Antisense oligonucleotides for the treatment of Canavan disease

Abstract

This invention relates to an antisense oligonucleotide (oligomer) complementary to NAT8L premRNA that can inhibit the expression of NAT8L (N-acetyltransferase 8-like) in cells expressing NAT8L. Inhibition of NAT8L expression is beneficial for the treatment of Canavan disease.

Description

TECHNICAL FIELD

[0001] The present invention relates to antisense oligonucleotides (oligomers) complementary to NAT8L pre-mRNA, which are capable of inhibiting the expression of NAT8L (N-acetyltransferase 8-like) in cells expressing NAT8L. Inhibition of NAT8L expression is beneficial for the treatment of Canavan disease.

BACKGROUND ART

[0002] Canavan disease is a recessively inherited vacuolar leukodystrophy caused by ASPA mutations. ASPA encodes aspartoacylase, an oligodendrocyte enzyme required to cleave the abundant brain amino acid N-acetyl-L-aspartic acid (NAA) into acetic acid and L-aspartic acid.

[0003] Canavan disease is a rare and fatal autosomal recessive degenerative disorder that causes progressive damage to nerve cells and pathological conditions of white matter in the brain. It is one of the degenerative brain diseases most frequently observed in infancy. Canavan disease belongs to a group of genetic disorders known as leukodystrophies, which refer to defects in white matter development and growth. Early symptoms of Canavan disease such as hypotonia, macrocephaly, and poor head control usually become apparent between 3 and 6 months of age. Affected infants show delays in developmental milestones (e.g., sitting, standing) and usually do not develop the ability to walk. The progressive nature of this disease results in the loss of previously acquired abilities, and additional symptoms such as seizures and intellectual disability also become apparent in early childhood. The prognosis for Canavan disease is poor, with death occurring in most cases before the age of 10.

[0004] Canavan disease is caused by mutations in the ASPA gene, which encodes aspartoacyclase, an enzyme necessary for the conversion of N-acetyl-l-aspartate (NAA) to acetate and L-aspartate. Currently, there are two leading hypotheses regarding the resulting pathological process. The "oligodendritic cell starvation" hypothesis suggests that a lack of functional aspartoacyclase leads to a deficiency of NAA-derived acetate, which is necessary for myelin (white matter) biosynthesis, resulting in myelin / white matter degeneration in patients. The "NAA toxicity" hypothesis, conversely, proposes that excessive NAA concentrations in the brains of patients lacking aspartocyclase cause osmotic homeostasis, resulting in astrogliosis and myelo vacuolation, which are characteristic of Canavan disease (Pleasure et al., Neurochem Res. 2020 Mar;45(3):561-565. doi:10.1007 / s11064-018-2693-6. Epub 2018 Dec 8. Pathophysiology and Treatment of Canavan Disease.).

[0005] Supporting the "NAA toxicity," Maier et al. in 2015 developed Aspa-deficient mice (Asap) that also lacked the NAA synthase Nat8l. nur7 / nur7 (Canavan disease model) (Aspa nur7 / nur7 / Nat8l - / - In a mouse model, despite having no detectable NAA at all, myelin levels were normal and no axonal degeneration was observed. However, survival time was not improved (Maier et al., J Neurosci. 2015 Oct 28;35(43):14501-16.doi:10.1523 / JNEUROSCI.1056-15.2015. N-Acetylaspartate Synthase Deficiency Corrects the Myelin Phenotype in a Canavan Disease Mouse Model But Does Not Affect Survival Time). Furthermore, in a mouse model with only one intact Nat8l allele (Aspanur7 / nur7 / Nat8l - / + In mice with less NAA accumulation and milder disease symptoms, phenotypic improvement and normal lifespan were observed. Similar results have been reported by Sohn et al. (J Neurosci. 2017 Jan 11;37(2):413-421.doi:10.1523 / JNEUROSCI.2013-16.2016.Suppressing N-Acetyl-l-Aspartate Synthesis Prevents Loss of Neurons in a Murine Model of Canavan Leukodystrophy).

[0006] Subsequently, Bannerman et al., 2018, used an adeno-associated virus vector carrying short hairpin Nat8l inhibitory RNA to study Aspa. nur7 / nur7 Knockdown of Nat8l expression in this group led to a decrease in NAA levels, suppression of the pathogenesis of the disease, and enhancement of motor function (Bannerman et al., Brain Nat8l Knockdown Suppresses Spongiform Leukodystrophy in an Aspartoacylase-Deficient Canvan Disease Mol Ther. 2018 Mar 7;26(3):793-800.doi:10.1016 / j.ymthe.2018.01.002.Epub 2018 Jan 10).

[0007] Furthermore, Hull et al., 2020, states that Aspa nur7 / nur7 Antisense oligonucleotides that reduce Nat8l expression also reduce NAA levels, reverse ataxia, and improve Aspa in young adults. nur7 / nur7It was shown to reduce cerebellar and thalamic formation in mice (Ann Neurol. 2020 Mar;87(3):480-485. doi:10.1002 / ana.25674. Epub 2020 Jan 22. Antisense Oligonucleotide Reverses Leukodystrophy in Canavan Disease Mice).

[0008] Overall, these data suggest that inhibition of NAT8L and reduction of NAA levels represent a potentially effective therapeutic concept for treating Canavan disease, a progressive and fatal neurodegenerative disease for which no treatments are currently available.

[0009] International patent application PCT / EP2023 / 077175 (published as WO2024 / 068997A2) describes a target region for downregulation of the NAT8L gene. Specifically, it identifies a target region that enables efficient downregulation of the gene. Furthermore, this document discloses antisense oligonucleotides targeting the NAT8L gene, such as compounds referred to as "66_124," "66_130," and "66_192." However, these compounds are not disclosed in the priority application WO2024 / 068997A2.

[0010] There is a need for means and methods for the efficient downregulation of the NAT8L gene in patients, particularly oligonucleotides that enable efficient downregulation of the target gene and possess further advantageous properties, such as low toxicity in vivo, favorable pharmacodynamics in vivo, and low off-target effects.

[0011] [Overview of the Initiative]

[0012] This invention relates to an antisense oligonucleotide that downregulates NATL8 expression in cells.

[0013] The present invention relates to an antisense oligonucleotide selected from the group of antisense oligonucleotides consisting of the following: TlxEmxTmxGdxTmxCdxTdxGdxTdxAdxTdxAdxTdxTdxEmoElxAl(Sequence ID 1), TlxElxUoxGdxTmxCdxTdxGdxTdxAdxTdxAdxTdxTdxCdxEmxAl(Sequence ID 2), AlxAlxCdxAlxEmxTdxTdxTdxAdxEdxGdxTdxCdxTmxGlxTdxEmxTl(Sequence ID 3), and AmxAmxElxAmoEmxTdxTdxTdxAdxEdxGdxTdxCdxTmoGmxTlxEmxTm (Sequence ID 4) (In the formula, Adx represents 2'-deoxyadenosine-3'-phosphorothioate, Aox represents 2'-O-methyladenosine-3'-phosphorothioate, Amx represents 2'-O-methoxyethyladenosine-3'-phosphorothioate, Alx represents 2'-O-beta-D-oxyLNA adenosine-3'-phosphorothioate, Cdx represents 2'-deoxycytidine-3'-phosphorothioate, Cox represents 2'-O-methylcytidine-3'-phosphorothioate, Cmx represents 2'-O-methoxyethyl-5-methylcytidine-3'-phosphorothioate, Clx represents 2'-O-beta-D-oxyLNA-5-methylcytidine-3'-phosphorothioate, Edx represents 2'-deoxy-5-methylcytidine-3'-phosphorothioate, Emx represents 2'-O-methoxyethyl-5-methylcytidine-3'-phosphorothioate, Elx represents 2'-O-beta-D-oxyLNA-5-methylcytidine-3'-phosphorothioate, Gdx represents 2'-deoxyguanosine-3'-phosphorothioate, Gox represents 2'-O-methylguanosine-3'-phosphorothioate, Gmx represents 2'-O-methoxyethylguanosine-3'-phosphorothioate, Glx represents 2'-O-beta-D-oxy LNA guanosine-3'-phosphorothioate, Tdx represents 2'-deoxythymidine-3'-phosphorothioate, Tmx represents 2'-O-methoxyethylthymidine-3'-phosphorothioate, Tlx represents 2'-O-beta-D-oxy LNA thymidine-3'-phosphorothioate, Uox represents 2'-O-methyluridine-3'-phosphorothioate, Ado represents 2'-deoxyadenosine-3'-phosphate, Aoo represents 2'-O-methyladenosine-3'-phosphate, Amo represents 2'-O-methoxyethyladenosine-3'-phosphate, Alo represents 2'-O-beta-D-oxy LNA adenosine-3'-phosphate, Cdo represents 2'-deoxycytidine-3'-phosphate, Coo represents 2'-O-methylcytidine-3'-phosphate, Cmo represents 2'-O-methoxyethyl-5-methylcytidine-3'-phosphate, Edo represents 2'-deoxy-5-methylcytidine-3'-phosphate, Emo represents 2'-O-methoxyethyl-5-methylcytidine-3'-phosphate, Elo represents 2'-O-beta-D-oxy LNA-5-methylcytidine-3'-phosphate, Gdo represents 2'-deoxyguanosine-3'-phosphate, Goo represents 2'-O-methylguanosine-3'-phosphate, Gmo represents 2'-O-methoxyethylguanosine-3'-phosphate, Glo represents 2'-O-beta-D-oxy LNA guanosine-3'-phosphate, Tdo represents 2'-deoxythymidine-3'-phosphate, Tmo represents 2'-O-methoxyethylthymidine-3'-phosphate, Tlo represents 2'-O-beta-D-oxy LNA thymidine-3'-phosphate, Uoo represents 2'-O-methyluridine-3'-phosphate, Ad represents 2'-deoxyadenosine, Ace represents 2'-O-methyladenosine, Am represents 2'-O-methoxyethyladenosine, Al represents 2'-O-beta-D-oxy LNA adenosine, Cd represents 2'-deoxycytidine, Co represents 2'-O-methylcytidine, Ed represents 2'-deoxy-5-methylcytidine, Em represents 2'-O-methoxyethyl-5-methylcytidine, El represents 2'-O-beta-D-oxy LNA-5-methylcytidine, Gd represents 2'-deoxyguanosine, Go represents 2'-O-methylguanosine, Gm represents 2'-O-methoxyethylguanosine, Gl represents 2'-O-beta-D-oxy LNA guanosine, Td represents 2'-deoxythymidine, Tm represents 2'-O-methoxyethylthymidine, Tl represents 2'-O-beta-D-oxy LNA thymidine, Uo represents 2'-O-methyluridine, "x" between two nucleotides represents a phosphorothioate internucleoside linkage, and "o" between two nucleotides represents a phosphodiester linkage.)

[0014] The chemical structures of the four compounds of the present invention are also shown in Figures 1 to 4. Therefore, the present invention relates to the antisense oligonucleotides shown in Figure 1, Figure 2, Figure 3, or Figure 4.

[0015] The present invention further provides a complex comprising an antisense oligonucleotide and at least one complex moiety covalently bonded to the antisense oligonucleotide.

[0016] The present invention further provides pharmaceutical compositions comprising the antisense oligonucleotide of the present invention, the complex of the present invention, and pharmaceutically acceptable diluents, solvents, carriers, salts and / or adjuvants.

[0017] The present invention further provides an in vitro method for reducing NAT8L expression in host cells expressing NAT8L, the method comprising administering an effective amount of the antisense oligonucleotide, the complex, or the pharmaceutical composition of the present invention to the cells.

[0018] The present invention further provides a method for treating Canavan disease, comprising administering a pharmaceutically effective amount of the antisense oligonucleotide, the complex, or the pharmaceutical composition of the present invention.

[0019] The present invention also relates to the antisense oligonucleotide, the complex, or the pharmaceutical composition for use in the treatment of canavan disease.

[0020] The present invention further relates to the use of the antisense oligonucleotide, the complex, or the pharmaceutical composition of the present invention for the manufacture of a pharmaceutical for the treatment of Canavan disease. [Brief explanation of the drawing]

[0021] [Figure 1] The chemical structure of a compound having ASO ID66_130 (TlxEmxTmxGdxTmxCdxTdxGdxTdxAdxTdxAdxTdxTdxEmoElxAl, SEQ ID NO: 1). [Figure 2] Chemical structure of a compound having ASO ID 66_124 (TlxElxUoxGdxTmxCdxTdxGdxTdxAdxTdxAdxTdxTdxCdxEmxAl, SEQ ID NO: 2). [Figure 3] Chemical structure of a compound having ASO ID66_707 AlxAlxCdxAlxEmxTdxTdxTdxAdxEdxGdxTdxCdxTmxGlxTdxEmxTl (Sequence ID 3). [Figure 4] Chemical structure of the compound ASO ID66_709 (AmxAmxElxAmoEmxTdxTdxTdxAdxEdxGdxTdxCdxTmoGmxTlxEmxTm, Sequence ID No. 4).

[0022] Detailed Overview of the Invention Inhibition of NAT8L (N-acetyltransferase 8-like) expression is considered a therapeutic concept for treating Canavan disease. In a study described in international patent application PCT / EP2023 / 077175, published as WO2024 / 068997A2 (this specification is incorporated by reference in relation to the entire disclosure), a target region within NAT8L premRNA was identified that, when targeted by an antisense oligonucleotide, can be efficiently downregulated in host cells expressing the said premRNA or mRNA. For example, the target region of target ID 66 was identified (AGATTTTGTTAATCTGGAATATACAGACA GACGTAAAGTGTTTTAGCAAAATGGAAACAAACAGTTGTG, SEQ ID NO: 20, WO2024 / 068997A2).

[0023] In the research forming the basis of this invention, selected compounds disclosed in the international patent application, as well as newly synthesized compounds that bind to this target region, were further analyzed. Advantageously, oligonucleotides targeting this region were shown to have advantageously low off-target effects (see Example 3). Furthermore, they efficiently downregulate the expression of the NATL8 gene in host cells (see Examples 1 and 2), and therefore, the compounds can be advantageously used in pharmaceutical compositions for the treatment of patients with Canavan disease. The compounds are shown in Figures 1 (ASO ID 66_130), 2 (ASO ID 66_124), 3 (ASO ID 66_707), and 4 (ASO ID 66_709). Some of the test compounds were also tested for potential acute and subacute toxicity in vivo (see Examples 4 and 5), as well as for pharmacodynamics in a humanized mouse model (see Example 6). Advantageously, they were shown to be well-tolerated and active in vivo.

[0024] The compounds of the present invention are shown in Table 1. [Table 1] *Sequence ID 5 is the NATL8 premRNA sequence. In the "Compound" column of Table 1, three-letter or two-letter codes were used to describe the modified nucleotides present in the oligonucleotide compounds. Each new nucleotide begins with a capital letter, e.g., "A" in Adx. Furthermore, each compound in Table 1 contains a two-letter code at its 3' end and does not contain a phosphorothioate group or phosphate. The base and sugar groups of the two-letter codes are otherwise identical to those of the three-letter codes. Table 2 provides translations of the two-letter or three-letter codes into chemical names. The annotations typically also apply to the three-letter or two-letter codes of the compounds of the present invention. The x between two nucleotides represents a phosphorothioate nucleoside bond. The o between two nucleotides represents a phosphodiester bond.

[0025] [Table 2] JPEG2026534490000003.jpg219159 Complex polymers, such as antisense oligonucleotides according to the present invention having non-natural chemical modifications, can also be described in HELM format (HELM: "Hierachical Editioning Language for Macromolecules"). HELM format is described in Zhang T, Li H, Xi H, Stanton RV, Rotstein SH. HELM: a hierarchical notation language for complex biomolecule structure representation. J Chem Inf Model. 2012 Oct 22;52(10):2796-806. doi: 10.1021 / ci3001925. Epub 2012 Sep 26. PMID: 22947017. This application is incorporated herein by reference in its entirety.

[0026] Table 3 shows the compounds of the present invention in HELM annotation format. In preferred embodiments, the antisense oligonucleotide is a compound as shown in Table 3. [Table 3] Helm annotation keys for the compounds in Table 3: [LR](G) is a beta-D-oxy-LNA guanine nucleoside, [LR](T) is a beta-D-oxy-LNA thymine nucleoside, [LR](A) is a beta-D-oxy-LNA adenine nucleoside, [LR]([5meC]) is a beta-D-oxy-LNA5-methylcytosine nucleoside, [MOE](G) is a 2'-O-methoxyethylguanine nucleoside, [MOE](T) is a 2'-O-methoxyethyl thymine nucleoside, [MOE](A) is a 2'-O-methoxyethyl adenine nucleoside, [MOE]([5meC]) is a 2'-O-methoxyethyl-5-methylcytosine nucleoside, [mR](G) is a 2'-O-methylRNA guanine nucleoside, [mR](U) is a 2'-O-methylRNA uracil nucleoside, [mR](A) is a 2'-O-methylRNA adenine nucleoside, [mR](C) is a 2'-O-methylRNA cytosine nucleoside, [dR](G) is a DNA guanine nucleoside, [dR](T) is a DNA thymine nucleoside, [dR](A) is a DNA adenine nucleoside, [dR](C) is a DNA cytosine nucleoside, [dR]([5meC]) is a DNA5-methylcytosine nucleoside, [R](G) is an RNA guanine nucleoside, [R](T) is an RNA thymine nucleoside, [R](A) is an RNA adenine nucleoside, [R](C) is an RNA cytosine nucleoside, [sP] is a phosphorothioate nucleoside bond, P is a phosphate nucleoside bond.

[0027] All four compounds of the present invention (shown in Tables 1 and 3, and Figures 1-4) target a region within the 3'UTR of NAT8L premRNA. A study described in the international patent application PCT / EP2023 / 077175, published as WO2024 / 068997A2, showed that targeting the region with target ID 66 (see above) with antisense oligonucleotides enables efficient downregulation of NATL8 gene expression in cells. In particular, targeting positions 6543-6559 or 6553-6569 of SEQ ID NO: 5 enables efficient downregulation of NATL8. Antisense oligonucleotides with ASO IDs 66_124 and 66_130 target positions 6543-6559 of SEQ ID NO: 5. Antisense oligonucleotides with ASO numbers 66_707 and 66_709 target positions 6553-6569 of SEQ ID NO: 5.

[0028] Therefore, the present invention relates to an antisense oligonucleotide selected from the group of antisense oligonucleotides consisting of the following: TlxEmxTmxGdxTmxCdxTdxGdxTdxAdxTdxAdxTdxTdxEmoElxAl(ASO ID 66_130, Sequence ID 1), TlxElxUoxGdxTmxCdxTdxGdxTdxAdxTdxAdxTdxTdxCdxEmxAl(Sequence ID 2), AlxAlxCdxAlxEmxTdxTdxTdxAdxEdxGdxTdxCdxTmxGlxTdxEmxTl(Sequence ID 3), and AmxAmxElxAmoEmxTdxTdxTdxAdxEdxGdxTdxCdxTmoGmxTlxEmxTm (Sequence ID 4) (In the formula, Adx represents 2'-deoxyadenosine-3'-phosphorothioate, Aox represents 2'-O-methyladenosine-3'-phosphorothioate, Amx represents 2'-O-methoxyethyladenosine-3'-phosphorothioate, Alx represents 2'-O-beta-D-oxyLNA adenosine-3'-phosphorothioate, Cdx represents 2'-deoxycytidine-3'-phosphorothioate, Cox represents 2'-O-methylcytidine-3'-phosphorothioate, Cmx represents 2'-O-methoxyethyl-5-methylcytidine-3'-phosphorothioate, Clx represents 2'-O-beta-D-oxyLNA-5-methylcytidine-3'-phosphorothioate, Edx represents 2'-deoxy-5-methylcytidine-3'-phosphorothioate, Emx represents 2'-O-methoxyethyl-5-methylcytidine-3'-phosphorothioate, Elx represents 2'-O-beta-D-oxyLNA-5-methylcytidine-3'-phosphorothioate, Gdx represents 2'-deoxyguanosine-3'-phosphorothioate, Gox represents 2'-O-methylguanosine-3'-phosphorothioate, Gmx represents 2'-O-methoxyethylguanosine-3'-phosphorothioate, Glx represents 2'-O-beta-D-oxy LNA guanosine-3'-phosphorothioate, Tdx represents 2'-deoxythymidine-3'-phosphorothioate, Tmx represents 2'-O-methoxyethylthymidine-3'-phosphorothioate, Tlx represents 2'-O-beta-D-oxyLNA thymidine-3'-phosphorothioate, Uox represents 2'-O-methyluridine-3'-phosphorothioate, Ado represents 2'-deoxyadenosine-3'-phosphate, Aoo represents 2'-O-methyladenosine-3'-phosphate, Amo represents 2'-O-methoxyethyl adenosine-3'-phosphate, Alo represents 2'-O-beta-D-oxyLNA adenosine-3'-phosphate, Cdo represents 2'-deoxycytidine-3'-phosphate, Coo represents 2'-O-methylcytidine-3'-phosphate, Cmo represents 2'-O-methoxyethyl-5-methylcytidine-3'-phosphate, Edo represents 2'-deoxy-5-methylcytidine-3'-phosphate, Emo represents 2'-O-methoxyethyl-5-methylcytidine-3'-phosphate, Elo represents 2'-O-beta-D-oxyLNA-5-methylcytidine-3'-phosphate, GDO represents 2'-deoxyguanosine-3'-phosphate, Goo represents 2'-O-methylguanosine-3'-phosphate, GMO stands for 2'-O-methoxyethylguanosine-3'-phosphate. Glo represents 2'-O-beta-D-oxy LNA guanosine-3'-phosphate, Tdo represents 2'-deoxythymidine-3'-phosphate, Tmo represents 2'-O-methoxyethylthymidine-3'-phosphate, Tlo represents 2'-O-beta-D-oxyLNA thymidine-3'-phosphate, Uoo represents 2'-O-methyluridine-3'-phosphate, Ad represents 2'-deoxyadenosine, Ace represents 2'-O-methyladenosine, Am represents 2'-O-methoxyethyladenosine, Al represents 2'-O-beta-D-oxyLNA adenosine, Cd represents 2'-deoxycytidine, Co represents 2'-O-methylcytidine, Ed represents 2'-deoxy-5-methylcytidine, Em represents 2'-O-methoxyethyl-5-methylcytidine, El represents 2'-O-beta-D-oxyLNA-5-methylcytidine, Gd represents 2'-deoxyguanosine, Go represents 2'-O-methylguanosine, Gm represents 2'-O-methoxyethylguanosine, Gl represents 2'-O-beta-D-oxyLNA guanosine, Td represents 2'-deoxythymidine, Tm represents 2'-O-methoxyethylthymidine, Tl represents 2'-O-beta-D-oxyLNA thymidine, Uo represents 2'-O-methyluridine.

[0029] Furthermore, the present invention relates to antisense oligonucleotides shown in Figure 1, Figure 2, Figure 3, or Figure 4.

[0030] In a preferred embodiment of the present invention, the antisense oligonucleotide is an antisense oligonucleotide having ASO ID66_130(TlxEmxTmxGdxTmxCdxTdxGdxTdxAdxTdxAdxTdxTdxEmoElxAl, SEQ ID NO: 1). The chemical structure of this antisense oligonucleotide is also shown in Figure 1. Therefore, the present invention also relates to the antisense oligonucleotide shown in Figure 1.

[0031] In another preferred embodiment of the present invention, the antisense oligonucleotide is an antisense oligonucleotide having ASO ID66_124(TlxElxUoxGdxTmxCdxTdxGdxTdxAdxTdxAdxTdxTdxCdxEmxAl, SEQ ID NO: 2). The chemical structure of this antisense oligonucleotide is also shown in Figure 2. Therefore, the present invention also relates to the antisense oligonucleotide shown in Figure 2.

[0032] In another preferred embodiment of the present invention, the antisense oligonucleotide is an antisense oligonucleotide having ASO ID66_707 (AlxAlxCdxAlxEmxTdxTdxTdxAdxEdxGdxTdxCdxTmxGlxTdxEmxTl, SEQ ID NO: 3). The chemical structure of this antisense oligonucleotide is also shown in Figure 3. Therefore, the present invention also relates to the antisense oligonucleotide shown in Figure 3.

[0033] In another preferred embodiment of the present invention, the antisense oligonucleotide is an antisense oligonucleotide having ASO ID66_709 (AmxAmxElxAmoEmxTdxTdxTdxAdxEdxGdxTdxCdxTmoGmxTlxEmxTm, SEQ ID NO: 4). The chemical structure of this antisense oligonucleotide is also shown in Figure 4. Therefore, the present invention also relates to the antisense oligonucleotide shown in Figure 4.

[0034] The antisense oligonucleotides of the present invention are also shown in the sequence listing.

[0035] In one embodiment, the antisense oligonucleotide comprises or consists of a sequence such as that shown in Sequence ID No. 1.

[0036] In another embodiment, the antisense oligonucleotide comprises or consists of a sequence such as that shown in Sequence ID No. 2.

[0037] In another embodiment, the antisense oligonucleotide comprises or consists of a sequence such as that shown in Sequence ID No. 3.

[0038] In another embodiment, the antisense oligonucleotide comprises or consists of a sequence such as that shown in Sequence ID No. 4.

[0039] The antisense oligonucleotides of the present invention are typically single-stranded oligonucleotides. Furthermore, they have various chemical modifications that do not typically occur in nature. The introduced modifications increase the stability of the oligonucleotide, for example. The modifications are well known in the art and are outlined, for example, in Crooke et al., which are incorporated herein by reference in their entirety (Stanley T Crooke, Xue-Hai Liang, Brenda F Baker, Rosanne M Crooke. Review of J Biol Chem 2021 Jan-Jun;296. Antisense Technology: A review). It is incorporated herein by reference in its entirety. For example, some nucleotides contain a 2'-modified ribose. Furthermore, the oligonucleotides contain modified nucleoside bonds. Specifically, the nucleoside bonds in the oligonucleotides are phosphorothioate nucleoside bonds. Typically, the oligonucleotides referred to herein are chemically synthesized, for example, by solid-phase chemical synthesis. For example, they can be produced by linking individual nucleotide units, for example, by phosphoramidite chemistry.

[0040] The antisense oligonucleotides of the present invention are capable of downregulating NATL8 expression in cells expressing the NATL8 gene. Therefore, when expressed intracellularly, they can bind to the NAT8L gene, particularly NAT8L premRNA, thereby downregulating the expression of the NAT8L gene within the cell. In one embodiment, the cells are human cells, which are cells of the central nervous system (CNS). Typically, the cells are brain cells.

[0041] The NAT8L (N-acetyltransferase 8-like) gene is well known in the art. The NAT8L gene is typically the human NAT8L gene. Gene information, including nucleic acid sequence information, can be found in known databases, e.g., NCBI Gene ID: 339983. (Other names for the gene include FLJ37478, Hcml3, Shati, or N-acetylspartate synthetase gene).

[0042] The human NAT8L gene encodes a protein with N-acetylaspartate synthetase activity (EC2.3.1.17). Therefore, it catalyzes the synthesis of N-acetylaspartate (NAA) from L-aspartate and acetyl-CoA. The protein sequence can be evaluated in the Uniprot database under accession number Q8N9F0 (NAT8L_HUMAN). Typically, the human NAT8L protein has an amino acid sequence as shown in SEQ ID NO: 7 (encoded by a transcript having a sequence as shown in SEQ ID NO: 6).

[0043] The NAT8L protein is typically referred to as "N-acetyltransferase 8-like." Other names include N-acetylaspartate synthetase, NAA synthetase, or aspartate N-acetyltransferase.

[0044] Typically, the ASO of the present invention targets human NAT8L premRNA, i.e., downregulates the expression of said premRNA. The sequence of human NAT8L premRNA can be evaluated in the Ensembl database, for example, with the accession number ENST00000423729.3. This is encoded by the region on human chromosome 4: positions 2,059,327 to 2,069,089 of the forward strand (assembly GRCh38). The sequence of human premRNA has a sequence such as that shown in SEQ ID NO: 5. In cells, the premRNA is further processed, i.e., by splicing, thereby producing protein-coding mRNA (also referred to herein as a transcript). In some embodiments, the antisense oligonucleotide of the present invention may also target human NAT8L mRNA (where the target region is located within an exon, in a coding region, or in either the 3'UTR or 5'UTR). For example, the antisense oligonucleotide of the present invention may target human NAT8L mRNA having a sequence such as that shown in SEQ ID NO: 6. Sequence IDs 5 and 6 are RNA sequences. In the sequence listing, they are provided as DNA sequences. It will be understood by those skilled in the art that the target RNA sequence has uracil (U) bases instead of thymidine (T) bases.

[0045] Preferably, the antisense oligonucleotide (or pharmaceutical composition) of the present invention is administered to the CNS, particularly the brain. Therefore, the ASO is delivered to the CNS via intrathecal injection. Thus, the ASO or pharmaceutical composition of the present invention is preferably administered intrathecally. In addition to delivery to the CNS, the ASO may be administered subcutaneously or intravenously, with or without the complex, to reach the peripheral nervous system, which is also adversely affected by loss of ASPA expression.

[0046] The antisense oligonucleotides of the present invention can be administered / delivered "without assistance" in physiological saline. However, distribution to specific tissues and uptake into cells can be enhanced by complexing and formulation techniques. Complexation to ASOs may be with receptors or proteins on target cells that mediate transcytosis, such as peptides, antibodies, and aptamers that bind to transferrin receptors. Antisense oligos can also be complexed with naturally occurring ligands or modifications thereof, as exemplified by GalNac complexation that binds with high affinity to asialoglycoprotein receptor 1 (ASGR1, ASPGR), and alpha-tocopherol complexation and interaction with transfer protein Alfa-TTP. It may also be a small molecule produced through medicinal chemistry that has high affinity to known receptors and transporters. Furthermore, it may be complexed with long-chain fatty acids that modify the hydrophobic and protein-binding properties of ASOs, but may function through its ability to bind to lipoprotein particles and thus through endogenous mechanisms for lipid transport and uptake.

[0047] The term “antisense oligonucleotide” typically also includes pharmaceutically acceptable salts of antisense oligonucleotides. A pharmaceutically acceptable salt is one that retains the biological efficacy and properties of a free base or free acid and is not biologically or otherwise undesirable. These salts are formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, and phosphoric acid, particularly hydrochloric acid, and organic acids such as acetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, salicylic acid, and N-acetylcysteine. Furthermore, these salts can be prepared from the addition of an inorganic or organic base to a free acid. Salts derived from inorganic bases include, but are not limited to, salts of sodium, potassium, lithium, ammonium, calcium, and magnesium. Examples of salts derived from organic bases include, but are not limited to, primary, secondary, and tertiary amines, naturally occurring substituted amines, cyclic amines, and substituted amines including basic ion exchange resins, such as isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, lysine, arginine, N-ethylpiperidine, piperidine, and salts of polyamine resins. The compounds of the present invention may also exist in zwitterionic form. In some embodiments, ASO is provided as a sodium salt.

[0048] The present invention further provides a complex comprising an antisense oligonucleotide and at least one complex moiety covalently bonded to the antisense oligonucleotide. For example, it can be bonded to the ASO via a linker, via one or more linker nucleotides, such as one, two, three, or four linker nucleotides (or more). The linker may be cleaved after the complex is administered to the patient.

[0049] As described above, the antisense oligonucleotides of the present invention are preferably delivered or administered to the CNS, particularly the brain. Therefore, the complex portion is assumed to be a portion that allows the complex to cross the blood-brain barrier. For example, the portion may be an antibody or its antigen-binding fragment that targets a transferrin receptor.

[0050] In addition to complexation, the tissue delivery and intracellular uptake of the ASO of the present invention can be enhanced through formulation with nanocarriers that facilitate passage through biological barriers such as cell membranes. Various types of nanocarriers, such as lipid nanoparticles (LNPs) used in BioNTech's mRNA vaccines, have been described as having desirable properties for nucleic acid delivery, and LNPs can be functionalized with peptides, pegylated lipids, cationic lipids, both artificial and natural exosomes (lipid bilayers), such as milk exosomes and globular nucleic acids, as well as others as described in Roberts et al., 2020 (Thomas C Roberts, Robert Langer, Matthew JAwood. Review Nat Rev Drug Discov. 2020 Oct;19(10):673-694. Advances in oligonucleotide drug delivery).

[0051] The present invention further provides an in vitro method for reducing NAT8L expression in host cells expressing NAT8L, the method comprising administering an effective amount of the antisense oligonucleotide, the complex, or the pharmaceutical composition of the present invention to the cells.

[0052] The present invention further provides pharmaceutical compositions comprising the antisense oligonucleotide of the present invention, the complex of the present invention, and pharmaceutically acceptable diluents, solvents, carriers, salts and / or adjuvants.

[0053] Typically, a pharmaceutical composition comprises the antisense oligonucleotide or complex of the present invention together with a pharmaceutically acceptable carrier and / or a particularly pharmaceutically acceptable excipient. Where used herein, the term "pharmaceutically acceptable" refers, in certain exemplary embodiments, to the non-toxicity of a substance that does not interact with the action of the oligonucleotide or complex present in the pharmaceutical composition.

[0054] As used herein, the term "carrier" refers to an organic or inorganic component of natural or synthetic nature that is combined with the active ingredient to facilitate, enhance, or enable its application.

[0055] As used herein, the term “excipients” is intended to include all substances that may be present in a pharmaceutical composition and are not active ingredients, such as salts, binders (e.g., lactose, dextrose, sucrose, trehalose, sorbitol, mannitol), fillers, lubricants, thickeners, surfactants, preservatives, emulsifiers, or buffering agents.

[0056] The form, route of administration, dosage, and regimen of a pharmaceutical composition naturally depend on the condition being treated, the severity of the disease, the patient's age, weight, and sex.

[0057] In one embodiment, the pharmaceutical composition may be formulated for intrathecal administration. Therefore, the antisense oligonucleotide or complex of the present invention is preferably administered by intrathecal administration, which is a route of drug administration via injection into the spinal canal. Thereafter, it reaches the cerebrospinal fluid and the brain.

[0058] The present invention further relates to an antisense oligonucleotide, a complex, or a pharmaceutical composition, as described in the present invention, for use in medical applications.

[0059] Therefore, the present invention relates to an antisense oligonucleotide, a complex, or a pharmaceutical composition as described in the present invention, for use in the treatment of canavan disease.

[0060] Furthermore, the present invention relates to the use of the antisense oligonucleotide, the complex, or the pharmaceutical composition described in the present invention for the manufacture of a pharmaceutical for the treatment of Canavan disease.

[0061] Canavan disease (also known as Canvan-van Bogaert-Bertnd disease) is a degenerative disorder associated with progressive nerve cell damage and white matter loss in the brain. The disease is inherited in an autosomal recessive manner. It is caused by mutations in the ASPA gene, which encodes the enzyme aspartoacylase. Reduced aspartoacylase activity impairs the normal breakdown of N-acetylaspartate.

[0062] Therefore, the present invention relates to an antisense oligonucleotide, a complex, or a pharmaceutical composition as described in the present invention, for use in the treatment of canavan disease.

[0063] Furthermore, the present invention relates to the use of the antisense oligonucleotide, the complex, or the pharmaceutical composition described in the present invention for the manufacture of a pharmaceutical for the treatment of Canavan disease.

[0064] Furthermore, the present invention relates to a method for treating Canavan disease, comprising administering a pharmaceutically effective amount of the antisense oligonucleotide, the complex, or the pharmaceutical composition described in the present invention to a subject suffering from Canavan disease.

[0065] As used herein, the terms “to treat” or “treatment” refer to administering a compound or composition or combination of compounds or compositions to a subject in order to induce remission of Canavan disease. Therefore, the term encompasses both improvement of one or more symptoms of Canavan disease or prevention of exacerbation of one or more symptoms, i.e., prevention. Improvement of symptoms also includes a reduction of one or more symptoms. Therefore, the term preferably refers to the alleviation of one or more symptoms of the disease. In other words, treatment is typically a disease-modifying treatment that reduces one or more symptoms of Canavan disease. In one embodiment, the onset of the disease's pathology is inhibited. Therefore, it will be recognized that the treatments referred to herein may be prophylactic or disease-modifying in some embodiments. It should be understood that complete cure of Canavan disease is not possible through treatment. Canavan disease is known to reduce life expectancy. Therefore, the term “treatment” also includes increasing the life expectancy of a subject (compared to an untreated subject).

[0066] It should be understood that in order to enable the treatment of Canavan disease, a pharmaceutically effective amount of antisense oligonucleotides will be administered to the patient.

[0067] According to the present invention, the subject to be treated is a subject suffering from Canavan disease. However, the patient may not yet be exhibiting symptoms of Canavan disease at the time of treatment. Typically, the subject exhibits symptoms of Canavan disease. The symptoms of Canavan disease are well known in the art and include (but are not limited to) one or more of the following: lack of motor development, macrocephaly, lack of head control, and abnormal muscle tone. Preferably, the subject has been diagnosed with Canavan disease by genetic testing. Typically, the disease is diagnosed at infancy. Also typically, the diagnosis involves genetic testing and / or detection of elevated levels of N-acetylaspartate (NAA) in urine.

[0068] As used herein, the terms “subject” and “patient” are used interchangeably. “Subject” or “patient” may be a vertebrate. This term includes both humans and other animals, particularly mammals, and other living organisms. In some embodiments, the subject is a mammal. In some embodiments, the subject is a primate. Preferably, the subject is a human subject suffering from Canavan disease.

[0069] All patents, patent applications, and publications referenced herein are incorporated herein by reference in their entirety.

[0070] The present invention will be further described with reference to the examples described herein. However, it should be understood that the present invention is not limited to such examples.

[0071] [Examples]

[0072] Introduction NAT8L-targeted ASOs were tested in vitro in human cells, either HEK293 cells derived from induced pluripotent stem cells or human glutamate-enriched cortical neurons (iPSC-derived glutan neurons), to evaluate and confirm their activity. This is illustrated in Examples 1 and 2. During the activity evaluation, RNA sequencing was used on RNA derived from human iPSC-derived neurons treated with ASOs to establish the selectivity profile of the ASOs for the human transcriptome. ASOs that bind to fewer off-target mRNAs are preferred. This is illustrated in Example 3.

[0073] In addition to good in vitro activity and selectivity, evaluating in vivo tolerability and activity in mice made it possible to identify ASOs with properties suitable for therapeutic use. Two different tolerability readings were evaluated: neurobehavioral symptoms (acute neurotoxicity) after intracerebroventricular administration and body weight gain up to 6 weeks post-administration. These measurements were compared to those in saline-treated animals, and ASOs with acceptable profiles for these two parameters were evaluated for their ability to reduce human NAT8L mRNA in a humanized mouse model.

[0074] oligonucleotide synthesis The synthesis of oligonucleotides is generally known in the art and can be obtained from several different suppliers. In the listed in vitro experiments (Examples 1, 2, and 3), all oligonucleotides were obtained from Biosearch Technologies (Lystrup, Denmark). Briefly, after cleavage from a solid support, the oligonucleotides are cartridge-purified using ammonium acetate. They are dissolved in PBS at 750 μM and their purity (≥80%) is determined by LC / MS.

[0075] In the listed in vivo experiments (Examples 4, 5, and 6), oligonucleotides were obtained from WuXi Apptec (China). After cleavage from a solid support, the oligonucleotides were purified by HPLC to a purity of over 90% (LC-TOF / MS), lyophilized as sodium salts, and formulated in sterile 0.9% sodium chloride. Endotoxin testing was performed to ensure an endotoxin level of <1.0 EU / mg (dynamic turbidimetry or chromogenic LAL assay).

[0076] An overview of the antisense oligonucleotide compounds used in the Examples section can be found in Table A1.

[0077] [Table 4]

[0078] Compounds 66_707 and 66_709 correspond to compounds 66_153 and 66_629, respectively, except that one cysteine ​​residue in compounds 66_707 and 66_709 is methylated. Therefore, they are essentially identical. The methylated residue in compounds 66_707 and 66_709 is shown in bold in the table above. The cysteine ​​residue was methylated to reduce side effects (see Kariko et al., Immunity. 2005 Aug;23(2):165-75. doi:10.1016 / j.immuni.2005.06.008).

[0079] Example 1. Measurement of ASO knockdown activity against human NAT8L mRNA by concentration-response curve experiment. Efficacy expressed as the EC50 value of NAT8L-targeted ASO in HEK293 cells.

[0080] HEK293 cells were maintained and expanded according to the supplier's recommendations. Cells were grown to 70-80% confluence, then trypsinized and resuspended in growth medium. Live cells were counted using trypan blue and a Vi-CELL automated cell counter (Beckman Coulter). A suitable number of cells were diluted in complete growth medium, mixed by gentle pipetting, added to a reagent reservoir, and distributed to 96-well plates at a total volume of 190 μl / well using a multichannel pipette. Sterile PBS was added to the wells of the 96-well culture plates (Nunc® Edge® 96-Well, Nunclo Delta-Treated, Flat-Bottom Microplates) to reduce evaporation and potential plate effects. After 24 hours of incubation, NAT8L ASO is added directly to the growth medium from a 20-fold stock dilution in PBS to achieve final ASO concentrations of 0.01 μM, 0.0316 μM, 1 μM, 0.316 μM, 1.0 μM, 3.16 μM, 10 μM, or 31.6 μM. Table A2 summarizes the most important parameters related to cell handling.

[0081] [Table 5] In addition to ASO designed to target NAT8L, each plate also included a well containing a PBS control (untreated control). After 120 hours, cells were harvested by gently aspirating the growth medium, and 125 μl of RLT buffer and RNA were extracted using RNeasy 96, QIA Dose Reduction HT Kit (Qiagen #74171) according to the manufacturer's instructions for use and eluted in 75 μl of water.

[0082] Prior to qPCR-based expression analysis, transfer 10 μl of RNA containing the eluate to a new plate, dilute 10-fold with RNAse-free water, then heat shock at 90°C for 40 seconds and place on ice. Use the diluted and heat-shocked RNA as an input template for qPCR using qScript® XLT One-Step RT-qPCR ToughMix® (Catalog No. 95134-500) from QuantaBio and qPCR assays from DNA Technology (IDT). Also use the following probes: NAT8L:Hs.PT.58.39061553 for gene of interest (GOI) assay; HEX probe with ZEN / IBFQ double quencher and endogen normalizer for ATXN3:Hs.PT.58.39355049; FAM probe with ZEN / IBFQ double quencher.

[0083] qPCR reactions were performed in 384 wells using QuantStudio 7 Flex (a biosystem adapted by Thermo Fisher Scientific). The amount of NAT8L mRNA was calculated using the ddCT method, with the median of all PBS-treated wells in the same plate serving as the "untreated control". Incubating cells with various concentrations of ASO (0.01 μM, 0.0316 μM, 1 μM, 0.316 μM, 1.0 μM, 3.16 μM, 10 μM, 31.6 μM) allowed for the generation of concentration-response curves and calculation of EC50 values.

[0084] Concentration-response curves were generated using GraphPad prism software version 9 with the "log(inhibitor) vs. response -- variable slope (4 parameters)" function, using a fit constrained to a bottom greater than 0 and a top value of 100. The EC50 values ​​representing the half-effective concentration are shown in Table A3.

[0085] [Table 6]

[0086] In conclusion, concentration-reaction experiments identified very potent compounds and demonstrated that the introduction of 5-methylcytosine in ASO IDs 66_707 and 66_709 yields ASOs with similar activity to the non-5-methylated versions, as seen from ASOs with comparable potency when comparing 66_153 (66_707) and 66_629 (66_709).

[0087] Example 2. In vitro efficacy and efficacy testing of antisense oligonucleotides targeting NAT8L in iPSC-derived human neurons at multiple test concentrations.

[0088] To confirm the activity and efficacy of the preferred ASO in an appropriate cell model, we tested it in iPSC-derived human neurons.

[0089] iPSC-derived neurons were maintained according to the supplier's recommendations (Fujifilm, 01279).

[0090] 96-well cell culture plates (Nunc®Egd® 96-well, Nunlon Delta-Treated, Flat-Bottom Microplates) were coated with sterile 0.07% polyethyleneimide for 1 hour, washed with PBS and water, and coated with 0.01 mg / ml laminin for 1 hour. Without further washing of the culture plates, the laminin solution was removed, iPSC-derived neurons were thawed, and seeded at a density of 80,000 neurons per well at a total volume of 190 μl / well using a multichannel pipette, as described in the instructions for use of Fuji films: iCell GlutaNeurons. After 24 and 96 hours of incubation, half of the medium was replaced. 96 hours after seeding, NAT8L ASO was added directly to the growth medium from a 20-fold stock dilution in PBS to a final ASO concentration of either 1 μM, 5 μM, or 25 μM. Table A4 summarizes the most important parameters related to cell handling.

[0091] [Table 7]

[0092] After 96 hours of treatment with ASO, neurons were collected by gently aspirating the growth medium, and 125 μl of RLT buffer and RNA were extracted using RNeasy 96, QIA reduction HT kit (Qiagen #74171) according to the manufacturer's instructions for use, and eluted in 75 μl of water.

[0093] qPCR experiments were performed, and the data were calculated as described in Example 1. The expression level of NAT8L after ASO treatment (Table A5) is shown as the percentage of PBS-treated wells (%UTC).

[0094] As in Example 1, the concentration-response curve was generated using GraphPad prism software version 9 with the "log(inhibitor) vs. response -- variable slope (4 parameters)" function, using a fit constrained to a bottom greater than 0 and a top value of 100. The EC50 values ​​representing the half-effective concentration are shown in Table A5.

[0095] [Table 8]

[0096] In vitro activity evaluation of ASOs in HEK293 cells and iPSC-derived neurons showed favorable activity for all ASOs, resulting in a significant decrease in NAT8L mRNA.

[0097] Example 3: Off-target effects of selected gapmers in vitro We designed modified antisense oligonucleotides complementary to human NAT8L premRNA and tested their transcriptome-wide off-target effects in human neurons via non-auxiliary uptake. ASOs were tested at three different concentrations (1, 5, and 25 μM) and compared to a PBS-treated control in a series of experiments under conditions similar to those described in Example 2. For each concentration, typically, triple replicate tests were performed.

[0098] Libraries for RNA sequencing were prepared using standard polydT enrichment of isolated RNA, followed by mRNA fragmentation, strand-specific random priming cDNA synthesis, and adapter ligation. Adapter-specific PCR amplification, followed by paired-end read sequencing on an Illumina NovaSeq 6000, yielded approximately 70 million paired-end reads (2 × 150 bp) per sample (Eurofins Genomic).

[0099] Reads were trimmed and mapped to the human genome (built-in GRCh38) using the CLC Genomics workbench (version 23.0.5). Gene expression levels were estimated as the number of reads mapped to each gene divided by the gene length as TPM (transcripts per million).

[0100] For selected genes, concentration-response curves (CRCs) of RNA levels (as a percentage of PBS) after treatment with three different concentrations of ASO were analyzed using nonlinear least-squares fitting of a two-parameter logistic function (the fitting parameters were a combination of slope and the effective concentration at half benefit (EC50)).

[0101] Genes were selected for CRC analysis if (1) they showed a significant and at least 25% decrease in RNA levels between samples treated with PBS and samples treated with 25 μM ASO (by an empirical Bayesian-mediated t-statistic of less than 5% for the false detection rate FDR), (2) they showed a general concentration-dependent decrease with ASO treatment (by one-sided multiple regression analysis, treating with 0 (PBS), 1, 5, or 25 μM ASO concentrations as ordinal independent variables and controlling for less than 5% FDR from the t-statistic obtained for linear trends), and (3) they were not identified in (1) and (2) across multiple different ASOs with different nucleic acid base sequences.

[0102] The genes identified in 1 and 2 were determined to be significantly influenced by ASOs with different nucleic acid base sequences and were found to be involved in a general transcriptional program that responds to ASO processing in human neurons. The only exception is NAT8L, which is targeted by all ASOs.

[0103] As a result, genes for which CRC was fitted and EC50 was estimated were found only in individual ASOs or groups of ASOs with identical or nearly identical nucleic acid base sequences. Therefore, such genes may be off-target based on hybridization, or genes affected downstream that disrupt such off-target effects.

[0104] For each ASO, the EC50 ratio between potential off-target and on-target (NAT8L) effects was calculated, grouped, and counted, as shown in Table A6 below. The weaker the effect on off-target effects compared to on-target effects, the larger the EC50 ratio.

[0105] Table A6. Number of potential off-targets stratified by EC50 compared to NAT8L. Potential off-targets with EC50 values ​​less than 10 times weaker than NAT8L's EC50 are indicated in the "<10" column, and those with EC50 values ​​10 to 20 times weaker are indicated in the "10~20" column. [Table 9]

[0106] The number of unintended genes reduced varies by ASO ID. For ASO IDs 29_85, 29_75, 66_545, and 29_124, at least four off-target transcripts with EC50 less than 10-fold were identified, and these ASOs also had higher numbers in the other EC50 ratio ranges compared to ASO IDs 66_153, 66_124, 66_130, and 66_629, indicating that these ASOs are less selective. In contrast, ASO IDs 66_153, 66_124, 66_130, and 66_629 exhibit fewer off-target effects despite these ASOs possessing drug-suitable selectivity properties.

[0107] In vivo characterization of selected ASOs To test the potential acute toxicity, subacute tolerability, or pharmacodynamics of NAT8L-targeted ASOs in a humanized mouse model, mice were administered intraventricularly (ICV), and the above were measured as described in Examples 4, 5, and 6 below.

[0108] Example 4 - In vivo acute toxicity of ASO targeting NAT8L in mice.

[0109] Experimental Mice: The in vivo acute tolerability of antisense oligonucleotides was tested in mice using 5-6 mice per ASO group. 8-10 week old mice were housed in European IVC cage type IIL with TAPVEI aspen bedding (TapveiEATonis OU, Estonia). The cage was richly filled with nesting materials, wooden sticks, and camouflage materials. The light-phase cycle consisted of 12 hours of dark and 12 hours of light. The diet consisted of pelletized complete food (Altromin 1324, Brogaarden) and tap water. Food and water were administered freely.

[0110] The overall health status of all animals was examined daily. Any clinical signs or behavioral abnormalities were recorded. Humane endpoints and early termination: All animals showing clinical signs of moderate pain or moderate suffering, or any degree of suffering, were treated appropriately, such as discontinuing administration of the test substance or euthanizing the animals. In accordance with European and Dutch laws regarding experimental animals, animals showing clinical signs were humanely euthanized if the limits of the study-specific humane endpoints were exceeded.

[0111] Administration by ICV injection: Analgesia was administered at least 30 minutes before the start of administration. All animals received prophylactic pain treatment with Meloxicam (2 mg / kg SC). Mice were anesthetized with isoflurane.

[0112] For injection, a G23 needle was mounted on a stand and precisely penetrated 3.9 mm through the mouse's skull. A dose volume of 5 μL was injected over 30 seconds, and the animals were then returned to their cages and clinically observed according to the following instructions.

[0113] After administration, the animals were observed in detail. The evaluation was carried out according to a scoring system in which a score from 0 to 4 was assigned to five parameters, as shown in Table A7: activity level (increase or decrease in activity, respectively), motor function, posture / appearance, and muscle tremor / spasm.

[0114] Scoring was performed before administration and at 30 and 60 minutes after administration. A score of less than 6 indicates that ASO was immediately well-tolerated.

[0115] [Table 10]

[0116] Table A8 summarizes the mean neurobehavioral scores one hour after administration for 50 μg or 100 μg doses. Mice euthanized one hour prior to administration had a score of 20. As shown in Table A8 below, all ASOs tested for acute tolerability were well-tolerated.

[0117] [Table 11]

[0118] Example 5 - Subacute tolerability in mice. As a measure of tolerability, mice administered the ASO described in Example 4 via ICV were weighed twice a week. The weight gain relative to the day of administration (day 0) was calculated for each mouse, and the average value for each administration group was calculated to obtain tolerability indices for each ASO.

[0119] A single 50 μg dose of ASO ID 66_123 resulted in significant weight loss and euthanasia in mice two weeks after administration. This tolerability concern was clearly mitigated by ASO ID 66_124 and ASO ID 66_130, and as shown in Table A9, treatment with 50 μg of ASO ICV did not affect weight gain in mice up to 42 days after administration.

[0120] As shown in Table A9, a single 100 μg dose of ASO ID 66_153 and ASO ID 66_629 was well tolerated in mice after ICV administration, as evidenced by the significant weight gain observed up to day 28.

[0121] [Table 12]

[0122] Example 6 - Single-dose in vivo efficacy study in heterozygous humanized mice To evaluate the efficacy of a single dose, the most preferred ASO was administered via ICV to a mouse model containing a human version of the humanized mouse model NAT8L. In vivo efficacy in the CNS was evaluated by autopsy and brain tissue collection one week after administration.

[0123] Mice were administered and handled as described in Example 4. Seven days after administration, the mice were euthanized by cervical dislocation during necropsy. Brain tissue was sampled from the hippocampus and cortex, and the dissected tissue was rapidly frozen by immersion in liquid nitrogen in Precellys tubes (CK14, 2 mL, catalog number P000912-LYSK0-A). The tissue was stored at -80°C until RNA purification. On the RNA extraction day, tissue samples (30-80 mg) were homogenized in 280 μL of RLT buffer (Qiagen number: 79216) using a Precellys 24 tissue homogenizer. RNA was then extracted using TRIzol (ThermoFisher, catalog number 15596023) in combination with a Qia cube (Qiagen) for automated RNA extraction. After extraction, the RNA concentration was normalized to 2 ng / μl.

[0124] Diluted RNA was used as an input template for qPCR assays from Integrated DNA Technologies (IDT) using TaqPath® 1-Step RT-qPCR Master Mix, CG (ThermoFisher catalog number A15299), and Hs.PT.58.39061553 against human NAT8L and Ppia-Mm.PT.39a.2gs as an endogenous normalization factor. The qPCR reaction was performed in monolayer on a Quantstudio 6 qPCR machine (ThermoFisher).

[0125] The expression levels of human NAT8L were calculated using the ddCt method and normalized to the mean NAT8L expression level in mouse samples treated with physiological saline.

[0126] As shown in Table A10, a single 100 μg dose of ASO ID66_124, 66_130, 66_153, and 66_629 administered intracerebroventricularly resulted in a significant reduction in human NAT8L in the brain regions of humanized mice, specifically in the cortex and hippocampus, compared to mouse ppia as an endogenous control. Table A10: Human NAT8L mRNA levels after ASO treatment, expressed as a percentage of saline-treated mice (normalized to mouse ppia). [Table 13]

[0127] In summary, the examples showed that ASO IDs 66_124, 66_130, 66_153, and 66_629 effectively reduced human NAT8L mRNA in HEK cells and iPSC-derived neurons, bound to several off-target genes, and exhibited good activity, such as NAT8L knockdown across brain regions, as indicated by neurobehavioral scores and weight gain after a single ICV administration, and were well-tolerated acutely and subacutely. Therefore, ASO IDs 66_124, 66_130, 66_153, and 66_629 all possess pharmaceutical-suitable properties. ASO numbers 66_707 and 66_709 were shown to efficiently reduce human NAT8L mRNA in HEK cells. As they correspond in principle to ASO IDs 66_629 and 66_153, they are similarly expected to have low off-target effects. Furthermore, they are expected to be well-tolerated in vivo.

Claims

1. Antisense oligonucleotides selected from the following group: a) AlxAlxCdxAlxEmxTdxTdxTdxAdxEdxGdxTdxCdxTmxGlxTdxEmxTl (Sequence ID 3, ASO ID 66_707), b) TlxEmxTmxGdxTmxCdxTdxGdxTdxAdxTdxAdxTdxTdxEmoElxAl (Sequence ID 1, ASO ID 66_130), c) TlxElxUoxGdxTmxCdxTdxGdxTdxAdxTdxAdxTdxTdxCdxEmxAl (Sequence ID 2, ASO ID 66_124), and d) AmxAmxElxAmoEmxTdxTdxTdxAdxEdxGdxTdxCdxTmoGmxTlxEmxTm (Sequence ID 4, ASO ID 66_709), (In the formula, Adx represents 2'-deoxyadenosine-3'-phosphorothioate, Aox represents 2'-O-methyladenosine-3'-phosphorothioate, Amx represents 2'-O-methoxyethyladenosine-3'-phosphorothioate, Alx represents 2'-O-beta-D-oxyLNA adenosine-3'-phosphorothioate, Cdx represents 2'-deoxycytidine-3'-phosphorothioate, Cox represents 2'-O-methylcytidine-3'-phosphorothioate, Cmx represents 2'-O-methoxyethyl-5-methylcytidine-3'-phosphorothioate, Clx represents 2'-O-beta-D-oxyLNA-5-methylcytidine-3'-phosphorothioate, Edx represents 2'-deoxy-5-methylcytidine-3'-phosphorothioate, Emx represents 2'-O-methoxyethyl-5-methylcytidine-3'-phosphorothioate, Elx represents 2'-O-beta-D-oxyLNA-5-methylcytidine-3'-phosphorothioate, Gdx represents 2'-deoxyguanosine-3'-phosphorothioate, Gox represents 2'-O-methylguanosine-3'-phosphorothioate, Gmx represents 2'-O-methoxyethylguanosine-3'-phosphorothioate, Glx represents 2'-O-beta-D-oxy LNA guanosine-3'-phosphorothioate, Tdx represents 2'-deoxythymidine-3'-phosphorothioate, Tmx represents 2'-O-methoxyethylthymidine-3'-phosphorothioate, Tlx represents 2'-O-beta-D-oxyLNA thymidine-3'-phosphorothioate, Uox represents 2'-O-methyluridine-3'-phosphorothioate, Ado represents 2'-deoxyadenosine-3'-phosphate, Aoo represents 2'-O-methyladenosine-3'-phosphate, Amo represents 2'-O-methoxyethyladenosine-3'-phosphate, Alo represents 2'-O-beta-D-oxyLNA adenosine-3'-phosphate, Cdo represents 2'-deoxycytidine-3'-phosphate, Coo represents 2'-O-methylcytidine-3'-phosphate, Cmo represents 2'-O-methoxyethyl-5-methylcytidine-3'-phosphate, Edo represents 2'-deoxy-5-methylcytidine-3'-phosphate, Emo represents 2'-O-methoxyethyl-5-methylcytidine-3'-phosphate, Elo represents 2'-O-beta-D-oxyLNA-5-methylcytidine-3'-phosphate, Gdo represents 2'-deoxyguanosine-3'-phosphate, Goo represents 2'-O-methylguanosine-3'-phosphate, Gmo represents 2'-O-methoxyethylguanosine-3'-phosphate, Glo represents 2'-O-beta-D-oxy LNA guanosine-3'-phosphate, Tdo represents 2'-deoxythymidine-3'-phosphate, Tmo represents 2'-O-methoxyethylthymidine-3'-phosphate, Tlo represents 2'-O-beta-D-oxyLNA thymidine-3'-phosphate, Uoo represents 2'-O-methyluridine-3'-phosphate, Ad represents 2'-deoxyadenosine, Ace represents 2'-O-methyladenosine, Am represents 2'-O-methoxyethyladenosine, Al represents 2'-O-beta-D-oxyLNAadenosine, Cd represents 2'-deoxycytidine, Co represents 2'-O-methylcytidine, Ed represents 2'-deoxy-5-methylcytidine, Em represents 2'-O-methoxyethyl-5-methylcytidine, El represents 2'-O-beta-D-oxyLNA-5-methylcytidine, Gd represents 2'-deoxyguanosine, Go represents 2'-O-methylguanosine, Gm represents 2'-O-methoxyethylguanosine, Glu represents 2'-O-beta-D-oxyLNAguanosine, Td represents 2'-deoxythymidine, Tm represents 2'-O-methoxyethylthymidine, Tl represents 2'-O-beta-D-oxyLNAthymidine, Uo represents 2'-O-methyluridine.

2. Antisense oligonucleotides shown in Figure 1, Figure 2, Figure 3, or Figure 4.

3. A complex comprising an antisense oligonucleotide according to claim 1 or 2 and at least one complex portion covalently bonded to the antisense oligonucleotide.

4. A pharmaceutical composition comprising an antisense oligonucleotide according to claim 1 or 2, a complex according to any one of claim 3, and a pharmaceutically acceptable diluent, solvent, carrier, salt, and / or adjuvant.

5. An in vitro method for reducing NAT8L expression in host cells expressing NAT8L, the method comprising administering an effective amount of an antisense oligonucleotide according to claim 1 or 2, a complex according to claim 3, or a pharmaceutical composition according to claim 4 to the cells.

6. A method for treating Canavan disease, comprising administering a pharmaceutically effective amount of an antisense oligonucleotide according to claim 1 or 2, a complex according to claim 3, or a pharmaceutical composition according to claim 4.

7. An antisense oligonucleotide according to claim 1 or 2, a complex according to claim 3, or a pharmaceutical composition according to claim 4, for use in the treatment of Canavan disease.

8. Use of the antisense oligonucleotide according to claim 1 or 2, the complex according to claim 3, or the pharmaceutical composition according to claim 4 for the manufacture of a pharmaceutical for the treatment of Canavan disease.

Images