Circular RNA vector containing modified nucleotides

Abstract

An RNA vector is provided comprising a substitution group 1 intron / exon containing a 5' exon, a 3' exon, and an intron, wherein the intron comprises a substitution group 1 intron / exon containing a 5' intron end and a 3' intron end, and at least one modified nucleotide, wherein the 3' exon is upstream of the 5' exon, a portion of the intron containing the 3' intron end is upstream of the 3' exon, a portion of the intron containing the 5' intron end is downstream of the 5' exon, and the substitution group 1 intron / exon is active in the presence of the modified nucleotide. A DNA vector and a method for expressing a target protein from a circular RNA vector are also provided.

Description

Technical Field

[0001] [Cross-Reference to Related Applications] This application claims the benefit of priority of U.S. Provisional Application No. 63 / 587,270, filed on October 2, 2023, which is hereby incorporated herein by reference in its entirety.

[0002] [Reference to Sequence Listing] The Sequence Listing, which was created on September 26, 2024, and submitted on October 2, 2024 as an .XML file titled "11579-011WO1_ST26.xml" with a file size of 39,572 bytes, is incorporated herein by reference in accordance with 37 C.F.R. § 1.52(e)(5).

Background Art

[0003] Linear mRNAs containing modified nucleosides (such as those containing pseudouridine and N1-methylpseudouridine) can be prepared by in vitro transcription. These nucleoside-modified linear mRNAs are important gene therapy vectors with reduced immunogenicity. There is a need to incorporate such modified nucleosides into cyclic mRNAs, which have a longer half-life than linear mRNAs.

[0004] Cyclic mRNAs contain an internal ribosome entry site (450 to 750 nucleotides) required for translation and an open reading frame encoding a therapeutic protein. Therefore, to express any therapeutic protein longer than 200 amino acids, a cyclic mRNA containing more than 1,000 nucleotides is required. However, no available methods exist to incorporate these modified nucleosides into cyclic mRNAs having a length of more than 1,000 nucleotides.

Summary of the Invention

[0005] A circular mRNA platform for expressing a target protein is disclosed herein. Further disclosed herein is a circular mRNA platform for transient gene therapy having reduced immunogenicity and reactogenicity, which can be translated in the presence of modified nucleotides (e.g., pseudouridine and N1-methylpseudridine). Methods and constructs for preparing these nucleoside-modified circular mRNAs are also disclosed herein.

[0006] In one embodiment, an RNA vector is provided comprising a substitution group 1 intron / exon including a 5' exon, a 3' exon, and an intron, wherein the intron comprises a substitution group 1 intron / exon including a 5' intron terminus and a 3' intron terminus, and at least one modified nucleotide, wherein the 3' exon is upstream of the 5' exon, a portion of the intron including the 3' intron terminus is upstream of the 3' exon, a portion of the intron including the 5' intron terminus is downstream of the 5' exon, and the substitution group 1 intron / exon is active in the presence of the modified nucleotide.

[0007] In another embodiment, a circular RNA vector formed from any of the disclosed RNA vectors is provided.

[0008] In yet another embodiment, a DNA vector is provided comprising a substitution group 1 intron / exon including a 5' exon, a 3' exon, and an intron, wherein the intron includes a substitution group 1 intron / exon including a 5' intron end and a 3' intron end, and a multiple cloning site, wherein the 3' exon is upstream of the 5' exon, a portion of the intron including the 3' intron end is upstream of the 3' exon, and a portion of the intron including the 5' intron end is downstream of the 5' exon.

[0009] In yet another embodiment, a circular RNA vector transcribed from one of the disclosed DNA vectors is provided.

[0010] In yet another embodiment, a method is provided for expressing a target protein from a circular RNA vector, comprising providing one of the disclosed circular RNA vectors and translating the target protein.

[0011] Other systems, methods, features, and / or advantages will be apparent to those skilled in the art after examining the following drawings and detailed description. All such additional systems, methods, features, and / or advantages are contained within this description and are intended to be protected by the attached claims. [Brief explanation of the drawing]

[0012] [Figure 1A] This demonstrates that RNA can be cyclized without the need for a protein. [Figure 1B] This demonstrates that RNA can be cyclized without the need for a protein. [Figure 2] This describes a method used to investigate how m1Ψ modification prevents substitutional group 1 intron cyclization of synthetic mRNA. [Figure 3] This shows different uridine analogs used to generate fully uridine-modified mRNA. [Figure 4A] We demonstrate that both linear Azoarcus (Figure 4A) and PIE Azoarcus (Figure 4B) constructs were prepared by IVT using different ratios of U to m1Ψ. [Figure 4B] We demonstrate that both linear Azoarcus (Figure 4A) and PIE Azoarcus (Figure 4B) constructs were prepared by IVT using different ratios of U to m1Ψ. [Figure 4C] Figure 4C shows the quantification of the amount of residual precursor for both Figure 4A and Figure 4B. [Figure 5A] Figure 5A shows the directional evolution of the complete uridine substitution group 1 intron. [Figure 5B] Figure 5B shows the number of mutations per molecule from the prepared library. [Figure 5C] Figure 5C shows the variants present in the mutant library. [Figure 5D] Figure 5D shows the activity of the mutant library compared to the wild-type sequence. [Figure 6] Shows the mechanism of group I intron-PIE splicing. [Figure 7] Shows that self versus non-self recognition protects hosts from invading pathogens. [Figure 8] Shows a schematic diagram of the experimental workflow used to investigate TLR7 / 8 sensing of exogenous circRNA. [Figure 9A] Shows circRNA preparation. [Figure 9B] Shows circRNA preparation. [Figure 9C] Shows circRNA preparation. [Figure 10A] Shows circRNA immunogenicity. [Figure 10B] Shows circRNA immunogenicity. [Figure 11A] Shows the verification of CRISPR KO of the target gene in transdifferentiated BLaER1 cells. [Figure 11B] Shows the verification of CRISPR KO of the target gene in transdifferentiated BLaER1 cells. [Figure 11C] Shows the verification of CRISPR KO of the target gene in transdifferentiated BLaER1 cells. [Figure 12A] Shows that circRNA sensing is TLR7 / 8-mediated. [Figure 12B] Shows that circRNA sensing is TLR7 / 8-mediated. [Figure 13A] Shows how ψ / m1ψ modification reduces group I intron activity by weakening the interaction between the GAAA tetraloop and its receptor. [Figure 13B] Shows how ψ / m1ψ modification reduces group I intron activity by weakening the interaction between the GAAA tetraloop and its receptor. [Figure 13C]This study demonstrates how ψ / m1ψ modification reduces group I intron activity by weakening the interaction between the GAAA tetraloop and its receptor. [Figure 13D] This study demonstrates how ψ / m1ψ modification reduces group I intron activity by weakening the interaction between the GAAA tetraloop and its receptor. [Figure 13E] This study demonstrates how ψ / m1ψ modification reduces group I intron activity by weakening the interaction between the GAAA tetraloop and its receptor. [Figure 14] This study demonstrates the effects of pseudouridine and N1-methylpseudridine on the splicing efficiency of Anabaena PIE. [Figure 15A] This study demonstrates the effects of pseudouridine and N1-methylpseudridine on the splicing efficiency of Anabaena PIE and the precursor remaining over time. [Figure 15B] This study demonstrates the effects of pseudouridine and N1-methylpseudridine on the splicing efficiency of Anabaena PIE and the precursor remaining over time. [Figure 16] This study demonstrates the effects of pseudouridine and N1-methylpseudridine on the splicing efficiency of Azoarcus PIE. [Figure 17A] This study demonstrates the effects of pseudouridine and N1-methylpseudridine on the splicing efficiency of Azoarcus PIE and its residual precursor over time. [Figure 17B] This study demonstrates the effects of pseudouridine and N1-methylpseudridine on the splicing efficiency of Azoarcus PIE and its residual precursor over time. [Figure 18A] This study demonstrates that Azoarcus PIE P6 can be efficiently cyclized, successfully producing modified circular mRNA. [Figure 18B] This study demonstrates that Azoarcus PIE P6 can be efficiently cyclized, successfully producing modified circular mRNA. [Figure 18C] Figure 18C shows that circular mRNA does not accumulate. [Figure 19] This shows the cyclization efficiency of Azoarcus PIE P8. [Figure 20] The results of a 6% denatured PAGE, SYBR gold staining assay are shown, demonstrating cyclization of Ψ-modified RNA with an efficiency of over 90%. [Figure 21] This demonstrates that the improved Azoarcus PIE generates accurate exon-exon junctions. [Figure 22] This is a schematic diagram of the substitutional intron-exon (PIE) strategy for cyclization. [Figure 23A] It shows a 15% cyclization efficiency for 1.5kb pseudouridine-modified mRNA. [Figure 23B] It shows a 15% cyclization efficiency for 1.5kb pseudouridine-modified mRNA. [Modes for carrying out the invention]

[0013] For clarity, it is understood that certain features of the Disclosure described in the context of a separate embodiment may also be provided in combination with a single embodiment. Conversely, for brevity, various features of the Disclosure described in the context of a single embodiment may also be provided separately or in any preferred partial combination. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Methods and materials similar to or equivalent to those described herein may be used in the implementation or testing of the Disclosure.

[0014] In one embodiment, an RNA vector is provided comprising a substitution group 1 intron / exon including a 5' exon, a 3' exon, and an intron, wherein the intron comprises a substitution group 1 intron / exon including a 5' intron terminus and a 3' intron terminus, and at least one modified nucleotide, wherein the 3' exon is upstream of the 5' exon, a portion of the intron including the 3' intron terminus is upstream of the 3' exon, a portion of the intron including the 5' intron terminus is downstream of the 5' exon, and the substitution group 1 intron / exon is active in the presence of the modified nucleotide. In some embodiments, the RNA vector may further include a nucleic acid sequence encoding a target protein.

[0015] In another embodiment, an RNA vector is provided comprising a substitution group 1 intron / exon including a 5' exon, a 3' exon, and an intron, wherein the intron includes a 5' intron terminus and a 3' intron terminus, a nucleic acid sequence encoding a target protein, and at least one modified nucleotide, wherein the 3' exon is upstream of the 5' exon, a portion of the intron including the 3' intron terminus is upstream of the 3' exon, a portion of the intron including the 5' intron terminus is downstream of the 5' exon, and the substitution group 1 intron / exon is active in the presence of the modified nucleotide. In some embodiments, the nucleic acid sequence encoding the target protein may be between the 3' and 5' exons.

[0016] In some embodiments, the modified nucleotides may be modified uridine nucleotides, such as pseudouridine, N1-methylpseudridine, 5-methyluridine, 5-methoxyuridine, 5-methylcytidine, 1-ethylpseudridine, 2-thiouridine, 4-thiouridine, 2-thio-1-methylpseudridine, 2-thio-5-azauridine, 4-thio-1-methylpseudridine, 5-thiopseudridine, 5-azauridine, or any combination thereof. In some such embodiments, some or all of the uridine nucleotides in the RNA vector may be replaced with modified uridine nucleotides, or any combination thereof. For example, in some embodiments, more than 0% of the uridine nucleotides in the RNA vector (e.g., more than 5%, more than 10%, more than 15%, more than 20%, more than 25%, more than 30%, more than 35%, more than 40%, more than 45%, more than 50%, more than 55%, more than 60%, more than 65%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, more than 95%, more than 100%) can be replaced with modified uridine nucleotides. In some embodiments, up to approximately 100% (e.g., up to approximately 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, and 5%) of the uridine nucleotides in the RNA vector can be replaced with modified uridine nucleotides.

[0017] It is conceivable that any percentage of uridine nucleotides in an RNA vector can be replaced with modified uridine nucleotides. For example, in some embodiments, about 0% to about 100% of the uridine nucleotides in an RNA vector (e.g., about 5% to about 95%, about 10% to about 90%, about 15% to about 85%, about 20% to about 80%, about 25% to about 75%, about 30% to about 70%, about 35% to about 65%, about 40% to about 60%, about 45% to about 55%, about 0% to about 50%, about 5% to about 45%, about 10% to about 40%, about 15% to about 35%, about 20% to about 30%, about 50% to about 100%, about 55% to about 95%, about 60% to about 90%, about 65% to about 85%, about 70% to about 80%) can be replaced with modified uridine nucleotides.

[0018] In addition or alternatively, in other embodiments, the modified nucleotide may be a modified adenosine nucleotide, a modified cytidine nucleotide, a modified guanosine nucleotide, or any combination thereof.

[0019] It is understood that at least one modified nucleotide may be present in any portion of the RNA vector. For example, in some embodiments, at least one modified nucleotide may be present in a substitution group 1 intron / exon. In other embodiments, at least one modified nucleotide may be present in the nucleic acid sequence encoding the target protein. In yet another embodiment, both the substitution group 1 intron / exon and the nucleic acid sequence encoding the target protein may each contain at least one modified nucleotide.

[0020] In some embodiments, the substituted group 1 intron / exon may be an Azoarcus group 1 intron / exon. In some embodiments, the substituted group 1 intron / exon may further include at least one mutation to a wild-type group 1 intron / exon. In some embodiments, the wild-type group 1 intron / exon may be an Azoarcus group 1 intron / exon. In some embodiments, the mutation may improve the transcription of the vector. In some embodiments, the mutation may include the addition and / or removal of nucleotides to / from a wild-type group 1 intron / exon.

[0021] In some embodiments, a portion of an intron including its 3' intron end may have a similarity of 80% or more to SEQ ID NO: 15 or SEQ ID NO: 16 (e.g., 81% or more similarity, 82% or more similarity, 83% or more similarity, 84% or more similarity, 85% or more similarity, 86% or more similarity, 87% or more similarity, 88% or more similarity, 89% or more similarity, 90% or more similarity, 91% or more similarity, 92% or more similarity, 93% or more similarity, 94% or more similarity, 95% or more similarity, 96% or more similarity, 97% or more similarity, 98% or more similarity, 99% or more similarity). In some embodiments, a portion of an intron including its 3' intron end may have a similarity of 80% or more to SEQ ID NO: 15 or SEQ ID NO: 16.

[0022] In some embodiments, a portion of an intron including its 5' intron end may have a similarity of 80% or more to SEQ ID NO: 17 or SEQ ID NO: 18 (e.g., 81% or more similarity, 82% or more similarity, 83% or more similarity, 84% or more similarity, 85% or more similarity, 86% or more similarity, 87% or more similarity, 88% or more similarity, 89% or more similarity, 90% or more similarity, 91% or more similarity, 92% or more similarity, 93% or more similarity, 94% or more similarity, 95% or more similarity, 96% or more similarity, 97% or more similarity, 98% or more similarity, 99% or more similarity). In some embodiments, a portion of an intron including its 5' intron end may have a similarity of 80% or more to SEQ ID NO: 17 or SEQ ID NO: 18.

[0023] In some embodiments, the 3' exon may contain 80% or more similarity to SEQ ID NO: 19 or SEQ ID NO: 20 (e.g., 81% or more similarity, 82% or more similarity, 83% or more similarity, 84% or more similarity, 85% or more similarity, 86% or more similarity, 87% or more similarity, 88% or more similarity, 89% or more similarity, 90% or more similarity, 91% or more similarity, 92% or more similarity, 93% or more similarity, 94% or more similarity, 95% or more similarity, 96% or more similarity, 97% or more similarity, 98% or more similarity, 99% or more similarity). In some embodiments, the 3' exon may contain SEQ ID NO: 19 or SEQ ID NO: 20.

[0024] In some embodiments, the 5' exon may have a similarity of 80% or more to SEQ ID NO: 21 or SEQ ID NO: 22 (e.g., 81% or more similarity, 82% or more similarity, 83% or more similarity, 84% or more similarity, 85% or more similarity, 86% or more similarity, 87% or more similarity, 88% or more similarity, 89% or more similarity, 90% or more similarity, 91% or more similarity, 92% or more similarity, 93% or more similarity, 94% or more similarity, 95% or more similarity, 96% or more similarity, 97% or more similarity, 98% or more similarity, 99% or more similarity). In some embodiments, the 5' exon may have a similarity of 80% or more to SEQ ID NO: 21 or SEQ ID NO: 22.

[0025] In some embodiments, the target protein may be any protein of interest. For example, in some embodiments, the target protein may be an antigen (e.g., COVID spike protein), a hormone (e.g., insulin, erythropoietin, human growth hormone), a cytokine (e.g., interferon), or a coagulation factor (e.g., factor IX). Additionally or alternatively, in other embodiments, the target protein may include a fluorescent protein. In some such embodiments, the target protein may include eGFP, mCherry, Firefly luciferase, or NanoLuc luciferase. An exemplary RNA vector encoding eGFP is provided in SEQ ID NO: 26.

[0026] In some embodiments, the target protein may contain at least one modified nucleotide. In some such embodiments, the substitution group 1 intron / exon may additionally contain at least one modified nucleotide. In other such embodiments, the substitution group 1 intron / exon may not contain any modified nucleotide. In some embodiments, the modified nucleotide may be a modified uridine nucleotide, e.g., pseudouridine, N1-methylpseudridine, 5-methyluridine, 5-methoxyuridine, 5-methylcytidine, 1-ethylpseudridine, 2-thiouridine, 4-thiouridine, 2-thio-1-methylpseudridine, 2-thio-5-aza-uridine, 4-thio-1-methylpseudridine, 5-thiopseudridine, 5-aza-uridine, or any combination thereof. In some such embodiments, some or all of the uridine nucleotides in the nucleic acid sequence encoding the target protein may be replaced with modified uridine nucleotides. For example, in some embodiments, more than 0% of the uridine nucleotides in the nucleic acid sequence encoding the target protein (e.g., more than 5%, more than 10%, more than 15%, more than 20%, more than 25%, more than 30%, more than 35%, more than 40%, more than 45%, more than 50%, more than 55%, more than 60%, more than 65%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, more than 95%, more than 100%) can be replaced with modified uridine nucleotides. In some embodiments, up to about 100% (e.g., up to about 95%, up to about 90%, up to about 85%, up to about 80%, up to about 75%, up to about 70%, up to about 65%, up to about 60%, up to about 55%, up to about 50%, up to about 45%, up to about 40%, up to about 35%, up to about 30%, up to about 25%, up to about 20%, up to about 15%, up to about 10%, up to about 5%) of the uridine nucleotides in the nucleic acid sequence encoding the target protein can be replaced with modified uridine nucleotides.

[0027] Any percentage of uridine nucleotides in the nucleic acid sequence encoding the target protein can be replaced with modified uridine nucleotides. For example, in some embodiments, about 0% to about 100% (e.g., about 5% to about 95%, about 10% to about 90%, about 15% to about 85%, about 20% to about 80%, about 25% to about 75%, about 30% to about 70%, about 35% to about 65%, about 40% to about 60%, about 45% to about 55%, about 0% to about 50%, about 5% to about 45%, about 10% to about 40%, about 15% to about 35%, about 20% to about 30%, about 50% to about 100%, about 55% to about 95%, about 60% to about 90%, about 65% to about 85%, about 70% to about 80%) of the uridine nucleotides in the nucleic acid sequence encoding the target protein can be replaced with modified uridine nucleotides.

[0028] In some embodiments, the RNA vector may further include an internal ribosome entry site (IRES). In some embodiments, the IRES may be active in the presence of modified nucleotides. In some embodiments, the IRES may have more than 80% similarity to SEQ ID NO: 23 (e.g., more than 81%, more than 82%, more than 83%, more than 84%, more than 85%, more than 86%, more than 87%, more than 88%, more than 89%, more than 90%, more than 91%, more than 92%, more than 93%, more than 94%, more than 95%, more than 96%, more than 97%, more than 98%, more than 99%). In some embodiments, the IRES may contain SEQ ID NO: 23.

[0029] In some embodiments, the RNA vector may further include at least one spacer. In some embodiments, the spacer may be selected from sequences that, at each occurrence, have a similarity of 80% or more to SEQ ID NO: 10 or SEQ ID NO: 11 (e.g., 81% or more similarity, 82% or more similarity, 83% or more similarity, 84% or more similarity, 85% or more similarity, 86% or more similarity, 87% or more similarity, 88% or more similarity, 89% or more similarity, 90% or more similarity, 91% or more similarity, 92% or more similarity, 93% or more similarity, 94% or more similarity, 95% or more similarity, 96% or more similarity, 97% or more similarity, 98% or more similarity, 99% or more similarity). In some embodiments, the spacer may be selected from SEQ ID NO: 10 or SEQ ID NO: 11 at each occurrence.

[0030] In some embodiments, the RNA vector may be more than approximately 1000 nucleotides in length (e.g., more than approximately 1100 nucleotides, more than approximately 1200 nucleotides, more than approximately 1300 nucleotides, more than approximately 1400 nucleotides, more than approximately 1500 nucleotides, more than approximately 1600 nucleotides, more than approximately 1700 nucleotides, more than approximately 1800 nucleotides, more than approximately 2000 nucleotides, more than approximately 2200 nucleotides, more than approximately 2400 nucleotides, more than approximately 2600 nucleotides, more than approximately 2800 nucleotides, more than approximately 3000 nucleotides, more than approximately 3200 nucleotides, more than approximately 3400 nucleotides, more than approximately 3600 nucleotides, more than approximately 3800 nucleotides, more than approximately 4000 nucleotides, more than approximately 4200 nucleotides, more than approximately 4400 nucleotides, more than approximately 4600 nucleotides, more than approximately 4800 nucleotides, more than approximately 5000 nucleotides).

[0031] In some embodiments, RNA vectors can be cyclized.

[0032] In yet another embodiment, a method is provided for preparing a circular RNA vector, comprising cyclizing one of the disclosed RNA vectors. In some embodiments, the 5' intron end can hybridize at least partially with the 3' intron end to form a circular RNA vector. In some embodiments, the method may further include splicing the introns.

[0033] In some embodiments, the RNA vector can be cyclized by in vitro transcription (IVT). In some embodiments, IVT can be carried out at a temperature of at least about 30°C (e.g., at least about 32°C, at least about 34°C, at least about 36°C, at least about 38°C, at least about 40°C, at least about 42°C, at least about 44°C, at least about 46°C, at least about 48°C, at least about 50°C, at least about 52°C, at least about 54°C, at least about 56°C, at least about 58°C, at least about 60°C, at least about 62°C, at least about 64°C, at least about 66°C, at least about 68°C, at least about 70°C). In some embodiments, IVT can be performed at temperatures up to approximately 70°C (for example, up to approximately 68°C, up to approximately 66°C, up to approximately 64°C, up to approximately 62°C, up to approximately 60°C, up to approximately 58°C, up to approximately 56°C, up to approximately 54°C, up to approximately 52°C, up to approximately 50°C, up to approximately 48°C, up to approximately 46°C, up to approximately 44°C, up to approximately 42°C, up to approximately 40°C, up to approximately 38°C, up to approximately 36°C, up to approximately 34°C, up to approximately 32°C, up to approximately 32°C, up to approximately 30°C).

[0034] It is considered that IVT can be performed at temperatures ranging from any of the minimum values ​​to any of the maximum values ​​listed above. For example, in some embodiments, IVT can be performed at temperatures of about 30°C to about 70°C (e.g., about 32°C to about 68°C, about 34°C to about 66°C, about 36°C to about 64°C, about 38°C to about 62°C, about 40°C to about 60°C, about 42°C to about 58°C, about 44°C to about 56°C, about 46°C to about 54°C, about 48°C to about 52°C, about 30°C to about 50°C, about 32°C to about 48°C, about 34°C to about 46°C, about 36°C to about 44°C, about 38°C to about 42°C, about 50°C to about 70°C, about 52°C to about 68°C, about 54°C to about 66°C, about 56°C to about 64°C, about 58°C to about 62°C).

[0035] In yet another embodiment, a circular RNA vector is provided which is formed from any of the disclosed RNA vectors and contains at least one modified nucleotide. In some embodiments, the modified nucleotide may be a modified uridine nucleotide, e.g., pseudouridine, N1-methylpseudridine, 5-methyluridine, 5-methoxyuridine, 5-methylcytidine, 1-ethylpseudridine, 2-thiouridine, 4-thiouridine, 2-thio-1-methylpseudridine, 2-thio-5-aza-uridine, 4-thio-1-methylpseudridine, 5-thiopseudridine, 5-aza-uridine, or any combination thereof. In some such embodiments, some or all of the uridine nucleotides in the circular RNA vector may be replaced with modified uridine nucleotides. For example, in some embodiments, more than 0% of the uridine nucleotides in the nucleic acid sequence encoding the target protein (e.g., more than 5%, more than 10%, more than 15%, more than 20%, more than 25%, more than 30%, more than 35%, more than 40%, more than 45%, more than 50%, more than 55%, more than 60%, more than 65%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, more than 95%, more than 100%) can be replaced with modified uridine nucleotides. In some embodiments, up to approximately 100% (e.g., up to approximately 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, and 5%) of the uridine nucleotides in a circular RNA vector can be replaced with modified uridine nucleotides.

[0036] Any percentage of uridine nucleotides in a circular RNA vector can be replaced with modified uridine nucleotides. For example, in some embodiments, about 0% to about 100% of the uridine nucleotides in a circular RNA vector (e.g., about 5% to about 95%, about 10% to about 90%, about 15% to about 85%, about 20% to about 80%, about 25% to about 75%, about 30% to about 70%, about 35% to about 65%, about 40% to about 60%, about 45% to about 55%, about 0% to about 50%, about 5% to about 45%, about 10% to about 40%, about 15% to about 35%, about 20% to about 30%, about 50% to about 100%, about 55% to about 95%, about 60% to about 90%, about 65% to about 85%, about 70% to about 80%) can be replaced with modified uridine nucleotides.

[0037] In yet another embodiment, a DNA vector is provided comprising a substitution group 1 intron / exon comprising a 5' exon, a 3' exon, and an intron, wherein the intron comprises a substitution group 1 intron / exon comprising a 5' intron end and a 3' intron end, wherein the 3' exon is upstream of the 5' exon, a portion of the intron including the 3' intron end is upstream of the 3' exon, and a portion of the intron including the 5' intron end is downstream of the 5' exon. In some embodiments, the DNA vector may further comprise multiple cloning sites. Additionally or alternatively, in other embodiments, the DNA vector may further comprise a nucleic acid sequence encoding a target protein. Additionally or alternatively, in yet another embodiment, the DNA vector may further comprise an internal ribosome entry site (IRES).

[0038] In yet another embodiment, an RNA vector is provided comprising a substitution group 1 intron / exon including a 5' exon, a 3' exon, and an intron, wherein the intron comprises a substitution group 1 intron / exon including a 5' intron end and a 3' intron end, and a multiple cloning site, wherein the 3' exon is upstream of the 5' exon, a portion of the intron including the 3' intron end is upstream of the 3' exon, a portion of the intron including the 5' intron end is downstream of the 5' exon, and the substitution group 1 intron / exon is active in the presence of modified nucleotides. In some embodiments, the multiple cloning site may be between the 3' exon and the 5' exon.

[0039] In yet another embodiment, an RNA vector is provided comprising a substitution group 1 intron / exon including a 5' exon, a 3' exon, and an intron, wherein the intron comprises a substitution group 1 intron / exon including a 5' intron end and a 3' intron end, and a nucleic acid sequence encoding a target protein, wherein the 3' exon is upstream of the 5' exon, a portion of the intron including the 3' intron end is upstream of the 3' exon, a portion of the intron including the 5' intron end is downstream of the 5' exon, and the substitution group 1 intron / exon is active in the presence of modified nucleotides. In some embodiments, the nucleic acid sequence encoding the target protein may be between the 3' and 5' exons. In some embodiments, the DNA vector may further include an internal ribosome entry site (IRES).

[0040] In some embodiments, the substituted group 1 intron / exon may be an Azoarcus group I intron / exon. In some embodiments, the substituted group 1 intron / exon may further include at least one mutation to a wild-type group 1 intron / exon. In some embodiments, the wild-type group 1 intron / exon may be an Azoarcus group 1 intron / exon and may include SEQ ID NO: 1. In some embodiments, the mutation may improve the transcription of the vector. In some embodiments, the mutation may include the addition and / or removal of nucleotides to / from a wild-type group 1 intron / exon.

[0041] In some embodiments, the substitution group 1 intron / exon may have a similarity of 80% or more to SEQ ID NO: 1 (e.g., 81% or more similarity, 82% or more similarity, 83% or more similarity, 84% or more similarity, 85% or more similarity, 86% or more similarity, 87% or more similarity, 88% or more similarity, 89% or more similarity, 90% or more similarity, 91% or more similarity, 92% or more similarity, 93% or more similarity, 94% or more similarity, 95% or more similarity, 96% or more similarity, 97% or more similarity, 98% or more similarity, 99% or more similarity). In some embodiments, the substitution group 1 intron / exon may have a similarity of 80% or more to SEQ ID NO: 1.

[0042] In some embodiments, a portion of an intron including its 3' intron terminus may have a similarity of 80% or more to SEQ ID NO: 2 or SEQ ID NO: 3 (e.g., 81% or more similarity, 82% or more similarity, 83% or more similarity, 84% or more similarity, 85% or more similarity, 86% or more similarity, 87% or more similarity, 88% or more similarity, 89% or more similarity, 90% or more similarity, 91% or more similarity, 92% or more similarity, 93% or more similarity, 94% or more similarity, 95% or more similarity, 96% or more similarity, 97% or more similarity, 98% or more similarity, 99% or more similarity). In some embodiments, a portion of an intron including its 3' intron terminus may have a similarity of 80% or more to SEQ ID NO: 2 or SEQ ID NO: 3.

[0043] In some embodiments, a portion of an intron including its 5' intron end may have a similarity of 80% or more to SEQ ID NO: 4 or SEQ ID NO: 5 (e.g., 81% or more similarity, 82% or more similarity, 83% or more similarity, 84% or more similarity, 85% or more similarity, 86% or more similarity, 87% or more similarity, 88% or more similarity, 89% or more similarity, 90% or more similarity, 91% or more similarity, 92% or more similarity, 93% or more similarity, 94% or more similarity, 95% or more similarity, 96% or more similarity, 97% or more similarity, 98% or more similarity, 99% or more similarity). In some embodiments, a portion of an intron including its 5' intron end may have a similarity of 80% or more to SEQ ID NO: 4 or SEQ ID NO: 5.

[0044] In some embodiments, the 5' exon may contain 80% or more similarity to sequence number 6 (e.g., 81% or more similarity, 82% or more similarity, 83% or more similarity, 84% or more similarity, 85% or more similarity, 86% or more similarity, 87% or more similarity, 88% or more similarity, 89% or more similarity, 90% or more similarity, 91% or more similarity, 92% or more similarity, 93% or more similarity, 94% or more similarity, 95% or more similarity, 96% or more similarity, 97% or more similarity, 98% or more similarity, 99% or more similarity). In some embodiments, the 5' exon may contain sequence number 6.

[0045] In some embodiments, the 3' exon may contain 80% or more similarity to sequence number 7 (e.g., 81% or more similarity, 82% or more similarity, 83% or more similarity, 84% or more similarity, 85% or more similarity, 86% or more similarity, 87% or more similarity, 88% or more similarity, 89% or more similarity, 90% or more similarity, 91% or more similarity, 92% or more similarity, 93% or more similarity, 94% or more similarity, 95% or more similarity, 96% or more similarity, 97% or more similarity, 98% or more similarity, 99% or more similarity). In some embodiments, the 3' exon may contain sequence number 7.

[0046] In some embodiments, the multiple cloning site may have a similarity of 80% or more to SEQ ID NO: 8 or SEQ ID NO: 9 (e.g., 81% or more similarity, 82% or more similarity, 83% or more similarity, 84% or more similarity, 85% or more similarity, 86% or more similarity, 87% or more similarity, 88% or more similarity, 89% or more similarity, 90% or more similarity, 91% or more similarity, 92% or more similarity, 93% or more similarity, 94% or more similarity, 95% or more similarity, 96% or more similarity, 97% or more similarity, 98% or more similarity, 99% or more similarity). In some embodiments, the multiple cloning site may have a similarity of 8 or SEQ ID NO: 9.

[0047] In some embodiments, the target protein can be any protein of interest. For example, in some embodiments, the target protein may be an antigen (e.g., COVID spike protein), a hormone (e.g., insulin, erythropoietin, human growth hormone), a cytokine (e.g., interferon), or a coagulation factor (e.g., factor IX). Additionally or alternatively, in other embodiments, the target protein may include a fluorescent protein. In some such embodiments, the target protein may include eGFP, mCherry, Firefly luciferase, or NanoLuc luciferase.

[0048] In some embodiments, the DNA vector may further include at least one spacer. In some embodiments, the spacer may be selected from sequences having 80% or more similarity to SEQ ID NO: 10 or SEQ ID NO: 11 at each occurrence (e.g., 81% or more similarity, 82% or more similarity, 83% or more similarity, 84% or more similarity, 85% or more similarity, 86% or more similarity, 87% or more similarity, 88% or more similarity, 89% or more similarity, 90% or more similarity, 91% or more similarity, 92% or more similarity, 93% or more similarity, 94% or more similarity, 95% or more similarity, 96% or more similarity, 97% or more similarity, 98% or more similarity, 99% or more similarity). In some embodiments, the spacer may be selected from SEQ ID NO: 10 or SEQ ID NO: 11 at each occurrence.

[0049] In some embodiments, the DNA vector may be more than approximately 1000 nucleotides in length (e.g., more than approximately 1100 nucleotides, more than approximately 1200 nucleotides, more than approximately 1300 nucleotides, more than approximately 1400 nucleotides, more than approximately 1500 nucleotides, more than approximately 1600 nucleotides, more than approximately 1700 nucleotides, more than approximately 1800 nucleotides, more than approximately 2000 nucleotides, more than approximately 2200 nucleotides, more than approximately 2400 nucleotides, more than approximately 2600 nucleotides, more than approximately 2800 nucleotides, more than approximately 3000 nucleotides, more than approximately 3200 nucleotides, more than approximately 3400 nucleotides, more than approximately 3600 nucleotides, more than approximately 3800 nucleotides, more than approximately 4000 nucleotides, more than approximately 4200 nucleotides, more than approximately 4400 nucleotides, more than approximately 4600 nucleotides, more than approximately 4800 nucleotides, more than approximately 5000 nucleotides).

[0050] In some embodiments, DNA vectors can be cyclized.

[0051] In yet another embodiment, a method for preparing a circular RNA vector is provided, comprising a) transcribing one of the disclosed DNA vectors into an RNA vector, and b) cyclizing the RNA vector. In some embodiments, the method may further comprise c) modifying at least one nucleotide in the circular RNA vector. In some embodiments, the DNA vector may be transcribed in vitro, in vivo, or ex vivo. In some embodiments, the RNA vector may be one of the disclosed RNA vectors.

[0052] In some embodiments, the 5' intron end can hybridize with the 3' intron end, at least partially, to form a circular RNA vector. In some embodiments, the method may further include splicing the intron.

[0053] In some embodiments, the RNA vector can be cyclized by in vitro transcription (IVT). In some embodiments, IVT can be carried out at a temperature of at least about 30°C (e.g., at least about 32°C, at least about 34°C, at least about 36°C, at least about 38°C, at least about 40°C, at least about 42°C, at least about 44°C, at least about 46°C, at least about 48°C, at least about 50°C, at least about 52°C, at least about 54°C, at least about 56°C, at least about 58°C, at least about 60°C, at least about 62°C, at least about 64°C, at least about 66°C, at least about 68°C, at least about 70°C). In some embodiments, IVT can be performed at temperatures up to approximately 70°C (for example, up to approximately 68°C, up to approximately 66°C, up to approximately 64°C, up to approximately 62°C, up to approximately 60°C, up to approximately 58°C, up to approximately 56°C, up to approximately 54°C, up to approximately 52°C, up to approximately 50°C, up to approximately 48°C, up to approximately 46°C, up to approximately 44°C, up to approximately 42°C, up to approximately 40°C, up to approximately 38°C, up to approximately 36°C, up to approximately 34°C, up to approximately 32°C, up to approximately 32°C, up to approximately 30°C).

[0054] It is considered that IVT can be performed at temperatures ranging from any of the minimum values ​​to any of the maximum values ​​listed above. For example, in some embodiments, IVT can be performed at temperatures of about 30°C to about 70°C (e.g., about 32°C to about 68°C, about 34°C to about 66°C, about 36°C to about 64°C, about 38°C to about 62°C, about 40°C to about 60°C, about 42°C to about 58°C, about 44°C to about 56°C, about 46°C to about 54°C, about 48°C to about 52°C, about 30°C to about 50°C, about 32°C to about 48°C, about 34°C to about 46°C, about 36°C to about 44°C, about 38°C to about 42°C, about 50°C to about 70°C, about 52°C to about 68°C, about 54°C to about 66°C, about 56°C to about 64°C, about 58°C to about 62°C).

[0055] In yet another embodiment, a circular RNA vector is provided which is formed from any of the disclosed DNA vectors and contains at least one modified nucleotide. In some embodiments, the modified nucleotide may be a modified uridine nucleotide, e.g., pseudouridine, N1-methylpseudridine, 5-methyluridine, 5-methoxyuridine, 5-methylcytidine, 1-ethylpseudridine, 2-thiouridine, 4-thiouridine, 2-thio-1-methylpseudridine, 2-thio-5-aza-uridine, 4-thio-1-methylpseudridine, 5-thiopseudridine, 5-aza-uridine, or any combination thereof. In some such embodiments, some or all of the uridine nucleotides in the circular RNA vector may be replaced with modified uridine nucleotides. For example, in some embodiments, more than 0% of the uridine nucleotides in the nucleic acid sequence encoding the target protein (e.g., more than 5%, more than 10%, more than 15%, more than 20%, more than 25%, more than 30%, more than 35%, more than 40%, more than 45%, more than 50%, more than 55%, more than 60%, more than 65%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, more than 95%, more than 100%) can be replaced with modified uridine nucleotides. In some embodiments, up to approximately 100% (e.g., up to approximately 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, and 5%) of the uridine nucleotides in a circular RNA vector can be replaced with modified uridine nucleotides.

[0056] Any percentage of uridine nucleotides in a circular RNA vector can be replaced with modified uridine nucleotides. For example, in some embodiments, about 0% to about 100% of the uridine nucleotides in a circular RNA vector (e.g., about 5% to about 95%, about 10% to about 90%, about 15% to about 85%, about 20% to about 80%, about 25% to about 75%, about 30% to about 70%, about 35% to about 65%, about 40% to about 60%, about 45% to about 55%, about 0% to about 50%, about 5% to about 45%, about 10% to about 40%, about 15% to about 35%, about 20% to about 30%, about 50% to about 100%, about 55% to about 95%, about 60% to about 90%, about 65% to about 85%, about 70% to about 80%) can be replaced with modified uridine nucleotides.

[0057] Some sequences disclosed herein are DNA sequences, but the corresponding RNA sequences are also disclosed herein (i.e., thymine is replaced by uracil).

[0058] In yet another embodiment, a method is provided for expressing a target protein from a circular RNA vector, comprising providing one of the disclosed circular RNA vectors and translating the target protein. [Examples]

[0059] Example 1: 1-Methylpseudridine inhibits group 1 intron-promoting cyclization of synthetic mRNA. The efficacy of mRNA-based therapeutics can be significantly improved by combining RNA modification and RNA cyclization, further increasing the performance of synthetic mRNA and leading to more effective therapeutics. Compared to linear mRNA, they are more durable because they are resistant to exonuclease degradation. However, the most effective mRNA cyclization strategy, based on substitution group I introns, is currently 1-methylpseudridine (m1Ψ). 1This is incompatible with widely used modified nucleotides, such as those mentioned above. This hinders the development of fully modified circular mRNA as a novel mRNA therapeutic platform. Since these modified nucleotides are important in reducing immunostimulatory effects and the reactogenicity of mRNA therapeutics (PMID: 16111635), a fully modified circular mRNA platform is expected to significantly extend the duration of mRNA therapeutics while having a reactogenicity profile similar to currently FDA-approved linearly modified mRNA.

[0060] We conducted experiments to investigate how m1Ψ modifications prevent substitutional group 1 intron cyclization of synthetic mRNA, and how directed evolution could potentially overcome this challenge.

[0061] RNA can be cyclized without protein as shown in Figures 1A and 1B, which illustrate group 1 introns (Figure 1A) and substitutional intron-exon reactions (Figure 1B). For PIE constructs, the group 1 intron sequence is split in half and rearranged so that the intron halves surround their exons.

[0062] The method used in this experiment is shown in Figure 2. In vitro transcription (IVT) templates were prepared by PCR amplification from plasmids containing the target sequence. IVT was performed at 37°C for 2 hours, with UTP being replaced with uridine analogs as needed. For time-course experiments, gel purification of IVT RNA was performed so that only precursor RNA was present at t=0. Agarose gel was used for RNA < 500 nts. Polyacrylamide gel was used for RNA < 500 nts.

[0063] Figures 3, 4A–4C, and 5A–5D show the results of this experiment. The upper portion of Figure 3 shows the different uridine analogs used to generate fully uridine-modified mRNA. mRNA containing EMCV IRES and eGFP was prepared via IVT using different uridine analogs. The mRNA was cleaned up by precipitation, followed by cyclization. 500 ng of RNA was denatured by treatment with glyoxal and visualized by agarose electrophoresis. Figures 4A–4C demonstrate that both linear Azoarcus (Figure 4A) and PIE Azoarcus (Figure 4B) constructs were prepared by IVT using different U to m1Ψ ratios. The resulting RNA was cleaned up using a spin column. The RNA was spliced / cyclized at 40°C for 10 minutes. The RNA was visualized using PAGE. Figure 4C shows the quantification of the amount of residual precursor for both Figures 4A and 4B.

[0064] Figure 5A shows a diagram of the directed evolution of complete uridine substitution group 1 introns. A library of mutant group 1 intron variants is prepared via error-prone PCR. This is followed by IVT, splicing, and PAGE-based selection based on the size of the spliced ​​introns. Finally, the spliced ​​introns are recovered via gel extraction and converted into templates for IVT via RT and PCR. Finally, the restored templates are used for selection in the next round. Figure 5B shows the number of mutations per molecule from the prepared library. Figure 5C shows the mutant types present in the mutant library. Figure 5D shows the activity of the mutant library compared to the wild-type sequence.

[0065] This study determined that Azoarcus group 1 introns could be used to generate circular RNA using the PIE method. The linear morphology of Azoarcus group 1 introns exhibits a similar pattern of inhibition by m1Ψ as the PIE construct and can be used to test the inactivating effect of uridine analogs. The intron variant library contains mutations that deplete uridine residues. In future studies, chemical probing can be used to determine secondary structural changes resulting from uridine modifications. Directed evolution can also be used to find group 1 intron variants that are active when modified.

[0066] Example 2: Exogenous circRNA sensing by TLR7 / 8 activates innate immune responses in human cells. Circular RNA (circRNA) is a ubiquitous expression class of RNA that forms a unique covalent closed-loop structure. Due to its circular topology, circRNA is more stable and resistant to exonuclease degradation than its linear counterpart. Therefore, circRNA may be a promising platform for RNA-based therapeutics. However, in the context of innate immunity, it remains unclear whether exogenous circRNA can evade immune surveillance. To explore this, we conducted experiments in which circRNA was synthesized via a substitutional intron-exon (PIE) system with group I introns and transfected into immune cell models to determine their immunogenicity and the innate immune sensors involved in their recognition. Figure 6 shows the mechanism of group I intron-PIE splicing. Free guanosine attacks the substitutional linear template, resulting in spontaneous cyclization of the exon sequence.

[0067] The central focus of this study is RNA sensing in innate immunity. Figure 7 illustrates how self-versus-non-self recognition protects the host from invading pathogens. Detection of structures associated with foreign RNA by intracellular sensors triggers a signaling cascade, ultimately inducing an innate immune response through transcriptional upregulation of type I interferons (IFNs) and pro-inflammatory cytokines.

[0068] Figure 8 shows a schematic diagram of the experimental workflow used in this study. After differentiating BLaER1 cells from immunosensitive pre-B cells to highly responsive monocytes / macrophages, they were transfected with circRNA complexed with either poly-L-arginine (pLa) or TransIT-mRNA. pLa and TransIT-mRNA deliver RNA to the endolysosome or cytoplasmic compartment, respectively. The study measured cytokine secretion via ELISA as an immunogenicity readout. In addition, the study also determined transcriptional induction of certain immunogenes via RT-qPCR.

[0069] Figures 9A–9C show the circRNA preparation. The circRNA was completely purified of any intermediate contaminants from the splicing reaction. Figure 9A shows that the precursor IVT-mRNA and purified circRNA were analyzed by glyoxal gel. Figure 9B shows the FPLC chromatogram of the purified circRNA. Figure 9C shows that 200 ng of RNA from the crude reaction and purified fractions were blotted and analyzed with J2 dsRNA-specific mAbs, along with sequentially diluted positive controls and blanks.

[0070] Figures 10A-10B show circRNA immunogenicity. Purified circRNA is nonimmunogenic in non-immune cells but immunogenic in primary immune cells. After transfection with crude or purified circRNA fractions, relative mRNA levels of RIG-I and IFNβ were determined in A549 cells (Figure 10A), and cytokine release was profiled in PBMCs (Figure 10B).

[0071] Figures 11A-11C show the validation of CRISPR knockout of target genes in transdifferentiated BLaER1 cells. The expression of TLR7 (Figure 11A), TLR8 (Figure 11B), or MAVS (Figure 11C) of the indicated genotypes is shown.

[0072] Figures 12A-12B demonstrate that circRNA sensing is TLR7 / 8 mediated. The mode of circRNA delivery influences the subsequent cytokine / IFN response in BLaER1 monocytes. Figure 12A shows that when circRNA is introduced into the cytoplasm, a MAVS-dependent type I IFN response is induced. Figure 12B shows that endosomal-delivered circRNA is sensed by TLR7 / 8 and activates the inflammatory program.

[0073] This study determined that purified circRNA did not activate non-immune cells (A549 cells) but was immunogenic in primary immune cells (PBMCs). Cytoplasmic detection of circRNA induced a strong MAVS-dependent type I IFN response, while endosomal delivery via pLa induced a potent TLR7 / 8-mediated pro-inflammatory response. However, pLa did not induce detectable IFN signaling, and TransIT resulted in marginal inflammation. Future studies could further investigate how circRNA activates cytoplasmic sensors by testing their immunogenicity in RIG-I- / - and MDA5- / -BLaER1 cell lines to precisely determine which of the two sensors is responsible. Future studies could also assess whether immunogenicity persists across various delivery methods (LNP, DOTAP, etc.) and which innate immune response: pro-inflammatory or antiviral. Similar to how nucleoside modifications of linear mRNA enable immune evasion, such studies can also determine whether the same effect can be observed with circRNAs. In addition to the PIE method, circRNAs can be synthesized via sprint ligation so that the constructs are "scarless," and their immunogenicity can be tested in immune cell models.

[0074] Example 3: ψ / m1ψ modification reduces the activity of group I introns. RNA self-splicing group I introns are a remarkable model system for testing RNA catalysis and structure-function relationships. Their catalytic core employs complex folding and is further stabilized by contact in the peripheral region via GAAA tetraloop-tetraloop receptor (TR) interactions (Figure 13A). Group I introns are also an important tool for circRNA therapeutics, as the substituted Anabaena group I intron can cyclize RNA up to 5,000 nucleotides with an impressive 80% cyclization efficiency (in contrast, conventional enzymatic ligation methods yield only <5% yield for such long RNAs). However, this Anabaena group I intron cannot cyclize nucleoside-modified RNA because its activity is completely abolished by m1ψ modification. Therefore, manipulating group I introns compatible with modified nucleosides remains a crucial step in developing nucleoside-modified circRNAs.

[0075] Figures 13A–13E illustrate how ψ / m1ψ modification reduces group I intron activity by weakening the interaction between the GAAA tetraloop and its receptor. Figure 13A shows the crystal structure of the Azoarcus group I intron, as well as the structure of the tetraloop receptor and a schematic diagram of its interaction with the GAAA tetraloop. Figure 13B shows the splicing rate of unmodified or ψ / m1ψ-modified Azoarcus group I introns. Figure 13C shows the efficient cyclization of 151nt ψ-modified RNA. Figure 13D shows DMS chemical probing of unmodified or ψ / m1ψ-modified Azoarcus group I introns. The absence and presence of DMS modification at major residues are highlighted by open and closed rings, respectively. Figure 13E shows that the C7.34 tetraloop-tetraloop receptor pair discovered by in vitro selection does not contain a U nucleotide.

[0076] More compact group I introns exhibited approximately 100-fold reduction in splicing rate when modified, and were recently identified from the thermophilic bacterium Azoarcus that tolerates ψ / m1ψ modification (Figure 13B). Using Azoarcus group I introns, 151nt ψ-modified RNA was cyclized with >90% efficiency (Figure 13C). This result established the validity of preparing nucleoside-modified circRNAs using a substitution group I intron strategy. A deeper understanding of how ψ / m1ψ reduces Azoarcus group I intron activity would enable further improvements in splicing rate and high efficiency of cyclization of long nucleoside-modified RNAs.

[0077] As a first step toward this goal, DMS chemical probing was used to investigate the secondary structure of ψ / m1ψ-modified group I introns. These modified group I introns retained the same overall secondary structure as the unmodified ones, but significant changes were observed in the tetraloop and its receptor. In unmodified Azoarcus group I introns, strong DMS protection was observed in the first and second adenosines in the GAAA tetraloop, as well as in A8 in the TR, consistent with stable tetraloop-TR interactions. However, ψ / m1ψ modification made these adenosines as reactive to DMS as unfolded RNA (Figure 13D). Since the GAAA tetraloop does not contain any uridine, it is hypothesized that ψ / m1ψ alters the structure of the tetraloop receptor and significantly weakens its interaction with the GAAA tetraloop. Furthermore, the ψ / m1ψ modification sensitized nucleotide A171, which is deeply embedded in the catalytic core, to the DMS modification (Figure 13A), indicating that the weakened tetraloop-tetraloop acceptor interaction altered the structure of the catalytic core. Collectively, these results provide a clear model of the mechanism by which the ψ / m1ψ modification reduces the activity of the Azoarcus group I intron.

[0078] To further confirm that the TR structure is altered by these modified nucleotides, CMCT chemical probing can be performed to directly measure the U / ψ / m1ψ base pairings, particularly those in the TR. U3, which base pairs with A8, is expected to be reactive to CMCT in the modified group I intron. In addition, since the 2'-OH group is heavily involved in the tertiary interactions of the group I intron (particularly in the active site and tetraloop-TR interactions), SHAPE experiments can also be performed as an orthogonal approach to test how these modified nucleotides alter the structure of the tetraloop and its receptor and affect the folding of the active site.

[0079] Based on this insight into the mechanism, mutations can be introduced to restore the GAAA tetraloop-TR interaction. Previous in vitro selection studies have identified several sequences that form a strong tetraloop-TR interaction and can fully support the splicing activity of group I introns. Fortunately, some of these sequences do not contain uridine (Figure 13E), making them ideal candidates for this purpose. Introducing these novel tetraloop / TR sequences is expected to restore the activity of ψ / m1ψ-modified Azoarcus group I introns. If further optimization is required, well-established in vitro selection strategies can be used to find the optimal sequence for cyclizing ψ / m1ψ-modified RNA. These experiments may allow for the manipulation of group I introns to cyclize long nucleoside-modified RNAs.

[0080] Example 4: Prepare modified circular RNA using Azoarcus introns. Generally, RNA substitution intron-exon (PIE) cyclization is inhibited by modified nucleotides such as N1-methylpseudridine. Anabaena introns / exons are commonly used for PIE cyclization. Figure 14 shows the effects of pseudouridine and N1-methylpseudridine on the splicing efficiency of Anabaena PIEs, where modified uridine nucleotides are observed to significantly reduce splicing efficiency and RNA cyclization. Figures 15A-15B show the effects of pseudouridine and N1-methylpseudridine on the splicing efficiency of Anabaena PIEs and the precursors remaining over time. A summary of splicing rates is given in Table 1. [Table 1]

[0081] Surprisingly, Azoarcus introns / exons can effectively cyclize RNA even in the presence of modified uridine nucleotides. Figure 16 shows the effects of pseudouridine and N1-methylpseudridine on the splicing efficiency of Azoarcus PIEs, and it is observed that Azoarcus PIEs remain active even in the presence of modified uridine nucleotides. Figures 17A-17B show the effects of pseudouridine and N1-methylpseudridine on the splicing efficiency of Azoarcus PIEs and the precursors remaining over time. A summary of the splicing rates is given in Table 2. [Table 2]

[0082] Figures 18A-18B show that Azoarcus PIE P6 is efficiently cyclized, and modified circular mRNA can be successfully produced. Figure 18C shows that circular mRNA does not accumulate. Figure 19 shows the cyclization efficiency of Azoarcus PIE P8.

[0083] Example 5: To develop nucleoside-modified circular mRNA. Figure 20 shows the results of a 6% denatured PAGE, SYBR gold staining assay, which demonstrates cyclization of Ψ-modified RNA (SEQ ID NO: 25) with an efficiency of over 90%. Figure 21 shows that the improved Azoarcus PIE generates accurate exon-exon junctions. Figure 22 is a schematic diagram of the substitutional intron-exon (PIE) strategy for cyclization. Figures 23A-23B show a 15% cyclization efficiency for 1.5kb pseudouridine-modified mRNA (SEQ ID NO: 26).

[0084] definition In this specification and the following claims, many terms are referenced and defined as follows:

[0085] As used herein, “comprising” should be interpreted as identifying the presence of a referenced feature, element, step, or component, but not as excluding the presence or addition of one or more features, elements, steps, or components, or groups thereof. Furthermore, each of the terms “by,” “comprising,” “comprised of,” “including,” “included,” “involving,” “involves,” “involved,” and “such as” is used in an open, non-restrictive sense and may be used interchangeably. In addition, the term “comprising” is intended to include examples and aspects that are encompassed by “consisting essentially of” and “consisting of.” Similarly, the term “consisting essentially of” is intended to include examples that are encompassed by the term “consisting of.”

[0086] As used herein and in the appended claims, the singular forms "a," "an," and "the" refer to multiple subjects unless the context clearly indicates otherwise. For example, "compound," "composition," or "cancer" could refer to two or more such compounds, compositions, or cancers, but is not limited to these.

[0087] It should be noted that ratios, concentrations, quantities, and other numerical data may be expressed in range form as used herein. It may be further understood that it is important that each endpoint of a range is both related to and independent of the other endpoint. There may be several values ​​disclosed herein, and each value may be disclosed herein not only as the value itself, but also as an approximation of that particular value. For example, if the value "10" is disclosed, then "about 10" is also disclosed. In this specification, ranges may be expressed as "about" from a particular value and / or "about" to another particular value. Similarly, when a value is expressed as an approximation, it may be understood that the particular value forms a further aspect by using the antecedent "about". For example, if the value "about 10" is disclosed, then "10" is also disclosed.

[0088] Where a range is expressed, further embodiments include a range from one specific value to and / or the other specific value. For example, if an expressed range includes one or both limits, a range excluding one or both of such included limits is also included in this disclosure, for example, the phrase "x to y" includes the range "x" to "y," as well as the ranges greater than "x" and less than "y." A range can also be expressed as an upper limit, for example, "about x, y, z or less" should be interpreted as including the specific ranges "about x," "about y," and "about z," as well as the ranges "less than x," "less than y," and "less than z." Similarly, the phrase "about x, y, z or greater" should be interpreted as including the specific ranges "about x," "about y," and "about z," as well as the ranges "greater than x," "greater than y," and "greater than z." In addition, where "x" and "y" are numerical values, the phrase "about "x" to "y"" includes "about "x" to about "y."

[0089] Such range formats are used for convenience and brevity, and should therefore be interpreted flexibly to include not only the numerical limits explicitly stated as range limits, but also all individual numerical values ​​or subranges contained within that range, as if each numerical value and subrange were explicitly stated. For illustrative purposes, the numerical range "approximately 0.1% to 5%" should be interpreted to include not only the explicitly stated values ​​of approximately 0.1% to approximately 5%, but also the individual values ​​within the indicated range (e.g., approximately 1%, approximately 2%, approximately 3%, and approximately 4%) and subranges (e.g., approximately 0.5% to approximately 1.1%, approximately 5% to approximately 2.4%, approximately 0.5% to approximately 3.2%, and approximately 0.5% to approximately 4.4%, as well as other possible subranges).

[0090] Where used herein, the terms “about,” “approximately,” “at or about,” and “substantially” mean that the quantity or value in question may be an exact value or a value that provides equivalent results or effects to those described in the claims or taught herein. That is, quantities, sizes, formulations, parameters, and other quantities and characteristics are not, and do not need to be, exact, but may be approximate, and / or greater or less, as desired, to obtain equivalent results and effects, and are understood to reflect tolerances, conversion factors, rounding, measurement errors, etc., and other factors known to those skilled in the art. In some situations, a value that provides equivalent results or effects cannot be reasonably determined. In such cases, where used herein, “about” and “at or about” are generally understood to mean nominal values ​​with a variation of ±10%, unless otherwise indicated or inferred. In general, quantities, sizes, formulations, parameters, or other quantities or characteristics are “about,” “approximately,” or “at or about,” whether expressly indicated so. When "about," "approximately," or "by or about" is used before a quantitative value, it is understood that the parameter includes the specific quantitative value itself, unless otherwise specifically indicated.

[0091] As used herein, the term “effective amount” refers to an amount sufficient to achieve a desired modification of the physical properties of a composition or material. For example, the “effective amount” of a monomer refers to an amount sufficient to achieve a desired improvement in properties regulated by the compound, such as a desired antioxidant release rate or viscoelasticity. The specific level required as the effective amount in the composition in terms of wt% will depend on a variety of factors, including the amount and type of monomer, the amount and type of polymer, such as acrylamide, the amount of antioxidant, and the desired release kinetics.

[0092] As used herein, the terms “optional” or “optional” mean that the events or circumstances described thereafter may or may not occur, and this description includes both instances in which such events or circumstances occur and instances in which they do not occur.

[0093] In this specification, nucleic acids and nucleic acid sequences are used interchangeably. The terms “nucleic acid” and “nucleic acid sequence” refer to nucleotides, oligonucleotides, polynucleotides (these terms may be used interchangeably), or any fragment thereof. These terms also refer to DNA or RNA of genomic or synthetic origin (which may be single-stranded or double-stranded and may represent sense or antisense strands).

[0094] Variants comprising deletions to a reference amino acid sequence or nucleotide sequence are contemplated herein. A “deletion” means a change in an amino acid or nucleotide sequence that results in the absence of one or more amino acid residues or nucleotides compared to the reference sequence. A deletion removes at least 1, 2, 3, 4, 5, 10, 20, 50, 100, or 200 amino acid residues or nucleotides. A deletion may include an internal deletion or a terminal deletion (e.g., an N-terminal or C-terminal cleavage of a reference polypeptide, or both, or a 5'-terminal or 3'-terminal cleavage of a reference polynucleotide, or both).

[0095] Variants comprising fragments of a reference amino acid sequence or nucleotide sequence are contemplated herein. A “fragment” is a portion of an amino acid sequence or nucleotide sequence that is identical in sequence to the reference sequence but shorter in length. A fragment may comprise the reference sequence minus at least one nucleotide / amino acid residue. For example, each fragment may comprise 5 to 1000 consecutive nucleotides or consecutive amino acid residues of the reference polynucleotide or reference polypeptide. In some embodiments, each fragment may comprise at least 5, 10, 15, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, 100, 150, 250, or 500 consecutive nucleotides or consecutive amino acid residues of the reference polynucleotide or reference polypeptide. Fragments may be preferentially selected from a particular region of a molecule, e.g., the N-terminal and / or C-terminal region of a polypeptide, or the 5'-terminal and / or 3'-terminal region of a polynucleotide. The term "at least one fragment" includes full-length polynucleotides or full-length polypeptides.

[0096] Variants involving insertions or additions to a reference sequence are contemplated herein. The terms “insertion” and “addition” refer to changes in an amino acid or nucleotide sequence that result in the addition of one or more amino acid residues or nucleotides. An insertion or addition may refer to 1, 2, 3, 4, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, or 200 amino acid residues or nucleotides.

[0097] Fusion polynucleotides are also contemplated herein. “Fusion polynucleotide” refers to the fusion of the nucleotide sequence of a first polynucleotide with the nucleotide sequence of a second heterogeneous polynucleotide (e.g., the 3' end of the first polynucleotide and the 5' end of the second polynucleotide). If the first and second polynucleotides encode a protein, the fusion may be such that the encoded protein is in-frame, resulting in a fusion protein. The first and second polynucleotides may be fused in such a way that they are operably bound together (e.g., as a promoter and a gene expressed by the promoter, as discussed below).

[0098] "Homologousity" refers to sequence similarity or, interchangeably, sequence identity between two or more polypeptide sequences or polynucleotide sequences. Homologousity, sequence similarity, and sequence identity percentages may be determined using methods described in the art and herein.

[0099] The terms “identity percentage” and “identity %” applied to polynucleotide sequences refer to the percentage of residue matches between at least two polynucleotide sequences aligned using a standardized algorithm. Such algorithms can insert gaps into the sequences being compared in a standardized and reproducible manner to optimize the alignment between the two sequences, and thus achieve a more meaningful comparison of the two sequences. The identity percentage of nucleic acid sequences can be determined as understood in the art. (See, for example, U.S. Patent No. 7,396,664, which is incorporated herein by reference in its entirety.) A commonly used and freely available suite of sequence comparison algorithms is provided by the National Center for Biotechnology Information (NCBI) Basic Local Alignment Search Tool (BLAST) (Altschul, SF et al. (1990) J.Mol. Biol. 215:403 410), which is available on its website from several sources, including NCBI, Bethesda, Md. The BLAST software suite includes various sequence analysis programs, including "blastn," which is used to align known polynucleotide sequences with other polynucleotide sequences from various databases. A tool called "BLAST2 Sequences" is also available for direct pairwise comparison of two nucleotide sequences. "BLAST2 Sequences" can be interactively accessed and used on the NCBI website. The "BLAST2 Sequences" tool can be used with both blastn and blastp (discussed above).

[0100] The identity percentage may be measured over the length of the entire defined polynucleotide sequence, or over a shorter length, for example, over the length of a fragment taken from a larger, defined sequence, e.g., a fragment of at least 20, at least 30, at least 40, at least 50, at least 70, at least 100, or at least 200 consecutive nucleotides. Such lengths are illustrative only, and it should be understood that any fragment length may be used to describe the length over which the identity percentage can be measured.

[0101] A "full-length" polynucleotide sequence contains at least a translation start codon (e.g., methionine), followed by an open reading frame and a translation end codon. A "full-length" polynucleotide sequence encodes a "full-length" polypeptide sequence.

[0102] A “variant,” “mutant,” or “derivative” of a particular nucleic acid sequence can be defined using blastn with the “BLAST2 sequences” tool available on the National Center for Biotechnology Informations website as a nucleic acid sequence that has at least 50% sequence identity to a particular nucleic acid sequence over a certain length of one of the nucleic acid sequences. (See Tatiana A. Tatusova, Thomas L. Madden (1999), “Blast 2 sequences—a new tool for comparing protein and nucleotide sequences”, FEMS Microbiol Lett. 174:247-250). In some embodiments, a variant polynucleotide may exhibit at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or more sequence identity over a certain defined length with respect to a reference polynucleotide. Variant polynucleotides may have substantially the same functional activity as the reference polynucleotide.

[0103] Nucleic acid sequences that do not exhibit a high degree of identity may nevertheless encode similar amino acid sequences through genetic code degeneracy. It is understood that nucleic acid sequences can be altered using this degeneracy to generate multiple nucleic acid sequences that all encode substantially the same protein.

[0104] "Operatively bound" refers to a situation where a first nucleic acid sequence is positioned in a functional relationship with a second nucleic acid sequence. For example, if a promoter influences the transcription or expression of a coding sequence, the promoter is operationally bound to the coding sequence. Operationally bound DNA sequences may be adjacent or contiguous and in the same reading frame if necessary to join two protein-coding regions.

[0105] "Recombinant nucleic acids" are sequences that do not exist naturally or that have sequences created by the artificial combination of two or more otherwise separated segments of a sequence. This artificial combination is often achieved by chemical synthesis, or more generally by the artificial manipulation of isolated segments of nucleic acids, such as by genetic engineering techniques, as described in Sambrook, J. et al. (1989) Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 13, Cold Spring Harbor Press, Plainview NY. The term recombinant includes nucleic acids that have been modified only by the addition, substitution, or deletion of a portion of the nucleic acid. Often, recombinant nucleic acids may include nucleic acid sequences operably bound to a promoter sequence. Such recombinant nucleic acids may, for example, be part of a vector used to transform cells.

[0106] "Transformation" describes the process by which exogenous DNA is introduced into recipient cells. Transformation may occur naturally or artificially under various methods well known in the art and may depend on any known method for the insertion of exogenous nucleic acid sequences into prokaryotic or eukaryotic host cells. Methods for transformation are selected based on the type of host cell being transformed and may include, but are not limited to, bacteriophage or viral infection, electroporation, heat shock, lipofection, and particle shock. The term "transformed cell" includes stably transformed cells in which the inserted DNA can replicate either as an autonomously replicating plasmid or as part of a host chromosome, as well as transiently transformed cells in which the inserted DNA or RNA is expressed for a limited time.

[0107] "Substantially isolated or purified" nucleic acids or amino acid sequences are the subject of this specification. The term "substantially isolated or purified" means nucleic acids or amino acid sequences that have been removed from their natural environment and are at least 60%, preferably at least 75%, more preferably at least 90%, and even more preferably at least 95% free from other components to which they naturally associate.

[0108] The terms “mismatched” or “mismatched target sequence” refer to an off-target sequence that is not perfectly complementary to the first or second DNA sequence of the chimeric deoxyribonucleic acid described herein. A double-retargeted DNA may have at least one mismatch, but may also have two, three, four, five, six, or seven or more mismatched nucleotides with respect to the off-target sequence.

[0109] The following patents, patent applications, and publications listed below and throughout this document are incorporated herein by reference in their entirety. List of References 1. Wesselhoeft,RAet al.Molecular Cell 74,508-520.e4(2019). 2. Strobel, SA & Shetty, K. PNAS 94, 2903-2908 (1997). 3. Zhao X, Zhong Y, Wang X, Shen J, An W. Int J Med Sci.19(6):975-985. (2022) 4. Jensen S and Thomsen AR. J Virol.86(6):2900-10. (2012) 5. Wesselhoeft RA,et al.Mol.Cell.74(3):508-520.e4. (2019) 6. Chen YG,et al.Mol Cell.3;76(1):96-109.e9. (2019) 7. Obi P and Chen YG. Methods.196:85-103. (2021) 8. Chen LL. Nat Rev Mol Cell Biol.(4):205-11. (2016)

[0110] Sequence SEQ ID NO: 1 GGGCCTCTAGCTCATGCTTGGTTAGAGCAGCGGACTCATATTTCGATGTGCCTTGCGCCGGGAAACCACGCAAGGGATGGTGTCAAATTCGGCGAAACCTAAGCGCCCGCCCGGGCGTATGGCAACGCCGAGCCAAGCTTCGGCGCCTGCGCCGATGAAGGTGTAGAGACTAGACGGCACCCACCTAAGGCAAACGCTATGGTGAAGGCATAGTCCAGGGAGTGGCGAAAGTCACACAAACCGGAATCCGTTGGTGCTGGGTTCGACTCCCAGGGGGCCCACCA SEQ ID NO: 2 GGCGCCGATGAAGGTGTAGAGACTAGACGGCACCCACCTAAGGCAAACGCTATGGTGAAGGCATAGTCCAGGGAGTGGCGAAAGTCACACAAACCGG SEQ ID NO: 3 GGGAGCTATGGTGAAGGCATAGTCCAGGGAGTGGCGAAAGTCACACAAACCGG SEQ ID NO: 4 ATTTCGATGTGCCTTGCGCCGGGAAACCACGCAAGGGATGGTGTCAAATTCGGCGAAACCTAAGCGCCCGCCCGGGCGTATGGCAACGCCGAGCCAAGCTTCGGCGCC SEQ ID NO: 5 ATTTCGATGTGCCTTGCGCCGGGAAACCACGCAAGGGATGGTGTCAAATTCGGCGAAACCTAAGCGCCCGCCCGGGCGTATGGCAACGCCGAGCCAAGCTTCGGCGCCTGCGCCGATGAAGGTGTAGAGACTAGACGGCACCCACCTAAGGCTCAA SEQ ID NO: 6 GGGCCTCTAGCTCATGCTTGGTTAGAGCAGCGGACTCAT Sequence ID 7 AATCCGTTGGTGCTGGGTTCGACTCCCAGGGGGCCCACCA Sequence ID 8 CGGATCCGAGACGATCTAGACTGCAGCGTCTCAGGGTCGAC Sequence ID 9 AAGGCGAGACGATAGGATCCCCACGTCTCCATCA Sequence ID 10 AAAAACAAAAACAAAAAAA Sequence ID 11 AAAAAACAAAAAACAAAAA Sequence ID 12 GGCGCCGATGAAGGTGTAGAGACTAGACGGCACCCACCTAAGGCAAACGCTATGGTGAAGGCATAGTCCAGGGAGTGGCGAAAGTCACACAAACCGGAATCCGTTGGTGCTGGGTTCGACTCCCAGGGGGCCCACCAAAAAACAAAAACAAAAAACGGATCCGAGACGATCTAGACTGCA GCGTCTCAGGGTCGACAAAAAACAAAAAAAAAGGGCCTCTAGCTCATGCTTGGTTAGAGCAGCGGACTCATATTTCGATGTGCCTTGCGCGGAAACCACGCAAGGGATGGTGTCAAATTCGGCGAAACCTAAGCGCCCGCCCGGGCGTATGGCAACGCCGAGCCAAGCTTCGGCGCC Sequence ID 13 GGGAGCTATGGTGAAGGCATAGTCCAGGGAGTGGCGAAAGTCCACAAACCGGAATCCGTTGGTGCTGGGTTCGACTCCCAGGGGCCCACAAAAACAAAAAAAAAAAAAGGCGAGACGATAGGATCCCCACGTCTCCATCAAAAAAAACAAAAACAAAAAGGGCCTCTAGCTCAT GCTTGGTTAGAGCAGCGGACTCATATTTCGATGTGCCTTGCGCCGGGAAACCACGCAAGGGATGGTGTCAAATTCGGCGAAACCTAAGCGCCCGCCCGGGCGTATGGCAACGCCGAGCCAAGCTTCGGCGCCTGCGCCGATGAAGGTGTAGAGACTAGACGGCACCCACCTAAGGCTCAA sequence number 14 AATCCGTTGGTGCTGGGTTCCGACTCCCAGGGGCCCACAAAAACAAAAAACAAAAAAAAGGCGAGACGATAGGATCCCCACGTCTCCATCAAAAAACAAAAACAAAAAGGGCCTCTAGCTCATGCTTGGTTAGCAGCGGACTCAT sequence number 15 GGGAGCUAUGGUGAAGGCAUAGUCCAGGGAGUGGCGAAAGUCACACAAACCGG sequence number 16 GGGCGCCGAUGAAGGUGUAGAGACUAGACGGCACCCACCUAAGGCAAACGCUAUGGUGAAGGCAUAGUCCAGGGAGUGGCGAAAGUCACACAAACCGG sequence number 17 AUUUCGAUGUGCCUUGCGCCGGGAAACCACGCAAGGGAUGGUGUCAAAUUCGGCGAAACCUAAGCGCCCGCCCGGGCGUAUGGCAACGCCGAGCCAAGCUUCGGCGCCUGCGCCGAUGAAGGUGUAGAGACUAGACGCACCCACCUAAGGCUCAA sequence number 18 AUUUCGAUGUGCCUUGCGCCGGGAAACCACGCAAGGGAUGGUGUCAAAUUCGGCGAAACCUAAGCGCCCGCCCGGGCGUAUGGCAACGCCGAGCCAAGCUUCGGCGCC Sequence ID 19 AAUCCGUUGGUGCUGGGUUCGACUCCCAGGGGGCCCACCA Sequence ID 20 AAUCCGUUGGUGCUGGGUUCGACUCCCAGGGGGCCCACCACGCCGGAAACGCAAUAGCCG Sequence ID 21 GGGCCUCUAGCUCAUGCUUGGUUAGAGCAGCGGACUCAU Sequence ID 22 CGGCUAUUAUGCGUUACCGGCGGGGCCUCUAGCUCAUGCUUGGUUAGAGCAGCGGACUCAU Sequence ID 23 ACGUUACUGGCCGAAGCCGCUUGGAAUAAGGCCGGUGUGCGUUUGUCUAUAUGUUAUUUUCCACCAUAUUGCCGUCUUUUGGCAAUGUGAGGGCCCGGAAACCUGGCCCUGUCUUCUUGACGAGCAUUCCUAGGGGUCUUUCCCCUUCGCCAAAGGAAUGCAAGGUCUGUUGAAUGUCGUGAAGGAAGCAGUUCCUCUGGAAGCUUCUUGAAGACAAACAACGUCUGUAGCGACCCUUUGCAGGCAGCGGAACCCCCCACCUGGCGACAGGUGC CUCUGCGGCCAAAGCCACGUGUAUAAAGAUCACCUGCAAAGGCGGCACAACCCCAGUGCCACGUUGUGAGUUGGAUAGUUGUGGAAAGAGUCAAAUGGCUCUCUCAAGCGUAUUCAACAAGGGGCUGAAGGAUGCCCAGAAGGUACCCAUUGAUGGGAUCUGAUCUGGGGCCUCGGUGCACAUGCUUUACAUGUGUUUAGUCGAGGUAAAAAACGUCUAGGCCCCCGAACCACGGGAGGUUUUCCUUUGAAAAACACGAUGAUAUAU sequence number 24 AUGGUGAGCAAGGGCGAGGAGCUGUUCACCGGGGUGGUGCCCAUCCUGGUCGAGCUGGACGGCGACGUAACGGCCACAAGUUCAGCGUGUCCGGCGAGGGCGAGGGCGAUGCCACCUACGGCAAGCUGACCCUGAAGUUCAUCUGCACCACCGGCAAGCUGCCCGUGCCCUGGCCCACC CUCGUGACCACCCUGACCUACGGCGUGCAGUGCUUCAGCCGCUACCCGACCACAUGAAGCAGCACGACUUCUCAAGUCCGCCAUGCCCGAAGGCUACGUCCAGGAGCCACCAUCUUCUUCAAGGACGACGGCAACUACAAGACCCGGCCCGAGGUGAAGUUCGAGGGCGACACCCUUG GUGAACCGCAUCGAGCUGAAGGGCAUCGACUUCAAGGAGGACGGCAACAUCCUGGGGCACAAGCUGGAGUACAACUACAACAGCCACAACGUCUAUAUCAUGGCCGACAAGCAGAAGAACGGCAUCAAGGUGAACUUCAAGAUCCGCCACAACAUCGAGGACGGCAGCGUGCAGCUCGCC GACCACUACCAGCAGAACACCCCCAUCGGCGACGGCCCCGUGCUGCUGCCCGACAACCACUACCUGAGCACCAGUCCGCCCUGAGCAAAGACCCCAACGAGAAGCGCGAUCACAUGGUCCUGCUGGAGUUCGUGACCGCCCGGGAUCACUCUCGGCAUGGACGAGCUGUACAAGUAA அக்க்கு நுர்க்கு25 GGGAGCUAUGGUGAAGGCAUAGUCCAGGGAGUGGCGAAAGUCACACAAACCGGAAUCCGUUGGUGCUGGGUUCGACUCCCAGGGGCCCACAAAAACAAAAAAAAAAAAAGGCGAGACGAUAGGAUCCCACGUCUCCAUCAAAAAAAAAAAAAAAAAGGCCUCUAGCUCAU GCUUGGUUAAGAGCAGCGGACUCAUAUUUCGAUGUGCCUUGCGCCGGGAAACCACGCAAGGGAUGGUGUCAAAUUCGGCGAAACCUAAGCGCCCGCCCGGGCGUAUGGCAACGCCGAGCCAAGCUUCGGCGCCUGCGCCGAUGAAGGUGUAGAGACUAGACGCACCCACCUAAGGCUCAA sequence number 26

Claims

1. A substitution group 1 intron / exon comprising a 5' exon, a 3' exon, and an intron, wherein the intron comprises a 5' intron terminus and a 3' intron terminus, and An RNA vector comprising at least one modified nucleotide, The 3' exon is located upstream of the 5' exon. A portion of the intron, including the 3' intron terminal, is located upstream of the 3' exon. A portion of the intron, including the 5' intron terminal, is located downstream of the 5' exon. An RNA vector in which the substitution group 1 intron / exon is active in the presence of the modified nucleotide.

2. The RNA vector according to claim 1, wherein the modified nucleotide is pseudouridine or N1-methylpseudridine.

3. The RNA vector according to claim 2, wherein all uridine nucleotides are replaced with pseudouridine or N1-methylpseudridine.

4. The RNA vector according to any one of claims 1 to 3, wherein the substituted group 1 intron / exon further comprises at least one mutation to a wild-type group 1 intron / exon.

5. The RNA vector according to claim 4, wherein the wild-type group 1 intron / exon is an Azoarcus group 1 intron / exon.

6. The RNA vector according to claim 4 or 5, wherein the mutation improves the transcription of the vector.

7. The RNA vector according to any one of claims 1 to 6, wherein the portion of the intron including the 3' intron terminus has 80% or more similarity to SEQ ID NO: 15 or SEQ ID NO:

16.

8. The RNA vector according to any one of claims 1 to 7, wherein the portion of the intron including the 5' intron terminus has 80% or more similarity to SEQ ID NO: 17 or SEQ ID NO:

18.

9. The RNA vector according to any one of claims 1 to 8, wherein the 3' exon has 80% or more similarity to SEQ ID NO: 19 or SEQ ID NO:

20.

10. The RNA vector according to any one of claims 1 to 9, wherein the 5' exon has 80% or more similarity to SEQ ID NO: 21 or SEQ ID NO:

22.

11. The RNA vector according to any one of claims 1 to 10, further comprising an internal ribosome entry site (IRES).

12. The RNA vector according to claim 11, wherein the IRES has 80% or more similarity to SEQ ID NO:

23.

13. An RNA vector according to any one of claims 1 to 12, further comprising a nucleic acid sequence encoding a target protein.

14. An RNA vector according to any one of claims 1 to 13, further comprising at least one spacer.

15. The RNA vector according to claim 14, wherein the spacer is selected from sequences that have 80% or more similarity to sequence number 10 or sequence number 11 in each occurrence.

16. The RNA vector according to any one of claims 1 to 15, wherein the vector has a length of more than approximately 1,000 nucleotides.

17. A circular RNA vector formed from an RNA vector according to any one of claims 1 to 16.

18. The circular RNA vector according to claim 17, further comprising a nucleic acid sequence encoding a target protein.

19. A substitution group 1 intron / exon comprising a 5' exon, a 3' exon, and an intron, wherein the intron comprises a 5' intron terminus and a 3' intron terminus, and A DNA vector containing multiple cloning sites, The 3' exon is located upstream of the 5' exon. A portion of the intron, including the 3' intron terminal, is located upstream of the 3' exon. A DNA vector in which a portion of the intron, including the 5' intron end, is located downstream of the 5' exon.

20. The DNA vector according to claim 19, wherein the substituted group 1 intron / exon further comprises at least one mutation to a wild-type group 1 intron / exon.

21. The DNA vector according to claim 20, wherein the wild-type group 1 intron / exon is an Azoarcus group 1 intron / exon and has 80% or more similarity to SEQ ID NO:

1.

22. The DNA vector according to any one of claims 19 to 21, wherein the mutation improves the transcription of the vector.

23. The DNA vector according to any one of claims 19 to 22, wherein the portion of the intron including the 3' intron terminus contains 80% or more similarity to SEQ ID NO: 2 or SEQ ID NO:

3.

24. The DNA vector according to any one of claims 19 to 23, wherein the portion of the intron including the 5' intron terminus has 80% or more similarity to SEQ ID NO: 4 or SEQ ID NO:

5.

25. The DNA vector according to any one of claims 19 to 24, wherein the 3' exon has 80% or more similarity to SEQ ID NO:

7.

26. The DNA vector according to any one of claims 19 to 25, wherein the multiple cloning site has 80% or more similarity to SEQ ID NO: 8 or SEQ ID NO:

9.

27. The DNA vector according to any one of claims 19 to 26, wherein the 5' exon has 80% or more similarity to SEQ ID NO:

6.

28. A DNA vector according to any one of claims 19 to 27, further comprising a nucleic acid sequence encoding a target protein.

29. A DNA vector according to any one of claims 19 to 28, further comprising at least one spacer.

30. The DNA vector according to claim 29, wherein the spacer is selected from sequences that have 80% or more similarity to sequence number 10 or sequence number 11 in each occurrence.

31. The DNA vector according to any one of claims 19 to 30, wherein the vector has a length of more than approximately 1,000 nucleotides.

32. A circular RNA vector transcribed from a DNA vector according to any one of claims 19 to 31, comprising at least one modified nucleotide.

33. The circular RNA vector according to claim 32, further comprising a nucleic acid sequence encoding a target protein.

34. A method for expressing a target protein from a circular RNA vector, To provide a circular RNA vector according to claim 18 or 33, A method comprising translating the aforementioned target protein.

Images