Methods for generating, stimulating, or increasing the proliferation of various subsets of CD8+ T cells.

Abstract

This specification describes the use of polychain chimeric polypeptides, and various subsets thereof, for the generation and / or stimulation and / or increased proliferation of CD8+ T cells. Furthermore, this specification describes pharmaceutical compositions comprising polychain chimeric polypeptides. In addition, kits comprising pharmaceutical compositions comprising the polychain chimeric polypeptides disclosed herein are also provided.

Description

[Technical Field]

[0001] Cross-reference of related applications This application claims priority under 35 U.S.C. § 119(e) to U.S. Provisional Patent Application No. 63 / 541,991, filed on 2 October 2023, and U.S. Provisional Patent Application No. 63 / 594,651, filed on 31 October 2023. The entirety of each of these disclosures is incorporated herein by reference.

[0002] Sequence listing reference This application includes a sequence listing submitted electronically as an XML file, the entirety of which is incorporated herein by reference. The XML file was created on 2 October 2024, is named "8774HCW-15.xml", and is 47,167 bytes in size.

[0003] This disclosure relates to the field of biotechnology, more specifically to antigen-binding molecules and CD8 + Regarding a subset of T cells. [Background technology]

[0004] Tissue factor (TF), a membrane-bound glycoprotein with a molecular weight of approximately 46 kDa and 263 amino acids, and a trigger protein in the extrinsic blood coagulation pathway, is the primary initiator of coagulation in vivo. Normally, tissue factor does not come into contact with circulating blood, but upon exposure to circulating coagulation serine protease factors, it initiates the coagulation cascade. Vascular damage exposes subendothelial cells expressing tissue factor, resulting in the formation of a calcium-dependent, high-affinity complex with existing plasma factor VIIa (FVIIa). Binding of serine protease FVIIa to tissue factor promotes the rapid degradation of FX to FXa and FIX to FIXa. The resulting FXa and the proteolytic activity on the active membrane surface then inefficiently convert small amounts of prothrombin into thrombin. The thrombin generated by FXa initiates platelet activation, activating trace amounts of pro-cofactors factor V (FV) and factor VIII (FVIII) to form the active cofactors factor Va (FVa) and factor VIIIa (FVIIIa). FIXa complexes with FVIIIa on the platelet surface to form an intrinsic pathway tenase complex, which leads to the rapid generation of FXa. FXa then complexes with FVa to form a prothrombinase complex on the activated platelet surface, which leads to the rapid degradation of prothrombin back into thrombin.

[0005] In addition to the tissue factor-FVIIa complex, recent studies have shown that the tissue factor-FVIIa-FXa complex can activate FVIII, which provides additional levels of FVIIIa during the initiation phase. This extrinsic pathway is crucial for initiating coagulation via limited thrombin activation, while the intrinsic pathway maintains coagulation through a dramatic amplification of initial signals.

[0006] Most of the tissue factor expressed on the cell surface is "encrypted" and needs to be "decrypted" for full participation in coagulation. The mechanism of "decryption" of cell surface tissue factor is still unclear at present, but exposure of anionic phospholipids plays an important role in this process. Healthy cells actively sequester anionic phospholipids such as phosphatidylserine (PS) in the inner leaflet inside the cell membrane. Upon cell damage, activation, or cytosolic Ca 2+ This bilayer asymmetry is lost after the level increases, resulting in increased PS exposure in the outer leaflet, which increases the specific activity of the tissue factor-FVIIa complex on the cell surface. PS exposure is known to decrease the apparent Km for activation of FIX and FX by the tissue factor-FVIIa complex, but additional mechanisms may include conformational rearrangement of tissue factor or tissue factor-FVIIa and subsequent exposure of the substrate binding site. Summary of the Invention Means for Solving the Problems

[0007] Provided herein are methods for increasing the proliferation of CD8 + T (Tpex) cells, effector memory CD8 + T (Tem) cells, central memory CD8 + T (Tcm) cells, memory stem CD8 + T (Tscm) cells, antigen-experienced CD8 + T cells, and late exhausted CD8 + T (Tex) cells, the method comprising, in vitro, increasing the proliferation of CD8 + T cells selected from the group consisting of these cells, the method comprising CD8 +The method involves contacting T cells with an effective amount of a polychain chimeric polypeptide comprising: (a) a first chimeric polypeptide comprising (i) a first target-binding domain; (ii) a soluble tissue factor domain; and (iii) a first domain of a pair of affinity domains; and (b) a second chimeric polypeptide comprising (i) a second domain of a pair of affinity domains; and (ii) a second target-binding domain, wherein the first and second chimeric polypeptides associate via binding of the first and second domains of a pair of affinity domains; and the first and second target-binding domains each comprise a soluble TGF-β receptor II (TGF-βRII).

[0008] Furthermore, this specification includes the preceding exhaustion CD8 + A method for increasing T(Tpex) cell proliferation in vitro is also provided, and this method involves precursor-exhausted CD8 + The method involves contacting T(Tpex) cells with an effective amount of a polychain chimeric polypeptide comprising: (a) a first chimeric polypeptide comprising (i) a first target-binding domain; (ii) a soluble tissue factor domain; and (iii) a first domain of a pair of affinity domains; and (b) a second chimeric polypeptide comprising (i) a second domain of a pair of affinity domains; and (ii) a second target-binding domain, wherein the first and second chimeric polypeptides associate via binding of the first and second domains of a pair of affinity domains; and the first and second target-binding domains each comprise a soluble TGF-β receptor II (TGF-βRII).

[0009] Furthermore, this specification includes Effector Memory CD8 + A method for increasing T(Tem) cell proliferation in vitro is also provided, and this method is used in Effector Memory CD8 +The method involves contacting T(Tem) cells with an effective amount of a polychain chimeric polypeptide comprising: (a) a first chimeric polypeptide comprising (i) a first target-binding domain; (ii) a soluble tissue factor domain; and (iii) a first domain of a pair of affinity domains; and (b) a second chimeric polypeptide comprising (i) a second domain of a pair of affinity domains; and (ii) a second target-binding domain, wherein the first and second chimeric polypeptides associate via binding of the first and second domains of a pair of affinity domains; and the first and second target-binding domains each comprise a soluble TGF-β receptor II (TGF-βRII).

[0010] Furthermore, this specification includes Central Memory CD8 + A method for increasing T(Tcm) cell proliferation in vitro is also provided, and this method is central memory CD8 + The method involves contacting T(Tcm) cells with an effective amount of a polychain chimeric polypeptide comprising: (a) a first chimeric polypeptide comprising (i) a first target-binding domain; (ii) a soluble tissue factor domain; and (iii) a first domain of a pair of affinity domains; and (b) a second chimeric polypeptide comprising (i) a second domain of a pair of affinity domains; and (ii) a second target-binding domain, wherein the first and second chimeric polypeptides associate via binding of the first and second domains of a pair of affinity domains; and the first and second target-binding domains each comprise a soluble TGF-β receptor II (TGF-βRII).

[0011] Furthermore, CD8 + A method for increasing the proliferation of T memory stem (Tscm) cells in vitro is also provided herein, and this method is CD8 +The method involves contacting T memory stem cells with an effective amount of a polychain chimeric polypeptide comprising: (a) a first chimeric polypeptide comprising (i) a first target-binding domain; (ii) a soluble tissue factor domain; and (iii) a first domain of a pair of affinity domains; and (b) a second chimeric polypeptide comprising (i) a second domain of a pair of affinity domains; and (ii) a second target-binding domain, wherein the first and second chimeric polypeptides associate via binding of the first and second domains of a pair of affinity domains; and the first and second target-binding domains each comprise a soluble TGF-β receptor II (TGF-βRII).

[0012] Furthermore, antigen-experienced CD8 + A method for increasing the proliferation of T cells in vitro is also provided herein, which is an antigen-experienced CD8 + The method involves contacting T cells with an effective amount of a polychain chimeric polypeptide comprising: (a) a first chimeric polypeptide comprising (i) a first target-binding domain; (ii) a soluble tissue factor domain; and (iii) a first domain of a pair of affinity domains; and (d) a second chimeric polypeptide comprising (i) a second domain of a pair of affinity domains; and (ii) a second target-binding domain, wherein the first and second chimeric polypeptides associate via binding of the first and second domains of a pair of affinity domains; and the first and second target-binding domains each comprise a soluble TGF-β receptor II (TGF-βRII).

[0013] Furthermore, the late-stage exhausted CD8 + A method for increasing T(Tex) cell proliferation in vitro is also provided herein, which is used for late-exhausted CD8 +The method involves contacting T cells with an effective amount of a polychain chimeric polypeptide comprising: (a) a first chimeric polypeptide comprising (i) a first target-binding domain; (ii) a soluble tissue factor domain; and (iii) a first domain of a pair of affinity domains; and (b) a second chimeric polypeptide comprising (i) a second domain of a pair of affinity domains; and (ii) a second target-binding domain, wherein the first and second chimeric polypeptides associate via binding of the first and second domains of a pair of affinity domains; and the first and second target-binding domains each comprise a soluble TGF-β receptor II (TGF-βRII).

[0014] This specification includes the precursor fatigue CD8 + A method for generating T(Tpex) cells in vitro is provided, and this method is CD8 + The method involves contacting T cells with an effective amount of a polychain chimeric polypeptide comprising: (a) a first chimeric polypeptide comprising (i) a first target-binding domain; (ii) a soluble tissue factor domain; and (iii) a first domain of a pair of affinity domains; and (b) a second chimeric polypeptide comprising (i) a second domain of a pair of affinity domains; and (ii) a second target-binding domain, wherein the first and second chimeric polypeptides associate via binding of the first and second domains of a pair of affinity domains; and the first and second target-binding domains each comprise a soluble TGF-β receptor II (TGF-βRII).

[0015] Furthermore, this specification includes the Effector Memory CD8 + A method for generating T(Tem) cells in vitro is also provided, and this method is CD8 +The method involves contacting T cells with an effective amount of a polychain chimeric polypeptide comprising: (a) a first chimeric polypeptide comprising (i) a first target-binding domain; (ii) a soluble tissue factor domain; and (iii) a first domain of a pair of affinity domains; and (b) a second chimeric polypeptide comprising (i) a second domain of a pair of affinity domains; and (ii) a second target-binding domain, wherein the first and second chimeric polypeptides associate via binding of the first and second domains of a pair of affinity domains; and the first and second target-binding domains each comprise a soluble TGF-β receptor II (TGF-βRII).

[0016] Furthermore, this specification includes Central Memory CD8 + A method for generating T(Tcm) cells in vitro is also provided, and this method is CD8 + The method involves contacting T cells with an effective amount of a polychain chimeric polypeptide comprising: (a) a first chimeric polypeptide comprising (i) a first target-binding domain; (ii) a soluble tissue factor domain; and (iii) a first domain of a pair of affinity domains; and (b) a second chimeric polypeptide comprising (i) a second domain of a pair of affinity domains; and (ii) a second target-binding domain, wherein the first and second chimeric polypeptides associate via binding of the first and second domains of a pair of affinity domains; and the first and second target-binding domains each comprise a soluble TGF-β receptor II (TGF-βRII).

[0017] Furthermore, CD8 + A method for generating T memory stem (Tscm) cells in vitro is also provided herein, and this method is CD8 +The method involves contacting T cells with an effective amount of a polychain chimeric polypeptide comprising: (a) a first chimeric polypeptide comprising (i) a first target-binding domain; (ii) a soluble tissue factor domain; and (iii) a first domain of a pair of affinity domains; and (b) a second chimeric polypeptide comprising (i) a second domain of a pair of affinity domains; and (ii) a second target-binding domain, wherein the first and second chimeric polypeptides associate via binding of the first and second domains of a pair of affinity domains; and the first and second target-binding domains each comprise a soluble TGF-β receptor II (TGF-βRII).

[0018] Furthermore, this specification includes virtual memory CD8 + A method for generating T(Tvm) cells in vitro is also provided, and this method is CD8 + The method involves contacting T cells with an effective amount of a polychain chimeric polypeptide comprising: (a) a first chimeric polypeptide comprising (i) a first target-binding domain; (ii) a soluble tissue factor domain; and (iii) a first domain of a pair of affinity domains; and (b) a second chimeric polypeptide comprising (i) a second domain of a pair of affinity domains; and (ii) a second target-binding domain, wherein the first and second chimeric polypeptides associate via binding of the first and second domains of a pair of affinity domains; and the first and second target-binding domains each comprise a soluble TGF-β receptor II (TGF-βRII).

[0019] Furthermore, antigen-experienced CD8 + A method for generating T cells in vitro is also provided herein, and this method is CD8 +The method involves contacting T cells with an effective amount of a polychain chimeric polypeptide comprising: (a) a first chimeric polypeptide comprising (i) a first target-binding domain; (ii) a soluble tissue factor domain; and (iii) a first domain of a pair of affinity domains; and (b) a second chimeric polypeptide comprising (i) a second domain of a pair of affinity domains; and (ii) a second target-binding domain, wherein the first and second chimeric polypeptides associate via binding of the first and second domains of a pair of affinity domains; and the first and second target-binding domains each comprise a soluble TGF-β receptor II (TGF-βRII).

[0020] Furthermore, the late-stage exhausted CD8 + A method for generating T cells in vitro is also provided herein, and this method is CD8 + The method involves contacting T cells with an effective amount of a polychain chimeric polypeptide comprising: (a) a first chimeric polypeptide comprising (i) a first target-binding domain; (ii) a soluble tissue factor domain; and (iii) a first domain of a pair of affinity domains; and (b) a second chimeric polypeptide comprising (i) a second domain of a pair of affinity domains; and (ii) a second target-binding domain, wherein the first and second chimeric polypeptides associate via binding of the first and second domains of a pair of affinity domains; and the first and second target-binding domains each comprise a soluble TGF-β receptor II (TGF-βRII).

[0021] Furthermore, this specification includes the preceding exhaustion CD8 + A method for stimulating T(Tpex) cells in vitro is also provided, and this method involves precursor-exhausted CD8 +The method involves contacting T(Tpex) cells with an effective amount of a polychain chimeric polypeptide comprising: (a) a first chimeric polypeptide comprising (i) a first target-binding domain; (ii) a soluble tissue factor domain; and (iii) a first domain of a pair of affinity domains; and (b) a second chimeric polypeptide comprising (i) a second domain of a pair of affinity domains; and (ii) a second target-binding domain, wherein the first and second chimeric polypeptides associate via binding of the first and second domains of a pair of affinity domains; and the first and second target-binding domains each comprise a soluble TGF-β receptor II (TGF-βRII).

[0022] Furthermore, this specification includes Effector Memory CD8 + A method for stimulating T(Tem) cells in vitro is also provided, and this method is used in Effector Memory CD8 + The method involves contacting T(Tem) cells with an effective amount of a polychain chimeric polypeptide comprising: (a) a first chimeric polypeptide comprising (i) a first target-binding domain; (ii) a soluble tissue factor domain; and (iii) a first domain of a pair of affinity domains; and (b) a second chimeric polypeptide comprising (i) a second domain of a pair of affinity domains; and (ii) a second target-binding domain, wherein the first and second chimeric polypeptides associate via binding of the first and second domains of a pair of affinity domains; and the first and second target-binding domains each comprise a soluble TGF-β receptor II (TGF-βRII).

[0023] Furthermore, this specification also includes Central Memory CD8 + A method for stimulating T(Tcm) cells in vitro is also provided, and this method is central memory CD8 +The method involves contacting T(Tcm) cells with an effective amount of a polychain chimeric polypeptide comprising: (a) a first chimeric polypeptide comprising (i) a first target-binding domain; (ii) a soluble tissue factor domain; and (iii) a first domain of a pair of affinity domains; and (b) a second chimeric polypeptide comprising (i) a second domain of a pair of affinity domains; and (ii) a second target-binding domain, wherein the first and second chimeric polypeptides associate via binding of the first and second domains of a pair of affinity domains; and the first and second target-binding domains each comprise a soluble TGF-β receptor II (TGF-βRII).

[0024] Furthermore, CD8 + A method for stimulating T memory stem (Tscm) cells in vitro is also provided herein, comprising contacting Tscm cells with an effective amount of a polychain chimeric polypeptide comprising: (a) a first chimeric polypeptide comprising (i) a first target-binding domain; (ii) a soluble tissue factor domain; and (iii) a first domain of a pair of affinity domains; and (b) a second chimeric polypeptide comprising (i) a second domain of a pair of affinity domains; and (ii) a second target-binding domain, wherein the first and second chimeric polypeptides associate via binding of the first and second domains of a pair of affinity domains; and the first and second target-binding domains each comprise a soluble TGF-β receptor II (TGF-βRII).

[0025] Furthermore, this specification includes virtual memory CD8 + A method for stimulating T(Tvm) cells in vitro is also provided, and this method utilizes virtual memory CD8 +The method involves contacting T(Tvm) cells with an effective amount of a polychain chimeric polypeptide comprising: (a) a first chimeric polypeptide comprising (i) a first target-binding domain; (ii) a soluble tissue factor domain; and (iii) a first domain of a pair of affinity domains; and (b) a second chimeric polypeptide comprising (i) a second domain of a pair of affinity domains; and (ii) a second target-binding domain, wherein the first and second chimeric polypeptides associate via binding of the first and second domains of a pair of affinity domains; and the first and second target-binding domains each comprise a soluble TGF-β receptor II (TGF-βRII).

[0026] Furthermore, antigen-experienced CD8 + A method for stimulating T cells in vitro is also provided herein, which involves antigen-experienced CD8 + The method involves contacting T cells with an effective amount of a polychain chimeric polypeptide comprising: (a) a first chimeric polypeptide comprising (i) a first target-binding domain; (ii) a soluble tissue factor domain; and (iii) a first domain of a pair of affinity domains; and (d) a second chimeric polypeptide comprising (i) a second domain of a pair of affinity domains; and (ii) a second target-binding domain, wherein the first and second chimeric polypeptides associate via binding of the first and second domains of a pair of affinity domains; and the first and second target-binding domains each comprise a soluble TGF-β receptor II (TGF-βRII).

[0027] Furthermore, the late-stage exhausted CD8 + A method for stimulating T cells (Tex) in vitro is also provided herein, which is a late-exhausted CD8 cell. +The method involves contacting T cells with an effective amount of a polychain chimeric polypeptide comprising: (a) a first chimeric polypeptide comprising (i) a first target-binding domain; (ii) a soluble tissue factor domain; and (iii) a first domain of a pair of affinity domains; and (b) a second chimeric polypeptide comprising (i) a second domain of a pair of affinity domains; and (ii) a second target-binding domain, wherein the first and second chimeric polypeptides associate via binding of the first and second domains of a pair of affinity domains; and the first and second target-binding domains each comprise a soluble TGF-β receptor II (TGF-βRII).

[0028] Furthermore, this specification includes virtual memory CD8 + A method for increasing T(Tvm) cell proliferation in vitro is also provided, and this method utilizes virtual memory CD8 + The method involves contacting T(Tvm) cells with an effective amount of a polychain chimeric polypeptide comprising: (a) a first chimeric polypeptide comprising (i) a first target-binding domain; (ii) a soluble tissue factor domain; and (iii) a first domain of a pair of affinity domains; and (b) a second chimeric polypeptide comprising (i) a second domain of a pair of affinity domains; and (ii) a second target-binding domain, wherein the first and second chimeric polypeptides associate via binding of the first and second domains of a pair of affinity domains; and the first and second target-binding domains each comprise a soluble TGF-β receptor II (TGF-βRII).

[0029] In some embodiments of the methods described herein, the method does not involve specific antigen stimulation.

[0030] In any few embodiments of the methods described herein, the first target-binding domain and the soluble tissue factor domain are in direct contact with each other in the first chimeric polypeptide.

[0031] In any few embodiments of the methods described herein, the first chimeric polypeptide further comprises a linker sequence between the first target-binding domain and the soluble tissue factor domain in the first chimeric polypeptide.

[0032] In any few embodiments of the methods described herein, the soluble tissue factor domain and the first domain of a pair of affinity domains are in direct contact with each other in the first chimeric polypeptide.

[0033] In any few embodiments of the methods described herein, the first chimeric polypeptide further comprises a linker sequence between the soluble tissue factor domain and the first domain of a pair of affinity domains in the first chimeric polypeptide.

[0034] In any few embodiments of the methods described herein, the second domain and the second target-binding domain of a pair of affinity domains are in direct contact with each other in the second chimeric polypeptide.

[0035] In any few embodiments of the methods described herein, the second chimeric polypeptide further comprises a linker sequence between the second domain and the second target-binding domain of a pair of affinity domains in the second chimeric polypeptide.

[0036] In some embodiments of the methods described herein, the first target-binding domain and the second target-binding domain specifically bind to the same antigen. In some embodiments of the methods described herein, the first target-binding domain and the second target-binding domain specifically bind to different antigens.

[0037] In any few embodiments of the methods described herein, one or both of the first target-binding domain and the second target-binding domain are antigen-binding domains.

[0038] In any few embodiments of the methods described herein, one or both of the first target-binding domain and the second target-binding domain are soluble TGF-β receptor II (TGF-βRII).

[0039] In any few embodiments of the methods described herein, the first target-binding domain and the second target-binding domain are soluble TGF-βRII.

[0040] In any few embodiments of the methods described herein, the first target-binding domain and the second target-binding domain each comprise a soluble TGF-β receptor II (TGF-βRII) having at least 90% identical amino acid sequence to SEQ ID NO: 5.

[0041] In any few embodiments of the methods described herein, the first chimeric polypeptide further comprises one or more additional target-binding domains.

[0042] In any few embodiments of the methods described herein, the second chimeric polypeptide further comprises one or more additional target-binding domains.

[0043] In any few embodiments of the methods described herein, the soluble tissue factor domain is a soluble human tissue factor domain. In one embodiment of any of the methods described herein, the soluble human tissue factor domain comprises a sequence that is at least 90% identical to Sequence ID No. 1.

[0044] In some embodiments of the methods described herein, the pair of affinity domains are a sushi domain (SEQ ID NO: 22) derived from the α-chain of the human IL-15 receptor (IL15Rα) and soluble IL-15 (SEQ ID NO: 24). In one embodiment, the first domain of the pair of affinity domains contains a sequence that is at least 90% identical to SEQ ID NO: 24. In another embodiment, the second domain of the pair of affinity domains contains a sequence that is at least 90% identical to SEQ ID NO: 22.

[0045] In any few embodiments of the methods described herein, the first chimeric polypeptide and / or the second chimeric polypeptide further comprises a signal sequence at its N-terminus.

[0046] In any several embodiments of the methods described herein, the first target-binding domain includes a first sequence that is at least 80% identical to SEQ ID NO: 2 and a second sequence that is at least 80% identical to SEQ ID NO: 2, wherein the first and second sequences are separated by a linker. In any several embodiments of the methods described herein, the first target-binding domain includes a first sequence that is at least 90% identical to SEQ ID NO: 2 and a second sequence that is at least 90% identical to SEQ ID NO: 2. In any several embodiments of the methods described herein, the first target-binding domain includes the first sequence of SEQ ID NO: 2 and the second sequence of SEQ ID NO: 2. In any several embodiments of the methods described herein, the linker includes the sequence of SEQ ID NO: 20.

[0047] In any several embodiments of the methods described herein, the first target-binding domain comprises a sequence that is at least 90% identical to sequence number 5.

[0048] In any several embodiments of the methods described herein, the first chimeric polypeptide comprises a sequence that is at least 80% identical to SEQ ID NO: 8. In any several embodiments of the methods described herein, the first chimeric polypeptide comprises a sequence that is at least 90% identical to SEQ ID NO: 8. In any several embodiments of the methods described herein, the first chimeric polypeptide comprises the sequence of SEQ ID NO: 8. In any several embodiments of the methods described herein, the first chimeric polypeptide comprises the sequence of SEQ ID NO: 10.

[0049] In any several embodiments of the methods described herein, the second target-binding domain includes a first sequence that is at least 80% identical to SEQ ID NO: 2 and a second sequence that is at least 80% identical to SEQ ID NO: 2, wherein the first and second sequences are separated by a linker. In any several embodiments of the methods described herein, the second target-binding domain includes a first sequence that is at least 90% identical to SEQ ID NO: 2 and a second sequence that is at least 90% identical to SEQ ID NO: 2. In any several embodiments of the methods described herein, the second target-binding domain includes the first sequence of SEQ ID NO: 2 and the second sequence of SEQ ID NO: 2. In any several embodiments of the methods described herein, the linker includes the sequence of SEQ ID NO: 20.

[0050] In any several embodiments of the methods described herein, the second target-binding domain comprises a sequence that is at least 90% identical to sequence number 5.

[0051] In any several embodiments of the methods described herein, the second chimeric polypeptide comprises a sequence that is at least 80% identical to SEQ ID NO: 12. In any several embodiments of the methods described herein, the second chimeric polypeptide comprises a sequence that is at least 90% identical to SEQ ID NO: 12. In any several embodiments of the methods described herein, the second chimeric polypeptide comprises the sequence of SEQ ID NO: 12. In any several embodiments of the methods described herein, the second chimeric polypeptide comprises the sequence of SEQ ID NO: 14.

[0052] In any several embodiments of the methods described herein, the polychain chimeric polypeptide comprises a first chimeric polypeptide comprising (i) a first target-binding domain; (ii) a soluble tissue factor domain comprising a sequence at least 90% identical to SEQ ID NO: 1; and (iii) a first domain of a pair of affinity domains comprising a sequence at least 90% identical to SEQ ID NO: 24; and a second chimeric polypeptide comprising (i) a second domain of a pair of affinity domains comprising a sequence at least 90% identical to SEQ ID NO: 22; and (ii) a second target-binding domain, wherein the first and second chimeric polypeptides associate via binding of the first and second domains of a pair of affinity domains; and each of the first and second target-binding domains comprises a soluble TGF-β receptor II (TGF-βRII) having an amino acid sequence at least 90% identical to SEQ ID NO: 5.

[0053] Furthermore, this specification provides a method for treating age-related diseases of a subject of interest, the method comprising administering to the subject (i) a therapeutically effective amount of a polychain chimeric polypeptide, (ii) T cells or CAR-T cells, and optionally (iii) an additional T cell stimulant, wherein the polychain chimeric polypeptide comprises: (a) a first chimeric polypeptide comprising (i) a first target-binding domain; (ii) a soluble tissue factor domain; and (iii) a first domain of a pair of affinity domains; and (b) a second chimeric polypeptide comprising (i) a second domain of a pair of affinity domains; and (ii) a second target-binding domain, wherein the first and second chimeric polypeptides associate via binding of the first and second domains of a pair of affinity domains; and the first and second target-binding domains each comprise a soluble TGF-β receptor II (TGF-βRII). In any several embodiments of the method described herein, the method comprises administering T cells. In any and all embodiments of the methods described herein, the method includes administering CAR-T cells. In any and all embodiments of the methods described herein, the method includes administering an additional T-cell stimulant.

[0054] This specification also provides a method for treating a target cancer of any desired nature, comprising administering to the subject (i) a therapeutically effective amount of a polychain chimeric polypeptide, (ii) T cells or CAR-T cells, and optionally (iii) an additional T cell stimulant, wherein the polychain chimeric polypeptide comprises: (a) a first chimeric polypeptide comprising (i) a first target-binding domain; (ii) a soluble tissue factor domain; and (iii) a first domain of a pair of affinity domains; and (b) a second chimeric polypeptide comprising (i) a second domain of a pair of affinity domains; and (ii) a second target-binding domain, wherein the first and second chimeric polypeptides associate via binding of the first and second domains of a pair of affinity domains; and the first and second target-binding domains each comprise a soluble TGF-β receptor II (TGF-βRII).

[0055] Furthermore, this specification also provides a pharmaceutical composition comprising a therapeutically effective amount of (i) a polychain chimeric polypeptide, (ii) T cells or CAR-T cells, and optionally (iii) a T cell stimulant, wherein the polychain chimeric polypeptide comprises: (a) a first chimeric polypeptide comprising (i) a first target-binding domain; (ii) a soluble tissue factor domain; and (iii) a first domain of a pair of affinity domains; and (b) a second chimeric polypeptide comprising (i) a second domain of a pair of affinity domains; and (ii) a second target-binding domain, wherein the first and second chimeric polypeptides associate via binding of the first and second domains of a pair of affinity domains; and the first and second target-binding domains each comprise a soluble TGF-β receptor II (TGF-βRII).

[0056] In any and all embodiments of the pharmaceutical compositions described herein, the pharmaceutical composition comprises T cells. In any and all embodiments of the pharmaceutical compositions described herein, the pharmaceutical composition comprises CAR-T cells. In any and all embodiments of the pharmaceutical compositions described herein, the pharmaceutical composition comprises an additional T cell stimulant.

[0057] The Specified Provision also provides a pharmaceutical composition comprising a therapeutically effective amount of a polychain chimeric polypeptide and a therapeutic antibody that specifically binds to a tumor antigen, wherein the polychain chimeric polypeptide comprises: (a) a first chimeric polypeptide comprising (i) a first target-binding domain; (ii) a soluble tissue factor domain; and (iii) a first domain of a pair of affinity domains; and (b) a second chimeric polypeptide comprising (i) a second domain of a pair of affinity domains; and (ii) a second target-binding domain, wherein the first chimeric polypeptide and the second chimeric polypeptide associate via binding of the first and second domains of a pair of affinity domains; and the first target-binding domain and the second target-binding domain each comprise a soluble TGF-β receptor II (TGF-βRII).

[0058] In any several embodiments of the pharmaceutical compositions described herein, the first target-binding domain and the soluble tissue factor domain are in direct contact with each other in the first chimeric polypeptide. In any several embodiments of the pharmaceutical compositions described herein, the first chimeric polypeptide further comprises a linker sequence between the first target-binding domain and the soluble tissue factor domain in the first chimeric polypeptide.

[0059] In any several embodiments of the pharmaceutical compositions described herein, the soluble tissue factor domain and the first domain of the pair of affinity domains are in direct contact with each other in the first chimeric polypeptide. In any several embodiments of the pharmaceutical compositions described herein, the first chimeric polypeptide further comprises a linker sequence between the soluble tissue factor domain and the first domain of the pair of affinity domains in the first chimeric polypeptide.

[0060] In any several embodiments of the pharmaceutical compositions described herein, the second domain of a pair of affinity domains and the second target-binding domain are in direct contact with each other in the second chimeric polypeptide. In any several embodiments of the pharmaceutical compositions described herein, the second chimeric polypeptide further comprises a linker sequence between the second domain of the pair of affinity domains and the second target-binding domain in the second chimeric polypeptide.

[0061] In any several embodiments of the pharmaceutical compositions described herein, the first target-binding domain and the second target-binding domain specifically bind to the same antigen. In any several embodiments of the pharmaceutical compositions described herein, the first target-binding domain and the second target-binding domain specifically bind to different antigens.

[0062] In some embodiments of the pharmaceutical compositions described herein, one or both of the first target-binding domain and the second target-binding domain are antigen-binding domains.

[0063] In any several embodiments of the pharmaceutical compositions described herein, one or both of the first target-binding domain and the second target-binding domain are soluble TGF-β receptor II (TGF-βRII).

[0064] In any few embodiments of the pharmaceutical compositions described herein, the first target-binding domain and the second target-binding domain each comprise a soluble TGF-β receptor II (TGF-βRII) having an amino acid sequence that is at least 90% identical to SEQ ID NO: 5.

[0065] In any few embodiments of the pharmaceutical compositions described herein, the first chimeric polypeptide further comprises one or more additional target-binding domains. In any few embodiments of the pharmaceutical compositions described herein, the second chimeric polypeptide further comprises one or more additional target-binding domains.

[0066] In some embodiments of the pharmaceutical compositions described herein, the soluble tissue factor domain is a soluble human tissue factor domain. In some embodiments of the pharmaceutical compositions described herein, the soluble human tissue factor domain comprises a sequence that is at least 90% identical to Sequence ID No. 1.

[0067] In some embodiments of the pharmaceutical compositions described herein, the pair of affinity domains are a sushi domain (SEQ ID NO: 22) derived from the α-chain of the human IL-15 receptor (IL15Rα) and soluble IL-15 (SEQ ID NO: 24). In one embodiment, the first domain of the pair of affinity domains contains a sequence that is at least 90% identical to SEQ ID NO: 24. In another embodiment, the second domain of the pair of affinity domains contains a sequence that is at least 90% identical to SEQ ID NO: 22.

[0068] In any few embodiments of the pharmaceutical compositions described herein, the first chimeric polypeptide and / or the second chimeric polypeptide further comprises a signal sequence at its N-terminal end.

[0069] In any several embodiments of the pharmaceutical compositions described herein, the first target-binding domain comprises a first sequence that is at least 80% identical to SEQ ID NO: 2 and a second sequence that is at least 80% identical to SEQ ID NO: 2, wherein the first and second sequences are separated by a linker. In any several embodiments of the pharmaceutical compositions described herein, the first target-binding domain comprises a first sequence that is at least 90% identical to SEQ ID NO: 2 and a second sequence that is at least 90% identical to SEQ ID NO: 2. In any several embodiments of the pharmaceutical compositions described herein, the first target-binding domain comprises the first sequence of SEQ ID NO: 2 and the second sequence of SEQ ID NO: 2. In any several embodiments of the pharmaceutical compositions described herein, the linker comprises the sequence of SEQ ID NO: 20.

[0070] In any several embodiments of the pharmaceutical compositions described herein, the first target-binding domain comprises a sequence that is at least 90% identical to sequence number 5.

[0071] In any and all embodiments of the pharmaceutical compositions described herein, the first chimeric polypeptide comprises a sequence that is at least 80% identical to SEQ ID NO: 8. In any and all embodiments of the pharmaceutical compositions described herein, the first chimeric polypeptide comprises a sequence that is at least 90% identical to SEQ ID NO: 8. In any and all embodiments of the pharmaceutical compositions described herein, the first chimeric polypeptide comprises the sequence of SEQ ID NO: 8. In any and all embodiments of the pharmaceutical compositions described herein, the first chimeric polypeptide comprises the sequence of SEQ ID NO: 10.

[0072] In any several embodiments of the compositions described herein, the second target-binding domain comprises a sequence that is at least 90% identical to sequence number 5.

[0073] In any and all embodiments of the compositions described herein, the second chimeric polypeptide comprises a sequence that is at least 80% identical to SEQ ID NO: 12. In any and all embodiments of the compositions described herein, the second chimeric polypeptide comprises a sequence that is at least 90% identical to SEQ ID NO: 12. In any and all embodiments of the compositions described herein, the second chimeric polypeptide comprises the sequence of SEQ ID NO: 12. In any and all embodiments of the compositions described herein, the second chimeric polypeptide comprises the sequence of SEQ ID NO: 14.

[0074] In any few embodiments of the pharmaceutical compositions described herein, the polychain chimeric polypeptide comprises a first chimeric polypeptide comprising (i) a first target-binding domain; (ii) a soluble tissue factor domain comprising a sequence at least 90% identical to SEQ ID NO: 1; and (iii) a first domain of a pair of affinity domains comprising a sequence at least 90% identical to SEQ ID NO: 24; and a second chimeric polypeptide comprising (i) a second domain of a pair of affinity domains comprising a sequence at least 90% identical to SEQ ID NO: 22; and (ii) a second target-binding domain, wherein the first and second chimeric polypeptides associate via the binding of the first and second domains of a pair of affinity domains; and the first and second target-binding domains each comprise a soluble TGF-β receptor II (TGF-βRII) having an amino acid sequence at least 90% identical to SEQ ID NO: 5.

[0075] Furthermore, kits containing any of the pharmaceutical compositions described herein are also provided.

[0076] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art to which the invention pertains. While this specification describes methods and materials for use in the invention, other suitable methods and materials known in the art may also be used. Materials, methods, and examples are illustrative and not intended to limit the invention. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In the event of any conflict, including definitions, this specification shall prevail.

[0077] Other features and advantages of the present invention will become apparent from the following detailed description and drawings, as well as from the claims. [Brief explanation of the drawing]

[0078] [Figure 1] Polychain chimeric polypeptides: Exemplary schematic diagrams are shown of a first chimeric polypeptide comprising (i) a first target-binding domain (A), a soluble tissue factor domain, a first domain of a pair of affinity domains (soluble interleukin IL-15), and an additional target-binding domain (B); and (ii) a second chimeric polypeptide comprising a second domain of a pair of affinity domains (IL-15 receptor αsushi domain), a second target-binding domain (C), and an additional antigen-binding domain (D). The upper schematic diagram illustrates the binding of the first and second chimeric polypeptides via a pair of affinity domains. The lower schematic diagram shows the order of domains in the first and second chimeric polypeptides. [Figure 2]Polychain chimeric polypeptides: (i) a first chimeric polypeptide comprising a first target-binding domain (A), a soluble tissue factor domain containing five amino acid substitutions to remove the binding of the soluble tissue factor domain to FVIIa, a first domain of a pair of affinity domains (soluble interleukin IL-15 containing D8N or D8A amino acid substitutions), and an additional target-binding domain (B); and (ii) a second chimeric polypeptide comprising a second domain of a pair of affinity domains (IL-15 receptor αsushi domain), a second target-binding domain (C), and an additional antigen-binding domain (D). Exemplary schematic diagrams are shown. The upper schematic diagram depicts the binding of the first and second chimeric polypeptides via the pair of affinity domains. The lower schematic diagram shows the order of the domains in the first and second chimeric polypeptides. In any other embodiment of the polychain chimeric polypeptides described herein, the soluble tissue factor domain may comprise or consist of a soluble wild-type human tissue factor domain (containing or consisting of a continuous sequence within wild-type human tissue factor). [Figure 3] A schematic diagram of the TGFRt15-TGFRs structure is shown. [Figure 4] A schematic diagram of the additional TGFRt15-TGFRs structure is shown. [Figure 5] The results of TGFβ1 inhibition by TGFRt15-TGFRs and TGFR-Fc are shown. [Figure 6] The results of a 32Dβ cell proliferation assay using TGFRt15-TGFRs or recombinant IL-15 are shown. [Figure 7A] The results of detecting IL-15 and TGFβRII in TGFRt15-TGFRs using the ELISA method with the corresponding antibodies are shown. [Figure 7B] This is a continuation of Figure 7A. [Figure 8] This line graph shows the chromatographic profile of the culture supernatant of TGFRt15-TGFRs protein-containing cells after binding to and elution from the anti-TF antibody resin. [Figure 9] The SEC profile of TGFRt15-TGFRs is shown. [Figure 10] The TGFRt15-TGFRs before and after deglycosylation, as analyzed by reduced SDS-PAGE, are shown. [Figure 11A] Figure 11A shows the spleen weight and percentage of immune cell types in TGFRt15-TGFRs-treated mice and control mice. Figure 11B shows the spleen weight of TGFRt15-TGFRs-treated mice compared to PBS controls. Figure 11B shows the percentage of CD4+ T cells, CD8+ T cells, and NK cells in TGFRt15-TGFRs-treated mice compared to PBS controls. [Figure 11B] This is a continuation of Figure 11A. [Figure 12A] Figure 12A shows spleen weight and immune stimulation over 92 hours in mice treated with TGFRt15-TGFRs. Figure 12B shows the percentage of immune cells in mice treated with TGFRt15-TGFRs at 16, 24, 48, 72, and 92 hours post-treatment. [Figure 12B] This is a continuation of Figure 12A. [Figure 13A] This shows the time course of Ki67 and granzyme B expression in mice treated with TGFRt15-TGFRs. [Figure 13B] This is a continuation of Figure 13A. [Figure 14] This demonstrates the enhancement of splenic cell cytotoxicity by TGFRt15-TGFRs in C57BL / 6 mice. [Figure 15-1] Figure 15A shows an exemplary schematic diagram of the elimination of treatment-induced senescent cancer cells (TIS) in a mouse model. Figure 15B shows flow cytometry analysis of tumor cells, which reveals that immunotherapy-treated mice exhibit fewer GFP-positive treatment-induced senescent cancer cells compared to the PBS control group, as assessed by fluorescence microscopy. [Figure 15-2]Figure 15C shows that mice treated with immunotherapy exhibited fewer GFP-positive senescent tumor cells compared to the PBS control group. Tumors were collected 18 days after tumor inoculation, and tumor-infiltrating NK+ cells and CD8+ T cells were quantified by flow cytometry. [Figure 16] Figure 16A shows an exemplary schematic diagram for reducing senescent β-cells and senescence-associated phenotype (SASP) markers in a mouse model. Figure 16B shows multispectral imaging of pancreatic tissue sections from db / db mice treated with PBS (control) or TGFRt15-TGFRs (HCW9218). Representative islets are shown, and insulin-plus islet β-cells such as OPAL-520 and insulin-plus p21-plus β-cells such as OPAL-570 (appearing as white cells in the grayscale image) were reduced in the TGRt15-TGFR (HCW9218) treated group compared to the PBS treated group. [Figure 17] This shows the gene expression levels of Cdkn1a, IL1-β, and PAI-1 in the liver of aged mice treated with a single or double dose of TGFRt15-TGFRs (HCW9218). [Figure 18] This shows a series of graphs illustrating the enhanced cytotoxicity of CD8+ T cells after treatment with TGFRt15-TGFRs (HCW9218). [Figure 19-1] Figures 19A and 19B show purified CD8+ T cells stimulated in culture medium or TGFRt15-TGFRs (HCW9218) (1 μM) for 96 hours. Cells were harvested and stained. Gating strategies: CD3+CD8+ --- CD45RA+CD27+--PAN-KIR+NKG2A+ or PAN-KIR-NKG2A-CD45RA+CD27+. [Figure 19-2] Figure 19C shows CD8+ T cells from young and elderly donors stimulated overnight in culture medium or TGFRt15-TGFRs (HCW9218). The following morning, the cells were stimulated with HCW anti-CD3 for 6 hours and stained. Gating strategy: CD3+CD8+ --- CD8+NKG2A+--NKG2A+IFN-γ. [Figure 20]The study has shown that TGFRt15-TGFRs (HCW9218) enhance the spontaneous killing capacity of human CD8+ T cells in aged donors. [Figure 21A] A schematic diagram illustrating the results of subcutaneous injection of 0.5 × 10⁶ B16F10 melanoma tumor cells into 6-week-old C57Bl6 / j mice, followed by a single subcutaneous administration of 3 mg / kg of TGFRt15-TGFRs (HCW9218) 10 days later. [Figure 21B] The images show the in vivo distribution of TGFRt15-TGFRs (HCW9218) in mouse lymphoid and tumor tissue (top left), the decrease in TGF-β1 levels in tumors mediated by TGFRt15-TGFRs (HCW9218) (top right), and the increase in IL-2 (bottom left) and IL-12 (bottom right) levels in tumors mediated by TGFRt15-TGFRs (HCW9218). [Figure 21C] This shows the absolute number and proliferation (based on Ki67) of CD8+ T cell subsets in the inflow area lymph nodes of mice. [Figure 21D] This shows chemokine receptor expression in apoptosis lymph nodes and in a subset of CD8+ T cells in the blood of mice. [Figure 21E] This shows the absolute number of various CD8+ T cell subsets in mouse tumors. [Modes for carrying out the invention]

[0079] This specification includes the precursor fatigue CD8 + T(Tpex) cells, Effector Memory CD8 + T(Tem) cells, central memory CD8 + T (Tcm) cells, memory stem CD8 + T(Tscm) cells, virtual memory CD8 + T(Tvm) cells, antigen-experienced CD8 + T cells and / or late-exhausted CD8 + A method for generating T(Tex) cells in vitro is provided, and this method is CD8 +The method involves contacting T cells with an effective amount of a polychain chimeric polypeptide comprising: (a) a first chimeric polypeptide comprising (i) a first target-binding domain; (ii) a soluble tissue factor domain; and (iii) a first domain of a pair of affinity domains; and (b) a second chimeric polypeptide comprising (i) a second domain of a pair of affinity domains; and (ii) a second target-binding domain, wherein the first chimeric polypeptide and the second chimeric polypeptide associate via binding of the first and second domains of a pair of affinity domains; the first target-binding domain specifically binds to a ligand of TGF-β receptor II (TGF-βRII); the second target-binding domain specifically binds to a ligand of TGF-βRII; or the first target-binding domain and the second target-binding domain each contain soluble TGF-β receptor II (TGF-βRII) having at least 90% identical amino acid sequences to Sequence ID No. 5.

[0080] Furthermore, this specification includes the preceding exhaustion CD8 + A method for stimulating T(Tpex) cells in vitro is also provided, and this method involves precursor-exhausted CD8 + The method involves contacting T(Tpex) cells with an effective amount of a polychain chimeric polypeptide comprising: (a) a first chimeric polypeptide comprising (i) a first target-binding domain; (ii) a soluble tissue factor domain; and (iii) a first domain of a pair of affinity domains; and (b) a second chimeric polypeptide comprising (i) a second domain of a pair of affinity domains; and (ii) a second target-binding domain, wherein the first and second chimeric polypeptides associate via binding of the first and second domains of a pair of affinity domains; the first target-binding domain specifically binds to a ligand of TGF-β receptor II (TGF-βRII); the second target-binding domain specifically binds to a ligand of TGF-βRII; or the first and second target-binding domains each contain soluble TGF-β receptor II (TGF-βRII) having at least 90% identical amino acid sequences to SEQ ID NO: 5.

[0081] Furthermore, this specification includes the Effector Memory CD8 + A method for stimulating T(Tem) cells in vitro is also provided, and this method is used in Effector Memory CD8 + The method involves contacting T(Tem) cells with an effective amount of a polychain chimeric polypeptide comprising: (a) a first chimeric polypeptide comprising (i) a first target-binding domain; (ii) a soluble tissue factor domain; and (iii) a first domain of a pair of affinity domains; and (b) a second chimeric polypeptide comprising (i) a second domain of a pair of affinity domains; and (ii) a second target-binding domain, wherein the first and second chimeric polypeptides associate via binding of the first and second domains of a pair of affinity domains; the first target-binding domain specifically binds to a ligand of TGF-β receptor II (TGF-βRII); the second target-binding domain specifically binds to a ligand of TGF-βRII; or the first and second target-binding domains each contain soluble TGF-β receptor II (TGF-βRII) having at least 90% identical amino acid sequences to SEQ ID NO: 5.

[0082] Furthermore, this specification includes Central Memory CD8 + A method for stimulating T(Tcm) cells in vitro is also provided, and this method is central memory CD8 +The method involves contacting T(Tcm) cells with an effective amount of a polychain chimeric polypeptide comprising: (a) a first chimeric polypeptide comprising (i) a first target-binding domain; (ii) a soluble tissue factor domain; and (iii) a first domain of a pair of affinity domains; and (b) a second chimeric polypeptide comprising (i) a second domain of a pair of affinity domains; and (ii) a second target-binding domain, wherein the first and second chimeric polypeptides associate via binding of the first and second domains of a pair of affinity domains; the first target-binding domain specifically binds to a ligand of TGF-β receptor II (TGF-βRII); the second target-binding domain specifically binds to a ligand of TGF-βRII; or the first and second target-binding domains each contain soluble TGF-β receptor II (TGF-βRII) having at least 90% identical amino acid sequences to Sequence ID No. 5.

[0083] Furthermore, this specification includes the memory trunk CD8 + A method for stimulating T(Tscm) cells in vitro is also provided, and this method involves memory stem CD8 + The method involves contacting T(Tscm) cells with an effective amount of a polychain chimeric polypeptide comprising: (a) a first chimeric polypeptide comprising (i) a first target-binding domain; (ii) a soluble tissue factor domain; and (iii) a first domain of a pair of affinity domains; and (b) a second chimeric polypeptide comprising (i) a second domain of a pair of affinity domains; and (ii) a second target-binding domain, wherein the first and second chimeric polypeptides associate via binding of the first and second domains of a pair of affinity domains; the first target-binding domain specifically binds to a ligand of TGF-β receptor II (TGF-βRII); the second target-binding domain specifically binds to a ligand of TGF-βRII; or the first and second target-binding domains each contain soluble TGF-β receptor II (TGF-βRII) having at least 90% identical amino acid sequences to SEQ ID NO: 5.

[0084] Furthermore, this specification includes virtual memory CD8 + A method for stimulating T(Tvm) cells in vitro is also provided, and this method utilizes virtual memory CD8 + The method involves contacting T(Tvm) cells with an effective amount of a polychain chimeric polypeptide comprising: (a) a first chimeric polypeptide comprising (i) a first target-binding domain; (ii) a soluble tissue factor domain; and (iii) a first domain of a pair of affinity domains; and (b) a second chimeric polypeptide comprising (i) a second domain of a pair of affinity domains; and (ii) a second target-binding domain, wherein the first and second chimeric polypeptides associate via binding of the first and second domains of a pair of affinity domains; the first target-binding domain specifically binds to a ligand of TGF-β receptor II (TGF-βRII); the second target-binding domain specifically binds to a ligand of TGF-βRII; or the first and second target-binding domains each contain soluble TGF-β receptor II (TGF-βRII) having at least 90% identical amino acid sequences to Sequence ID No. 5.

[0085] Furthermore, this specification includes information on antigen-experienced CD8 + A method for stimulating T cells in vitro is also provided, and this method involves antigen-experienced CD8 +The method involves contacting T cells with an effective amount of a polychain chimeric polypeptide comprising: (a) a first chimeric polypeptide comprising (i) a first target-binding domain; (ii) a soluble tissue factor domain; and (iii) a first domain of a pair of affinity domains; and (b) a second chimeric polypeptide comprising (i) a second domain of a pair of affinity domains; and (ii) a second target-binding domain, wherein the first chimeric polypeptide and the second chimeric polypeptide associate via binding of the first and second domains of a pair of affinity domains; the first target-binding domain specifically binds to a ligand of TGF-β receptor II (TGF-βRII); the second target-binding domain specifically binds to a ligand of TGF-βRII; or the first target-binding domain and the second target-binding domain each contain soluble TGF-β receptor II (TGF-βRII) having at least 90% identical amino acid sequences to Sequence ID No. 5.

[0086] Furthermore, this specification includes late-stage exhausted CD8 + A method for stimulating T(Tex) cells in vitro is also provided, and this method is used for late-exhausted CD8 + The method involves contacting T(Tex cells) with an effective amount of a polychain chimeric polypeptide comprising: (a) a first chimeric polypeptide comprising (i) a first target-binding domain; (ii) a soluble tissue factor domain; and (iii) a first domain of a pair of affinity domains; and (b) a second chimeric polypeptide comprising (i) a second domain of a pair of affinity domains; and (ii) a second target-binding domain, wherein the first and second chimeric polypeptides associate via binding of the first and second domains of a pair of affinity domains; the first target-binding domain specifically binds to a ligand of TGF-β receptor II (TGF-βRII); the second target-binding domain specifically binds to a ligand of TGF-βRII; or the first and second target-binding domains each contain soluble TGF-β receptor II (TGF-βRII) having at least 90% identical amino acid sequences to Sequence ID No. 5.

[0087] Furthermore, this specification includes information on the pre-exhaustion CD8 + A method for increasing T(Tpex) cell proliferation in vitro is also provided, and this method involves precursor-exhausted CD8 + The method involves contacting T(Tpex) cells with an effective amount of a polychain chimeric polypeptide comprising: (a) a first chimeric polypeptide comprising (i) a first target-binding domain; (ii) a soluble tissue factor domain; and (iii) a first domain of a pair of affinity domains; and (b) a second chimeric polypeptide comprising (i) a second domain of a pair of affinity domains; and (ii) a second target-binding domain, wherein the first and second chimeric polypeptides associate via binding of the first and second domains of a pair of affinity domains; the first target-binding domain specifically binds to a ligand of TGF-β receptor II (TGF-βRII); the second target-binding domain specifically binds to a ligand of TGF-βRII; or the first and second target-binding domains each contain soluble TGF-β receptor II (TGF-βRII) having at least 90% identical amino acid sequences to SEQ ID NO: 5.

[0088] Furthermore, this specification includes the Effector Memory CD8 + A method for increasing T(Tem) cell proliferation in vitro is also provided, and this method is used in Effector Memory CD8 +The method involves contacting T(Tem) cells with an effective amount of a polychain chimeric polypeptide comprising: (a) a first chimeric polypeptide comprising (i) a first target-binding domain; (ii) a soluble tissue factor domain; and (iii) a first domain of a pair of affinity domains; and (b) a second chimeric polypeptide comprising (i) a second domain of a pair of affinity domains; and (ii) a second target-binding domain, wherein the first and second chimeric polypeptides associate via binding of the first and second domains of a pair of affinity domains; the first target-binding domain specifically binds to a ligand of TGF-β receptor II (TGF-βRII); the second target-binding domain specifically binds to a ligand of TGF-βRII; or the first and second target-binding domains each contain soluble TGF-β receptor II (TGF-βRII) having at least 90% identical amino acid sequences to SEQ ID NO: 5.

[0089] Furthermore, this specification includes Central Memory CD8 + A method for increasing T(Tcm) cell proliferation in vitro is also provided, and this method is central memory CD8 + The method involves contacting T(Tcm) cells with an effective amount of a polychain chimeric polypeptide comprising: (a) a first chimeric polypeptide comprising (i) a first target-binding domain; (ii) a soluble tissue factor domain; and (iii) a first domain of a pair of affinity domains; and (b) a second chimeric polypeptide comprising (i) a second domain of a pair of affinity domains; and (ii) a second target-binding domain, wherein the first and second chimeric polypeptides associate via binding of the first and second domains of a pair of affinity domains; the first target-binding domain specifically binds to a ligand of TGF-β receptor II (TGF-βRII); the second target-binding domain specifically binds to a ligand of TGF-βRII; or the first and second target-binding domains each contain soluble TGF-β receptor II (TGF-βRII) having at least 90% identical amino acid sequences to Sequence ID No. 5.

[0090] Furthermore, this specification includes the memory trunk CD8 + A method for increasing T(Tscm) cell proliferation in vitro is also provided, and this method is used for memory stem CD8 + The method involves contacting T(Tscm) cells with an effective amount of a polychain chimeric polypeptide comprising: (a) a first chimeric polypeptide comprising (i) a first target-binding domain; (ii) a soluble tissue factor domain; and (iii) a first domain of a pair of affinity domains; and (b) a second chimeric polypeptide comprising (i) a second domain of a pair of affinity domains; and (ii) a second target-binding domain, wherein the first and second chimeric polypeptides associate via binding of the first and second domains of a pair of affinity domains; the first target-binding domain specifically binds to a ligand of TGF-β receptor II (TGF-βRII); the second target-binding domain specifically binds to a ligand of TGF-βRII; or the first and second target-binding domains each contain soluble TGF-β receptor II (TGF-βRII) having at least 90% identical amino acid sequences to SEQ ID NO: 5.

[0091] Furthermore, this specification includes virtual memory CD8 + A method for increasing T(Tvm) cell proliferation in vitro is also provided, and this method utilizes virtual memory CD8 +The method involves contacting T(Tvm) cells with an effective amount of a polychain chimeric polypeptide comprising: (a) a first chimeric polypeptide comprising (i) a first target-binding domain; (ii) a soluble tissue factor domain; and (iii) a first domain of a pair of affinity domains; and (b) a second chimeric polypeptide comprising (i) a second domain of a pair of affinity domains; and (ii) a second target-binding domain, wherein the first and second chimeric polypeptides associate via binding of the first and second domains of a pair of affinity domains; the first target-binding domain specifically binds to a ligand of TGF-β receptor II (TGF-βRII); the second target-binding domain specifically binds to a ligand of TGF-βRII; or the first and second target-binding domains each contain soluble TGF-β receptor II (TGF-βRII) having at least 90% identical amino acid sequences to Sequence ID No. 5.

[0092] Furthermore, this specification includes information on antigen-experienced CD8 + A method for increasing T cell proliferation in vitro is also provided, comprising contacting antigen-experienced CD8+ T cells with an effective amount of a multi-chain chimeric polypeptide comprising: (a) a first chimeric polypeptide comprising (i) a first target-binding domain; (ii) a soluble tissue factor domain; and (iii) a first domain of a pair of affinity domains; and (b) a second chimeric polypeptide comprising (i) a second domain of a pair of affinity domains; and (ii) a second target-binding domain, wherein the first and second chimeric polypeptides associate via binding of the first and second domains of a pair of affinity domains; the first target-binding domain specifically binds to a ligand of TGF-β receptor II (TGF-βRII); the second target-binding domain specifically binds to a ligand of TGF-βRII; or the first and second target-binding domains each contain soluble TGF-β receptor II (TGF-βRII) having at least 90% identical amino acid sequences to SEQ ID NO: 5.

[0093] Furthermore, this specification includes late-stage exhausted CD8+ A method is also provided for in vitro increasing the proliferation of T(Tex cells), the method comprising contacting late exhausted CD8+ T cells with an effective amount of a polychain chimeric polypeptide comprising: (a) a first chimeric polypeptide comprising (i) a first target-binding domain; (ii) a soluble tissue factor domain; and (iii) a pair of affinity domains; and (b) a second chimeric polypeptide comprising (i) a pair of affinity domains; and (ii) a second target-binding domain, where the first chimeric polypeptide The polypeptide and the second chimeric polypeptide associate via binding of the first and second domains of a pair of affinity domains; the first target-binding domain specifically binds to the ligand of TGF-β receptor II (TGF-βRII), the second target-binding domain specifically binds to the ligand of TGF-βRII, or the first and second target-binding domains each contain soluble TGF-β receptor II (TGF-βRII) having at least 90% identical amino acid sequences to SEQ ID NO: 5.

[0094] Furthermore, this specification also includes a method for treating age-related diseases of a target subject as needed, the method comprising administering to the subject (i) a therapeutically effective amount of a polychain chimeric polypeptide and (ii) T cells or CAR-T cells, and optionally (iii) an additional T cell stimulant, wherein the polychain chimeric polypeptide comprises: (a) a first chimeric polypeptide comprising (i) a first target-binding domain; (ii) a soluble tissue factor domain; and (iii) a pair of affinity domains; and (b) a second domain comprising (i) a pair of affinity domains; and (ii) a second target-binding domain. The first chimeric polypeptide and the second chimeric polypeptide associate via binding of a pair of affinity domains; the first target-binding domain specifically binds to a ligand of TGF-β receptor II (TGF-βRII); the second target-binding domain specifically binds to a ligand of TGF-βRII; or the first target-binding domain and the second target-binding domain each contain soluble TGF-β receptor II (TGF-βRII) having at least 90% identical amino acid sequences to SEQ ID NO: 5.

[0095] Furthermore, this specification also includes a method for treating a target cancer as needed, the method comprising administering to the target (i) a therapeutically effective amount of a polychain chimeric polypeptide and (ii) T cells or CAR-T cells, and optionally (iii) an additional T cell stimulant, wherein the polychain chimeric polypeptide comprises: (a) a first chimeric polypeptide comprising a first domain of (i) a first target-binding domain; (ii) a soluble tissue factor domain; and (iii) a pair of affinity domains; and (b) a second domain comprising (i) a pair of affinity domains; and (ii) a second target-binding domain. A chimeric polypeptide comprising, wherein the first and second chimeric polypeptides associate via binding of a pair of affinity domains between the first and second domains; the first target-binding domain specifically binds to a ligand of TGF-β receptor II (TGF-βRII); the second target-binding domain specifically binds to a ligand of TGF-βRII; or the first and second target-binding domains each contain soluble TGF-β receptor II (TGF-βRII) having at least 90% identical amino acid sequences to SEQ ID NO: 5.

[0096] Furthermore, this specification also provides a pharmaceutical composition comprising a therapeutically effective amount of (i) a polychain chimeric polypeptide, (ii) T cells or CAR-T cells, and optionally (iii) an additional T cell stimulant, wherein the polychain chimeric polypeptide comprises: (a) a first chimeric polypeptide comprising (i) a first target-binding domain; (ii) a soluble tissue factor domain; and (iii) a pair of affinity domains; and (b) a second chimeric polypeptide comprising (i) a pair of affinity domains; and (ii) a second target-binding domain. Here, the first chimeric polypeptide and the second chimeric polypeptide associate via binding of the first and second domains of a pair of affinity domains; the first target-binding domain specifically binds to the ligand of TGF-β receptor II (TGF-βRII), the second target-binding domain specifically binds to the ligand of TGF-βRII, or the first and second target-binding domains each contain soluble TGF-β receptor II (TGF-βRII) having at least 90% identical amino acid sequences to SEQ ID NO: 5.

[0097] Furthermore, this specification also provides a pharmaceutical composition comprising a therapeutically effective amount of (i) a polychain chimeric polypeptide and (ii) a therapeutic antibody that specifically binds to a tumor antigen, wherein the polychain chimeric polypeptide comprises: (a) a first chimeric polypeptide comprising (i) a first target-binding domain; (ii) a soluble tissue factor domain; and (iii) a first domain comprising a pair of affinity domains; and (b) a second chimeric polypeptide comprising (i) a second domain comprising a pair of affinity domains; and (ii) a second target-binding domain, wherein the first The first and second chimeric polypeptides associate via binding of a pair of affinity domains between the first and second domains; the first target-binding domain specifically binds to a ligand of TGF-β receptor II (TGF-βRII), the second target-binding domain specifically binds to a ligand of TGF-βRII, or the first and second target-binding domains each contain soluble TGF-β receptor II (TGF-βRII) having at least 90% identical amino acid sequences to SEQ ID NO: 5.

[0098] Furthermore, this specification also provides kits containing any of the pharmaceutical compositions described herein.

[0099] As used herein, the term “chimera” refers to a polypeptide comprising amino acid sequences (e.g., domains) originally derived from two different sources (e.g., two different naturally occurring proteins, one or the other from the same species). For example, a chimeric polypeptide may comprise domains derived from at least two different naturally occurring human proteins. In some examples, a chimeric polypeptide may comprise a domain that is a synthetic sequence (e.g., scFv) and a domain derived from a naturally occurring protein (e.g., a naturally occurring human protein). In some embodiments, it may comprise at least two different domains that are synthetic sequences (e.g., two different scFv).

[0100] An "antigen-binding domain" is one or more protein domains that can specifically bind to one or more different antigens (for example, formed from amino acids derived from a single polypeptide, or from amino acids derived from two or more polypeptides (for example, the same or different polypeptides)). In some examples, an antigen-binding domain can bind to an antigen or epitope with specificity and affinity similar to that of a naturally occurring antibody. In some embodiments, the antigen-binding domain may be an antibody or a fragment thereof. In some embodiments, the antigen-binding domain may include an alternative scaffold. Non-limiting examples of antigen-binding domains are described herein. Additional examples of antigen-binding domains are known in the art.

[0101] A “soluble tissue factor domain” refers to a polypeptide that lacks a transmembrane domain and an intracellular domain and is at least 70% identical to a segment of wild-type mammalian tissue factor protein (e.g., wild-type human tissue factor protein) (e.g., at least 75% identity, at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 99% identity, or 100% identity). Non-limiting examples of soluble tissue factor domains are described herein.

[0102] The term "antibody" is used herein in its broadest sense and includes certain types of immunoglobulin molecules that contain one or more antigen-binding domains that specifically bind to an antigen or epitope. Specific examples of antibodies include, for example, intact antibodies (e.g., intact immunoglobulins), antibody fragments, and multispecific antibodies. An example of an antigen-binding domain is an antigen-binding domain formed by a VH-VL dimer. Examples of antibody additions are described herein. Examples of antibody additions are known in the art.

[0103] "Affinity" refers to the sum of the non-covalent interactions between an antigen-binding site and its binding partner (e.g., an antigen or epitope). Unless otherwise indicated, as used herein, "affinity" refers to intrinsic binding affinity, which reflects a 1:1 interaction between the antigen-binding domain and the antigen or epitope. The affinity of molecule X for its partner Y is given by the equilibrium dissociation constant (K). D) can be represented by. The kinetic components contributing to the equilibrium dissociation constant are described in more detail below. Affinity can be measured by common methods known in the art, including those described herein. Affinity can be determined, for example, using surface plasmon resonance (SPR) technology (e.g., BIACORE®) or biolayer interferometry (e.g., FORTEBIO®). Additional methods for determining the affinity between an antigen-binding domain and its corresponding antigen or epitope are known in the art.

[0104] As used herein, "multi-chain polypeptide" refers to a polypeptide (e.g., at least a first chimeric polypeptide and a second polypeptide) comprising two or more (e.g., 3, 4, 5, 6, 7, 8, 9, or 10) protein chains, wherein the two or more protein chains associate through non-covalent bonds to form a quaternary structure.

[0105] The term "pair of affinity domains" refers to two different protein domains that specifically bind to each other with a K of less than 1×10 -7 M (e.g., less than 1×10 -8 M, less than 1×10 -9 M, less than 1×10 -10 M, or less than 1×10 -11 M,). In some instances, the pair of affinity domains may be a pair of naturally occurring proteins. In some embodiments, the pair of affinity domains may be a pair of synthetic proteins. Non-limiting examples of pairs of affinity domains are described herein. D

[0106] ​The term "epitope" refers to a portion of an antigen that specifically binds to an antigen-binding domain. Epitopes may consist, for example, surface-contactable amino acid residues and / or sugar side chains, and may possess specific three-dimensional structural properties as well as specific charge properties. Structural epitopes and unstructural epitopes are distinguished in that binding to the former may be lost in the presence of a denaturing solvent, while binding to the latter is not lost in the presence of a denaturing solvent. Epitopes may include amino acid residues directly involved in binding and other amino acid residues not directly involved in binding. Methods for identifying epitopes to which antigen-binding domains bind are known in the art.

[0107] The term “treatment” means improving at least one symptom of a disorder. Generally, a treatment method involves administering a therapeutically effective amount of a composition that alleviates at least one symptom of a disease to a subject who needs such treatment or who has been determined to need such treatment. In some examples, the disorder being treated is cancer, and improving at least one symptom of cancer includes, for example, reducing abnormal growth, gene expression, signaling, translation, and / or secretion of factors. In some embodiments, treatment of cancer includes reducing the rate of cancer progression and / or the incidence of metastasis in a subject (for example, compared to the rate of cancer progression and / or the incidence of metastasis in a similar subject who is untreated or receiving a different treatment).

[0108] In some examples of any of the polychain chimeric polypeptides described herein, the total length of the first chimeric polypeptide and / or the second chimeric polypeptide is, independently, about 50 to about 3000 amino acids, about 50 to about 2500 amino acids, about 50 to about 2000 amino acids, about 50 to about 1500 amino acids, about 50 to about 1000 amino acids, about 50 to about 950 amino acids, about 50 to about 900 amino acids, about 50 to about 850 amino acids, about 50 to about 800 amino acids, and about 50 to about 7 50 amino acids, approximately 50 amino acids to approximately 700 amino acids, approximately 50 amino acids to approximately 650 amino acids, approximately 50 amino acids to approximately 600 amino acids, approximately 50 amino acids to approximately 550 amino acids, approximately 50 amino acids to approximately 500 amino acids, approximately 50 amino acids to approximately 480 amino acids, approximately 50 amino acids to approximately 460 amino acids, approximately 50 amino acids to approximately 440 amino acids, approximately 50 amino acids to approximately 420 amino acids, approximately 50 amino acids to approximately 400 amino acids, approximately 50 amino acids to approximately 380 amino acids, approximately 50 amino acids to approximately 360 amino acids, approximately 50 amino acids to approximately 340 amino acids, approximately 50 amino acids to approximately 320 amino acids, approximately 50 amino acids Mino acids ~ approximately 300 amino acids, approximately 50 amino acids ~ approximately 280 amino acids, approximately 50 amino acids ~ approximately 260 amino acids, approximately 50 amino acids ~ approximately 240 amino acids, approximately 50 amino acids ~ approximately 220 amino acids, approximately 50 amino acids ~ approximately 200 amino acids, approximately 50 amino acids ~ approximately 150 amino acids, approximately 50 amino acids ~ approximately 100 amino acids, approximately 100 amino acids ~ approximately 3000 amino acids, approximately 100 amino acids ~ approximately 2500 amino acids, approximately 100 amino acids ~ approximately 2000 amino acids, approximately 100 amino acids ~ approximately 1500 amino acids, approximately 100 amino acids ~ approximately 1000 amino acids, approximately 100 amino acids ~ approximately 950 amino acids, approximately 10 0 amino acids to approximately 900 amino acids, approximately 100 amino acids to approximately 850 amino acids, approximately 100 amino acids to approximately 800 amino acids, approximately 100 amino acids to approximately 750 amino acids, approximately 100 amino acids to approximately 700 amino acids, approximately 100 amino acids to approximately 650 amino acids, approximately 100 amino acids to approximately 600 amino acids, approximately 100 amino acids to approximately 550 amino acids, approximately 100 amino acids to approximately 500 amino acids, approximately 100 amino acids to approximately 480 amino acids, approximately 100 amino acids to approximately 460 amino acids, approximately 100 amino acids to approximately 440 amino acids, approximately 100 amino acids to approximately 420 amino acids, approximately 100 amino acids to approximately 400 amino acids,Approximately 100 amino acids to approximately 380 amino acids, approximately 100 amino acids to approximately 360 amino acids, approximately 100 amino acids to approximately 340 amino acids, approximately 100 amino acids to approximately 320 amino acids, approximately 100 amino acids to approximately 300 amino acids, approximately 100 amino acids to approximately 280 amino acids, approximately 100 amino acids to approximately 260 amino acids, approximately 100 amino acids to approximately 240 amino acids, approximately 100 amino acids to approximately 220 amino acids, approximately 100 amino acids to approximately 200 amino acids, approximately 100 amino acids to approximately 150 amino acids, approximately 150 amino acids to approximately 3000 amino acids, approximately 150 amino acids to approximately 2500 amino acids, approximately 150 amino acids to approximately 2000 Amino acids, approximately 150 amino acids to approximately 1500 amino acids, approximately 150 amino acids to approximately 1000 amino acids, approximately 150 amino acids to approximately 950 amino acids, approximately 150 amino acids to approximately 900 amino acids, approximately 150 amino acids to approximately 850 amino acids, approximately 150 amino acids to approximately 800 amino acids, approximately 150 amino acids to approximately 750 amino acids, approximately 150 amino acids to approximately 700 amino acids, approximately 150 amino acids to approximately 650 amino acids, approximately 150 amino acids to approximately 600 amino acids, approximately 150 amino acids to approximately 550 amino acids, approximately 150 amino acids to approximately 500 amino acids, approximately 150 amino acids to approximately 480 amino acids, approximately 150 amino acids to approximately 500 amino acids Approximately 460 amino acids, approximately 150 amino acids to approximately 440 amino acids, approximately 150 amino acids to approximately 420 amino acids, approximately 150 amino acids to approximately 400 amino acids, approximately 150 amino acids to approximately 380 amino acids, approximately 150 amino acids to approximately 360 amino acids, approximately 150 amino acids to approximately 340 amino acids, approximately 150 amino acids to approximately 320 amino acids, approximately 150 amino acids to approximately 300 amino acids, approximately 150 amino acids to approximately 280 amino acids, approximately 150 amino acids to approximately 260 amino acids, approximately 150 amino acids to approximately 240 amino acids, approximately 150 amino acids to approximately 220 amino acids, approximately 150 amino acids to approximately 200 amino acids, approximately 200 amino acids Acid ~ approximately 3000 amino acids, approximately 200 amino acids ~ approximately 2500 amino acids, approximately 200 amino acids ~ approximately 2000 amino acids, approximately 200 amino acids ~ approximately 1500 amino acids, approximately 200 amino acids ~ approximately 1000 amino acids, approximately 200 amino acids ~ approximately 950 amino acids, approximately 200 amino acids ~ approximately 900 amino acids, approximately 200 amino acids ~ approximately 850 amino acids, approximately 200 amino acids ~ approximately 800 amino acids, approximately 200 amino acids ~ approximately 750 amino acids, approximately 200 amino acids ~ approximately 700 amino acids, approximately 200 amino acids ~ approximately 650 amino acids, approximately 200 amino acids ~ approximately 600 amino acids, approximately 200 amino acids ~ approximately 550 amino acids,Approximately 200 to 500 amino acids, approximately 200 to 480 amino acids, approximately 200 to 460 amino acids, approximately 200 to 440 amino acids, approximately 200 to 420 amino acids, approximately 200 to 400 amino acids, approximately 200 to 380 amino acids, approximately 200 to 360 amino acids, approximately 200 to 340 amino acids, approximately 200 to 320 amino acids, approximately 200 to 300 amino acids, approximately 200 to 280 amino acids, approximately 200 to 260 amino acids, approximately 200 to 240 amino acids Acid, approximately 200 amino acids to approximately 220 amino acids, approximately 220 amino acids to approximately 3000 amino acids, approximately 220 amino acids to approximately 2500 amino acids, approximately 220 amino acids to approximately 2000 amino acids, approximately 220 amino acids to approximately 1500 amino acids, approximately 220 amino acids to approximately 1000 amino acids, approximately 220 amino acids to approximately 950 amino acids, approximately 220 amino acids to approximately 900 amino acids, approximately 220 amino acids to approximately 850 amino acids, approximately 220 amino acids to approximately 800 amino acids, approximately 220 amino acids to approximately 750 amino acids, approximately 220 amino acids to approximately 700 amino acids, approximately 220 amino acids to approximately 650 amino acids, approximately 220 amino acids to Approximately 600 amino acids, approximately 220 amino acids to approximately 550 amino acids, approximately 220 amino acids to approximately 500 amino acids, approximately 220 amino acids to approximately 480 amino acids, approximately 220 amino acids to approximately 460 amino acids, approximately 220 amino acids to approximately 440 amino acids, approximately 220 amino acids to approximately 420 amino acids, approximately 220 amino acids to approximately 400 amino acids, approximately 220 amino acids to approximately 380 amino acids, approximately 220 amino acids to approximately 360 amino acids, approximately 220 amino acids to approximately 340 amino acids, approximately 220 amino acids to approximately 320 amino acids, approximately 220 amino acids to approximately 300 amino acids, approximately 220 amino acids to approximately 280 amino acids, approximately 220 amino acids Acid ~ approximately 260 amino acids, approximately 220 amino acids ~ approximately 240 amino acids, approximately 240 amino acids ~ approximately 3000 amino acids, approximately 240 amino acids ~ approximately 2500 amino acids, approximately 240 amino acids ~ approximately 2000 amino acids, approximately 240 amino acids ~ approximately 1500 amino acids, approximately 240 amino acids ~ approximately 1000 amino acids, approximately 240 amino acids ~ approximately 950 amino acids, approximately 240 amino acids ~ approximately 900 amino acids, approximately 240 amino acids ~ approximately 850 amino acids, approximately 240 amino acids ~ approximately 800 amino acids, approximately 240 amino acids ~ approximately 750 amino acids, approximately 240 amino acids ~ approximately 700 amino acids, approximately 240 amino acids ~ approximately 650 amino acids,Approximately 240 amino acids to approximately 600 amino acids, approximately 240 amino acids to approximately 550 amino acids, approximately 240 amino acids to approximately 500 amino acids, approximately 240 amino acids to approximately 480 amino acids, approximately 240 amino acids to approximately 460 amino acids, approximately 240 amino acids to approximately 440 amino acids, approximately 240 amino acids to approximately 420 amino acids, approximately 240 amino acids to approximately 400 amino acids, approximately 240 amino acids to approximately 380 amino acids, approximately 240 amino acids to approximately 360 amino acids, approximately 240 amino acids to approximately 340 amino acids, approximately 240 amino acids to approximately 320 amino acids, approximately 240 amino acids to approximately 300 amino acids, approximately 240 amino acids to approximately 280 amino acids Acid, approximately 240 amino acids to approximately 260 amino acids, approximately 260 amino acids to approximately 3000 amino acids, approximately 260 amino acids to approximately 2500 amino acids, approximately 260 amino acids to approximately 2000 amino acids, approximately 260 amino acids to approximately 1500 amino acids, approximately 260 amino acids to approximately 1000 amino acids, approximately 260 amino acids to approximately 950 amino acids, approximately 260 amino acids to approximately 900 amino acids, approximately 260 amino acids to approximately 850 amino acids, approximately 260 amino acids to approximately 800 amino acids, approximately 260 amino acids to approximately 750 amino acids, approximately 260 amino acids to approximately 700 amino acids, approximately 260 amino acids to approximately 650 amino acids, approximately 260 amino acids to approximately 260 amino acids Approximately 600 amino acids, approximately 260 amino acids to approximately 550 amino acids, approximately 260 amino acids to approximately 500 amino acids, approximately 260 amino acids to approximately 480 amino acids, approximately 260 amino acids to approximately 460 amino acids, approximately 260 amino acids to approximately 440 amino acids, approximately 260 amino acids to approximately 420 amino acids, approximately 260 amino acids to approximately 400 amino acids, approximately 260 amino acids to approximately 380 amino acids, approximately 260 amino acids to approximately 360 amino acids, approximately 260 amino acids to approximately 340 amino acids, approximately 260 amino acids to approximately 320 amino acids, approximately 260 amino acids to approximately 300 amino acids, approximately 260 amino acids to approximately 280 amino acids, approximately 280 amino acids Acid ~ approximately 3000 amino acids, approximately 280 amino acids ~ approximately 2500 amino acids, approximately 280 amino acids ~ approximately 2000 amino acids, approximately 280 amino acids ~ approximately 1500 amino acids, approximately 280 amino acids ~ approximately 1000 amino acids, approximately 280 amino acids ~ approximately 950 amino acids, approximately 280 amino acids ~ approximately 900 amino acids, approximately 280 amino acids ~ approximately 850 amino acids, approximately 280 amino acids ~ approximately 800 amino acids, approximately 280 amino acids ~ approximately 750 amino acids, approximately 280 amino acids ~ approximately 700 amino acids, approximately 280 amino acids ~ approximately 650 amino acids, approximately 280 amino acids ~ approximately 600 amino acids, approximately 280 amino acids ~ approximately 550 amino acids,Approximately 280 amino acids to approximately 500 amino acids, approximately 280 amino acids to approximately 480 amino acids, approximately 280 amino acids to approximately 460 amino acids, approximately 280 amino acids to approximately 440 amino acids, approximately 280 amino acids to approximately 420 amino acids, approximately 280 amino acids to approximately 400 amino acids, approximately 280 amino acids to approximately 380 amino acids, approximately 280 amino acids to approximately 360 amino acids, approximately 280 amino acids to approximately 340 amino acids, approximately 280 amino acids to approximately 320 amino acids, approximately 280 amino acids to approximately 3 00 amino acids, approximately 300 to 3000 amino acids, approximately 300 to 2500 amino acids, approximately 300 to 2000 amino acids, approximately 300 to 1500 amino acids, approximately 300 to 1000 amino acids, approximately 300 to 950 amino acids, approximately 300 to 900 amino acids, approximately 300 to 850 amino acids, approximately 300 to 800 amino acids, approximately 300 to 750 amino acids Approximately 300 to 700 amino acids, approximately 300 to 650 amino acids, approximately 300 to 600 amino acids, approximately 300 to 550 amino acids, approximately 300 to 500 amino acids, approximately 300 to 480 amino acids, approximately 300 to 460 amino acids, approximately 300 to 440 amino acids, approximately 300 to 420 amino acids, approximately 300 to 400 amino acids, approximately 300 to 400 amino acids 380 amino acids, approximately 300 to approximately 360 amino acids, approximately 300 to approximately 340 amino acids, approximately 300 to approximately 320 amino acids, 320 to approximately 3000 amino acids, approximately 320 to approximately 2500 amino acids, approximately 320 to approximately 2000 amino acids, approximately 320 to approximately 1500 amino acids, approximately 320 to approximately 1000 amino acids, approximately 320 to approximately 950 amino acids, approximately 320 to approximately 900 amino acids, Approximately 320 amino acids to approximately 850 amino acids, approximately 320 amino acids to approximately 800 amino acids, approximately 320 amino acids to approximately 750 amino acids, approximately 320 amino acids to approximately 700 amino acids, approximately 320 amino acids to approximately 650 amino acids, approximately 320 amino acids to approximately 600 amino acids, approximately 320 amino acids to approximately 550 amino acids, approximately 320 amino acids to approximately 500 amino acids, approximately 320 amino acids to approximately 480 amino acids, approximately 320 amino acids to approximately 460 amino acids, approximately 320 amino acids to approximately 440 amino acids, approximately 320 amino acids to approximately 420 amino acids, approximately 320 amino acids to approximately 400 amino acids, approximately 320 amino acids to approximately 380 amino acids Acid, approximately 320 amino acids to approximately 360 amino acids, approximately 320 amino acids to approximately 340 amino acids, approximately 340 amino acids to approximately 3000 amino acids, approximately 340 amino acids to approximately 2500 amino acids, approximately 340 amino acids to approximately 2000 amino acids, approximately 340 amino acids to approximately 1500 amino acids, approximately 340 amino acids to approximately 1000 amino acids, approximately 340 amino acids to approximately 950 amino acids, approximately 340 amino acids to approximately 900 amino acids, approximately 340 amino acids to approximately 850 amino acids, approximately 340 amino acids to approximately 800 amino acids, approximately 340 amino acids to approximately 750 amino acids, approximately 340 amino acids to approximately 700 amino acids, approximately 340 amino acids to approximately 340 amino acids Approximately 650 amino acids, approximately 340 to approximately 600 amino acids, approximately 340 to approximately 550 amino acids, approximately 340 to approximately 500 amino acids, approximately 340 to approximately 480 amino acids, approximately 340 to approximately 460 amino acids, approximately 340 to approximately 440 amino acids, approximately 340 to approximately 420 amino acids, approximately 340 to approximately 400 amino acids, approximately 340 to approximately 380 amino acids, approximately 340 to approximately 360 amino acids, approximately 360 to approximately 3000 amino acids, approximately 360 to approximately 2500 amino acids, approximately 360 to approximately 2000 amino acids, approximately 360 Amino acids ~ approximately 1500 amino acids, approximately 360 amino acids ~ approximately 1000 amino acids, approximately 360 amino acids ~ approximately 950 amino acids, approximately 360 amino acids ~ approximately 900 amino acids, approximately 360 amino acids ~ approximately 850 amino acids, approximately 360 amino acids ~ approximately 800 amino acids, approximately 360 amino acids ~ approximately 750 amino acids, approximately 360 amino acids ~ approximately 700 amino acids, approximately 360 amino acids ~ approximately 650 amino acids, approximately 360 amino acids ~ approximately 600 amino acids, approximately 360 amino acids ~ approximately 550 amino acids, approximately 360 amino acids ~ approximately 500 amino acids, approximately 360 amino acids ~ approximately 480 amino acids, approximately 360 amino acids ~ approximately 460 amino acids,Approximately 360 amino acids to approximately 440 amino acids, approximately 360 amino acids to approximately 420 amino acids, approximately 360 amino acids to approximately 400 amino acids, approximately 360 amino acids to approximately 380 amino acids, approximately 380 amino acids to approximately 3000 amino acids, approximately 380 amino acids to approximately 2500 amino acids, approximately 380 amino acids to approximately 2000 amino acids, approximately 380 amino acids to approximately 1500 amino acids, approximately 380 amino acids to approximately 1000 amino acids, approximately 380 amino acids to approximately 950 amino acids, approximately 380 amino acids to approximately 900 amino acids, approximately 380 amino acids to approximately 850 amino acids, approximately 380 amino acids to approximately 800 amino acids, approximately 380 amino acids Acids ~ approximately 750 amino acids, approximately 380 amino acids ~ approximately 700 amino acids, approximately 380 amino acids ~ approximately 650 amino acids, approximately 380 amino acids ~ approximately 600 amino acids, approximately 380 amino acids ~ approximately 550 amino acids, approximately 380 amino acids ~ approximately 500 amino acids, approximately 380 amino acids ~ approximately 480 amino acids, approximately 380 amino acids ~ approximately 460 amino acids, approximately 380 amino acids ~ approximately 440 amino acids, approximately 380 amino acids ~ approximately 420 amino acids, approximately 380 amino acids ~ approximately 400 amino acids, approximately 400 amino acids ~ approximately 3000 amino acids, approximately 400 amino acids ~ approximately 2500 amino acids, approximately 400 amino acids ~ approximately 2000 amino acids Approximately 400 amino acids to approximately 1500 amino acids, approximately 400 amino acids to approximately 1000 amino acids, approximately 400 amino acids to approximately 950 amino acids, approximately 400 amino acids to approximately 900 amino acids, approximately 400 amino acids to approximately 850 amino acids, approximately 400 amino acids to approximately 800 amino acids, approximately 400 amino acids to approximately 750 amino acids, approximately 400 amino acids to approximately 700 amino acids, approximately 400 amino acids to approximately 650 amino acids, approximately 400 amino acids to approximately 600 amino acids, approximately 400 amino acids to approximately 550 amino acids, approximately 400 amino acids to approximately 500 amino acids, approximately 400 amino acids to approximately 480 amino acids, approximately 400 amino acids to approximately 460 amino acids, approximately 400 to 440 amino acids, approximately 400 to 420 amino acids, approximately 420 to 3000 amino acids, approximately 420 to 2500 amino acids, approximately 420 to 2000 amino acids, approximately 420 to 1500 amino acids, approximately 420 to 1000 amino acids, approximately 420 to 950 amino acids, approximately 420 to 900 amino acids, approximately 420 to 850 amino acids, approximately 420 to 800 amino acids, approximately 420 to 750 amino acids, approximately 420 to 700 amino acids,Approximately 420 amino acids to approximately 650 amino acids, approximately 420 amino acids to approximately 600 amino acids, approximately 420 amino acids to approximately 550 amino acids, approximately 420 amino acids to approximately 500 amino acids, approximately 420 amino acids to approximately 480 amino acids, approximately 420 amino acids to approximately 460 amino acids, approximately 420 amino acids to approximately 440 amino acids, approximately 440 amino acids to approximately 3000 amino acids, approximately 440 amino acids to approximately 2500 amino acids, approximately 440 amino acids to approximately 2000 amino acids, approximately 440 amino acids to approximately 1500 amino acids, approximately 440 amino acids to approximately 1000 amino acids, approximately 440 amino acids to approximately 950 amino acids, approximately 440 amino acids Acid ~ approximately 900 amino acids, approximately 440 amino acids ~ approximately 850 amino acids, approximately 440 amino acids ~ approximately 800 amino acids, approximately 440 amino acids ~ approximately 750 amino acids, approximately 440 amino acids ~ approximately 700 amino acids, approximately 440 amino acids ~ approximately 650 amino acids, approximately 440 amino acids ~ approximately 600 amino acids, approximately 440 amino acids ~ approximately 550 amino acids, approximately 440 amino acids ~ approximately 500 amino acids, approximately 440 amino acids ~ approximately 480 amino acids, approximately 440 amino acids ~ approximately 460 amino acids, approximately 460 amino acids ~ approximately 3000 amino acids, approximately 460 amino acids ~ approximately 2500 amino acids, approximately 460 amino acids ~ approximately 2000 amino acids Approximately 460 amino acids to approximately 1500 amino acids, approximately 460 amino acids to approximately 1000 amino acids, approximately 460 amino acids to approximately 950 amino acids, approximately 460 amino acids to approximately 900 amino acids, approximately 460 amino acids to approximately 850 amino acids, approximately 460 amino acids to approximately 800 amino acids, approximately 460 amino acids to approximately 750 amino acids, approximately 460 amino acids to approximately 700 amino acids, approximately 460 amino acids to approximately 650 amino acids, approximately 460 amino acids to approximately 600 amino acids, approximately 460 amino acids to approximately 550 amino acids, approximately 460 amino acids to approximately 500 amino acids, approximately 460 amino acids to approximately 480 amino acids, approximately 480 amino acids to approximately 3000 amino acids, approximately 480 amino acids to approximately 2500 amino acids, approximately 480 amino acids to approximately 2000 amino acids, approximately 480 amino acids to approximately 1500 amino acids, approximately 480 amino acids to approximately 1000 amino acids, approximately 480 amino acids to approximately 950 amino acids, approximately 480 amino acids to approximately 900 amino acids, approximately 480 amino acids to approximately 850 amino acids, approximately 480 amino acids to approximately 800 amino acids, approximately 480 amino acids to approximately 750 amino acids, approximately 480 amino acids to approximately 700 amino acids, approximately 480 amino acids to approximately 650 amino acids, approximately 480 amino acids to approximately 600 amino acids, approximately 480 amino acids to approximately 550 amino acids,Approximately 480 amino acids to approximately 500 amino acids, approximately 500 amino acids to approximately 3000 amino acids, approximately 500 amino acids to approximately 2500 amino acids, approximately 500 amino acids to approximately 2000 amino acids, approximately 500 amino acids to approximately 1500 amino acids, approximately 500 amino acids to approximately 1000 amino acids, approximately 500 amino acids to approximately 950 amino acids, approximately 500 amino acids to approximately 900 amino acids, approximately 500 amino acids to approximately 850 amino acids, approximately 500 amino acids to approximately 800 amino acids, approximately 500 amino acids to approximately 750 amino acids, approximately 500 amino acids to approximately 700 Amino acids, approximately 500 amino acids to approximately 650 amino acids, approximately 500 amino acids to approximately 600 amino acids, approximately 500 amino acids to approximately 550 amino acids, approximately 550 amino acids to approximately 3000 amino acids, approximately 550 amino acids to approximately 2500 amino acids, approximately 550 amino acids to approximately 2000 amino acids, approximately 550 amino acids to approximately 1500 amino acids, approximately 550 amino acids to approximately 1000 amino acids, approximately 550 amino acids to approximately 950 amino acids, approximately 550 amino acids to approximately 900 amino acids, approximately 550 amino acids to approximately 850 amino acids, approximately 550 amino acids to Approximately 800 amino acids, approximately 550 to approximately 750 amino acids, approximately 550 to approximately 700 amino acids, approximately 550 to approximately 650 amino acids, approximately 550 to approximately 600 amino acids, approximately 600 to approximately 3000 amino acids, approximately 600 to approximately 2500 amino acids, approximately 600 to approximately 2000 amino acids, approximately 600 to approximately 1500 amino acids, approximately 600 to approximately 1000 amino acids, approximately 600 to approximately 950 amino acids, approximately 600 to approximately 900 amino acids, approximately 600 Amino acids ~ approximately 850 amino acids, approximately 600 amino acids ~ approximately 800 amino acids, approximately 600 amino acids ~ approximately 750 amino acids, approximately 600 amino acids ~ approximately 700 amino acids, approximately 600 amino acids ~ approximately 650 amino acids, approximately 650 amino acids ~ approximately 3000 amino acids, approximately 650 amino acids ~ approximately 2500 amino acids, approximately 650 amino acids ~ approximately 2000 amino acids, approximately 650 amino acids ~ approximately 1500 amino acids, approximately 650 amino acids ~ approximately 1000 amino acids, approximately 650 amino acids ~ approximately 950 amino acids, approximately 650 amino acids ~ approximately 900 amino acids, Approximately 650 amino acids to approximately 850 amino acids, approximately 650 amino acids to approximately 800 amino acids, approximately 650 amino acids to approximately 750 amino acids, approximately 650 amino acids to approximately 700 amino acids, approximately 700 amino acids to approximately 3000 amino acids, approximately 700 amino acids to approximately 2500 amino acids, approximately 700 amino acids to approximately 2000 amino acids, approximately 700 amino acids to approximately 1500 amino acids, approximately 700 amino acids to approximately 1000 amino acids, approximately 700 amino acids to approximately 950 amino acids, approximately 700 amino acids to approximately 900 amino acids, approximately 700 amino acids to approximately 850 amino acids, approximately 700 amino acids to approximately 800 amino acids, approximately 700 amino acids to Approximately 750 amino acids, approximately 750 amino acids to approximately 3000 amino acids, approximately 750 amino acids to approximately 2500 amino acids, approximately 750 amino acids to approximately 2000 amino acids, approximately 750 amino acids to approximately 1500 amino acids, approximately 750 amino acids to approximately 1000 amino acids, approximately 750 amino acids to approximately 950 amino acids, approximately 750 amino acids to approximately 900 amino acids, approximately 750 amino acids to approximately 850 amino acids, approximately 750 amino acids to approximately 800 amino acids, approximately 800 amino acids to approximately 3000 amino acids, approximately 800 amino acids to approximately 2500 amino acids, approximately 800 amino acids to approximately 2000 amino acids, approximately 800 amino acids to approximately 1500 amino acids Mino acids, approximately 800 amino acids to approximately 1000 amino acids, approximately 800 amino acids to approximately 950 amino acids, approximately 800 amino acids to approximately 900 amino acids, approximately 800 amino acids to approximately 850 amino acids, approximately 850 amino acids to approximately 3000 amino acids, approximately 850 amino acids to approximately 2500 amino acids, approximately 850 amino acids to approximately 2000 amino acids, approximately 850 amino acids to approximately 1500 amino acids, approximately 850 amino acids to approximately 1000 amino acids, approximately 850 amino acids to approximately 950 amino acids, approximately 850 amino acids to approximately 900 amino acids, approximately 900 amino acids to approximately 3000 amino acids, approximately 900 amino acids to approximately 2500 amino acids, approximately 9 00 amino acids to approximately 2000 amino acids, approximately 900 amino acids to approximately 1500 amino acids, approximately 900 amino acids to approximately 1000 amino acids, approximately 900 amino acids to approximately 950 amino acids, approximately 950 amino acids to approximately 3000 amino acids, approximately 950 amino acids to approximately 2500 amino acids, approximately 950 amino acids to approximately 2000 amino acids, approximately 950 amino acids to approximately 1500 amino acids, approximately 950 amino acids to approximately 1000 amino acids, approximately 1000 amino acids to approximately 3000 amino acids, approximately 1000 amino acids to approximately 2500 amino acids, approximately 1000 amino acids to approximately 2000 amino acids, approximately 1000 amino acids to approximately 1500 amino acids,The amino acids may range from approximately 1500 to 3000 amino acids, approximately 1500 to 2500 amino acids, approximately 1500 to 2000 amino acids, approximately 2000 to 3000 amino acids, approximately 2000 to 2500 amino acids, or approximately 2500 to 3000 amino acids. Schematic diagrams of exemplary polychain chimeric polypeptides described herein are shown in Figures 1 and 2.

[0109] In some embodiments of any of the polychain chimeric polypeptides described herein, a first target-binding domain (e.g., any of the first target-binding domains described herein) and a soluble tissue factor domain (e.g., any of the exemplary soluble tissue factor domains described herein) are in direct contact with each other in the first chimeric polypeptide. In some embodiments of any of the polychain chimeric polypeptides described herein, the first chimeric polypeptide further comprises a linker sequence (e.g., any of the exemplary linker sequences described herein or known in the art) between the first target-binding domain (e.g., any of the exemplary first target-binding domains described herein) and the soluble tissue factor domain (e.g., any of the exemplary soluble tissue factor domains described herein) in the first chimeric polypeptide.

[0110] In some embodiments of any of the polychain chimeric polypeptides described herein, a soluble tissue factor domain (e.g., any of the exemplary soluble tissue factor domains described herein) and a first domain of a pair of affinity domains (e.g., any of the exemplary first domains of an exemplary pair of affinity domains described herein) are in direct contact with each other in the first chimeric polypeptide. In some embodiments of any of the polychain chimeric polypeptides described herein, the first chimeric polypeptide further comprises a linker sequence (e.g., any of the exemplary linker sequences described herein or known in the art) between the soluble tissue factor domain (e.g., any of the exemplary soluble tissue factor domains described herein) and a first domain of a pair of affinity domains (e.g., any of the exemplary first domains of an exemplary pair of affinity domains described herein) in the first chimeric polypeptide.

[0111] In some embodiments of any of the polychain chimeric polypeptides described herein, the second domain of a pair of affinity domains (e.g., any of the exemplary second domains of the exemplary pair of affinity domains described herein) and the second target-binding domain (e.g., any of the exemplary second target-binding domains described herein) are in direct contact with each other in the second chimeric polypeptide. In some embodiments of any of the polychain chimeric polypeptides described herein, the second chimeric polypeptide further includes a linker sequence (e.g., any of the exemplary linker sequences described herein or known in the art) between the second domain of a pair of affinity domains (e.g., any of the exemplary second domains of the exemplary pair of affinity domains described herein) and the second target-binding domain (e.g., any of the exemplary second target-binding domains described herein).

[0112] Non-limiting embodiments of these chimeric polypeptides, nucleic acids, vectors, cells, and methods are described below and can be used in any combination without limitation. Additional embodiments of these chimeric polypeptides, nucleic acids, vectors, cells, and methods are known in the art.

[0113] tissue factor Human tissue factor is a 263-amino acid transmembrane protein containing three domains: (1) a 219-amino acid N-terminal extracellular domain (residues 1-219), (2) a 22-amino acid transmembrane domain (residues 220-242), and (3) a 21-amino acid cytoplasmic C-terminal tail (residues 242-263) (UniProtKB identification number: P13726). The cytoplasmic tail contains two phosphorylation sites at Ser253 and Ser258, and one S-palmitoylation site at Cys245. No deletions or mutations in the cytoplasmic domain affecting tissue factor coagulation activity have been identified. Tissue factor has one S-palmitoylation site in the intracellular domain of the protein at Cys245. Cys245 is located at the amino acid terminus of the intracellular domain and is close to the membrane surface. The transmembrane domain of tissue factor consists of a single-spanning α-helix.

[0114] The extracellular domain of tissue factor, composed of two fibronectin type III domains, is linked to the transmembrane domain via a six-amino acid linker. This linker provides conformational flexibility to separate the extracellular domain of tissue factor from its transmembrane and cytoplasmic domains. Each tissue factor fibronectin type III module consists of two overlapping β-sheets, each having an upper sheet domain containing three antiparallel β-chains and a lower sheet containing four β-chains. The β-chains are linked by β-loops between βA and βB chains, between βC and βD chains, and between βE and βF chains, all of which maintain conformational conservation in both modules. There are three short α-helix segments linked to the β-chains. A feature unique to tissue factor is the 17-amino acid β-hairpin between β10 and β11 chains, which is not a common element of the fibronectin superfamily. The N-terminal domain also contains a 12-amino acid loop between β6F and β7G, which is not present in the C-terminal domain and is unique to tissue factor. Such fibronectin type III domain structures are characteristic of the immunoglobulin-like family of protein folds and are conserved among a wide variety of extracellular proteins.

[0115] Zymogen FVII is rapidly converted to FVIIa by limited degradation once it binds to tissue and forms an active tissue factor-FVIIa complex. FVIIa, circulating as an enzyme at a concentration of approximately 0.1 nM (1% plasma FVII), can also directly bind to tissue factor. Allosteric interactions between tissue factor and FVIIa in the tissue factor-FVIIa complex significantly increase the enzymatic activity of FVIIa: the hydrolysis rate of small chromogenic peptidyl substrates increases by approximately 20 to 100 times, and the activation rate of the natural polymer substrates FIX and FX increases by almost 1 million times. In conjunction with the allosteric activation of the activation site of FVIIa upon binding to tissue factor, the formation of the tissue factor-FVIIa complex on the phospholipid bilayer (i.e., when phosphatidyl-L-serine is exposed on the membrane surface) increases the rate of FIX or FX activation. 2+dependently, further increase it by 1,000-fold. Compared to free FVIIa, the overall increase of nearly 1,000,000-fold in FX activation by the tissue factor-FVIIa-phospholipid complex is an important regulatory point for the coagulation cascade.

[0116] FVII is a single-chain polypeptide of about 50 kDa consisting of 406 amino acid residues, having an N-terminal γ-carboxyglutamic acid-rich (GLA) domain, two epidermal growth factor-like domains (EGF1 and EGF2), and a C-terminal serine protease domain. FVII is located at Ile- in the short linker region between EGF2 and the protease domain 154 -Arg 152 is activated to FVIIa by specific proteolytic cleavage. This cleavage results in a light chain and a heavy chain that are held together by a single disulfide bond between Cys 135 and Cys 262 . FVIIa binds to phospholipid membranes in a Ca 2+ -dependent manner through its N-terminal GLA domain. Immediately adjacent to the C-terminus of the GLA domain are an aromatic stack and two EGF domains. The aromatic stack links GLA to the EGF1 domain, which is bound to a single Ca 2+ ion. Occupancy of this Ca 2+ binding site increases the amidolytic activity of FVIIa and the association of tissue factor. The catalytic triad consisting of His 193 , Asp 242 , and Ser 344 , as well as the binding of a single Ca 2+ ion within the FVIIa protease domain, are important for its catalytic activity. Proteolytic activation of FVII to FVIIa releases the newly formed amino terminus at Ile 153 , which folds and inserts into the activation pocket, and Asp 343A salt bridge is formed with the carboxylic acid, generating an oxyanion hole. This salt bridge formation is important for FVIIa activity. However, oxyanion hole formation does not occur in free FVIIa during proteolytic activation. As a result, FVIIa circulates in a zymogen-like state that is hardly recognized by plasma protease inhibitors, and is able to circulate with a half-life of approximately 90 minutes.

[0117] Tissue factor-mediated positioning of the FVIIa active site on the membrane surface is crucial for FVIIa relative to its congener substrates. Free FVIIa adopts a stable, extended structure when bound to the membrane with its active site positioned approximately 80 Å above the membrane surface. Upon binding of FVIIa to tissue molecules, the FVa active site is repositioned to approximately 6 Å away from the membrane. This regulation can facilitate proper alignment of the three catalytic residues of FVIIa with the target substrate cleavage site. Using GLA-domain-less FVIIa has been shown to still position the active site at a similar distance on the membrane, demonstrating that tissue factor can fully support the positioning of the FVIIa active site even in the absence of FVIIa-membrane interactions. Additional data have shown that tissue factor supports complete FVIIa proteolytic activity as long as its extracellular domain is somehow tethered to the membrane surface. However, raising the active site of FVIIa above 80 Å from the membrane surface significantly reduced the tissue factor-FVIIa complex's ability to activate FX, but it did not reduce tissue factor-FVIIa amid degradation activity.

[0118] Alanine scanning mutagenesis has been used to evaluate the role of specific amino acid side chains in the extracellular domain of tissue factor for interaction with FVIIa (Gibbs et al., Biochemistry 33(47):14003-14010, 1994; Schullek et al., J Biol Chem 269(30):19399-19403, 1994). Alanine substitution identified a limited number of residue positions where alanine substitution reduced affinity for FVIIa binding by 5-10 times. The majority of the side chains of these residues were found to be well exposed to the solvent within the crystal structure, consistent with polymeric ligand interactions. The FVIIa ligand binding site is located on a broad region at the boundary between the two molecules. In the C-module, the residue Arg is located on the protruding BC loop. 135 and Phe 140 This provides independent contact with FVIIa. Leu 133 It is located at the base of a finger-like structure and is packed into the gap between the two modules. This is Lys 20 , Thr 60 Asp 58 , and Ile 22 It provides continuity to the major cluster of important binding residues consisting of Thr. 60 It is only partially exposed to the solvent and may play a local structural role rather than making significant contact with the ligand. The binding site is Glu 24 and Gln 110 It extends to the concave side of the intermodal angle accompanied by, and in some cases, to the farther base Val 207 It extends to [location]. The binding region is from Asp58 to Lys 48 Lys 46 , Gln 37 Asp 44 , and Trp 45 It extends to the concave region formed by Trp. 45 and Asp 44 It does not interact with FVIIa independently, and Trp 45 The mutation effect at the Asp 44 and Gln 37This demonstrates the structural importance of this side chain for local packing adjacent to the side chain. The interaction region consists of two surface-exposed aromatic residues, Phe 76 and Tyr 78 These further include, and these form part of the hydrophobic cluster in the N-module.

[0119] The known physiological substrates of tissue factor-FVIIa are FVII, FIX, and FX, which are specific proteinase-activating receptors. Mutagenesis has identified numerous residues that, when mutated, support complete FVIIa amidogenesis activity for small peptidyl substrates but lack the ability to support activation of high molecular weight substrates (i.e., FVII, FIX, and FX) (Ruf et al., J Biol Chem 267(31):22206-22210, 1992; Ruf et al., J Biol Chem 267(9):6375-6381, 1992; Huang et al., J Biol Chem 271(36):21752-21757, 1996; Kirchhofer et al., Biochemistry 39(25):7380-7387, 2000). The loop region of tissue factor at residues 159–165, and the residues within or adjacent to this flexible loop, have been shown to be crucial for the proteolytic activity of the tissue factor-FVIIa complex. This defines the proposed substrate-binding exocyte region of tissue factor, which is quite far from the FVIIa active site. Substitution of even slightly bulkier glycine residues with alanine significantly impairs tissue factor-FVIIa proteolytic activity. This suggests that the flexibility conferred by glycine is important for the loop at residues 159–165 for the recognition of the tissue factor macromolecular substrate.

[0120] Residue Lys 165 and Lys 166 It has also been demonstrated that these residues are important for substrate recognition and binding. Mutations to alanine in any of these residues result in a significant decrease in the cofactor function of tissue factor. 165 and Lys 166They were facing away from each other, Lys 165 Most tissue factor-FVIOIa structures are oriented towards FVIIa, and Lys 166 This is the state in which the matrix is ​​oriented towards the substrate-binding exocite region in the crystal structure. FVIIa Lys 165 and Gla 35 The presumed salt bridge formation between them would support the view that tissue factor interaction with the GLA domain of FVIIa modulates substrate recognition. These results suggest that the C-terminal portion of the tissue factor ectodomain directly interacts with the GLA-domain, which is a possible adjacent EGF1 domain of FIX and FX, and that the presence of the GLA-domain of FVIIa can modulate these interactions either directly or indirectly.

[0121] Soluble tissue factor domain In some embodiments of any polypeptide, composition, or method described herein, the soluble tissue factor domain may be a wild-type tissue factor polypeptide lacking a signal sequence, transmembrane domain, and intracellular domain. In some examples, the soluble tissue factor domain may be a tissue factor variant in which the wild-type tissue factor polypeptide lacks a signal sequence, transmembrane domain, and intracellular domain and is further modified at selected amino acids. In some examples, the soluble tissue factor domain may be a soluble human tissue factor domain. In some examples, the soluble tissue factor domain may be a soluble mouse tissue factor domain. In some examples, the soluble tissue factor domain may be a soluble rat tissue factor domain. Non-limiting examples of soluble human tissue factor domains, mouse soluble tissue factor domains, rat soluble tissue factor domains, and variant soluble tissue factor domains are given below.

[0122] Exemplary soluble human tissue factor domain (SEQ ID NO: 1) [ka]

[0123] Exemplary nucleic acid encoding a soluble human tissue factor domain (SEQ ID NO: 7) [ka]

[0124] In some cases, the soluble tissue factor domain may contain sequences that are at least 70% identical, at least 72% identical, at least 74% identical, at least 76% identical, at least 78% identical, at least 80% identical, at least 82% identical, at least 84% identical, at least 86% identical, at least 88% identical, at least 90% identical, at least 92% identical, at least 94% identical, at least 96% identical, at least 98% identical, at least 99% identical, or 100% identical to Sequence ID No. 1. In some embodiments, soluble tissue factor may contain the sequence of Sequence ID No. 1, with 1 to 20 amino acids (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) removed from its N-terminus and / or with 1 to 20 amino acids (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) removed from its C-terminus.

[0125] As has been appreciated in the art, those skilled in the art will understand that mutations in amino acids conserved between different mammalian species are likely to reduce protein activity and / or structural stability, while mutations in amino acids not conserved between different mammalian species are less likely to reduce protein activity and / or structural stability.

[0126] In some examples of any of the polychain chimeric polypeptides described herein, the soluble tissue domain cannot bind to factor VIIa. In some examples of any of the polychain chimeric polypeptides described herein, the soluble tissue factor domain does not convert inactive factor X to factor Xa. In some embodiments of any of the polychain chimeric polypeptides described herein, the polychain chimeric polypeptide does not stimulate blood coagulation in mammals.

[0127] In some examples, the soluble tissue factor domain may be a soluble human tissue factor domain. In some embodiments, the soluble tissue factor domain may be a soluble mouse tissue factor domain. In some embodiments, the soluble tissue factor domain may be a soluble rat tissue factor domain.

[0128] In some cases, the soluble tissue factor domain does not contain one or more (e.g., two, three, four, five, six, or seven) of the following: lysine at the amino acid position corresponding to amino acid position 20 of mature wild-type human tissue factor protein; isoleucine at the amino acid position corresponding to amino acid position 22 of mature wild-type human tissue factor protein; tryptophan at the amino acid position corresponding to amino acid position 45 of mature wild-type human tissue factor protein; aspartic acid at the amino acid position corresponding to amino acid position 58 of mature wild-type human tissue factor protein; tyrosine at the amino acid position corresponding to amino acid position 94 of mature wild-type human tissue factor protein; arginine at the amino acid position corresponding to amino acid position 135 of mature wild-type human tissue factor protein; and phenylalanine at the amino acid position corresponding to amino acid position 140 of mature wild-type human tissue factor protein.

[0129] In some cases, the soluble tissue factor domain may be encoded by nucleic acids containing sequences that are at least 70% identical, at least 72% identical, at least 74% identical, at least 76% identical, at least 78% identical, at least 80% identical, at least 82% identical, at least 84% identical, at least 86% identical, at least 88% identical, at least 90% identical, at least 92% identical, at least 94% identical, at least 96% identical, at least 98% identical, at least 99% identical, or 100% identical to Sequence ID No. 7.

[0130] In some embodiments, the soluble tissue factor domain is as follows: approximately 20 to 220 amino acids, approximately 20 to 215 amino acids, approximately 20 to 210 amino acids, approximately 20 to 205 amino acids, approximately 20 to 200 amino acids, approximately 20 to 195 amino acids, approximately 20 to 190 amino acids, approximately 20 to 185 amino acids, approximately 20 to 180 amino acids, approximately 20 to 175 amino acids, approximately 20 to 170 amino acids, approximately 20 to 165 amino acids, approximately 20 to 160 amino acids. 20 amino acids to approximately 155 amino acids, approximately 20 amino acids to approximately 150 amino acids, approximately 20 amino acids to approximately 145 amino acids, approximately 20 amino acids to approximately 140 amino acids, approximately 20 amino acids to approximately 135 amino acids, approximately 20 amino acids to approximately 130 amino acids, approximately 20 amino acids to approximately 125 amino acids, approximately 20 amino acids to approximately 120 amino acids, approximately 20 amino acids to approximately 115 amino acids, approximately 20 amino acids to approximately 110 amino acids, approximately 20 amino acids to approximately 105 amino acids, approximately 20 amino acids to approximately 100 amino acids, approximately 20 amino acids to approximately 95 amino acids, approximately 20 amino acids to approximately 90 Approximately 85 amino acids, approximately 20 to approximately 80 amino acids, approximately 20 to approximately 75 amino acids, approximately 20 to approximately 70 amino acids, approximately 20 to approximately 60 amino acids, approximately 20 to approximately 50 amino acids, approximately 20 to approximately 40 amino acids, approximately 20 to approximately 30 amino acids, approximately 30 to approximately 220 amino acids, approximately 30 to approximately 215 amino acids, approximately 30 to approximately 210 amino acids, approximately 30 to approximately 205 amino acids, approximately 30 to approximately 200 amino acids, approximately 30 to approximately 195 amino acids, approximately 30 to approximately 190 amino acids, approximately 30 to approximately 30 amino acids Approximately 185 amino acids, approximately 30 to approximately 180 amino acids, approximately 30 to approximately 175 amino acids, approximately 30 to approximately 170 amino acids, approximately 30 to approximately 165 amino acids, approximately 30 to approximately 160 amino acids, approximately 30 to approximately 155 amino acids, approximately 30 to approximately 150 amino acids, approximately 30 to approximately 145 amino acids, approximately 30 to approximately 140 amino acids, approximately 30 to approximately 135 amino acids, approximately 30 to approximately 130 amino acids, approximately 30 to approximately 125 amino acids, approximately 30 to approximately 120 amino acids, approximately 30 to approximately 115 amino acids,Approximately 30 amino acids to approximately 110 amino acids, approximately 30 amino acids to approximately 105 amino acids, approximately 30 amino acids to approximately 100 amino acids, approximately 30 amino acids to approximately 95 amino acids, approximately 30 amino acids to approximately 90 amino acids, approximately 30 amino acids to approximately 85 amino acids, approximately 30 amino acids to approximately 80 amino acids, approximately 30 amino acids to approximately 75 amino acids, approximately 30 amino acids to approximately 70 amino acids, approximately 30 amino acids to approximately 60 amino acids, approximately 30 amino acids to approximately 50 amino acids, approximately 30 amino acids to approximately 40 amino acids, approximately 40 amino acids to approximately 220 amino acids, approximately 40 amino acids to approximately 215 amino acids, approximately 40 amino acids to approximately 210 amino acids, Approximately 40 amino acids to approximately 205 amino acids, approximately 40 amino acids to approximately 200 amino acids, approximately 40 amino acids to approximately 195 amino acids, approximately 40 amino acids to approximately 190 amino acids, approximately 40 amino acids to approximately 185 amino acids, approximately 40 amino acids to approximately 180 amino acids, approximately 40 amino acids to approximately 175 amino acids, approximately 40 amino acids to approximately 170 amino acids, approximately 40 amino acids to approximately 165 amino acids, approximately 40 amino acids to approximately 160 amino acids, approximately 40 amino acids to approximately 155 amino acids, approximately 40 amino acids to approximately 150 amino acids, approximately 40 amino acids to approximately 145 amino acids, approximately 40 amino acids to approximately 140 amino acids, approximately 40 amino acids to approximately 135 amino acids, approximately 40 amino acids to approximately 130 amino acids, approximately 40 amino acids to approximately 125 amino acids, approximately 40 amino acids to approximately 120 amino acids, approximately 40 amino acids to approximately 115 amino acids, approximately 40 amino acids to approximately 110 amino acids, approximately 40 amino acids to approximately 105 amino acids, approximately 40 amino acids to approximately 100 amino acids, approximately 40 amino acids to approximately 95 amino acids, approximately 40 amino acids to approximately 90 amino acids, approximately 40 amino acids to approximately 85 amino acids, approximately 40 amino acids to approximately 80 amino acids, approximately 40 amino acids to approximately 75 amino acids, approximately 40 amino acids to approximately 70 amino acids, approximately 40 amino acids to approximately 60 amino acids, approximately 40 amino acids ~approximately 50 amino acids, approximately 50 amino acids~approximately 220 amino acids, approximately 50 amino acids~approximately 215 amino acids, approximately 50 amino acids~approximately 210 amino acids, approximately 50 amino acids~approximately 205 amino acids, approximately 50 amino acids~approximately 200 amino acids, approximately 50 amino acids~approximately 195 amino acids, approximately 50 amino acids~approximately 190 amino acids, approximately 50 amino acids~approximately 185 amino acids, approximately 50 amino acids~approximately 180 amino acids, approximately 50 amino acids~approximately 175 amino acids, approximately 50 amino acids~approximately 170 amino acids, approximately 50 amino acids~approximately 165 amino acids, approximately 50 amino acids~approximately 160 amino acids, approximately 50 amino acids~approximately 155 amino acids,Approximately 50 amino acids to approximately 150 amino acids, approximately 50 amino acids to approximately 145 amino acids, approximately 50 amino acids to approximately 140 amino acids, approximately 50 amino acids to approximately 135 amino acids, approximately 50 amino acids to approximately 130 amino acids, approximately 50 amino acids to approximately 125 amino acids, approximately 50 amino acids to approximately 120 amino acids, approximately 50 amino acids to approximately 115 amino acids, approximately 50 amino acids to approximately 110 amino acids, approximately 50 amino acids to approximately 105 amino acids, approximately 50 amino acids to approximately 100 amino acids, approximately 50 amino acids to approximately 95 amino acids, approximately 50 amino acids to approximately 90 amino acids, approximately 50 amino acids to approximately 85 amino acids, approximately 50 amino acids to approximately 80 amino acids Mino acids, approximately 50 to 75 amino acids, approximately 50 to 70 amino acids, approximately 50 to 60 amino acids, approximately 60 to 220 amino acids, approximately 60 to 215 amino acids, approximately 60 to 210 amino acids, approximately 60 to 205 amino acids, approximately 60 to 200 amino acids, approximately 60 to 195 amino acids, approximately 60 to 190 amino acids, approximately 60 to 185 amino acids, approximately 60 to 180 amino acids, approximately 60 to 175 amino acids, approximately 60 to 170 amino acids, approximately 60 to 1 165 amino acids, approximately 60 to 160 amino acids, approximately 60 to 155 amino acids, approximately 60 to 150 amino acids, approximately 60 to 145 amino acids, approximately 60 to 140 amino acids, approximately 60 to 135 amino acids, approximately 60 to 130 amino acids, approximately 60 to 125 amino acids, approximately 60 to 120 amino acids, approximately 60 to 115 amino acids, approximately 60 to 110 amino acids, approximately 60 to 105 amino acids, approximately 60 to 100 amino acids, approximately 60 to 95 amino acids, approximately 6 0 amino acids to approximately 90 amino acids, approximately 60 amino acids to approximately 85 amino acids, approximately 60 amino acids to approximately 80 amino acids, approximately 60 amino acids to approximately 75 amino acids, approximately 60 amino acids to approximately 70 amino acids, approximately 70 amino acids to approximately 220 amino acids, approximately 70 amino acids to approximately 215 amino acids, approximately 70 amino acids to approximately 210 amino acids, approximately 70 amino acids to approximately 205 amino acids, approximately 70 amino acids to approximately 200 amino acids, approximately 70 amino acids to approximately 195 amino acids, approximately 70 amino acids to approximately 190 amino acids, approximately 70 amino acids to approximately 185 amino acids, approximately 70 amino acids to approximately 180 amino acids, approximately 70 amino acids to approximately 175 amino acids,Approximately 70 amino acids to approximately 170 amino acids, approximately 70 amino acids to approximately 165 amino acids, approximately 70 amino acids to approximately 160 amino acids, approximately 70 amino acids to approximately 155 amino acids, approximately 70 amino acids to approximately 150 amino acids, approximately 70 amino acids to approximately 145 amino acids, approximately 70 amino acids to approximately 140 amino acids, approximately 70 amino acids to approximately 135 amino acids, approximately 70 amino acids to approximately 130 amino acids, approximately 70 amino acids to approximately 125 amino acids, approximately 70 amino acids to approximately 120 amino acids, approximately 70 amino acids to approximately 115 amino acids, approximately 70 amino acids to approximately 110 amino acids, approximately 70 amino acids to approximately 105 amino acids, approximately 70 amino acids to approximately 10 0 amino acids, approximately 70 to 95 amino acids, approximately 70 to 90 amino acids, approximately 70 to 85 amino acids, approximately 70 to 80 amino acids, 80 to 220 amino acids, approximately 80 to 215 amino acids, approximately 80 to 210 amino acids, approximately 80 to 205 amino acids, approximately 80 to 200 amino acids, approximately 80 to 195 amino acids, approximately 80 to 190 amino acids, approximately 80 to 185 amino acids, approximately 80 to 180 amino acids, approximately 80 to 175 amino acids, approximately 80 to 1 70 amino acids, approximately 80 amino acids to approximately 165 amino acids, approximately 80 amino acids to approximately 160 amino acids, approximately 80 amino acids to approximately 155 amino acids, approximately 80 amino acids to approximately 150 amino acids, approximately 80 amino acids to approximately 145 amino acids, approximately 80 amino acids to approximately 140 amino acids, approximately 80 amino acids to approximately 135 amino acids, approximately 80 amino acids to approximately 130 amino acids, approximately 80 amino acids to approximately 125 amino acids, approximately 80 amino acids to approximately 120 amino acids, approximately 80 amino acids to approximately 115 amino acids, approximately 80 amino acids to approximately 110 amino acids, approximately 80 amino acids to approximately 105 amino acids, approximately 80 amino acids to approximately 100 amino acids, approximately 80 amino acids Mino acids ~ approximately 95 amino acids, approximately 80 amino acids ~ approximately 90 amino acids, approximately 90 amino acids ~ approximately 220 amino acids, approximately 90 amino acids ~ approximately 215 amino acids, approximately 90 amino acids ~ approximately 210 amino acids, approximately 90 amino acids ~ approximately 205 amino acids, approximately 90 amino acids ~ approximately 200 amino acids, approximately 90 amino acids ~ approximately 195 amino acids, approximately 90 amino acids ~ approximately 190 amino acids, approximately 90 amino acids ~ approximately 185 amino acids, approximately 90 amino acids ~ approximately 180 amino acids, approximately 90 amino acids ~ approximately 175 amino acids, approximately 90 amino acids ~ approximately 170 amino acids, approximately 90 amino acids ~ approximately 165 amino acids, approximately 90 amino acids ~ approximately 160 amino acids,Approximately 90 amino acids to approximately 155 amino acids, approximately 90 amino acids to approximately 150 amino acids, approximately 90 amino acids to approximately 145 amino acids, approximately 90 amino acids to approximately 140 amino acids, approximately 90 amino acids to approximately 135 amino acids, approximately 90 amino acids to approximately 130 amino acids, approximately 90 amino acids to approximately 125 amino acids, approximately 90 amino acids to approximately 120 amino acids, approximately 90 amino acids to approximately 115 amino acids, approximately 90 amino acids to approximately 110 amino acids, approximately 90 amino acids to approximately 105 amino acids, approximately 90 amino acids to approximately 100 amino acids, approximately 100 amino acids to approximately 220 amino acids, approximately 100 amino acids to approximately 215 amino acids, approximately 100 amino acids to approximately 210 amino acids, approximately 100 amino acids to approximately 205 amino acids, approximately 100 amino acids to approximately 200 amino acids, approximately 100 amino acids 0 amino acids ~ approximately 195 amino acids, approximately 100 amino acids ~ approximately 190 amino acids, approximately 100 amino acids ~ approximately 185 amino acids, approximately 100 amino acids ~ approximately 180 amino acids, approximately 100 amino acids ~ approximately 175 amino acids, approximately 100 amino acids ~ approximately 170 amino acids, approximately 100 amino acids ~ approximately 165 amino acids, approximately 100 amino acids ~ approximately 160 amino acids, approximately 100 amino acids ~ approximately 155 amino acids, approximately 100 amino acids ~ approximately 150 amino acids, approximately 100 amino acids ~ approximately 145 amino acids, approximately 100 amino acids ~ approximately 140 amino acids, approximately 100 amino acids ~ approximately 135 amino acids, approximately 100 amino acids ~ approximately 130 amino acids, approximately 100 amino acids ~ approximately 125 amino acids, approximately 100 amino acids ~ approximately 120 amino acids, approximately 100 amino acids ~ approximately 115 amino acids, Approximately 100-110 amino acids, approximately 110-220 amino acids, approximately 110-215 amino acids, approximately 110-210 amino acids, approximately 110-205 amino acids, approximately 110-200 amino acids, approximately 110-195 amino acids, approximately 110-190 amino acids, approximately 110-185 amino acids, approximately 110-180 amino acids, approximately 110-175 amino acids, approximately 110-170 amino acids, approximately 110-165 amino acids, approximately 110-160 amino acids Amino acids, approximately 110 amino acids to approximately 155 amino acids, approximately 110 amino acids to approximately 150 amino acids, approximately 110 amino acids to approximately 145 amino acids, approximately 110 amino acids to approximately 140 amino acids, approximately 110 amino acids to approximately 135 amino acids, approximately 110 amino acids to approximately 130 amino acids, approximately 110 amino acids to approximately 125 amino acids, approximately 110 amino acids to approximately 120 amino acids, approximately 110 amino acids to approximately 115 amino acids, approximately 115 amino acids to approximately 220 amino acids, approximately 115 amino acids to approximately 215 amino acids, approximately 115 amino acids to approximately 210 amino acids, approximately 115 amino acids to approximately 205 amino acids, approximately 115 amino acids to approximately 115 amino acids Approximately 200 amino acids, approximately 115 to approximately 195 amino acids, approximately 115 to approximately 190 amino acids, approximately 115 to approximately 185 amino acids, approximately 115 to approximately 180 amino acids, approximately 115 to approximately 175 amino acids, approximately 115 to approximately 170 amino acids, approximately 115 to approximately 165 amino acids, approximately 115 to approximately 160 amino acids, approximately 115 to approximately 155 amino acids, approximately 115 to approximately 150 amino acids, approximately 115 to approximately 145 amino acids, approximately 115 to approximately 140 amino acids, approximately 115 to approximately 135 amino acids, approximately 115 Amino acids ~ approximately 130 amino acids, approximately 115 amino acids ~ approximately 125 amino acids, approximately 115 amino acids ~ approximately 120 amino acids, approximately 120 amino acids ~ approximately 220 amino acids, approximately 120 amino acids ~ approximately 215 amino acids, approximately 120 amino acids ~ approximately 210 amino acids, approximately 120 amino acids ~ approximately 205 amino acids, approximately 120 amino acids ~ approximately 200 amino acids, approximately 120 amino acids ~ approximately 195 amino acids, approximately 120 amino acids ~ approximately 190 amino acids, approximately 120 amino acids ~ approximately 185 amino acids, approximately 120 amino acids ~ approximately 180 amino acids, approximately 120 amino acids ~ approximately 175 amino acids, approximately 120 amino acids ~ approximately 170 amino acids,Approximately 120 amino acids to approximately 165 amino acids, approximately 120 amino acids to approximately 160 amino acids, approximately 120 amino acids to approximately 155 amino acids, approximately 120 amino acids to approximately 150 amino acids, approximately 120 amino acids to approximately 145 amino acids, approximately 120 amino acids to approximately 140 amino acids, approximately 120 amino acids to approximately 135 amino acids, approximately 120 amino acids to approximately 130 amino acids, approximately 120 amino acids to approximately 125 amino acids, approximately 125 amino acids to approximately 220 amino acids, approximately 125 amino acids to approximately 215 amino acids, approximately 125 amino acids to approximately 210 amino acids, approximately 125 amino acids to approximately 205 amino acids, approximately 125 amino acids to approximately 200 Amino acids, approximately 125 amino acids to approximately 195 amino acids, approximately 125 amino acids to approximately 190 amino acids, approximately 125 amino acids to approximately 185 amino acids, approximately 125 amino acids to approximately 180 amino acids, approximately 125 amino acids to approximately 175 amino acids, approximately 125 amino acids to approximately 170 amino acids, approximately 125 amino acids to approximately 165 amino acids, approximately 125 amino acids to approximately 160 amino acids, approximately 125 amino acids to approximately 155 amino acids, approximately 125 amino acids to approximately 150 amino acids, approximately 125 amino acids to approximately 145 amino acids, approximately 125 amino acids to approximately 140 amino acids, approximately 125 amino acids to approximately 135 amino acids, approximately 125 amino acids to approximately 145 amino acids, approximately 125 amino acids to approximately 135 amino acids, approximately 125 amino acids to Approximately 130 amino acids, approximately 130 amino acids to approximately 220 amino acids, approximately 130 amino acids to approximately 215 amino acids, approximately 130 amino acids to approximately 210 amino acids, approximately 130 amino acids to approximately 205 amino acids, approximately 130 amino acids to approximately 200 amino acids, approximately 130 amino acids to approximately 195 amino acids, approximately 130 amino acids to approximately 190 amino acids, approximately 130 amino acids to approximately 185 amino acids, approximately 130 amino acids to approximately 180 amino acids, approximately 130 amino acids to approximately 175 amino acids, approximately 130 amino acids to approximately 170 amino acids, approximately 130 amino acids to approximately 165 amino acids, approximately 130 amino acids to approximately 160 amino acids, approximately 130 Amino acids ~ approximately 155 amino acids, approximately 130 amino acids ~ approximately 150 amino acids, approximately 130 amino acids ~ approximately 145 amino acids, approximately 130 amino acids ~ approximately 140 amino acids, approximately 130 amino acids ~ approximately 135 amino acids, approximately 135 amino acids ~ approximately 220 amino acids, approximately 135 amino acids ~ approximately 215 amino acids, approximately 135 amino acids ~ approximately 210 amino acids, approximately 135 amino acids ~ approximately 205 amino acids, approximately 135 amino acids ~ approximately 200 amino acids, approximately 135 amino acids ~ approximately 195 amino acids, approximately 135 amino acids ~ approximately 190 amino acids, approximately 135 amino acids ~ approximately 185 amino acids, approximately 135 amino acids ~ approximately 180 amino acids,Approximately 135 to 175 amino acids, approximately 135 to 170 amino acids, approximately 135 to 165 amino acids, approximately 135 to 160 amino acids, approximately 135 to 155 amino acids, approximately 135 to 150 amino acids, approximately 135 to 145 amino acids, approximately 135 to 140 amino acids, approximately 140 to 220 amino acids, approximately 140 to 215 amino acids, approximately 140 to 210 amino acids, approximately 140 to 205 amino acids, approximately 140 to 200 amino acids, approximately 140 to 195 amino acids Amino acids, approximately 140 amino acids to approximately 190 amino acids, approximately 140 amino acids to approximately 185 amino acids, approximately 140 amino acids to approximately 180 amino acids, approximately 140 amino acids to approximately 175 amino acids, approximately 140 amino acids to approximately 170 amino acids, approximately 140 amino acids to approximately 165 amino acids, approximately 140 amino acids to approximately 160 amino acids, approximately 140 amino acids to approximately 155 amino acids, approximately 140 amino acids to approximately 150 amino acids, approximately 140 amino acids to approximately 145 amino acids, approximately 145 amino acids to approximately 220 amino acids, approximately 145 amino acids to approximately 215 amino acids, approximately 145 amino acids to approximately 210 amino acids, approximately 145 amino acids to approximately 145 amino acids Approximately 205 amino acids, approximately 145 amino acids to approximately 200 amino acids, approximately 145 amino acids to approximately 195 amino acids, approximately 145 amino acids to approximately 190 amino acids, approximately 145 amino acids to approximately 185 amino acids, approximately 145 amino acids to approximately 180 amino acids, approximately 145 amino acids to approximately 175 amino acids, approximately 145 amino acids to approximately 170 amino acids, approximately 145 amino acids to approximately 165 amino acids, approximately 145 amino acids to approximately 160 amino acids, approximately 145 amino acids to approximately 155 amino acids, approximately 145 amino acids to approximately 150 amino acids, approximately 150 amino acids to approximately 220 amino acids, approximately 150 amino acids to approximately 215 amino acids, approximately 150 Amino acids ~ approximately 210 amino acids, approximately 150 amino acids ~ approximately 205 amino acids, approximately 150 amino acids ~ approximately 200 amino acids, approximately 150 amino acids ~ approximately 195 amino acids, approximately 150 amino acids ~ approximately 190 amino acids, approximately 150 amino acids ~ approximately 185 amino acids, approximately 150 amino acids ~ approximately 180 amino acids, approximately 150 amino acids ~ approximately 175 amino acids, approximately 150 amino acids ~ approximately 170 amino acids, approximately 150 amino acids ~ approximately 165 amino acids, approximately 150 amino acids ~ approximately 160 amino acids, approximately 150 amino acids ~ approximately 155 amino acids, approximately 155 amino acids ~ approximately 220 amino acids, approximately 155 amino acids ~ approximately 215 amino acids,Approximately 155 amino acids to approximately 210 amino acids, approximately 155 amino acids to approximately 205 amino acids, approximately 155 amino acids to approximately 200 amino acids, approximately 155 amino acids to approximately 195 amino acids, approximately 155 amino acids to approximately 190 amino acids, approximately 155 amino acids to approximately 185 amino acids, approximately 155 amino acids to approximately 180 amino acids, approximately 155 amino acids to approximately 175 amino acids, approximately 155 amino acids to approximately 170 amino acids, approximately 155 amino acids to approximately 165 amino acids, approximately 155 amino acids to approximately 160 amino acids, approximately 160 amino acids to approximately 220 amino acids, approximately 160 amino acids to approximately 215 amino acids, approximately 160 amino acids to approximately 210 Amino acids, approximately 160 amino acids to approximately 205 amino acids, approximately 160 amino acids to approximately 200 amino acids, approximately 160 amino acids to approximately 195 amino acids, approximately 160 amino acids to approximately 190 amino acids, approximately 160 amino acids to approximately 185 amino acids, approximately 160 amino acids to approximately 180 amino acids, approximately 160 amino acids to approximately 175 amino acids, approximately 160 amino acids to approximately 170 amino acids, approximately 160 amino acids to approximately 165 amino acids, approximately 165 amino acids to approximately 220 amino acids, approximately 165 amino acids to approximately 215 amino acids, approximately 165 amino acids to approximately 210 amino acids, approximately 165 amino acids to approximately 205 amino acids, approximately 165 amino acids to Approximately 200 amino acids, approximately 165 to approximately 195 amino acids, approximately 165 to approximately 190 amino acids, approximately 165 to approximately 185 amino acids, approximately 165 to approximately 180 amino acids, approximately 165 to approximately 175 amino acids, approximately 165 to approximately 170 amino acids, approximately 170 to approximately 220 amino acids, approximately 170 to approximately 215 amino acids, approximately 170 to approximately 210 amino acids, approximately 170 to approximately 205 amino acids, approximately 170 to approximately 200 amino acids, approximately 170 to approximately 195 amino acids, approximately 170 to approximately 190 amino acids, approximately 170 Amino acids ~ approximately 185 amino acids, approximately 170 amino acids ~ approximately 180 amino acids, approximately 170 amino acids ~ approximately 175 amino acids, approximately 175 amino acids ~ approximately 220 amino acids, approximately 175 amino acids ~ approximately 215 amino acids, approximately 175 amino acids ~ approximately 210 amino acids, approximately 175 amino acids ~ approximately 205 amino acids, approximately 175 amino acids ~ approximately 200 amino acids, approximately 175 amino acids ~ approximately 195 amino acids, approximately 175 amino acids ~ approximately 190 amino acids, approximately 175 amino acids ~ approximately 185 amino acids, approximately 175 amino acids ~ approximately 180 amino acids, approximately 180 amino acids ~ approximately 220 amino acids, approximately 180 amino acids ~ approximately 215 amino acids, Approximately 180 amino acids to approximately 210 amino acids, approximately 180 amino acids to approximately 205 amino acids, approximately 180 amino acids to approximately 200 amino acids, approximately 180 amino acids to approximately 195 amino acids, approximately 180 amino acids to approximately 190 amino acids, approximately 180 amino acids to approximately 185 amino acids, approximately 185 amino acids to approximately 220 amino acids, approximately 185 amino acids to approximately 215 amino acids, approximately 185 amino acids to approximately 210 amino acids, approximately 185 amino acids to approximately 205 amino acids, approximately 185 amino acids to approximately 200 amino acids, approximately 185 amino acids to approximately 195 amino acids, approximately 185 amino acids to approximately 190 amino acids, approximately 190 amino acids to approximately 220 amino acids, approximately 190 amino acids to approximately 215 amino acids, approximately 190 amino acids to approximately 210 amino acids, approximately 190 amino acids to approximately 205 amino acids, approximately 190 amino acids Mino acids may have total lengths of approximately 200 amino acids, approximately 190 to 195 amino acids, approximately 195 to 220 amino acids, approximately 195 to 215 amino acids, approximately 195 to 210 amino acids, approximately 195 to 205 amino acids, approximately 195 to 200 amino acids, approximately 200 to 220 amino acids, approximately 200 to 215 amino acids, approximately 200 to 210 amino acids, approximately 200 to 205 amino acids, approximately 205 to 220 amino acids, approximately 205 to 215 amino acids, approximately 205 to 210 amino acids, approximately 210 to 215 amino acids, or approximately 215 to 220 amino acids.

[0131] Linker array In some embodiments, the linker sequence may be a flexible linker sequence. Non-limiting examples of linker sequences that can be used are described in Klein et al., Protein Engineering, Design & Selection 27(10):325-330, 2014; Priyanka et al., Protein Sci. 22(2):153-167, 2013. In some examples, the linker sequence is a synthetic linker sequence.

[0132] In some embodiments of any of the polychain chimeric polypeptides described herein, the first chimeric polypeptide may comprise one, two, three, four, five, six, seven, eight, nine, or ten linker sequences (for example, identical or different linker sequences, e.g., any exemplary linker sequences described herein or known in the art). In some embodiments of any of the polychain chimeric polypeptides described herein, the second chimeric polypeptide may comprise one, two, three, four, five, six, seven, eight, nine, or ten linker sequences (for example, identical or different linker sequences, e.g., any exemplary linker sequences described herein or known in the art).

[0133] In some embodiments, the linker sequence is as follows: 1 amino acid to approximately 100 amino acids, 1 amino acid to approximately 90 amino acids, 1 amino acid to approximately 80 amino acids, 1 amino acid to approximately 70 amino acids, 1 amino acid to approximately 60 amino acids, 1 amino acid to approximately 50 amino acids, 1 amino acid to approximately 45 amino acids, 1 amino acid to approximately 40 amino acids, 1 amino acid to approximately 35 amino acids, 1 amino acid to approximately 30 amino acids, 1 amino acid to approximately 25 amino acids, 1 amino acid to approximately 24 amino acids, 1 amino acid to approximately 22 amino acids, 1 amino acid to approximately 20 amino acids, 1 amino acid to approximately 18 amino acids, 1 amino acid to approximately 16 amino acids Acid, 1 amino acid to approximately 14 amino acids, 1 amino acid to approximately 12 amino acids, 1 amino acid to approximately 10 amino acids, 1 amino acid to approximately 8 amino acids, 1 amino acid to approximately 6 amino acids, 1 amino acid to approximately 4 amino acids, approximately 2 amino acids to approximately 100 amino acids, approximately 2 amino acids to approximately 90 amino acids, approximately 2 amino acids to approximately 80 amino acids, approximately 2 amino acids to approximately 70 amino acids, approximately 2 amino acids to approximately 60 amino acids, approximately 2 amino acids to approximately 50 amino acids, approximately 2 amino acids to approximately 45 amino acids, approximately 2 amino acids to approximately 40 amino acids, approximately 2 amino acids to approximately 35 amino acids, approximately 2 amino acids to approximately 30 amino acids, approximately 2 amino acids to approximately 25 amino acids Acid, approximately 2 amino acids to approximately 24 amino acids, approximately 2 amino acids to approximately 22 amino acids, approximately 2 amino acids to approximately 20 amino acids, approximately 2 amino acids to approximately 18 amino acids, approximately 2 amino acids to approximately 16 amino acids, approximately 2 amino acids to approximately 14 amino acids, approximately 2 amino acids to approximately 12 amino acids, approximately 2 amino acids to approximately 10 amino acids, approximately 2 amino acids to approximately 8 amino acids, approximately 2 amino acids to approximately 6 amino acids, approximately 2 amino acids to approximately 4 amino acids, approximately 4 amino acids to approximately 100 amino acids, approximately 4 amino acids to approximately 90 amino acids, approximately 4 amino acids to approximately 80 amino acids, approximately 4 amino acids to approximately 70 amino acids, approximately 4 amino acids to approximately 60 amino acids, approximately 4 amino acids to approximately 4 amino acids Approximately 50 amino acids, approximately 4 to approximately 45 amino acids, approximately 4 to approximately 40 amino acids, approximately 4 to approximately 35 amino acids, approximately 4 to approximately 30 amino acids, approximately 4 to approximately 25 amino acids, approximately 4 to approximately 24 amino acids, approximately 4 to approximately 22 amino acids, approximately 4 to approximately 20 amino acids, approximately 4 to approximately 18 amino acids, approximately 4 to approximately 16 amino acids, approximately 4 to approximately 14 amino acids, approximately 4 to approximately 12 amino acids, approximately 4 to approximately 10 amino acids, approximately 4 to approximately 8 amino acids, approximately 4 to approximately 6 amino acids, approximately 6 to approximately 100 amino acids,Approximately 6 amino acids to approximately 90 amino acids, approximately 6 amino acids to approximately 80 amino acids, approximately 6 amino acids to approximately 70 amino acids, approximately 6 amino acids to approximately 60 amino acids, approximately 6 amino acids to approximately 50 amino acids, approximately 6 amino acids to approximately 45 amino acids, approximately 6 amino acids to approximately 40 amino acids, approximately 6 amino acids to approximately 35 amino acids, approximately 6 amino acids to approximately 30 amino acids, approximately 6 amino acids to approximately 25 amino acids, approximately 6 amino acids to approximately 24 amino acids, approximately 6 amino acids to approximately 22 amino acids, approximately 6 amino acids to approximately 20 amino acids, approximately 6 amino acids to approximately 18 amino acids, approximately 6 amino acids to approximately 16 amino acids, approximately 6 amino acids to approximately 14 amino acids, approximately 6 amino acids to Approximately 12 amino acids, approximately 6 to approximately 10 amino acids, approximately 6 to approximately 8 amino acids, approximately 8 to approximately 100 amino acids, approximately 8 to approximately 90 amino acids, approximately 8 to approximately 80 amino acids, approximately 8 to approximately 70 amino acids, approximately 8 to approximately 60 amino acids, approximately 8 to approximately 50 amino acids, approximately 8 to approximately 45 amino acids, approximately 8 to approximately 40 amino acids, approximately 8 to approximately 35 amino acids, approximately 8 to approximately 30 amino acids, approximately 8 to approximately 25 amino acids, approximately 8 to approximately 24 amino acids, approximately 8 to approximately 22 amino acids, approximately 8 to approximately 20 amino acids Approximately 8 to 18 amino acids, approximately 8 to 16 amino acids, approximately 8 to 14 amino acids, approximately 8 to 12 amino acids, approximately 8 to 10 amino acids, approximately 10 to 100 amino acids, approximately 10 to 90 amino acids, approximately 10 to 80 amino acids, approximately 10 to 70 amino acids, approximately 10 to 60 amino acids, approximately 10 to 50 amino acids, approximately 10 to 45 amino acids, approximately 10 to 40 amino acids, approximately 10 to 35 amino acids, approximately 10 to 30 amino acids, approximately 10 to 2 5 amino acids, approximately 10 to 24 amino acids, approximately 10 to 22 amino acids, approximately 10 to 20 amino acids, approximately 10 to 18 amino acids, approximately 10 to 16 amino acids, approximately 10 to 14 amino acids, approximately 10 to 12 amino acids, approximately 12 to 100 amino acids, approximately 12 to 90 amino acids, approximately 12 to 80 amino acids, approximately 12 to 70 amino acids, approximately 12 to 60 amino acids, approximately 12 to 50 amino acids, approximately 12 to 45 amino acids, approximately 12 to 40 amino acids,Approximately 12 amino acids to approximately 35 amino acids, approximately 12 amino acids to approximately 30 amino acids, approximately 12 amino acids to approximately 25 amino acids, approximately 12 amino acids to approximately 24 amino acids, approximately 12 amino acids to approximately 22 amino acids, approximately 12 amino acids to approximately 20 amino acids, approximately 12 amino acids to approximately 18 amino acids, approximately 12 amino acids to approximately 16 amino acids, approximately 12 amino acids to approximately 14 amino acids, approximately 14 amino acids to approximately 100 amino acids, approximately 14 amino acids to approximately 90 amino acids, approximately 14 amino acids to approximately 80 amino acids, approximately 14 amino acids to approximately 70 amino acids, approximately 14 amino acids to approximately 60 amino acids, approximately 14 amino acids to approximately 50 amino acids, approximately 14 amino acids to Approximately 45 amino acids, approximately 14 to approximately 40 amino acids, approximately 14 to approximately 35 amino acids, approximately 14 to approximately 30 amino acids, approximately 14 to approximately 25 amino acids, approximately 14 to approximately 24 amino acids, approximately 14 to approximately 22 amino acids, approximately 14 to approximately 20 amino acids, approximately 14 to approximately 18 amino acids, approximately 14 to approximately 16 amino acids, approximately 16 to approximately 100 amino acids, approximately 16 to approximately 90 amino acids, approximately 16 to approximately 80 amino acids, approximately 16 to approximately 70 amino acids, approximately 16 to approximately 60 amino acids, approximately 16 to approximately 50 amino acids, Approximately 16 amino acids to approximately 45 amino acids, approximately 16 amino acids to approximately 40 amino acids, approximately 16 amino acids to approximately 35 amino acids, approximately 16 amino acids to approximately 30 amino acids, approximately 16 amino acids to approximately 25 amino acids, approximately 16 amino acids to approximately 24 amino acids, approximately 16 amino acids to approximately 22 amino acids, approximately 16 amino acids to approximately 20 amino acids, approximately 16 amino acids to approximately 18 amino acids, approximately 18 amino acids to approximately 100 amino acids, approximately 18 amino acids to approximately 90 amino acids, approximately 18 amino acids to approximately 80 amino acids, approximately 18 amino acids to approximately 70 amino acids, approximately 18 amino acids to approximately 60 amino acids, approximately 18 amino acids to approximately 50 amino acids, approximately 18 amino acids to Approximately 45 amino acids, approximately 18 to approximately 40 amino acids, approximately 18 to approximately 35 amino acids, approximately 18 to approximately 30 amino acids, approximately 18 to approximately 25 amino acids, approximately 18 to approximately 24 amino acids, approximately 18 to approximately 22 amino acids, approximately 18 to approximately 20 amino acids, approximately 20 to approximately 100 amino acids, approximately 20 to approximately 90 amino acids, approximately 20 to approximately 80 amino acids, approximately 20 to approximately 70 amino acids, approximately 20 to approximately 60 amino acids, approximately 20 to approximately 50 amino acids, approximately 20 to approximately 45 amino acids, approximately 20 to approximately 40 amino acids,Approximately 20 to 35 amino acids, approximately 20 to 30 amino acids, approximately 20 to 25 amino acids, approximately 20 to 24 amino acids, approximately 20 to 22 amino acids, approximately 22 to 100 amino acids, approximately 22 to 90 amino acids, approximately 22 to 80 amino acids, approximately 22 to 70 amino acids, approximately 22 to 60 amino acids, approximately 22 to 50 amino acids, approximately 22 to 45 amino acids, approximately 22 to 40 amino acids, approximately 22 to 35 amino acids, approximately 22 to 30 amino acids, approximately 22 amino acids Approximately 25 amino acids, approximately 22 to approximately 24 amino acids, approximately 25 to approximately 100 amino acids, approximately 25 to approximately 90 amino acids, approximately 25 to approximately 80 amino acids, approximately 25 to approximately 70 amino acids, approximately 25 to approximately 60 amino acids, approximately 25 to approximately 50 amino acids, approximately 25 to approximately 45 amino acids, approximately 25 to approximately 40 amino acids, approximately 25 to approximately 35 amino acids, approximately 25 to approximately 30 amino acids, approximately 30 to approximately 100 amino acids, approximately 30 to approximately 90 amino acids, approximately 30 to approximately 80 amino acids, approximately 30 to approximately 70 amino acids, Approximately 30 to 60 amino acids, approximately 30 to 50 amino acids, approximately 30 to 45 amino acids, approximately 30 to 40 amino acids, approximately 30 to 35 amino acids, approximately 35 to 100 amino acids, approximately 35 to 90 amino acids, approximately 35 to 80 amino acids, approximately 35 to 70 amino acids, approximately 35 to 60 amino acids, approximately 35 to 50 amino acids, approximately 35 to 45 amino acids, approximately 35 to 40 amino acids, approximately 40 to 100 amino acids, approximately 40 to 90 amino acids, approximately 40 amino acids Approximately 80 amino acids, approximately 40 to approximately 70 amino acids, approximately 40 to approximately 60 amino acids, approximately 40 to approximately 50 amino acids, approximately 40 to approximately 45 amino acids, approximately 45 to approximately 100 amino acids, approximately 45 to approximately 90 amino acids, approximately 45 to approximately 80 amino acids, approximately 45 to approximately 70 amino acids, approximately 45 to approximately 60 amino acids, approximately 45 to approximately 50 amino acids, approximately 50 to approximately 100 amino acids, approximately 50 to approximately 90 amino acids, approximately 50 to approximately 80 amino acids, approximately 50 to approximately 70 amino acids, approximately 50 to approximately 60 amino acids,The linker may have a total length of approximately 60 to 100 amino acids, approximately 60 to 90 amino acids, approximately 60 to 80 amino acids, approximately 60 to 70 amino acids, approximately 70 to 100 amino acids, approximately 70 to 90 amino acids, approximately 70 to 80 amino acids, approximately 80 to 100 amino acids, approximately 80 to 90 amino acids, or approximately 90 to 100 amino acids. In some embodiments, the linker is rich in glycine (Gly or G) residues. In some embodiments, the linker is rich in serine (Ser or S) residues. In some embodiments, the linker is rich in both glycine and serine residues. In some embodiments, the linker has one or more glycine-serine residue pairs (GS), for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more GS pairs. In some embodiments, the linker has one or more Gly-Gly-Gly-Ser (GGGS) sequences, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more GGGS sequences. In some embodiments, the linker has one or more Gly-Gly-Gly-Gly-Ser (GGGGS) sequences, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more GGGGS sequences. In some embodiments, the linker has one or more Gly-Gly-Ser-Gly (GGSG) sequences, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more GGGSG sequences.

[0134] In some embodiments, the linker sequence may include or consist of GGGGSGGGGSGGGGS (Sequence ID 20). In some embodiments, the linker sequence is It may be encoded by nucleic acids containing or composed of GGCGGTGGAGGATCCGGAGGAGGTGGCTCCGGCGGCGGAGGATCT (Sequence ID 21). In some embodiments, the linker sequence may contain or composed of GGGSGGGS.

[0135] Target-binding domain In some embodiments of any of the polychain chimeric polypeptides described herein, the first target-binding domain, the second target-binding domain, and / or an additional one or more target-binding domains may be an antigen-binding domain that specifically binds to a ligand of TGF-βRII (e.g., any of the exemplary antigen-binding domains described herein or known in the art) or a soluble interleukin or cytokine receptor that specifically binds to a ligand of TGF-βRII (e.g., any of the exemplary soluble interleukin receptors or soluble cytokine receptors described herein).

[0136] In some embodiments of any of the polychain chimeric polypeptides described herein, the first target-binding domain, the second target-binding domain, and / or one or more additional target-binding domains are each independently: about 5 to about 1000 amino acids, about 5 to about 950 amino acids, about 5 to about 900 amino acids, about 5 to about 850 amino acids, about 5 to about 800 amino acids, about 5 to about 750 amino acids, about 5 to about 700 amino acids, about 5 to about 650 amino acids, about 5 to about 600 amino acids, about 5 to about 550 amino acids, about 5 to about 500 amino acids, about 5 to about 450 amino acids, and about 5 to about 400 amino acids. Approximately 5 amino acids to approximately 350 amino acids, approximately 5 amino acids to approximately 300 amino acids, approximately 5 amino acids to approximately 280 amino acids, approximately 5 amino acids to approximately 260 amino acids, approximately 5 amino acids to approximately 240 amino acids, approximately 5 amino acids to approximately 220 amino acids, approximately 5 amino acids to approximately 200 amino acids, approximately 5 amino acids to approximately 195 amino acids, approximately 5 amino acids to approximately 190 amino acids, approximately 5 amino acids to approximately 185 amino acids, approximately 5 amino acids to approximately 180 amino acids, approximately 5 amino acids to approximately 175 amino acids, approximately 5 amino acids to approximately 170 amino acids, approximately 5 amino acids to approximately 165 amino acids, approximately 5 amino acids to approximately 160 amino acids, approximately 5 amino acids to approximately 155 amino acids, approximately 5 amino acids to approximately 150 amino acids, approximately 5 amino acids to approximately 145 amino acids, approximately 5 amino acids to approximately 140 amino acids, approximately 5 amino acids to approximately 135 amino acids, approximately 5 amino acids to approximately 130 amino acids, approximately 5 amino acids to approximately 145 amino acids, approximately 5 amino acids to approximately 135 amino acids, approximately 5 amino acids to approximately 135 amino acids, approximately 5 amino acids to approximately 14 Approximately 125 amino acids, approximately 5 to approximately 120 amino acids, approximately 5 to approximately 115 amino acids, approximately 5 to approximately 110 amino acids, approximately 5 to approximately 105 amino acids, approximately 5 to approximately 100 amino acids, approximately 5 to approximately 95 amino acids, approximately 5 to approximately 90 amino acids, approximately 5 to approximately 85 amino acids, approximately 5 to approximately 80 amino acids, approximately 5 to approximately 75 amino acids, approximately 5 to approximately 70 amino acids, approximately 5 to approximately 65 amino acids, approximately 5 to approximately 60 amino acids, approximately 5 to approximately 55 amino acids, approximately 5 to approximately 50 amino acids, approximately 5 to approximately 45 amino acids, approximately 5 to approximately 40 amino acids, approximately 5 to approximately 35 amino acids, approximately 5 to approximately 30 amino acids, approximately 5 to approximately 25 amino acids, approximately 5 to approximately 20 amino acids, approximately 5 to approximately 15 amino acids,Approximately 5 amino acids to approximately 10 amino acids, approximately 10 amino acids to approximately 1000 amino acids, approximately 10 amino acids to approximately 950 amino acids, approximately 10 amino acids to approximately 900 amino acids, approximately 10 amino acids to approximately 850 amino acids, approximately 10 amino acids to approximately 800 amino acids, approximately 10 amino acids to approximately 750 amino acids, approximately 10 amino acids to approximately 700 amino acids, approximately 10 amino acids to approximately 650 amino acids, approximately 10 amino acids to approximately 600 amino acids, approximately 10 amino acids to approximately 550 amino acids, approximately 10 amino acids to approximately 500 amino acids, approximately 10 amino acids to approximately 450 amino acids, approximately 10 amino acids to approximately 400 amino acids, approximately 10 amino acids to approximately 350 amino acids, approximately 10 amino acids to approximately 300 amino acids, approximately 10 amino acids to approximately 280 amino acids, approximately 10 amino acids to approximately 260 amino acids, approximately 10 amino acids to approximately 240 amino acids, approximately 10 amino acids to approximately 220 amino acids, approximately 10 amino acids to approximately 200 amino acids, approximately 10 amino acids to approximately 195 amino acids, approximately 10 amino acids to approximately 190 amino acids, approximately 10 amino acids to approximately 185 amino acids, approximately 10 amino acids to approximately 180 amino acids, approximately 10 amino acids to approximately 175 amino acids, approximately 10 amino acids to approximately 170 amino acids, approximately 10 amino acids to approximately 165 amino acids, approximately 10 amino acids to approximately 160 amino acids, approximately 10 amino acids to approximately 155 amino acids, approximately 10 amino acids to approximately 150 amino acids, approximately 10 amino acids to approximately 145 amino acids, approximately 10 amino acids to approximately 140 amino acids, approximately 10 amino acids to approximately 135 amino acids, approximately 10 amino acids to approximately 130 amino acids, approximately 10 amino acids to approximately 125 amino acids, approximately 10 amino acids to approximately 120 amino acids, approximately 10 amino acids to approximately 115 amino acids, approximately 10 amino acids to approximately 110 amino acids, approximately 10 amino acids to approximately 105 amino acids, approximately 10 amino acids to approximately 100 amino acids, approximately 10 amino acids to approximately 95 amino acids, approximately 10 amino acids to approximately 90 amino acids, approximately 10 amino acids to approximately 85 Amino acids, approximately 10 to 80 amino acids, approximately 10 to 75 amino acids, approximately 10 to 70 amino acids, approximately 10 to 65 amino acids, approximately 10 to 60 amino acids, approximately 10 to 55 amino acids, approximately 10 to 50 amino acids, approximately 10 to 45 amino acids, approximately 10 to 40 amino acids, approximately 10 to 35 amino acids, approximately 10 to 30 amino acids, approximately 10 to 25 amino acids, approximately 10 to 20 amino acids, approximately 10 to 15 amino acids, approximately 15 to 1000 amino acids,Approximately 15 amino acids to approximately 950 amino acids, approximately 15 amino acids to approximately 900 amino acids, approximately 15 amino acids to approximately 850 amino acids, approximately 15 amino acids to approximately 800 amino acids, approximately 15 amino acids to approximately 750 amino acids, approximately 15 amino acids to approximately 700 amino acids, approximately 15 amino acids to approximately 650 amino acids, approximately 15 amino acids to approximately 600 amino acids, approximately 15 amino acids to approximately 550 amino acids, approximately 15 amino acids to approximately 500 amino acids, approximately 15 amino acids to approximately 450 amino acids, approximately 15 amino acids to approximately 400 amino acids, approximately 15 amino acids to approximately 350 amino acids, approximately 15 amino acids to approximately 300 amino acids, approximately 15 amino acids to approximately 280 amino acids, approximately 15 amino acids to approximately 260 amino acids, approximately 15 amino acids to approximately 240 amino acids, approximately 15 amino acids to approximately 220 amino acids, approximately 15 amino acids to approximately 200 amino acids, approximately 15 amino acids to approximately 195 amino acids, approximately 15 amino acids to approximately 190 amino acids, approximately 15 amino acids to approximately 185 amino acids, approximately 15 amino acids to approximately 180 amino acids, approximately 15 amino acids to approximately 175 amino acids, approximately 15 amino acids to approximately 170 amino acids, approximately 15 amino acids to approximately 165 amino acids, approximately 15 amino acids to approximately 160 amino acids, approximately 15 amino acids to approximately 155 amino acids, approximately 15 amino acids to approximately 150 amino acids, approximately 15 amino acids to approximately 145 amino acids, approximately 15 amino acids to approximately 140 amino acids, approximately 15 amino acids to approximately 135 amino acids, approximately 15 amino acids to approximately 130 amino acids, approximately 15 amino acids to approximately 125 amino acids, approximately 15 amino acids to approximately 120 amino acids, approximately 15 amino acids to approximately 115 amino acids, approximately 15 amino acids to approximately 110 amino acids, approximately 15 amino acids to approximately 105 amino acids, approximately 15 amino acids to approximately 100 amino acids, approximately 15 amino acids to approximately 95 amino acids, approximately 15 amino acids to approximately 90 amino acids, approximately 15 amino acids to approximately 85 amino acids, approximately 15 amino acids to approximately 80 amino acids, approximately 15 amino acids to approximately 75 amino acids Acid, approximately 15 amino acids to approximately 70 amino acids, approximately 15 amino acids to approximately 65 amino acids, approximately 15 amino acids to approximately 60 amino acids, approximately 15 amino acids to approximately 55 amino acids, approximately 15 amino acids to approximately 50 amino acids, approximately 15 amino acids to approximately 45 amino acids, approximately 15 amino acids to approximately 40 amino acids, approximately 15 amino acids to approximately 35 amino acids, approximately 15 amino acids to approximately 30 amino acids, approximately 15 amino acids to approximately 25 amino acids, approximately 15 amino acids to approximately 20 amino acids, approximately 20 amino acids to approximately 1000 amino acids, approximately 20 amino acids to approximately 950 amino acids, approximately 20 amino acids to approximately 900 amino acids, approximately 20 amino acids to approximately 850 amino acids,Approximately 20 amino acids to approximately 800 amino acids, approximately 20 amino acids to approximately 750 amino acids, approximately 20 amino acids to approximately 700 amino acids, approximately 20 amino acids to approximately 650 amino acids, approximately 20 amino acids to approximately 600 amino acids, approximately 20 amino acids to approximately 550 amino acids, approximately 20 amino acids to approximately 500 amino acids, approximately 20 amino acids to approximately 450 amino acids, approximately 20 amino acids to approximately 400 amino acids, approximately 20 amino acids to approximately 350 amino acids, approximately 20 amino acids to approximately 300 amino acids, approximately 20 amino acids to approximately 280 amino acids, approximately 20 amino acids to approximately 260 amino acids, approximately 20 amino acids to approximately 240 amino acids, approximately 20 amino acids to approximately 220 amino acids, approximately 20 to approximately 200 amino acids, approximately 20 to approximately 195 amino acids, approximately 20 to approximately 190 amino acids, approximately 20 to approximately 185 amino acids, approximately 20 to approximately 180 amino acids, approximately 20 to approximately 175 amino acids, approximately 20 to approximately 170 amino acids, approximately 20 to approximately 165 amino acids, approximately 20 to approximately 160 amino acids, approximately 20 to approximately 155 amino acids, approximately 20 to approximately 150 amino acids, approximately 20 to approximately 145 amino acids, approximately 20 to approximately 140 amino acids, approximately 20 to approximately 135 amino acids, approximately 20 amino acids to approximately 130 amino acids, approximately 20 amino acids to approximately 125 amino acids, approximately 20 amino acids to approximately 120 amino acids, approximately 20 amino acids to approximately 115 amino acids, approximately 20 amino acids to approximately 110 amino acids, approximately 20 amino acids to approximately 105 amino acids, approximately 20 amino acids to approximately 100 amino acids, approximately 20 amino acids to approximately 95 amino acids, approximately 20 amino acids to approximately 90 amino acids, approximately 20 amino acids to approximately 85 amino acids, approximately 20 amino acids to approximately 80 amino acids, approximately 20 amino acids to approximately 75 amino acids, approximately 20 amino acids to approximately 70 amino acids, approximately 20 amino acids to approximately 65 amino acids, approximately 20 amino acids to approximately 60 amino acids, approximately 20 amino acids to approximately 55 amino acids, approximately 20 amino acids to approximately 50 amino acids, approximately 20 amino acids to approximately 45 amino acids, approximately 20 amino acids to approximately 40 amino acids, approximately 20 amino acids to approximately 35 amino acids, approximately 20 amino acids to approximately 30 amino acids, approximately 20 amino acids to approximately 25 amino acids, approximately 25 amino acids to approximately 1000 amino acids, approximately 25 amino acids to approximately 950 amino acids, approximately 25 amino acids to approximately 900 amino acids, approximately 25 amino acids to approximately 850 amino acids, approximately 25 amino acids to approximately 800 amino acids, approximately 25 amino acids to approximately 750 amino acids, approximately 25 amino acids to approximately 700 amino acids, approximately 25 amino acids to approximately 650 amino acids,Approximately 25 amino acids to approximately 600 amino acids, approximately 25 amino acids to approximately 550 amino acids, approximately 25 amino acids to approximately 500 amino acids, approximately 25 amino acids to approximately 450 amino acids, approximately 25 amino acids to approximately 400 amino acids, approximately 25 amino acids to approximately 350 amino acids, approximately 25 amino acids to approximately 300 amino acids, Approximately 25 amino acids to approximately 280 amino acids, approximately 25 amino acids to approximately 260 amino acids, approximately 25 amino acids to approximately 240 amino acids, approximately 25 amino acids to approximately 220 amino acids, approximately 25 amino acids to approximately 200 amino acids, approximately 25 amino acids to approximately 195 amino acids, approximately 25 amino acids to approximately 190 amino acids, approximately 25 amino acids to approximately 185 amino acids, approximately 25 amino acids to approximately 180 amino acids, approximately 25 amino acids to approximately 175 amino acids, approximately 25 amino acids to approximately 170 amino acids, approximately 25 amino acids to approximately 165 amino acids, approximately 25 amino acids to approximately 160 amino acids, approximately 25 amino acids to approximately 155 amino acids, approximately 25 amino acids to approximately 150 amino acids, approximately 25 to 145 amino acids, approximately 25 to 140 amino acids, approximately 25 to 135 amino acids, approximately 25 to 130 amino acids, approximately 25 to 125 amino acids, approximately 25 to 120 amino acids, approximately 25 to 115 amino acids, approximately 25 to 110 amino acids, approximately 25 to 105 amino acids, approximately 25 to 100 amino acids, approximately 25 to 95 amino acids, approximately 25 to 90 amino acids, approximately 25 to 85 amino acids, approximately 25 to 80 amino acids, approximately 25 amino acids Acid ~ approximately 75 amino acids, approximately 25 amino acids ~ approximately 70 amino acids, approximately 25 amino acids ~ approximately 65 amino acids, approximately 25 amino acids ~ approximately 60 amino acids, approximately 25 amino acids ~ approximately 55 amino acids, approximately 25 amino acids ~ approximately 50 amino acids, approximately 25 amino acids ~ approximately 45 amino acids, approximately 25 amino acids ~ approximately 40 amino acids, approximately 25 amino acids ~ approximately 35 amino acids, approximately 25 amino acids ~ approximately 30 amino acids, approximately 30 amino acids ~ approximately 1000 amino acids, approximately 30 amino acids ~ approximately 950 amino acids, approximately 30 amino acids ~ approximately 900 amino acids, approximately 30 amino acids ~ approximately 850 amino acids, approximately 30 amino acids ~ approximately 800 amino acids, approximately 30 amino acids ~750 amino acids, ~700 amino acids, ~650 amino acids, ~600 amino acids, ~550 amino acids, ~500 amino acids, ~500 amino acids, ~450 amino acids, ~400 amino acids, ~30 amino acids, ~30 amino acids, ~350 amino acids, ~30 amino acids, ~300 amino acids, ~280 amino acids, ~260 amino acids, ~240 amino acids, ~220 amino acids, ~200 amino acidsApproximately 30 amino acids to approximately 195 amino acids, approximately 30 amino acids to approximately 190 amino acids, approximately 30 amino acids to approximately 185 amino acids, approximately 30 amino acids to approximately 180 amino acids, approximately 30 amino acids to approximately 175 amino acids, approximately 30 amino acids to approximately 170 amino acids, approximately 30 amino acids to approximately 165 amino acids, approximately 30 amino acids to approximately 160 amino acids, approximately 30 amino acids to approximately 155 amino acids, approximately 30 amino acids to approximately 150 amino acids, approximately 30 amino acids to approximately 145 amino acids, approximately 30 amino acids to approximately 140 amino acids, approximately 30 amino acids to approximately 135 amino acids, approximately 30 amino acids to approximately 130 amino acids, approximately 30 amino acids to approximately 125 amino acids, approximately 30 to 120 amino acids, approximately 30 to 115 amino acids, approximately 30 to 110 amino acids, approximately 30 to 105 amino acids, approximately 30 to 100 amino acids, approximately 30 to 95 amino acids, approximately 30 to 90 amino acids, approximately 30 to 85 amino acids, approximately 30 to 80 amino acids, approximately 30 to 75 amino acids, approximately 30 to 70 amino acids, approximately 30 to 65 amino acids, approximately 30 to 60 amino acids, approximately 30 to 55 amino acids, approximately 30 to 50 Amino acids, approximately 30 amino acids to approximately 45 amino acids, approximately 30 amino acids to approximately 40 amino acids, approximately 30 amino acids to approximately 35 amino acids, approximately 35 amino acids to approximately 1000 amino acids, approximately 35 amino acids to approximately 950 amino acids, approximately 35 amino acids to approximately 900 amino acids, approximately 35 amino acids to approximately 850 amino acids, approximately 35 amino acids to approximately 800 amino acids, approximately 35 amino acids to approximately 750 amino acids, approximately 35 amino acids to approximately 700 amino acids, approximately 35 amino acids to approximately 650 amino acids, approximately 35 amino acids to approximately 600 amino acids, approximately 35 amino acids to approximately 550 amino acids, approximately 35 amino acids to approximately 500 amino acids, approximately 35 amino acids ~Approximately 450 amino acids, approximately 35 amino acids~Approximately 400 amino acids, approximately 35 amino acids~Approximately 350 amino acids, approximately 35 amino acids~Approximately 300 amino acids, approximately 35 amino acids~Approximately 280 amino acids, approximately 35 amino acids~Approximately 260 amino acids, approximately 35 amino acids~Approximately 240 amino acids, approximately 35 amino acids~Approximately 220 amino acids, approximately 35 amino acids~Approximately 200 amino acids, approximately 35 amino acids~Approximately 195 amino acids, approximately 35 amino acids~Approximately 190 amino acids, approximately 35 amino acids~Approximately 185 amino acids, approximately 35 amino acids~Approximately 180 amino acids, approximately 35 amino acids~Approximately 175 amino acids, approximately 35 amino acids~Approximately 170 amino acids,Approximately 35 amino acids to approximately 165 amino acids, approximately 35 amino acids to approximately 160 amino acids, approximately 35 amino acids to approximately 155 amino acids, approximately 35 amino acids to approximately 150 amino acids, approximately 35 amino acids to approximately 145 amino acids, approximately 35 amino acids to approximately 140 amino acids, approximately 35 amino acids to approximately 135 amino acids, approximately 35 amino acids to approximately 130 amino acids, approximately 35 amino acids to approximately 125 amino acids, approximately 35 amino acids to approximately 120 amino acids, approximately 35 amino acids to approximately 115 amino acids, approximately 35 amino acids to approximately 110 amino acids, approximately 35 amino acids to approximately 105 amino acids, approximately 35 amino acids to approximately 100 amino acids, approximately 35 amino acids to approximately 9 5 amino acids, approximately 35 to 90 amino acids, approximately 35 to 85 amino acids, approximately 35 to 80 amino acids, approximately 35 to 75 amino acids, approximately 35 to 70 amino acids, approximately 35 to 65 amino acids, approximately 35 to 60 amino acids, approximately 35 to 55 amino acids, approximately 35 to 50 amino acids, approximately 35 to 45 amino acids, approximately 35 to 40 amino acids, approximately 40 to 1000 amino acids, approximately 40 to 950 amino acids, approximately 40 to 900 amino acids, approximately 40 to 850 amino acids 0 amino acids, approximately 40 to 800 amino acids, approximately 40 to 750 amino acids, approximately 40 to 700 amino acids, approximately 40 to 650 amino acids, approximately 40 to 600 amino acids, approximately 40 to 550 amino acids, approximately 40 to 500 amino acids, approximately 40 to 450 amino acids, approximately 40 to 400 amino acids, approximately 40 to 350 amino acids, approximately 40 to 300 amino acids, approximately 40 to 280 amino acids, approximately 40 to 260 amino acids, approximately 40 to 240 amino acids, approximately 40 amino acids ~approximately 220 amino acids, approximately 40 amino acids~approximately 200 amino acids, approximately 40 amino acids~approximately 195 amino acids, approximately 40 amino acids~approximately 190 amino acids, approximately 40 amino acids~approximately 185 amino acids, approximately 40 amino acids~approximately 180 amino acids, approximately 40 amino acids~approximately 175 amino acids, approximately 40 amino acids~approximately 170 amino acids, approximately 40 amino acids~approximately 165 amino acids, approximately 40 amino acids~approximately 160 amino acids, approximately 40 amino acids~approximately 155 amino acids, approximately 40 amino acids~approximately 150 amino acids, approximately 40 amino acids~approximately 145 amino acids, approximately 40 amino acids~approximately 140 amino acids, approximately 40 amino acids~approximately 135 amino acids,Approximately 40 amino acids to approximately 130 amino acids, approximately 40 amino acids to approximately 125 amino acids, approximately 40 amino acids to approximately 120 amino acids, approximately 40 amino acids to approximately 115 amino acids, approximately 40 amino acids to approximately 110 amino acids, approximately 40 amino acids to approximately 105 amino acids, approximately 40 amino acids to approximately 100 amino acids, approximately 40 amino acids to approximately 95 amino acids, approximately 40 amino acids to approximately 90 amino acids, approximately 40 amino acids to approximately 85 amino acids, approximately 40 amino acids to approximately 80 amino acids, approximately 40 amino acids to approximately 75 amino acids, approximately 40 amino acids to approximately 70 amino acids, approximately 40 amino acids to approximately 65 amino acids, approximately 40 amino acids to approximately 60 amino acids, approximately 40 amino acids to approximately 55 amino acids, approximately 40 amino acids to approximately 50 amino acids, approximately 40 amino acids to approximately 45 amino acids, approximately 45 amino acids to approximately 1000 amino acids, approximately 45 amino acids to approximately 950 amino acids, approximately 45 amino acids to approximately 900 amino acids, approximately 45 amino acids to approximately 850 amino acids, approximately 45 amino acids to approximately 800 amino acids, approximately 45 amino acids to approximately 750 amino acids, approximately 45 amino acids to approximately 700 amino acids, approximately 45 amino acids to approximately 650 amino acids, approximately 45 amino acids to approximately 600 amino acids, approximately 45 amino acids to approximately 550 amino acids, approximately 45 amino acids to approximately 500 amino acids, approximately 45 amino acids to approximately 450 amino acids Mino acids, approximately 45 amino acids to approximately 400 amino acids, approximately 45 amino acids to approximately 350 amino acids, approximately 45 amino acids to approximately 300 amino acids, approximately 45 amino acids to approximately 280 amino acids, approximately 45 amino acids to approximately 260 amino acids, approximately 45 amino acids to approximately 240 amino acids, approximately 45 amino acids to approximately 220 amino acids, approximately 45 amino acids to approximately 200 amino acids, approximately 45 amino acids to approximately 195 amino acids, approximately 45 amino acids to approximately 190 amino acids, approximately 45 amino acids to approximately 185 amino acids, approximately 45 amino acids to approximately 180 amino acids, approximately 45 amino acids to approximately 175 amino acids, approximately 45 amino acids to approximately 170 amino acids, approximately 45 amino acids Acid ~ approximately 165 amino acids, approximately 45 amino acids ~ approximately 160 amino acids, approximately 45 amino acids ~ approximately 155 amino acids, approximately 45 amino acids ~ approximately 150 amino acids, approximately 45 amino acids ~ approximately 145 amino acids, approximately 45 amino acids ~ approximately 140 amino acids, approximately 45 amino acids ~ approximately 135 amino acids, approximately 45 amino acids ~ approximately 130 amino acids, approximately 45 amino acids ~ approximately 125 amino acids, approximately 45 amino acids ~ approximately 120 amino acids, approximately 45 amino acids ~ approximately 115 amino acids, approximately 45 amino acids ~ approximately 110 amino acids, approximately 45 amino acids ~ approximately 105 amino acids, approximately 45 amino acids ~ approximately 100 amino acids, approximately 45 amino acids ~ approximately 95 amino acids,Approximately 45 amino acids to approximately 90 amino acids, approximately 45 amino acids to approximately 85 amino acids, approximately 45 amino acids to approximately 80 amino acids, approximately 45 amino acids to approximately 75 amino acids, approximately 45 amino acids to approximately 70 amino acids, approximately 45 amino acids to approximately 65 amino acids, approximately 45 amino acids to approximately 60 amino acids, approximately 45 amino acids to approximately 55 amino acids, approximately 45 amino acids to approximately 50 amino acids, approximately 50 amino acids to approximately 1000 amino acids, approximately 50 amino acids to approximately 950 amino acids, approximately 50 amino acids to approximately 900 amino acids, approximately 50 amino acids to approximately 850 amino acids, approximately 50 amino acids to approximately 800 amino acids, approximately 50 amino acids to approximately 750 amino acids, approximately 50 amino acids to approximately 700 amino acids, approximately 50 amino acids to approximately 650 amino acids, approximately 50 amino acids to approximately 600 amino acids, approximately 50 amino acids to approximately 550 amino acids, Approximately 50 amino acids to approximately 500 amino acids, approximately 50 amino acids to approximately 450 amino acids, approximately 50 amino acids to approximately 400 amino acids, approximately 50 amino acids to approximately 350 amino acids, approximately 50 amino acids to approximately 300 amino acids, approximately 50 amino acids to approximately 280 amino acids, approximately 50 amino acids to approximately 260 amino acids, approximately 50 amino acids to approximately 240 amino acids, approximately 50 amino acids to approximately 220 amino acids, approximately 50 amino acids to approximately 200 amino acids, approximately 50 amino acids to approximately 195 amino acids, approximately 50 amino acids to approximately 190 amino acids, approximately 50 amino acids to approximately 185 amino acids, approximately 50 amino acids to approximately 180 amino acids, approximately 50 amino acids to approximately 1 75 amino acids, approximately 50 amino acids to approximately 170 amino acids, approximately 50 amino acids to approximately 165 amino acids, approximately 50 amino acids to approximately 160 amino acids, approximately 50 amino acids to approximately 155 amino acids, approximately 50 amino acids to approximately 150 amino acids, approximately 50 amino acids to approximately 145 amino acids, approximately 50 amino acids to approximately 140 amino acids, approximately 50 amino acids to approximately 135 amino acids, approximately 50 amino acids to approximately 130 amino acids, approximately 50 amino acids to approximately 125 amino acids, approximately 50 amino acids to approximately 120 amino acids, approximately 50 amino acids to approximately 115 amino acids, approximately 50 amino acids to approximately 110 amino acids, approximately 50 amino acids to approximately 105 amino acids, approximately 50 amino acids Mino acids ~ approximately 100 amino acids, approximately 50 amino acids ~ approximately 95 amino acids, approximately 50 amino acids ~ approximately 90 amino acids, approximately 50 amino acids ~ approximately 85 amino acids, approximately 50 amino acids ~ approximately 80 amino acids, approximately 50 amino acids ~ approximately 75 amino acids, approximately 50 amino acids ~ approximately 70 amino acids, approximately 50 amino acids ~ approximately 65 amino acids, approximately 50 amino acids ~ approximately 60 amino acids, approximately 50 amino acids ~ approximately 55 amino acids, approximately 55 amino acids ~ approximately 1000 amino acids, approximately 55 amino acids ~ approximately 950 amino acids, approximately 55 amino acids ~ approximately 900 amino acids, approximately 55 amino acids ~ approximately 850 amino acids, approximately 55 amino acids ~ approximately 800 amino acids, approximately 55 amino acids Acid ~ approximately 750 amino acids, approximately 55 amino acids ~ approximately 700 amino acids, approximately 55 amino acids ~ approximately 650 amino acids, approximately 55 amino acids ~ approximately 600 amino acids, approximately 55 amino acids ~ approximately 550 amino acids, approximately 55 amino acids ~ approximately 500 amino acids, approximately 55 amino acids ~ approximately 450 amino acids, approximately 55 amino acids ~ approximately 400 amino acids, approximately 55 amino acids ~ approximately 350 amino acids, approximately 55 amino acids ~ approximately 300 amino acids, approximately 55 amino acids ~ approximately 280 amino acids, approximately 55 amino acids ~ approximately 260 amino acids, approximately 55 amino acids ~ approximately 240 amino acids, approximately 55 amino acids ~ approximately 220 amino acids, approximately 55 amino acids ~ approximately 200 amino acids,Approximately 55 amino acids to approximately 195 amino acids, approximately 55 amino acids to approximately 190 amino acids, approximately 55 amino acids to approximately 185 amino acids, approximately 55 amino acids to approximately 180 amino acids, approximately 55 amino acids to approximately 175 amino acids, approximately 55 amino acids to approximately 170 amino acids, approximately 55 amino acids to approximately 165 amino acids, approximately 55 amino acids to approximately 160 amino acids, approximately 55 amino acids to approximately 155 amino acids, approximately 55 amino acids to approximately 150 amino acids, approximately 55 amino acids to approximately 145 amino acids, approximately 55 amino acids to approximately 140 amino acids, approximately 55 amino acids to approximately 135 amino acids, approximately 55 amino acids to approximately 130 amino acids, approximately 55 amino acids to approximately 12 5 amino acids, approximately 55 amino acids to approximately 120 amino acids, approximately 55 amino acids to approximately 115 amino acids, approximately 55 amino acids to approximately 110 amino acids, approximately 55 amino acids to approximately 105 amino acids, approximately 55 amino acids to approximately 100 amino acids, approximately 55 amino acids to approximately 95 amino acids, approximately 55 amino acids to approximately 90 amino acids, approximately 55 amino acids to approximately 85 amino acids, approximately 55 amino acids to approximately 80 amino acids, approximately 55 amino acids to approximately 75 amino acids, approximately 55 amino acids to approximately 70 amino acids, approximately 55 amino acids to approximately 65 amino acids, approximately 55 amino acids to approximately 60 amino acids, approximately 60 amino acids to approximately 1000 amino acids, approximately 60 amino acids to approximately 950 Amino acids, approximately 60 amino acids to approximately 900 amino acids, approximately 60 amino acids to approximately 850 amino acids, approximately 60 amino acids to approximately 800 amino acids, approximately 60 amino acids to approximately 750 amino acids, approximately 60 amino acids to approximately 700 amino acids, approximately 60 amino acids to approximately 650 amino acids, approximately 60 amino acids to approximately 600 amino acids, approximately 60 amino acids to approximately 550 amino acids, approximately 60 amino acids to approximately 500 amino acids, approximately 60 amino acids to approximately 450 amino acids, approximately 60 amino acids to approximately 400 amino acids, approximately 60 amino acids to approximately 350 amino acids, approximately 60 amino acids to approximately 300 amino acids, approximately 60 amino acids to approximately 280 amino acids, approximately 60 amino acids Acid ~ approximately 260 amino acids, approximately 60 amino acids ~ approximately 240 amino acids, approximately 60 amino acids ~ approximately 220 amino acids, approximately 60 amino acids ~ approximately 200 amino acids, approximately 60 amino acids ~ approximately 195 amino acids, approximately 60 amino acids ~ approximately 190 amino acids, approximately 60 amino acids ~ approximately 185 amino acids, approximately 60 amino acids ~ approximately 180 amino acids, approximately 60 amino acids ~ approximately 175 amino acids, approximately 60 amino acids ~ approximately 170 amino acids, approximately 60 amino acids ~ approximately 165 amino acids, approximately 60 amino acids ~ approximately 160 amino acids, approximately 60 amino acids ~ approximately 155 amino acids, approximately 60 amino acids ~ approximately 150 amino acids, approximately 60 amino acids ~ approximately 145 amino acids,Approximately 60 to 140 amino acids, approximately 60 to 135 amino acids, approximately 60 to 130 amino acids, approximately 60 to 125 amino acids, approximately 60 to 120 amino acids, approximately 60 to 115 amino acids, approximately 60 to 110 amino acids, approximately 60 to 105 amino acids, approximately 60 to 100 amino acids, approximately 60 to 95 amino acids, approximately 60 to 90 amino acids, approximately 60 to 85 amino acids, approximately 60 to 80 amino acids, approximately 60 to 75 amino acids, approximately 60 to 70 amino acids Approximately 60 to 65 amino acids, approximately 65 to 1000 amino acids, approximately 65 to 950 amino acids, approximately 65 to 900 amino acids, approximately 65 to 850 amino acids, approximately 65 to 800 amino acids, approximately 65 to 750 amino acids, approximately 65 to 700 amino acids, approximately 65 to 650 amino acids, approximately 65 to 600 amino acids, approximately 65 to 550 amino acids, approximately 65 to 500 amino acids, approximately 65 to 450 amino acids, approximately 65 to 400 amino acids, approximately 65 to 3 50 amino acids, approximately 65 amino acids to approximately 300 amino acids, approximately 65 amino acids to approximately 280 amino acids, approximately 65 amino acids to approximately 260 amino acids, approximately 65 amino acids to approximately 240 amino acids, approximately 65 amino acids to approximately 220 amino acids, approximately 65 amino acids to approximately 200 amino acids, approximately 65 amino acids to approximately 195 amino acids, approximately 65 amino acids to approximately 190 amino acids, approximately 65 amino acids to approximately 185 amino acids, approximately 65 amino acids to approximately 180 amino acids, approximately 65 amino acids to approximately 175 amino acids, approximately 65 amino acids to approximately 170 amino acids, approximately 65 amino acids to approximately 165 amino acids, approximately 65 amino acids to approximately 160 amino acids, approximately 65 Amino acids ~ approximately 155 amino acids, approximately 65 amino acids ~ approximately 150 amino acids, approximately 65 amino acids ~ approximately 145 amino acids, approximately 65 amino acids ~ approximately 140 amino acids, approximately 65 amino acids ~ approximately 135 amino acids, approximately 65 amino acids ~ approximately 130 amino acids, approximately 65 amino acids ~ approximately 125 amino acids, approximately 65 amino acids ~ approximately 120 amino acids, approximately 65 amino acids ~ approximately 115 amino acids, approximately 65 amino acids ~ approximately 110 amino acids, approximately 65 amino acids ~ approximately 105 amino acids, approximately 65 amino acids ~ approximately 100 amino acids, approximately 65 amino acids ~ approximately 95 amino acids, approximately 65 amino acids ~ approximately 90 amino acids, approximately 65 amino acids ~ approximately 85 amino acids,Approximately 65 amino acids to approximately 80 amino acids, approximately 65 amino acids to approximately 75 amino acids, approximately 65 amino acids to approximately 70 amino acids, approximately 70 amino acids to approximately 1000 amino acids, approximately 70 amino acids to approximately 950 amino acids, approximately 70 amino acids to approximately 900 amino acids, approximately 70 amino acids to approximately 850 amino acids, approximately 70 amino acids to approximately 800 amino acids, approximately 70 amino acids to approximately 750 amino acids, approximately 70 amino acids to approximately 700 amino acids, approximately 70 amino acids to approximately 650 amino acids, approximately 70 amino acids to approximately 600 amino acids, approximately 70 amino acids to approximately 550 amino acids, approximately 70 amino acids to approximately 500 amino acids, approximately 70 amino acids to approximately 450 amino acids, approximately 70 amino acids to approximately 400 amino acids, approximately 70 amino acids to approximately 350 amino acids, approximately 70 amino acids to approximately 300 amino acids, approximately 70 amino acids to approximately 280 amino acids, approximately 70 amino acids to approximately 260 amino acids, approximately 70 amino acids to approximately 240 amino acids, approximately 70 amino acids to approximately 220 amino acids, approximately 70 amino acids to approximately 200 amino acids, approximately 70 amino acids to approximately 195 amino acids, approximately 70 amino acids to approximately 190 amino acids, approximately 70 amino acids to approximately 185 amino acids, approximately 70 amino acids to approximately 180 amino acids, approximately 70 amino acids to approximately 175 amino acids, approximately 70 amino acids to approximately 170 amino acids, approximately 70 amino acids to approximately 165 amino acids, approximately 70 amino acids to approximately 160 amino acids, approximately 70 amino acids to approximately 155 amino acids, approximately 70 amino acids to approximately 150 amino acids, approximately 70 amino acids to approximately 145 amino acids, approximately 70 amino acids to approximately 140 amino acids, approximately 70 amino acids to approximately 135 amino acids, approximately 70 amino acids to approximately 130 amino acids, approximately 70 amino acids to approximately 125 amino acids, approximately 70 amino acids to approximately 120 amino acids, approximately 70 amino acids to approximately 115 amino acids, approximately 70 amino acids to approximately 110 amino acids, Approximately 70 to 105 amino acids, approximately 70 to 100 amino acids, approximately 70 to 95 amino acids, approximately 70 to 90 amino acids, approximately 70 to 85 amino acids, approximately 70 to 80 amino acids, approximately 70 to 75 amino acids, approximately 75 to 1000 amino acids, approximately 75 to 950 amino acids, approximately 75 to 900 amino acids, approximately 75 to 850 amino acids, approximately 75 to 800 amino acids, approximately 75 to 750 amino acids, approximately 75 to 700 amino acids, approximately 75 to 650 amino acids Acid, approximately 75 amino acids to approximately 600 amino acids, approximately 75 amino acids to approximately 550 amino acids, approximately 75 amino acids to approximately 500 amino acids, approximately 75 amino acids to approximately 450 amino acids, approximately 75 amino acids to approximately 400 amino acids, approximately 75 amino acids to approximately 350 amino acids, approximately 75 amino acids to approximately 300 amino acids, approximately 75 amino acids to approximately 280 amino acids, approximately 75 amino acids to approximately 260 amino acids, approximately 75 amino acids to approximately 240 amino acids, approximately 75 amino acids to approximately 220 amino acids, approximately 75 amino acids to approximately 200 amino acids, approximately 75 amino acids to approximately 195 amino acids, approximately 75 amino acids to approximately 190 amino acids, approximately 75 amino acids to approximately 185 amino acids, approximately 75 amino acids to approximately 180 amino acids, approximately 75 amino acids to approximately 175 amino acids, approximately 75 amino acids to approximately 170 amino acids, approximately 75 amino acids to approximately 165 amino acids, approximately 75 amino acids to approximately 160 amino acids, approximately 75 amino acids to approximately 155 amino acids, approximately 75 amino acids to approximately 150 amino acids, approximately 75 amino acids to approximately 145 amino acids, approximately 75 amino acids to approximately 140 amino acids, approximately 75 amino acids to approximately 135 amino acids, approximately 75 amino acids to approximately 130 amino acids, approximately 75 amino acids to approximately 125 amino acids, approximately 75 amino acids to approximately 120 amino acids, approximately 75 amino acids to approximately 115 amino acids, approximately 75 Amino acids ~ approximately 110 amino acids, approximately 75 amino acids ~ approximately 105 amino acids, approximately 75 amino acids ~ approximately 100 amino acids, approximately 75 amino acids ~ approximately 95 amino acids, approximately 75 amino acids ~ approximately 90 amino acids, approximately 75 amino acids ~ approximately 85 amino acids, approximately 75 amino acids ~ approximately 80 amino acids, approximately 80 amino acids ~ approximately 1000 amino acids, approximately 80 amino acids ~ approximately 950 amino acids, approximately 80 amino acids ~ approximately 900 amino acids, approximately 80 amino acids ~ approximately 850 amino acids, approximately 80 amino acids ~ approximately 800 amino acids, approximately 80 amino acids ~ approximately 750 amino acids, approximately 80 amino acids ~ approximately 700 amino acids, approximately 80 amino acids ~ approximately 650 amino acids,Approximately 80 amino acids to approximately 600 amino acids, approximately 80 amino acids to approximately 550 amino acids, approximately 80 amino acids to approximately 500 amino acids, approximately 80 amino acids to approximately 450 amino acids, approximately 80 amino acids to approximately 400 amino acids, approximately 80 amino acids to approximately 350 amino acids, approximately 80 amino acids to approximately 300 amino acids, approximately 80 amino acids to approximately 280 amino acids, approximately 80 amino acids to approximately 260 amino acids, approximately 80 amino acids to approximately 240 amino acids, approximately 80 amino acids to approximately 220 amino acids, approximately 80 amino acids to approximately 200 amino acids, approximately 80 amino acids to approximately 195 amino acids, approximately 80 amino acids to approximately 190 amino acids, approximately 80 amino acids to approximately 185 Amino acids, approximately 80 amino acids to approximately 180 amino acids, approximately 80 amino acids to approximately 175 amino acids, approximately 80 amino acids to approximately 170 amino acids, approximately 80 amino acids to approximately 165 amino acids, approximately 80 amino acids to approximately 160 amino acids, approximately 80 amino acids to approximately 155 amino acids, approximately 80 amino acids to approximately 150 amino acids, approximately 80 amino acids to approximately 145 amino acids, approximately 80 amino acids to approximately 140 amino acids, approximately 80 amino acids to approximately 135 amino acids, approximately 80 amino acids to approximately 130 amino acids, approximately 80 amino acids to approximately 125 amino acids, approximately 80 amino acids to approximately 120 amino acids, approximately 80 amino acids to approximately 115 amino acids, approximately 80 amino acids ~Approximately 110 amino acids, approximately 80 amino acids~approximately 105 amino acids, approximately 80 amino acids~approximately 100 amino acids, approximately 80 amino acids~approximately 95 amino acids, approximately 80 amino acids~approximately 90 amino acids, approximately 80 amino acids~approximately 85 amino acids, approximately 85 amino acids~approximately 1000 amino acids, approximately 85 amino acids~approximately 950 amino acids, approximately 85 amino acids~approximately 900 amino acids, approximately 85 amino acids~approximately 850 amino acids, approximately 85 amino acids~approximately 800 amino acids, approximately 85 amino acids~approximately 750 amino acids, approximately 85 amino acids~approximately 700 amino acids, approximately 85 amino acids~approximately 650 amino acids, approximately 85 amino acids~approximately 600 amino acids, approximately 85 amino acids Mino acids ~ approximately 550 amino acids, approximately 85 amino acids ~ approximately 500 amino acids, approximately 85 amino acids ~ approximately 450 amino acids, approximately 85 amino acids ~ approximately 400 amino acids, approximately 85 amino acids ~ approximately 350 amino acids, approximately 85 amino acids ~ approximately 300 amino acids, approximately 85 amino acids ~ approximately 280 amino acids, approximately 85 amino acids ~ approximately 260 amino acids, approximately 85 amino acids ~ approximately 240 amino acids, approximately 85 amino acids ~ approximately 220 amino acids, approximately 85 amino acids ~ approximately 200 amino acids, approximately 85 amino acids ~ approximately 195 amino acids, approximately 85 amino acids ~ approximately 190 amino acids, approximately 85 amino acids ~ approximately 185 amino acids, approximately 85 amino acids ~ approximately 180 amino acids,Approximately 85 amino acids to approximately 175 amino acids, approximately 85 amino acids to approximately 170 amino acids, approximately 85 amino acids to approximately 165 amino acids, approximately 85 amino acids to approximately 160 amino acids, approximately 85 amino acids to approximately 155 amino acids, approximately 85 amino acids to approximately 150 amino acids, approximately 85 amino acids to approximately 145 amino acids, approximately 85 amino acids to approximately 140 amino acids, approximately 85 amino acids to approximately 135 amino acids, approximately 85 amino acids to approximately 130 amino acids, approximately 85 amino acids to approximately 125 amino acids, approximately 85 amino acids to approximately 120 amino acids, approximately 85 amino acids to approximately 115 amino acids, approximately 85 amino acids to approximately 110 amino acids, approximately 85 amino acids to approximately 105 Amino acids, approximately 85 amino acids ~ approximately 100 amino acids, approximately 85 amino acids ~ approximately 95 amino acids, approximately 85 amino acids ~ approximately 90 amino acids, approximately 90 amino acids ~ approximately 1000 amino acids, approximately 90 amino acids ~ approximately 950 amino acids, approximately 90 amino acids ~ approximately 900 amino acids, approximately 90 amino acids ~ approximately 850 amino acids, approximately 90 amino acids ~ approximately 800 amino acids, approximately 90 amino acids ~ approximately 750 amino acids, approximately 90 amino acids ~ approximately 700 amino acids, approximately 90 amino acids ~ approximately 650 amino acids, approximately 90 amino acids ~ approximately 600 amino acids, approximately 90 amino acids ~ approximately 550 amino acids, approximately 90 amino acids ~ approximately 500 amino acids, approximately 90 amino acids ~ Approximately 450 amino acids, approximately 90 amino acids to approximately 400 amino acids, approximately 90 amino acids to approximately 350 amino acids, approximately 90 amino acids to approximately 300 amino acids, approximately 90 amino acids to approximately 280 amino acids, approximately 90 amino acids to approximately 260 amino acids, approximately 90 amino acids to approximately 240 amino acids, approximately 90 amino acids to approximately 220 amino acids, approximately 90 amino acids to approximately 200 amino acids, approximately 90 amino acids to approximately 195 amino acids, approximately 90 amino acids to approximately 190 amino acids, approximately 90 amino acids to approximately 185 amino acids, approximately 90 amino acids to approximately 180 amino acids, approximately 90 amino acids to approximately 175 amino acids, approximately 90 amino acids to approximately 170 amino acids, approximately 90 Amino acids ~ approximately 165 amino acids, approximately 90 amino acids ~ approximately 160 amino acids, approximately 90 amino acids ~ approximately 155 amino acids, approximately 90 amino acids ~ approximately 150 amino acids, approximately 90 amino acids ~ approximately 145 amino acids, approximately 90 amino acids ~ approximately 140 amino acids, approximately 90 amino acids ~ approximately 135 amino acids, approximately 90 amino acids ~ approximately 130 amino acids, approximately 90 amino acids ~ approximately 125 amino acids, approximately 90 amino acids ~ approximately 120 amino acids, approximately 90 amino acids ~ approximately 115 amino acids, approximately 90 amino acids ~ approximately 110 amino acids, approximately 90 amino acids ~ approximately 105 amino acids, approximately 90 amino acids ~ approximately 100 amino acids, approximately 90 amino acids ~ approximately 95 amino acids,Approximately 95 amino acids to approximately 1000 amino acids, approximately 95 amino acids to approximately 950 amino acids, approximately 95 amino acids to approximately 900 amino acids, approximately 95 amino acids to approximately 850 amino acids, approximately 95 amino acids to approximately 800 amino acids, approximately 95 amino acids to approximately 750 amino acids, approximately 95 amino acids to approximately 700 amino acids, approximately 95 amino acids to approximately 650 amino acids, approximately 95 amino acids to approximately 600 amino acids, approximately 95 amino acids to approximately 550 amino acids, approximately 95 amino acids to approximately 500 amino acids, approximately 95 amino acids to approximately 450 amino acids, approximately 95 amino acids to approximately 400 amino acids, approximately 95 amino acids to approximately 350 amino acids, approximately 95 amino acids to Approximately 300 amino acids, approximately 95 to approximately 280 amino acids, approximately 95 to approximately 260 amino acids, approximately 95 to approximately 240 amino acids, approximately 95 to approximately 220 amino acids, approximately 95 to approximately 200 amino acids, approximately 95 to approximately 195 amino acids, approximately 95 to approximately 190 amino acids, approximately 95 to approximately 185 amino acids, approximately 95 to approximately 180 amino acids, approximately 95 to approximately 175 amino acids, approximately 95 to approximately 170 amino acids, approximately 95 to approximately 165 amino acids, approximately 95 to approximately 160 amino acids, approximately 95 to approximately 155 amino acids, Approximately 95 amino acids to approximately 150 amino acids, approximately 95 amino acids to approximately 145 amino acids, approximately 95 amino acids to approximately 140 amino acids, approximately 95 amino acids to approximately 135 amino acids, approximately 95 amino acids to approximately 130 amino acids, approximately 95 amino acids to approximately 125 amino acids, approximately 95 amino acids to approximately 120 amino acids, approximately 95 amino acids to approximately 115 amino acids, approximately 95 amino acids to approximately 110 amino acids, approximately 95 amino acids to approximately 105 amino acids, approximately 95 amino acids to approximately 100 amino acids, approximately 100 amino acids to approximately 1000 amino acids, approximately 100 amino acids to approximately 950 amino acids, approximately 100 amino acids to approximately 900 amino acids, approximately 100 amino acids Mino acids ~ approximately 850 amino acids, approximately 100 amino acids ~ approximately 800 amino acids, approximately 100 amino acids ~ approximately 750 amino acids, approximately 100 amino acids ~ approximately 700 amino acids, approximately 100 amino acids ~ approximately 650 amino acids, approximately 100 amino acids ~ approximately 600 amino acids, approximately 100 amino acids ~ approximately 550 amino acids, approximately 100 amino acids ~ approximately 500 amino acids, approximately 100 amino acids ~ approximately 450 amino acids, approximately 100 amino acids ~ approximately 400 amino acids, approximately 100 amino acids ~ approximately 350 amino acids, approximately 100 amino acids ~ approximately 300 amino acids, approximately 100 amino acids ~ approximately 280 amino acids, approximately 100 amino acids ~ approximately 260 amino acids,Approximately 100 amino acids to approximately 240 amino acids, approximately 100 amino acids to approximately 220 amino acids, approximately 100 amino acids to approximately 200 amino acids, Approximately 100 amino acids to approximately 195 amino acids, approximately 100 amino acids to approximately 190 amino acids, approximately 100 amino acids to approximately 185 amino acids, approximately 100 amino acids to approximately 180 amino acids, approximately 100 amino acids to approximately 175 amino acids, approximately 100 amino acids to approximately 170 amino acids, approximately 100 amino acids to approximately 165 amino acids, approximately 100 amino acids to approximately 160 amino acids, approximately 100 amino acids to approximately 155 amino acids, approximately 100 amino acids to approximately 150 amino acids, approximately 100 amino acids to approximately 145 amino acids, approximately 100 amino acids to approximately 140 amino acids, approximately 100 amino acids to approximately 135 amino acids, approximately 100 amino acids to approximately 130 Amino acids, approximately 100 amino acids to approximately 125 amino acids, approximately 100 amino acids to approximately 120 amino acids, approximately 100 amino acids to approximately 115 amino acids, approximately 100 amino acids to approximately 110 amino acids, approximately 100 amino acids to approximately 105 amino acids, approximately 105 amino acids to approximately 1000 amino acids, approximately 105 amino acids to approximately 950 amino acids, approximately 105 amino acids to approximately 900 amino acids, approximately 105 amino acids to approximately 850 amino acids, approximately 105 amino acids to approximately 800 amino acids, approximately 105 amino acids to approximately 750 amino acids, approximately 105 amino acids to approximately 700 amino acids, approximately 105 amino acids to approximately 650 amino acids, approximately 105 amino acids ~600 amino acids, approximately 105 amino acids~approximately 550 amino acids, approximately 105 amino acids~approximately 500 amino acids, approximately 105 amino acids~approximately 450 amino acids, approximately 105 amino acids~approximately 400 amino acids, approximately 105 amino acids~approximately 350 amino acids, approximately 105 amino acids~approximately 300 amino acids, approximately 105 amino acids~approximately 280 amino acids, approximately 105 amino acids~approximately 260 amino acids, approximately 105 amino acids~approximately 240 amino acids, approximately 105 amino acids~approximately 220 amino acids, approximately 105 amino acids~approximately 200 amino acids, approximately 105 amino acids~approximately 195 amino acids, approximately 105 amino acids~approximately 190 amino acids, approximately 105 Amino acids ~ approximately 185 amino acids, approximately 105 amino acids ~ approximately 180 amino acids, approximately 105 amino acids ~ approximately 175 amino acids, approximately 105 amino acids ~ approximately 170 amino acids, approximately 105 amino acids ~ approximately 165 amino acids, approximately 105 amino acids ~ approximately 160 amino acids, approximately 105 amino acids ~ approximately 155 amino acids, approximately 105 amino acids ~ approximately 150 amino acids, approximately 105 amino acids ~ approximately 145 amino acids, approximately 105 amino acids ~ approximately 140 amino acids, approximately 105 amino acids ~ approximately 135 amino acids, approximately 105 amino acids ~ approximately 130 amino acids, approximately 105 amino acids ~ approximately 125 amino acids, approximately 105 amino acids ~ approximately 120 amino acids,Approximately 105 amino acids to approximately 115 amino acids, approximately 105 amino acids to approximately 110 amino acids, approximately 110 amino acids to approximately 1000 amino acids, approximately 110 amino acids to approximately 950 amino acids, approximately 110 amino acids to approximately 900 amino acids, approximately 110 amino acids to approximately 850 amino acids, approximately 110 amino acids to approximately 800 amino acids, approximately 110 amino acids to approximately 750 amino acids, approximately 110 amino acids to approximately 700 amino acids, approximately 110 amino acids to approximately 650 amino acids, approximately 110 amino acids to approximately 600 amino acids, approximately 110 amino acids to approximately 550 amino acids, approximately 110 amino acids to approximately 500 amino acids, approximately 110 amino acids to approximately 450 Amino acids, approximately 110 amino acids to approximately 400 amino acids, approximately 110 amino acids to approximately 350 amino acids, approximately 110 amino acids to approximately 300 amino acids, approximately 110 amino acids to approximately 280 amino acids, approximately 110 amino acids to approximately 260 amino acids, approximately 110 amino acids to approximately 240 amino acids, approximately 110 amino acids to approximately 220 amino acids, approximately 110 amino acids to approximately 200 amino acids, approximately 110 amino acids to approximately 195 amino acids, approximately 110 amino acids to approximately 190 amino acids, approximately 110 amino acids to approximately 185 amino acids, approximately 110 amino acids to approximately 180 amino acids, approximately 110 amino acids to approximately 175 amino acids, approximately 110 amino acids to approximately 180 amino acids Approximately 170 amino acids, approximately 110 to approximately 165 amino acids, approximately 110 to approximately 160 amino acids, approximately 110 to approximately 155 amino acids, approximately 110 to approximately 150 amino acids, approximately 110 to approximately 145 amino acids, approximately 110 to approximately 140 amino acids, approximately 110 to approximately 135 amino acids, approximately 110 to approximately 130 amino acids, approximately 110 to approximately 125 amino acids, approximately 110 to approximately 120 amino acids, approximately 110 to approximately 115 amino acids, approximately 115 to approximately 1000 amino acids, approximately 115 to approximately 950 amino acids, approximately 115 Amino acids ~ approximately 900 amino acids, approximately 115 amino acids ~ approximately 850 amino acids, approximately 115 amino acids ~ approximately 800 amino acids, approximately 115 amino acids ~ approximately 750 amino acids, approximately 115 amino acids ~ approximately 700 amino acids, approximately 115 amino acids ~ approximately 650 amino acids, approximately 115 amino acids ~ approximately 600 amino acids, approximately 115 amino acids ~ approximately 550 amino acids, approximately 115 amino acids ~ approximately 500 amino acids, approximately 115 amino acids ~ approximately 450 amino acids, approximately 115 amino acids ~ approximately 400 amino acids, approximately 115 amino acids ~ approximately 350 amino acids, approximately 115 amino acids ~ approximately 300 amino acids, approximately 115 amino acids ~ approximately 280 amino acids,Approximately 115 amino acids to approximately 260 amino acids, approximately 115 amino acids to approximately 240 amino acids, approximately 115 amino acids to approximately 220 amino acids, approximately 115 amino acids to approximately 200 amino acids, approximately 115 amino acids to approximately 195 amino acids, approximately 115 amino acids to approximately 190 amino acids, approximately 115 amino acids to approximately 185 amino acids, approximately 115 amino acids to approximately 180 amino acids, approximately 115 amino acids to approximately 175 amino acids, approximately 115 amino acids to approximately 170 amino acids, approximately 115 amino acids to approximately 165 amino acids, approximately 115 amino acids to approximately 160 amino acids, approximately 115 amino acids to approximately 155 amino acids, approximately 115 amino acids to approximately 150 Amino acids, approximately 115 amino acids to approximately 145 amino acids, approximately 115 amino acids to approximately 140 amino acids, approximately 115 amino acids to approximately 135 amino acids, approximately 115 amino acids to approximately 130 amino acids, approximately 115 amino acids to approximately 125 amino acids, approximately 115 amino acids to approximately 120 amino acids, approximately 120 amino acids to approximately 1000 amino acids, approximately 120 amino acids to approximately 950 amino acids, approximately 120 amino acids to approximately 900 amino acids, approximately 120 amino acids to approximately 850 amino acids, approximately 120 amino acids to approximately 800 amino acids, approximately 120 amino acids to approximately 750 amino acids, approximately 120 amino acids to approximately 700 amino acids, approximately 120 amino acids ~650 amino acids, approximately 120 amino acids~600 amino acids, approximately 120 amino acids~550 amino acids, approximately 120 amino acids~500 amino acids, approximately 120 amino acids~450 amino acids, approximately 120 amino acids~400 amino acids, approximately 120 amino acids~350 amino acids, approximately 120 amino acids~300 amino acids, approximately 120 amino acids~280 amino acids, approximately 120 amino acids~260 amino acids, approximately 120 amino acids~240 amino acids, approximately 120 amino acids~220 amino acids, approximately 120 amino acids~200 amino acids, approximately 120 amino acids~195 amino acids, approximately 120 Amino acids ~ approximately 190 amino acids, approximately 120 amino acids ~ approximately 185 amino acids, approximately 120 amino acids ~ approximately 180 amino acids, approximately 120 amino acids ~ approximately 175 amino acids, approximately 120 amino acids ~ approximately 170 amino acids, approximately 120 amino acids ~ approximately 165 amino acids, approximately 120 amino acids ~ approximately 160 amino acids, approximately 120 amino acids ~ approximately 155 amino acids, approximately 120 amino acids ~ approximately 150 amino acids, approximately 120 amino acids ~ approximately 145 amino acids, approximately 120 amino acids ~ approximately 140 amino acids, approximately 120 amino acids ~ approximately 135 amino acids, approximately 120 amino acids ~ approximately 130 amino acids, approximately 120 amino acids ~ approximately 125 amino acids,Approximately 125 amino acids to approximately 1000 amino acids, approximately 125 amino acids to approximately 950 amino acids, approximately 125 amino acids to approximately 900 amino acids, approximately 125 amino acids to approximately 850 amino acids, approximately 125 amino acids to approximately 800 amino acids, approximately 125 amino acids to approximately 750 amino acids, approximately 125 amino acids to approximately 700 amino acids, approximately 125 amino acids to approximately 650 amino acids, approximately 125 amino acids to approximately 600 amino acids, approximately 125 amino acids to approximately 550 amino acids, approximately 125 amino acids to approximately 500 amino acids, approximately 125 amino acids to approximately 450 amino acids Approximately 125 amino acids to approximately 400 amino acids, approximately 125 amino acids to approximately 350 amino acids, approximately 125 amino acids to approximately 300 amino acids, approximately 125 amino acids to approximately 280 amino acids, approximately 125 amino acids to approximately 260 amino acids, approximately 125 amino acids to approximately 240 amino acids, approximately 125 amino acids to approximately 220 amino acids, approximately 125 amino acids to approximately 200 amino acids, approximately 125 amino acids to approximately 195 amino acids, approximately 125 amino acids to approximately 190 amino acids, approximately 125 amino acids to approximately 185 amino acids, approximately 125 amino acids to approximately 180 amino acids, Approximately 125 to 175 amino acids, approximately 125 to 170 amino acids, approximately 125 to 165 amino acids, approximately 125 to 160 amino acids, approximately 125 to 155 amino acids, approximately 125 to 150 amino acids, approximately 125 to 145 amino acids, approximately 125 to 140 amino acids, approximately 125 to 135 amino acids, approximately 125 to 130 amino acids, approximately 130 to 1000 amino acids, approximately 130 to 950 amino acids Approximately 130 amino acids to approximately 900 amino acids, approximately 130 amino acids to approximately 850 amino acids, approximately 130 amino acids to approximately 800 amino acids, approximately 130 amino acids to approximately 750 amino acids, approximately 130 amino acids to approximately 700 amino acids, approximately 130 amino acids to approximately 650 amino acids, approximately 130 amino acids to approximately 600 amino acids, approximately 130 amino acids to approximately 550 amino acids, approximately 130 amino acids to approximately 500 amino acids, approximately 130 amino acids to approximately 450 amino acids, approximately 130 amino acids to approximately 400 amino acids, approximately 130 amino acids to approximately 350 amino acids, Approximately 130 amino acids to approximately 300 amino acids, approximately 130 amino acids to approximately 280 amino acids, approximately 130 amino acids to approximately 260 amino acids, approximately 130 amino acids to approximately 240 amino acids, approximately 130 amino acids to approximately 220 amino acids, approximately 130 amino acids to approximately 200 amino acids, approximately 130 amino acids to approximately 195 amino acids, approximately 130 amino acids to approximately 190 amino acids, approximately 130 amino acids to approximately 185 amino acids, approximately 130 amino acids to approximately 180 amino acids, approximately 130 amino acids to approximately 175 amino acids, approximately 130 amino acids to approximately 170 amino acids, approximately 130 amino acids to approximately 165 amino acids, approximately 130 amino acids to approximately 160 amino acids Mino acids, approximately 130 amino acids to approximately 155 amino acids, approximately 130 amino acids to approximately 150 amino acids, approximately 130 amino acids to approximately 145 amino acids, approximately 130 amino acids to approximately 140 amino acids, approximately 130 amino acids to approximately 135 amino acids, approximately 135 amino acids to approximately 1000 amino acids, approximately 135 amino acids to approximately 950 amino acids, approximately 135 amino acids to approximately 900 amino acids, approximately 135 amino acids to approximately 850 amino acids, approximately 135 amino acids to approximately 800 amino acids, approximately 135 amino acids to approximately 750 amino acids, approximately 135 amino acids to approximately 700 amino acids, approximately 135 amino acids to approximately 650 amino acids, approximately 135 amino acids to approximately 135 amino acids Approximately 600 amino acids, approximately 135 amino acids to approximately 550 amino acids, approximately 135 amino acids to approximately 500 amino acids, approximately 135 amino acids to approximately 450 amino acids, approximately 135 amino acids to approximately 400 amino acids, approximately 135 amino acids to approximately 350 amino acids, approximately 135 amino acids to approximately 300 amino acids, approximately 135 amino acids to approximately 280 amino acids, approximately 135 amino acids to approximately 260 amino acids, approximately 135 amino acids to approximately 240 amino acids, approximately 135 amino acids to approximately 220 amino acids, approximately 135 amino acids to approximately 200 amino acids, approximately 135 amino acids to approximately 195 amino acids, approximately 135 amino acids to approximately 190 amino acids, approximately 135 amino acids Mino acids ~ approximately 185 amino acids, approximately 135 amino acids ~ approximately 180 amino acids, approximately 135 amino acids ~ approximately 175 amino acids, approximately 135 amino acids ~ approximately 170 amino acids, approximately 135 amino acids ~ approximately 165 amino acids, approximately 135 amino acids ~ approximately 160 amino acids, approximately 135 amino acids ~ approximately 155 amino acids, approximately 135 amino acids ~ approximately 150 amino acids, approximately 135 amino acids ~ approximately 145 amino acids, approximately 135 amino acids ~ approximately 140 amino acids, approximately 140 amino acids ~ approximately 1000 amino acids, approximately 140 amino acids ~ approximately 950 amino acids, approximately 140 amino acids ~ approximately 900 amino acids, approximately 140 amino acids ~ approximately 850 amino acids,Approximately 140 amino acids to approximately 800 amino acids, approximately 140 amino acids to approximately 750 amino acids, approximately 140 amino acids to approximately 700 amino acids, approximately 140 amino acids to approximately 650 amino acids, approximately 140 amino acids to approximately 600 amino acids, approximately 140 amino acids to approximately 550 amino acids, approximately 140 amino acids to approximately 500 amino acids, approximately 140 amino acids to approximately 450 amino acids, approximately 140 amino acids to approximately 400 amino acids, approximately 140 amino acids to approximately 350 amino acids, approximately 140 amino acids to approximately 300 amino acids, Approximately 140 amino acids to approximately 280 amino acids, approximately 140 amino acids to approximately 260 amino acids, approximately 140 amino acids to approximately 240 amino acids, approximately 140 amino acids to approximately 220 amino acids, approximately 140 amino acids to approximately 200 amino acids, approximately 140 amino acids to approximately 195 amino acids, approximately 140 amino acids to approximately 190 amino acids, approximately 140 amino acids to approximately 185 amino acids, approximately 140 amino acids to approximately 180 amino acids, approximately 140 amino acids to approximately 175 amino acids, approximately 140 amino acids to approximately 170 amino acids, approximately 140 amino acids to approximately 165 amino acids, approximately 140 amino acids to approximately 160 amino acids, approximately 140 amino acids to approximately 155 amino acids Mino acids, approximately 140 amino acids to approximately 150 amino acids, approximately 140 amino acids to approximately 145 amino acids, approximately 145 amino acids to approximately 1000 amino acids, approximately 145 amino acids to approximately 950 amino acids, approximately 145 amino acids to approximately 900 amino acids, approximately 145 amino acids to approximately 850 amino acids, approximately 145 amino acids to approximately 800 amino acids, approximately 145 amino acids to approximately 750 amino acids, approximately 145 amino acids to approximately 700 amino acids, approximately 145 amino acids to approximately 650 amino acids, approximately 145 amino acids to approximately 600 amino acids, approximately 145 amino acids to approximately 550 amino acids, approximately 145 amino acids to approximately 500 amino acids, approximately 145 amino acids to approximately 145 amino acids Approximately 450 amino acids, approximately 145 amino acids to approximately 400 amino acids, approximately 145 amino acids to approximately 350 amino acids, approximately 145 amino acids to approximately 300 amino acids, approximately 145 amino acids to approximately 280 amino acids, approximately 145 amino acids to approximately 260 amino acids, approximately 145 amino acids to approximately 240 amino acids, approximately 145 amino acids to approximately 220 amino acids, approximately 145 amino acids to approximately 200 amino acids, approximately 145 amino acids to approximately 195 amino acids, approximately 145 amino acids to approximately 190 amino acids, approximately 145 amino acids to approximately 185 amino acids, approximately 145 amino acids to approximately 180 amino acids, approximately 145 amino acids to approximately 175 amino acids, approximately 145 amino acids Mino acids ~ approximately 170 amino acids, approximately 145 amino acids ~ approximately 165 amino acids, approximately 145 amino acids ~ approximately 160 amino acids, approximately 145 amino acids ~ approximately 155 amino acids, approximately 145 amino acids ~ approximately 150 amino acids, approximately 150 amino acids ~ approximately 1000 amino acids, approximately 150 amino acids ~ approximately 950 amino acids, approximately 150 amino acids ~ approximately 900 amino acids, approximately 150 amino acids ~ approximately 850 amino acids, approximately 150 amino acids ~ approximately 800 amino acids, approximately 150 amino acids ~ approximately 750 amino acids, approximately 150 amino acids ~ approximately 700 amino acids, approximately 150 amino acids ~ approximately 650 amino acids, approximately 150 amino acids ~ approximately 600 amino acids,Approximately 150 amino acids to approximately 550 amino acids, approximately 150 amino acids to approximately 500 amino acids, approximately 150 amino acids to approximately 450 amino acids, approximately 150 amino acids to approximately 400 amino acids, approximately 150 amino acids to approximately 350 amino acids, approximately 150 amino acids to approximately 300 amino acids, approximately 150 amino acids to approximately 280 amino acids, approximately 150 amino acids to approximately 260 amino acids, approximately 150 amino acids to approximately 240 amino acids, approximately 150 amino acids to approximately 220 amino acids, approximately 150 amino acids to approximately 200 amino acids, approximately 150 amino acids to approximately 195 amino acids, approximately 150 amino acids to approximately 190 amino acids, approximately 150 amino acids to approximately 185 amino acids Mino acids, approximately 150 amino acids to approximately 180 amino acids, approximately 150 amino acids to approximately 175 amino acids, approximately 150 amino acids to approximately 170 amino acids, approximately 150 amino acids to approximately 165 amino acids, approximately 150 amino acids to approximately 160 amino acids, approximately 150 amino acids to approximately 155 amino acids, approximately 155 amino acids to approximately 1000 amino acids, approximately 155 amino acids to approximately 950 amino acids, approximately 155 amino acids to approximately 900 amino acids, approximately 155 amino acids to approximately 850 amino acids, approximately 155 amino acids to approximately 800 amino acids, approximately 155 amino acids to approximately 750 amino acids, approximately 155 amino acids to approximately 700 amino acids, approximately 155 amino acids to Approximately 650 amino acids, approximately 155 amino acids to approximately 600 amino acids, approximately 155 amino acids to approximately 550 amino acids, approximately 155 amino acids to approximately 500 amino acids, approximately 155 amino acids to approximately 450 amino acids, approximately 155 amino acids to approximately 400 amino acids, approximately 155 amino acids to approximately 350 amino acids, approximately 155 amino acids to approximately 300 amino acids, approximately 155 amino acids to approximately 280 amino acids, approximately 155 amino acids to approximately 260 amino acids, approximately 155 amino acids to approximately 240 amino acids, approximately 155 amino acids to approximately 220 amino acids, approximately 155 amino acids to approximately 200 amino acids, approximately 155 amino acids to approximately 195 amino acids, approximately 155 amino acids Mino acids ~ approximately 190 amino acids, approximately 155 amino acids ~ approximately 185 amino acids, approximately 155 amino acids ~ approximately 180 amino acids, approximately 155 amino acids ~ approximately 175 amino acids, approximately 155 amino acids ~ approximately 170 amino acids, approximately 155 amino acids ~ approximately 165 amino acids, approximately 155 amino acids ~ approximately 160 amino acids, approximately 160 amino acids ~ approximately 1000 amino acids, approximately 160 amino acids ~ approximately 950 amino acids, approximately 160 amino acids ~ approximately 900 amino acids, approximately 160 amino acids ~ approximately 850 amino acids, approximately 160 amino acids ~ approximately 800 amino acids, approximately 160 amino acids ~ approximately 750 amino acids, approximately 160 amino acids ~ approximately 700 amino acids,Approximately 160 amino acids to approximately 650 amino acids, approximately 160 amino acids to approximately 600 amino acids, approximately 160 amino acids to approximately 550 amino acids, approximately 160 amino acids to approximately 500 amino acids, approximately 160 amino acids to approximately 450 amino acids, approximately 160 amino acids to approximately 400 amino acids, approximately 160 amino acids to approximately 350 amino acids, approximately 160 amino acids to approximately 300 amino acids, approximately 160 amino acids to approximately 280 amino acids, approximately 160 amino acids to approximately 260 amino acids, approximately 160 amino acids to approximately 240 amino acids, approximately 160 amino acids to approximately 220 amino acids, approximately 160 amino acids to approximately 200 amino acids, approximately 160 amino acids to approximately 195 amino acids Mino acids, approximately 160-190 amino acids, approximately 160-185 amino acids, approximately 160-180 amino acids, approximately 160-175 amino acids, approximately 160-170 amino acids, approximately 160-165 amino acids, approximately 165-1000 amino acids, approximately 165-950 amino acids, approximately 165-900 amino acids, approximately 165-850 amino acids, approximately 165-800 amino acids, approximately 165-750 amino acids, approximately 165-700 amino acids, approximately 165- Approximately 650 amino acids, approximately 165 amino acids to approximately 600 amino acids, approximately 165 amino acids to approximately 550 amino acids, approximately 165 amino acids to approximately 500 amino acids, approximately 165 amino acids to approximately 450 amino acids, approximately 165 amino acids to approximately 400 amino acids, approximately 165 amino acids to approximately 350 amino acids, approximately 165 amino acids to approximately 300 amino acids, approximately 165 amino acids to approximately 280 amino acids, approximately 165 amino acids to approximately 260 amino acids, approximately 165 amino acids to approximately 240 amino acids, approximately 165 amino acids to approximately 220 amino acids, approximately 165 amino acids to approximately 200 amino acids, approximately 165 amino acids to approximately 195 amino acids, approximately 165 amino acids Mino acids ~ approximately 190 amino acids, approximately 165 amino acids ~ approximately 185 amino acids, approximately 165 amino acids ~ approximately 180 amino acids, approximately 165 amino acids ~ approximately 175 amino acids, approximately 165 amino acids ~ approximately 170 amino acids, approximately 170 amino acids ~ approximately 1000 amino acids, approximately 170 amino acids ~ approximately 950 amino acids, approximately 170 amino acids ~ approximately 900 amino acids, approximately 170 amino acids ~ approximately 850 amino acids, approximately 170 amino acids ~ approximately 800 amino acids, approximately 170 amino acids ~ approximately 750 amino acids, approximately 170 amino acids ~ approximately 700 amino acids, approximately 170 amino acids ~ approximately 650 amino acids, approximately 170 amino acids ~ approximately 600 amino acids,Approximately 170 amino acids to approximately 550 amino acids, approximately 170 amino acids to approximately 500 amino acids, approximately 170 amino acids to approximately 450 amino acids, approximately 170 amino acids to approximately 400 amino acids, approximately 170 amino acids to approximately 350 amino acids, approximately 170 amino acids to approximately 300 amino acids, approximately 170 amino acids to approximately 280 amino acids, approximately 170 amino acids to approximately 260 amino acids, approximately 170 amino acids to approximately 240 amino acids, approximately 170 amino acids to approximately 220 amino acids, approximately 170 amino acids to approximately 200 amino acids, approximately 170 amino acids to approximately 195 amino acids, approximately 170 amino acids to approximately 190 amino acids, approximately 170 amino acids to approximately 185 amino acids, Approximately 170-180 amino acids, approximately 170-175 amino acids, approximately 175-1000 amino acids, approximately 175-950 amino acids, approximately 175-900 amino acids, approximately 175-850 amino acids, approximately 175-800 amino acids, approximately 175-750 amino acids, approximately 175-700 amino acids, approximately 175-650 amino acids, approximately 175-600 amino acids, approximately 175-550 amino acids, approximately 175-500 amino acids, approximately 175-450 amino acids Approximately 175 amino acids to approximately 400 amino acids, approximately 175 amino acids to approximately 350 amino acids, approximately 175 amino acids to approximately 300 amino acids, approximately 175 amino acids to approximately 280 amino acids, approximately 175 amino acids to approximately 260 amino acids, approximately 175 amino acids to approximately 240 amino acids, approximately 175 amino acids to approximately 220 amino acids, approximately 175 amino acids to approximately 200 amino acids, approximately 175 amino acids to approximately 195 amino acids, approximately 175 amino acids to approximately 190 amino acids, approximately 175 amino acids to approximately 185 amino acids, approximately 175 amino acids to approximately 180 amino acids, approximately 180 amino acids to approximately 1000 amino acids, approximately 180 amino acids to approximately 950 amino acids Amino acids, approximately 180 amino acids to approximately 900 amino acids, approximately 180 amino acids to approximately 850 amino acids, approximately 180 amino acids to approximately 800 amino acids, approximately 180 amino acids to approximately 750 amino acids, approximately 180 amino acids to approximately 700 amino acids, approximately 180 amino acids to approximately 650 amino acids, approximately 180 amino acids to approximately 600 amino acids, approximately 180 amino acids to approximately 550 amino acids, approximately 180 amino acids to approximately 500 amino acids, approximately 180 amino acids to approximately 450 amino acids, approximately 180 amino acids to approximately 400 amino acids, approximately 180 amino acids to approximately 350 amino acids, approximately 180 amino acids to approximately 300 amino acids, approximately 180 amino acids to approximately 180 amino acids Approximately 280 amino acids, approximately 180 to approximately 260 amino acids, approximately 180 to approximately 240 amino acids, approximately 180 to approximately 220 amino acids, approximately 180 to approximately 200 amino acids, approximately 180 to approximately 195 amino acids, approximately 180 to approximately 190 amino acids, approximately 180 to approximately 185 amino acids, approximately 185 to approximately 1000 amino acids, approximately 185 to approximately 950 amino acids, approximately 185 to approximately 900 amino acids, approximately 185 to approximately 850 amino acids, approximately 185 to approximately 800 amino acids, approximately 185 to approximately 750 amino acids, approximately 185 Amino acids ~ approximately 700 amino acids, approximately 185 amino acids ~ approximately 650 amino acids, approximately 185 amino acids ~ approximately 600 amino acids, approximately 185 amino acids ~ approximately 550 amino acids, approximately 185 amino acids ~ approximately 500 amino acids, approximately 185 amino acids ~ approximately 450 amino acids, approximately 185 amino acids ~ approximately 400 amino acids, approximately 185 amino acids ~ approximately 350 amino acids, approximately 185 amino acids ~ approximately 300 amino acids, approximately 185 amino acids ~ approximately 280 amino acids, approximately 185 amino acids ~ approximately 260 amino acids, approximately 185 amino acids ~ approximately 240 amino acids, approximately 185 amino acids ~ approximately 220 amino acids, approximately 185 amino acids ~ approximately 200 amino acids,Approximately 185 amino acids to approximately 195 amino acids, approximately 185 amino acids to approximately 190 amino acids, approximately 190 amino acids to approximately 1000 amino acids, approximately 190 amino acids to approximately 950 amino acids, approximately 190 amino acids to approximately 900 amino acids, approximately 190 amino acids to approximately 850 amino acids, approximately 190 amino acids to approximately 800 amino acids, approximately 190 amino acids to approximately 750 amino acids, approximately 190 amino acids to approximately 700 amino acids, approximately 190 amino acids to approximately 650 amino acids, approximately 190 amino acids to approximately 600 amino acids, approximately 190 amino acids to approximately 550 amino acids, approximately 190 amino acids to approximately 500 amino acids, approximately 190 amino acids to approximately 450 Amino acids, approximately 190 amino acids to approximately 400 amino acids, approximately 190 amino acids to approximately 350 amino acids, approximately 190 amino acids to approximately 300 amino acids, approximately 190 amino acids to approximately 280 amino acids, approximately 190 amino acids to approximately 260 amino acids, approximately 190 amino acids to approximately 240 amino acids, approximately 190 amino acids to approximately 220 amino acids, approximately 190 amino acids to approximately 200 amino acids, approximately 190 amino acids to approximately 195 amino acids, approximately 195 amino acids to approximately 1000 amino acids, approximately 195 amino acids to approximately 950 amino acids, approximately 195 amino acids to approximately 900 amino acids, approximately 195 amino acids to approximately 850 amino acids, approximately 195 amino acids ~800 amino acids, approximately 195 amino acids~approximately 750 amino acids, approximately 195 amino acids~approximately 700 amino acids, approximately 195 amino acids~approximately 650 amino acids, approximately 195 amino acids~approximately 600 amino acids, approximately 195 amino acids~approximately 550 amino acids, approximately 195 amino acids~approximately 500 amino acids, approximately 195 amino acids~approximately 450 amino acids, approximately 195 amino acids~approximately 400 amino acids, approximately 195 amino acids~approximately 350 amino acids, approximately 195 amino acids~approximately 300 amino acids, approximately 195 amino acids~approximately 280 amino acids, approximately 195 amino acids~approximately 260 amino acids, approximately 195 amino acids~approximately 240 amino acids, approximately 195 Amino acids ~ approximately 220 amino acids, approximately 195 amino acids ~ approximately 200 amino acids, approximately 200 amino acids ~ approximately 1000 amino acids, approximately 200 amino acids ~ approximately 950 amino acids, approximately 200 amino acids ~ approximately 900 amino acids, approximately 200 amino acids ~ approximately 850 amino acids, approximately 200 amino acids ~ approximately 800 amino acids, approximately 200 amino acids ~ approximately 750 amino acids, approximately 200 amino acids ~ approximately 700 amino acids, approximately 200 amino acids ~ approximately 650 amino acids, approximately 200 amino acids ~ approximately 600 amino acids, approximately 200 amino acids ~ approximately 550 amino acids, approximately 200 amino acids ~ approximately 500 amino acids, approximately 200 amino acids ~ approximately 450 amino acids,Approximately 200 to 400 amino acids, approximately 200 to 350 amino acids, approximately 200 to 300 amino acids, approximately 200 to 280 amino acids, approximately 200 to 260 amino acids, approximately 200 to 240 amino acids, approximately 200 to 220 amino acids, approximately 220 to 1000 amino acids, approximately 220 to 950 amino acids, approximately 220 to 900 amino acids, approximately 220 to 850 amino acids, approximately 220 to 800 amino acids, approximately 220 to 750 amino acids, approximately 220 to 700 amino acids Amino acids, approximately 220 amino acids to approximately 650 amino acids, approximately 220 amino acids to approximately 600 amino acids, approximately 220 amino acids to approximately 550 amino acids, approximately 220 amino acids to approximately 500 amino acids, approximately 220 amino acids to approximately 450 amino acids, approximately 220 amino acids to approximately 400 amino acids, approximately 220 amino acids to approximately 350 amino acids, approximately 220 amino acids to approximately 300 amino acids, approximately 220 amino acids to approximately 280 amino acids, approximately 220 amino acids to approximately 260 amino acids, approximately 220 amino acids to approximately 240 amino acids, approximately 240 amino acids to approximately 1000 amino acids, approximately 240 amino acids to approximately 950 amino acids, approximately 240 amino acids ~900 amino acids, approximately 240 amino acids~approximately 850 amino acids, approximately 240 amino acids~approximately 800 amino acids, approximately 240 amino acids~approximately 750 amino acids, approximately 240 amino acids~approximately 700 amino acids, approximately 240 amino acids~approximately 650 amino acids, approximately 240 amino acids~approximately 600 amino acids, approximately 240 amino acids~approximately 550 amino acids, approximately 240 amino acids~approximately 500 amino acids, approximately 240 amino acids~approximately 450 amino acids, approximately 240 amino acids~approximately 400 amino acids, approximately 240 amino acids~approximately 350 amino acids, approximately 240 amino acids~approximately 300 amino acids, approximately 240 amino acids~approximately 280 amino acids, approximately 240 Amino acids ~ approximately 260 amino acids, approximately 260 amino acids ~ approximately 1000 amino acids, approximately 260 amino acids ~ approximately 950 amino acids, approximately 260 amino acids ~ approximately 900 amino acids, approximately 260 amino acids ~ approximately 850 amino acids, approximately 260 amino acids ~ approximately 800 amino acids, approximately 260 amino acids ~ approximately 750 amino acids, approximately 260 amino acids ~ approximately 700 amino acids, approximately 260 amino acids ~ approximately 650 amino acids, approximately 260 amino acids ~ approximately 600 amino acids, approximately 260 amino acids ~ approximately 550 amino acids, approximately 260 amino acids ~ approximately 500 amino acids, approximately 260 amino acids ~ approximately 450 amino acids, approximately 260 amino acids ~ approximately 400 amino acids,Approximately 260 amino acids to approximately 350 amino acids, approximately 260 amino acids to approximately 300 amino acids, approximately 260 amino acids to approximately 280 amino acids, approximately 280 amino acids to approximately 1000 amino acids, approximately 280 amino acids to approximately 950 amino acids, approximately 280 amino acids to approximately 900 amino acids, approximately 280 amino acids to approximately 850 amino acids, approximately 280 amino acids to approximately 800 amino acids, approximately 280 amino acids to approximately 750 amino acids, approximately 280 amino acids to approximately 700 amino acids, approximately 280 amino acids to approximately 650 amino acids, approximately 280 amino acids to approximately 600 amino acids, approximately 280 amino acids to approximately 550 amino acids, approximately 280 amino acids to approximately 500 amino acids, approximately 280 amino acids to approximately 450 amino acids, Approximately 280 amino acids to approximately 400 amino acids, approximately 280 amino acids to approximately 350 amino acids, approximately 280 amino acids to approximately 300 amino acids, approximately 300 amino acids to approximately 1000 amino acids, approximately 300 amino acids to approximately 950 amino acids, approximately 300 amino acids to approximately 900 amino acids, approximately 300 amino acids to approximately 850 amino acids, approximately 300 amino acids to approximately 800 amino acids, approximately 300 amino acids to approximately 750 amino acids, approximately 300 amino acids to approximately 700 amino acids, approximately 300 amino acids to approximately 650 amino acids, approximately 300 amino acids to approximately 600 amino acids, approximately 300 amino acids to approximately 550 amino acids, approximately 300 amino acids to approximately 500 amino acids, approximately 300 amino acids to approximately 450 amino acids, Approximately 300-400 amino acids, approximately 300-350 amino acids, approximately 350-1000 amino acids, approximately 350-950 amino acids, approximately 350-900 amino acids, approximately 350-850 amino acids, approximately 350-800 amino acids, approximately 350-750 amino acids, approximately 350-700 amino acids, approximately 350-650 amino acids, approximately 350-600 amino acids, approximately 350-550 amino acids, approximately 350-500 amino acids, approximately 350-450 amino acids Amino acids, approximately 350 amino acids ~ approximately 400 amino acids, approximately 400 amino acids ~ approximately 1000 amino acids, approximately 400 amino acids ~ approximately 950 amino acids, approximately 400 amino acids ~ approximately 900 amino acids, approximately 400 amino acids ~ approximately 850 amino acids, approximately 400 amino acids ~ approximately 800 amino acids, approximately 400 amino acids ~ approximately 750 amino acids, approximately 400 amino acids ~ approximately 700 amino acids, approximately 400 amino acids ~ approximately 650 amino acids, approximately 400 amino acids ~ approximately 600 amino acids, approximately 400 amino acids ~ approximately 550 amino acids, approximately 400 amino acids ~ approximately 500 amino acids, approximately 400 amino acids ~ approximately 450 amino acids, approximately 450 amino acids ~ Approximately 1000 amino acids, approximately 450 to 950 amino acids, approximately 450 to 900 amino acids, approximately 450 to 850 amino acids, approximately 450 to 800 amino acids, approximately 450 to 750 amino acids, approximately 450 to 700 amino acids, approximately 450 to 650 amino acids, approximately 450 to 600 amino acids, approximately 450 to 550 amino acids, approximately 450 to 500 amino acids, approximately 500 to 1000 amino acids, approximately 500 to 950 amino acids, approximately 500 to 900 amino acids, approximately 500 Amino acids ~ approximately 850 amino acids, approximately 500 amino acids ~ approximately 800 amino acids, approximately 500 amino acids ~ approximately 750 amino acids, approximately 500 amino acids ~ approximately 700 amino acids, approximately 500 amino acids ~ approximately 650 amino acids, approximately 500 amino acids ~ approximately 600 amino acids, approximately 500 amino acids ~ approximately 550 amino acids, approximately 550 amino acids ~ approximately 1000 amino acids, approximately 550 amino acids ~ approximately 950 amino acids, approximately 550 amino acids ~ approximately 900 amino acids, approximately 550 amino acids ~ approximately 850 amino acids, approximately 550 amino acids ~ approximately 800 amino acids, approximately 550 amino acids ~ approximately 750 amino acids, approximately 550 amino acids ~ approximately 700 amino acids,Approximately 550 amino acids to approximately 650 amino acids, approximately 550 amino acids to approximately 600 amino acids, approximately 600 amino acids to approximately 1000 amino acids, approximately 600 amino acids to approximately 950 amino acids, approximately 600 amino acids to approximately 900 amino acids, approximately 600 amino acids to approximately 850 amino acids, approximately 600 amino acids to approximately 800 amino acids, approximately 600 amino acids to approximately 750 amino acids, approximately 600 amino acids to approximately 700 amino acids, approximately 600 amino acids to approximately 650 amino acids, approximately 650 amino acids to approximately 1000 amino acids, approximately 650 amino acids to approximately 950 amino acids, approximately 650 amino acids to approximately 900 amino acids, approximately 650 amino acids to approximately 850 amino acids, approximately 650 amino acids to approximately 800 amino acids, approximately 650 amino acids to approximately 750 amino acids, approximately 650 amino acids to approximately 700 amino acids, approximately 700 amino acids to approximately 1000 amino acids, approximately 700 amino acids to approximately 950 amino acids, approximately 700 amino acids It may have a total number of amino acids ranging from approximately 900 amino acids, 700 to 850 amino acids, 700 to 800 amino acids, 700 to 750 amino acids, 750 to 1000 amino acids, 750 to 950 amino acids, 750 to 900 amino acids, 750 to 850 amino acids, 750 to 800 amino acids, 800 to 1000 amino acids, 800 to 950 amino acids, 800 to 900 amino acids, 800 to 850 amino acids, 850 to 1000 amino acids, 850 to 950 amino acids, 850 to 950 amino acids, 900 to 1000 amino acids, 900 to 950 amino acids, or 950 to 1000 amino acids.

[0137] Any of the target-binding domains described herein is 1 × 10 -7 Less than M, 1 x 10 -8 Less than M, 1 x 10 -9 Less than M, 1 x 10 -10 Less than M, 1 x 10 -11 Less than M, 1 x 10 -12 Less than M, or 1 × 10 -13 Equilibrium dissociation constant (K) less than M D) can bind to the TGF-βRII ligand. In some embodiments, the antigen-binding protein constructs provided herein are approximately 1 × 10⁻⁶ -3 M ~ approx. 1×10 -5 M, about 1 x 10 -4 M ~ approx. 1×10 -6 M, about 1 x 10 -5 M ~ approx. 1×10 -7 M, about 1 x 10 -6 M ~ approx. 1×10 -8 M, about 1 x 10 -7 M ~ approx. 1×10 -9 M, about 1 x 10 -8 M ~ approx. 1×10 -10 M, or approximately 1 x 10 -9 M ~ approx. 1×10 -11 K of M (including the values ​​at both ends) D It can bind to the antigen that has been identified.

[0138] Any of the target-binding domains described herein has a molecular size of approximately 1 pM to approximately 30 nM (for example, approximately 1 pM to approximately 25 nM, approximately 1 pM to approximately 20 nM, approximately 1 pM to approximately 15 nM, approximately 1 pM to approximately 10 nM, approximately 1 pM to approximately 5 nM, approximately 1 pM to approximately 2 nM, approximately 1 pM to approximately 1 nM, approximately 1 pM to approximately 950 pM, approximately 1 pM to approximately 900 pM, approximately 1 pM to approximately 850 pM, approximately 1 pM to approximately 800 pM, approximately 1 pM to approximately 750 pM, approximately 1 pM to approximately 700 pM, approximately 1 pM to approximately 650 pM, approximately 1 pM to approximately 600 pM, approximately 1 pM to approximately 550 pM, approximately 1 pM to approximately 500 pM, approximately 1 pM to approximately 450 pM, Approximately 1 pM to approximately 400 pM, approximately 1 pM to approximately 350 pM, approximately 1 pM to approximately 300 pM, approximately 1 pM to approximately 250 pM, approximately 1 pM to approximately 200 pM, approximately 1 pM ~ about 150 pM, about 1 pM - about 100 pM, about 1 pM - about 90 pM, about 1 pM - about 80 pM, about 1 pM - about 70 pM, about 1 pM - about 60 pM, about 1 pM to about 50 pM, about 1 pM to about 40 pM, about 1 pM to about 30 pM, about 1 pM to about 20 pM, about 1 pM to about 10 pM, about 1 pM ~about 5pM, about 1pM to about 4pM, about 1pM to about 3pM, about 1pM to about 2pM, about 2pM to about 30nM, about 2pM to about 25nM, about 2pM Approximately 20nM, approximately 2pM to approximately 15nM, approximately 2pM to approximately 10nM, approximately 2pM to approximately 5nM, approximately 2pM to approximately 2nM, approximately 2pM to approximately 1nM, approximately 2pM ~950pM, approximately 2pM to approximately 900pM, approximately 2pM to approximately 850pM, approximately 2pM to approximately 800pM, approximately 2pM to approximately 750pM, approximately 2pM to approximately 7 00pM, about 2pM to about 650pM, about 2pM to about 600pM, about 2pM to about 550pM, about 2pM to about 500pM, about 2pM to about 450 pM, about 2 pM to about 400 pM, about 2 pM to about 350 pM, about 2 pM to about 300 pM, about 2 pM to about 250 pM, about 2 pM to about 200 pM, Approximately 2pM to approximately 150pM, approximately 2pM to approximately 100pM, approximately 2pM to approximately 90pM, approximately 2pM to approximately 80pM, approximately 2pM to approximately 70pM, approximately 2pM to Approximately 60 pM, approximately 2 pM to approximately 50 pM, approximately 2 pM to approximately 40 pM, approximately 2 pM to approximately 30 pM, approximately 2 pM to approximately 20 pM, approximately 2 pM to approximately 10 pM, approximately 2 pM to about 5 pM, about 2 pM to about 4 pM, about 2 pM to about 3 pM, about 5 pM to about 30 nM, about 5 pM to about 25 nM, about 5 pM to about 20 nM, about 5pM to about 15nM, about 5pM to about 10nM, about 5pM to about 5nM, about 5pM to about 2nM, about 5pM to about 1nM, about 5pM to about 950pM,Approximately 5pM to approximately 900pM, approximately 5pM to approximately 850pM, approximately 5pM to approximately 800pM, approximately 5pM to approximately 750pM, approximately 5pM to approximately 700pM, approximately 5pM to approximately 650pM, approximately 5pM to approximately 600pM, approximately 5pM to approximately 550pM, approximately 5pM to approximately 500pM, approximately 5pM to approximately 450pM, approximately 5pM~ Approximately 400pM, approximately 5pM to approximately 350pM, approximately 5pM to approximately 300pM, approximately 5pM to approximately 250pM, approximately 5pM to approximately 200pM, approximately 5pM to approximately 150pM, approximately 5pM to approximately 100pM, approximately 5pM to approximately 90pM, approximately 5pM to approximately 80pM, approximately 5pM to approximately 70pM, approximately 5pM to approximately 60pM, approximately 5 pM ~ approximately 50 pM, approximately 5 pM ~ approximately 40 pM, approximately 5 pM ~ approximately 30 pM, approximately 5 pM ~ approximately 20 pM, approximately 5 pM ~ approximately 10 pM, approximately 10 pM ~ approximately 30 nM, approximately 10 pM ~ approximately 25 nM, approximately 10 pM ~ approximately 20 nM, approximately 10 pM ~ approximately 15 nM, approximately 10 pM ~ approximately 10 nM, approximately 10 pM ~ approximately 5 nM, approximately 10pM to approximately 2nm, approximately 10pM to approximately 1nm, approximately 10pM to approximately 950pM, approximately 10pM to approximately 900pM, approximately 10pM to approximately 850pM, approximately 10pM to approximately 800pM, approximately 10pM to approximately 750pM, approximately 10pM to approximately 700pM, approximately 10pM to approximately 650pM, approximately 10pM to approximately 600pM Approximately 10 pM to approximately 550 pM, approximately 10 pM to approximately 500 pM, approximately 10 pM to approximately 450 pM, approximately 10 pM to approximately 400 pM, approximately 10 pM to approximately 350 pM, approximately 10 pM to approximately 300 pM, approximately 10 pM to approximately 250 pM, approximately 10 pM to approximately 200 pM, approximately 10 pM to approximately 150 pM, approximately 10 pM to approximately 1 0pM, approximately 10pM to approximately 90pM, approximately 10pM to approximately 80pM, approximately 10pM to approximately 70pM, approximately 10pM to approximately 60pM, approximately 10pM to approximately 50pM, approximately 10pM to approximately 40pM, approximately 10pM to approximately 30pM, approximately 10pM to approximately 20pM, approximately 15pM to approximately 30nm, approximately 15pM to approximately 25nm. Approximately 15 pM to approximately 20 nm, approximately 15 pM to approximately 15 nm, approximately 15 pM to approximately 10 nm, approximately 15 pM to approximately 5 nm, approximately 15 pM to approximately 2 nm, approximately 15 pM to approximately 1 nm, approximately 15 pM to approximately 950 pM, approximately 15 pM to approximately 900 pM, approximately 15 pM to approximately 850 pM, approximately 15 pM to approximately 800 pM, approximately 15 p M~approx. 750pM, approx. 15pM~approx. 700pM, approx. 15pM~approx. 650pM, approx. 15pM~approx. 600pM, approx. 15pM~approx. 550pM, approx. 15pM~approx. 500pM, approx. 15pM~approx. 450pM, approx. 15pM~approx. 400pM, approx. 15pM~approx. 350pM, approx. 15pM~approx. 300pMApproximately 15pM to approximately 250pM, approximately 15pM to approximately 200pM, approximately 15pM to approximately 150pM, approximately 15pM to approximately 100pM, approximately 15pM to approximately 90pM, approximately 15pM to approximately 80pM, approximately 15pM to approximately 70pM, approximately 15pM to approximately 60pM, approximately 15pM to approximately 50pM, approximately 15pM to approximately 40pM. Approximately 15 pM to approximately 30 pM, approximately 15 pM to approximately 20 pM, approximately 20 pM to approximately 30 nmM, approximately 20 pM to approximately 25 nmM, approximately 20 pM to approximately 20 nmM, approximately 20 pM to approximately 15 nmM, approximately 20 pM to approximately 10 nmM, approximately 20 pM to approximately 5 nmM, approximately 20 pM to approximately 2 nmM, approximately 20 pM to approximately 1 nmM, approximately 20 pM to approximately 950pM, approximately 20pM to approximately 900pM, approximately 20pM to approximately 850pM, approximately 20pM to approximately 800pM, approximately 20pM to approximately 750pM, approximately 20pM to approximately 700pM, approximately 20pM to approximately 650pM, approximately 20pM to approximately 600pM, approximately 20pM to approximately 550pM, approximately 20pM to approximately 500pM, approximately 20pM to approximately 450pM, approximately 20pM to approximately 400pM, approximately 20pM to approximately 350pM, approximately 20pM to approximately 300pM, approximately 20pM to approximately 250pM, approximately 20pM to approximately 20pM, approximately 200pM to approximately 150pM, approximately 20pM to approximately 100pM, approximately 20pM to approximately 90pM, approximately 20pM to approximately 80pM M, approximately 20pM to approximately 70pM, approximately 20pM to approximately 60pM, approximately 20pM to approximately 50pM, approximately 20pM to approximately 40pM, approximately 20pM to approximately 30pM, approximately 30pM to approximately 30nM, approximately 30pM to approximately 25nM, approximately 30pM to approximately 30nM, approximately 30pM to approximately 15nM, approximately 30pM to approximately 10nM, approximately 3 0pM to approximately 5nm, approximately 30pM to approximately 2nm, approximately 30pM to approximately 1nm, approximately 30pM to approximately 950pM, approximately 30pM to approximately 900pM, approximately 30pM to approximately 850pM, approximately 30pM to approximately 800pM, approximately 30pM to approximately 750pM, approximately 30pM to approximately 700pM, approximately 30pM to approximately 650pM, approximately 3 0pM~approx. 600pM, approx. 30pM~approx. 550pM, approx. 30pM~approx. 500pM, approx. 30pM~approx. 450pM, approx. 30pM~approx. 400pM, approx. 30pM~approx. 350pM, approx. 30pM~approx. 300pM, approx. 30pM~approx. 250pM, approx. 30pM~approx. 200pM, approx. 30pM~approx. 150pM 0pM, approximately 30pM to approximately 100pM, approximately 30pM to approximately 90pM, approximately 30pM to approximately 80pM, approximately 30pM to approximately 70pM, approximately 30pM to approximately 60pM, approximately 30pM to approximately 50pM, approximately 30pM to approximately 40pM, approximately 40pM to approximately 30nm, approximately 40pM to approximately 25nm, approximately 40pM to approximately 30nm.Approximately 40 pM to approximately 15 nm, approximately 40 pM to approximately 10 nm, approximately 40 pM to approximately 5 nm, approximately 40 pM to approximately 2 nm, approximately 40 pM to approximately 1 nm, approximately 40 pM to approximately 950 pM, approximately 40 pM to approximately 900 pM, approximately 40 pM to approximately 850 pM, approximately 40 pM to approximately 800 pM, approximately 40 pM to approximately 750 pM, approximately 40 40pM to approximately 700pM, approximately 40pM to approximately 650pM, approximately 40pM to approximately 600pM, approximately 40pM to approximately 550pM, approximately 40pM to approximately 500pM, approximately 40pM to approximately 450pM, approximately 40pM to approximately 400pM, approximately 40pM to approximately 350pM, approximately 40pM to approximately 300pM, approximately 40pM to approximately 250pM M, approximately 40pM to approximately 200pM, approximately 40pM to approximately 150pM, approximately 40pM to approximately 100pM, approximately 40pM to approximately 90pM, approximately 40pM to approximately 80pM, approximately 40pM to approximately 70pM, approximately 40pM to approximately 60pM, approximately 40pM to approximately 50pM, approximately 50pM to approximately 30nm, approximately 50pM to approximately 25nm. Approximately 50 pM to approximately 30 nm, approximately 50 pM to approximately 15 nm, approximately 50 pM to approximately 10 nm, approximately 50 pM to approximately 5 nm, approximately 50 pM to approximately 2 nm, approximately 50 pM to approximately 1 nm, approximately 50 pM to approximately 950 pM, approximately 50 pM to approximately 900 pM, approximately 50 pM to approximately 850 pM, approximately 50 pM to approximately 800 pM, approximately 50 p M~approx. 750pM, approx. 50pM~approx. 700pM, approx. 50pM~approx. 650pM, approx. 50pM~approx. 600pM, approx. 50pM~approx. 550pM, approx. 50pM~approx. 500pM, approx. 50pM~approx. 450pM, approx. 50pM~approx. 400pM, approx. 50pM~approx. 350pM, approx. 50pM~approx. 300pM Approximately 50 pM to approximately 250 pM, approximately 50 pM to approximately 200 pM, approximately 50 pM to approximately 150 pM, approximately 50 pM to approximately 100 pM, approximately 50 pM to approximately 90 pM, approximately 50 pM to approximately 80 pM, approximately 50 pM to approximately 70 pM, approximately 50 pM to approximately 60 pM, approximately 60 pM to approximately 30 nM, approximately 60 pM to approximately 25 nM. Approximately 60 pM to approximately 30 nm, approximately 60 pM to approximately 15 nm, approximately 60 pM to approximately 10 nm, approximately 60 pM to approximately 5 nm, approximately 60 pM to approximately 2 nm, approximately 60 pM to approximately 1 nm, approximately 60 pM to approximately 950 pM, approximately 60 pM to approximately 900 pM, approximately 60 pM to approximately 850 pM, approximately 60 pM to approximately 800 pM, approximately 60 p M~approx. 750pM, approx. 60pM~approx. 700pM, approx. 60pM~approx. 650pM, approx. 60pM~approx. 600pM, approx. 60pM~approx. 550pM, approx. 60pM~approx. 500pM, approx. 60pM~approx. 450pM, approx. 60pM~approx. 400pM, approx. 60pM~approx. 350pM, approx. 60pM~approx. 300pMApproximately 60 pM to approximately 250 pM, approximately 60 pM to approximately 200 pM, approximately 60 pM to approximately 150 pM, approximately 60 pM to approximately 100 pM, approximately 60 pM to approximately 90 pM, approximately 60 pM to approximately 80 pM, approximately 60 pM to approximately 70 pM, approximately 70 pM to approximately 30 nM, approximately 70 pM to approximately 25 nM, approximately 70 pM to approximately 30 nM, approximately 70 pM to approximately 15 nM, approximately 70 pM to approximately 10 nM, approximately 70 pM to approximately 5 nM, approximately 70 pM ~ approximately 2nM, approximately 70pM ~ approximately 1nM, approximately 70pM ~ approximately 950pM, approximately 70pM ~ approximately 900pM, approximately 70pM ~ approximately 850pM, approximately 70pM ~ approximately 800pM, approximately 70pM ~ approximately 750pM, approximately 70pM ~ approximately 700pM, approximately 70pM ~ approximately 650pM, approximately 70pM ~ approximately 600pM, approximately 70pM ~ approximately 550pM, approximately 70pM ~ approximately 500pM, approximately 70pM ~ approximately 450pM Approximately 70pM to approximately 400pM, approximately 70pM to approximately 350pM, approximately 70pM to approximately 300pM, approximately 70pM to approximately 250pM, approximately 70pM to approximately 200pM, approximately 70pM to approximately 150pM, approximately 70pM to approximately 100pM, approximately 70pM to approximately 90pM, approximately 70pM to approximately 80pM, approximately 80pM to approximately 300pM nM, approximately 80pM to approximately 25nM, approximately 80pM to approximately 30nM, approximately 80pM to approximately 15nM, approximately 80pM to approximately 10nM, approximately 80pM to approximately 5nM, approximately 80pM to approximately 2nM, approximately 80pM to approximately 1nM, approximately 80pM to approximately 950pM, approximately 80pM to approximately 900pM, approximately 80pM to approximately 850pM, approximately 80pM~approx. 800pM, approx. 80pM~approx. 750pM, approx. 80pM~approx. 700pM, approx. 80pM~approx. 650pM, approx. 80pM~approx. 600pM, approx. 80pM~approx. 550pM, approx. 80pM~approx. 500pM, approx. 80pM~approx. 450pM, approx. 80pM~approx. 400pM, approx. 80pM~approx. 3 50pM, approximately 80pM to approximately 300pM, approximately 80pM to approximately 250pM, approximately 80pM to approximately 200pM, approximately 80pM to approximately 150pM, approximately 80pM to approximately 100pM, approximately 80pM to approximately 90pM, approximately 90pM to approximately 30nM, approximately 90pM to approximately 25nM, approximately 90pM to approximately 30nM, approximately 90pM to approximately 15nM, approximately 90pM to approximately 10nM, approximately 90pM to approximately 5nM, approximately 90pM to approximately 2nM, approximately 90pM to approximately 1nM, approximately 90pM to approximately 950pM, approximately 90pM to approximately 900pM, approximately 90pM to approximately 850pM, approximately 90pM to approximately 800pM, approximately 90pM to approximately 750pM, approximately 90pM to approximately 700pM 0pM, approximately 90pM to approximately 650pM, approximately 90pM to approximately 600pM, approximately 90pM to approximately 550pM, approximately 90pM to approximately 500pM, approximately 90pM to approximately 450pM, approximately 90pM to approximately 400pM, approximately 90pM to approximately 350pM, approximately 90pM to approximately 300pM, approximately 90pM to approximately 250pM, approximately 90 pM ~ approximately 200 pM, approximately 90 pM ~ approximately 150 pM, approximately 90 pM ~ approximately 100 pM, approximately 100 pM ~ approximately 30 nM, approximately 100 pM ~ approximately 25 nM, approximately 100 pM ~ approximately 30 nM, approximately 100 pM ~ approximately 15 nM, approximately 100 pM ~ approximately 10 nM, approximately 100 pM ~ approximately 5 nM, approximately 100 pM ~ approximately 2 nM Approximately 100 pM to approximately 1 nm; approximately 100 pM to approximately 950 pM; approximately 100 pM to approximately 900 pM; approximately 100 pM to approximately 850 pM; approximately 100 pM to approximately 800 pM; approximately 100 pM to approximately 750 pM; approximately 100 pM to approximately 700 pM; approximately 100 pM to approximately 650 pM; approximately 100 pM to approximately 600 pM.Approximately 100pM to approximately 550pM, approximately 100pM to approximately 500pM, approximately 100pM to approximately 450pM, approximately 100pM to approximately 400pM, approximately 100pM to approximately 350pM, approximately 100pM to approximately 300pM, approximately 100pM to approximately 250pM, approximately 100pM to approximately 200pM, approximately 100pM to approximately 150pM pM, approximately 150 pM to approximately 30 nm, approximately 150 pM to approximately 25 nm, approximately 150 pM to approximately 30 nm, approximately 150 pM to approximately 15 nm, approximately 150 pM to approximately 10 nm, approximately 150 pM to approximately 5 nm, approximately 150 pM to approximately 2 nm, approximately 150 pM to approximately 1 nm, approximately 150 pM to approximately 950 pM, approximately 150 pM ~approximately 900pM, approximately 150pM~approximately 850pM, approximately 150pM~approximately 800pM, approximately 150pM~approximately 750pM, approximately 150pM~approximately 700pM, approximately 150pM~approximately 650pM, approximately 150pM~approximately 600pM, approximately 150pM~approximately 550pM, approximately 150pM~approximately 500pM, approximately 15 0pM~approx. 450pM, approx. 150pM~approx. 400pM, approx. 150pM~approx. 350pM, approx. 150pM~approx. 300pM, approx. 150pM~approx. 250pM, approx. 150pM~approx. 200pM, approx. 200pM~approx. 3 ...450pM, approx. 150pM~approx. 400 pM ~ approximately 15 nmM, approximately 200 pM ~ approximately 10 nmM, approximately 200 pM ~ approximately 5 nmM, approximately 200 pM ~ approximately 2 nmM, approximately 200 pM ~ approximately 1 nmM, approximately 200 pM ~ approximately 950 pM, approximately 200 pM ~ approximately 900 pM, approximately 200 pM ~ approximately 850 pM, approximately 200 pM ~ approximately 800 pM, approximately 200 pM ~ approximately 7 nmM 50pM, approximately 200pM to approximately 700pM, approximately 200pM to approximately 650pM, approximately 200pM to approximately 600pM, approximately 200pM to approximately 550pM, approximately 200pM to approximately 500pM, approximately 200pM to approximately 450pM, approximately 200pM to approximately 400pM, approximately 200pM to approximately 350pM, approximately 200pM~ Approximately 300 pM, approximately 200 pM to approximately 250 pM, approximately 300 pM to approximately 30 nm, approximately 300 pM to approximately 25 nm, approximately 300 pM to approximately 30 nm, approximately 300 pM to approximately 15 nm, approximately 300 pM to approximately 10 nm, approximately 300 pM to approximately 5 nm, approximately 300 pM to approximately 2 nm, approximately 300 pM to approximately 1 nm, approximately 3 00pM~approx. 950pM, approx. 300pM~approx. 900pM, approx. 300pM~approx. 850pM, approx. 300pM~approx. 800pM, approx. 300pM~approx. 750pM, approx. 300pM~approx. 700pM, approx. 300pM~approx. 650pM, approx. 300pM~approx. 600pM, approx. 300pM~approx. 550pMApproximately 300pM to approximately 500pM, approximately 300pM to approximately 450pM, approximately 300pM to approximately 400pM, approximately 300pM to approximately 350pM, approximately 400pM to approximately 30nm, approximately 400pM to approximately 25nm, approximately 400pM to approximately 30nm, approximately 400pM to approximately 15nm, approximately 400pM to approximately 10nm, approximately 40 0pM ~ approximately 5nm, approximately 400pM ~ approximately 2nm, approximately 400pM ~ approximately 1nm, approximately 400pM ~ approximately 950pM, approximately 400pM ~ approximately 900pM, approximately 400pM ~ approximately 850pM, approximately 400pM ~ approximately 800pM, approximately 400pM ~ approximately 750pM, approximately 400pM ~ approximately 700pM, approximately 400pM ~ Approximately 650 pM, approximately 400 pM to approximately 600 pM, approximately 400 pM to approximately 550 pM, approximately 400 pM to approximately 500 pM, approximately 500 pM to approximately 30 nm, approximately 500 pM to approximately 25 nm, approximately 500 pM to approximately 30 nm, approximately 500 pM to approximately 15 nm, approximately 500 pM to approximately 10 nm, approximately 500 pM to approximately 5 nm M, approximately 500pM to approximately 2nM, approximately 500pM to approximately 1nM, approximately 500pM to approximately 950pM, approximately 500pM to approximately 900pM, approximately 500pM to approximately 850pM, approximately 500pM to approximately 800pM, approximately 500pM to approximately 750pM, approximately 500pM to approximately 700pM, approximately 500pM to approximately 650pM, approximately 500pM~approx. 600pM, approx. 500pM~approx. 550pM, approx. 600pM~approx. 30nm, approx. 600pM~approx. 25nm, approx. 600pM~approx. 30nm, approx. 600pM~approx. 15nm, approx. 600pM~approx. 10nm, approx. 600pM~approx. 5nm, approx. 600pM~approx. 2nm, approx. 600pM~approx. 1 nM, approximately 600 pM to approximately 950 pM, approximately 600 pM to approximately 900 pM, approximately 600 pM to approximately 850 pM, approximately 600 pM to approximately 800 pM, approximately 600 pM to approximately 750 pM, approximately 600 pM to approximately 700 pM, approximately 600 pM to approximately 650 pM, approximately 700 pM to approximately 30 nM, approximately 700 pM to approximately 25 nM nM, approximately 700pM to approximately 30nM, approximately 700pM to approximately 15nM, approximately 700pM to approximately 10nM, approximately 700pM to approximately 5nM, approximately 700pM to approximately 2nM, approximately 700pM to approximately 1nM, approximately 700pM to approximately 950pM, approximately 700pM to approximately 900pM, approximately 700pM to approximately 850pM, approximately 700 pM ~ approximately 800 pM, approximately 700 pM ~ approximately 750 pM, approximately 800 pM ~ approximately 30 nM, approximately 800 pM ~ approximately 25 nM, approximately 800 pM ~ approximately 30 nM, approximately 800 pM ~ approximately 15 nM, approximately 800 pM ~ approximately 10 nM, approximately 800 pM ~ approximately 5 nM, approximately 800 pM ~ approximately 2 nM, approximately 800 pM ~ approximately 1 nMApproximately 800pM~950pM, approximately 800pM~900pM, approximately 800pM~850pM, approximately 900pM~30nM, approximately 900pM~25nM, approximately 900pM~30nM, approximately 900pM~15nM, approximately 900pM~10nM, approximately 900pM~5nM, approximately 900pM~2nM Approximately 900 pM to approximately 1 nm, approximately 900 pM to approximately 950 pM, approximately 1 nm to approximately 30 nm, approximately 1 nm to approximately 25 nm, approximately 1 nm to approximately 20 nm, approximately 1 nm to approximately 15 nm, app...

Claims

1. Pre-exhausted CD8 ＋ T (Tpex) cells, Effector Memory CD 8 ＋ T (Temp) cells, central memory CD8 ＋ T (Tcm) cells, memory stem CD8 ＋ T (Tscm) cells, antigen-experienced CD8 ＋ T cells and late exhausted CD8 ＋ CD8 selected from a group consisting of T(Tex) cells ＋ A method for increasing T cell proliferation in vitro, wherein the method is the CD8 ＋ T cells: (a)(i) First target binding domain; (ii) A soluble tissue factor domain containing a sequence that is at least 90% identical to sequence number 1; and (iii) The first domain of a pair of affinity domains containing a sequence that is at least 90% identical to sequence number 24. A first chimeric polypeptide containing; (b) (i) A second domain of a pair of affinity domains containing a sequence that is at least 90% identical to sequence number 22; and (ii) Second target binding domain This involves contacting a second chimeric polypeptide containing with an effective amount of a polychain chimeric polypeptide containing Here, the first chimeric polypeptide and the second chimeric polypeptide associate via the binding of the first domain and the second domain of the pair of affinity domains; A method comprising a first target-binding domain and a second target-binding domain, each containing a soluble TGF-β receptor II (TGF-βRII) having an amino acid sequence that is at least 90% identical to SEQ ID NO:

5.

2. The method according to claim 1, wherein the method does not involve specific antigen stimulation.

3. The method according to claim 1 or 2, wherein the first target-binding domain and the soluble tissue factor domain are in direct contact with each other in the first chimeric polypeptide.

4. The method according to claim 1 or 2, wherein the first chimeric polypeptide further comprises a linker sequence between the first target-binding domain and the soluble tissue factor domain in the first chimeric polypeptide.

5. The method according to any one of claims 1 to 4, wherein the soluble tissue factor domain and the first domain of the pair of affinity domains are in direct contact with each other in the first chimeric polypeptide.

6. The method according to any one of claims 1 to 4, wherein the first chimeric polypeptide further comprises a linker sequence between the soluble tissue factor domain in the first chimeric polypeptide and the first domain of the pair of affinity domains.

7. The method according to any one of claims 1 to 6, wherein the second domain and the second target-binding domain of the pair of affinity domains are in direct contact with each other in the second chimeric polypeptide.

8. The method according to any one of claims 1 to 6, wherein the second chimeric polypeptide further comprises a linker sequence between the second domain and the second target-binding domain of the pair of affinity domains in the second chimeric polypeptide.

9. The method according to any one of claims 1 to 8, wherein the first chimeric polypeptide further comprises one or more additional target-binding domains.

10. The method according to any one of claims 1 to 9, wherein the second chimeric polypeptide further comprises one or more additional target-binding domains.

11. The method according to any one of claims 1 to 10, wherein the first chimeric polypeptide and / or the second chimeric polypeptide further comprises a signal sequence at its N-terminus.

12. The method according to any one of claims 1 to 11, wherein the first target-binding domain comprises the sequence of SEQ ID NO:

5.

13. The method according to any one of claims 1 to 8, 11, and 12, wherein the first chimeric polypeptide comprises a sequence that is at least 80% identical to SEQ ID NO:

8.

14. The method according to claim 13, wherein the first chimeric polypeptide comprises a sequence that is at least 90% identical to SEQ ID NO:

8.

15. The method according to claim 14, wherein the first chimeric polypeptide comprises the sequence of SEQ ID NO:

8.

16. The method according to claim 15, wherein the first chimeric polypeptide comprises the sequence of SEQ ID NO:

10.

17. The method according to any one of claims 1 to 16, wherein the second target-binding domain comprises the sequence of SEQ ID NO:

5.

18. The method according to any one of claims 1 to 8 and 11 to 17, wherein the second chimeric polypeptide comprises a sequence that is at least 80% identical to SEQ ID NO:

12.

19. The method according to claim 18, wherein the second chimeric polypeptide comprises a sequence that is at least 90% identical to sequence number 12.

20. The method according to claim 19, wherein the second chimeric polypeptide comprises the sequence of SEQ ID NO:

12.

21. The method according to claim 20, wherein the second chimeric polypeptide comprises the sequence of SEQ ID NO:

14.

22. A pharmaceutical composition comprising a therapeutically effective amount of (i) a polychain chimeric polypeptide, (ii) T cells or CAR-T cells, and optionally (iii) a T cell stimulant, The aforementioned polychain chimeric polypeptide is as follows: (a)(i) First target binding domain; (ii) A soluble tissue factor domain containing a sequence that is at least 90% identical to sequence number 1; and (iii) The first domain of a pair of affinity domains containing a sequence that is at least 90% identical to sequence number 24. A first chimeric polypeptide containing; (b) (i) A second domain of a pair of affinity domains containing a sequence that is at least 90% identical to sequence number 22; and (ii) Second target binding domain A second chimeric polypeptide comprising, Here, the first chimeric polypeptide and the second chimeric polypeptide associate via the binding of the first domain and the second domain of the pair of affinity domains; A pharmaceutical composition comprising a soluble TGF-β receptor II (TGF-βRII) in which the first target-binding domain and the second target-binding domain each have an amino acid sequence that is at least 90% identical to that of SEQ ID NO:

5.

23. The pharmaceutical composition according to claim 22, wherein the pharmaceutical composition comprises T cells.

24. The pharmaceutical composition according to claim 22, wherein the pharmaceutical composition comprises CAR-T cells.

25. The pharmaceutical composition according to any one of claims 22 to 24, wherein the pharmaceutical composition comprises a T cell stimulant.

26. A pharmaceutical composition comprising a therapeutically effective amount of a polychain chimeric polypeptide and a therapeutic antibody that specifically binds to a tumor antigen, The aforementioned polychain chimeric polypeptide is as follows: (a)(i) First target binding domain; (ii) A soluble tissue factor domain containing a sequence that is at least 90% identical to sequence number 1; and (iii) The first domain of a pair of affinity domains containing a sequence that is at least 90% identical to sequence number 24. A first chimeric polypeptide containing; (b) (i) A second domain of a pair of affinity domains containing a sequence that is at least 90% identical to sequence number 22; and (ii) Second target binding domain A second chimeric polypeptide comprising, Here, the first chimeric polypeptide and the second chimeric polypeptide associate via the binding of the first domain and the second domain of the pair of affinity domains; A pharmaceutical composition comprising a soluble TGF-β receptor II (TGF-βRII) in which the first target-binding domain and the second target-binding domain each have an amino acid sequence that is at least 90% identical to that of SEQ ID NO:

5.

27. The pharmaceutical composition according to any one of claims 22 to 26, wherein the first chimeric polypeptide further comprises one or more additional target-binding domains.

28. The pharmaceutical composition according to any one of claims 22 to 27, wherein the second chimeric polypeptide further comprises one or more additional target-binding domains.

29. The pharmaceutical composition according to any one of claims 22 to 28, wherein the first target-binding domain comprises the sequence of Sequence ID No.

5.

30. The pharmaceutical composition according to any one of claims 22 to 26 and 29, wherein the first chimeric polypeptide comprises a sequence that is at least 80% identical to SEQ ID NO:

8.

31. The pharmaceutical composition according to claim 30, wherein the first chimeric polypeptide comprises a sequence that is at least 90% identical to SEQ ID NO:

8.

32. The pharmaceutical composition according to claim 31, wherein the first chimeric polypeptide comprises the sequence of SEQ ID NO:

8.

33. The pharmaceutical composition according to claim 32, wherein the first chimeric polypeptide comprises the sequence of SEQ ID NO:

10.

34. The pharmaceutical composition according to any one of claims 22 to 31 and 29 to 33, wherein the second target-binding domain comprises the sequence of Sequence ID No.

5.

35. The pharmaceutical composition according to any one of claims 22 to 26 and 29 to 33, wherein the second chimeric polypeptide comprises a sequence that is at least 80% identical to SEQ ID NO:

12.

36. The pharmaceutical composition according to claim 35, wherein the second chimeric polypeptide comprises a sequence that is at least 90% identical to SEQ ID NO:

12.

37. The pharmaceutical composition according to claim 36, wherein the second chimeric polypeptide comprises the sequence of SEQ ID NO:

12.

38. The pharmaceutical composition according to claim 37, wherein the second chimeric polypeptide comprises the sequence of SEQ ID NO:

14.

39. A kit comprising the pharmaceutical composition according to any one of claims 22 to 38.

Images