number 14. In preferred embodiments, the mRNA contains the sequence described in sequence number 14.

[0132] In some embodiments, macrophages are manipulated with mRNA encoding both IL-10 and MMP9. In some embodiments, macrophages are manipulated with mRNA containing both the sequence described in SEQ ID NO: 13 and the sequence described in SEQ ID NO: 14. In some embodiments, the sequences described in SEQ ID NO: 13 and SEQ ID NO: 14 reside on the same mRNA molecule. In some embodiments, the sequences described in SEQ ID NO: 13 and SEQ ID NO: 14 reside on separate molecules. In a preferred embodiment, the mRNA contains the sequences described in SEQ ID NO: 13 and SEQ ID NO: 14 on the same mRNA molecule, separated by mRNA encoding a self-cleaving linker. In a preferred embodiment, the self-cleaving linker has the amino acid sequence described in SEQ ID NO: 9. In a preferred embodiment, the mRNA encoding the self-cleaving linker has the sequence described in SEQ ID NO: 15.

[0133] In some embodiments, the mRNA construct expresses IL-10 fused to MMP9 via a cleavable linker. In some embodiments, the linker is p2A. p2A may have the amino acid sequence described in SEQ ID NO: 9, which may be encoded by the mRNA sequence described in SEQ ID NO: 8 or 15. In preferred embodiments, p2A is encoded by the mRNA sequence described in SEQ ID NO: 15. p2A is part of a larger family of 2A self-cleaving peptides or 2A peptides. This class of peptides are 18–22 amino acid length peptides that can induce ribosome skipping during protein translation in cells. These peptides share the DxExNPGP core sequence motif. This allows IL-10 and MMP9 to be expressed as separate proteins despite being located within the same mRNA molecule.

[0134] In preferred embodiments, both IL-10 and MMP9 are expressed from mRNA molecules. In some embodiments, the mRNA molecule contains a sequence that is at least 80% identical to SEQ ID NO: 10. In some embodiments, the mRNA molecule contains a sequence that is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 10. In preferred embodiments, the mRNA contains the sequence described in SEQ ID NO: 10. In particularly preferred embodiments, the mRNA contains the sequence described in SEQ ID NO: 10 and optionally further comprises a poly-A tail and / or a 5' cap of a length of 65 to 250 residues, preferably 90 to 120 residues, preferably about 90 residues. In particularly preferred embodiments, the mRNA contains the sequence described in SEQ ID NO: 10 and optionally further comprises a poly-A tail and a 5' cap of a length of 65 to 250 residues, preferably 90 to 120 residues, for example, 90 residues, and a 5' cap. In a preferred embodiment, the exogenous mRNA sequence comprises a sequence that is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence described in SEQ ID NO: 16. In a particularly preferred embodiment, the exogenous mRNA sequence comprises the sequence described in SEQ ID NO: 16 and preferably further comprises a 5' cap.

[0135] In some embodiments, the exogenous mRNA sequence includes a 5' untranslated region (5'UTR) sequence that is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence described in SEQ ID NO: 19. In preferred embodiments, the exogenous mRNA sequence includes a 5' untranslated region (5'UTR) sequence that is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence described in SEQ ID NO: 17. In preferred embodiments, the exogenous mRNA sequence includes the 5'UTR sequence described in SEQ ID NO: 17.

[0136] In some embodiments, the exogenous mRNA sequence includes a 3' untranslated region (3'UTR) sequence that is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence described in SEQ ID NO: 20. In preferred embodiments, the exogenous mRNA sequence includes a 3' untranslated region (3'UTR) sequence that is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence described in SEQ ID NO: 18. In preferred embodiments, the exogenous mRNA sequence includes the 3'UTR sequence described in SEQ ID NO: 18. In preferred embodiments, the exogenous mRNA includes both the 5'UTR sequence described in SEQ ID NO: 17 and the 3'UTR sequence described in SEQ ID NO: 18.

[0137] Alternatively, or in addition, the IRES site may be inserted between the coding sequences, thereby interrupting expression and forming two separate proteins, as those skilled in the art will understand.

[0138] In some embodiments, the mRNA molecule contains a poly(A) tail. The poly(A) tail is a long chain of adenine nucleotides added to the mRNA molecule during RNA processing to enhance its stability. A suitable poly(A) tail is 65–250 residues long, preferably 90–120 residues long. The poly(A) tail further stabilizes the RNA molecule and prevents its degradation.

[0139] In some embodiments, the mRNA molecule contains at least one cap. The 5' cap is characteristic of eukaryotic mRNA. Chemically, the 5' cap consists of an inverted 7-methylguanosine connected to the remainder of the eukaryotic mRNA via a 5'-5' triphosphate bridge. This so-called "cap0" contributes, among other things, to the stabilization of eukaryotic mRNA, the initiation of translation, and the degradation of mRNA. Artificial cap structures have been designed to enhance the success of translation in vitro. Examples of synthetic anti-inverted cap analogs include CleanCap® AG, which is a trinucleotide methylated with additional methylation and first adenosine. At least one cap may be a synthetic cap analog, preferably CleanCap®.

[0140] In some embodiments, mRNA is modified RNA. In some embodiments, mRNA modification includes chemical modification of uridine and / or chemical modification of cytidine. In some embodiments, mRNA modification includes pseudouridine, N1-methyl pseudouridine, 5-methoxyuridine, and 5-methylcytidine, preferably 5-methoxyuridine.

[0141] In one embodiment, the mRNA is modified with 5-methoxyuridine and contains at least one CleanCap®.

[0142] In some embodiments, the mRNA construct includes the sequence of SEQ ID NO: 2, or a sequence that is at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% similar to or homologous to SEQ ID NO: 2.

[0143] In some embodiments, macrophages are manipulated using nucleic acid vectors. In some embodiments, macrophages are transfected via electroporation. Another preferred transfection method is nucleofection.

[0144] In some embodiments, mRNA is delivered to macrophages by nanoparticles. In some embodiments, the nanoparticles are lipid nanoparticles, which may be, for example, those described in U.S. Patents 8,058,069, 8,492,359, 8,822,668, 9,364,435, 9,504,651, and 11,141,378.

[0145] In some embodiments, macrophages are autologous or allogeneic to the target. In some embodiments, macrophages are derived from progenitor cells such as iPSCs, hematopoietic stem cells, or monocytes.

[0146] In some embodiments, macrophages are induced from monocytes by culturing monocytes under suitable conditions. Such conditions may preferably include: An in vitro method for producing macrophages, (a) A step comprising culturing monocytes in a culture medium for 3 to 5 days to produce macrophages, wherein the culture medium contains one or more growth factors to stimulate macrophage production, A method in which all steps (a) are performed in the same culture medium.

[0147] Preferably, the culture medium is suitable for the generation of macrophages from monocytes. Preferably, the culture medium is a T cell medium. Preferably, the culture medium can be selected from X-Vivo 10, X-Vivo 15, TexMACS, AIMv, RPMI, DMEM, and DMEM / F12. Preferably, the culture medium is TexMACS (Miltenyi).

[0148] Preferably, the culture medium is serum-free. Preferably, the culture medium is heterologous protein-free. Preferably, the culture medium is GMP compliant.

[0149] Preferably, the culture medium may contain one or more factors. Preferred factors include growth factors, polysaccharides, cytokines, and chemokines. Preferred factors include MCSF and GM-CSF. Therefore, preferably, the factors are growth factors. Preferably, one or more factors are GMP compliant. In one embodiment, the culture medium may contain one or more growth factors, which may include MCSF or GM-CSF. Monocytes are most commonly cultured with either MCSF or GM-CSF. Culture of monocytes with GM-CSF results in a bias towards an "inflammatory" phenotype, while culture of monocytes with MCSF results in a bias towards a "recovery-promoting" phenotype. In other embodiments, the one or more growth factors do not include a combination of MCSF and GM-CSF. Therefore, in any of the methods of the present invention, when M-CSF is used as a growth factor to generate macrophages, it may be preferable not to use GM-CSF to generate macrophages from monocytes. This applies to the process of culturing monocytes until macrophages are produced.

[0150] A further aspect of the present invention provides a population of manipulated macrophages as described herein. The population may be suitable for use in the therapies described above.

[0151] A further aspect of the present invention provides a composition comprising engineered macrophages. In some embodiments, the composition of engineered macrophages is used for the treatment described above, or is a population of engineered macrophages used for the treatment described above. The composition may also include other pharmaceutically acceptable components (e.g., suitable cell culture media, excipients, etc.).

[0152] According to any aspect of the present invention, use preferably involves administering an effective amount of the manipulated macrophages to a subject.

[0153] According to any embodiment of the present invention, use may involve delivering the manipulated macrophages to a subject by systemic administration, preferably by systemic injection. In some embodiments, administration is by local injection, for example, into the kidneys and lungs. In some embodiments, administration is by pulmonary administration using a sprayer. For example, in patients with cirrhosis, peripheral intravenous injection is preferred for hepatic conditions to avoid invasive procedures. Local injection, such as into the renal artery, may be better tolerated for renal conditions.

[0154] It is preferable to manipulate the macrophages used for treatment ex vivo before delivering them to the patient.

[0155] However, in some embodiments, macrophages can be manipulated in vivo. In some embodiments, macrophages are manipulated in vivo by administering preparations of exogenous coding sequences of IL-10 and MMP9 suitable for macrophage transfection to the target. The preparations may contain any of the exogenous coding sequences discussed herein. Suitable delivery media for in vivo manipulation include macrophage targeting molecules that utilize macrophage cell surface markers. Where in vivo transfection of macrophages is envisioned, local application of the preparation, such as local injection into the liver or kidney, or spraying into the lungs, may be more effective. Such treatments may be prepared as nanoparticles to support macrophage targeting.

[0156] A further aspect of the present invention provides a method for improving the migration of monocytes to an inflammatory site, comprising the use of engineered macrophages according to a first aspect of the present invention, a population of engineered macrophages according to a second aspect of the present invention, or a composition according to a third aspect of the present invention.

[0157] In some embodiments, the method polarizes host monocytes / macrophages to a pro-recovery phenotype. In some embodiments, the method polarizes unpolarized host macrophages to an anti-inflammatory and / or pro-recovery phenotype. In some embodiments, the method polarizes inflammatory host macrophages to an anti-inflammatory and / or pro-recovery phenotype.

[0158] In some embodiments, the pro-recovery phenotype may be described using one or more of the following markers: increased CD206 and / or CD163, and decreased inflammatory markers such as CD86 and / or MHC class II (HLA-DR). These increases / decreases are compared to nonpolar (quiescent) or pro-inflammatory macrophages. From the perspective of secretion profiles, these macrophages are expected not to express TNFα, IFNg, and IL1b, which are normally associated with pro-inflammatory and pro-fibrotic profiles. In preferred embodiments, the manipulated macrophages express CD206 at a 5-fold higher level compared to unmanipulated nonpolarized cells, such as those described in International Publication No. 2019 / 17559.

[0159] In some embodiments, the manipulated macrophages do not secrete TNFα, IFNg, IL1b, IL-12p70, and / or IL-2. In preferred embodiments, the manipulated macrophages secrete TNFα at less than 40 pg / ml. In some embodiments, the manipulated macrophages secrete TNFα, IFNg, IL1b, IL-12p70, and / or IL-2 at the same or similar levels as unmanipulated nonpolarized cells.

[0160] The manipulated macrophages secrete IL-10 and / or MMP9. In preferred embodiments, the manipulated macrophages secrete at least 10,000 pg / ml of IL-10. In preferred embodiments, the manipulated macrophages secrete at least 200 ng / ml of MMP9. In some embodiments, the manipulated macrophages exhibit enhanced MMP activity. In preferred embodiments, the manipulated macrophages exhibit 1.5 times higher MMP activity compared to unmanipulated, non-polarized cells. In some embodiments, the manipulated macrophages secrete IL-6 and / or CXCL8.

[0161] According to another aspect of the present invention, a method is provided for producing engineered macrophages expressing IL-10 and MMP9. In some embodiments, the method includes introducing a nucleic acid comprising at least one sequence encoding IL-10 and at least one sequence encoding MMP9 into a macrophage or a cell from which macrophages are induced.

[0162] In certain embodiments, the method includes the step of transiently transfecting macrophages with an mRNA construct comprising at least one sequence encoding IL-10 and at least one sequence encoding MMP9. In another embodiment, a method is provided for producing engineered macrophages expressing IL-10, the engineered macrophages secreting at least 10,000 pg / mL of IL-10, and the method includes the step of introducing the nucleic acid encoding IL-10 into macrophages or cells from which macrophages are induced. In some embodiments, the method further includes the step of contacting macrophages with post-transfection anti-inflammatory treatment (e.g., IL-4 and IL-13). In some embodiments, the method includes the step of contacting macrophages with IL-4 and IL-13. In some embodiments, macrophages are incubated with IL-4, IL-13, and M-CSF.

[0163] In some embodiments, the method includes electroporation. In some embodiments, macrophages are brought into contact with an anti-inflammatory treatment following electroporation.

[0164] In a particular embodiment, the present invention provides the following: 1. Manipulated macrophages containing the exogenous coding sequence for IL-10 and the exogenous coding sequence for MMP9.

[0165] 2. The manipulated macrophage according to Embodiment 1, wherein the expression of the exogenous coding sequence has a synergistic effect in the restoration of MMP activity and / or in monocyte recruitment by the macrophage, compared to a manipulated macrophage containing only the exogenous IL-10 sequence.

[0166] 3. The manipulated macrophage according to Embodiment 1 or 2, wherein the macrophage and / or coding sequence is human.

[0167] 4. The manipulated macrophage according to any one of Embodiments 1 to 3, wherein the exogenous coding sequence is present on one or more nucleic acid molecules or is incorporated into the genome of the macrophage.

[0168] 5. The manipulated macrophage according to Embodiment 4, wherein the nucleic acid molecule is a DNA or RNA molecule, preferably an mRNA molecule.

[0169] 6. The manipulated macrophage according to Embodiment 5, wherein the mRNA molecule comprises chemically modified residues, preferably modified uracil residues, and optionally comprises at least one synthetic cap.

[0170] 7. The manipulated macrophage according to any one of Embodiments 1 to 6, wherein the exogenous coding sequence of IL-10 is located on the same nucleic acid as the exogenous coding sequence of MMP9.

[0171] 8. The cells are engineered to overexpress IL-10, and preferably, the level of secreted IL-10 protein is 4 × 10⁻⁶. 6 A manipulated macrophage according to any one of Embodiments 1 to 7, having a cell concentration of more than approximately 300 pg / ml at cells / ml.

[0172] 9. An engineered macrophage according to any one of Embodiments 1 to 8, wherein the level of metalloproteinase activity is at least 1.5 times that of an unengineered macrophage.

[0173] 10. A manipulated macrophage according to any one of Embodiments 1 to 7, wherein metalloproteinase activity is restored compared to the reduction in metalloproteinase activity in macrophages manipulated with IL-10 coding sequences alone.

[0174] 11. An engineered macrophage according to any one of Embodiments 1 to 10, which is optionally transfected transiently via electroporation.

[0175] 12. Transfection is performed on the manipulated macrophages described in Embodiment 10, which are nonviral.

[0176] 13. An engineered macrophage according to any one of Embodiments 1 to 12, having a recovery-promoting phenotype.

[0177] 14. A population of manipulated macrophages according to any one of Embodiments 1 to 13.

[0178] 15. A therapeutic composition comprising a population of macrophages as described in Embodiment 14 and a pharmaceutically acceptable medium.

[0179] 16. Manipulated macrophages according to any one of Embodiments 1 to 13, a population of macrophages according to Embodiment 14, or a composition according to Embodiment 15, for use in therapeutic purposes.

[0180] 17. The manipulated macrophages, population, or composition according to Embodiment 16, which administer the treatment to a subject in need thereof.

[0181] 18. Manipulated macrophages according to any one of Embodiments 1 to 13, a population of macrophages according to Embodiment 14, or a composition according to Embodiment 15, for use in treating an inflammatory condition in a subject.

[0182] 19. The macrophages are autologous or homogeneous to the subject, the manipulated macrophages, population, or composition according to Embodiment 17 or 18.

[0183] 20. The manipulated macrophages, population, or composition according to Embodiment 18 or 19, wherein the condition is a chronic inflammatory state with fibrotic elements, and optionally, the condition is organ damage associated with chronic inflammation.

[0184] 21. The condition is acute exacerbation of chronic liver failure (ACLF), the manipulated macrophages, population, or composition according to Embodiment 18 or 19.

[0185] 22. A method for improving the migration of monocytes to an inflammatory area, comprising the use of an engineered macrophage, a population of engineered macrophages, or a composition described in any one of Embodiments 1 to 21.

[0186] 23. The method according to Embodiment 22, which polarizes host monocytes / macrophages into a pro-recovery phenotype and / or avoids a pro-inflammatory phenotype.

[0187] 24. A method for producing an engineered macrophage according to any one of Embodiments 1 to 13, comprising the step of transiently transfecting a macrophage with an mRNA molecule encoding IL-10 and / or MMP9.

[0188] 25. The method according to Embodiment 24, comprising the step of contacting macrophages with IL-4 and IL-13 before, during, or after transfection.

[0189] 26. The method according to Embodiment 24 or 25, wherein mRNA molecules encoding IL-10 and MMP9 are co-transfected using a bisistronic vector linked by a p2A linker sequence.

[0190] 27. An engineered macrophage according to any one of Embodiments 1 to 13, which is engineered with a human IL-10 encoding mRNA construct fused to a human MMP9 protein via a cleavable linker.

[0191] 28. A method for treating inflammation and / or fibrosis, comprising the step of administering a therapeutically effective dose of an engineered macrophage described in any one of Embodiments 1 to 13 to a subject in need thereof.

[0192] The present invention also provides the following embodiments, which can be combined with any other embodiments: 1. Manipulated macrophages that have been engineered to overexpress IL-10.

[0193] 2. 4×10 6 The manipulated macrophages according to Embodiment 1, which, when cultured in vitro at a cell concentration of cells / ml, secrete IL-10 at a culture supernatant concentration of at least 10,000 pg / ml.

[0194] 3. The engineered macrophages according to Embodiment 1 or 2, further engineered to overexpress MMP9.

[0195] 4. The manipulated macrophage according to Embodiment 3, comprising an exogenous coding sequence for IL-10 and an exogenous coding sequence for MMP9.

[0196] 5. The manipulated macrophage according to Embodiment 4, wherein the expression of the exogenous coding sequence has a synergistic effect in the restoration of MMP activity and / or in monocyte recruitment by the macrophage, compared to a manipulated macrophage containing only the exogenous IL-10 sequence.

[0197] 6. The manipulated macrophage according to any one of Embodiments 1 to 5, wherein the macrophage and / or coding sequence is human.

[0198] 7. The exogenous coding sequence of IL-10 codes for a protein having an amino acid sequence at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4, and optionally, the IL-10 protein contains the same amino acid sequence as SEQ ID NO: 4, wherein the manipulated macrophage is according to any one of Embodiments 4 to 6.

[0199] 8. The exogenous coding sequence of MMP9 codes for a protein having an amino acid sequence that is at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 6, and optionally, the MMP9 protein contains the same amino acid sequence as SEQ ID NO: 6, wherein the manipulated macrophage is according to any one of Embodiments 4 to 7.

[0200] 9. The manipulated macrophage according to Embodiments 4, 5, 7, or 8, wherein the exogenous coding sequence is present on one or more nucleic acid molecules or is incorporated into the genome of the macrophage.

[0201] 10. The manipulated macrophage according to Embodiment 9, wherein the nucleic acid molecule is a DNA or RNA molecule, preferably an mRNA molecule, and optionally, IL-10 and MMP9 are expressed from the same mRNA molecule, and optionally, the mRNA molecule encodes IL-10 and MMP9 linked by a linker sequence, and optionally, the linker is a self-cleaving 2A linker, and optionally, the linker is p2A.

[0202] 11. The nucleic acid molecule is an mRNA molecule containing at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical sequence to SEQ ID NO: 13, and optionally the nucleic acid is an engineered macrophage according to Embodiment 10, comprising SEQ ID NO: 13.

[0203] 12. The nucleic acid molecule is an mRNA molecule containing at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical sequence to SEQ ID NO: 14, and optionally the nucleic acid is an engineered macrophage according to Embodiment 10 or 11, comprising SEQ ID NO: 14.

[0204] 13. The nucleic acid molecule is an mRNA molecule encoding IL-10 and MMP9 linked by a linker sequence, the linker sequence encoding a protein containing the amino acid sequence described in SEQ ID NO: 7, and optionally the protein encoded by the linker sequence contains the amino acid sequence described in SEQ ID NO: 9, wherein the manipulated macrophage is according to any one of Embodiments 10 to 12.

[0205] 14. The manipulated macrophage according to any one of Embodiments 10 to 13, wherein the nucleic acid molecule is an mRNA molecule encoding IL-10 and MMP9 linked by a linker sequence, and the linker sequence comprises mRNA having the sequence described in Sequence ID No. 15.

[0206] 15. The nucleic acid molecule is an mRNA molecule having a sequence that is at least 80% identical to SEQ ID NO: 10, preferably at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 10, and optionally further comprising a poly(A) tail and / or 5' cap of 65 to 250 residues in length, preferably 90 to 120 residues in length. This is the manipulated macrophage according to any one of Embodiments 10 to 14.

[0207] 16. The nucleic acid molecule is an mRNA molecule having a sequence that is at least 80% identical to SEQ ID NO: 16, preferably at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 16, and optionally the mRNA further comprises a 5' cap, the manipulated macrophage according to any one of embodiments 10 to 15.

[0208] 17. The manipulated macrophage according to Embodiment 16, wherein the mRNA molecule comprises chemically modified residues, preferably modified uracil residues, and optionally comprises at least one synthetic cap.

[0209] 18. An engineered macrophage according to any one of Embodiments 4 to 17, wherein the exogenous coding sequence for IL-10 is located on the same nucleic acid as the exogenous coding sequence for MMP9.

[0210] 19. A manipulated macrophage according to any one of Embodiments 1 to 18, wherein the macrophage is manipulated by editing the endogenous promoter of the IL-10 gene and / or the MMP9 gene, or by regulating the expression of endogenous silencing RNA, or by introducing an exogenous silencing RNA sequence, wherein the silencing RNA is optionally a miRNA.

[0211] 20. An engineered macrophage according to any one of Embodiments 1 to 19, wherein the level of metalloproteinase activity is at least 1.5 times that of an unengineered macrophage.

[0212] 21. An engineered macrophage according to any one of Embodiments 1 to 20, wherein CD86 expression is reduced to at least half or less compared to unengineered, nonpolarized cells.

[0213] 22. An engineered macrophage according to any one of Embodiments 1 to 21, wherein HLA-DR expression is reduced to at least half or less compared to unengineered, nonpolarized cells.

[0214] 23. Manipulated macrophages according to any one of Embodiments 1 to 22, wherein IL-10 secretion is increased by at least 1,000-fold compared to unmanipulated, nonpolarized cells.

[0215] 24. Manipulated macrophages according to any one of Embodiments 1 to 23, having at least a 10-fold increase in MMP3 secretion compared to unmanipulated, nonpolarized cells.

[0216] 25. Manipulated macrophages according to any one of Embodiments 1 to 24, having at least a 20-fold increase in MMP10 secretion compared to unmanipulated, nonpolarized cells.

[0217] 26. 4×10 6 A manipulated macrophage according to any one of Embodiments 1 to 25, which secretes IL-10 at a culture supernatant concentration of at least 10,000 pg / ml when cultured in vitro at a cell concentration of cells / ml.

[0218] 27. 4×10 6 A manipulated macrophage according to any one of Embodiments 1 to 26, which secretes MMP9 at a culture supernatant concentration of at least 200 ng / ml when cultured in vitro at a cell concentration of cells / ml.

[0219] 28. The engineered macrophage according to any one of embodiments 1 to 27, wherein the expression of CD206 is increased by at least 5-fold as compared with monocytes.

[0220] 29. The engineered macrophage according to any one of embodiments 1 to 28, wherein the expression of 25F9 is increased by at least 5-fold as compared with monocytes.

[0221] 30. The engineered macrophage according to any one of embodiments 1 to 29, wherein the expression of CD80 is reduced by at least 10% as compared with unengineered non-polarized cells.

[0222] 31. 4×10 6 The engineered macrophage according to any one of embodiments 1 to 30, which secretes TNF-a at a culture supernatant concentration of up to 40 pg / ml when cultured in vitro at a cell concentration of cells / ml.

[0223] 32. The engineered macrophage according to any one of embodiments 1 to 31, which has phagocytic capacity at least equivalent to that of unengineered non-polarized cells.

[0224] 33. The engineered macrophage according to any one of embodiments 1 to 32, wherein the metalloprotease activity is restored as compared with the reduction of metalloprotease activity in macrophages engineered with only an IL-10 coding sequence.

[0225] 34. The engineered macrophage according to any one of embodiments 1 to 33, which is transiently transfected, optionally via electroporation.

[0226] 35. The engineered macrophage according to embodiment 34, wherein the transfection is non-viral.

[0227] 36. The engineered macrophage according to any one of claims 1 to 35, which has a recovery-promoting phenotype.

[0228] 37. The population of engineered macrophages according to any one of embodiments 1 to 36.

[0229] 38. A therapeutic composition comprising the population of macrophages according to embodiment 37 and a pharmaceutically acceptable vehicle.

[0230] 39. The engineered macrophage according to any one of embodiments 1 to 36, the population of macrophages according to embodiment 37, or the composition according to embodiment 38, for use in therapy.

[0231] 40. The engineered macrophage, population, or composition according to embodiment 39, wherein the therapy is administered to a subject in need thereof.

[0232] 41. The engineered macrophage according to any one of embodiments 1 to 36, the population of macrophages according to embodiment 37, or the composition according to embodiment 38, for use in the treatment of an inflammatory condition in a subject.

[0233] 42. The engineered macrophage, population, or composition according to embodiment 40 or 41, wherein the macrophage is autologous or allogeneic to the subject.

[0234] 43. The engineered macrophage, population, or composition according to embodiment 41, wherein the inflammatory condition is liver injury, optionally chronic liver injury.

[0235] 44. The engineered macrophage, population, or composition according to embodiment 41 or 43, wherein the condition is a chronic inflammatory condition with a fibrotic component, and optionally the condition is organ damage associated with chronic inflammation.

[0236] 45. The condition is fibrosis, and the fibrosis is present in or affects an organ selected from the group consisting of the liver, lungs, heart, kidneys, pancreas, skin, gastrointestinal tract, bone marrow, hematopoietic tissue, nervous system, eyes, and combinations thereof, the manipulated macrophages, population, or composition according to Embodiments 41, 43, or 44.

[0237] 46. ​​The condition is cirrhosis of the liver, an engineered macrophage, population, or composition according to Embodiment 43 or 44.

[0238] 47. The manipulated macrophages, population, or composition according to Embodiment 46, arising from cirrhosis of the liver from at least one disease or condition selected from the group consisting of non-alcoholic fatty liver disease (NAFL) (e.g., non-alcoholic fatty liver disease (NAFLD) or non-alcoholic steatohepatitis (NASH)), alcoholic liver disease (e.g., alcoholic fatty liver disease (AFLD) or alcoholic steatohepatitis (ASH)), mechanical trauma to the liver, bile duct obstruction, autoimmune hepatitis, iron overload, hepatitis B infection (HBV), and hepatitis C infection (HCV).

[0239] 48. The manipulated macrophages, population, or composition according to Embodiment 46, wherein cirrhosis arises from fatty liver disease (SLD), and optionally, the fatty liver disease is metabolic dysfunction-related fatty liver disease, metabolic-related steatohepatitis, Met-ALD, or idiopathic SLD.

[0240] 49. The cirrhosis is selected from compensated cirrhosis or decompensated cirrhosis, and is an engineered macrophage, population, or composition according to any one of embodiments 46 to 48.

[0241] 50. The condition is acute exacerbation of chronic liver failure (ACLF), an engineered macrophage, population, or composition according to any one of Embodiments 41 to 49.

[0242] 51. An engineered macrophage, population, or composition according to any one of Embodiments 46 to 49 for use in the treatment of a subject that has recovered (recompensated) from an initial hepatic decompensation event, wherein the initial hepatic decompensation event required hospitalization of the subject, and preferably the subject has not experienced any further hepatic decompensation events since recovering from the initial hepatic decompensation event.

[0243] 52. The subject is an engineered macrophage, population, or composition according to any one of embodiments 46-49 and 51, exhibiting or recovering from one or more clinical signs of hepatic decompensation selected from the list consisting of jaundice, ascites, hepatic encephalopathy, hepatorenal syndrome, variceal bleeding, and gastrointestinal bleeding.

[0244] 53. The manipulated macrophages, population, or composition according to any one of Embodiments 1 to 52, wherein the macrophages are derived from human monocyte-derived macrophages (hMDM) or stem cells, and optionally the stem cells are induced pluripotent stem cells (iPSCs).

[0245] 54. The manipulated macrophages, population, or composition according to Embodiment 53, wherein the macrophages are derived from iPSCs, and the iPSCs essentially lack functional HLA I and II complexes on their surface.

[0246] 55. A method for improving the migration of monocytes to an inflammatory area, comprising the use of an engineered macrophage, a population of engineered macrophages, or a composition described in any one of Embodiments 1 to 54.

[0247] 56. The method according to Embodiment 55, which polarizes host monocytes / macrophages into a pro-recovery phenotype and / or avoids a pro-inflammatory phenotype.

[0248] 57. A method of producing the engineered macrophage according to any one of embodiments 1 to 36, comprising the step of transiently transfecting a macrophage with an mRNA molecule encoding IL-10 and / or MMP9.

[0249] 58. The method according to embodiment 57, comprising the step of contacting the macrophage with IL-4, IL-13, and M-CSF before, during, or after transfection.

[0250] 59. The method according to embodiment 57 or 58, wherein the mRNA molecules encoding IL-10 and MMP9 are co-transfected using a bicistronic vector linked by a p2A linker sequence.

[0251] 60. The engineered macrophage according to any one of embodiments 1 to 36, which is engineered with an mRNA construct encoding human IL-10 fused to human MMP9 protein via a cleavable linker.

[0252] 61. A method of treating inflammation and / or fibrosis, comprising the step of administering a therapeutically effective amount of the engineered macrophage according to any one of embodiments 1 to 36 to a subject in need thereof.

[0253] 62. A method of polarizing a macrophage to a pro-resolving phenotype, wherein the polarized macrophage has increased expression of CD163 and CD206 and reduced expression of HLA DR and CD86 compared to a cell not polarized to the pro-resolving phenotype, and the method comprises the step of engineering the macrophage to express IL-10 and MMP9 above endogenous levels.

[0254] 63. The method according to embodiment 62, wherein the macrophage is engineered to express IL-10 and MMP9 by introducing an exogenous nucleic acid comprising nucleotide sequences encoding IL-10 and MMP9.

[0255] 64. The method according to Embodiment 63, wherein the nucleotide sequences encoding IL-10 and MMP9 are located on the same nucleic acid molecule.

[0256] 65. The method according to Embodiment 63, wherein the nucleotide sequences encoding IL-10 and MMP9 are located on separate nucleic acid molecules.

[0257] 66. The method according to any one of embodiments 63 to 65, wherein the nucleic acid is mRNA.

[0258] 67. A method for polarizing macrophages to a regenerative phenotype, wherein the polarized macrophages have increased expression of CD163 and CD206 and decreased expression of HLA DR and CD86 compared to cells that have not been polarized to a regenerative phenotype, the method comprising the step of manipulating macrophages to overexpress IL-10, and optionally the macrophages being 4 × 10⁶ 6 A method for inducing IL-10 secretion at a culture supernatant concentration of at least 10,000 pg / ml when cells are cultured in vitro at a cell concentration of cells / ml.

[0259] 68. The method according to Embodiment 67, wherein macrophages are manipulated to express IL-10 by introducing an exogenous nucleic acid containing a nucleotide sequence encoding IL-10.

[0260] 69. The method according to embodiment 67 or 68, wherein the nucleic acid is mRNA.

[0261] 70. A method for improving the freeze-recovery ability of macrophages, comprising the step of incubating macrophages in a culture medium containing IL-4, IL-13, and M-CSF.

[0262] 71. A method for cryopreserving macrophages, comprising the step of incubating the macrophages in a culture medium containing IL-4, IL-13, and M-CSF before cryopreservation.

[0263] 72. The concentrations of IL-4 and IL-13 in the culture medium were 20 ng / ml, the concentration of M-CSF was 100 ng / ml, and the number of macrophages was 4 × 10⁶. 6 The method according to embodiment 70 or 71, wherein the concentration is at a number of cells / ml.

[0264] 73. The method according to any one of embodiments 70 to 72, wherein cells are incubated overnight in a medium containing IL-4, IL-13, and M-CSF.

[0265] 74. Cryopreserved macrophages obtained by the method described in any one of Embodiments 70 to 73.

[0266] According to a preferred embodiment, the present invention provides engineered macrophages for use in a method of treating cirrhosis in a subject, wherein the macrophages are engineered to overexpress IL-10 and optionally further engineered to overexpress MMP9, the method comprising the step of administering the engineered macrophages to a subject, the subject being hospitalized after an initial hepatic decompensation event and having experienced subsequent further decompensation events after the initial decompensation event prior to the administration of the engineered macrophages to the subject.

[0267] According to a preferred embodiment, the present invention provides engineered macrophages for use in a method of treating cirrhosis of the liver in a subject, wherein the engineered macrophages are engineered to overexpress IL-10 and further engineered to optionally overexpress MMP9, the method comprising the step of administering the engineered macrophages to a subject, the subject having refractory ascites.

[0268] According to some embodiments, "cirrhosis" in the subject refers to cirrhosis resulting from a liver disease etiology selected from at least one of the following: (1) pure metabolic dysfunction-related fatty liver disease (MASLD), (2) metabolic and alcohol-related liver disease (Met-ALD), (3) persistent virological response to HCV with progressive cirrhosis (HCV SVR), or (4) alcohol-related liver disease (ALD or Met-ALD), provided that the patient has not consumed alcohol beyond the Met-ALD limit (i.e., does not show alcohol abuse) and the PEth alcohol test value is less than 25 mg / l. In a particularly preferred embodiment, the present invention provides engineered macrophages engineered to overexpress IL-10 and optionally further engineered to overexpress MMP9 for use in a method of treating cirrhosis in a subject, wherein the method comprises the step of administering the engineered macrophages to a subject, the subject being hospitalized after the subject's first hepatic decompensation event, and having experienced subsequent further decompensation events after the first decompensation event prior to administration of the engineered macrophages to the subject, and the subject having all of the following characteristics indicating a high likelihood of benefiting from the treatment Having: No known contraindications to G-CSF or leukocyte extraction procedures; age 18-17 years; diagnosis of cirrhosis based on at least one of the following: a. Clinical and radiological features correlating with the diagnosis of cirrhosis; liver stiffness score measured by transient elastography (TE; FibroScan) > 15 kPa; and c. Past liver biopsy supporting the histological features of cirrhosis; etiology of the following liver diseases: a. pure metabolic dysfunction-related fatty liver disease (MASLD), or metabolic and alcohol-related liver disease (Met-ALD), or persistent virological response to HCV (HCV SVR) with progressing cirrhosis; b. alcohol-related liver disease (ALD or Met-ALD), only if it is confirmed that the subject has not consumed alcohol beyond the Met-ALD limit, which is defined as intake of more than 14 units / week or more than 2 units / day for women, and more than 3 units / day for men (1 unit is equivalent to 8g of alcohol); c.The study is limited to patients with alcohol-related liver disease (ALD or Met-ALD) whose PEth test value is less than 25 mg / l; a MELD 3.0 score of 12-20 obtained within two weeks of an eligible decompensated event; or, if the participant is eligible as an outpatient, a MELD 3.0 score of 12-20 at screening (visit 1); and hospitalization as a patient with a severe hepatic decompensated event such as ascites, hepatic encephalopathy, variceal bleeding, hepatorenal syndrome / acute kidney injury (HRS / AKI), or spontaneous bacterial peritonitis (SBP), which is either the only hospitalization for a hepatic decompensated event within the past six months, or refractory ascites defined as ascites that cannot be mobilized or recurs within eight weeks after LVP (the onset date of refractory ascites is defined as the time of the second LVP).

[0269] In certain embodiments, subjects do not possess any of the following characteristics indicating ineligibility for treatment: cirrhosis resulting from any viral hepatitis other than hepatitis C virus (HCV SVR); cirrhosis resulting from autoimmune and cholestatic etiologies, e.g., primary biliary cholangitis (PBC) and primary sclerosing cholangitis (PSC); acute liver disease without underlying cirrhosis, e.g., drug-induced liver injury (DILI), e.g., drug-induced liver injury (DILI); any current organ failure requiring more than outpatient supportive care and not associated with a participant's hepatic decompensation event; known splenomegaly of 16 cm or more; 50 × 10 9Thrombocytopenia less than 1 / L; presence or suspicion of any of the following comorbidities: history of liver or other organ transplantation, ACLF, sepsis (with positive microbial culture), except for stable cases and at least 4 weeks after completion of a full course of IV antibiotics for human immunodeficiency virus (HIV); known human immunodeficiency virus; human T-lymphotropic virus type 1, pulmonary embolism (PE), hepatocellular carcinoma (HCC) or active malignancy within the past 5 years (excluding non-melanoma skin cancer, cervical intraepithelial neoplasia, superficial bladder cancer, benign polyps, etc.), hepatic comorbidities, e.g., portal vein thrombosis, hepatic pleural effusion, except for small pleural effusions that are not clinically apparent, detected incidentally by radiological evaluation, and do not require clinical intervention; chronic renal impairment (on dialysis) or unresolved acute kidney injury (AKI); acute or chronic heart failure (New York Heart Association Grade III / IV) Portal pulmonary hypertension, severe chronic lung disease, e.g., chronic obstructive pulmonary disease (COPD) or interstitial lung disease, where FEV1 is less than 50% and / or FEV1 / FVC is less than 60%, hepatopulmonary syndrome, history of chronic albumin treatment, or current treatment with chronic albumin, severe untreated / unstable mental illness, TIPS within the past 6 months; any evidence of life-threatening complications; current or planned use of immunomodulatory or immunosuppressant agents (low-dose corticosteroids up to 10 mg / kg / day of prednisone or equivalent). Participants who are permitted to use or who use inhaled steroids to manage asthma; who are currently receiving gene therapy or cell therapy; who have a known hypersensitivity to dimethyl sulfoxide (DMSO); for female patients only - who are pregnant or breastfeeding, or who plan to become pregnant within the next year, or who are capable of becoming pregnant and do not intend to follow any contraceptive requirements; who have had current or recent alcohol abuse in the three months prior to treatment, defined as drinking more than 3 units / day for women, more than 4 units / day for men, or heavy drinking (more than 14 units / day); or who are using drugs without the supervision of a physician.

[0270] In another preferred embodiment, the present invention provides engineered macrophages engineered to overexpress IL-10 and optionally further engineered to overexpress MMP9 for use in a method of treating cirrhosis in a subject, the method comprising the step of administering the engineered macrophages to a subject, the subject having been hospitalized after the subject's first hepatic decompensation event and having experienced subsequent further decompensation events after the first decompensation event prior to administration of the engineered macrophages to the subject, and the subject not having, knowingly having, and / or being suspected of having any of the following comorbidities or indicators of increased risk: HCV Cirrhosis resulting from any viral hepatitis other than SVR; cirrhosis resulting from autoimmune and cholestatic etiologies (e.g., primary biliary cholangitis and primary sclerosing cholangitis, but not limited to these); any current organ failure requiring more than outpatient supportive care, not associated with a hepatic decompensation event (an eligible event); known splenomegaly, optionally, with a maximum spleen size greater than 16 cm; thrombocytopenia, optionally, with thrombocytopenia of 50 × 10⁴ 9Platelet count less than 1 platelets / L (as defined); history of liver or other organ transplantation, e.g., having received at least one previous liver or organ transplant; acute exacerbation of chronic liver failure (ACLF); recent sepsis, positive for microbial culture or as defined by a physician, except when stable and at least 5 weeks after completion of a full course of IV antibiotics; known human immunodeficiency virus (HIV) infection; pulmonary embolism; hepatocellular carcinoma (HCC) or active malignancy (excluding non-melanoma skin cancer, cervical carcinoma in situ, or superficial bladder cancer) within 5 years prior to the initiation of treatment. Hepatic pleural effusion (resistant to medical treatment) or hepatic complications such as portal vein thrombosis; chronic renal dysfunction (in which cases may require dialysis); unresolved acute kidney injury (AKI); acute heart failure; chronic heart failure; portal pulmonary hypertension; severe chronic lung disease, e.g., chronic obstructive pulmonary disease (COPD) or interstitial lung disease, where the forced expiratory capacity (FEV1) is less than 50% or 60% and / or forced vital capacity (FVC) is less than 60%; hepatopulmonary syndrome; history of or current chronic albumin treatment; and / or severe untreated or unstable mental illness.

[0271] In a particularly preferred embodiment, the present invention provides engineered macrophages engineered to overexpress IL-10 and optionally further engineered to overexpress MMP9 for use in a method of treating cirrhosis in a subject, the method comprising the step of administering the engineered macrophages to a subject, wherein the subject has been hospitalized after an initial hepatic decompensation event and has experienced subsequent decompensation events after the initial decompensation event prior to administration of the engineered macrophages to the subject, the subject does not have any of the aforementioned comorbidities or indicators of increased risk and exhibits all of the aforementioned characteristics indicating that it is likely to benefit from the treatment.

[0272] According to a preferred embodiment, the present invention provides engineered macrophages engineered to overexpress IL-10 and optionally further engineered to overexpress MMP9 for use in a method of treating cirrhosis in a subject, wherein the method comprises the step of administering the engineered macrophages to a subject, the subject being hospitalized after the subject's first hepatic decompensation event, the subject recovering from the subject's first hepatic decompensation event, the subject not having experienced any subsequent or further decompensation events prior to the treatment, and the subject being likely to benefit from the treatment, all of the following characteristics The following conditions must be met: no known contraindications to G-CSF or leukocyte transport procedures; age 18-17 years; diagnosis of cirrhosis based on at least one of the following: a. clinical and radiological features correlating with the diagnosis of cirrhosis; liver stiffness score measured by transient elastography (TE; FibroScan) > 15 kPa; and c. past liver biopsy supporting the histological features of cirrhosis; etiology of the following liver diseases: a. pure metabolic dysfunction-related fatty liver disease (MASLD), or metabolic and alcohol-related liver disease (Met-ALD), or persistent virological response to HCV with progressing cirrhosis (HCV b. Alcohol-related liver disease (ALD or Met-ALD), only if it is confirmed that the subject has not consumed alcohol in excess of the Met-ALD limit, which is defined as consuming more than 14 units / week or 2 units / day for women, and more than 3 units / day for men (1 unit is equivalent to 8g of alcohol); c. Alcohol-related liver disease (ALD or Met-ALD), only if the subject has a PEth test value of less than 25 mg / l; a MELD 3.0 score of 12-20 obtained within two weeks of an eligible decompensated event, or, if the participant is eligible as an outpatient, a MELD 3.0 score of 12-20 at the time of screening (visit 1).The patient must have a score of 0; be admitted as a patient with a severe hepatic decompensation event such as ascites, hepatic encephalopathy, variceal bleeding, hepatorenal syndrome / acute kidney injury (HRS / AKI), or spontaneous bacterial peritonitis (SBP), and this is either the only hospitalization for a hepatic decompensation event within the past 6 months, or refractory ascites defined as ascites that cannot be mobilized or recurs within 8 weeks after LVP (the onset date of refractory ascites is defined as the time of the second LVP).

[0273] In certain embodiments, subjects do not possess any of the following characteristics indicating ineligibility for treatment: cirrhosis resulting from any viral hepatitis other than hepatitis C virus (HCV SVR); cirrhosis resulting from autoimmune and cholestatic etiologies, e.g., primary biliary cholangitis (PBC) and primary sclerosing cholangitis (PSC); acute liver disease without underlying cirrhosis, e.g., drug-induced liver injury (DILI), e.g., drug-induced liver injury (DILI); any current organ failure requiring more than outpatient supportive care and not associated with a participant's hepatic decompensation event; known splenomegaly of 16 cm or more; 50 × 10 9Thrombocytopenia less than 1 / L; presence or suspicion of any of the following comorbidities: history of liver or other organ transplantation, ACLF, sepsis (with positive microbial culture), except for stable cases and at least 4 weeks after completion of a full course of IV antibiotics for human immunodeficiency virus (HIV), known human immunodeficiency virus, human T-lymphotropic virus type 1, pulmonary embolism (PE), hepatocellular carcinoma (HCC) or active malignancy (excluding non-melanoma skin cancer, cervical intraepithelial neoplasia, superficial bladder cancer, benign polyps, etc.) within the past 5 years, hepatic comorbidities, e.g., portal vein thrombosis, hepatic pleural effusion, except for small pleural effusions that are not clinically apparent, detected incidentally by radiological evaluation, and do not require clinical intervention, chronic renal impairment (on dialysis) or unresolved acute kidney injury (AKI), acute or chronic heart failure (New York Heart Association Grade III / IV) Portal pulmonary hypertension, severe chronic lung disease, e.g., chronic obstructive pulmonary disease (COPD) or interstitial lung disease, where FEV1 is less than 50% and / or FEV1 / FVC is less than 60%, hepatopulmonary syndrome, history of chronic albumin treatment, or current treatment with chronic albumin, severe untreated / unstable mental illness, TIPS within the past 6 months; any evidence of life-threatening complications; current or planned use of immunomodulatory or immunosuppressant agents (low-dose corticosteroids up to 10 mg / kg / day of prednisone or equivalent) Participants who are tolerant of steroids or inhaled steroids for managing asthma; who are currently receiving gene therapy or cell therapy; participants with a known hypersensitivity to dimethyl sulfoxide (DMSO); female patients only - pregnant or breastfeeding, planning to become pregnant within the next year, or of childbearing potential and unwilling to follow contraceptive requirements; current / recent alcohol abuse in the three months prior to treatment, drinking more than 3 units / day for women, more than 4 units / day for men, or heavy drinking (more than 14 units / day); drug abuse not under the supervision of a physician.

[0274] According to another preferred embodiment, the present invention provides engineered macrophages engineered to overexpress IL-10 and optionally further engineered to overexpress MMP9 for use in a method of treating cirrhosis in a subject, the method comprising the step of administering the engineered macrophages to a subject, wherein the subject has been hospitalized following the subject's first hepatic decompensation event, the subject has recovered from the subject's first hepatic decompensation event, the subject has not experienced any subsequent or further decompensation events prior to the treatment, and the subject does not have, or is not known to have, any of the following comorbidities or indicators of increased risk at the start of the treatment: HCV Cirrhosis resulting from any viral hepatitis other than SVR; cirrhosis resulting from autoimmune and cholestatic etiologies (e.g., primary biliary cholangitis and primary sclerosing cholangitis, but not limited to these); any current organ failure requiring more than outpatient supportive care, not associated with a hepatic decompensation event (an eligible event); known splenomegaly, optionally, with a maximum spleen size greater than 16 cm; thrombocytopenia, optionally, with thrombocytopenia of 50 × 10⁴ 9Platelet count less than 1 platelets / L (as defined); history of liver or other organ transplantation, e.g., having received at least one previous liver or organ transplant; acute exacerbation of chronic liver failure (ACLF); recent sepsis, positive for microbial culture or as defined by a physician, except when stable and at least 5 weeks after completion of a full course of IV antibiotics; known human immunodeficiency virus (HIV) infection; pulmonary embolism; hepatocellular carcinoma (HCC) or active malignancy (excluding non-melanoma skin cancer, cervical carcinoma in situ, or superficial bladder cancer) within 5 years prior to the initiation of treatment. Hepatic pleural effusion (resistant to medical treatment) or hepatic complications such as portal vein thrombosis; chronic renal dysfunction (in which cases may require dialysis); unresolved acute kidney injury (AKI); acute heart failure; chronic heart failure; portal pulmonary hypertension; severe chronic lung disease, e.g., chronic obstructive pulmonary disease (COPD) or interstitial lung disease, where the forced expiratory capacity (FEV1) is less than 50% or 60% and / or forced vital capacity (FVC) is less than 60%; hepatopulmonary syndrome; history of or current chronic albumin treatment; and / or severe untreated or unstable mental illness.

[0275] According to another preferred embodiment, the present invention provides engineered macrophages engineered to overexpress IL-10 and optionally further engineered to overexpress MMP9 for use in a method of treating cirrhosis in a subject, the method comprising the step of administering the engineered macrophages to a subject, wherein the subject has been hospitalized following the subject's first hepatic decompensation event, the subject has recovered from the subject's first hepatic decompensation event (or is clinically stable following this first hepatic decompensation event) prior to administration of the engineered macrophages to the subject, the subject has not experienced any subsequent or further decompensation events prior to the treatment, the subject does not have any of the aforementioned comorbidities or indicators of increased risk, and exhibits all of the aforementioned characteristics indicating that it is likely to benefit from the treatment.

[0276] In a particularly preferred embodiment, the present invention provides engineered macrophages engineered to overexpress IL-10 and optionally further engineered to overexpress MMP9 for use in a method for treating cirrhosis in a subject, the method comprising the step of administering the engineered macrophages to a subject, the subject having refractory ascites and possessing all of the following characteristics indicating a high likelihood of benefiting from the treatment: no known contraindications to G-CSF or leukocyte transport procedures; age 18-17 years; diagnosis of cirrhosis based on at least one of the following: a. clinical and radiological features correlating with the diagnosis of cirrhosis; liver stiffness score measured by transient elastography (TE; FibroScan) > 15 kPa; and c. past liver biopsy supporting histological features of cirrhosis; etiology of the following liver disease: a. pure metabolic dysfunction-related fatty liver disease (MASLD), or metabolic and alcohol-related liver disease (Met-ALD), or persistent virological response to HCV with progressing cirrhosis (HCV b. Alcohol-related liver disease (ALD or Met-ALD), only if it is confirmed that the subject has not consumed alcohol in excess of the Met-ALD limit, which is defined as consuming more than 14 units / week or 2 units / day for women, and more than 3 units / day for men (1 unit is equivalent to 8g of alcohol); c. Alcohol-related liver disease (ALD or Met-ALD), only if the subject has a PEth test value of less than 25 mg / l; a MELD 3.0 score of 12-20 obtained within two weeks of an eligible decompensated event, or, if the participant is eligible as an outpatient, a MELD score of 12-20 at screening (visit 1). A score of 3.0 is required; the patient must be admitted as a patient with a severe hepatic decompensation event such as ascites, hepatic encephalopathy, variceal bleeding, hepatorenal syndrome / acute kidney injury (HRS / AKI), or spontaneous bacterial peritonitis (SBP), and this is the only hospitalization for a hepatic decompensation event within the past six months, or refractory ascites defined as ascites that cannot be mobilized or recurs within eight weeks after LVP (the onset date of refractory ascites is defined as the time of the second LVP).

[0277] In certain embodiments, subjects do not possess any of the following characteristics indicating ineligibility for treatment: cirrhosis resulting from any viral hepatitis other than hepatitis C virus (HCV SVR); cirrhosis resulting from autoimmune and cholestatic etiologies, e.g., primary biliary cholangitis (PBC) and primary sclerosing cholangitis (PSC); acute liver disease without underlying cirrhosis, e.g., drug-induced liver injury (DILI), e.g., drug-induced liver injury (DILI); any current organ failure requiring more than outpatient supportive care and not associated with a participant's hepatic decompensation event; known splenomegaly of 16 cm or more; 50 × 10 9Thrombocytopenia less than 1 / L; presence or suspicion of any of the following comorbidities: history of liver or other organ transplantation, ACLF, sepsis (with positive microbial culture), except for stable cases and at least 4 weeks after completion of a full course of IV antibiotics for human immunodeficiency virus (HIV), known human immunodeficiency virus, human T-lymphotropic virus type 1, pulmonary embolism (PE), hepatocellular carcinoma (HCC) or active malignancy (excluding non-melanoma skin cancer, cervical intraepithelial neoplasia, superficial bladder cancer, benign polyps, etc.) within the past 5 years, hepatic comorbidities, e.g., portal vein thrombosis, hepatic pleural effusion, except for small pleural effusions that are not clinically apparent, detected incidentally by radiological evaluation, and do not require clinical intervention, chronic renal impairment (on dialysis) or unresolved acute kidney injury (AKI), acute or chronic heart failure (New York Heart Association Grade III / IV) Portal pulmonary hypertension, severe chronic lung disease, e.g., chronic obstructive pulmonary disease (COPD) or interstitial lung disease, where FEV1 is less than 50% and / or FEV1 / FVC is less than 60%, hepatopulmonary syndrome, history of chronic albumin treatment, or current treatment with chronic albumin, severe untreated / unstable mental illness, TIPS within the past 6 months; any evidence of life-threatening complications; current or planned use of immunomodulatory or immunosuppressant agents (low-dose corticosteroids up to 10 mg / kg / day of prednisone or equivalent) Participants who are tolerant of steroids or inhaled steroids for managing asthma; who are currently receiving gene therapy or cell therapy; participants with a known hypersensitivity to dimethyl sulfoxide (DMSO); female patients only - pregnant or breastfeeding, planning to become pregnant within the next year, or of childbearing potential and unwilling to follow contraceptive requirements; current / recent alcohol abuse in the three months prior to treatment, drinking more than 3 units / day for women, more than 4 units / day for men, or heavy drinking (more than 14 units / day); drug abuse not under the supervision of a physician.

[0278] In another preferred embodiment, the present invention provides engineered macrophages engineered to overexpress IL-10 and optionally further engineered to overexpress MMP9 for use in a method for treating cirrhosis in a subject, the method comprising the step of administering the engineered macrophages to a subject, the subject having refractory ascites, and the subject not having, or being known to have, any of the following comorbidities or indicators of increased risk, and / or not being suspected of having: cirrhosis resulting from any viral hepatitis other than HCV SVR; cirrhosis resulting from autoimmune and cholestatic etiologies (e.g., primary biliary cholangitis and primary sclerosing cholangitis); any current organ failure requiring more than outpatient supportive care, not associated with a hepatic decompensation event (an eligible event); known splenomegaly, optionally, the subject's spleen is greater than 16 cm; thrombocytopenia, optionally, thrombocytopenia is 50 × 10 9 Platelet count less than 1 platelets / L (as defined); history of liver or other organ transplantation, e.g., having received at least one previous liver or organ transplant; acute exacerbation of chronic liver failure (ACLF); recent sepsis, positive for microbial culture or as defined by a physician, except when stable and at least 5 weeks after completion of a full course of IV antibiotics; known human immunodeficiency virus (HIV) infection; pulmonary embolism; hepatocellular carcinoma (HCC) or active malignancy (excluding non-melanoma skin cancer, cervical carcinoma in situ, or superficial bladder cancer) within 5 years prior to the initiation of treatment. Hepatic pleural effusion (resistant to medical treatment) or hepatic complications such as portal vein thrombosis; chronic renal dysfunction (in which cases may require dialysis); unresolved acute kidney injury (AKI); acute heart failure; chronic heart failure; portal pulmonary hypertension; severe chronic lung disease, e.g., chronic obstructive pulmonary disease (COPD) or interstitial lung disease, where the forced expiratory capacity (FEV1) is less than 50% or 60% and / or forced vital capacity (FVC) is less than 60%; hepatopulmonary syndrome; history of or current chronic albumin treatment; and / or severe untreated or unstable mental illness.

[0279] In a particularly preferred embodiment, the present invention provides engineered macrophages engineered to overexpress IL-10 and optionally further engineered to overexpress MMP9 for use in a method of treating cirrhosis in a subject, the method comprising the step of administering the engineered macrophages to a subject, the subject having refractory ascites, the subject not having any of the aforementioned comorbidities or indicators of increased risk, and exhibiting all of the aforementioned characteristics indicating a high likelihood of benefiting from the treatment.

[0280] In a preferred embodiment, the present invention provides an engineered macrophage engineered to overexpress IL-10 for use in a method of treating cirrhosis in a subject hospitalized after an initial hepatic decompensation event. In a preferred embodiment, the present invention provides an engineered macrophage engineered to overexpress IL-10 for use in a method of treating cirrhosis in a subject hospitalized after an initial hepatic decompensation event, wherein the subject is treated with the engineered macrophage when the subject has recovered from the initial hepatic decompensation event and before experiencing further hepatic decompensation events. In a particularly preferred embodiment, the present invention provides an engineered macrophage engineered to overexpress IL-10 and MMP9 for use in a method of treating cirrhosis in a subject hospitalized after an initial hepatic decompensation event, wherein the subject is treated with the engineered macrophage when the subject has recovered from the initial hepatic decompensation event and before experiencing further hepatic decompensation events.

[0281] In a more preferred embodiment, the present invention provides engineered macrophages derived from iPSCs and engineered to overexpress IL-10. Preferably, the engineered iPSC-derived macrophages are used in the treatment of cirrhosis, particularly in subjects hospitalized after an initial hepatic decompensation event. In a particularly preferred embodiment, the engineered iPSC-derived macrophages are used in the treatment of cirrhosis, particularly in subjects hospitalized after an initial hepatic decompensation event, and the subjects are treated with the engineered macrophages while they have recovered from the initial hepatic decompensation event and before they experience any further hepatic decompensation events.

[0282] In a more preferred embodiment, the present invention provides engineered macrophages that are engineered to overexpress IL-10 and MMP9, and include exogenous mRNA encoding IL-10 and MMP9, which is optionally isolated by a cleavable linker. Preferably, the exogenous mRNA includes the sequence described in SEQ ID NO: 10, a poly-A tail (optionally 65 to 250 residues long, preferably 90 to 120 residues long), and a 5' cap. In another preferred embodiment, the exogenous mRNA sequence includes the sequence described in SEQ ID NO: 16 and a 5' cap. Preferably, the engineered macrophages are used for the treatment of cirrhosis, particularly in subjects hospitalized after an initial hepatic decompensation event. In a particularly preferred embodiment, the engineered macrophages are used for the treatment of cirrhosis, particularly in subjects hospitalized after an initial hepatic decompensation event, and the subjects are treated with the engineered macrophages while the subjects have recovered from the initial hepatic decompensation event and before experiencing further hepatic decompensation events.

[0283] In a more preferred embodiment, the present invention provides engineered macrophages derived from iPSCs and engineered to overexpress IL-10 and MMP9, comprising exogenous mRNA encoding IL-10 and MMP9, which is optionally isolated by a cleavable linker. Preferably, the exogenous mRNA comprises the sequence described in SEQ ID NO: 10, a poly-A tail (optionally 65 to 250 residues long, preferably 90 to 120 residues long, preferably about 90 residues long), and / or a 5' cap. In another preferred embodiment, the exogenous mRNA sequence comprises the sequence described in SEQ ID NO: 16 and a 5' cap. Preferably, the iPSC-derived engineered macrophages are used for the treatment of cirrhosis, particularly in subjects hospitalized after an initial hepatic decompensation event. In a particularly preferred embodiment, the manipulated macrophages derived from iPSCs are used to treat cirrhosis, especially in subjects hospitalized after an initial hepatic decompensation event, and the subjects are treated with the manipulated macrophages while they have recovered from the initial hepatic decompensation event and before they experience any further hepatic decompensation events.

[0284] In a more preferred embodiment, the present invention relates to engineered macrophages engineered to overexpress IL-10, used in a method for treating cirrhosis, particularly in subjects hospitalized after an initial hepatic decompensation event, wherein the macrophages are 4 × 10 6 The present invention provides engineered macrophages that secrete IL-10 at a culture supernatant concentration of at least 10,000 pg / ml when cultured in vitro at a cell concentration of 4 cells / ml. In a particularly preferred embodiment, the present invention provides engineered macrophages engineered to overexpress IL-10, used in a method of treating cirrhosis, particularly in subjects hospitalized after an initial hepatic decompensation event, wherein the macrophages are 4 × 10⁶ 6We provide engineered macrophages that, when cultured in vitro at a cell concentration of cells / ml, secrete IL-10 at a culture supernatant concentration of at least 10,000 pg / ml, and are used to treat subjects after they have recovered from their first hepatic decompensation event and before they experience any further hepatic decompensation events.

[0285] In a more preferred embodiment, the present invention relates to engineered macrophages engineered to overexpress IL-10 and MMP9, wherein the level of metalloproteinase activity is at least 1.5 times that of unengineered macrophages; CD86 expression is reduced by at least half compared to unengineered nonpolarized cells; HLA-DR expression is reduced by at least half compared to unengineered nonpolarized cells; IL-10 secretion is increased by at least 1000 times compared to unengineered nonpolarized cells; MMP3 secretion is increased by at least 10 times compared to unengineered nonpolarized cells; MMP10 secretion is increased by at least 20 times compared to unengineered nonpolarized cells; CD206 expression is increased by at least 5 times compared to monocytes; 25F9 expression is increased by at least 5 times compared to monocytes; CD80 expression is reduced by at least 10% compared to unengineered nonpolarized cells; 4 × 10 6 When cultured in vitro at a cell concentration of cells / ml, IL-10 was secreted at a culture supernatant concentration of at least 10,000 pg / ml; 4 × 10 6 When cultured in vitro at a cell concentration of cells / ml, the cells secrete MMP9 at a culture supernatant concentration of at least 200 ng / ml; and 4 × 10 6The present invention provides engineered macrophages that secrete TNF-α at a maximum culture supernatant concentration of 40 pg / ml when cultured in vitro at a cell concentration of cells / ml. In a particularly preferred embodiment, the engineered macrophages are derived from iPSCs and contain exogenous mRNA encoding IL-10 and MMP9, which are selectively isolated by a cleavable linker. Preferably, the iPSC-derived engineered macrophages are used for the treatment of cirrhosis, particularly in subjects hospitalized after an initial hepatic decompensation event. The present invention will now be further described with reference to the sections with the following headings. Any feature under any section may be combined with any aspect or embodiment of the present invention in any feasible order.

[0286] explanation The following definitions are provided.

[0287] "Payload," as used herein, is at least one nucleic acid (e.g., DNA or RNA, but not limited to) that codes for a therapeutic gene, which is optionally introduced into a macrophage by transfection.

[0288] As used herein, "nonpolarized macrophages" refers to mature macrophages that have not received further stimulation to induce specific functional capabilities, and nonpolarized macrophages may also refer to naive macrophages or inactivated macrophages.

[0289] "Mature macrophages" refer to macrophages that express mature cell surface markers (preferably CCR2-, CD14+, and 25F9+).

[0290] Macrophages can exist in various states known as "polarization," which are usually simplified into two main extremes: "pro-inflammatory" (or classical activation, "M1," "M1-like") and "pro-regenerative" (or "pre-recovery," alternative activation, "M2," "M2-like," anti-inflammatory, or anti-fibrotic). However, macrophages can exist in states between these extremes, which may be "non-polarized," quiescent, or naive (M0), or may be close to an anti-inflammatory or pro-inflammatory state.

[0291] Generally, M1 macrophages are assumed to be pro-inflammatory, while M2 macrophages are assumed to be involved in immunomodulation and wound healing responses. However, it is becoming increasingly clear that this binary classification cannot account for the more complex heterogeneity in vivo, such as macrophages exhibiting different phenotypes in response to various stimuli they are exposed to, and even switching between phenotypes. It is impossible to accurately reproduce these in vivo macrophage phenotypes in tissue culture models, highlighting the importance of function-based macrophage characterization. Macrophages acquire a "pro-regenerative" state under the action of various combinations of factors, including macrophage colony-stimulating factor (M-CSF), IL-4, IL-13, IL-10, and TGF-β. Macrophages primarily mediate wound healing and tissue regeneration.

[0292] Due to the complexity of macrophage biology, the classification into "M1" and "M2" may be considered an oversimplification. For example, "M2" macrophages are actually thought to be a spectrum depending on the environment. Therefore, further subcategorization of the regenerative M2-like state has been attempted, such as the following subcategorization proposed by Gharavi, AT et al., “The role of macrophage subtypes and exosomes in immunomodulation,” Cell Mol Biol Lett 27, 83 (2022). In this subcategorization, for example: M2a cells are thought to be anti-inflammatory, pro-fibrotic, and involved in allergy and wound healing. Such cells are classified by the expression of IL-10, IL-1R, IL-27a, CCL1, CCL17, CCL18, CCL22, CD11b, CD45, CD206, YM1, RELMa, IGF1, DCIR, Stabilin 1, Factor XIII-A, Ly6C, TREM-2, and DC-SIGN. The M2a state can be acquired under the action of factors such as IL-4, IL-13, IL-10, and PPARg. "M2b" cells are thought to be involved in the activation of T helper 2 (Th2) type responses, immunomodulation, and promotion of tumor progression. Such cells are classified by the expression of IL-6, TNF-α, CD86, and SPHK1. The M2b state can be acquired under the action of IL-1β or exposure to LPS. M2c cells are associated with immunosuppression, phagocytosis, tissue repair, and extracellular matrix remodeling. Such cells are classified by the expression of IL-10, CXCL13, CD163, CD206, CXCR4, TGF-β, and MerTK. The M2c state can be acquired under the action of IL-10, glucocorticoids, IL-6, IL-10, TNF-α, and TLR stimulation. "M2d" cells are associated with tumor progression, angiogenesis, and apoptotic tissue clearance. Such cells are classified by the expression of IL-10, VEGF, and TGF-β. The M2d state can be acquired through exposure to LPS.

[0293] Of the markers associated with each of these recovery-promoting states, the engineered macrophages of the present invention may typically express IL-10, CCL22, CD11b, CD45, CD206, CD86, CD163, and CXCR4. The engineered macrophages of the present invention may also typically express MHC II, which is more commonly associated with pro-inflammatory macrophages than usual. Thus, the engineered macrophages of the present invention differ from the recovery-promoting, anti-inflammatory macrophages described in the literature because they express markers associated with multiple subtypes (e.g., both M2a and M2c-like cells). However, in all embodiments of the present invention, the engineered macrophages of the present invention may express markers consistent with functional human monocyte-derived macrophages, such as CD45, CD14, CD206, CCR2, CD163, CD169, and 25F9.

[0294] The manipulated macrophages of the present invention (containing IL-10 and MMP9) function as “pro-recovery” macrophages. As described, for example, in Ramachandran et al., Proc Natl Acad Sci USA. November 13, 2012; 109(46): E3186-E3195, pro-recovery macrophages exhibit loss of pro-inflammatory gene expression, increased expression of matrix-degrading enzymes, and enrichment of phagocytosis-related genes. Furthermore, the phenotype of pro-recovery macrophages falls outside the M1 / M2 paradigm, thereby highlighting the limitations of this classification in an in vivo setting. Pro-recovery macrophages play a crucial role in tissue remodeling (e.g., fibrosis resolution).

[0295] Macrophages reported by Ramachandran et al. exhibit high MMP activity. Furthermore, Figure 5 shows several genes regulated in pro-recovery macrophages. Notably, upregulation of Mrc1 (now CD206), which is also expressed in the macrophages of the examples presented here, is shown. In addition, low levels of TNFα and IL1b are shown, as demonstrated in the examples presented here. Therefore, this may indicate a pro-recovery phenotype. However, these macrophages described in this paper spontaneously express low levels of IL-10.

[0296] When used herein, "GMP compliant" means that the method conforms to the principles of Good Manufacturing Practices and may be used synonymously with "GMP compatible" and "GMP grade." For example, GMP-compliant culture media must be serum-free, antibiotic-free, animal-derived material-free, and heterologous protein-free. The WHO provides the following guidance on requirements for Good Manufacturing Practices: "Chapter 1: WHO good manufacturing practices: Main principles for pharmaceutical products." Quality Assurance of Pharmaceuticals: A compendium of guidelines and related materials - Good manufacturing practices and inspection. 2 (2nd updated ed.). WHO Press. pp. 17-18. ISBN 9789241547086.

[0297] As used herein, “UT,” “NTRx,” or “UT N / T” refers to untransfected macrophages that have been differentiated from monocytes using the same process used to differentiate transfected macrophages, but have not undergone any further incubation and / or transfection with additional factors. Such macrophages are similar to the unpolarized, untransfected cells used in the MATCH study described in International Publication No. 2019175595 (thus UT may also be described in this application as MATCH-like cells), however, the macrophages in the MATCH study are matured over 7 days, while the UT macrophages in this application are matured over 5 days.

[0298] As used herein, “UT+TR”, “NTRx+Tr”, or “UT T” refers to untransfected cells (as described above) that have been treated in the same way as transfected cells (i.e., incubated with IL-4+IL-13+M-CSF after mock transfection). Incubation with IL-4+IL-13+M-CSF is described in more detail in the examples herein.

[0299] Similarly described herein are hMDMs that have not been treated with the IL-4+IL-13+M-CSF described herein, but have been transfected with constructs encoding specific products such as MMP9 and / or IL-10. Such cells are referred to as "TRx," for example, cells that have been transfected with IL-10 but have not been incubated with IL-4+IL-13+M-CSF are indicated as "IL-10 TRx."

[0300] Similarly described herein are hMDMs that have been transfected with constructs encoding specific products and further treated with IL-4+IL-13+M-CSF. Such cells are indicated as "TRx+TR," such as "IL-10 TRx+TR." Similarly described herein are hMDMs that have been transfected with exogenous bicistronic mRNA constructs expressing IL-10 and MMP9. Such cells are indicated as "RTX001." While we do not wish to be bound by theory or mechanism, overexpression of IL-10 and MMP9 means that RTX001 cells may autopolarize into an anti-inflammatory and / or pro-recovery phenotype.

[0301] Note that the terms "a" or "an" entity refer to one or more of these entities.

[0302] Unless otherwise defined, "approximately" means + / -10%, + / -9%, + / -8%, + / -7%, + / -6%, + / -5%, + / -4%, + / -3%, + / -2%, and + / -1% of the indicated value.

[0303] Manipulated macrophages used as cell therapy In a preferred embodiment, the present invention relates to an engineered macrophage comprising one or more exogenous coding sequences of IL-10 and MMP9.

[0304] The present invention relates to engineered macrophages that have been engineered to express IL-10 and MMP9. Macrophages can be engineered to express these proteins by including exogenous coding sequences. The exogenous coding sequences may be extrachromosomal or integrated into the cell's genome. Engineered macrophages express exogenous coding sequences for IL-10 and MMP9.

[0305] In some embodiments, the engineered macrophages possess one or more exogenous sequences capable of initiating endogenous expression of IL-10 and / or MMP9. Any macrophage that has been genetically modified by any means via an exogenous sequence (i.e., a sequence that is not part of the natural macrophage genome) is an engineered macrophage according to the present invention.

[0306] Manipulated macrophages may be used in therapies, for example, to treat inflammatory and / or fibrotic conditions in a subject.

[0307] Preferably, administration of manipulated macrophages to subjects is not associated with an inflammatory response. In particular, administration of manipulated macrophages to subjects is not associated with an increase in plasma concentrations of inflammatory cytokines such as IL-1b and / or TNF-α.

[0308] As used herein, "macrophage" refers to a phagocytic cell that is involved in the detection, uptake, and destruction of pathogens and apoptotic cells and is produced by the differentiation of monocytes. In this invention, "engineered macrophage" refers to a macrophage that has been engineered to express IL-10 and / or MMP9. In particular, this expression is above endogenous levels, resulting in engineered macrophages expressing IL-10 and / or MMP9 at higher levels than unengineered cells. Macrophages may be engineered to express these proteins by including exogenous coding sequences. In some embodiments, macrophages are 4 × 10⁶ 6 When cultured in vitro at a cell concentration of cells / m², they secrete IL-10 at a culture supernatant concentration of at least 10,000 pg / ml. In some embodiments, macrophages are 4 × 10⁶ 6 When cultured in vitro at a cell concentration of cells / ml, MMP9 is secreted at a culture supernatant concentration of at least 200 ng / ml.

[0309] In some embodiments, the IL-10 amino acid sequence is encoded by mRNA containing the sequence of SEQ ID NO: 1. The natural mRNA sequence of IL-10 mRNA is provided in NCBI reference sequence: NM_000572.3. Variants and homologs of this sequence are also included.

[0310] MMP9 (matrix metallopeptidase 9) is a type IV collagenase and a matrix metalloproteinase. MMP9 is also known as 92kDa type IV collagenase, 92kDa gelatinase, or gelatinase B (GELB). Matrix metalloproteinases (MMPs), also known as matrix metalloproteinases or matrixins, are a family of peptidases capable of cleaving all components of the extracellular matrix (ECM). MMPs can also process bioactive mediators such as growth factors, cytokines, chemokines, and cell surface receptors. Twenty-five mammalian MMPs have been identified, playing various roles in ECM maintenance and tissue repair processes, including both inhibitory and stimulatory roles in fibrosis.

[0311] In some embodiments, the MMP9 coding sequence is the human MMP9 described in the NCBI reference sequence:NM_004994.3. In some embodiments, the amino acid sequence is encoded by the sequence of SEQ ID NO: 3, or by mRNA containing variants that are at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% similar to SEQ ID NO: 3.

[0312] In some embodiments, the mRNA is modified. In some embodiments, the mRNA modification is selected from chemical modifications of uridine and / or chemical modifications of cytidine, pseudouridine. In some embodiments, the mRNA modification includes pseudouridine, N1-methyl pseudouridine, 5-methoxyuridine, and 5-methylcytidine, preferably including 5-methoxyuridine. In preferred embodiments, all endogenous uridines are substituted with 5-methoxyuridine.

[0313] In some embodiments, the mRNA contains a poly(A) tail at the 3' end. A preferred poly(A) tail is 65–250 residues long, preferably 90–120 residues long. In a preferred embodiment, the 3'UTR and 5'UTR are modified relative to the endogenous 3'UTR and 5'UTR. In some embodiments, the poly(A) tail is 120 residues long. In a preferred embodiment, the poly(A) tail is longer than the endogenous poly(A) tail. In a particularly preferred embodiment, the poly(A) tail is 90 residues long. In a particularly preferred embodiment, the mRNA contains the sequence of SEQ ID NO: 10, or a variant that is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% similar to SEQ ID NO: 10. In another preferred embodiment, the exogenous mRNA sequence contains a sequence that is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence described in SEQ ID NO: 16. In a particularly preferred embodiment, the exogenous mRNA sequence includes the sequence described in SEQ ID NO: 16. As used herein, the endogenous uridine in SEQ ID NOs: 10 and 16 is substituted with 5-methoxyuridine. In a preferred embodiment, the mRNA includes the sequence of SEQ ID NO: 10, a 90-residue poly-A tail, and a 5' cap. In a preferred embodiment, the mRNA includes the sequence of SEQ ID NO: 16 and a 5' cap.

[0314] In some embodiments, the mRNA is resistant to degradation. In some embodiments, the mRNA is not immunogenic.

[0315] In some embodiments, the IL-10 protein and the MMP9 protein are expressed by separate exogenous coding sequences or nucleic acid molecules. In some embodiments, the IL-10 protein and the MMP9 protein are expressed as a fusion protein encoded by a single mRNA molecule linked by a cleavable linker.

[0316] In some embodiments, the mRNA comprises the sequence of SEQ ID NO: 2, or a variant that is at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% similar to SEQ ID NO: 2.

[0317] In some embodiments, the mRNA is modified at either the 5' end and / or the 3' end, or both, by any means that enhances its stability and / or its ability to express the encoded protein.

[0318] In some embodiments, one or more ribonucleotides of the mRNA molecule are modified. In some embodiments, one or more uracil bases are modified, preferably to 5-methoxyuridine.

[0319] In some embodiments, one or both caps of the mRNA molecule are synthetic, preferably CleanCap®.

[0320] Overexpression is understood as the “excessive” or higher level of expression of a gene, such as that caused by an increase in the gene’s transcription frequency. Therefore, overexpression can also be considered as exceeding wild-type or normal expression levels. Overexpression can be defined by referring to the amount of protein produced relative to a cell population, or by referring to a multiple increase from wild-type or normal expression levels. Expression levels can be described as the amount of secreted protein per unit volume of cell culture. However, increased transcription does not necessarily lead to an increase in the amount of secreted protein.

[0321] Cells that overexpress IL-10 and / or MMP9 contain coding sequences that express IL-10 and / or MMP9 at higher levels compared to unmanipulated cells. As described above, overexpression can be achieved by introducing exogenous nucleic acids encoding IL-10 and / or MMP9, such as mRNA, or by genetic modification that stimulates the expression of IL-10 and / or MMP9 from endogenous coding sequences. Manipulated macrophages that overexpress IL-10 and / or MMP9 do not necessarily secrete larger amounts of IL-10 and / or MMP9 than unmanipulated macrophages.

[0322] As used herein, overexpression refers to an increase in the amount of artificial expression of a gene compared to the expression level of an unmodified gene (which may be referred to herein as wild-type or natural macrophages). As used in the examples, the expression level was quantified 16–24 hours after transfection. The expression levels listed herein are 4 × 10⁻⁶. 6 pieces / ml(1cm 2 2x10 6 This is obtained for a macrophage population at a concentration equivalent to that of a single cell. In preferred embodiments, overexpression is achieved by introducing exogenous mRNA into macrophages. In the examples, macrophages were transfected, isolated by centrifugation, resuspended in TexMACs buffer supplemented with IL-3 and IL-14, and incubated at 37°C under 5% CO2. Those skilled in the art will know of equivalent conditions suitable for determining secreted protein concentrations. The following levels were experimentally determined under these conditions.

[0323] In one embodiment, IL-10 overexpression means that the level of secreted IL-10 protein exceeds about 300 pg / ml. Preferably, the IL-10 expression level exceeds about 300 pg / ml, or 400 pg / ml, or 500 pg / ml, or 600 pg / ml, or 700 pg / ml, or 800 pg / ml, or 900 pg / ml, or 1,000 pg / ml, or 2,000 pg / ml, or 3,000 pg / ml, or 4,000 pg / ml, or 5,000 pg / ml, or 6,000 pg / ml, or 7,000 pg / ml, or 8,000 pg / ml, or 9,000 pg / ml, or 10,000 pg / ml, or 11,000 pg / ml. In a preferred embodiment, the level of secreted IL-10 protein exceeds 10,000 pg / ml.

[0324] In one embodiment, "relative overexpression" of IL-10 in a culture of IL-10-engineered macrophages means that the level of secreted IL-10 protein in the culture is increased by approximately 100–300 pg / ml or more than approximately 300 pg / ml compared to the average wild-type protein secretion in a culture of wild-type macrophages cultured under the same conditions. Preferably, the increase in IL-10 expression is greater than approximately 300 pg / ml, or 400 pg / ml, or 500 pg / ml, or 600 pg / ml, or 700 pg / ml, or 800 pg / ml, or 900 pg / ml, or 1,000 pg / ml, or 2,000 pg / ml, or 3,000 pg / ml, or 4,000 pg / ml, or 5,000 pg / ml, or 6,000 pg / ml, or 7,000 pg / ml, or 8,000 pg / ml, or 9,000 pg / ml, or 10,000 pg / ml, or 11,000 pg / ml. In a preferred embodiment, the level of secreted IL-10 protein is greater than 10,000 pg / ml. Preferably, these IL-10 protein levels are achieved by culturing macrophages as described above, with a macrophage concentration in the culture medium of 4 × 10⁻⁶ 6 cells / ml (2 × 10⁻⁶) 6 cells / cm 2It is equivalent to culturing and measuring the concentration of protein in the culture medium. Therefore, macrophages are 4 × 10 6 When cultured in vivo at a cell concentration of cells / ml, the cells secrete IL-10 at a culture supernatant concentration of at least 10,000 pg / ml. In some embodiments, the manipulated macrophages can secrete IL-10 at a level 1,000 times higher than unmanipulated nonpolarized hMDM. Unmanipulated nonpolarized hMDM is described in the art, for example, in International Publication No. 2019175595.

[0325] In one embodiment, MMP9 expression means that the secreted MMP9 protein level is about 200 ng / ml to 2000 ng / ml. Preferably, the secreted MMP9 protein level is about 300 ng / ml, or 400 ng / ml, or 500 ng / ml, or 600 ng / ml, or 700 ng / ml, or 800 ng / ml, or 900 ng / ml, or 1,000 ng / ml. Preferably, the secreted MMP9 protein level is about 200 ng / ml to 2000 ng / ml. In a preferred embodiment, the secreted MMP9 level is greater than 200 ng / ml. Preferably, engineered macrophages (containing IL-10 and MMP9) have a higher secreted MMP9 protein level compared to the average secreted MMP9 protein level in macrophages engineered with IL-10 alone. Preferably, the overall MMP activity of the manipulated macrophages of the present invention is also higher than that of macrophages manipulated with IL-10 alone. In preferred embodiments, the overall MMP activity of the manipulated macrophages is at least 1.5 times higher than that of untransfected macrophages.

[0326] In one embodiment, "relative overexpression of MMP9" in a culture of MMP9-manipulated macrophages means that the level of secreted MMP9 protein in the culture is increased by 200 ng / ml to 2000 ng / ml compared to the average wild-type protein expression in a culture of wild-type macrophages cultured under the same conditions. Preferably, the level of secreted MMP9 protein is greater than approximately 300 ng / ml, 400 ng / ml, 500 ng / ml, 600 ng / ml, 700 ng / ml, 800 ng / ml, 900 ng / ml, or 1,000 ng / ml compared to the average wild-type protein expression in a culture of wild-type macrophages cultured under the same conditions. Preferably, the increase in the level of secreted MMP9 protein in the culture is about 200 ng / ml to 2000 ng / ml compared to the average wild-type protein expression in a culture of wild-type macrophages cultured under the same conditions. Preferably, these MMP9 protein levels are achieved by culturing macrophages as described above, with a macrophage concentration in the culture medium of 4 × 10⁻⁶ 6 cells / ml (2 × 10⁻⁶) 6 cells / cm 2 It is equivalent to culturing and measuring the concentration of protein in the culture medium. Therefore, macrophages are 4 × 10 6When cultured in vivo at a cell concentration of cells / ml, MMP9 is secreted at a culture supernatant concentration of at least 200 ng / ml. In preferred embodiments, the level of secreted MMP9 is greater than 200 ng / ml. Preferably, the increase in the level of secreted MMP9 in a culture of IL-10-MMP9-engineered macrophages (i.e., containing IL-10 and MMP9) is higher than the average increase in secreted MMP9 protein in a culture of MMP9-engineered macrophages compared to the average wild-type protein expression in a culture of wild-type macrophages cultured under the same conditions. Preferably, the overall MMP activity of the engineered macrophages of the present invention is also higher than the overall MMP activity of macrophages engineered with IL-10 alone. In some embodiments, these increases are synergistic. In preferred embodiments, the overall MMP activity of engineered macrophages is at least 1.5 times higher than that of untransfected macrophages.

[0327] In one embodiment, "relative overexpression of MMP9" in IL-10-operated macrophage cultures means that the level of secreted MMP9 protein in these cultures is reduced by approximately 50 ng / ml to 100 ng / ml, approximately 100 ng / ml to 200 ng / ml, or approximately 200 ng / ml to 2000 ng / ml compared to the average wild-type protein expression in wild-type macrophage cultures cultured under the same conditions. Preferably, the reduction in the level of secreted MMP9 protein is greater than approximately 100 ng / ml, 300 ng / ml, 400 ng / ml, 500 ng / ml, 600 ng / ml, 700 ng / ml, 800 ng / ml, 900 ng / ml, or 1,000 ng / ml compared to the average wild-type protein expression in wild-type macrophage cultures cultured under the same conditions. Preferably, the reduction in the level of secreted MMP9 protein is about 200 ng / ml to 500 ng / ml compared to the average wild-type protein expression in wild-type macrophage cultures cultured under the same conditions.

[0328] The engineered macrophages of the present invention (containing IL-10 and MMP9) secrete MMP9 at higher levels than those expressed by macrophages engineered with IL-10 alone (see Figure 1: IL-10-MMP9 Trx vs. IL-10 Trx). In one embodiment, the macrophages are engineered with at least one DNA vector encoding IL-10 and / or MMP9. It will be understood that the DNA vector may require one or more accessory sequences, such as a promoter, terminator, and poly(A) signaling sequence.

[0329] A "promoter" is a nucleotide sequence that initiates and regulates the transcription of a polynucleotide. Examples of promoters include inductive promoters (where the expression of a polynucleotide sequence operably linked to this promoter is induced by an analyte, cofactor, regulatory protein, etc.), repressive promoters (where the expression of a polynucleotide sequence operably linked to this promoter is repressed by an analyte, cofactor, regulatory protein, etc.), and constitutive promoters. The terms "promoter" or "regulatory element" are intended to include full-length promoter regions and functional segments of these regions (such as segments that regulate transcription or translation).

[0330] In one embodiment, the DNA vector may include one or more liver-specific promoters or cirrhosis-specific promoters. In some embodiments, the DNA vector may include the CX3CR1 promoter, insulin-like growth factor 1 (IGF1), or the CD1 IB promoter.

[0331] "Operatively ligated" refers to the arrangement of elements configured so that the component described in this way performs its normal function. Therefore, a given promoter operably ligated to a nucleic acid sequence can influence the expression of that sequence, provided the appropriate enzyme is present. The promoter does not need to be contiguous with the sequence, insofar as it functions to induce the expression of the sequence. For example, even if there may be an untranslated but transcribed sequence between the promoter sequence and the nucleic acid sequence, the promoter sequence can still be considered "operably ligated" to the coding sequence. Thus, the term "operably ligated" is intended to encompass any distance or orientation between the promoter element and the target DNA sequence that allows the transcription of the target DNA sequence to begin upon recognition of the promoter element by the transcription complex.

[0332] As used herein, "treatment" means an intervention on a physiological condition that prevents, reduces, or eliminates clinical symptoms associated with a given physiological condition in a subject.

[0333] As used herein, the “therapeutic dose” of macrophages is any amount that, when used alone or in combination with another therapeutic agent, protects a subject from the onset of the disease, or promotes disease regression as demonstrated by a reduction in the severity of disease symptoms, an increase in the frequency and duration of disease-free periods, or the prevention of functional or physical impairment resulting from the distress of the disease. The ability of a therapeutic agent to promote disease regression can be assessed by a skilled professional using a variety of known methods, for example, in human subjects during clinical trials, in animal model systems to predict efficacy in humans, or by assaying the activity of the drug in an in vitro assay. The therapeutic dose and administration regimen can be determined empirically by testing in known in vitro or in vivo (e.g., animal model) systems.

[0334] "Subject," "individual," "animal," or "patient" means any subject (especially mammalian subjects) for which diagnosis, prognosis, or treatment is desired, unless the subject is defined as a "healthy subject." Mammalian subjects include humans; domestic animals; farm animals; for example, dogs, cats, guinea pigs, rabbits, rats, mice, horses, cattle, dairy cows, etc.

[0335] Preferably, the subject may require treatment. Therefore, preferably, the subject may suffer from or be at risk of developing a disease, condition, or disorder. Preferably, the subject may exhibit one or more symptoms of a disease, condition, or disorder.

[0336] The manipulated macrophages of the present invention may be used for therapeutic purposes. The macrophages of the present invention may be used to treat inflammatory and / or fibrotic conditions in a subject. As defined above, "treating" as herein may mean the prevention, reduction, or elimination of inflammation / fibrosis / organ damage. For example, manipulated macrophages may be administered to a subject in the acute inflammatory phase for the purpose of preventing a chronic inflammatory state. Manipulated macrophages may also be administered to a subject in the chronic inflammatory phase for the purpose of preventing / reducing chronic fibrosis. Manipulated macrophages may also be administered to a subject experiencing an acute exacerbation of a chronic inflammatory phase, such as an acute exacerbation of chronic hepatic failure (ACLF).

[0337] Preferably, acute diseases or injuries can be classified as diseases or injuries that develop less than 24 weeks after the cause. Preferably, chronic diseases can be classified as diseases or injuries that persist for more than 6 months. Preferably, acute exacerbations of chronic diseases can be classified as diseases or injuries that develop less than 24 weeks after the cause in patients who already have a chronic disease that persists for more than 6 months. Preferably, the manipulated macrophages of the present invention can be administered to subjects with acute onset to prevent the progression to or increase of chronic inflammation and fibrosis.

[0338] Fibrosis refers to the deposition of extracellular matrix and connective tissue after tissue injury, resulting in replacement of parenchymal tissue, and in excessive cases, ultimately leading to scarring. In some embodiments, the condition is fibrosis.

[0339] In some embodiments, the condition is located in or affects an organ selected from the group consisting of the liver, lungs, heart, kidneys, pancreas, skin, gastrointestinal tract, bone marrow, hematopoietic tissue, nervous system, eyes, or combinations thereof.

[0340] Preferably, the condition is a chronic organ injury associated with chronic inflammation. Preferably, the condition relates to the kidneys, liver, or lungs. For example, the condition may be inflammatory liver injury, inflammatory kidney injury, or inflammatory lung injury.

[0341] Preferably, the present invention relates to a cell therapy product for inflammatory organ injury based on monocyte-derived macrophages genetically modified with a payload that induces a regenerative phenotype.

[0342] Preferably, the manipulated macrophages have a recovery-promoting phenotype and are anti-inflammatory and anti-fibrotic.

[0343] The M2-like phenotype is pro-recovery, while the M1-like phenotype is pro-inflammatory.

[0344] The manipulated macrophages contain exogenous coding sequences for IL-10 and MMP9. These exogenous coding sequences can be provided by any preferred method. This may be in the form of a nucleic acid vector, delivered by any means, or through genetic modification. For example, this may be done by the use of a viral or non-viral vector, a DNA or RNA construct, or gene editing using any preferred technique.

[0345] Macrophages engineered to express IL-10 and MMP9 can be genetically engineered in any preferred manner, for example, by the use of a virus or non-viral vector, by the use of a DNA or RNA construct, or by gene editing using any preferred technique.

[0346] Macrophages can be manipulated using viruses. Such genetic engineering methods involve introducing exogenous coding sequences / payloads into macrophages using viruses such as lentiviruses, adenoviruses, or AAVs. The virus can either deliver the exogenous coding sequence / payload as an "extrachromosomal" construct, or the gene can be integrated into the macrophage's genome. Viral manipulation of macrophages requires careful techniques, as demonstrated in the art, to prevent the macrophages from phagocytosing the virus.

[0347] Preferably, the manipulated macrophages are nonvirally manipulated using, for example, a nucleic acid vector containing an exogenous coding sequence. The nucleic acid can be any suitable nucleic acid, including DNA and RNA. Preferably, the macrophages are transfected with a DNA vector. Preferably, the DNA vector is a naked DNA vector and, as a result, does not contain proteins and / or lipids. Preferably, the DNA vector is not derived from a viral genome. Optionally, the DNA vector is a non-integrated vector and, as a result, can function without being integrated into the macrophage chromosome. Alternatively, the nucleic acid vector is a messenger RNA (mRNA) molecule.

[0348] Preferably, the DNA vector comprises at least one sequence encoding IL-10 and / or MMP9, operably ligated to a promoter.

[0349] As used herein, "encodes" refers to the ability of a specific nucleotide sequence, such as a gene or mRNA, to function as a template for synthesizing macromolecules, such as proteins, within a cell. A gene codes for a protein if the transcription and translation of the mRNA corresponding to that gene results in the production of that protein within the cell.

[0350] Preferably, the manipulated macrophages are genetically engineered macrophages containing a nucleic acid construct that overexpresses IL-10 and MMP9.

[0351] Preferably, the mRNA molecule expresses IL-10 and / or MMP9. In other words, the mRNA contains coding sequences for IL-10 and MMP9 that are exogenous to macrophages. The mRNA may be chemically modified. The chemical modification may be any preferred modification, most notably any preferred modification to improve the half-life of the mRNA in the cell. Preferred modifications are discussed extensively herein.

[0352] Nucleic acid vectors can be introduced into cells using any suitable transfection method (e.g., cationic liposome-mediated transfection, lipofection, polymer encapsulation, peptide-mediated transfection, or bioristic particle delivery systems such as "gene guns"). Preferably, macrophages are transfected with nucleic acids via electroporation. Another suitable transfection method is nucleofection.

[0353] Macrophages can be suitably manipulated by altering their genome through gene editing. Gene editing enables the permanent insertion of exogenous coding sequences. Numerous gene editing techniques are known, including those requiring the use of nucleases. Various nucleases are known that can be used for genome modification, from base editing and prime editing techniques to gene editing. Many nucleases are known, including zinc fingers, TALENs, and guided nucleases. These can be induced by RNA ("RNA"-induced nucleases), such as Cas9, Cas12a, Cas13, Mad7, etc., and can also be induced by enzymes involved in CRISPR. Macrophages themselves can be the target of gene editing, or progenitor cells can be gene edited before conversion to macrophages.

[0354] Preferably, macrophages are transfected with one or more types of free nucleic acids or vectors.

[0355] Preferably, macrophages are transfected with one or more exogenous coding sequences, including IL-10 and MMP9.

[0356] Preferably, the macrophage is provided with at least one exogenous coding sequence of IL-10 and at least one exogenous coding sequence of MMP9.

[0357] Preferably, macrophages are engineered to overexpress IL-10 and MMP9.

[0358] Preferably, the macrophages are autologous or homogeneous to the target.

[0359] The present invention also relates to a population of manipulated macrophages described herein, which may be used as a cell therapy.

[0360] Preferably, use involves administering an effective amount of manipulated macrophages to the target.

[0361] The present invention also relates to compositions comprising the manipulated macrophages or populations thereof. Preferably, the compositions are pharmaceutical compositions.

[0362] Preferably, the manipulated macrophages can be formulated into a pharmaceutical composition. Preferably, the composition is suitable for administration to a subject. Preferably, the composition is a liquid. Preferably, the composition is an insoluble liquid.

[0363] Preferably, the manipulated macrophages are administered to the subject via any route. Delivery to the subject is by local or systemic administration. In some embodiments, administration is, for example, by local injection, spray, or systemic injection. Preferably, the manipulated macrophages are administered to the subject by injection. Preferably, the manipulated macrophages are administered to the subject parenterally (preferably intravenously). Preferably, the manipulated macrophages are administered to the subject by injection or infusion. Preferably, the manipulated macrophages are administered to the subject intravenously by infusion.

[0364] The present invention also relates to a method for improving the migration of monocytes to inflammation, comprising the use of manipulated macrophages according to a first aspect of the present invention, a macrophage population according to a second aspect of the present invention, or a composition according to a third aspect of the present invention.

[0365] Preferably, engineered macrophages, engineered macrophages for therapeutic use, or engineered macrophages used in methods to improve monocyte migration to inflammation have a chemotactic effect on monocytes. Engineered macrophages may have a chemotactic effect on monocytes in vitro or in vivo. Mobilization of host monocytes at the site of inflammation / injured organ is advantageous for treating inflammatory conditions. In some embodiments, engineered macrophages have a chemotactic effect specifically on monocytes and not on other immune cell types. In some embodiments, engineered macrophages, when administered to subjects with fibrosis, e.g., subjects with a chronic inflammatory condition with fibrotic elements, localize to the site of fibrosis and / or mobilize monocytes to the site of fibrosis. The presence of engineered macrophages or monocytes at the site of fibrosis can be determined by flow cytometry, as described in the examples herein. In some embodiments, the site of fibrosis may be the lung or the liver.

[0366] Production of engineered macrophages expressing IL-10 and MMPs The present invention also relates to a method for producing engineered macrophages expressing IL-10 and MMP9, comprising the step of transiently transfecting macrophages with a complex mRNA construct comprising at least one sequence encoding IL-10 and at least one sequence encoding MMP9. In some embodiments, the macrophages are contacted with an anti-inflammatory agent after transfection. In some embodiments, the macrophages are contacted with IL-4 and IL-13. In other embodiments, the macrophages are contacted with IL-4, IL-13, and M-CSF. Preferably, the engineered macrophages overexpress IL-10 and restore MMP activity as a result of co-expression with MMP9 (in other states, MMP activity is suppressed by IL-10). Preferably, the engineered macrophages are pro-recovery. Preferably, the produced engineered macrophages can be used in cell therapy.

[0367] In particular, macrophages that overexpress IL-10 or are engineered to overexpress IL-10 and MMP9 exhibit a pro-regenerative phenotype without further anti-inflammatory treatment after transfection. Preferably, the engineered macrophages produced are manufactured according to GMP-compliant standards. Therefore, preferably, the engineered macrophages and their population are GMP-compliant.

[0368] In other embodiments, a method for producing manipulated macrophages includes the step of introducing sequences encoding IL-10 and / or MMP9 into the genome of macrophages.

[0369] In a preferred embodiment, in the population of manipulated macrophages produced by this method, at least 80% of the macrophages secrete IL-10.

[0370] Also provided herein are methods for improving the cryo-restorability of macrophages, comprising the step of incubating macrophages in a culture medium containing IL-4, IL-13, and M-CSF. According to some embodiments, incubation with IL-4, IL-13, and M-CSF is performed before cryopreservation. According to some embodiments, IL-4, IL-13, and M-CSF are removed from the culture medium before cryopreservation, resulting in the absence of IL-4, IL-13, and M-CSF in the cryopreservation medium. According to some embodiments, methods for cryopreserving macrophages are provided herein, comprising the step of incubating macrophages in a culture medium containing IL-4, IL-13, and M-CSF before cryopreservation. According to some embodiments, the method for improving cryo-restorability, or the method for cryopreserving macrophages, further comprises the step of removing IL-4, IL-13, and M-CSF from the culture medium before cryopreservation. As used herein, the term “freeze-recovery capacity” (which may also be referred to as “recovery”) refers to the viability of cryopreserved macrophages, as optionally measured by the percentage of cryopreserved macrophages that survive after freezing. In some embodiments, the concentrations of IL-4 and IL-13 in the culture medium are 20 ng / ml, the concentration of M-CSF is 100 ng / ml, and the number of macrophages is 4 × 10⁶. 6 The concentration is at 1 cell / ml. In some embodiments, the cells are incubated overnight in a medium containing IL-4, IL-13, and M-CSF.

[0371] Macrophages for manipulation Preferably, the macrophages to be manipulated are produced from any suitable progenitor cells. Preferably, the macrophages are produced in vitro.

[0372] Preferably, the macrophages for manipulation are monocyte-derived. Preferably, the macrophages for manipulation are human monocyte-derived macrophages (hMDM). Monocyte-derived means macrophages differentiated from monocytes. Monocytes are the natural precursors of macrophages and dendritic cells and are found in the blood and bone marrow. Preferably, the macrophages are derived from peripheral blood monocytes, and preferably, the macrophages are peripheral blood monocyte-derived macrophages. Preferably, the macrophages are human peripheral blood monocyte-derived macrophages. Preferably, the monocytes are isolated from human subjects.

[0373] Preferably, macrophages are induced from monocytes by culturing monocytes, preferably in vitro. Preferably, macrophages are induced from monocytes using any suitable culture method.

[0374] Preferably, macrophages are produced in vitro from monocytes by a culture method lasting 3 to 8 days, and optionally 4 to 8 days. Preferably, macrophages are produced in vitro from monocytes by a culture method lasting 3 to 7 days, particularly 4 to 7 days or 5 to 7 days. In one embodiment, macrophages are produced in vitro from monocytes by a culture method lasting 3 to 5 days, 4 or 5 days, or 7 days, known as the 5-day method or the 7-day method, respectively. An example of an in vitro method for producing macrophages from monocytes is described in International Publication 2019 / 175595. The "5-day" method is described in Application PCT / GB2021 / 051294 (the contents of which are incorporated herein by reference).

[0375] Preferably, macrophages are used in the "Day 5" method, (a) A step comprising culturing monocytes in a culture medium for 3 to 5 days or 4 to 5 days to produce macrophages, wherein the culture medium contains one or more growth factors to stimulate macrophage production, It is produced by a method in which all steps (a) are carried out in the same culture medium.

[0376] Preferably, the culture medium contains one or more growth factors selected from the CSF family, and preferably contains M-CSF. Preferably, the culture medium contains M-CSF at a concentration of 25-150 ng / mL. Preferably, the culture medium contains 100 ng / mL of GMP-grade recombinant human macrophage colony-stimulating factor 1 (rhM-CSF-1, also known as "rh(recombinant human)CSF-1").

[0377] In other embodiments, macrophages are produced from stem cells such as pluripotent stem cells or dual-potent stem cells. In specific embodiments, macrophages are produced from induced pluripotent stem cells (iPSCs).

[0378] Anti-inflammatory treatment In one embodiment, a method for producing engineered macrophages engineered with a combination of IL-10 and MMP9 includes transient transfection of macrophages with exogenous coding sequences of IL-10 and MMP9. The coding sequences may be provided by transfection with nucleic acids (e.g., one or more mRNA molecules).

[0379] Macrophages are provided with at least one exogenous coding sequence of IL-10 and at least one exogenous coding sequence of MMP9.

[0380] In some embodiments, macrophages are contacted with an anti-inflammatory agent after transfection with an exogenous coding sequence. Preferably, the anti-inflammatory agent includes anti-inflammatory cytokines. In some embodiments, macrophages are contacted with an anti-inflammatory agent containing IL4 and IL3.

[0381] In some embodiments, an anti-inflammatory agent may be added during the process of transfecting macrophages.

[0382] The transfected macrophages can be contacted with these anti-inflammatory cytokines (IL4 and IL13) for a period of about 2 hours to about 48 hours, preferably for a period of 4 hours to 40 hours, preferably for a period of 12 to 24 hours, and optionally for about 16 hours.

[0383] The transfected macrophages can be contacted with these anti-inflammatory cytokines (IL4 and IL13) at a concentration of 2 ng / mL to 200 ng / mL, preferably at a concentration of 5 ng / mL to 150 ng / mL, preferably at a concentration of 10 ng / mL to 100 ng / mL, preferably at a concentration of 15 ng / mL to 75 ng / mL, preferably at a concentration of 20 ng / mL to 50 ng / mL.

[0384] Preferably, the anti-inflammatory treatment agent is used as a solution.

[0385] In the step of bringing macrophages into contact with IL4+IL13, the cells are preferably seeded as follows: 4×10 6 2×10 cells / mL 6 hMDM cells / cm 2 .

[0386] The present invention will now be described with reference to the following drawings. Brief Description of the Drawings

[0387] [Figure 1] This is a plot showing the experimental results of macrophage transfection with IL-10 and IL-10+MMP9 - macrophages secrete high levels of IL-10. A: hMDMs transfected with IL-10 show reduced expression levels of MMP9. B: hMDMs transfected with IL-10+MMP9 show elevated MMP9 levels. The dotted line represents the minimum desirable level of the product. [Figure 2]This plot shows experimental results of macrophage transfection with various constructs. The percentage of IL-10 secreting cells over 2 hours using a flow cytometry capture assay is shown. Both constructs show a higher percentage of secreting cells. Each symbol represents an independent donor. [Figure 3] This plot shows experimental results of macrophage transfection with various components from the perspective of cell surface markers. Flow cytometry analysis of hMDM identity cell surface markers by flow cytometry. The solid black line represents the normalized level of expression in unmanipulated cells. Each plot represents a different macrophage cell surface marker: A: CD45, B: CD14, C: CD206, D: CCR2, E: CD163, F: CD169, and G: 25F9. [Figure 4] This plot shows experimental results of macrophage transfection with various components from the perspective of pro-inflammatory markers. When measured by flow cytometry, the pro-inflammatory markers CD86 (A) and HLA-DR (B) were significantly downregulated in the manipulated cells. Other inflammatory markers remained substantially unchanged compared to non-Trx hMDM cells. CD80 expression should ideally be less than 20% or greater than 10-15% of the unmanipulated (NTx) level. The solid black line represents the level in non-Trx cells. The dotted red line represents the maximum desirable level. Each symbol represents an independent donor. [Figure 5] This plot shows experimental results of macrophage transfection with various components from the perspective of phagocytic capacity. Phagocytosis is measured using pH-sensitive (pHrodo) beads coated with E. coli (E. coli). The percentage of phagocytic macrophages is measured by flow cytometry. Each symbol represents an independent donor. The dotted line represents the minimum desirable percentage of phagocytic macrophages. [Figure 6]These plots show experimental results of macrophage transfection with various compositions in terms of M1 markers (A and B) and M2 markers (C and D). M1 and M2 markers are used as indicators of pro-inflammatory and anti-inflammatory phenotypes of macrophages generated in vitro. Flow cytometry analysis of M1 and M2 cell surface markers in macrophages treated overnight with the supernatant of non--Trx, non-+Trx+, IL-10 Trx, and IL-10+MMP9 Trx hMDM. M2 = positive control: macrophages from the same donor, polarized using high levels of IL-10 (dotted line). Plot A shows the results for CD86, plot B shows the results for HLA DR, plot C shows the results for CD206, and plot D shows the results for CD163. [Figure 7] This plot shows experimental results of macrophage transfection with various components in terms of their effects on the migration of other cells. The results of a PBMC migration assay measured by flow cytometry are also shown. Only monocytes showed significant migration. Data are normalized to Ntrx cells (black line), and the minimum desirable increase is indicated by the dotted line. [Figure 8] This plot shows experimental results of macrophage transfection with various components on MMP expression. The results shown are MMP activity assays in the supernatants of NTrx, NTrx+-treated, IL-10 Trx, and IL-10+MMP9 Trx hMDM tested. The dotted line represents a 1.5-fold increase in activity level measured in the NTrx hMDM supernatant. Each symbol represents an independent donor. [Figure 9A] This plot shows experimental results of macrophage transfection with various components at the site of injury in vivo. Shown are the percentages (%) of live (7AAD-) human macrophages measured in digests from fibrous liver using flow cytometry. Each point represents an individual mouse. Data are reported as mean ± standard deviation (SD). Plot A shows localization to the lung. [Figure 9B]This plot shows experimental results of macrophage transfection with various components at the site of injury in vivo. Shown are the percentages (%) of live (7AAD-) human macrophages measured in digests from fibrous liver using flow cytometry. Each point represents an individual mouse. Data are reported as mean ± standard deviation (SD). Plot B shows localization to the liver. [Figure 10A] This plot shows experimental results of macrophage transfection with various components on in vivo expression of IL-10 and MMP9. Shown are EKISA measurements of human IL-10 and human MMP9 in the blood circulation of mice with chronic liver fibrosis at different time points after cell injection. Each point represents a separate mouse. Data are reported as mean ± SD. Plot A shows IL-10 in plasma. [Figure 10B] This plot shows experimental results of macrophage transfection with various components on in vivo expression of IL-10 and MMP9. Shown are EKISA measurements of human IL-10 and human MMP9 in the blood circulation of mice with chronic liver fibrosis at different time points after cell injection. Each point represents a separate mouse. Data are reported as mean ± SD. Plot B shows MMP9 in plasma. [Figure 11] This plot shows experimental results of macrophage transfection with various components after injection into a mouse model. Mouse inflammatory cytokines IL-1β and TNFα were measured in plasma by ELISA to verify, if present, inflammation induced by injection of engineered and unengineered cells. Measurements were performed at various time points after cell injection. The black dotted line represents the maximum acceptable level. Each point represents an individual mouse. Data are reported as mean ± SD. Plot A shows the results for mIL-1β, and plot B shows the results for mTNF-α. [Figure 12]As shown, human monocytes were recruited from conditioned media from unmanipulated hMDM or hMDM transfected with various genes. This assay was performed as shown in Materials and Methods, and the results were analyzed by flow cytometry. Each symbol represents a conditioned medium from an independent donor. Data are reported as single-donor variance, mean, and standard deviation. [Figure 13] Normalized media from IL-10-transfected hMDM specifically recruit monocytes. The data shown were prepared using the same protocol as in Figure 12, but illustrate the migration of individual cell types. All symbols represent normalized media from independent donors. Data are reported as single-donor variance, mean, and standard deviation. [Figure 14] Normalization medium from IL-10 transfected macrophages polarizes non-polarized macrophages to a regenerative phenotype. This assay was performed as shown in Part (A), with macrophages cultured on day 5 (culture method described in the Examples) treated with either unprocessed cells treated with IL-4, IL-13, and M-CSF, cells processed with either IL-10 or MERTK payloads, or normalization medium containing MexMACS and IL-10 at 50 ng / ml. Expression of HLA-DR (B), CD86 (C), 25F9 (D), CD206 (E), and CD163 (F) was evaluated using flow cytometry as described in the Examples. [Figure 15]Normalized media from IL-10 transfected macrophages rescue pro-inflammatory macrophages and promote a regenerative phenotype. This assay was performed as shown in Part (A), with macrophages cultured on day 5 (culture method described in the Examples) treated with either unprocessed cells treated with IL-4, IL-13, and M-CSF, cells processed with either IL-10 or MERTK payloads, or conditioned media from polarized medium (containing MexMACS and IL-10 at 50 ng / ml). Expression of HLA-DR (B), CD86 (C), 25F9 (D), CD206 (E), and CD163 (F) was evaluated using flow cytometry as described in the Examples. [Figure 16] Macrophages transfected with IL-10 alone possess a secretome equivalent to that of unmanipulated, nonpolarized macrophages. Cells were treated as shown in the figure: cells with or without post-transfection treatment with IL-4, IL-13, and M-CSF (UT TR), untransfected cells, or cells transfected with a specified payload (IL-10, MERTK, MMP9, or MMP12, shown on the x-axis). The concentrations of IL-10 (A), IL-6 (B), CXCL8 (C), IL-12p70 (D), IL-2 (E), IL-1β (F), TNF-α (G), and IFN-Y (H) were measured in the culture supernatant of cells cultured at a concentration of 4 × 10⁶ cells / ml, as described herein. [Figure 17] Macrophages transfected with IL-10 alone localize to the liver after administration to mice in a hepatic fibrosis model. IL-10 transfected cells or PBS were administered intravenously to mice in a CCl4-induced model of fibrous liver injury, as described in Example 8. [Figure 18]Macrophages transfected with MMP9 show increased MMP activity. Total MMP activity was measured in untransfected macrophages, those administered or not administered with an interferon gene stimulator inhibitor (iSTING), or macrophages transfected with the specified payload, as described in the examples. Data are expressed as mean ± SD. ***p ≤ 0.005. [Figure 19] In macrophages transfected with MMP9, the expression of other matrix metalloproteinases is increased. The expression of MMP1, 3, 7, 8, and 10 was measured in untransfected macrophages (NT), macrophages administered with or without a STING inhibitor (STINGi), and macrophages transfected with MMP9 alone. Darker shadows indicate higher expression. [Figure 20] RTX001 macrophages recruit monocytes in vitro. RTX001 macrophages were produced by transfection with a bicistronic construct having the sequence shown in SEQ ID NO: 16. PBMC migration assays were performed as described in the examples, and the results were measured by flow cytometry. The results were normalized to untransfected (NTrx) cells. [Figure 21] RTX001 macrophages recruit monocytes in vivo. Total myeloid cell recruitment was assessed using flow cytometry, and CD11b+ Tim4- cells were detected as a percentage of total CD45+ cells (left panel). Monocytes were identified as Ly6Chi CD64- CD45+ cells by flow cytometry (right panel). Recruitment was measured in a mouse CCl4-induced model of hepatic fibrosis. Macrophages transfected with RTX001, untransfected macrophages, or PBS medium were injected into mice, and recruitment was assessed 24 hours post-administration. [Figure 22]RTX001 macrophages promote an anti-inflammatory environment in vivo. Mouse IL-10 levels were measured in liver homogenetes 24 hours after administration of RTX001 macrophages, untransfected macrophages, or PBS controls to a CCL4-induced mouse model of hepatic fibrosis. [Figure 23] Macrophages engineered to express only IL-10, as well as macrophages engineered to express both IL-10 and MMP9, exhibit similar pro-recovery secretomes. The amounts of secreted IL-2 (A), IL-12p70 (B), IFNg (C), TNF-α (D), and IL-1B (E) were measured in the supernatant of the culture medium, and the engineered cells were cultured at a concentration of 4 × 10⁶ cells / ml. [Figure 24] Administration of RTX001 macrophages reduced scarring cells in vivo. RTX001 macrophages, untransfected macrophages, or PBS media were administered to a CCL4-induced mouse model of hepatic fibrosis. Tissue sections were collected from mice one week after administration and stained for a-SMA (left panel). The percentage of a-SMA-positive areas in these sections is listed, and the results are shown in the right panel. [Figure 25] RTX001 macrophage CM significantly reduced LX-2 αSMA expression. (A) Change in the multiplier of mean fluorescence intensity (MFI) of αSMA compared to TGF-β stimulated control (no CM). (B) Graph comparing the percentage of cells expressing αSMA. The experiment was repeated three times and averaged, and the data are expressed as mean ± SD (n=1). **p ≤ 0.01. [Figure 26]Optimized bicistronic mRNA enhances recovery-promoting properties. Cells were transfected with either non-optimized mRNA (SEQ ID NO: 2, further containing a 120-residue poly-A tail) or optimized mRNA (SEQ ID NO: 16), both of which are bicistronic mRNAs encoding both IL-10 and MMP9. The amounts of MMP9 (left panel) and IL-10 (right panel) secreted into the culture supernatant were detected, and MMP activity was measured as described herein. MMP activity was normalized to untransfected cells. [Figure 27] RTX001 is stable in an inflammatory environment. Changes in CD80 and CD86 (inflammatory markers), and CD206 (a recovery-promoting marker and a common macrophage identification marker) were measured in engineered macrophages exposed to specified concentrations of IFN-γ. No significant changes were observed in the pro-inflammatory markers (CD80 and CD86) or the macrophage identification marker CD206 (A). MATCH-like (Ntrx) cells and RTX0001 (Trx+tr) cells were incubated with IFN-γ (1.05, 10.5, or 105 ng / mL) for 24 hours. MFI of the pro-inflammatory markers HLA-DR and CD80 was assessed using flow cytometry. The data shown are multiplicative changes compared to Ntrx cells cultured without IFN-γ (B and C). [Figure 28]This table shows the expression of macrophage markers or cytokine secretion in specified macrophage products. The macrophage products consist of untransfected and untreated products (UT), products treated with IL-4, IL-13, and M-CSF (UT+TR), products transfected with IL-10 and MMP9 and untreated products (IL-10 MMP9 TRx), or products transfected and then treated with IL-4, IL-13, and M-CSF (IL-10 MMP9 TRx+TR). The mean fluorescence intensity was measured by flow cytometry as described herein. [Figure 29] Post-transfection treatment does not contribute to further polarization of the manipulated macrophages. cD86 (left) and MHC II (right) expression were detected in macrophage products by flow cytometry. The macrophage products tested consisted of: untransfected macrophages that were either untreated with IL-4, IL-13, and M-CSF (NTx) or treated with IL-4, IL-13, and M-CSF (NTx + TR); macrophages transfected with both MMP9 and IL-10; or macrophages that were either untreated with IL-4, IL-13, and M-CSF after transfection (IL-10-MMP9) or treated with IL-10-MMP9 + TR. [Figure 30] Treatment with IL-4, IL-13, and M-CSF improved cryopreservation. The viability of the macrophage product population was determined after cryopreservation. The macrophage products consisted of: untransfected macrophages that were either not further treated with IL-4, IL-13, and M-CSF (NTrx) or treated with IL-4, IL-13, and M-CSF (NTrx+Tr); and macrophages transfected with both IL-10 and MMP9, either not further treated with IL-4, IL-13, and M-CSF after transfection (Trx) or treated with IL-10 and MMP9 (Trx+Tr). Viability was evaluated by measuring the percentage of cells still alive after cryopreservation as the proportion of all cells alive before cryopreservation. [Figure 31] This is an overview of the protocol used to measure effectiveness in the mouse-on-mouse model of Example 25. [Figure 32] This is a schematic diagram illustrating the mechanism thought to be the basis for the therapeutic effect of manipulated macrophages. [Figure 33] This is a schematic diagram showing an overview of the EMERALD clinical trial design. [Figure 34] This is a timeline showing the stages of patient evaluation before mobilization, monocyte collection, and treatment in the EMERALD clinical trial. [Figure 35] This is a timeline showing the stages of genetically modified macrophage production and treatment in the EMERALD clinical trial. [Figure 36] This is a timeline showing the treatment assignments and the stages of treatment by manipulated macrophages (RTX001) in the EMERALD clinical trial. [Modes for carrying out the invention]

[0388] The data presented in these figures demonstrate that the remarkably effective combination of tandem expression of two specific genes, IL-10 and MMP9, brings about unexpected and remarkable advantages to the phenotype of engineered macrophages. Remarkably, expression of MMP9 alone was able to restore the reduced MMP expression / activity observed in IL-10 transfected macrophages. As shown above, this effect appears to be synergistic. Furthermore, given the conventional assumption that cytokines and other entities are involved in the recruitment process, the superior monocyte recruitment resulting from this combined overexpression was unexpected.

[0389] Genetic manipulation of macrophages to enable overexpression of IL-10 in combination with MMP9 brings about many desirable characteristics and functions for cell therapy useful in inflammatory conditions such as organ regeneration. The inventors have shown that IL-10 combined with MMP9 brings about the following: - Unwavering macrophage identity, undisturbed by the manipulation process. - A strong anti-inflammatory phenotype. - The ability to pattern naive macrophages into a recovery-promoting phenotype. - Excellent phagocytic ability. - A reassuring stability and in vivo distribution profile, including infiltration into damaged organs and rapid clearance / disappearance in other organs.

[0390] The characteristics described above are common to macrophages manipulated with IL-10 alone, which the inventors have already investigated. However, the combination of IL-10 and MMP9 brings about several specific and surprising characteristics that are key to achieving the desired therapeutic effect, such as those listed below: - A strong ability to attract monocytes and then pattern them into a recovery-promoting phenotype. - The ability to restore MMP activity (fibrosis / alternative to extracellular matrix (ECM) remodeling) that is suppressed by manipulation of IL-10 alone.

[0391] Therefore, the inventors are confident that by manipulating macrophages with a combination of IL-10 and MMP9, an effective product can be obtained that possesses both anti-inflammatory and anti-fibrotic functions in the treatment of several organ injury situations, both acute and chronic. In acute injury situations, the reconstruction of ECM components is of paramount importance to ensure tissue restoration and proper regeneration.

[0392] Equal portions Those skilled in the art will be able to recognize, or at least recognize, equivalents of the specific embodiments described herein using ordinary experiments. Such equivalents are intended to be covered by the following claims. Any combination of any multiple dependent claims or embodiments disclosed in the examples is intended to be within the scope of this disclosure.

[0393] Embedding by reference Any patents, patent application publications, and scientific publications mentioned herein, as well as the contents of their drawings, are incorporated herein by reference in their entirety.

[0394] Sequence List Italics - Encodes proteins Bold - Linker In all mRNA sequences, uridine is transcribed as thymine.

[0395] Sequence ID 1 1. Single hIL10 mRNA

[0396] [ka]

[0397] Sequence ID 2 2. Bicistronic hIL10 -P2A-hMMP9

[0398] [ka]

[0399] [ka]

[0400] Sequence ID 3 3. MMP9

[0401] [ka]

[0402] Sequence ID 4 Human IL-10 protein sequence (bold = open reading frame)

[0403] [ka]

[0404] Sequence ID 5 Protein sequence IL10-p2a-MMP9 (bold = open reading frame, underline = linker)

[0405] [ka]

[0406] Sequence ID 6 Human MMP9 protein sequence (bold = open reading frame)

[0407] [ka]

[0408] Sequence ID 7 p2A motif DXEXNPGP

[0409] Sequence ID 8 Unoptimized p2A mRNA sequence GGAAGCGGAGCCACGAACTTCTCTCTGTTAAAGCAAGCAGGAGATGTTGAAGAAAACCCCGGGCCT

[0410] Sequence ID 9 p2A amino acid sequence GSGATNFSLLKQAGDVEENPGP

[0411] Sequence ID 10 Optimized bicistronic mRNA coding sequence (linker sequences are underlined). All uridines (transcribed here as thymine) are 5-methoxyuridines.

[0412] [ka]

[0413] Sequence ID 11 Amino acid sequence encoded by an optimized bicistronic mRNA sequence (IL-10-p2A-MMP9 fusion protein) (linker sequence is underlined)

[0414] [ka]

[0415] Sequence ID 12 Sequence of mouse mRNA-based transcript introduced into mRTX001.

[0416] [ka]

[0417] Sequence ID 13 Optimized sequence of IL-10 mRNA. All uridines (transcribed here as thymine) are 5-methoxyuridines.

[0418] [ka]

[0419] Sequence ID 14 Optimized sequence of MMP9 mRNA. All uridines (transcribed here as thymine) are 5-methoxyuridines.

[0420] [ka]

[0421] Sequence ID 15 Linker-optimized mRNA sequence. All uridines (transcribed here as thymine) are 5-methoxyuridines. GGCTCCGGCGCCACCAACTTCAGCCTGCTGAAGCAGGCCGGCGACGTGGAGGAGAACCCCGGCCCA

[0422] Sequence ID 16 Optimized bicistronic mRNA (including 5'UTR and 3'UTR). All uridines (transcribed here as thymine) are 5-methoxyuridine.

[0423] [ka]

[0424] Sequence ID 17 - 5'UTR of an optimized bicistronic mRNA construct (all uridines (transcribed here as thymine) are 5-methoxyuridines)

[0425] [ka]

[0426] Sequence number 18 - 3'UTR of the optimized bicistronic mRNA construct (all uridines (transcribed here as thymine) are 5-methoxyuridines)

[0427] [ka]

[0428] Sequence ID 19 - 5'UTR of an unoptimized bicistronic mRNA construct AGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCACC

[0429] Sequence ID 20 - 3'UTR of an unoptimized bicistronic mRNA construct

[0430] [ka]

[0431] (References) TIFF2026534478000018.tif202154TIFF2026534478000019.tif213154TIFF20265344780 00020.tif206154TIFF2026534478000021.tif213154TIFF2026534478000022.tif200154 [Examples]

[0432] Materials and methods The data described in the following example was created using the protocol described below.

[0433] Macrophage cell culture The inventors isolated monocytes from buffy coat products derived from healthy volunteers provided by the Scottish National Blood Transfusion Service (SNBTS) using a Ficoll gradient (GE Healthcare) followed by magnetic column selection using CliniMACS CD14 Reagent (Miltenyi Biotec). The inventors then matured the monocytes for 1–7 days in phenol red-free TexMACS (Miltenyi Biotec) in the presence of 100 ng / mL GMP-grade recombinant human macrophage colony-stimulating factor (rhM-CSF) (R&D System, Biotechne) and 2 × 10⁶ hMDM over 5 days. 6 pieces / cm 2 The cells were cultured at the specified density in 6-well multi-well plates (Corning Costar). hMDM was counted using an automated counter (TC20, BioRad).

[0434] Macrophage manipulation Small / medium-scale transfection-RNA Mature macrophages are pelleted at 300 × g for 5 minutes, then the supernatant is removed, and the cells are resuspended in supplement buffer P3 (Lonza) at a density of 50 × 10^6 cells or 100 × 10^6 cells / ml. mRNA is added at a concentration of 2 ug / 10^6 cells for IL10 (798 NT) or 8 ug / 10^6 cells for IL10-MMP9 (2985 NT), and thoroughly mixed by pipetting. The cell suspension is transferred to an electroporation cuvette / cassette (100 ul / 1 ml). Cells are transfected with a Lonza Nucleofector using pulse code CM-137. Cells are collected in sterile Falcon tubes. Wash the electroporation cuvette / cassette with 100 µl / 1 ml TexMACS medium supplemented with M-CSF (100 ng / ml), IL4 (20 ng / ml), and IL13 (20 ng / ml), and add it to the cell suspension. Place the cells in a TC incubator for 20 minutes. Perform cell counting and adjust the cell density to 4 × 10^6 cells / ml. Cell density: 2 × 10^6 cells / cm 2 Seeds are sown and placed in a cell culture incubator.

[0435] Large-scale fluid transfection - mRNA Mature macrophages were pelleted at 300 × g for 5 minutes. The supernatant was removed, and the cells were resuspended in supplement buffer P3 (Lonza) at a density of 200 × 10^6 cells / ml. mRNA was transferred to sterile Falcon tubes at a concentration of 2 ug / 10^6 cells for IL10 (798 NT) and at a concentration of 8 ug / 10^6 cells for IL10-MMP9 (2985 NT), and supplement buffer P3 was added until the volume was equal to that of the cell suspension. The Lonza Nucleofector LV transfection system was set up. The cell suspension and mRNA were transferred to the 4D-Nucleofector LV Reservoir as appropriate. Cell culture bags pre-filled with TexMACS medium supplemented with M-CSF (100 ng / ml), IL4 (20 ng / ml), and IL13 (20 ng / ml) were attached to the tubes of an electroporation cassette to elute the cells. Cells were transfected using a Lonza Nucleofector with a pulse code CM-137. The bags containing the cells were transferred to a TC incubator for 20 minutes. Cell counting was performed to adjust the cell density to 4 × 10^6 cells / ml. Cell density was reduced to 2 × 10^6 cells / cm³. 2 The seeds were seeded and placed in a cell culture incubator.

[0436] Small-scale transfection-pDNA As used herein, "payload" refers to a therapeutic gene that is introduced by transfection to test its effects on macrophages.

[0437] Human monocyte-derived macrophages (hMDMs) on day 5 were resuspended in CliniMACS® El electroporation buffer (Miltenyi Biotec, #170-076-625) at a density of 75 × 10^6 cells / ml or 150 × 10^6 cells / ml. 100–300 μl of the suspension was transferred to an electroporation cuvette with a gap size of 0.2 cm. Plasmid DNA was directly added to the cuvette at a dose of 5 μg per 5 × 10^6 cells, and the cuvette was gently tapped to mix with the cells. The cells were transfected using a CliniMACS® electroporator controlled by CliniMACS Prodigy®. The electroporation parameters are outlined in Table 1 below (further details are provided in patent application PCT / GB2021 / 051300, published as International Publication No. 2021240167).

[0438] [Table 1]

[0439] Following transfection, cells were collected from the cuvettes into sterile TexMACS® GMP medium (Miltenyi Biotec, #170-076-306) using an 1 mL syringe with a sterile 18 G needle or similar instrument. Cell counting was performed using a TC-20 automated cell counter (Bio-Rad). Cells were centrifuged at 300 × g for 5 minutes at room temperature. The supernatant is aspirated, and the cells are resuspended at a concentration of 4 × 10^6 cells / mL in sterile TexMACS® GMP medium (Miltenyi Biotec, #170-076-306) supplemented with 100 ng / mL rhM-CSF (R&D Systems, #AFL216), 20 ng / mL rhIL4 (R&D Systems, #AFL204), and 20 ng / mL rhIL13 (R&D Systems, #213-ILB / CF), resulting in a cell-to-cm³ concentration of 2 × 10^6 cells / cm³. 2 They were sown at this density.

[0440] Macrophages used to generate the data shown in Figures 1 to 11 and 20 to 30 were transfected with RNA constructs. Macrophages used to generate the data shown in Figures 12 to 16, 18, and 19 were transfected with plasmid DNA constructs.

[0441] Freezing and thawing treatment To improve the freeze-thaw recovery capacity of engineered macrophages after transfection, the macrophages were cultured at 4×10 6 cells / mL and 2×10 6 cells / cm 2 cell concentrations in TexMACS serum-free medium (Miltenyi Biotec) containing 100 ng / mL M-CSF (BioTechne) and 20 ng / mL IL-4 and IL-13 (BioTechne) overnight for incubation.

[0442] Phagocytosis assay Briefly, macrophages were prepared for imaging analysis by seeding them in 96-well clear-bottom imaging plates (Grenier) at a density of 150,000 cells per well. The supernatant was removed, and the cells were stained with 100 μL of PBS + NucBlue (ThermoFisher) and 5 μg / ml Cellmask Deep Red Plasma Membrane Stain (Invitrogen) for 30 minutes at 37°C with 5% CO₂. The cells were washed 3 times with 100 μL of PBS. For T0 analysis using the Opera Phenix High Content Screening System, 50 μL of PBS was added to the cells. After T0, 50 μL of 0.2 mg / ml pHrodo Red Zymosan beads (Life Technologies) was added to the cells. A series of images were acquired over a period of 96 minutes to monitor phagocytosis. The images were analyzed with Columbus data imaging software and the Tibco Spotfire data analysis system. Graphs were plotted using GraphPad Prism 9.2.0.

[0443] The cells were placed in PBS + 0.5 mM EDTA (Life Technologies) in a 2x10⁻¹⁶ solution. 6 Cells were prepared for flow cytometry analysis by resuspending them at a concentration of cells / ml. 50 μL of the cell suspension was dispensed into a low-adhesion, round-bottom 96-well plate. 50 μL of resuspended pHrodo beads (prepared according to manufacturer's instructions) were placed in the test wells. The cells were incubated at 37°C, 5% CO2 for 2 hours. At the end of the 1-hour incubation, the plate was centrifuged at 300 × g, 4°C, for 5 minutes, the supernatant was removed, and the pellet was resuspended in 100 μL / well of 1:100 FcR block PEA solution. After incubation at 4°C in the dark for 15 minutes, the antibody (see Table 2) was added to the appropriate test well and incubated at 4°C for 20 minutes. The cells were washed with PBS + 0.5 mM EDTA and centrifuged at 300 g for 5 minutes. The supernatant was removed by tapping, and the cells were resuspended in PBS + 0.5 mM EDTA + 1:1000 DRAQ7. They were incubated at 4°C for 5 minutes. After washing as described above, the cells were resuspended in PBS + 0.5 mM EDTA + 0.1% human serum (100 μL). 50 μL of cells were collected using Novocyte3000 or Novocyte Quanteon (Agilent). Flow cytometry analysis was performed using NovoExpress software, and actively phagocytic macrophages were identified using the following gating strategies: a "cell gate" to exclude debris, a "singlet gate" to exclude cell doublets, a "live gate" to exclude dead cells, a "CD14+ gate" to identify iMACS, and a "phRodo+ve gate" to measure the percentage of phagocytic macrophages.

[0444] IL-10 Capture Assay For each condition, 1 × 10 6The cells were resuspended in 80 μL of cold TexMACS, 20 μL of IL-10 Catch Reagent was added, and the cells were incubated on ice for 5 minutes. Then, 10 mL of warm TexMACS was added to the cells transfected with the payload (test group), and 10 mL of cold TexMACS was added to a separate tube of the transfected cells as a negative control. The test group was incubated at 37°C for 1.5 hours under continuous rotation. The negative control was stored on ice. After incubation, the cells were washed with 15 mL of cold buffer and centrifuged at 4°C. Then, the cells were washed again with 10 mL of cold buffer and centrifuged at 4°C. The cells were resuspended in 80 μL of cold buffer, 20 μL of detection antibody and 5 μL of CD14 VioBlue were added, and the cells were incubated on ice for 10 minutes. The cells were washed with 5 mL of cold buffer and centrifuged at 4°C. Next, the cells were resuspended in 1 mL of 1:1000 Draq7 (in cold buffer), and 100 μL of the sample was transferred to a 96W plate. The plate was centrifuged to precipitate, resuspended in 100 μL of cold buffer, and acquired using a flow cytometer.

[0445] Flow cytometry labeling Macrophages were mixed in PBS + 0.5 mM EDTA (Life Technologies) + FcR block 1:100 (Miltenyi) in a 1 × 10⁶ solution. 6 The cells were resuspended at a concentration of cells / ml. 100 μL of cells were dispensed into a low-adhesion, round-bottom 96-well plate. The cells were incubated for 5 minutes, then the appropriate antibody (see Table 2) was added to the appropriate test well and left at 4°C for 20 minutes. The cells were washed with PBS + 0.5 mM EDTA and centrifuged at 300 g for 5 minutes. The supernatant was removed by tapping, and the cells were resuspended in PBS + 0.5 mM EDTA + 1:1000 DRAQ7. Incubated at 4°C for 5 minutes. Washed as described above, then resuspended in PBS + 0.5 mM EDTA + 0.1% human serum 100 μL. 50 μL of cells were collected using Novocyte3000 or Novocyte Quanteon (Agilent).

[0446] [Table 2]

[0447] MSD V-plex cytokine dosage Cytokines in cell culture supernatant were analyzed using the V-PLEX Human Biomarker 10-Plex kit on a MESO Quickplex SQ 120, following the manufacturer's instructions (Meso Scale Discovery). 10 μL of supernatant was tested. Results are shown in pg / mL. Values ​​have been adjusted to account for dilutions during testing. All data shown represent secretion over a 24-hour period. The reported data represent net concentrations calculated by subtracting the amount of a given cytokine in the culture medium (TexMACS) only from the amount of cytokine detected in the cell culture supernatant.

[0448] PBMC attraction / migration assay Buffy coat samples were purchased from SNBTS under sample control 20-17. Peripheral blood mononuclear cells were isolated from this buffy coat using standard methods and placed in CryoStorCS10 (STEMCELL) at a rate of 50 × 10⁶ 6 The PBMCs were frozen at a density of 1 / mL and stored until needed. To set up the migration assay, the PBMCs were thawed and placed in TexMACS (Miltenyi) at a density of 4.6 × 10⁶ 6The cells were resuspended individually. 75 µl of cells in TexMACS were placed in the upper chamber of a 5-micron 96-well Transwell (Corning). 150 µl of frozen and thawed acclimatization medium was placed in the lower chamber. This Transwell plate was placed in an incubator (37°C, 5% CO2). After 3 hours, the upper chamber was removed, and the cells that had migrated to the lower chamber were stained with CD45-PerCP, CD14-VioBlue, CD15-Pevio770, CD16-BV605, CD56-PE, CD3-FITC, and CD19-APC using a standard flow cytometry staining procedure, and collected using Novocyte3000 or Novoocyte Quanteon (Agilent).

[0449] Polarization assay - non-polarized macrophages Macrophages that matured on day 5 were divided into 2 × 10⁶ cells in MCSF (R&D) with TexMACS + 100 ng / ml. 6 pieces / cm 2 Cells were seeded at a density in 96-well plates (Corning). 50 ng / ml of IL-10 (R&D) was added to the control wells (M2 polarized medium). After cell attachment (5 hours), the medium was removed and replaced with acclimatization medium. The cells were incubated with acclimatization medium in an incubator (37°C, 5% CO2) for 18 hours, and then stained with CD14-VioBlue, CD45-PerCP, CD206-BV711, 25F9-eF660, HLA-DR-PeCy7, CD86-PE, and CD163-FITC using a standard flow cytometry staining protocol. Dead cells were stained using DRAQ7. Cells were harvested using Novoocyte3000 or Novoocyte Quanteon (Agilent).

[0450] MMP activity assay MMP activity was confirmed by the successful cleavage of a standard MMP peptide. The standard MMP peptide was sandwiched between a quencher and a fluorescent signal and did not fluoresce when intact. The cleaved peptide no longer quenched the fluorescent signal and therefore emitted fluorescence, which was measured as relative fluorescence units (RFU). This assay was performed according to the manufacturer's instructions (https: / / www.abcam.com / ps / products / 112 / ab112146 / documents / ab112146%20MMP%20Activity%20Assay%20Kit%20Fluorometric%20-%20Green%20v4b%20(website).pdf - ab112146 MMP Activity Assay Kit Fluorometric - Green v4b), and 25 µl of cell culture supernatant was tested. All data shown represent the activity of MMP secreted over a 24-hour period. The results are plotted by subtracting the background fluorescence of the culture medium (TexMACS) only from the RFU.

[0451] statistics All reported dots represent separate donors. Unless otherwise specified, at least three donors were analyzed for each condition. Data are presented as mean ± SD where necessary. Two-tailed t-tests were performed on paired data where necessary.

[0452] result (Example 1) Efficient transfection of IL-10 and IL-10+MMP9 in hMDM To generate transfected (Trx) human monocyte-derived macrophages (hMDMs) for cell therapy, it is necessary to significantly increase the expression and secretion levels of the desired payload. Based on internal and published results, we established minimum thresholds for our selected payloads, IL-10 and MMP9. The levels of secreted proteins were measured in the cell culture supernatant 24 hours after transfection by ELISA. Interestingly, transfection with both IL-10 and IL1-0+MMP9 (bisistronic vector) resulted in a significant increase in IL-10 secretion (Figure 1). The increase in IL-10 secretion in the manipulated macrophages was also confirmed by a flow cytometry-based IL-10 capture assay, which monitored IL-10 secretion in macrophages over a 2-hour period (Figure 2). However, MMP9 secretion did not increase dramatically, and transfection with IL-10 alone slightly decreased MMP9 secretion, which was at least partially restored by co-transfection with IL-10 and MMP9 (Figure 1), suggesting that the transfection efficiency of MMP9 is sufficient. In all experiments described herein, the inventors always analyzed untransfected (NTrx), NTx + reconstitution treatment (IL4 + IL13), IL-10 alone Trx, and IL-10 + MMP9 Trx. All Trx cells underwent reconstitution treatment. IL-10 and MMP9 were co-transfected using a bisistronic vector linked with a p2A linker sequence.

[0453] (Example 2) hMDs transfected with IL-10 and hMDMs transfected with IL-10+MMP9 show conservation of macrophage identity markers. Maintaining macrophage cell surface identity markers is crucial for achieving safe and effective macrophage cell therapy. This indicates that the genetic manipulation procedure does not fundamentally alter cell identity. The panleukocyte marker CD45 is retained in all cell types. In IL-10+MMP9, the expression intensity of the bone marrow marker CD14 is slightly decreased (MFI multiplier change), but the proportion of positive cells remains unchanged, and therefore, we are confident that the cells maintain bone marrow identity. The mature macrophage marker 25F9 is slightly increased in the manipulated cells, which is a positive sign of strong macrophage identity. All other markers analyzed (CD206, CD163, CCR2, CD169) are either unchanged or slightly increased in the manipulated cells compared to unmanipulated cells. These data support our view that our manipulation method is safe and does not disrupt cell identity. The data are shown in Figure 3.

[0454] (Example 3) hMDM transfected with IL-10 and hMDM transfected with IL-10 + MMP9 exhibit a significant anti-inflammatory profile. For example, obtaining highly anti-inflammatory macrophages is crucial for treating acute and chronic inflammatory conditions associated with organ damage. Surprisingly, transfected macrophages not only retain all identity markers (Figure 3) but also show a decrease in several pro-inflammatory markers, such as CD86 and HLA-DR (Figure 4). This highlights the autocrine-paracrine effect of engineered IL-10 in inducing a potent anti-inflammatory phenotype in engineered macrophages. The slight increase in CD80 levels observed in IL-10+MMP9 is within 10% of the desired level (red dotted line) and is therefore not considered significant from a biological effect perspective.

[0455] (Example 4) hMDM transfected with IL-10 and hMDM transfected with IL-10+MMP9 exhibit excellent phagocytic activity. For example, another important aspect of effective macrophage cell therapy in acute and chronic inflammatory conditions associated with organ damage is its efficient phagocytic ability. Here, we report that both engineered and unengineered macrophages efficiently phagocytose beyond the minimum desired level (dotted line) (Figure 5).

[0456] (Example 5) hMDM transfected with IL-10 and hMDM transfected with IL-10+MMP9 polarize naive macrophages into a recovery-promoting phenotype. During inflammatory organ injury, local macrophages need to acquire a regenerative phenotype to support fibrotic reconstruction and / or tissue regeneration. In this assay, we evaluate the ability of cell culture supernatants 24 hours after transfection of NTrx, NTrx+ treated, IL-10 Trx, and IL-10+MMP9 Trx macrophages to polarize macrophages from unrelated donors. M2 macrophages polarized from the same donor using recombinant IL-10 are used as a positive control (red dotted line). The desired result is that, compared to macrophages treated with supernatant from unmanipulated hMDM, macrophages treated with supernatant from manipulated hMDM show decreased M1 markers CD86 and HLA-DR, while M2 markers CD206 and CD163 are similar or increased. Supernatants from both IL-10 Trx and IL-10+MMP9 Trx hMDM are effective in promoting the conversion of unrelated donor macrophages to a regenerative phenotype (decreased CD86 and HLA-DR, increased CD206, and similar levels of CD163) (Figure 6).

[0457] (Example 6) hMDM transfected with IL-10+MMP9 exhibits superior mono-ball mobilization capabilities compared to hMDM transfected with IL-10. A key function of macrophages is their ability to situately recruit new monocytes and pattern this recruitment into a recovery-promoting phenotype. Figure 6 shows evidence of the ability of IL-10 Trx and IL-10+MMP9 Trx hMDM to induce such a phenotype in non-polarized macrophages. Surprisingly, the data shown in Figure 7 supports the idea that only the supernatant derived from IL-10+MMP9 Trx hMDM induces significant monocyte migration when tested in a PBMC migration assay.

[0458] (Example 7) Macrophages transfected with IL-10+MMP9 exhibit superior metalloproteinase activity compared to macrophages transfected with IL-10. A final key feature in macrophage cell therapy aimed at inducing tissue remodeling is the ability to digest extracellular matrix (ECM) components. This assay measures the ability of the entire MMP pool in the cell culture supernatant to digest ECM components using a fluorescent probe. Surprisingly, IL-10 Trx significantly reduced overall MMP activity measured in the supernatant (-50%) compared to NTrx hMDM. Notably, co-transfection with MMP9 alone was sufficient to restore such ability in the supernatant, and even increase it compared to NTrx hMDM. hMDM co-expressing IL-10 and MMP9 had 1.5 times higher MMP activity than NTrx hMDM, suggesting that MMP9 and IL-10 synergistically increase the MMP activity of hMDM. This may highlight the ability of MMP9 transfection to also increase the activation of other MMPs. The data are shown in Figure 8.

[0459] (Example 8) hMDM transfected with IL-10 and hMDM transfected with IL-10+MMP9 localize to the liver 24 and 72 hours after injection and are rapidly eliminated from the lungs in chronic liver disease models. For macrophage cell therapy to be effective, it needs to localize to the site of injury after injection. In this experiment, chronic liver disease was induced in immunodeficient mice (NSG strain) by injecting a toxin (CCl4). After 4 weeks of fibrosis induction, hMDM was injected via tail vein, and the liver was harvested at various time points and digested using enzymes to collect the non-parenchymal fraction. The results showed that both IL-10 Trx and IL-10+MMP9 Trx hMDM initially localized to the lungs and liver, but remained only in the liver after 72 hours. Within one week after injection, the genetically modified cells had disappeared as expected (Figure 9). Therefore, these cells exhibit pharmacokinetics and distribution that are suitable for efficacy and safety.

[0460] (Example 9) hMDM transfected with IL-10 and hMDM transfected with IL-10+MMP9 maintain payload expression for 24 hours post-injection in a chronic liver disease model. In the same experiment outlined above, circulating human IL-10 and MMP9 were measured in mouse plasma at various time points after cell therapy injection. Interestingly, despite macrophages being concentrated in the liver and lungs, both IL-10 and MMP9 were detected systemically (circulating in the blood) in the expected mouse population (Figure 10). Appropriate controls were implemented to ensure that human proteins were reliably detected without cross-reactivity with mouse counterparts.

[0461] (Example 10) IL-10 and IL-10+MMP9 have a favorable safety profile in chronic liver disease models. Finally, for success in a clinical setting, cell therapy must be safe both at the time of injection and at various subsequent time points. In particular, it is crucial for cell therapy to have no off-target effects in undamaged organs and to be eliminated within a safe timeframe. The data support the safety of both IL-10 Trx hMDM and IL-10+MMP9 Trx hMDM. In fact, no embolism was detected at the time of injection, and no systemic inflammation was detected systemically in mice with chronic liver disease at various post-injection time points (Table 3 and Figure 11). These data, coupled with the rapid clearance observed in Figure 10, rule out the possibility that these cells are oncogenetic or possess any long-term toxicity.

[0462] [Table 3]

[0463] (Example 11) Engineered macrophages that overexpress IL-10 specifically recruit monocytes. Migration of PBMCs in response to conditioned medium from hMDM treated as shown in Figure 12 was measured as described herein. "D6 UT" cells were collected 6 days after the culture described herein, without transfection, and without treatment with IL-4 or IL-13 (recovery treatment as described herein). "D6 UT+TR" cells were collected 6 days after the culture described herein, without transfection, but treated with IL-4 / IL-13 (recovery treatment as described herein). The remaining treatment groups were transfected with the indicated genes. Transfection with IL-10 alone induced maximum monocyte recruitment, while transfection with CCR2 was another treatment site that produced macrophages capable of significant monocyte recruitment. Figure 12 shows only monocyte recruitment identified by flow cytometry. Figure 13 shows the recruitment of other cell types (B cells, T cells, NK cells, neutrophils, and monocytes) by macrophages treated with a subset of the conditions shown in Figure 12 (UT and UT TR correspond to D6 UT cells and D6 UT TR cells described in Figure 12), as identified using flow cytometry. Figure 13 shows that IL-10 transfected cells specifically recruit monocytes without recruiting other cell types. Conditioned media derived from untransfected macrophages and macrophages overexpressing MMP9 did not affect monocyte recruitment.

[0464] (Example 12) Engineered macrophages that overexpress IL-10 convert both unpolarized and pro-inflammatory macrophages into a pro-recovery phenotype. To test the ability of IL-10-overexpressing macrophages to convert monocyte-derived macrophages into pro-recovery macrophages, the inventors tested the effect of CMs from IL-10-overexpressing macrophages on the phenotypes of M0 and M1 macrophages. When M0 macrophages (essentially derived from monocytes incubated for 5 days in the presence of 100 ng / ml recombinant human macrophage colony-stimulating factor rhM-CSF, as described in International Publication No. 2021 / 240162) were incubated with CMs from IL-10-overexpressing cells, the M0 macrophages exhibited marker profiles associated with pro-recovery M2 macrophages (i.e., downregulation of HLA-DR and CD86, and upregulation of 25F9, CD206, and CD163). This effect was comparable to that observed when M0 macrophages were incubated with M2 polarized medium (TexsMACS + 50 ng / ml IL-10) (Figure 14). Surface markers were evaluated using flow cytometry and by measuring mean fluorescence intensity (MFI).

[0465] Similarly, macrophages overexpressing IL-10 incubated with macrophages were able to "rescue" M1 macrophages and convert their phenotype to the resuscitation-promoting M2 phenotype. To test this, CMs were incubated with macrophages pre-polarized to the M1 phenotype using 100 ng / ml LPS + 50 ng / ml IFN-γ. This rescue ability was similar to that observed when using M2 polarization medium (Figure 15).

[0466] (Example 13) Macrophages engineered to overexpress IL-10 have an anti-inflammatory secretome profile. The secretion levels of pro-inflammatory cytokines were measured in macrophages overexpressing only IL-10, macrophages overexpressing only MMP9, macrophages overexpressing both IL-10 and MMP9, and untransfected, non-polarized macrophages. Macrophages overexpressing IL-10 showed an anti-inflammatory secretome profile. In particular, when macrophages overexpressed IL-10, no secretion of pro-inflammatory factors such as TNF-α and IFN-γ was observed (Figure 16). Surprisingly, macrophages overexpressing only MMP9 showed increased secretion of pro-inflammatory cytokines such as IL2, IL12p70, IFNg, TNFα, and IL1β (Figure 16), while macrophages overexpressing both MMP9 and IL-10 showed secretion levels similar to those of macrophages overexpressing only IL-10 (Figure 23). Similarly, the effect of macrophages on systemic inflammation was evaluated in vivo. In short, NSG mice were subjected to 4-5 weeks of CCl4 poisoning. At SD23, mice were randomized to receive either macrophages overexpressing only IL-10 (IL-10 Trx hMDM) or macrophages overexpressing both IL-10 and MMP9 (IL-10-MMP Trx hMDM). Mice injected with phosphate-buffered saline (PBS) were used as a media control. Mouse IL1β and TNFα levels in liver homogenates were measured by MSD assay. Surprisingly, despite the pro-inflammatory secretome profile of macrophages expressing only MMP9 when measured in vitro, neither macrophages overexpressing only IL-10 nor macrophages overexpressing both IL-10 and MMP9 induced an increase in inflammatory cytokines compared to the media control (Figure 11).

[0467] (Example 14) Manipulated macrophages can be delivered to the liver and can persist within it. In addition, human macrophages overexpressing IL-10, when intravenously injected into a mouse model of hepatic fibrosis, localized to the liver and persisted for at least 72 hours after administration, suggesting that these human macrophages could be delivered to a therapeutic area for patients suffering from hepatic fibrosis (Figure 17).

[0468] (Example 15) The manipulated macrophages possess MMP and scar reconstitution activity. To restore the ability of IL-10-overexpressing macrophages to induce scar remodeling, the inventors investigated the introduction of matrix metalloproteinases (MMPs) because MMPs are known to play a crucial role in the degradation of scar tissue in inflamed liver (e.g., Campana et al., Nature Reviews Molecular Cell Biology, Vol. 22, pp. 608-624 (2021)). Since macrophages overexpressing either MMP9 or MMP12 showed the ability to maintain some degree of phagocytic capacity, the inventors tested the scar remodeling ability of macrophages expressing either MMP. By measuring total MMP activity using a FRET-based fluorophore method, it was observed that both MMP9 and MMP12 induced an increase in total MMP activity, with MMP9 inducing a higher increase in total activity (Figure 1).

[0469] (Example 16) Macrophages engineered to overexpress both MMP9 and IL-10 recruit monocytes in vitro and in vivo. RTX001 macrophages were produced by transfecting hMDM with a single bicistronic mRNA containing sequences encoding both MMP9 and IL-10. Figure 20 shows the results from a PBMC migration assay performed as described in Materials and Methods, comparing NTRx cells and RTX001 macrophages in vitro. The ability of macrophages overexpressing both MMP9 and IL10 to recruit monocytes was also confirmed in vivo in a mouse model of hepatic fibrosis (liver injury induced by 4-5 weeks of CCl4 toxicity) 24 hours post-administration. The results of this assay are shown in Figure 21. NSG mice were subjected to 4-5 weeks of CCl4 toxicity. RTX001 and NTrx cells were administered IV with SD23, and readouts were collected 24 hours post-administration. Mice injected with phosphate-buffered saline (PBS) were used as a medium control. Flow cytometry counting was performed to count the recruitment of myeloid cells (defined as CD45+, SiglecF-, Ly6G-, Tim4-, CD11b+) and classical monocytes (defined as CD45+, SiglecF-, Ly6G-, Tim4-, CD11b+, CD64-, Ly6Chi) as a percentage of mouse CD45 leukocytes. In vivo migration was defined as cell recruitment to the liver compared to a medium control. As shown in Figure 21, mice treated with cells overexpressing IL-10 and MMP9 (RTX001) showed increased percentages of monocytes (right panel) and myeloid cells (left panel) recruited from total leukocytes compared to mice treated with untransfected cells (NTRx) or PBS.

[0470] (Example 17) Manipulated macrophages convert liver cells to a regenerative phenotype in vivo. NSG mice were subjected to CCl4 poisoning for 4-5 weeks. RTX001 and NTrx cells were administered intravenously via SD23, and readouts were collected 24 hours after cell administration. Mice injected with phosphate-buffered saline (PBS) were used as a medium control. Mouse cytokines, including IL-10 levels in liver homogenates, were evaluated by the MAD assay. As can be seen in Figure 22, administration of human cells (RTX001) overexpressing IL-10 and MMP9 could induce an increase in mouse IL-10 (when measured in liver homogenates). This indicates that human IL-10 induced an anti-inflammatory phenotype, suggesting a conversion of mouse cells to a regenerative phenotype, considering the known polarization properties of IL-10 (notably, untransfected, non-polarized cells did not induce any increase in mouse IL-10 levels).

[0471] (Example 18) RTX001 macrophages reduce α-SMA expression in vitro and in vivo. The beneficial effects of macrophages overexpressing IL-10 and MMP9 have been demonstrated in vivo within one week of administration in a mouse model of hepatic fibrosis (mice poisoned with CCl4 for 4-5 weeks). When macrophages were intravenously injected into mice, a reduction in the activation of scar-generating cells (i.e., activated hepatic stellate cells, HSCs) was observed in scar tissue compared to untransfected (NTrx) macrophages and PBS controls (visualized by staining for α-SMA, an HSC activation marker, and quantified in the results in the right panel) (Figure 24).

[0472] To further demonstrate the effects of IL-10 and MMP9-expressing macrophages (RTX001) on hepatic fibrosis, an in vitro system was developed using the LX-2 cell line (Sigma Aldrich, SCC064). The LX-2 cell line is a broadly characterized human hepatic stellate cell line that has been shown to retain key features of hepatic stellate cells, and is therefore a suitable model for human hepatic fibrosis. In this system, LX-2 cells were activated by treating them with 50 ng / ml TGF-β in DMEM medium for 24 hours; this activation occurs during hepatic fibrosis. These cells were then incubated with DMEM-conditioned medium (CM) for a further 24 hours, during which the following macrophages were grown for approximately 18 hours: 1. Unprocessed / untransfected / UT human macrophages (Non-Trx CM). 2. Human macrophages (RTX001 CM) expressing constructs encoding IL-10 and MMP9. 3. Human macrophages expressing a construct that codes only for IL-10 (control CM).

[0473] For each of these groups, conditioned medium from macrophages of six different donors was used as a biological replicate. After incubation with the conditioned medium, the inventors measured the number of LX-2 cells expressing α-SMA (Panel B) and the intracellular expression level of α-SMA (Figure 25A). Since α-SMA is an activation marker for human hepatic stellate cells, a decrease in its level indicates reduced activation. Since hepatic stellate cells are involved in hepatic scar formation, a decrease in their activation indicates an alleviation of hepatic fibrosis. As can be shown in Figure 25B, LX-2 cells treated with RTX001 showed both a reduction in the number of α-SMA-expressing cells and a decrease in α-SMA expression, which indicates the inhibitory effect of RTX001 on hepatic stellate cell activation.

[0474] (Example 19) Optimized bicistronic mRNA improves IL-10 secretion. As can be seen in the right panel of Figure 26, transfection with optimized bicistronic mRNA resulted in significantly higher IL-10 secretion. Surprisingly, as shown in Figure 1B, despite the inhibitory effect of IL-10 on MM9 secretion, the optimized sequence resulted in both significantly higher MMP9 secretion and significantly higher MMP activity compared to untransfected macrophages (NTRx) (left and bottom panels of Figure 26). In these experiments, the conditions and mRNA concentrations used were identical for both optimized and unoptimized mRNA.

[0475] (Example 20) Manipulated macrophages are stable in an inflammatory environment. In the livers of patients with end-stage chronic liver disease, pro-inflammatory macrophages accumulate, secreting pro-inflammatory cytokines that enhance the inflammatory response (see, for example, Campana et al., 2021).

[0476] To confirm that macrophages expressing IL-10+MMP9 do not revert to a pro-inflammatory phenotype when administered to patients and encountered an inflammatory environment in the liver, the inventors conducted stability tests. In these tests, the inventors confirmed the stability of the pro-recovery phenotype of IL-10+MMP9-expressing macrophages in an inflammatory environment (mimicking the environment within the liver of patients with end-stage chronic liver disease by modeling the patient's hIFN-γ levels).

[0477] To test the stability of this phenotype, the inventors examined the phenotype of cells after incubation with hIFN-γ using the following experimental procedure.

[0478] To obtain macrophages, PBMCs were isolated from steady-state leukocyte extrusion samples or recruited blood samples. CD14+ cells were isolated from the PBMCs and seeded in TexMacs + M-CSF for 5 days to differentiate into macrophages. On day 5 of culture, macrophages were harvested and either transfected with IL-10 + MMP9 or left untransfected. After transfection, macrophages were incubated overnight (approximately 16 hours) at 37°C and 5% CO2 in TexMacs + 100 ng / mL M-CSF, IL-4 (20 ng / mL), and IL-13 (20 ng / mL). After this resting period, macrophages were harvested and seeded in TexMacs with or without stimulation (hIFN-γ) for 2 × 10⁶ cells. 5 Cells were seeded at a density of 1 cell / well on U-bottom ultra-low adhesion sterile culture plates (Corning, catalog no. 7007). The concentration of hIFN-γ was calculated using the following information: the total IFN-γ in human liver was calculated using the total IFN-γ concentration in injured mouse liver determined by previous in vivo pharmacological experiments, and scaled up to the mass of human liver. This total level of IFN-γ was then divided by the planned dose of therapeutic cells to obtain the level of IFN-γ per cell. Using this, a concentration gradient was created to account for the possibility that patients might exhibit levels of IFN-γ higher or lower than the calculated concentration. All groups were seeded, and three technical replicates were obtained. Macrophages were then cultured for 24 hours and centrifuged at 300×G for 5 minutes. The culture supernatant was collected, frozen at -20°C, and the cells were used for flowmetry to assess the levels of CD80, CD86, MHCII, 25F9, CD14, CD206, and CD163 present on the cell surface. After staining, the cells were analyzed using Novocyte Quanteon, and data analysis was performed using NovoExpress and GraphPad Prism software. No significant changes were observed in pro-inflammatory markers (HLA-DR, CD80, and CD86) or the macrophage identification marker CD206.

[0479] As can be seen in Figure 27, the phenotype of cells expressing MMP9 and IL10 is stable under inflammatory conditions.

[0480] (Example 21) Macrophage marker expression differs among macrophage products. Macrophage products consist of: untransfected and untreated (UT) or treated with IL-4, IL-13, and M-CSF (UT+TR); transfected with IL-10 and MMP9 and untreated (IL-10 MMP9 TRx) or transfected and then treated with IL-4, IL-13, and M-CSF (IL-10 MMP9 TRx+TR). The average fluorescence intensity was measured by flow cytometry as described herein, and the results are shown in Figure 28.

[0481] (Example 22) Post-transfection treatment does not contribute to further polarization of the manipulated macrophages, but it improves their freeze-recovery ability. CD86 (A) and MHC II (B) expression was measured in cells transfected with bicistronic constructs encoding MMP9 and IL-10, either without further treatment (IL-10-MMP9) or after transfection with IL-4, IL-13, and M-CSF (IL-10-MMP9+TR). No difference in CD86 and MHC II expression was detected between the IL-10-MMP9 group and the IL-10-MMP9+TR group (Figure 29). Therefore, the transfected cells were completely autopolarized due to IL-10 secretion (e.g., the reduction in HLA-DR and CD86 was solely due to IL-10 secretion by the transfected cells). However, as shown in Figure 30, the cryo-restorability of untransfected (NTRx) macrophages or transfected (TRx) macrophages incubated with IL-4+IL-13 is higher, as measured by the percentage of cells that survive after cryopreservation.

[0482] (Example 23) Measurement of the anti-fibrotic performance of manipulated macrophages in an immunodeficient mouse model of hepatic fibrosis. The macrophages described herein are of human origin. Understanding the behavior of macrophages in mammalian systems requires immunodeficient mice that enable transient engraftment of human material in vivo. Otherwise, immune wild-type recipient strains would rapidly reject administered human cells through the mechanism of xenolytic acute rejection. Highly immunodeficient "NSG" strains are genetically modified to eliminate the activity of host T, B, and NK cells. While we do not wish to be constrained by theory or mechanism, the mechanism of action (MoA) of macrophages depends, in part, on the recruitment of host innate immune effector cells such as monocytes (Thomas et al., 2011; Ma et al., 2017). NSG mice can accept human cell transplantation, but they lack some functional host immune cells that would lead to a secondary immune response after macrophage treatment. Consequently, the complete pharmacological response expected in humans cannot be modeled in immunodeficient strains. In addition, due to species differences in receptor binding and downstream signaling pathways, some human proteins in the macrophage secretome are likely to be non-functional in mice. Therefore, limitations in immunodeficient strains mean that absolute proof of the efficacy of macrophages described herein (as demonstrated by a statistically significant reduction in hepatic fibrosis) will be at best underestimated or entirely impossible. Nevertheless, the in vivo experimental model for testing efficacy is described below.

[0483] The macrophages used in this example are primary human monocyte-derived macrophages (hMDMs) whose phenotype has been modified by transient transfection to deliver bicistronic mRNA transcripts encoding IL-10 and MMP-9 along with a P2A autocleavage peptide. To demonstrate the antifibrotic properties of the cell therapy under test, experimental hepatic fibrosis is modeled in an immunodeficient mouse line. NSG mice (formal name: NOD.Cg-PrkdcSCID Il2rgtm1Wjl / SzJ, supplied by Charles River Laboratories) lack T cells, B cells, and NK cells, making them immunodeficient and consequently enabling transient engraftment of human cells in vivo. Hepatic fibrosis is induced in NSG mice by twice-weekly administration of carbon tetrachloride (CCl4, ip, 0.4 μL / g body weight, diluted in olive oil) for 12 weeks. The CCl4 fibrosis model is a well-recognized and manageable rodent fibrosis model, and obeticholic acid (Fan et al., 2019) 47 ;Younossi et al., 2019 48 ) and ranifibranol (Wettstein et al., 2017) 49 ;Francque et al., 2021 50 Clinical predictability has been demonstrated by the following: The antifibrotic performance of macrophages being tested is assessed when hepatic fibrosis is established, and cells (1 × 10⁶) are measured 8 weeks after CCl4 administration. 6 The test is performed by intravenous delivery of (1 x 10⁻¹). Damaged mice administered with PBS alone serve as a medium control. In addition, untransfected human monocyte-derived macrophages (NTrx hMDM, 1 x 10⁻¹) are used. 6Damaged mice administered with CCl4 (iv) serve as a comparator group for the procedure being performed. Only cells or the medium are administered 24 hours after the 17th dose of CCl4 (100 μL, iv, in PBS). All mice are continued to receive CCl4 for a further 4 weeks. All mice are humanely euthanized by exsanguination 24 hours after the 24th and final dose of CCl4, and then cervical dislocation is performed under terminal anesthesia. Whole blood is collected and processed by cardiac puncture, and plasma or serum is separated to evaluate liver chemical biomarkers. The liver, spleen, lungs, heart, and kidneys are collected and fixed for histological analysis. To determine the antifibrotic performance of macrophages, hepatic fibrosis is quantified in histological liver sections using picrosilius red (PSR) staining to visualize collagen fibers. PSR-stained sections are digitized using a microscope slide scanner (Zeiss Axioscan, Zeiss AG), and liver fibrosis is quantified using image analysis software (Zen, Zeiss AG). The anti-fibrotic performance of macrophages is evaluated by comparing the percentage of PSR in macrophage-treated mice with that of mice administered only the medium or treated with NTrx-hMDM.

[0484] (Example 24) Measurement of the anti-fibrotic performance of manipulated macrophages in an immunodeficient mouse model of fibrous fatty liver disease. To demonstrate the anti-fibrotic performance of the manipulated macrophages in Example 23, experimental hepatic fibrosis is modeled in an immunodeficient mouse strain with a background of fatty liver disease. NSG mice (formal name: NOD.Cg-PrkdcSCID Il2rgtm1Wjl / SzJ, supplied by Charles River Laboratories) lack T cells, B cells, and NK cells, making them immunodeficient and consequently enabling transient engraftment of human cells in vivo. Hepatic fibrosis is induced by feeding the mice a choline-deficient amino acid-defined high-fat diet (CDAA HFD) with restricted methionine content. Ad libitum feeding of CDAA HFD induces hepatic steatosis and inflammation, resulting in a clear fibrotic histological pattern, but the animals do not experience significant weight loss. The CDAA HFD model is valuable because, unlike other fibrosis models, the fibrosis induced by CDAA HFD resolves gradually and remains stable for at least two weeks after cessation of dietary restriction. Therefore, the characteristics of this model allow for the evaluation of test substances in the absence of ongoing injury. In this example, NSG mice are given CDAA-HFD (freely) for 12 weeks to induce the establishment of hepatic fibrosis against the background of fatty liver disease. After 2 weeks, the mice are switched to a standard diet. After restarting the normal diet, manipulated macrophages are tested for antifibrotic performance after intravenous administration. Injured mice are administered only PBS, which serves as a medium control. In addition, untransfected human monocyte-derived macrophages (NTrx hMDMs, 1 × 10⁶) are used. 6Damaged mice administered with iv) serve as a comparator group for the procedure being performed. 24 hours after resuming standard (RM3) diet, only cells or the medium are administered (100 μL, iv, in PBS). All mice are continued to be fed standard diet for a further 4 weeks. At the end of the experiment, all mice are humanely euthanized by bleeding, followed by cervical dislocation under terminal anesthesia. Whole blood is collected and processed by cardiac puncture, and plasma or serum is separated to evaluate liver chemical biomarkers. The liver, spleen, lungs, heart, and kidneys are collected and fixed for histological analysis. To measure liver fibrosis, histological liver sections are stained with picrosilius red (PSR) staining to visualize collagen fibers. PSR-stained sections are digitized using a microscope slide scanner (Zeiss Axioscan, Zeiss AG), and liver fibrosis is quantified using image analysis software (QuPath Image Analysis open-source software). The antifibrotic performance of manipulated macrophages is evaluated by comparing the percentage of PSR-positive staining in macrophage-treated mouse samples with that of samples from mice that were administered only the medium or treated with NTrx-hMDM.

[0485] [Table 4]

[0486] [Table 5]

[0487] conclusion In conclusion, genetic engineering of IL-10 combined with MMP9 yields many desirable features and functions for cell therapy (e.g., prevention / treatment of inflammatory conditions and / or regeneration of organ damage). IL-10 combined with MMP9 yields the following: - Unwavering macrophage identity, undisturbed by the manipulating process. - A strong anti-inflammatory phenotype. - The ability to pattern naive macrophages into a recovery-promoting phenotype. - Excellent phagocytic ability. - A reassuring stability and in vivo distribution profile, including infiltration into damaged organs and rapid clearance / disappearance in other organs.

[0488] The above characteristics are common to macrophages manipulated with IL-10 alone. However, the combination of IL-10 and MMP9 brings about several specific and surprising characteristics, such as those listed below, which are key to achieving the desired therapeutic effect for the inventors: - A strong ability to attract monocytes and then pattern them into a recovery-promoting phenotype. - The ability to restore MMP activity (a substitute for fibrosis / ECM remodeling) that is suppressed by IL-10 alone.

[0489] Therefore, the inventors are confident that manipulating macrophages with a combination of IL-10 and MMP9 will yield an effective product that can possess both anti-inflammatory and anti-fibrotic functions in several organ injury situations, both acute and chronic (in acute injury situations, the reconstruction of ECM components is crucial to ensure tissue restoration and proper regeneration).

[0490] (Example 25) Autologous monocyte-derived macrophage therapy in humans To evaluate the safety, tolerability, and efficacy of engineered autologous monocyte-derived macrophages (RTX001, described above) overexpressing IL-10 and MMP9, an open-label, phase 1 / 2, multicenter clinical trial (EMERALD) will be conducted in participants with decompensated cirrhosis and participants hospitalized for the first time due to hepatic decompensation. Details of this trial are described below.

[0491] Eligibility Criteria The safety and efficacy of autologous monocyte-derived macrophage products will be evaluated in clinically stable subjects who have experienced an "eligible event." Subjects will also be evaluated against the following inclusion criteria, and will only be included in this trial if they meet all of the following criteria (and do not meet any exclusion criteria): Inclusion Criteria i. Participants must be between 18 and 75 years old. ii. Diagnosis of cirrhosis based on at least one of the following: a. Clinical and radiological features that correlate with the diagnosis of cirrhosis; b. Liver stiffness scores greater than 15 kPa as measured by transient elastography (TE; FibroScan); and c. Past liver biopsies supporting the histological characteristics of cirrhosis. iii. Etiology of the following liver diseases: a. Pure metabolic dysfunction-related fatty liver disease (MASLD), or metabolic and alcohol-related liver disease (Met-ALD), or persistent virological response to HCV (HCV SVR) with progressing cirrhosis, b. Alcohol-related liver disease (ALD or Met-ALD) only if it is confirmed that the subject has not consumed alcohol in excess of the Met-ALD limit, which is defined as consuming more than 14 units / week or 2 units / day for women, or more than 3 units / day for men. 1 unit is equivalent to 8g of alcohol: half a pint of beer (approximately 240mL), one glass of wine (125mL), or one (25mL) of distilled spirits. c. The target group is limited to those with alcohol-related liver disease (ALD or Met-ALD) whose PEth test value is less than 25 mg / l. iv. A Model for End-Stage Liver Disease (MELD) score of 12–20 obtained within two weeks of an eligible decompensated event. If a participant is eligible as an outpatient, they must have a MELD 3.0 score of 12–20 at screening (visit 1). There are no known contraindications to vG-CSF or leukocyte extraction procedures. vi. The patient is admitted as a patient with a severe hepatic decompensation event such as ascites, hepatic encephalopathy, variceal bleeding, hepatorenal syndrome / acute kidney injury (HRS / AKI), or spontaneous bacterial peritonitis (SBP), and this is the only hospitalization for a hepatic decompensation event within the past six months. vii. Outpatients: Refractory ascites (alone): Defined as ascites that cannot be made mobile within 8 weeks after LVP or that recurs. The onset date of refractory ascites is defined as the time of the second LVP.

[0492] The subjects will also be evaluated against the following exclusion criteria, and will be excluded if any of the following exclusion criteria are met: Exclusion criteria i. Cirrhosis of the liver caused by the following: Any viral hepatitis other than hepatitis aC virus (HCV SVR), or b. Autoimmune and cholestatic etiologies, e.g., primary biliary cholangitis (PBC) and primary sclerosing cholangitis (PSC) ii. Acute liver disease not accompanied by cirrhosis as an underlying condition, such as drug-induced liver injury (DILI), though not limited to these. iii. Any current organ failure requiring more than outpatient supportive care and not associated with a participant's hepatic decompensation event. iv. Known splenomegaly of 16 cm or more v.50×10 9 Thrombocytopenia of less than 1 cell / L vi. The presence or suspicion of any of the following comorbidities: a. History of liver transplant or other organ transplant b. ACLF c. Sepsis (with positive microbial culture), or as defined by PI, provided the patient is stable and at least four weeks after completing a full course of IV antibiotics for human immunodeficiency virus (HIV). d. Known human immunodeficiency viruses e. Human T-lymphotropic virus type 1 f. Pulmonary embolism (PE) g. Hepatocellular carcinoma (HCC) or active malignant disease within the past five years (excluding non-melanoma skin cancer, cervical intraepithelial neoplasia, superficial bladder cancer, benign polyps, etc.) h. Liver complications, such as portal vein thrombosis, i. Patients with hepatic pleural effusion are excluded, except for small pleural effusions that are not clinically apparent, are incidentally detected by radiological evaluation, and do not require clinical intervention. j. Chronic renal impairment (on dialysis) or unresolved acute kidney injury (AKI) k. Acute or chronic heart failure (New York Heart Association Grade III / IV) l. Portal pulmonary hypertension m. Severe chronic lung disease, e.g., chronic obstructive pulmonary disease (COPD) or interstitial lung disease, where FEV1 is less than 50% and / or FEV1 / FVC is less than 60%. n.Hepatopulmonary syndrome o. A history of chronic albumin treatment, or current treatment with chronic albumin. p. Severe, untreated / unstable mental illness Q. Tips from the past 6 months vii. Any evidence of clinically significant comorbidities that, in the judgment of the principal investigator, could be life-threatening or limit compliance with the study procedure. viii. Current or planned use of immunomodulatory or immunosuppressant agents; Note: Low-dose corticosteroids up to 10 mg / kg / day of prednisone or equivalent are permitted, or inhaled corticosteroids for the management of asthma. ix. At any point in time, receiving gene therapy or cell therapy. x. Participants with known hypersensitivity to dimethyl sulfoxide (DMSO) xi. The principal investigator's judgment that a participant should not participate in the study if there is a low probability that the participant will comply with the study procedures, restrictions, and requirements. xii. For female participants only: Pregnant or breastfeeding, planning to become pregnant within the next year, or capable of becoming pregnant and unwilling to follow contraceptive requirements. xiii. Current / recent alcohol abuse in the three months prior to screening, defined as drinking more than 3 units / day for women, more than 4 units / day for men, or heavy drinking (more than 14 units / day), as determined by the principal investigator. Note: 1 unit is equivalent to 14g of alcohol: half a pint of beer (approximately 240mL), one glass of wine (125mL), or one (25mL) unit of distilled spirit. xiv. Unsupervised drug abuse that is judged (by the principal investigator) to be at high risk to the participant's health or that makes the participant more likely to fail to comply with follow-up.

[0493] Test design In short, the design of this study is as follows: Part 1 - Screening and Stabilization After confirming that a subject meets the eligibility criteria for this trial, the subject will be evaluated for clinical stability following an eligible hepatic decompensation event. If a subject is found to be clinically stable within six weeks of their first visit (when the subject's MELD score is first measured and the subject undergoes informed screening), the subject will proceed to Part 2 of this trial.

[0494] Part 2 - Cell Motivation, Leukocyte Extraction, and RTX001 Production Eligible participants in Part 1 will be treated with filgrastim (G-CSF) to mobilize leukocytes from the bone marrow, followed by leukocyte extrusion to collect blood cells for RTX001 production. Filgrastim will be administered to subjects at a unit dose intensity of 30 μg / 0.5 mL for 4-5 consecutive days at a dose of 10 μg / kg / day (and leukocyte extrusion will be performed on day 5 or 6 up to 24 hours after the final dose of G-CSF).

[0495] After transferring the mobile leukocyte extrusion material to a Good Manufacturing Practice (GMP) site, CD14+ monocytes are isolated and differentiated into macrophages using recombinant human M-CSF, and manipulated to overexpress IL-10 and MMP9. From one mobile leukocyte extrusion collection per participant, 1 × 10⁶ cells are extracted. 8Four individual doses of autologous, manipulated macrophages are produced.

[0496] The overall scheme for mobility, RTX001 manufacturing, and administration to the target population is shown in Figure 35.

[0497] Part 3 - Assignment to treatment groups and treatment After the production of RTX001, participants will be assigned to one of two groups based on their current cirrhosis compensation status, as follows: • Stabilization group: Participants who remain clinically stable as assessed by the principal investigator after an eligible decompensation event. • Subsequent decompensation group: Participants who experienced further decompensation events after leukocyte extraction and / or the RTX001 manufacturing process.

[0498] The treatment is identical for both groups, with each participant receiving up to four doses of RTX001 via intravenous (IV) infusion. After the fourth or final dose of RTX001 is administered, all participants will proceed to Part 4 of the study for long-term follow-up.

[0499] The patient selection and the splitting into two arms are shown in Figure 33.

[0500] Administration to macrophages As mentioned above, subjects in both treatment arms of this clinical trial will be administered up to four doses of autologous monocyte-derived therapeutic macrophages (RTX001). All therapeutic macrophages administered to subjects will be produced from monocytes obtained from a single leukocyte transport. Each dose of RTX001 will contain 1 × 10⁶ macrophages per 10 mL. 8 The drug is administered as an infusion dispersion in units (with an acceptable range of 70 to 130 million units per dose). This dispersion contains the following excipients: 33.13% physiological saline, 0.17% human serum albumin, and 66.7% Cryostor-10, and is filled into bags and frozen (final concentration of DMSO = 6.7%). It is administered at 6-week intervals. The administration regimen is shown in Figure 36.

[0501] Measured outcomes The primary outcome of the EMERALD trial is to evaluate the safety and tolerability of RTX001. Therefore, this primary outcome will be measured by monitoring and recording adverse events. Specifically, the primary endpoints are the incidence and severity of TEAEs and SAEs, changes from baseline in safety assessments, and the incidence and severity of infusion reactions.

[0502] Secondary outcomes measured by the EMERALD trial include (i) evaluating the clinical efficacy of RTX001 (by measuring (a) time to serious hepatic decompensation events, clinical decompensation events, new registration or transplantation for liver transplantation, and death (liver-related and all causes); (b) measuring the incidence and severity of serious hepatic decompensation events, clinical decompensation events, new registration or transplantation for liver transplantation, and death (liver-related and all causes); and (ii) evaluating the change in MELD score from baseline to end of treatment (by measuring ΔMELD, ΔΔMELD, and MELD stabilization).

[0503] Patient outcomes will be measured over a long-term follow-up period of 96 weeks after the procedure.

Claims

1. A method for treating cirrhosis of the liver in a subject, comprising the step of administering engineered macrophages that have been engineered to overexpress IL-10 to the subject.

2. A modified macrophage, which is engineered to overexpress IL-10, for use in a method for treating cirrhosis of the liver in a subject, the method comprising the step of administering the modified macrophage to the subject.

3. The subjects are (a) having experienced a first hepatic decompensation event requiring hospitalization; or (b) having refractory ascites, and optionally, the refractory ascites began within 6 months prior to administration of the macrophages, and are operated macrophages for use according to the method of claim 1 or claim 2.

4. The subjects are macrophages manipulated for use according to any one of claims 1 to 3, who are exhibiting, recovering from, or clinically stable after the clinical signs of hepatic decompensation, one or more clinical signs of hepatic decompensation, which are optionally selected from ascites, hepatic encephalopathy, variceal bleeding (variceal extirpation), hepatorenal syndrome / acute kidney injury (HRS / AKI), and / or spontaneous bacterial peritonitis (SBP).

5. The macrophage is an automated macrophage for use according to any one of claims 1 to 4, wherein the macrophage is autologous or homogeneous to the subject.

6. The macrophages are autologous to the subject, and the macrophages are differentiated from monocytes obtained from the subject by apheresis, followed by monocyte isolation, and optionally by incubation of monocytes in the presence of M-CSF, according to claim 5 or engineered macrophages for use.

7. The method according to claim 6, wherein the subject is treated with G-CSF before monocytes are obtained from the subject by apheresis; or the method according to claim 6 or the engineered macrophage for use, wherein the subject has already been treated with G-CSF and monocytes are obtained from the subject by apheresis, wherein optionally the G-CSF is recombinant G-CSF, and optionally the recombinant G-CSF is filgrastim.

8. The subject is an engineered macrophage for use according to any one of claims 3 to 7, which has been confirmed to be clinically stable after the first hepatic decompensation event requiring hospitalization of the subject and prior to the step of administering the engineered macrophage.

9. The subjects are clinically stable after the first hepatic decompensation event requiring hospitalization and prior to treatment with G-CSF, and optionally, the subjects are clinically stable at least 6 weeks prior to treatment with G-CSF, engineered macrophages for the method or use according to claim 7 or 8.

10. The subject has experienced a subsequent further hepatic decompensation event following an initial hepatic decompensation event requiring hospitalization, and prior to administration of the manipulated macrophages to the subject, and optionally, the subject has been confirmed to be clinically stable following the subsequent further hepatic decompensation event and prior to administration of the manipulated macrophages to the subject, the method according to any one of claims 3 to 7 or the manipulated macrophages for use.

11. The method or use of the manipulated macrophages according to claim 10, wherein the manipulated macrophages are autologous to the subject, and the subject has experienced a subsequent further hepatic decompensation event after an initial decompensation event and after monocytes have been obtained from the subject by apheresis to produce the manipulated macrophages.

12. The subject is an engineered macrophage for use according to claim 10 or 11, which has been confirmed to be clinically stable after a subsequent further hepatic decompensation event and prior to administration of the engineered macrophages to the subject.

13. A macrophage manipulated for use by the method according to any one of claims 1 to 9, wherein the subject has recovered from (or is clinically stable from) the subject's first hepatic decompensation event, and the subject has not experienced any further hepatic decompensation events after recovering from (or being clinically stable after) the first hepatic decompensation event.

14. The subjects are manipulated macrophages for use according to any one of claims 1 to 13, which have been screened for suitability to the treatment prior to administration of the manipulated macrophages.

15. The etiology of cirrhosis is, (a) Pure metabolic dysfunction-related fatty liver disease (MASLD), (b) Metabolic and alcohol-related liver disease (Met-ALD), (c) Persistent virological response to HCV (HCV SVR) with ongoing cirrhosis, or (d) The patient has been confirmed not to have consumed alcohol beyond the Met-ALD limit and has a PEth alcohol test result of less than 25 mg / l, and is diagnosed with alcohol-related liver disease (ALD or Met-ALD). A macrophage manipulated for use according to any one of claims 1 to 14.

16. The subjects are macrophages manipulated for the method or use according to any one of claims 1 to 15, which have no known contraindications to G-CSF or apheresis.

17. The subjects are macrophages manipulated for use by the method according to any one of claims 1 to 16, wherein the chronic liver failure consortium acute decompensation score is greater than 45 points.

18. The subjects are macrophages manipulated for use according to any one of claims 1 to 17, having a Model for End Stage Liver Disease 3.0 (MELD 3.0) score of 12 to 20.

19. The diagnosis of cirrhosis of the liver is, (a) Clinical or radiological features consistent with cirrhosis; (b) Liver stiffness measurement values ​​(LSM) measured using transient elastography (TE) at over 15 kPa; and (c) Confirmation of histological characteristics of cirrhosis based on past liver biopsies A macrophage manipulated for use or according to any one of claims 1 to 17, based on the presence of at least one of the following.

20. The diagnosis of cirrhosis of the liver was made based on the presence of all of (a) to (c), the method according to claim 18 or an engineered macrophage for use.

21. A macrophage is further manipulated to overexpress MMP9, wherein the macrophage is manipulated for use according to any one of claims 1 to 20.

22. The manipulated macrophage comprises an exogenous coding sequence for IL-10 and an exogenous coding sequence for MMP9, according to the method or use of any one of claims 1 to 21.

23. The method according to any one of claims 1 to 22, or an engineered macrophage for use, wherein the expression of the exogenous coding sequence has a synergistic effect in the restoration of MMP activity and / or in monocyte recruitment by the macrophage, compared to an engineered macrophage containing only the exogenous coding sequence of IL-10.

24. The macrophage and / or coding sequence is human, the manipulated macrophage for use according to claim 22 or 23.

25. The exogenous coding sequence of IL-10 codes for a protein having an amino acid sequence at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4, and optionally, the IL-10 protein comprises the same amino acid sequence as SEQ ID NO: 4, wherein the macrophages are manipulated for the method or use according to any one of claims 22 to 24.

26. The exogenous coding sequence of MMP9 codes for a protein having an amino acid sequence at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 6, and optionally, the MMP9 protein comprises the same amino acid sequence as SEQ ID NO: 6, wherein the macrophage is manipulated for use according to any one of claims 22 to 25.

27. The exogenous coding sequence is present on one or more nucleic acid molecules or is incorporated into the genome of the macrophage, wherein the method according to any one of claims 22 to 26 or an engineered macrophage for use.

28. The nucleic acid molecule is a DNA or RNA molecule, preferably an mRNA molecule, optionally expressing IL-10 and MMP9 from the same mRNA molecule, optionally encoding IL-10 and MMP9 linked by a linker sequence, optionally being a self-cleaving 2A linker, optionally being a p2A linker, wherein the macrophage is manipulated for use according to claim 27.

29. The nucleic acid molecule is an mRNA molecule containing at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical sequence to SEQ ID NO: 13, and optionally the nucleic acid comprises SEQ ID NO: 13, an engineered macrophage for the method or use of claim 28.

30. The nucleic acid molecule is an mRNA molecule containing at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical sequence to SEQ ID NO: 14, and optionally the nucleic acid comprises SEQ ID NO: 14, an engineered macrophage for the method or use described in claim 28 or 29.

31. A nucleic acid molecule is an mRNA molecule encoding IL-10 and MMP9 linked by a linker sequence, the linker sequence encoding a protein comprising the amino acid sequence described in SEQ ID NO: 7, and optionally, the protein encoded by the linker sequence comprising the amino acid sequence described in SEQ ID NO: 9, wherein the macrophage is an engineered macrophage for use according to any one of claims 28 to 30.

32. A nucleic acid molecule is an mRNA molecule encoding IL-10 and MMP9 linked by a linker sequence, wherein the linker sequence comprises mRNA having the sequence described in SEQ ID NO: 15, wherein the macrophage is manipulated for use according to any one of claims 28 to 31.

33. The nucleic acid molecule is an mRNA molecule having a sequence that is at least 80% identical to SEQ ID NO: 10, preferably at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 10, and optionally the mRNA further comprises a poly(A) tail and / or 5' cap, preferably about 65 to 250 residues in length, preferably 90 to 120 residues in length.

34. The nucleic acid molecule is an mRNA molecule having a sequence that is at least 80% identical to SEQ ID NO: 16, preferably at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 16, and optionally the mRNA further comprises a 5' cap, an engineered macrophage for the method or use according to any one of claims 28 to 33.

35. An engineered macrophage for use according to claim 34, wherein the mRNA molecule comprises a chemically modified residue, preferably a modified uracil residue, and optionally comprises at least one synthetic cap.

36. A macrophage manipulated for use according to any one of claims 22 to 35, wherein the exogenous coding sequence for IL-10 is located on the same nucleic acid as the exogenous coding sequence for MMP9.

37. Macrophages are manipulated by editing the endogenous promoters of the IL-10 gene and / or the MMP9 gene, or by regulating the expression of endogenous silencing RNA, or by introducing an exogenous silencing RNA sequence, wherein the silencing RNA is optionally a miRNA, according to any one of claims 1 to 36 or a manipulated macrophage for use.

38. The method according to any one of claims 1 to 37, or an engineered macrophage for use, wherein the level of metalloproteinase activity of the engineered macrophage is at least 1.5 times that of the unengineered macrophage.

39. The manipulated macrophages have reduced CD86 expression to less than half compared to unmanipulated nonpolarized cells, according to any one of claims 1 to 38 or manipulated macrophages for use.

40. The method according to any one of claims 1 to 39 or an engineered macrophage for use, wherein the engineered macrophages have HLA-DR expression reduced to less than half compared to unengineered nonpolarized cells.

41. The manipulated macrophages have at least a 1000-fold increase in IL-10 secretion compared to unmanipulated nonpolarized cells, according to the method or manipulated macrophages for use according to any one of claims 1 to 40.

42. The manipulated macrophages have at least a 10-fold increase in MMP3 secretion compared to unmanipulated nonpolarized cells, according to the method or for use of any one of claims 1 to 41.

43. The manipulated macrophages have at least a 20-fold increase in MMP10 secretion compared to unmanipulated nonpolarized cells, according to the method or for use of any one of claims 1 to 42.

44. The manipulated macrophages were 4 × 10 6 Macrophages manipulated for use according to any one of claims 1 to 43, which secrete IL-10 at a culture supernatant concentration of at least 10,000 pg / ml when cultured in vitro at a cell concentration of cells / ml.

45. The manipulated macrophages were 4 × 10 6 Macrophages manipulated for use according to any one of claims 1 to 44, which secrete MMP9 at a culture supernatant concentration of at least 200 ng / ml when cultured in vitro at a cell concentration of cells / ml.

46. The manipulated macrophages have at least a 5-fold increase in CD206 expression compared to monocytes, according to the method or for use of any one of claims 1 to 45.

47. The manipulated macrophages have at least a 5-fold increase in 25F9 expression compared to monocytes, according to the method or for use of any one of claims 1 to 46.

48. The manipulated macrophages have at least 10% reduced CD80 expression compared to unmanipulated nonpolarized cells, according to any one of claims 1 to 47 or manipulated macrophages for use.

49. The manipulated macrophages were 4 × 10 6 Macrophages manipulated for use according to any one of claims 1 to 48, which secrete TNF-α at a maximum culture supernatant concentration of 40 pg / ml when cultured in vitro at a cell concentration of cells / ml.

50. The manipulated macrophages have phagocytic capacity at least equivalent to that of unmanipulated nonpolarized cells, according to the method or use of any one of claims 1 to 49.

51. The method according to any one of claims 1 to 50, or a manipulated macrophage for use, wherein the metalloproteinase activity in the manipulated macrophage is restored compared to the reduction in metalloproteinase activity in the macrophage manipulated with only the IL-10 coding sequence.

52. The macrophages are optionally transfected via electroporation, wherein the macrophages are operated macrophages for use according to any one of claims 1 to 51.

53. Transfection is performed on a nonviral macrophage for use according to claim 51 or the method described above.

54. The macrophage is a macrophage operated for use according to any one of claims 1 to 53, having a recovery-promoting phenotype.

55. The method according to any one of claims 1 to 54, or manipulated macrophages for use, administered to a target in one or more doses of manipulated macrophages.

56. The method according to claim 55, or manipulated macrophages for use, wherein multiple doses of manipulated macrophages are administered to a subject at intervals of six weeks.

57. Manipulated macrophages are macrophages 1 × 10 8 A macrophage manipulated for use according to any one of claims 1 to 56, administered to a subject in a dose.

58. The method according to any one of claims 1 to 57, or manipulated macrophages for use, administered to a target in four doses of manipulated macrophages.

Images