A method for treating cancer using a combination of a TAAxCD3 bispecific antibody and targeted immunocytokine.

Abstract

This disclosure relates to a method for treating or inhibiting tumor growth, comprising selecting subjects with cancer and administering a therapeutically effective dose of a targeted immunocytokine (e.g., a fusion protein comprising an IL2 moiety and an immunoglobulin antigen-binding domain that binds to PD1) in combination with a TAAxCD3 bispecific antibody to subjects in need. The combination therapy shows increased antitumor efficacy, increased duration of tumor control, and / or increased overall survival in subjects compared to subjects treated with targeted immunocytokines as monotherapy.

Description

TECHNICAL FIELD

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of priority to U.S. Provisional Patent Application No. 63 / 674,101 filed on July 22, 2024, U.S. Provisional Patent Application No. 63 / 594,094 filed on October 30, 2023, and U.S. Provisional Patent Application No. 63 / 588,906 filed on October 9, 2023, the entire disclosures of which are incorporated herein by reference in their entirety.

[0002] SEQUENCE LISTING The Sequence Listing of this application has been submitted electronically as an xml file in ST.26 format with the file name "SeqList-11609", a creation date of October 9, 2023, and a size of 44,976 bytes. The submitted Sequence Listing is part of the present specification and is incorporated herein by reference in its entirety. Sequences less than the minimum length are AAS (SEQ ID NO: 7) and TAS (SEQ ID NO: 41).

[0003] FIELD The present disclosure relates to methods of treating or inhibiting tumor growth by administering a combination of a targeted immunocytokine and a TAAxCD3 bispecific antibody. BACKGROUND ART

[0004] Cytokines are secreted proteins that can activate and modulate immune responses by acting in autocrine and paracrine manner. Their immunomodulatory activity has provided a strong rationale for the search for cytokine-based therapeutics for cancer treatment (Non-Patent Literature 1). Interleukin-2 (IL-2 or IL2), a cytokine, is a pluripotent cytokine primarily produced by activated T cells. It stimulates the proliferation and differentiation of T cells; induces the generation of cytotoxic T lymphocytes (CTLs) and the differentiation of peripheral blood lymphocytes into cytotoxic cells and lymphokine-activated killer (LAK) cells; promotes the expression of cytokines and cytolytic molecules by T cells; facilitates the proliferation and differentiation of B cells and the synthesis of immunoglobulins by B cells; and stimulates the generation, proliferation, and activation of natural killer (NK) cells.

[0005] IL-2 signals via two types of receptor complexes formed from three subunits: IL-2Rα (IL2Ra, CD25), IL-2Rβ (IL2Rb, CD122), and IL-2Rγ (IL2Rg, CD132). The heterodimeric IL2Rb / g receptor binds to IL-2 with intermediate affinity and is mostly expressed on resting CD8+ T cells and NK cells; the heterotrimeric IL2Ra / b / g receptor binds to IL-2 with high affinity and is mainly expressed on Treg and activated T cells (Non-Patent Literature 2). Recombinant IL-2 has been approved for the treatment of advanced melanoma and renal cell carcinoma and has induced complete, permanent tumor regression in some patients (Non-Patent Literature 3). However, serious systemic toxicity associated with high-dose IL-2 therapy has limited its practical use (Non-Patent Literature 4, Non-Patent Literature 5). To reduce toxicity associated with high-dose IL-2 treatment and limit Treg expansion, a new generation of IL-2 therapies has been developed that exhibit reduced binding to IL2Ra and thus biased activity towards the IL2Rb / g dimer receptor on CD8+ T and NK cells (Non-Patent Literature 6, 7, 8, 9). While some of these molecules are thought to result in improved safety profiles in clinical trials, limited monotherapy efficacy has been reported from these studies (Non-Patent Literature 10, 11).

[0006] An alternative approach to improve efficacy and avoid the systemic toxicity of IL-2 is to convert it into an antibody-cytokine conjugate that has the ability to target the delivery of immunocytokine-cytokines to specific cell types. This allows IL-2 signaling to be specifically delivered to tumor-reactive T cells. One cell surface marker for such tumor-reactive T cells is co-inhibitory receptor programmed cell death protein 1 (PD-1 or PD1) (Non-Patent Literature 12, Non-Patent Literature 13). PD1 is expressed on the surface of antigen-activated T cells, and antibodies that bind to PD1 enable targeted delivery of IL-2. In this regard, IL-2 mutant protein molecules attenuated by IL2Ra, targeting PD1, have recently been developed to preferentially provide IL2R agonism against PD1+ tumor-reactive T cells (Non-Patent Literature 14, Non-Patent Literature 15). A receptor-masked IL-2 immunocytokine targeting PD1, called anti-PD1-IL2Ra-IL2 (or "PD1-IL2Ra-IL2", REGN10597), was generated. Receptor masking should result in attenuated IL-2 activity for both the IL2Ra / b / g trimer receptor and the IL-2Rb / g dimer receptor, but PD1 targeting should selectively reconstitute the IL2Ra / b / g agonism on PD1+ tumor-responsive T cells.

[0007] CD3 is a homodimeric or heterodimeric antigen expressed on T cells bound to the T cell receptor complex (TCR), and is required for T cell activation. Antibodies against CD3 have been shown to cluster CD3 on T cells, thereby inducing T cell activation in a manner similar to the engagement of the TCR by peptide-loaded MHC molecules.

[0008] CD3 bispecific T cell engagers have induced CD3 / TCR-mediated tumor cell killing and have shown remarkable activity in several hematological malignancies (Non-Patent Literature 16). However, despite the promising indications shown by some new early clinical data, the efficacy and safety profiles of CD3 bispecific antibodies (BsAbs) in solid tumors have not been particularly impressive, suggesting unique challenges in targeting solid tumors. Successful application of CD3 BsAbs to solid tumors requires strategies to overcome several complicating factors, such as "on-target, off-tumor" toxicity caused by the expression of target antigens on normal tissues, as well as barriers in the solid tumor environment that suppress T cell invasion, function, and survival (Non-Patent Literature 17, Non-Patent Literature 18). Baseline tumor-infiltrating T cell density has been shown to be a key determinant of response to CD3 bispecific T cell engager therapy in solid tumor models (Non-Patent Literature 19). [Prior art documents] [Non-patent literature]

[0009] [Non-Patent Document 1] Waldmann, 2018, Cold Spring Harbor Perspectives in Biol., 10 pages. [Non-Patent Document 2] Spolski and Leonard, 2018, Nat. Rev. Immunol, 18: pp. 648-659. [Non-Patent Document 3] Rosenberg, 2014, J.Immunol., 192:5451~5458 [Non-Patent Document 4] Dutcher et al., 2014, J. Immunotherapy of Cancer, 2:26 p. [Non-Patent Document 5] Vial and Descotes, 1992, Drug Safety, 7: pp. 417-433. [Non-Patent Document 6] Charych et al., 2016, Clin. Cancer Res., 22: pp. 680-690. [Non-Patent Document 7] Klein et al., 2017, Oncoimmunology, 6:e1277306 [Non-Patent Document 8] Lopes et al., 2020, J.Immunother.Cancer, 8:e000673 [Non-Patent Document 9] Ptacin et al., 2021, Nat.Commun., 12(1):4785. [Non-Patent Document 10] Bentebibel et al., 2019, Cancer Discovery, 9: pp. 711-721 [Non-Patent Document 11] Janku et al., 2021, Cancer Res., 81:L-B041-L-B041 [Non-Patent Document 12] Gros et al., 2014, J. Clin. Investigation, 124: pp. 2246-2259. [Non-Patent Document 13] Gros et al., 2016, Nature Med., 22, pp. 433-438. [Non-Patent Document 14] Codarri Deak et al., 2022, Nature, 610: pp. 161-172 [Non-Patent Document 15] Ren et al., 2022, J. Clin. Investigation, 132(3):e153604 [Non-Patent Document 16] van de Donk and Zweegman, 2023, The Lancet, 402: pp. 142-158. [Non-Patent Document 17] Crawford and Chiu, 2021, Molecular Cancer Therapeutics, 20: pp. 1350-1358. [Non-Patent Document 18] Arvedson et al., 2022, Ann. Rev. Cancer Biol., 6: pp. 17-34 [Non-Patent Document 19] Belmontes et al., 2021, Science Translational Med., 13:eabd1524. [Overview of the Initiative] [Problems that the invention aims to solve]

[0010] There is still a need for more effective therapies in cancer treatment that achieve substantially improved responses without significant side effects. [Means for solving the problem]

[0011] In one embodiment, the disclosed technique is a method for treating or inhibiting tumor growth, comprising (a) selecting a subject having cancer; and (b) administering to the subject a therapeutically effective amount of a targeted immunocytokine in combination with a therapeutically effective amount of a TAAxCD3 bispecific antibody, wherein the combined administration results in increased antitumor efficacy compared to a subject administered the targeted immunocytokine as monotherapy. In some embodiments, the targeted immunocytokine comprises a fusion protein comprising (i) an immunoglobulin antigen-binding domain of a checkpoint inhibitor and (ii) an IL2 moiety. In some embodiments, the checkpoint inhibitor is an inhibitor of PD1, PD-L1, PD-L2, LAG-3, CTLA-4, TIM3, A2aR, B7H1, BTLA, CD160, LAIR1, TIGHT, VISTA, or VTCN1. In some embodiments, the checkpoint inhibitor is an inhibitor of PD1. In some embodiments, the IL2 moiety comprises IL2 receptor alpha (IL2Ra) or a fragment thereof; and IL2 or a fragment thereof. In some embodiments, the Ig antigen-binding domain of the checkpoint inhibitor includes three heavy chain complementarity-determining regions (CDRs) (HCDR1, HCDR2, and HCDR3) contained within a heavy chain variable region (HCVR) selected from the group consisting of SEQ ID NOs: 1, 11, and 20, and three light chain CDRs (LCDR1, LCDR2, and LCDR3) contained within a light chain variable region (LCVR) selected from the group consisting of SEQ ID NOs: 5 and 15.

[0012] In some embodiments, the Ig antigen-binding domain of the checkpoint inhibitor comprises three heavy chain complementarity-determining regions (CDRs) (HCDR1, HCDR2, and HCDR3) and three light chain CDRs (LCDR1, LCDR2, and LCDR3), where (i) HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, and LCDR3 each comprise the amino acid sequences of SEQ ID NOs. 2, 3, 4, 6, 7, and 8; (ii) HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, and LCDR3 each comprise the amino acid sequences of SEQ ID NOs. 12, 13, 14, 16, 7, and 17; or (iii) HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, and LCDR3 each comprise the amino acid sequences of SEQ ID NOs. 21, 22, 23, 6, 7, and 8. In some embodiments, the antigen-binding domain of the checkpoint inhibitor includes an HCVR / LCVR amino acid sequence pair selected from SEQ ID NOs: 1 / 5, 11 / 15, and 20 / 5. In some embodiments, the antigen-binding domain of the checkpoint inhibitor includes the HCVR / LCVR amino acid sequence pair of SEQ ID NO: 20 / 5. In some embodiments, the fusion protein includes an HCVR of IgG1 or IgG4 isotype and a heavy chain containing a heavy chain constant region.

[0013] In some embodiments, the fusion protein comprises a heavy chain and a light chain, where (i) the heavy chain comprises the amino acid sequence of SEQ ID NO: 24 and the light chain comprises the amino acid sequence of SEQ ID NO: 25; (ii) the heavy chain comprises the amino acid sequence of SEQ ID NO: 9 and the light chain comprises the amino acid sequence of SEQ ID NO: 10; or (iii) the heavy chain comprises the amino acid sequence of SEQ ID NO: 18 and the light chain comprises the amino acid sequence of SEQ ID NO: 19. In some embodiments, the IL2 portion is linked to the C-terminus of the heavy chain via a linker comprising the amino acid sequence of SEQ ID NO: 30 or 31. In some embodiments, the IL2 portion comprises IL2 having the amino acid sequence of SEQ ID NO: 29. In some embodiments, the IL2 portion comprises IL2 or a fragment thereof linked to the C-terminus of IL2Ra or a fragment thereof via a linker. In some embodiments, IL2Ra or a fragment thereof comprises the amino acid sequence of SEQ ID NO: 28. In some embodiments, the IL2 portion comprises the amino acid sequence of SEQ ID NO: 27.

[0014] In some embodiments, TAA is AFP, ALK, BAGE protein, BCMA, BIRC5 (Survivin), BIRC7, β-catenin, brc-abl, BRCA1, BORIS, CA9, carbonic anhydrase IX, caspase-8, CALR, CCR5, CD19, CD20 (MS4A1), CD22, CD30, CD40, CDK4, CEA, CTLA4, cyclin- B1, CYP1B1, EGFR, EGFRvIII, ErbB2 / Her2, ErbB3, ErbB4, ETV6-AML, EpCAM, EphA2, Fra-1, FOLR1, GAGE ​​protein (e.g., GAGE-1, -2), GD2, GD3, GloboH, Glypican-3, GM3, gp100, Her2, HLA / B-raf, HLA / k-ras, HLA / MAGE-A3, hTERT, LMP2, MAGE proteins (e.g., MAGE-1, -2, -3, -4, -6, and -12), MART-1, mesothelin, ML-IAP, Muc1, Muc2, Muc3, Muc4, Muc5, Muc16 (CA-125), MUM1, NA17, NY-BR1, NY-BR62, NY-BR85, NY-ESO1, OX40, p15, p53, PAP, PAX3, P The TAA is selected from AX5, PCTA-1, PLAC1, PRLR, PRAME, PSMA(FOLH1), RAGE protein, Ras, RGS5, Rho, SART-1, SART-3, STEAP1, STEAP2, TAG-72, TGF-β, TMPRSS2, Thompson-nouvelle antigen (Tn), TRP-1, TRP-2, tyrosinase, and uroplakin-3. In some embodiments, the TAA is MUC16.

[0015] In some embodiments, the TAAxCD3 bispecific antibody is a MUC16xCD3 bispecific antibody. In some embodiments, the MUC16xCD3 bispecific antibody is a bispecific antibody or its antigen-binding fragment comprising: a first binding arm that specifically binds to CD3, comprising three heavy chain complementarity-determining regions (CDRs) (A1-HCDR1, A1-HCDR2, and A1-HCDR3) contained within a heavy chain variable region (HCVR) having the amino acid sequence of SEQ ID NO: 34 and three light chain CDRs (LCDR1, LCDR2, and LCDR3) contained within a light chain variable region (LCVR) having the amino acid sequence of SEQ ID NO: 39; and a second binding arm that specifically binds to MUC16, comprising three heavy chain complementarity-determining regions (CDRs) (A2-HCDR1, A2-HCDR2, and A2-HCDR3) contained within an HCVR having the amino acid sequence of SEQ ID NO: 44 and three light chain CDRs (LCDR1, LCDR2, and LCDR3) contained within an LCVR having the amino acid sequence of SEQ ID NO: 39. In some embodiments, the MUC16xCD3 bispecific antibody or its antigen-binding fragment of the second therapy, A1-HCDR1, A1-HCDR2, A1-HCDR3, LCDR1, LCDR2, LCDR3, A2-HCDR1, A2-HCDR2, A2-HCDR3, LCDR1, LCDR2, and LCDR3, each contain the amino acid sequences of SEQ ID NOs. 35, 36, 37, 40, 41, 42, 45, 46, 47, 40, 41, and 42, respectively.

[0016] In some embodiments, the MUC16xCD3 bispecific antibody or its antigen-binding fragment comprises (i) a first binding arm comprising an HCVR having the amino acid sequence of SEQ ID NO: 34 and / or an LCVR having the amino acid sequence of SEQ ID NO: 39, and (ii) a second binding arm comprising an HCVR having the amino acid sequence of SEQ ID NO: 44 and / or an LCVR having the amino acid sequence of SEQ ID NO: 39. In some embodiments, the MUC16xCD3 bispecific antibody or its antigen-binding fragment comprises a first binding arm comprising a heavy chain and a light chain, the heavy chain having the amino acid sequence of SEQ ID NO: 33 and / or the light chain having the amino acid sequence of SEQ ID NO: 38; and a second binding arm comprising a heavy chain and a light chain, the heavy chain having the amino acid sequence of SEQ ID NO: 43 and / or the light chain having the amino acid sequence of SEQ ID NO: 38. In some embodiments, the MUC16xCD3 bispecific antibody or its antigen-binding fragment is BSMUC16 / CD3-001.

[0017] In some embodiments, the cancer is selected from anal cancer, angiosarcoma, basal cell carcinoma, bladder cancer, osteosarcoma, brain tumor, breast cancer, cervical cancer, bile duct cancer, chondrosarcoma, colon cancer, colorectal cancer, cutaneous squamous cell carcinoma, endometrial cancer, esophageal cancer, glioblastoma multiforme, head and neck squamous cell carcinoma, hepatocellular carcinoma, kidney cancer, liver cancer, lung cancer, Merkel cell carcinoma, melanoma, myeloma, non-small cell lung cancer, ovarian cancer, pancreatic cancer, prostate cancer, salivary gland cancer, skin cancer, soft tissue sarcoma, gastric cancer, testicular cancer, and uterine cancer.

[0018] In some embodiments, the targeted immunocytokine is administered to the subject before or simultaneously with the administration of the TAAxCD3 bispecific antibody. In some embodiments, the targeted immunocytokine is administered to the subject after the administration of the TAAxCD3 bispecific antibody.

[0019] In another embodiment, the disclosed technique is a method for enhancing the efficacy of targeted immunocytokine therapy, comprising (a) selecting a subject having cancer; and (b) administering to the subject a therapeutically effective amount of targeted immunocytokine in combination with a therapeutically effective amount of a TAAxCD3 bispecific antibody, wherein the combined administration results in increased antitumor efficacy compared to a subject administered targeted immunocytokine as monotherapy. In some embodiments, the targeted immunocytokine comprises (a) an immunoglobulin antigen-binding domain comprising a heavy chain variable region having the amino acid sequence of SEQ ID NO: 20 and a light chain variable region having the amino acid sequence of SEQ ID NO: 5; and (b) a fusion protein comprising an IL2 moiety comprising IL2 or a fragment thereof linked via a linker to the C-terminus of IL2Ra or a fragment thereof.

[0020] In some embodiments, TAA is AFP, ALK, BAGE protein, BCMA, BIRC5 (Survivin), BIRC7, β-catenin, brc-abl, BRCA1, BORIS, CA9, carbonic anhydrase IX, caspase-8, CALR, CCR5, CD19, CD20 (MS4A1), CD22, CD30, CD40, CDK4, CEA, CTLA4, cyclin- B1, CYP1B1, EGFR, EGFRvIII, ErbB2 / Her2, ErbB3, ErbB4, ETV6-AML, EpCAM, EphA2, Fra-1, FOLR1, GAGE ​​protein (e.g., GAGE-1, -2), GD2, GD3, GloboH, Glypican-3, GM3, gp100, Her2, HLA / B-raf, HLA / k-ras, HLA / MAGE-A3, hTERT, LMP2, MAGE proteins (e.g., MAGE-1, -2, -3, -4, -6, and -12), MART-1, mesothelin, ML-IAP, Muc1, Muc2, Muc3, Muc4, Muc5, Muc16 (CA-125), MUM1, NA17, NY-BR1, NY-BR62, NY-BR85, NY-ESO1, OX40, p15, p53, PAP, PAX3, P The TAA is selected from AX5, PCTA-1, PLAC1, PRLR, PRAME, PSMA(FOLH1), RAGE protein, Ras, RGS5, Rho, SART-1, SART-3, STEAP1, STEAP2, TAG-72, TGF-β, TMPRSS2, Thompson-nouvelle antigen (Tn), TRP-1, TRP-2, tyrosinase, and uroplakin-3. In some embodiments, the TAA is MUC16.

[0021] In some embodiments, the TAAxCD3 bispecific antibody is a MUC16xCD3 bispecific antibody. In some embodiments, the MUC16xCD3 bispecific antibody includes a first binding arm that specifically binds to CD3 and includes three heavy chain complementarity-determining regions (CDRs) (A1-HCDR1, A1-HCDR2, and A1-HCDR3) contained within a heavy chain variable region (HCVR) having the amino acid sequence of SEQ ID NO: 34 and three light chain CDRs (LCDR1, LCDR2, and LCDR3) contained within a light chain variable region (LCVR) having the amino acid sequence of SEQ ID NO: 39; and a second binding arm that specifically binds to MUC16 and includes three heavy chain complementarity-determining regions (CDRs) (A2-HCDR1, A2-HCDR2, and A2-HCDR3) contained within an HCVR having the amino acid sequence of SEQ ID NO: 44 and three light chain CDRs (LCDR1, LCDR2, and LCDR3) contained within an LCVR having the amino acid sequence of SEQ ID NO: 39.

[0022] Other embodiments of this disclosure will become apparent from the following detailed description. [Brief explanation of the drawing]

[0023] [Figure 1-1] Figures 1A-1D relate to Example 2 and illustrate the requirements for IL-2Ra engagement for the antitumor activity of IL-2. Figure 1A is a graph showing the level of STAT5 phosphorylation on gated Treg cells as measured by flow cytometry. Figure 1B is a graph showing the level of STAT5 phosphorylation on CD8+ T cells as measured by flow cytometry. Figure 1C is a graph showing the level of STAT5 phosphorylation on NK cells as measured by flow cytometry. Figure 1D is a graph showing the level of IL-2Ra expression on each gated population as measured by flow cytometry. [Figure 1-2] Same as above. [Figure 2-1] Figures 2A-2C relate to Example 2. Figure 2A shows the design of the in vivo experiment. Figure 2B is a graph showing the average tumor growth. Figure 3C is a graph showing the survival rate in the experiment. [Figure 2-2] Same as above. [Figure 3] Figures 3A and 3B relate to Example 2 and are graphs showing SPR sensorgrams of the binding of PD1-IL2Ra-IL2 or a control molecule to the indicated IL-2 receptor subunit proteins. Figure 3A is a graph showing the binding to the IL-2 receptor subunit protein IL-2Ra. Figure 3B is a graph showing the binding to the IL-2 receptor subunit proteins IL-2Rb and IL-2Rg. [Figure 4A] Figures 4A-4B relate to Example 2 and are graphs showing cell binding as analyzed by flow cytometry. The insert is an enlarged view of a specified portion of the larger graph. Figure 4A is a graph showing the titration of each indicated molecule that binds to YT / STAT5-Luc / IL2RaKO / PD1KO cells. [Figure 4B] Figures 4A-4B relate to Example 2 and are graphs showing cell binding as analyzed by flow cytometry. The insert is an enlarged view of a specified portion of the larger graph. Figure 4B is a graph showing the titration of each indicated molecule that binds to YT / STAT5-Luc / IL2RaOE / PD1KO cells. [Figure 5-1] Figures 5A-5C relate to Example 2 and are graphs showing the activation of the STAT5 luciferase reporter on three YT / STAT5-Luc / IL2RaKO cell lines expressing specific levels of PD-1, as determined by titration of the respective molecules. Figure 5A is a graph showing activation on a YT / STAT5-Luc / IL2RaKO cell line that does not express PD-1. Figure 5B is a graph showing activation on a YT / STAT5-Luc / IL2RaKO cell line expressing an intermediate level of PD-1. Figure 5C is a graph showing activation on a YT / STAT5-Luc / IL2RaKO cell line expressing a high level of PD-1. [Figure 5-2] Same as above. [Figure 6]Figures 6A and 6B relate to Example 2 and are graphs showing the level of STAT5 phosphorylation measured by flow cytometry. Figure 6A is a graph showing the level of STAT5 phosphorylation on gated PD1-CD8+ T cells. Figure 6B is a graph showing the level of STAT5 phosphorylation on gated PD1+CD8+ T cells. [Figure 7] Figures 7A and 7B relate to Example 2 and are graphs showing the T cell count in peripheral blood leukocytes per 1 ml of blood, as analyzed by flow cytometry. Figure 7A is a graph showing the PD1-CD8+ T cell count per 1 ml of blood. Figure 7B is a graph showing the PD1+CD8+ T cell count per 1 ml of blood. [Figure 8] Figures 8A and 8B relate to Example 2. Figure 8A is a graph showing the change in body weight. Figure 8B is a graph showing the change in the wet weight of the lungs. [Figure 9-1] Figures 9A-9D relate to Example 2 and are graphs showing the number of tumor-free (TF) mice and the mean tumor volume at the end of the study in mice administered with PD1-IL2Ra-IL2 in different syngeneic tumor models. Figure 9A shows the number of TF mice and the mean tumor volume in mice transplanted with B16F10 tumor cells. Figure 9B shows the number of TF mice and the mean tumor volume in mice transplanted with MCA205 tumor cells. Figure 9C shows the number of TF mice and the mean tumor volume in mice transplanted with TRAMP-C2 tumor cells. Figure 9D shows the number of TF mice and the mean tumor volume in mice transplanted with Colon26 tumor cells. [Figure 9-2] Same as above. [Figure 10] Figures 10A and 10B relate to Example 2. Figure 10A is a graph showing the average tumor size. Figure 10B is a graph showing the survival rate. [Figure 11-1] Figures 11A-11C relate to Example 2. Figure 11A is a schematic diagram of the in vivo experiment. Figure 11B is a graph showing the average tumor size for the experiment. Figure 11C is a graph showing the survival rate for the experiment. [Figure 11-2]Same as above. [Figure 12] Figure 12 relates to Example 2 and is a graph showing the average tumor volume. [Figure 13-1] Figures 13A to 13E relate to Example 2 and are graphs showing T cell density in excised tumors of mice administered the indicated molecules. Figure 13A is a graph showing tumor CD8+ T cell density. Figure 13B is a graph showing tumor SPAS-1-dextramer+CD8+ T cells as a percentage of total CD8+ T cells. Figure 13C is a graph showing tumor SPAS-1-dextramer+CD8+ T cell density. Figure 13D is a graph showing tumor PD1+CD8+ T cell density. Figure 13E is a graph showing tumor TCF1+PD1+CD8+ T cell density. [Figure 13-2] Same as above. [Figure 14] Figure 14 relates to Example 3 and is a graph showing the average tumor growth in mice administered with the indicated molecule. [Figure 15-1] Figures 15A-15F relate to Example 3 and are graphs showing individual tumor growth curves and the number of tumor-free mice at the end of the same experiment as Figure 14. Figure 15A shows the individual tumor growth curves and the number of tumor-free mice for mice administered with the CD3 control. Figure 15B shows the individual tumor growth curves and the number of tumor-free mice for mice administered with the CD3 control and mPD1-IL2Ra-IL2. Figure 15C shows the individual tumor growth curves and the number of tumor-free mice for mice administered with MUC16xCD3. Figure 15D shows the individual tumor growth curves and the number of tumor-free mice for mice administered with MUC16xCD3 and anti-mouse PD1 antibody (amPD1). Figure 15E shows the individual tumor growth curves and the number of tumor-free mice for mice administered with MUC16xCD3 and NT-IL2Ra-IL2. Figure 15F shows the individual tumor growth curves and the number of tumor-free mice for mice administered with MUC16xCD3 and mPD1-IL2Ra-IL2. [Figure 15-2] Same as above. [Figure 15-3] Same as above. [Figure 16] Figure 16 is a graph showing the average tumor growth in mice derived from the same test described in Example 3. [Figure 17-1] Figures 17A-17I relate to Example 4. Figure 17A is a graph showing PD-1 expression on anti-huMUC16 or control CAR+T cells after co-culture with tumor cell lines shown in vitro. Figure 17B is a schematic diagram of the in vivo study. Figure 17C is a graph showing mean tumor growth (mean + SD) monitored over time and statistically analyzed using two-way ANOVA with Bonferroni's multiple comparison test (**P≦0.01, ***P≦0.001, ****P≦0.0001). Figure 17D shows individual tumor growth curves for mice administered with control CAR-T cells and isotype controls. Figure 17E shows individual tumor growth curves for mice administered with control CAR-T cells and mPD1-IL2Ra-IL2. Figure 17F shows individual tumor growth curves for mice administered with huMUC16 CAR-T and isotype controls. Figure 17G shows the individual tumor growth curves of mice administered with huMUC16 CAR-T cells and anti-mouse PD1 antibody (amPD1). Figure 17H ​​shows the individual tumor growth curves of mice administered with huMUC16 CAR-T cells and NT-IL2Ra-IL2. Figure 17I shows the individual tumor growth curves of mice administered with huMUC16 CAR-T cells and mPD1-IL2Ra-IL2. [Figure 17-2] Same as above. [Figure 17-3] Same as above. [Figure 17-4] Same as above. [Figure 17-5] Same as above. [Figure 18] Figure 18 relates to Example 6 and is a set of graphs showing the STAT3 activity of the indicated cell line treated with the indicated molecule. [Figure 19] Figure 19 relates to Example 6 and is a schematic diagram of the in vivo experiment. [Figure 20-1]Figures 20A-20H relate to Example 6 and are graphs showing the concentrations of the indicated cell types in tumors harvested from mice administered PBS or mPD1-IL2Ra-IL2. Figure 20A is a graph showing the concentration of total T cells. Figure 20B is a graph showing the percentage of total T cells that are CD8 or CD4 T cells. Figure 20C is a graph showing the concentration of CD8 T cells. Figure 20D is a graph showing the concentration of PD-1+CD8 T cells. Figure 20E is a graph showing the concentration of CD4 T cells. Figure 20F is a graph showing the concentration of PD-1+CD4 T cells. Figure 20G is a graph showing the concentration of Treg cells. Figure 20H is a graph showing the concentration of PD-1+Treg cells. [Figure 20-2] Same as above. [Figure 20-3] Same as above. [Figure 20-4] Same as above. [Figure 21-1] Figures 21A-21H relate to Example 6 and are graphs showing the concentrations of the indicated cell types in the spleens harvested from mice administered PBS or mPD1-IL2Ra-IL2. Figure 21A is a graph showing the total number of T cells per spleen. Figure 21B is a graph showing the percentage of total T cells that are CD8 or CD4 T cells. Figure 21C is a graph showing the number of CD8 T cells per spleen. Figure 21D is a graph showing the number of PD-1+CD8 T cells per spleen. Figure 21E is a graph showing the number of CD4 T cells per spleen. Figure 21F is a graph showing the number of PD-1+CD4 T cells per spleen. Figure 21G is a graph showing the number of Tregs per spleen. Figure 21H is a graph showing the number of PD-1+Tregs per spleen. [Figure 21-2] Same as above. [Figure 21-3] Same as above. [Figure 21-4] Same as above. [Figure 22] Figure 22 relates to Example 6 and is a set of graphs showing the ratio of CD8 T cells to Treg cells in tumors and spleens harvested from mice administered PBS or mPD1-IL2Ra-IL2. [Figure 23] Figure 23 relates to Example 7 and is a graph showing the percentage change in body weight over time in mice administered the indicated molecule. [Figure 24A] Figures 24A and 24B relate to Example 7. Figure 24A is a set of graphs showing the concentrations of the indicated cytokines in mice administered with the indicated molecules. [Figure 24B] Figures 24A and 24B relate to Example 7. Figure 24B is a set of graphs showing the concentrations of the indicated cytokines in mice administered with the indicated molecules. [Figure 25] Figure 25 relates to Example 8 and is a schematic diagram of the in vivo experiment. [Figure 26] Figure 26 relates to Example 8 and is a graph showing the average tumor growth in mice treated with the cells and molecules shown. [Figure 27-1] Figures 27A to 27D relate to Example 8. Figure 27A is a graph showing tumor growth in individual mice treated with control CAR-T cells and mNT-IL2Ra-IL2. Figure 27B is a graph showing tumor growth in individual mice treated with control CAR-T cells and mPD1-IL2Ra-IL2. Figure 27C is a graph showing tumor growth in individual mice treated with huMUC16 CAR-T cells and mNT-IL2Ra-IL2. Figure 27D is a graph showing tumor growth in individual mice treated with huMUC16 CAR-T cells and mPD1-IL2Ra-IL2. [Figure 27-2] Same as above. [Figure 28] Figure 28 relates to Example 8 and is a graph showing the percentage change in body weight over time in mice administered the indicated cells and molecules. [Figure 29A] Figures 29A and 29B relate to Example 8. Figure 29A is a set of graphs showing the concentrations of the indicated cytokines in mice administered with the indicated cells and molecules. [Figure 29B]Figures 29A and 29B relate to Example 8. Figure 29B is a set of graphs showing the concentrations of the indicated cytokines in mice administered with the indicated molecules. [Modes for carrying out the invention]

[0024] This disclosure is not limited to the specific methods and experimental conditions described herein, and it should be understood that the methods and conditions may vary. It should also be understood that the terminology used herein is intended to describe only specific embodiments and is not intended to limit them, and that the scope of this disclosure is limited only by the appended claims.

[0025] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art to which this disclosure belongs. Any methods and materials similar to or equivalent to those described herein may be used in the implementation or testing of this disclosure, but preferred methods and materials are described herein. All publications described herein are incorporated herein by reference in their entirety unless otherwise stated.

[0026] Where used herein, the singular forms “a,” “an,” and “the” include multiple references unless otherwise explicitly indicated in the text; and the terms “and / or” or “ / ” mean any one of the items to which the term is joined, any combination of items, or all items.

[0027] As used herein, the terms “approximately” or “about” applied to one or more values ​​of interest refer to values ​​similar to the reference value described. In some embodiments, unless otherwise stated or otherwise evident from the context, the terms “approximately” or “about” refer to a range of values ​​that are within or less than 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% (greater than or less than) the reference value described (except where such numbers exceed 100% of the possible value).

[0028] Methods for treating or inhibiting tumor growth This disclosure includes a method for treating or inhibiting tumor growth by administering a combination therapy comprising a therapeutically effective dose of targeted immunocytokine and a therapeutically effective dose of a TAAxCD3 bispecific antibody to a subject in need thereof. This disclosure also includes a method for enhancing the efficacy of targeted immunocytokine by administering a combination therapy comprising a therapeutically effective dose of targeted immunocytokine and a therapeutically effective dose of a TAAxCD3 bispecific antibody to a subject with cancer.

[0029] The targeted immunocytokines of this disclosure comprise a fusion protein containing an antigen-binding moiety that specifically binds to an immune checkpoint (e.g., human PD1) that targets tumor-reactive T cells. The antigen-binding moiety helps to selectively reconstitute activity against tumor-reactive T cells. Without this targeting moiety, non-targeted (NT) immunocytokines would have reduced efficacy in specifically activating tumor-reactive T cells and could induce undesirable on-target, off-tumor effects. In some embodiments, the targeted immunocytokines of this disclosure further comprise a cytokine moiety containing a cytokine (e.g., IL2) bound to a receptor subunit of the cytokine (e.g., IL2Ra) or a fragment of the receptor subunit. However, the targeted immunocytokines retain the ability to engage with endogenous receptors (e.g., high-affinity heterotrimeric IL2Ra / b / g receptor) required for antitumor efficacy. In some embodiments, the targeted immunocytokines of this disclosure form homodimers via their respective heavy chain constant regions, enabling the binding of one subunit of the cytokine to the receptor of the other subunit, known as trans-sequence conformation. This maintains engagement with activated CD8+ T cells; however, the conjugated arrangement of the cytokine moiety helps mask the cytokine, attenuating its activity and thus contributing to a reduction in systemic toxicity. By specifically activating tumor-reactive T cells, the targeted immunocytokines of this disclosure promote effective immune regulation of tumor growth.

[0030] As used herein, the terms “to treat,” “to treat,” or similar means to reduce or lessen the severity of at least one symptom or sign; to temporarily or permanently eliminate the cause of a symptom; to delay or inhibit tumor growth; to reduce the amount of tumor cells or tissue; to promote tumor regression; to cause tumor shrinkage, necrosis, and / or disappearance; to prevent tumor recurrence; to prevent or inhibit metastasis; to inhibit metastatic tumor growth; to eliminate the need for surgery; and / or to increase the survival of the subject. In many embodiments, the terms “tumor,” “lesion,” “tumor lesion,” “cancer,” and “malignant tumor” are used interchangeably and refer to one or more cancerous growths.

[0031] As used herein, the expression “subject in need” means a human or non-human mammal exhibiting one or more symptoms or signs of cancer, and / or having been diagnosed with cancer, and requiring treatment for it. In some embodiments, the terms “subject” and “patient” are used interchangeably. This expression also includes patients with primary, established, metastatic, or recurrent tumors (advanced malignancies). In certain embodiments, the expression “subject in need” includes subjects with tumors that are resistant to, unresponsive to, or not adequately controlled by, previous therapies (e.g., treatment with anticancer drugs).

[0032] In certain embodiments, the methods of this disclosure are used to treat subjects having solid tumors. As used herein, the term “solid tumor” refers to an abnormal mass of tissue that does not typically contain cysts or fluid areas. Solid tumors can be benign (not cancerous) or malignant (cancerous). For the purposes of this disclosure, the term “solid tumor” means malignant solid tumor. This term includes various types of solid tumors named according to the cell type that forms them, namely sarcomas, carcinomas and blastomas. In certain embodiments, the term “solid tumor” refers to cancers including, but not limited to, anal cancer, angiosarcoma, basal cell carcinoma, bladder cancer, osteosarcoma, brain tumor, breast cancer, cervical cancer, cholangiocarcinoma, chondrosarcoma, colon cancer, colorectal cancer, cutaneous squamous cell carcinoma, endometrial cancer, esophageal cancer, glioblastoma multiforme, head and neck squamous cell carcinoma, hepatocellular carcinoma, kidney cancer, liver cancer, lung cancer, Merkel cell carcinoma, melanoma, myeloma, non-small cell lung cancer, ovarian cancer, pancreatic cancer, prostate cancer, salivary gland cancer, skin cancer, soft tissue sarcoma, gastric cancer, testicular cancer, and uterine cancer. In some embodiments, the methods of this disclosure are used to treat subjects having tumors that express TAA.

[0033] In certain embodiments, the disclosed method comprises administering therapeutically effective doses of targeted immunocytokines and TAAxCD3 bispecific antibodies, respectively. Additional therapeutic agents or therapies may include one or more of the following: NSAIDs, corticosteroids, antibodies against antibodies against tumor-specific antigens, IDO inhibitors, Ang2 inhibitors, cancer vaccines, oncolytic viruses, EGFR inhibitors, TGF-beta inhibitors, antibodies against PD-L1, CTLA-4 inhibitors, LAG3 inhibitors, TIM3 inhibitors, nutritional supplements, VEGF antagonists, surgery, radiation, chemotherapeutic agents, and cytotoxic agents.

[0034] In some embodiments, the disclosed method results in an increase in the efficacy and duration of the antitumor response. Methods according to this aspect of the disclosure include selecting a subject having cancer and administering to the subject a therapeutically effective amount of targeted immunocytokine in combination with a therapeutically effective amount of a TAAxCD3 bispecific antibody. In some embodiments, the disclosed method provides an increase in tumor inhibition and / or duration of the antitumor response, for example, by about 20%, greater than 20%, greater than 30%, greater than 40%, greater than 50%, greater than 60%, greater than 70%, or greater than 80%, compared to an untreated subject or a subject treated with the targeted immunocytokine or TAAxCD3 bispecific antibody as monotherapy. In some embodiments, the disclosed method increases the duration of response in a subject by, for example, more than 2%, more than 3%, more than 4%, more than 5%, more than 6%, more than 7%, more than 8%, more than 9%, more than 10%, more than 20%, more than 30%, more than 40%, or more than 50% compared to an untreated subject or a subject treated with a targeted immunocytokine or a TAAxCD3 bispecific antibody as monotherapy.

[0035] In some embodiments, administration of the disclosed combination therapies results in, respectively, (i) delay in tumor growth and development; (ii) increased disease-free survival (DFS) from treatment day to tumor recurrence or death; and (iii) an improved overall response rate (ORR), complete response (CR; complete disappearance of all evidence of tumor cells), partial response (PR; reduction of at least 30% of tumor cells or tumor size), increased overall survival (OS), or increased progression-free survival (PFS), compared to untreated subjects or subjects treated with targeted immunocytokines or TAAxCD3 bispecific antibodies as monotherapy. Tumor reduction can be measured by known methods, e.g., radiography, positron emission tomography (PET), computed tomography (CT), magnetic resonance imaging (MRI), cytology, histology, or molecular genetic analysis.

[0036] Targeted immunocytokines As used herein, “targeted immunocytokine” refers to a cytokine such as interleukin-2 (IL2) that has a portion linked to an immune checkpoint (i.e., “targets” an immune checkpoint). Non-limiting examples of checkpoint inhibitors include inhibitors of PD1, PD-L1, PD-L2, LAG-3, CTLA-4, TIM3, A2aR, B7H1, BTLA, CD160LAIR1, TIGHT, VISTA, or VTCN1. In some embodiments, the targeted immunocytokine comprises the immunoglobulin antigen-binding domain of the checkpoint inhibitor. In one preferred embodiment, the checkpoint inhibitor is an inhibitor of PD1 (e.g., an anti-PD1 antibody or its antigen-binding fragment).

[0037] In certain embodiments, the targeted immunocytokine is a fusion protein comprising (i) an antigen-binding domain of a checkpoint inhibitor and (ii) an IL2 moiety. In some embodiments, the antigen-binding domain specifically binds to human PD1. In some embodiments, the antigen-binding domain is an antibody or its antigen-binding fragment. In some embodiments, the targeted immunocytokine is an anti-PD1-IL2Ra-IL2 fusion protein.

[0038] As used herein, the term “fusion protein” means a protein comprising two or more polypeptide sequences that are covalently or non-covalently linked together. A fusion protein encompassed by this disclosure may include a translation product of a chimeric gene construct in which a nucleic acid sequence encoding a first polypeptide is linked with a nucleic acid sequence encoding a second polypeptide to form a single open reading frame. Alternatively, a fusion protein may be encoded by two or more gene constructs on separate vectors that can be co-expressed in a host cell. Generally, a “fusion protein” is a recombinant protein of two or more proteins linked by peptide bonds or by several peptides. In some embodiments, a fusion protein may also include a peptide linker between the two domains.

[0039] Fusion proteins disclosed herein may contain one or more conservative modifications. Fusion proteins having one or more conservative modifications may retain desirable functional properties, which can be tested using functional assays known in the art. The term “conservative sequence modification” refers to an amino acid modification that does not significantly affect or alter the binding properties of a protein containing an amino acid sequence. Such conservative modifications include amino acid substitutions, additions, and deletions. Modifications can be introduced by standard techniques known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis. A conservative amino acid substitution is one in which an amino acid residue is replaced by an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains are defined in the art. These families include amino acids having basic side chains (e.g., lysine, arginine, histidine); acidic side chains (e.g., aspartic acid, glutamic acid); non-charged side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan); nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine); beta-branched side chains (e.g., threonine, valine, isoleucine); and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine), and include one or more conserved modifications. Cas proteins having one or more conserved modifications may retain desirable functional properties, which can be tested using functional assays known in the art. As used herein, the term “conservative sequence modification” refers to an amino acid modification that does not significantly affect or alter the binding properties of a protein containing an amino acid sequence. Such conservative modifications include amino acid substitutions, additions, and deletions. Modifications can be introduced by standard techniques known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis. Conservative amino acid substitutions are those in which an amino acid residue is replaced by an amino acid residue having a similar side chain. Families of amino acid residues with similar side chains are defined in the art.These families include amino acids having basic side chains (e.g., lysine, arginine, histidine); acidic side chains (e.g., aspartic acid, glutamic acid); non-charged side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan); nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine); beta-branched side chains (e.g., threonine, valine, isoleucine); and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).

[0040] As used herein, “antibody” refers to an immunoglobulin molecule (i.e., a “total antibody molecule”) comprising four polypeptide chains, two heavy chains (H) and two light chains (L), interconnected by disulfide bonds, as well as its polymer (e.g., IgM) or its antigen-binding fragment. Each heavy chain comprises a heavy chain variable region (“HCVR” or “VH”) and a heavy chain constant region (containing domains CH1, CH2, and CH3). Each light chain comprises a light chain variable region (“LCVR” or “VL”) and a light chain constant region (CL). The VH and VL regions can be further divided into hypervariable regions called CDRs, which contain more conserved regions called framework regions (FRs). Each VH and VL consists of three CDRs and four FRs arranged from the amino terminus to the carboxyl terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. In some embodiments, the FR of the antibody (or its antigen-binding fragment) may be identical to that of the human germline sequence, or it may be naturally or artificially modified. The amino acid consensus sequence can be defined based on a parallel analysis of two or more CDRs. The term “antibody” also includes the antigen-binding fragment of the entire antibody molecule.

[0041] As used herein, “antigen” means any substance that causes the immune system to produce antibodies or a specific cell-mediated immune response to them. A disease-associated antigen is any substance associated with any disease that causes the immune system to produce antibodies or a specific cell-mediated immune response to them.

[0042] As used herein, an "antigen-binding fragment" or "antigen-binding moiety" of an antibody, etc., includes any naturally occurring, enzymatically obtained, synthetic, or genetically engineered polypeptide or glycoprotein that specifically binds to an antigen to form a complex. Antigen-binding fragments of antibodies can be derived from the whole antibody molecule using any suitable standard technique, such as proteolytic digestion or recombinant genetic engineering techniques, which include manipulation and expression of DNA encoding the antibody variable domain and optionally constant domain. Such DNA is known and / or readily available from, for example, commercial sources, DNA libraries (including, for example, phage antibody libraries), or can be synthesized. DNA can be sequenced and manipulated chemically or by using molecular biological techniques to, for example, position one or more variable and / or constant domains in a suitable configuration, or to introduce codons, create cysteine ​​residues, modify, add, or delete amino acids.

[0043] Non-limiting examples of antigen-binding fragments include (i) Fab fragments; (ii) F(ab')2 fragments; (iii) Fd fragments; (iv) Fv fragments; (v) single-chain Fv(scFv) molecules; (vi) dAb fragments; and (vii) the smallest recognition units consisting of amino acid residues that mimic the hypervariable region of an antibody (e.g., isolated CDRs such as the CDR3 peptide) or a constrained FR3-CDR3-FR4 peptide. Domain-specific antibodies, single-domain antibodies, domain deletion antibodies, chimeric antibodies, CDR-implanted antibodies, diabodies, triabodies, tetrabodies, minibodies, nanobodies (e.g., monovalent nanobodies, bivalent nanobodies, etc.), small modular immunotherapy drugs (SMIPs), and other manipulated molecules such as shark variable IgNAR domains are also included within the expression “antigen-binding fragment” as used herein.

[0044] In some embodiments, the antigen-binding domain of the fusion protein comprises three heavy chain CDRs (HCDR1, HCDR2, and HCDR3) and three light chain CDRs (LCDR1, LCDR2, and LCDR3), where HCDR1 comprises the amino acid sequence of SEQ ID NO: 2, 12, or 21; HCDR2 comprises the amino acid sequence of SEQ ID NO: 3, 13, or 22; HCDR3 comprises the amino acid sequence of SEQ ID NO: 4, 14, or 23; LCDR1 comprises the amino acid sequence of SEQ ID NO: 6 or 16; LCDR2 comprises the amino acid sequence of SEQ ID NO: 7; and LCDR3 comprises the amino acid sequence of SEQ ID NO: 8 or 17. In some embodiments, the antigen-binding domain of the fusion protein includes HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, and LCDR3, each containing the amino acid sequences of (i) SEQ ID NOs: 2, 3, 4, 6, 7, and 8; (ii) SEQ ID NOs: 12, 13, 14, 16, 7, and 17; or (iii) SEQ ID NOs: 21, 22, 23, 6, 7, and 8, respectively. In some embodiments, the antigen-binding domain of the fusion protein includes HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, and LCDR3, each containing the amino acid sequences of SEQ ID NOs: 21, 22, 23, 6, 7, and 8, respectively. In some embodiments, the antigen-binding domain of the fusion protein includes an HCVR / LCVR amino acid sequence pair selected from SEQ ID NOs: 1 / 5, 11 / 15, and 20 / 5. In one embodiment, the antigen-binding domain of the fusion protein includes the HCVR / LCVR amino acid sequence pair of SEQ ID NOs: 20 / 5.

[0045] In some embodiments, the antigen-binding domain of the fusion protein includes a heavy / light chain sequence pair containing the amino acid sequences of SEQ ID NOs: 9 / 10, 18 / 19, or 24 / 25. In some embodiments, the fusion protein includes a heavy / light chain sequence pair containing the amino acid sequences of SEQ ID NOs: 24 and 25.

[0046] In some embodiments, the IL2 moiety comprises (i) IL2 or a fragment thereof; and (ii) IL2 receptor alpha ("IL2Rα" or "IL2Ra") or a fragment thereof. In some embodiments, the IL2 moiety may optionally comprise a wild-type (e.g., human wild-type) or variant IL2 domain fused to the IL2-binding domain of IL2Ra via a linker. In some embodiments, the IL2-binding domain of the IL2Ra fragment is bound to an IL2 (wild-type or variant) domain or fragment thereof at its C-terminus via a linker. As used herein, “wild-type” form of IL2 is a form of IL2 that is otherwise identical to the mutant IL2 polypeptide, except that the wild-type has wild-type amino acids at each amino acid position of the mutant IL2 polypeptide. For example, if the IL2 mutant is full-length IL2 (i.e., IL2 not fused or conjugated to any other molecule), then the wild-type form of this mutant is full-length native IL2.

[0047] In some embodiments, IL2 or a fragment thereof includes the amino acid sequence of SEQ ID NO: 29. In some embodiments, the IL2 portion includes the amino acid sequence of SEQ ID NO: 27.

[0048] Targeted immunocytokines may include one or more linkers (e.g., peptide linkers or non-peptide linkers) that connect various components of the molecule. In some embodiments, two or more components of a targeted immunocytokine are linked to each other by a peptide linker. In non-limiting examples, linkers can be used to connect (a) the IL2 moiety and the antigen-binding domain of a checkpoint inhibitor; (b) different domains within the IL2 moiety (e.g., the IL2 domain and the IL2Ra domain); or (c) different domains within the antigen-binding moiety (e.g., different components of the anti-PD1 antigen-binding domain).

[0049] Examples of flexible linkers that can be used in the disclosed targeted immunocytokines include those disclosed in Chen et al., Adv Drug Deliv Rev., 65(10):1357-69 (2013) and Klein et al., Protein Engineering, Design & Selection, 27(10):325-30 (2014). Particularly useful flexible linkers are monomers or polymers of glycine and serine repeats, e.g., GnS or SGn (wherein n is an integer from 1 to 10, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10), or comprising the same. In some embodiments, the linker is a monomer or polymer of a repeating G4S (GGGGS; SEQ ID NO: 32), e.g., (GGGGS)n, or comprising the same.

[0050] In some embodiments, the IL2 portion and the antigen-binding portion are linked via a linker containing one or more repeating amino acid sequences of GGGGS (SEQ ID NO: 32). In some embodiments, the linker contains the amino acid sequence of SEQ ID NO: 30 or 31. In some embodiments, the IL2 portion is linked to the C-terminus of the antigen-binding portion via a peptide linker. In some embodiments, the linker contains the amino acid sequence of SEQ ID NO: 30.

[0051] The targeted immunocytokines of this disclosure exhibit reduced binding to IL2Ra, IL2Rb, and IL2Rg. In some embodiments, the targeted immunocytokines do not compete with REGN2810, pembrolizumab, or nivolumab. In some embodiments, the targeted immunocytokines exhibit decreased activity in the activation of human IL2Ra / b / g trimer and IL2Rb / g dimer receptor complexes compared to IL2, and increased activity in the activation of human IL2Ra / b / g trimer and IL2Rb / g dimer receptor complexes compared to untargeted IL2Ra-IL2 constructs. In some embodiments, the targeted immunocytokines exhibit increased activity in the stimulation of antigen-activated T cells, as measured by the level of IFN-γ release, compared to wild-type human IL2.

[0052] TAAxCD3 bispecific antibody and its antigen-binding fragment As used herein, "TAA" refers to tumor-associated antigens. Non-limited examples of TAAs include AFP, ALK, BAGE protein, BCMA, BIRC5 (Survivin), BIRC7, β-catenin, brc-abl, BRCA1, BORIS, CA9, carbonic anhydrase IX, caspase-8, CALR, CCR5, CD19, CD20 (MS4A1), CD22, CD30, CD40, CDK4, CEA, CTLA4, and cyclin-B1. CYP1B1, EGFR, EGFRvIII, ErbB2 / Her2, ErbB3, ErbB4, ETV6-AML, EpCAM, EphA2, Fra-1, FOLR1, GAGE ​​protein (e.g., GAGE-1, -2), GD2, GD3, GloboH, Glypican-3, GM3, gp100, Her2, HLA / B-raf, HLA / k-ras, HLA / MAGE-A3, hTERT, LMP2, MAGE proteins (e.g., MAGE-1, -2, -3, -4, -6, and -12), MART-1, mesothelin, ML-IAP, Muc1, Muc2, Muc3, Muc4, Muc5, Muc16 (CA-125), MUM1, NA17, NY-BR1, NY-BR62, NY-BR85, NY-ESO1, OX40, p15, p53, PAP, PAX3 These include PAX5, PCTA-1, PLAC1, PRLR, PRAME, PSMA(FOLH1), RAGE protein, Ras, RGS5, Rho, SART-1, SART-3, STEAP1, STEAP2, TAG-72, TGF-β, TMPRSS2, Thompson-nouvelle antigen (Tn), TRP-1, TRP-2, tyrosinase, and uroplakin-3.

[0053] As used herein, the term "MUC16" refers to mucin 16. MUC16 is an endogenous membrane glycoprotein with a highly glycosylated single-pass transmembrane domain, which is highly expressed, for example, in ovarian cancer. As used herein, "antibody that binds to MUC16" or "anti-MUC16 antibody" includes an antibody that specifically recognizes MUC16 and its antigen-binding fragment. As used herein, the term "MUC16" refers to the human MUC16 protein unless it is specified that it originates from a non-human species (e.g., "mouse MUC16," "monkey MUC16," etc.).

[0054] As used herein, the term "CD3" refers to the antigen expressed on T cells as part of the multimolecular T cell receptor (TCR), consisting of homodimers or heterodimers formed from the association of two of the four receptor chains: CD3-epsilon, CD3-delta, CD3-zeta, and CD3-gamma. All references to proteins, polypeptides, and protein fragments herein are intended to refer to the human versions of the respective proteins, polypeptides, or protein fragments unless expressly identified as originating from a non-human species. Thus, the term "CD3" means human CD3 unless specifically identified as originating from a non-human species, such as "mouse CD3," "monkey CD3," etc.

[0055] As used herein, “CD3-binding antibody” or “anti-CD3 antibody” includes an antibody and its antigen-binding fragment that specifically recognizes a single CD3 subunit (e.g., epsilon, delta, gamma, or zeta), as well as an antibody and its antigen-binding fragment that specifically recognizes a dimeric complex of two CD3 subunits (e.g., gamma / epsilon, delta / epsilon, and zeta / zeta CD3 dimer). The antibodies and their antigen-binding fragments of this disclosure can bind to soluble CD3 and / or CD3 expressed on the cell surface. Soluble CD3 includes native CD3 proteins and recombinant CD3 protein variants, such as monomeric and dimeric CD3 constructs that lack a transmembrane domain or are otherwise not bound to the cell membrane.

[0056] The antibodies of this disclosure can function via complement-dependent cell-mediated cytotoxicity (CDC) or antibody-dependent cell-mediated cytotoxicity (ADCC). "Complement-dependent cell-mediated cytotoxicity" (CDC) refers to the lysis of antigen-expressing cells by the antibodies of this disclosure in the presence of complement. "Antibody-dependent cell-mediated cytotoxicity" (ADCC) refers to a cell-mediated response in which nonspecific cytotoxic cells expressing the Fc receptor (FcR) (e.g., natural killer (NK) cells, neutrophils, and macrophages) recognize a bound antibody on target cells, thereby resulting in the lysis of the target cells. CDC and ADCC can be measured using assays well known and available in the industry (e.g., U.S. Patents 5,500,362 and 5,821,337; see Clynes et al., 1998, Proc. Natl. Acad. Sci. (USA) 95: pp. 652-656). The constant region of the antibody is important for its ability to fix complement and mediate cell-dependent cytotoxicity. Thus, antibody isotypes can be selected based on whether mediating cytotoxicity is desirable for the antibody.

[0057] In certain embodiments, the TAAxCD3 bispecific antibody of this disclosure is a human antibody. As used herein, the term “human antibody” is intended to include antibodies having variable and constant regions derived from human germline immunoglobulin sequences. The human antibodies of this disclosure may, for example, contain amino acid residues in the CDR, particularly CDR3, that are not encoded by the human germline immunoglobulin sequence (e.g., mutations introduced by random or site-directed mutagenesis in vitro or somatic mutation in vivo). However, as used herein, the term “human antibody” is not intended to include antibodies in which a CDR sequence derived from the germline of another mammalian species, such as mouse, has been transplanted onto a human framework sequence.

[0058] The antibodies used in the methods disclosed herein may be recombinant human antibodies. As used herein, the term “recombinant human antibody” includes all human antibodies produced, expressed, produced or isolated by recombinant means, such as antibodies expressed using a recombinant expression vector transfected into host cells (as further described below), antibodies isolated from a recombinant combinatorial human antibody library (as further described below), antibodies isolated from an animal transgenic for the human immunoglobulin gene (e.g., mouse) (see, e.g., Taylor et al. (1992) Nucl. Acids Res. 20: pp. 6287-6295), or antibodies produced, expressed, produced or isolated by any other means, including splicing of the human immunoglobulin gene sequence into another DNA sequence. Such recombinant human antibodies have variable and constant regions derived from the human germline immunoglobulin sequence. In certain embodiments, however, such recombinant human antibodies are subjected to in vitro mutagenesis (or, if an animal transgenic for the human Ig sequence is used, in vivo somatic mutagenesis), and thus the recombinant antibody V H and V L The amino acid sequence of the region is human germline V H and VL This sequence is derived from and related to other sequences, but may not naturally exist within the human antibody germline repertoire in vivo.

[0059] The antibodies of this disclosure may be bispecific or multispecific. Multispecific antibodies may be specific to different epitopes of one target polypeptide, or may contain antigen-binding domains specific to more than one target polypeptide. See, for example, Tutt et al., 1991, J.Immunol. 147: pp. 60-69; Kufer et al., 2004, Trends Biotechnol. 22: pp. 238-244. The anti-TAA / anti-CD3 bispecific antibodies of this disclosure may be ligated to or co-expressed with another functional molecule, such as another peptide or protein. For example, an antibody or fragment may be functionally ligated to one or more other molecular entities, such as another antibody or antibody fragment, to produce a bispecific or multispecific antibody with a second or additional binding specificity (e.g., by chemical coupling, gene fusion, non-covalent association or otherwise).

[0060] According to certain exemplary embodiments, the Disclosure includes bispecific antigen-binding molecules that specifically bind to CD3 and TAA. Such molecules may be referred to herein, for example, as “anti-CD3 / anti-TAA” or “anti-CD3xTAA” or “CD3xTAA” bispecific molecules, or other similar terms (e.g., TAAxCD3). The Disclosure provides bispecific antigen-binding molecules constructed using a first antigen-binding arm that binds to TAA and a second antigen-binding arm that binds to CD3. In some embodiments, the anti-CD3 arm is IGHV3-9 * 01, IGHJ6 * 02, IGHD5-12 * Contains a heavy chain derived from 01.

[0061] As used herein, the expression “bispecific antigen-binding molecule” means a protein, polypeptide, or molecular complex comprising at least a first antigen-binding domain and a second antigen-binding domain. Each antigen-binding domain within a bispecific antigen-binding molecule contains at least one CDR, either alone or together with one or more additional CDRs and / or framework regions (FRs), that specifically binds to a particular antigen. In the context of this disclosure, the first antigen-binding domain specifically binds to a first antigen (e.g., CD3), and the second antigen-binding domain specifically binds to a second, different antigen (e.g., TAA or MUC16).

[0062] In some embodiments, the bispecific antigen-binding molecule is a bispecific antibody. Each antigen-binding domain of a bispecific antibody includes a heavy chain variable domain (HCVR) and a light chain variable domain (LCVR). In the context of a bispecific antigen-binding molecule (e.g., a bispecific antibody) containing first and second antigen-binding domains, the CDR of the first antigen-binding domain may be designated with the prefix "A1", and the CDR of the second antigen-binding domain may be designated with the prefix "A2". Thus, the CDRs of the first antigen-binding domain may be referred to herein as A1-HCDR1, A1-HCDR2, and A1-HCDR3; the CDRs of the second antigen-binding domain may be referred to herein as A2-HCDR1, A2-HCDR2, and A2-HCDR3.

[0063] The first antigen-binding domain and the second antigen-binding domain can be directly or indirectly connected to each other to form the bispecific antigen-binding molecule of the present disclosure. Alternatively, the first antigen-binding domain and the second antigen-binding domain can each be connected to separate multimerization domains. Association of one multimerization domain with another multimerization domain facilitates the association between the two antigen-binding domains, thereby forming the bispecific antigen-binding molecule. As used herein, a "multimerization domain" is any macromolecule, protein, polypeptide, peptide, or amino acid that has the ability to associate with a second multimerization domain of the same or similar structure or configuration. For example, the multimerization domain is an immunoglobulin C H It may be a polypeptide comprising 3 domains. Non-limiting examples of multimerization components include the Fc portion of an immunoglobulin (C H 2-C H comprising 3 domains), for example, the Fc domain of IgG selected from isotypes IgG1, IgG2, IgG3, and IgG4, as well as any allotype within each respective isotype group.

[0064] The term "specifically binds" or the like means that an antibody or antigen-binding fragment thereof forms a complex with an antigen that is relatively stable under physiological conditions. Methods for determining whether an antibody specifically binds to an antigen are well known in the art, and include, for example, equilibrium dialysis, surface plasmon resonance, and the like.

[0065] This disclosure includes antigen-binding molecules having amino acid sequences that differ from those of the exemplary molecules disclosed herein but retain the ability to bind to CD3 and / or TAA. Such variant molecules may include the addition, deletion, or substitution of one or more amino acids compared to the parent sequence, but may exhibit essentially the same biological activity as those of the described bispecific antigen-binding molecules. This disclosure includes antigen-binding molecules that are bioequivalent to any of the exemplary antigen-binding molecules described herein. As used herein, the term “bioequivalent” refers to a TAAxCD3 bispecific antibody or fragment thereof that is a pharmaceutically equivalent or pharmaceutically substitute whose rate and / or degree of absorption does not differ significantly from that of the reference antibody when administered in single or multiple doses at the same molar dose under similar experimental conditions. In the context of this disclosure, the term “bioequivalent” includes antigen-binding proteins that bind to TAA and CD3 and have no clinically significant differences from the reference antibody in terms of safety, purity, and / or potency.

[0066] According to one particular embodiment, a bispecific antibody can be constructed using a heavy chain derived from an anti-CD3 antibody, a heavy chain derived from an anti-TAA antibody, and a common light chain derived from an anti-TAA antibody. In other examples, a bispecific antibody can be constructed using a heavy chain derived from an anti-CD3 antibody, a heavy chain derived from an anti-TAA antibody, and a light chain derived from an anti-CD3 antibody, or an antibody light chain that is promiscuous or known to efficiently pair with various heavy chain arms. A bispecific antibody having an IgG1 Fc domain or a modified (chimeric) IgG4 Fc domain as described in US9359437 can be produced.

[0067] According to a particular embodiment, the TAAxCD3 bispecific antibody is MUC16xCD3, comprising a first binding arm that binds to human CD3 and includes a heavy chain containing the amino acid sequence of SEQ ID NO: 33 and a light chain containing the amino acid sequence of SEQ ID NO: 38; and a second binding arm that binds to human MUC16 and includes a heavy chain containing the amino acid sequence of SEQ ID NO: 43 and a light chain containing the amino acid sequence of SEQ ID NO: 38.

[0068] According to a particular embodiment, the MUC16xCD3 bispecific antibody includes a first binding arm that binds to human CD3 and includes three heavy chain complementarity-determining regions (HCDRs) of a heavy chain variable region (HCVR) containing the amino acid sequence of SEQ ID NO: 34 and three light chain complementarity-determining regions (LCDRs) of a light chain variable region (LCVR) containing the amino acid sequence of SEQ ID NO: 39. In a particular embodiment, the first binding arm of the MUC16xCD3 bispecific antibody comprises three HCDRs (A1-HCDR1, A1-HCDR2, and A1-HCDR3) and three LCDRs (LCDR1, LCDR2, and LCDR3), where A1-HCDR1 comprises the amino acid sequence of SEQ ID NO: 35; A1-HCDR2 comprises the amino acid sequence of SEQ ID NO: 36; A1-HCDR3 comprises the amino acid sequence of SEQ ID NO: 37; LCDR1 comprises the amino acid sequence of SEQ ID NO: 40; LCDR2 comprises the amino acid sequence of SEQ ID NO: 41; and LCDR3 comprises the amino acid sequence of SEQ ID NO: 42. In a particular embodiment, the first binding arm of the MUC16xCD3 bispecific antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 33 and a light chain comprising the amino acid sequence of SEQ ID NO: 38.

[0069] According to a particular embodiment, the MUC16xCD3 bispecific antibody includes a second binding arm that binds to human MUC16 and includes three heavy chain complementarity-determining regions (HCDRs) of a heavy chain variable region (HCVR) containing the amino acid sequence of SEQ ID NO: 44 and three light chain complementarity-determining regions (LCDRs) of a light chain variable region (LCVR) containing the amino acid sequence of SEQ ID NO: 39. In a particular embodiment, the second binding arm of the MUC16xCD3 bispecific antibody comprises three HCDRs (A1-HCDR1, A2-HCDR2, and A3-HCDR3) and three LCDRs (LCDR1, LCDR2, and LCDR3), where A1-HCDR1 comprises the amino acid sequence of SEQ ID NO: 45; A2-HCDR2 comprises the amino acid sequence of SEQ ID NO: 46; A3-HCDR3 comprises the amino acid sequence of SEQ ID NO: 47; LCDR1 comprises the amino acid sequence of SEQ ID NO: 40; LCDR2 comprises the amino acid sequence of SEQ ID NO: 41; and LCDR3 comprises the amino acid sequence of SEQ ID NO: 42. In a particular embodiment, the second binding arm of the MUC16xCD3 bispecific antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 43 and a light chain comprising the amino acid sequence of SEQ ID NO: 38.

[0070] An exemplary MUC16xCD3 bispecific antibody for use in the disclosed method is BSMUC16 / CD3-001. See WO2018067331.

[0071] Combination therapy Generally, the methods of this disclosure involve administering a therapeutically effective amount of targeted immunocytokine in combination with a therapeutically effective amount of TAAxCD3 bispecific antibody. As used herein, the expression "in combination with" means that the targeted immunocytokine is administered before, after, or concurrently with the TAAxCD3 bispecific antibody. This expression includes sequential or simultaneous administration of the targeted immunocytokine and the TAAxCD3 bispecific antibody.

[0072] In some embodiments, the disclosed combination therapy treats or inhibits tumor growth in a subject. In some embodiments, administration of the disclosed TAAxCD3 bispecific antibody enhances the efficacy of targeted immunocytokines. In some embodiments, administration of targeted immunocytokines and TAAxCD3 bispecific antibody in combination with an additional therapeutic agent or therapy results in improved antitumor efficacy, reduced side effects of one or both of the first-line therapies, and / or reduced doses of one or both of the first-line therapies.

[0073] In some embodiments, the disclosed method further includes the administration of an additional therapeutic agent or therapy. Non-limiting examples of additional therapeutic agents or therapies include one or more of the following: NSAIDs, corticosteroids, antibodies against tumor-specific antigens, IDO inhibitors, Ang2 inhibitors, cancer vaccines, oncolytic viruses, EGFR inhibitors, TGF-beta inhibitors, PD1 inhibitors (e.g., anti-PD-1 antibodies), CTLA-4 inhibitors, LAG3 inhibitors, TIM3 inhibitors, nutritional supplements, VEGF antagonists, surgery, radiation, chemotherapeutic agents, and cytotoxic agents.

[0074] This disclosure also provides kits for therapeutic use as described herein, comprising a disclosed targeted immunocytokine (e.g., a fusion protein comprising the immunoglobulin antigen-binding domain and IL-2 moiety of a checkpoint inhibitor) and a TAAxCD3 bispecific antibody. The kits typically include a label and instructions for use that indicate the intended use of the kit contents. As used herein, the term “label” includes any written or recorded material on, in, or supplied with the kit, or otherwise provided with the kit. In some embodiments, this disclosure provides a kit for treating a cancer-affected subject, comprising (a) a therapeutically effective dose of a disclosed targeted immunocytokine; a therapeutically effective dose of a disclosed TAAxCD3 bispecific antibody; and (b) instructions for use of a combination of doses in any of the methods disclosed herein.

[0075] Administration regimen This disclosure includes a method for administering a combination of targeted immunocytokines and a TAAxCD3 bispecific antibody to a subject with cancer at a dosage frequency that achieves a therapeutic response. In some embodiments, the targeted immunocytokines and / or the TAAxCD3 bispecific antibody are administered to the subject in one or more doses, administered approximately four times a week, twice a week, once a week, once every two weeks, once every three weeks, once every four weeks, once every five weeks, once every six weeks, once every eight weeks, once every twelve weeks, or less frequently as long as a therapeutic response is achieved.

[0076] In some embodiments, when the targeted immunocytokine is administered "before" the TAAxCD3 bispecific antibody, the targeted immunocytokine may be administered for longer than 12 weeks before the administration of the TAAxCD3 bispecific antibody, approximately 12 weeks, approximately 11 weeks, approximately 10 weeks, approximately 9 weeks, approximately 8 weeks, approximately 7 weeks, approximately 6 weeks, approximately 5 weeks, approximately 4 weeks, approximately 3 weeks, approximately 2 weeks, approximately 1 week, approximately 150 hours, approximately 100 hours, approximately 72 hours, approximately 60 hours, approximately 48 hours, approximately 36 hours, approximately 24 hours, approximately 12 hours, approximately 10 hours, approximately 8 hours, approximately 6 hours, approximately 4 hours, approximately 2 hours, approximately 1 hour, or approximately 30 minutes before the administration of the TAAxCD3 bispecific antibody.

[0077] In some embodiments, when the targeted immunocytokine is administered "after" the TAAxCD3 bispecific antibody, the targeted immunocytokine may be administered approximately 30 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 8 hours, 10 hours, 12 hours, 24 hours, 36 hours, 48 ​​hours, 60 hours, 72 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 5 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, or longer than 12 weeks after the administration of the TAAxCD3 bispecific antibody.

[0078] As used herein, “simultaneous” administration means that the targeted immunocytokine and the TAAxCD3 bispecific antibody are administered to the subject in a single dosage form (e.g., co-formulated) or in separate dosage forms, within approximately 15 minutes or less, or within approximately 30 minutes or less from each other (i.e., before, after, or simultaneously). If administered in separate dosage forms, each dosage form may be administered via the same route (e.g., both intravenously, subcutaneously, etc.); or each dosage form may be administered via different routes. For the purposes of this disclosure, any administration of components in a single dosage form, in different dosage forms via the same route, or in different dosage forms via different routes in any given event is considered “simultaneous” administration.

[0079] As used herein, “sequential” dosing means that each dose of the selected therapy is administered to the subject at different times, for example, on different days separated by a predetermined interval (e.g., hours, days, weeks, or months). For illustrative purposes, sequential dosing may include administering an initial dose of the targeted immunocytokine (or TAAxCD3 bispecific antibody), then one or more second doses of the TAAxCD3 bispecific antibody (or targeted immunocytokine), and optionally, then one or more third doses of the targeted immunocytokine (or TAAxCD3 bispecific antibody). For illustrative purposes, sequential dosing may include administering an initial dose of the targeted immunocytokine (or TAAxCD3 bispecific antibody), then one or more second doses of the TAAxCD3 bispecific antibody (or targeted immunocytokine), and optionally, then one or more third doses of the TAAxCD3 bispecific antibody (or targeted immunocytokine) to the subject.

[0080] Dosage With respect to pharmaceutical compositions, the disclosed targeted immunocytokine or TAAxCD3 bispecific antibody can each be formulated with one or more carriers, excipients, and / or diluents. Pharmaceutical compositions containing the targeted immunocytokine and / or TAAxCD3 bispecific antibody can be formulated for specific uses, such as for veterinary use or for pharmaceutical use in humans. The form of the composition (e.g., dry powder, liquid formulation, etc.) and the excipients, diluents, and / or carriers used depend on the intended therapeutic use and desired mode of administration of the targeted immunocytokine or TAAxCD3 bispecific antibody.

[0081] The pharmaceutical compositions of this disclosure may contain either or both a targeted immunocytokine and / or a TAAxCD3 bispecific antibody. Such pharmaceutical compositions can be administered to a subject by various routes, such as orally, transdermally, subcutaneously, intranasally, intravenously, intramuscularly, intratumorally, intrathecally, topically, or locally. In some embodiments, the pharmaceutical composition is administered to the subject intravenously or subcutaneously. The pharmaceutical compositions can be conveniently provided in unit dosage forms containing a predetermined amount of the disclosed targeted immunocytokine and / or TAAxCD3 bispecific antibody per dose.

[0082] Generally, the amount of targeted immunocytokine and / or TAAxCD3 bispecific antibody administered to a subject according to the method of this disclosure is a therapeutically effective dose. As used herein, “therapeutically effective dose” means the amount of targeted immunocytokine combined with TAAxCD3 bispecific antibody that results in one or more of the following compared to an untreated subject or a subject treated with the targeted immunocytokine as monotherapy: (a) reduction in the severity or duration of cancer symptoms; (b) enhanced inhibition of tumor growth, or increased tumor necrosis, tumor shrinkage and / or tumor disappearance; (c) delay in tumor growth and development; (d) inhibition, delay or termination of tumor metastasis; (e) prevention of recurrence of tumor growth; (f) increased survival of a subject with cancer; and (g) reduction in the use or need for conventional anticancer therapy (e.g., reduction or elimination of the use of chemotherapeutic agents or cytotoxic agents).

[0083] In some embodiments, the therapeutically effective dose of targeted immunocytokines may be about 0.05 mg to about 600 mg, or about 0.005 mg to about 10 mg per kg of body weight of the subject. In some embodiments, the therapeutically effective dose of TAAxCD3 bispecific antibody may be about 0.05 mg to about 800 mg, or about 0.01 mg to about 20 mg per kg of body weight of the subject. [Examples]

[0084] The following examples are provided to give a complete disclosure and explanation of the methods and compositions of this disclosure to those skilled in the art, and are not intended to limit the scope of what the inventors consider to be their invention. Similarly, this disclosure is not limited to any particular preferred embodiments described herein. Indeed, modifications and variations of embodiments can be made without departing from the spirit and scope thereof, as will be apparent to those skilled in the art by reading this specification. Although efforts have been made to ensure accuracy with respect to the numbers used (e.g., quantity, temperature, etc.), some experimental errors and deviations should be noted. Unless otherwise indicated, parts are parts by weight, molecular weight is the average molecular weight, temperature is Celsius, room temperature is approximately 25°C, and pressure is atmospheric pressure or near it. [Examples]

[0085] Generation of anti-PD1-IL2Ra-IL2 fusion protein Three anti-PD1-IL2Ra-IL2 fusion proteins were generated in host cells by expressing a first polynucleotide sequence encoding the heavy chain of the anti-PD1 antibody ligated to the N-terminus of the IL2 moiety and a second polynucleotide sequence encoding the light chain of the anti-PD1 antibody. The IL2 moiety contains IL2 ligated to the C-terminus of IL2Ra. The first and second polynucleotide sequences can be supported on the same or different expression vectors. See US20220402989. Table 1 lists the amino acid sequence identifiers of the three anti-PD1-IL2Ra-IL2 fusion proteins. See WO2022266598.

[0086] [Table 1]

[0087] The IL2 moiety (SEQ ID NO: 27) contains IL2 (SEQ ID NO: 29) linked to the C-terminus of IL2Ra (SEQ ID NO: 28). The IL2 moiety (SEQ ID NO: 27) is linked to the C-terminus of the heavy chain constant region (SEQ ID NO: 26) of the anti-PD1 antibody via a linker containing the amino acid sequence of SEQ ID NO: 30.

[0088] Regarding REGN10595, the heavy chain (HC) (SEQ ID NO: 9) contains the amino acid sequences of HCVR (SEQ ID NO: 1) and the heavy chain constant region (SEQ ID NO: 26); it is linked to the IL2 moiety (SEQ ID NO: 27) via a linker (SEQ ID NO: 30).

[0089] Regarding REGN10486, the heavy chain (HC) (SEQ ID NO: 18) contains the amino acid sequences of HCVR (SEQ ID NO: 11) and the heavy chain constant region (SEQ ID NO: 26), and is linked to the IL2 moiety (SEQ ID NO: 27) via a linker (SEQ ID NO: 30).

[0090] Regarding REGN10597, the heavy chain (HC) (SEQ ID NO: 24) contains the amino acid sequences of HCVR (SEQ ID NO: 20) and the heavy chain constant region (SEQ ID NO: 26), and is linked to the IL2 moiety (SEQ ID NO: 27) via a linker (SEQ ID NO: 30).

[0091] Table 2 lists the amino acid sequences of three anti-PD1-IL2Ra-IL2 fusion proteins.

[0092] [Table 2-1] [Table 2-2] [Table 2-3] [Examples]

[0093] IL-2 immunocytokines that engage IL-2Ra, target PD1, and are receptor-masked enhance T cell-mediated antitumor therapy. This embodiment relates to a receptor-masked IL-2 immunocytokine that targets PD1 and engages with IL-2Ra. Interleukin-2 (IL-2 or IL2), a key cytokine for T cell proliferation, differentiation, and effector function, has been used to treat metastatic melanoma and renal cell carcinoma, inducing complete, permanent tumor regression in some patients. However, its widespread use in cancer immunotherapy has been limited by severe toxicity. A new generation of IL-2 therapies with reduced binding to the IL-2 receptor alpha chain (IL-2Ra) to mitigate toxicity and Treg expansion have achieved only limited clinical success.

[0094] Here, the ability to engage with IL-2Ra has been shown to be crucial for the antitumor activity of systemic IL-2 therapy. Despite inducing robust expansion of CD8+ T cells and NK cells more effectively than circulating Tregs, IL-2 mutant proteins with deactivated IL-2Ra binding exhibit limited antitumor efficacy compared to wild-type IL-2. Based on these findings, a PD1-targeting receptor-masked IL-2 immunocytokine was developed that exhibits attenuated systemic IL-2 activity but maintains the ability to engage with IL-2Ra on PD1+ T cells. PD1-IL2Ra-IL2 (REGN10597) exhibits PD1-targeting-dependent IL-2 activity in vitro and drives selective expansion of tumor-infiltrating PD1+CD8+ T cells with an active effector profile in vivo. Mice treated with PD1-IL2Ra-IL2 showed no signs of systemic toxicity observed with unmasked IL-2 treatment and demonstrated robust tumor growth control and enhanced survival. Finally, it has been shown that PD1-IL2Ra-IL2 can be efficiently combined with another T cell-mediated immunotherapy, the MUC16xCD3 bispecific antibody, to enhance the antitumor response. In summary, these results provide unique insights into the functional mechanisms of IL-2-based therapeutics, highlighting the therapeutic potential of PD1-IL2Ra-IL2 as a novel targeted, masked receptor, and "alpha-maintained" IL-2 therapy for cancer treatment.

[0095] The clinical success of immune checkpoint inhibitors, as well as the clear potential of several new modalities such as cell therapies and bispecific T-cell engagers, has highlighted the potential of cancer immunotherapy and transformed cancer treatment (Bagchi (2021), Kawalekar (2016), van de Donk (2023)). T cells are the primary inducers of anticancer activity, primarily through antigen-directed cytotoxicity against tumor cells (Waldman (2020)). While checkpoint inhibitors have improved patient outcomes across several cancer types, the majority of patients still fail to achieve a permanent response. Removing these physiological brakes is insufficient in itself in patients where antitumor T-cell immunity is actively suppressed by other barriers, such as weak cytotoxic T-cell infiltration and function in the immunosuppressive tumor microenvironment (Bagchi (2021), Fridman (2012)).

[0096] Cytokines are secreted proteins that can activate and modulate immune responses by acting in autocrine and paracrine manners. Their immunomodulatory activity has provided a strong rationale for the search for cytokine-based therapeutics for cancer treatment (Waldmann (2018)). IL-2 is a central T cell cytokine that promotes T cell proliferation, differentiation, and effector function. It can signal via two types of receptor complexes formed from three subunits: IL-2Rα (IL-2a, CD25), IL-2Rβ (IL2Rb, CD122), and IL-2Rγ (IL-2Rb, CD132). The heterodimeric IL-2Rβ / γ (IL-2Rb / g) receptor binds to IL-2 with intermediate affinity and is mostly expressed on resting CD8+ T cells and NK cells; the heterotrimeric IL-2Rα / β / γ (IL-2Ra / b / g) receptor binds to IL-2 with high affinity and is mainly expressed on Treg and activated T cells (Spolski (2018)). Recombinant IL-2 (aldesleukin) is approved for the treatment of advanced melanoma and renal cell carcinoma and has induced complete, permanent tumor regression in some patients (Rosenberg (2014)). However, serious systemic toxicity associated with high-dose IL-2 therapy has limited its practical use (Dutcher (2014), Vial (1992)). To reduce the toxicity associated with high-dose IL-2 treatment and limit Treg expansion, a new generation of IL-2 therapies with activity biased towards the IL-2Rb / g dimer receptor have been developed, which have reduced binding to IL-2Ra and thus improve stimulation of CD8+ T and NK cells (Charych (2016), Klein (2017), Lopes (2020), Ptacin (2021)). In clinical settings, IL-2 requires high doses and high frequency administration to overcome its short in vivo half-life and efficiently activate effector T cells. While some of these molecules are thought to yield improved safety profiles in clinical trials, limited monotherapy efficacy has been reported from these studies (Bentebibel (2019), Janku (2021)).

[0097] Given the multifaceted functions of IL-2 and the broad expression of its receptor on various cell types, attempts have been made to selectively deliver IL-2 to the tumor microenvironment by fusing IL-2 with antibodies targeting tumor-associated antigens or tumor stroma. However, such strategies have been less efficient than expected in localizing IL-2 activity to tumor tissue (Tzeng (2015), van Brummelen (2018), Waldhauer (2021)). An alternative approach to improve the efficacy of IL-2 and avoid systemic toxicity is to induce specific IL-2 signaling to tumor-reactive T cells. One cell surface marker for such tumor-reactive T cells is co-inhibitory receptor programmed cell death protein-1 (PD1) (Gros (2014), Gros (2016)). PD1 is expressed on the surface of antigen-activated T cells, and antibodies that bind to PD1 enable targeted delivery of IL-2. In this regard, IL-2 mutant protein molecules attenuated by IL-2Ra, targeting PD1, have recently been developed to preferentially provide IL-2R agonism to PD1+ tumor-reactive T cells (Codarri Deak (2022), Ren (2022)).

[0098] Here, IL-2Ra engagement has been shown to be crucial for the antitumor activity of systemic IL-2 therapy. Despite being more efficient than Treg in expanding circulating CD8+ T cells and NK cells, IL-2 mutant proteins with deactivated IL-2Ra exhibited reduced antitumor efficacy compared to wild-type IL-2. A receptor-masked IL-2 immunocytokine targeting PD1, called PD1-IL2Ra-IL2 (REGN10597), was further developed. Receptor masking results in attenuation of IL-2 activity for both IL-2Ra / b / g trimer and IL-2Rb / g dimer receptors, but PD1 targeting selectively reconstitutes IL-2Ra / b / g agonism against PD1+ tumor-reactive T cells, as demonstrated by the constitutive PD1-targeting-dependent IL-2 activity in vitro, which induced selective expansion of tumor-infiltrating PD1+CD8 T cells with a highly functional effector profile in vivo. Treatment with PD1-IL2Ra-IL2 results in robust tumor growth inhibition and enhanced survival in mice. Finally, it was shown that PD1-IL2Ra-IL2 can be efficiently combined with another T cell-mediated immunotherapy, the MUC16xCD3 bispecific T cell engager, to enhance the antitumor response. In summary, these results elucidate the functional mechanisms of IL-2-based therapeutics, highlight the therapeutic potential of PD1-IL2Ra-IL2, and provide information for its clinical development as a monotherapy and in combination with other immunotherapies for the treatment of cancer.

[0099] Requirements for the engagement of IL-2Ra to the antitumor activity of systemic IL-2: CD8 cells expressing IL-2Rb / g reduce systemic IL-2 toxicity more effectively than endothelial cells and Treg cells expressing IL-2Ra / b / g. +Most IL-2-based cancer therapies currently evaluated in clinical trials utilize IL-2Rb / g biased IL-2 strategies to selectively expand T cells and NK cells (Raeber (2022)). However, the requirement of IL-2Ra for induction of antitumor activity in these approaches has not yet been identified. To understand the requirements for IL-2Ra engagement in IL-2-mediated antitumor activity, we compared the in vitro and in vivo activity of wild-type (wt) IL-2 and IL-2Rb / g biased IL-2 variants (IL2v) carrying three mutations that specifically inactivate binding to IL-2Ra (Klein (2017)). Both molecules were generated in Fc fusion form to extend their half-lives. Human PBMCs were stimulated with titrators of IL2wt-Fc or IL2v-Fc for 20 min. As expected, when comparing IL2wt-Fc and IL2v-Fc in their ability to induce IL-2R signaling on primary human lymphocytes, IL2v-Fc showed reduced efficacy in inducing STAT5 phosphorylation, specifically in IL-2Ra + It is only Treg, IL-2Ra - CD8 + This was not observed on T cells or NK cells (Figure 1A-1D). Consistently, administration of IL2wt-Fc was observed in the spleen of mice, affecting CD8 + While IL2v-Fc treatment induced preferential expansion of Treg cells rather than T cells, IL2v-Fc treatment induced preferential expansion of CD8 cells rather than Treg cells. + This resulted in robust systemic expansion of T cells and NK cells. The data are representative of three independent experiments.

[0100] The antitumor efficacy of IL2wt-Fc and IL2v-Fc was compared in a syngeneic MC38 colon cancer model, both as single agents and in combination with anti-PD1 blockade (Figures 2A-2C). Subcutaneously established MC38 tumors (100 mm) 3C57BL / 6 mice carrying IL2wt-Fc (0.75 mg / kg), IL2v-Fc (0.75 mg / kg), anti-mPD1 (10 mg / kg), IL2wt-Fc (0.75 mg / kg) + anti-mPD1 (10 mg / kg), or IL2v-Fc (0.75 mg / kg) + anti-mPD1 (10 mg / kg) were treated intraperitoneally on the indicated day, and growth was measured. Statistical significance (mean + SEM) regarding mean tumor growth was determined by two-way ANOVA and Bonferroni's multiple comparison test. **** P ≤ 0.0001). Statistical significance in the survival curve was determined by Kaplan-Meier analysis using the log-rank test. ** P ≤ 0.01, *** P ≤ 0.001, **** (P ≤ 0.0001). The data are representative of three independent experiments.

[0101] Surprisingly, IL2v-Fc showed minimal effect on tumor growth and mouse survival, while IL2wt-Fc resulted in significant suppression of tumor growth and prolonged survival. Combination with anti-PD1 blockade further enhanced the efficacy of IL2wt-Fc, achieving complete tumor regression in more mice, but the improvement in the antitumor activity of IL2v-Fc was slight (Figure 2B-2C). The observation that IL2v-Fc induced robust expansion of splenic CD8+ T cells and NK cells, but had limited antitumor efficacy, suggests that IL2v-Fc systemically expanded CD8+ cells. + This had shown that T cells may be largely unrelated to anti-tumor immunity. To test whether the same immune profile is induced at tumor sites, mice carrying MC38 tumors were treated with IL2wt-Fc versus IL2v-Fc, and tumor-infiltrating lymphocytes were analyzed by flow cytometry. In stark contrast to what was observed in the spleen and blood from the same mice, IL2wt-Fc treatment, rather than IL2v-Fc treatment, induced CD8 in the tumors. +It resulted in robust T cell expansion. Neither IL2wt-Fc nor IL2v-Fc expanded Tregs in the tumor, but IL2v-Fc, unlike IL2wt-Fc, increased NK cells in the tumor. CD8 in the spleen and blood. + Unlike T cells, tumor-infiltrating CD8 + T cells upregulate the expression of both IL-2Ra and PD1, suggesting that they are actively stimulated by antigens in the tumor environment—presumably tumor-responsive T cells (Kalia (2010)). CD8 in tumors + Selective expression of IL-2Ra on T cells also provides an explanation for why these cells are stimulated more efficiently by IL-2wt-Fc than by IL-2v-Fc. In summary, these results suggest that IL-2 biased towards IL-2Rb / g is CD8 + This can lead to systemic expansion of T cells and NK cells, but it suggests that the cells being expanded are not tumor-specific. Therefore, the ability to engage with IL-2Ra is important in designing IL-2 therapies to efficiently stimulate tumor-responsive T cells and control tumor growth.

[0102] Manipulation and characterization of receptor-masked IL-2 targeting PD1: Based on these findings, novel IL-2 therapeutics were developed that (1) maintain the ability to engage with IL-2Ra to maximize antitumor capacity; (2) have attenuated IL-2 activity to avoid nonspecific activation of unrelated cells and systemic toxicity; and (3) involve targeted delivery that selectively activates tumor-reactive T cells.

[0103] The use of the ligand-binding domains of IL-2Ra and IL-2Rb, which bind to IL-2 with relatively high affinity among all three IL-2R subunits, was explored as a possible method for masking and attenuating IL-2 (Myszka (1996)). The wild-type sequence of IL-2 was used so that the unmasked active form retained its ability to engage with endogenous IL-2Ra. All constructs were generated in the form of either N-terminal or C-terminal Fc fusions with different relative orders between IL-2 and the receptor mask. Compared to the unmasked control, the different receptor-masked forms resulted in varying degrees of attenuation of IL-2 activity on YT / STAT5-luciferase reporter cell lines engineered to either knock out or overexpress IL-2Ra, and thus be IL-2Rb / g+ or IL-2Ra / b / g+ cell lines, respectively. Along with an unmasked IL-2 control, all masked IL-2 molecules exhibited higher activity in the presence of IL-2Ra, suggesting they retained their ability to bind to IL-2Ra on cells. Based on the attenuation, protein expression, and aggregation profiles of each molecule, the Fc-IL2Ra-IL2 form was selected as the read "masked" IL2 form. Two flexible glycine-serine (GGGGS) molecules in Fc-IL2Ra-IL2 connect Fc and IL2Ra, while the other connects IL2Ra and IL2. nFurther efforts to optimize linker length suggested that the length of either linker had only a slight effect on the degree of IL-2 activity attenuation. The Fc-(GGGGS)3-IL2Ra-(GGGGS)5-IL2 construct was selected for use with the antibody targeting domain. PD1 was used as an enriched marker on tumor-reactive T cells (Gros (2014)). Furthermore, PD1 expression by virtually all enlarged intratumoral CD8+ T cells after treatment with IL2wt-Fc also suggests that PD1 may be a good target for delivering masked IL-2 to tumor-reactive T cells. Therefore, the IL2Ra-IL2 moiety was conjugated to the C-terminus of an anti-PD1 antibody (hereinafter referred to herein as PD1-IL2Ra-IL2, or REGN10597) to selectively reconstitute IL-2 activity on PD1+ tumor-reactive T cells. PD1-IL2Ra-IL2 is based on the previously described (Davis (2016), Skokos (2020)) hinge-stabilized, effector-minimized IgG4 isotype.

[0104] We characterized the masking configuration in PD1-IL2Ra-IL2 by utilizing the unique dynamic half-arm exchange (also known as "Fab arm exchange") (van der Neut Kolfschoten (2007)) of IgG4 antibodies. Using native mass spectrometry, we examined the ability of PD1-IL2Ra-IL2 to undergo half-arm exchange with another IgG4 antibody when the disulfide bond between the heavy chains was removed by limited reduction. In contrast to the unmasked PD1-IL2 control molecule, which showed a clear peak of the half-arm exchange product, no half-arm exchange product was observed when PD1-IL2Ra-IL2 was mixed with another IgG4 antibody. This result indicates that PD1-IL2Ra-IL2 employs a trans-isolation conformation in which interchain interactions between the IL2Ra mask and the IL2 cytokine primarily prevent half-arm exchange. Interestingly, a similar preference for intermolecular interactions has been previously reported for the mouse IL2-IL2Ra fusion protein, which forms a “head-to-tail” dimer on its own, despite the absence of Fc-mediated dimerization and the reversed order in which the cytokine and receptor fuse with each other (Ward (2018)).

[0105] PD1-IL2Ra-IL2, parental PD1 Ab, or PD1-IL2 were captured with surface-bound anti-hFab, then injected with the indicated IL-2 receptor subunit proteins, and surface plasmon resonance (SPR) measurements were performed at 25°C and pH 7.4. Compared to an unmasked PD1-IL2 control, trans-masking in PD1-IL2Ra-IL2 resulted in a decrease in the percentage of active IL-2 capable of binding to the respective IL-2 receptor subunits, IL-2Ra, IL-2Rb, and IL-2Rg (Figure 3A-3B). To examine whether masking prevents the interaction of PD1-IL2Ra-IL2 with the IL-2 receptor on the cell surface, the above IL-2Rb / g+ or IL-2Ra / b / g+ YT reporter cell lines, further engineered to knock out PD1, were used. Compared to an unmasked PD1-IL2 control, PD1-IL2Ra-IL2 showed a significantly reduced binding signal to both cell lines. Regarding PD1-IL2, PD1-IL2Ra-IL2 is IL-2Rb / g + Rather than targeting cells, IL-2Ra / b / g + The cells showed strong binding and enhanced binding in the presence of IL-2Ra (Figures 4A-4B). In summary, these results suggest that the majority of IL-2 in PD1-IL2Ra-IL2 is trans-masked and inactive, but rare unmasking releases fully active IL-2 that retains the ability to engage with IL-2Ra.

[0106] PD1 targeting enhances the activity of receptor-masked IL-2: To evaluate the role of PD1 targeting in the disclosed receptor-masked IL-2 activity, the IL-2 agonist activity of PD1-IL2Ra-IL2 was compared to isotype-matched, untargeted NT-IL2Ra-IL2 (anti-human MUC16-IL2RA-IL2 fusion control) using IL-2Rb / g+ or IL-2Ra / b / g+YT / STAT5-Luc reporter cell lines. On cell lines engineered to lack PD-1 expression, both PD-1-IL2Ra-IL2 and NT-IL2Ra-IL2 showed lower potency in inducing STAT5 activation than recombinant human IL-2 (rhIL-2, proleukin), which was consistent with mask-mediated reduction in binding (Figure 5A-5C). Increased PD1 expression on YT / STAT5-Luc cells with both IL-2Rb / g+ and IL-2Ra / b / g+ induced enhanced STAT5 activation by PD1-IL2Ra-IL2, while the potency of NT-IL2Ra-IL2 was not affected by the presence of PD1. Each data point is shown as the mean ± SD of three technical replicates in the same experiment. Data are representative of at least three experiments. To assess their ability to induce IL-2R activation-mediated STAT5 phosphorylation on primary human T cells, PD1-IL2Ra-IL2 and NT-IL2Ra-IL2 were incubated with PBMCs. Human PBMCs were stimulated for 20 min with titrators of the respective indicated molecules. Data are representative of three independent experiments performed on different donors. Both PD1-CD8+ T cells showed similarly attenuated efficacy compared to rhIL-2, but PD1-IL2Ra-IL2 showed enhanced efficacy compared to NT-IL2Ra-IL2 on PD1+CD8+ T cells (Figures 6A-6B). Overall, PD1-IL2Ra-IL2 demonstrated that PD1 targeting enhances IL-2R agonism in assays performed on both engineered cell lines and primary human T cells.

[0107] To further investigate whether PD1 targeting enhances the ability of masked IL-2 to promote T cell activation, a mixed lymphocyte response (MLR) assay was performed in which T cells derived from one donor were stimulated with growth-arrested allogeneic PBMCs derived from different donors in the presence of increasing amounts of PD1-IL2Ra-IL2 or other control molecules. Compared to NT-IL2Ra-IL2, PD1-IL2Ra-IL2 more potently promotes T cell activation, as measured by the production of effector cytokines TNFα and IFNγ from cells stimulated with allogeneic PBMCs.

[0108] PD1-IL2Ra-IL2 exhibits improved specificity and reduced toxicity in vivo: Considering its promising masking and PD1 targeting profile in vitro, we investigated whether these elements of PD1-IL2Ra-IL2 can enhance the specificity and safety of IL-2 administration in vivo. To evaluate the specificity of PD1-IL2Ra-IL2 in vivo, we examined the expansion of PD1+CD8+ T cells versus PD1-CD8+ T cells in the blood of treated human PD1 knock-in mice. Human PD1 knock-in mice carrying established MC38 tumors (n=6 per group) were treated twice by intraperitoneal injection at 0.5 mg / kg of each indicated molecule on days 0 and 3. On day 6, the expansion of PD1-CD8+ T cells per ml of blood was examined. + T cell count and PD1 + CD8 + Regarding T cell counts, peripheral blood leukocytes were analyzed by flow cytometry. The results are presented as mean ± SD. Statistical analysis was performed using one-way ANOVA along with Tukey's multiple comparison test. ** P ≤ 0.01, *** (P ≤ 0.001). The data are representative of the two experiments.

[0109] In the absence of masking, NT-IL2 and PD1-IL2 resulted in the expansion of both PD1- and PD1+ CD8+ T cells without selectivity. PD1 targeting in PD1-IL2 did not improve selectivity for PD1+ cells (Figure 7A). In the presence of masking, NT-IL2Ra-IL2 did not expand either PD1- or PD1+CD8+ T cells, but PD1-IL2Ra-IL2 resulted in the selective expansion of PD1+CD8+ T cells with minimal effect on PD1-CD8+ T cells (Figure 7B). These results suggest that masking attenuates systemic activity of IL-2, while PD1 targeting enables selective reconstitution of activity for PD1+ cells, and both are important for in vivo specificity.

[0110] One major dose-limiting side effect associated with systemic IL-2 therapy is pulmonary edema (Vial (1992)). To evaluate this issue with PD1-IL2Ra-IL2, human PD-1 knock-in mice (n=5 per group) were treated daily with isotype control (1.2 mg / kg), NT-IL2 (1.5 mg / kg), PD1-IL2 (1.5 mg / kg), NT-IL2Ra-IL2 (1.8 mg / kg), or PD1-IL2Ra-IL2 (1.8 mg / kg) via intraperitoneal injection over a total of four injections. Dose levels represent equimolar amounts of each drug. Body weight change was measured daily throughout the experiment. Statistical analysis was performed using two-way ANOVA with Bonferroni's multiple comparison test. * P ≤ 0.05, ** (P ≤ 0.01). One day after the final dose, mice were euthanized, and the wet lung weight was determined by subtracting the dry lung weight (after drying at 55°C for 72 hours) from the fresh lung weight (immediately after collection). Statistical analysis was performed using one-way ANOVA along with Dunnett's multiple comparison test. ****(P ≤ 0.0001). The data are representative of two experiments. Daily administration of unmasked NT-IL2 or PD1-IL2 resulted in pulmonary edema, observed as significant weight loss and increased pulmonary wet weight. In contrast, daily injections of the same molar amount of NT-IL2Ra-IL2 or PD1-IL2Ra-IL2 resulted in neither weight change nor pulmonary wet weight change, suggesting a reduction in systemic IL-2 toxicity in the presence of masking (Figure 8A-8B). These data indicate that PD1-IL2Ra-IL2 enhanced specificity and reduced toxicity in vivo compared to unmasked IL2.

[0111] PD1-IL2Ra-IL2 exhibits potent antitumor activity in syngeneic tumor models: The antitumor efficacy of PD1-IL2Ra-IL2 was evaluated in several syngeneic mouse tumor models, including B16F10 melanoma, MCA205 fibrosarcoma, TRAMP-C2 prostate cancer, and Colon 26 and MC38 colorectal cancer. Due to the lack of binding of anti-huPD1 targeted antibodies to mouse PD1, tumor-bearing mice were administered either the anti-huPD1-IL2Ra-IL2 molecule (REGN10597) for human PD1 knock-in mice or the mouse surrogate anti-mPD1-IL2Ra-IL2 molecule for wild-type C57BL / 6 or BALB / c mice. Human PD-1 knock-in mice (8 mice per group) were subcutaneously transplanted with B16F10 or MCA205 tumors. TRAMP-C2 tumor cells were subcutaneously transplanted into C57BL / 6 mice (6-7 mice per group). Colon26 tumor cells were subcutaneously transplanted into BALB / c mice (6 mice per group). If a tumor was established, mice were randomized to groups and treated by intraperitoneal injection with the indicated molecules and doses on the indicated days. Tumor growth (mean + SEM) was monitored over time. The number of tumor-free (TF) mice at the end of the study is shown for the selected tumor models.

[0112] Robust antitumor activity of PD1-IL2Ra-IL2 was observed in all models tested (Figures 9A-9D and 10A-10B). For the MC38 model experiment, a subcutaneously established MC38 tumor (120 mm) was used. 3 Human PD-1 knock-in mice carrying ) were randomized (9-10 mice per group) and treated with the indicated molecule and dose on the indicated day by intraperitoneal injection. Tumor growth (mean + SEM) (Figure 10A) and mouse survival (Figure 10B) were monitored over time. The number of TF mice at the end of the study is shown for the selected group. Data are representative of at least three experiments. Statistical analysis of tumor growth was performed using two-way ANOVA with Bonferroni's multiple comparison test. * P ≤ 0.05, ** P ≤ 0.01, *** P ≤ 0.001, **** P ≤ 0.0001). All statistical significance regarding mouse survival was determined by Kaplan-Meier analysis using the log-rank test. *** P ≤ 0.001, **** (P ≤ 0.0001). The efficacy of PD1-IL2Ra-IL2 in inhibiting tumor growth and improving tumor-free survival was far superior to that of NT-IL2Ra-IL2, anti-PD1 blockers, or combinations thereof (Figures 10A-10B).

[0113] To determine the lymphocyte subset required for the antitumor efficacy of PD1-IL2Ra-IL2, NK cells, CD8+, or CD4+ T cells were depleted before and during PD1-IL2Ra-IL2 treatment. Human PD-1 knock-in mice carrying established MC38 tumors were randomized (5-7 mice per group) and treated with PD1-IL2Ra-IL2 (0.5 mg / kg) in combination with an isotype control or the indicated depletion mAb or FTY-720 via intraperitoneal injection. The injection schedule for each reagent is shown in the schematic diagram (Figure 11A). Tumor growth (mean + SEM) (Figure 11B) and mouse survival (Figure 11C) were monitored over time. Statistical analysis of tumor growth was performed using two-way ANOVA with Bonferroni's multiple comparison test. * P ≤ 0.05, ** P ≤ 0.01, *** P ≤ 0.001, **** P ≤ 0.0001). All statistical significance regarding mouse survival was determined by Kaplan-Meier analysis using the log-rank test. *** P ≤ 0.001, **** P ≤ 0.0001).

[0114] Depletion of CD8+ T cells, rather than CD4+ T cells or NK cells, completely abolished PD1-IL2Ra-IL2-induced tumor growth inhibition and tumor-free survival (Figures 11A-11C). Furthermore, much of this antitumor effect was retained when T cell exodus from lymph nodes was blocked by treatment with the S1PR inhibitor FTY720, suggesting that pre-existing intratumoral CD8+ T cells play a more important role in mediating PD1-IL2Ra-IL2-induced antitumor immunity compared to newly recruited cells into the tumor.

[0115] To further investigate whether PD1-IL2Ra-IL2 therapy generates anti-tumor memory, human PD1 knock-in mice that had previously eradicated MC38 tumors after PD1-IL2Ra-IL2 treatment were re-challenged with MC38 tumors 97 days after initial tumor transplantation (88 days after the last PD1-IL2Ra-IL2 dose), and control naive mice were also challenged simultaneously. PD-1 knock-in mice that had previously eliminated MC38 tumors after PD1-IL2Ra-IL2 treatment were re-challenged with a second MC38 tumor graft via subcutaneous injection into the contralateral flank. Tumor growth (mean ± SEM) was monitored over time. Data are representative of the three experiments. Statistical analysis of tumor growth was performed using two-way ANOVA along with Bonferroni's multiple comparison test. * P ≤ 0.05, ** P ≤ 0.01, *** P ≤ 0.001, **** (P ≤ 0.0001). Naive mice developed progressive MC38 tumors, but no tumor growth occurred in mice pre-treated with PD1-IL2Ra-IL2 (Figure 12). In summary, these results indicate that PD1-IL2Ra-IL2 elicits robust anti-tumor immunity primarily by boosting the CD8+ T cell response within tumors, and also leads to the development of long-term memory against tumor cells.

[0116] PD1-IL2Ra-IL2 induces dynamic differentiation of PD1+CD8+ effector T cells within tumors: To gain deeper insights into the effects of PD1-IL2Ra-IL2 treatment on the immune landscape of the tumor microenvironment, single-cell RNA sequencing (scRNA-seq) was performed on CD45+ immune cells isolated from MC38 tumors after treatment with PD1-IL2Ra-IL2, NT-IL2Ra-IL2, anti-PD1, or isotype controls, respectively. Overall, PD1-IL2Ra-IL2 resulted in a significant expansion of the T cell population and a decrease in the bone marrow population compared to the other treatment groups.

[0117] Further unsupervised clustering of all CD3e+ T cells identified four CD4+ T cell clusters (CD4_1 to CD4_4) and nine CD8+ T cell clusters (CD8_1 to CD8_9). Of the CD4+ T cell clusters, PD1-IL2Ra-IL2 treatment did not increase the size of the FoxP3+ Treg population (CD4_1, CD4_2, and CD4_3), but slightly expanded CD4_4, which expresses genes associated with the identity of memory T cells in non-lymphoid tissues (Ramp3, Tnfsf8, Tnfsf11) (Miragaia (2019)). The most significant effect of PD1-IL2Ra-IL2 treatment was on CD8+ T cells, inducing the expansion of several PD1+CD8+ T cell clusters (CD8_4, CD8_5, CD8_6, CD8_8, and CD8_9) that were absent or minimally present in the other treatment groups. All of these clusters, despite fluctuating levels, exhibited upregulated expression of effector function-associated genes (Gzma, Klrd1, Prf1, Cx3cr1, Ifng) and activation / exhaustion markers (Pdcd1, Lag3, Il2Ra, Havcr2), representing effector CD8+ T cell populations that transitioned between various activated and differentiated states. CD8_6 had the highest expression of several Gzm family genes and represented a more differentiated cytotoxic effector. Compared to CD8_6, CD8_4 had lower expression of Gzm genes, Prf1, and Havcr2, contained a smaller subset of cells expressing Tcf7, and therefore corresponded to a faster effector. CD8_5 had similar levels of effector gene expression to CD8_4 but also showed interferon-stimulated gene signatures (Isg15, Ifit1, Ifit3). CD8_8 and CD8_9 also expressed cell cycle genes (Mki67, Top2a, Stmn1) that represent actively proliferating effector cells.In addition to a significant expansion of effector CD8+ T cells, the PD1-IL2Ra-IL2 treatment group also showed moderate enrichment of CD8_2, which co-expresses Pdcd1, Tcf7, and the pro-survival gene Bcl2, likely representing stem cell precursor CD8+ T cells (Siddiqui (2019), Miller (2019)). Consistently, pseudo-temporal analysis of CD8+ T cell clusters showed a continuous differentiation trajectory starting from CD8_1, progressing to CD8_2 and 3, further progressing to CD8_4 and 5, then progressing to CD8_6, and ending at CD8_7. Taken together, these results suggest that PD1-IL2Ra-IL2 expands intratumoral PD1+CD8+ T cells with a robust effector profile and diverse differentiation states, leading to robust and persistent anti-tumor immunity.

[0118] To understand the clonal structure of different T cell clusters and the relationships between them, parallel single-cell TCRseq was performed using the same TIL samples analyzed by scRNA-seq. Effector CD8+ T cell clusters induced by PD1-IL2Ra-IL2 treatment showed the highest degree of clonal expansion, indicating tumor-associated antigen recognition. Furthermore, considerable clonal type overlap was observed between different expanded effector CD8+ T cell clusters, further reinforcing the results from orbital analysis and highlighting the ability of PD1-IL2Ra-IL2 to promote dynamic differentiation of tumor-reactive T cell compartments.

[0119] The ability of PD1-IL2Ra-IL2 to expand tumor antigen-specific T cells was confirmed using the TRAMP-C2 model, in which tumor rejection is mediated by CD8+ T cells that recognize the tumor-specific antigen epitope Spas-1 (Fasso (2008)). TRAMP-C2 tumor cells were subcutaneously transplanted into C57BL / 6 mice. 175mm 3When the tumors were established, mice were grouped (4 mice per group) and treated with a single dose of the indicated molecule by intraperitoneal injection. Six days after administration, the mice were euthanized, the tumors were excised and weighed. The tumors were dissociated into single-cell suspensions, and the density of tumor CD8+ T cells as a percentage of total CD8+ T cells and SPAS-1-dextramer were measured. + CD8 + T cells were analyzed by flow cytometry. SPAS-1-dextramer in tumors. + CD8 + T cell density was quantified. PD1 in tumors + CD8 + and TCF1 + PD1 + CD8 + T cell density was quantified. Statistical analysis was performed using one-way ANOVA along with Dunnett's multiple comparison test. ** (P ≤ 0.01). The data are representative of the two experiments.

[0120] According to the antitumor activity of PD1-IL2Ra-IL2 in the TRAMP-C2 model (Figure 9C), flow cytometry analysis of TILs isolated from TRAMP-C2 tumors showed a significant expansion of CD8+ T cells after treatment with PD1-IL2Ra-IL2, rather than with NT-IL2Ra-IL2 or high doses of anti-PD1 (Figure 13A). Of the expanded CD8+ T cells, a substantial increase in both the number and frequency of Spas-1-specific CD8+ T cells was induced by PD1-IL2Ra-IL2, directly demonstrating its ability to expand tumor-specific T cells (Figures 13B-13C). Consistent with PD1-IL2Ra-IL2 delivering IL2 in a PD1-targeting manner, the majority of the expanded CD8+ T cells were PD1+, including a subset that is PD1+TCF1+ and likely a stem cell-like precursor pool of tumor-reactive T cells (Figures 13D-13E). [Examples]

[0121] Improved antitumor efficacy of anti-mPD1-IL2Ra-IL2 when combined with MUC16xCD3 bispecific antibody in a syngeneic ID8-VEGF / huMUC16Δ tumor model. This example relates to an in vivo study conducted to demonstrate the improved antitumor efficacy of targeted immunocytokines when combined with a MUC16xCD3 bispecific antibody in the treatment of established tumors and the prevention of new tumor formation after clearance. The MUC16xCD3 bispecific antibody was BSMUC16 / CD3-001 (WO2018067331). The tumor model was ID8-VEGF / huMUC16-delta tumor, a mouse model of ovarian cancer. The targeted immunocytokine was a mouse surrogate, anti-mPD1-IL2Ra-IL2, a fusion protein having the same IL2 moiety (IL2Ra-IL2, SEQ ID NO: 27) as anti-PD1-IL2Ra-IL2, but with a targeting domain replaced by an antibody that specifically binds to mouse PD1 (anti-mPD1 antibody). Controls for this fusion protein were (i) anti-mPD1 antibody and (ii) an untargeted version of IL2Ra-IL2 (NT-IL2Ra-IL2). The control for the MUC16xCD3 bispecific antibody was a bispecific antibody in which one arm specifically binds to CD3 and the other arm specifically binds to an unrelated antigen (EGFRvIII). Mice were humanized for MUC16 and CD3, i.e., mouse MUC16 and mouse CD3 were knocked out and replaced with their human homologs ("hMUC16 / hCD3 mice").

[0122] Table 3 lists the amino acid sequence identifiers for BSMUC16 / CD3-001.

[0123] [Table 3]

[0124] Experiment 1 - Reduction of Tumor Growth and Complete Tumor Regression: On day 0, ID8-VEGF / huMUC16-delta tumor cells were subcutaneously transplanted into hMUC16 / hCD3 mice. On day 10, the mice were divided into six different treatment groups (n=5). The mice were administered specific combinations of antibodies on days 10, 13, and 17. See Figure 14 for treatments and dosages. Tumor volume and weight were measured approximately twice a week until approximately week 6.

[0125] Results: With MUC16xCD3 monotherapy, slight control of tumor growth was observed (Figures 14 and 15A-15F). Similarly, anti-mPD1-IL2Ra-IL2 showed limited efficacy in the presence of a CD3 bispecific antibody control (Figures 14 and 15A-15F). However, the combination of MUC16xCD3 and anti-mPD1-IL2Ra-IL2 resulted in a substantial improvement in tumor growth control, with 4 out of 5 mice achieving complete tumor regression. Such synergistic effects were not observed when MUC16xCD3 was combined with the same dose of NT-IL2Ra-IL2 or anti-mPD1, and none of the mice in these combination groups achieved complete tumor regression (Figures 14 and 15A-15F). The combination of MUC16xCD3 and anti-mPD1-IL2Ra-IL2 did not result in weight loss.

[0126] Experiment 2 - Endogenous antitumor immunological memory: On day 77 after the initial transplant, mice derived from Experiment 1 (n=4) that were tumor-free and administered the MUC16xCD3 + anti-mPD1-IL2Ra-IL2 combination were re-challenged by transplantation of parental ID8-VEGF tumor cells. Naive hMUC16 / hCD3 mice were used as a control (n=10). No further therapy was administered. Tumor volume was measured approximately twice a week until approximately day 110.

[0127] Results: At the end of the experiment, the average tumor volume of naive mice was 900 mm². 3Although larger than the initial tumor, the mice that underwent a second attempt did not show tumor growth (Figure 16). Surprisingly, in mice from which the ID8-VEGF / huMUC16-delta tumor had been pre-removed by treatment with MUC16xCD3 + anti-mPD1-IL2Ra-IL2, the establishment of new, parental ID8-VEGF tumors was completely prevented (Figure 16). This immunological memory was impressive and unexpected.

[0128] Conclusion: Experiments 1 and 2 demonstrate that substantially improved antitumor efficacy was achieved when combined with the MUC16xCD3 bispecific antibody BSMUC16 / CD3-001, targeting immunocytokine, anti-mPD1-IL2Ra-IL2. Furthermore, Experiment 1 shows that the combination therapy was far superior to either monotherapy in reducing tumor growth and inducing complete tumor regression, while Experiment 2 shows that the combination therapy can also induce robust endogenous antitumor immunological memory. [Examples]

[0129] Synergistic antitumor efficacy of PD1-targeted IL-2 immunocytokine (PD1-IL2Ra-IL2) treatment combined with anti-huMUC16 CAR T-cell therapy. This example relates to an in vivo study conducted to demonstrate the synergistic antitumor efficacy of PD1-targeting IL-2 immunocytokine (PD1-IL2Ra-IL2) treatment in combination with anti-huMUC16 CAR T cell therapy.

[0130] Despite being an effective therapy for some hematological malignancies, the therapeutic activity of CAR-T cells has been limited in many solid tumors, partly due to their low in vivo persistence and function. Numerous combination strategies have been explored to overcome these limitations of CAR-T cells in solid tumors (Young, 2022; Al-Haideri, 2022). To investigate whether PD1-IL2Ra-IL2 improves the antitumor activity of CAR-T cells in solid tumors, we evaluated the combined efficacy of anti-huMUC16 CAR-T cells + mPD1-IL2Ra-IL2 in controlling syngeneic ID8-VEGF / huMUC16-delta tumors, as anti-huMUC16 CAR-T cells upregulate PD-1 expression when co-cultured with target cells expressing huMUC16 (Figure 17A). CD3 / MUC16 double-humanized mice were lymphocyte-depleted, transplanted with ID8-VEGF / huMUC16-delta tumor cells, and treated on the indicated days with either anti-huMUC16 or control CAR-T cells combined with mPD1-IL2Ra-IL2 or a control molecule (Figure 17B). Compared to control CAR-T cells + isotyped mAb, huMUC16 CAR-T cell + isotyped mAb treatment moderately delayed tumor growth. This monotherapy efficacy of huMUC16 CAR-T cells was not further enhanced when they were combined with either NT-IL2Ra-IL2 or a high dose of anti-mPD1 antibody. In contrast, the combination of huMUC16 CAR-T cells with mPD1-IL2Ra-IL2 resulted in a significant enhancement of antitumor efficacy, and tumor regression was observed in all mice in this treatment group. While there was no therapeutic benefit from mPD1-IL2Ra-IL2 in mice treated with control CAR-T cells, this suggests that the activity of mPD1-IL2Ra-IL2 in these lymphocyte-depleted mice is dependent on the introduced huMUC16 CAR-T cells (Figures 17C-17I). In summary, these results indicate that PD1-IL2Ra-IL2 enhances the in vivo antitumor activity of CAR-T cells. [Examples]

[0131] material and method The following disclosure relates to the materials and methods used in the experiments described in Examples 2-4.

[0132] Protein Production: All antibodies or Fc / IL-2 fusion proteins and CD3 BsAbs were produced by Regeneron Pharmaceuticals. The proteins were expressed transiently in Expi293F® cells (ThermoFisher Scientific, A14527) or stably transfected Chinese hamster ovary cells, followed by purification using protein A-affinity capture, then size exclusion chromatography or ion exchange and hydrophobic interaction chromatography. The production of MUC16xCD3 BsAb (REGN4018) and anti-PD-1 mAb (semiprimab) has been previously described (Burova, 2017; Young, 2022). A parental anti-human PD-1 antibody for anti-hPD1-IL2Ra-IL2 (REGN10597) was generated by immunization of VelocImmune® mice (Macdonald et al., Proceedings of the National Academy of Sciences, 111:5147-5152 (2014); Murphy et al., Proceedings of the National Academy of Sciences, 111:5153-5158 (2014)) using recombinant human PD-1-mFc protein.

[0133] Cell lines: Using the human T / NK cell leukemia YT cell line (DSMZ ACC-434), a series of YT / STAT5-luciferase reporter cell lines exhibiting varying expression levels of IL-2Rα and PD-1 were created. To generate the parent YT / STAT5-Luc cell line, YT cells were electroporated with a STAT5 response element-driven luciferase reporter construct (Promega, #E4651), single cells were cloned, and maintained in Iscove medium (Irvine Scientific) supplemented with 20% FBS, 1X L-glutamine, penicillin / streptomycin (Gibco®, 10378016), and 200 μg / mL hygromycin-B. To further generate YT / STAT5-Luc / IL2RaKO and / or PD1KO cell lines, IL-2Rα (CD25) and / or PD-1 were knocked out using TrueCut Cas9 Protein v2 (ThermoFisher Scientific, A36498) with a guide targeting IL2Rα (ThermoFisher Scientific, CRISPR1029141_SGM, target sequence AATTGTGGCGTGTGGGATCTC) or PD-1 (ThermoFisher Scientific, CRISPR816555_SGM, target sequence ATGTGGAAGTCACGCCCGTT). IL-2Rα and / or PD-1 negative cells were isolated by FACS. To generate IL-2RαOE and / or PD1OE derivatives of the above cell lines, human IL-2Rα and / or PD-1 were stably expressed by lentiviral transduction using vectors encoding IL-2Rα (accession number NP_000408.1, M1-I272) and / or PD-1 (accession number NP_005009.2, M1-L288). Cells were selected in a culture medium supplemented with 15 μg / mL blasticidine (for IL-2Rα selection) and / or 1 mg / mL G418 (for PD-1 selection). Human IL-2Rα and / or PD-1-positive cells were validated by FACS.

[0134] MC38 (from the National Cancer Institute Lab of Tumor Immunology and Biology), B16F10 (ATCC, CRL-6475), MCA205 (Sigma-Aldrich, SCC173), and TRAMP-C2 (ATCC, CRL-2731) tumor cells were cultured in DME (Irvine Scientific, 9031) medium supplemented with 10% FBS (Seradigm, 1500-500) and 1X L-glutamine / penicillin / streptomycin (Gibco®, 10378016). Colon26 (ATCC, CRL2638) cells were cultured in RPMI1640 (Irvine Scientific, 9160) medium supplemented with 10% FBS, 1X L-glutamine, and penicillin / streptomycin. The ID8-VEGF cell line (Ludwig Institute for Cancer Research) was maintained in DME medium supplemented with 10% FBS, 1X L-glutamine, and penicillin / streptomycin. ID8-VEGF / huMUC16-delta cells (Crawford, 2019) were generated by stably expressing the proximal membrane region of human MUC16 on parental ID8-VEGF cells.

[0135] Cell surface receptor binding assay: Binding of PD1-IL2Ra-IL2 and control molecules to the cell surface IL-2 receptor complex was evaluated by flow cytometry. Briefly, cells were incubated at 4°C for 30 min with serial dilutions of each indicated molecule, followed by two washes with FACS buffer (PBS + 2% FBS). Binding molecules were detected using an anti-human IgG H / L secondary F(ab')2 antibody (Jackson Immunoresearch, 109-606-088) conjugated to AlexaFluor 647 in the presence of a fixable violet Live / Dead dye (Invitrogen, #L34960). Cells were washed twice, fixed, acquired on an iQue Screener Plus flow cytometer (IntelliCyt), and analyzed using Forecyt software. Geometric mean fluorescence intensity was plotted, with the un-titrated molecular condition (secondary antibody only) represented as the lowest point on the titration curve.

[0136] STAT5-luciferase reporter bioassay: Manipulated YT / STAT5-luciferase reporter cell lines exhibiting varying expression levels of IL-2Rα and PD-1 were incubated at 37°C for 4.5 hours with serial dilutions of IL-2 (proleukin, Clinigen #NDC7631D-022-01), PD1-IL2Ra-IL2, parental PD-1 mAb, or NT-IL2RA-IL2 control. After incubation, the One-Glo luciferase assay reagent (Promega, #E6130) was added, and the luminescence signal was measured on an Envision plate reader. Relative luminal units (RLU) were plotted, and the un-titrated molecular condition was represented as the lowest point on the titration curve. All samples were tested in three replicates.

[0137] STAT5 phosphorylation assay for human PBMCs: Human peripheral blood mononuclear cells (PBMCs) were obtained from BioIVT, LLC. Frozen human PBMCs were thawed and rested overnight in IL-2-free culture medium. The following day, cells were stained with a near-infrared viability analyzer dye (Invitrogen) that could be fixed at room temperature for 15 minutes. The cells were washed and treated with serial dilutions of the indicated molecules for 20 minutes, then fixed with BD Cytofix® fixation buffer at 37°C for 12 minutes. The cells were then permeabilized on ice for 10 minutes with pre-cooled BD Phosflow® Perm Buffer III. The cells were washed twice with FACS buffer (PBS + 2% FBS) and then stained with anti-Stat5 pY694 antibody (BD Biosciences-562076) conjugated to Alexa Fluor® 647 for 60 minutes in a dark room at room temperature. To identify different lymphocyte populations within PBMCs, the following antibody panel was also included in the staining cocktail: CD8 (RPA-T8), CD4 (L200), CD25 (MA251), CD56 (HCD56), CD3 (SP34-2), Foxp3 (259D / C7), PD-1 (EH12.1), and NKp46 (9-E2). After washing cells twice with FACS buffer, data was acquired on a BD LSRFortessa® X-20 flow cytometer. Raw data were analyzed using FlowJo.

[0138] Mixed Lymphocyte Response (MLR) Assay: An MLR assay was performed to evaluate primary human T cell activation in the presence of allogeneic PBMCs. PBMCs were isolated from blood using the EasySep® Direct Human PBMC Isolation Kit (STEMCELL Technologies) according to the manufacturer's protocol. T cells were isolated from PBMCs using the EasySep® T Cell Isolation Kit (STEMCELL Technologies) according to the manufacturer's protocol. Allogeneic PBMCs used to stimulate allogeneic T cells were incubated for 1 hour at 37°C and 5% CO2 in assay medium (X-Vivo 15, 10% FBS, HEPES, sodium pyruvate, non-essential amino acids, 0.01 mM beta-mercaptoethanol) containing 50 μg / mL mitomycin C to stabilize cell growth. The stabilized allogeneic PBMCs were washed with assay medium and incubated with T cells at 37°C and 5% CO2 for 6 days. Pre-stimulated T cells were isolated from a co-culture containing PBMCs whose growth had been stopped using the Easy Sep T cell isolation kit according to the manufacturer's protocol. The cells were then resuspended in assay medium and allowed to rest at 37°C and 5% CO2 for 24 hours prior to the assay.

[0139] When pre-stimulated T cells were in a resting state, fresh vials of allogeneic PBMCs were thawed, resuspended in assay medium containing 50 ng / mL IFNγ, and incubated overnight at 37°C and 5% CO2. The following day, the IFNγ-treated PBMCs were treated with 50 μg / mL mitomycin C in assay medium for 1 hour at 37°C and 5% CO2, and then washed with Dulbecco PBS containing 2% FBS before assay.

[0140] Pre-stimulated T cells and allogeneic PBMCs treated with IFNγ were added to plates in a 1:3 T cell:PBMC ratio. Cells were incubated for 72 hours with serial dilutions of proleukin, PD1-IL2Ra-IL2, parental PD-1 mAb, NT-IL2RA-IL2, or isotype control. The supernatant from the assay plate was removed, and the AlphaLISA human TNFα and IFNγ assay was performed according to the manufacturer's protocol. Plates were read on an Envision multimode plate reader. Measured TNFα and IFNγ concentrations were plotted, and un-titrated molecular conditions were represented as the lowest point on the titration curve. All samples were tested in three replicates.

[0141] Animal studies: All animals were maintained under pathogen-free conditions. C57BL / 6 and BALB / c mice were obtained from Jackson Laboratory. Human PD-1 knock-in mice and human CD3 / MUC16 knock-in mice were generated in-house and were previously described (Burova, 2017; Crawford, 2019). All mice were 8–16 weeks old when used in the studies.

[0142] For tumor studies, unless otherwise indicated, different mouse strains were transplanted with tumor cells (Gibco® 14025076) resuspended in HBSS by subcutaneous injection into the right flank. The following tumor cell counts were used: MC38 (3 x 10⁻¹⁰) 5 (individual cells), B16F10 (3x10 5 (individual cells), MCA205 (1 x 10) 6 (individual cells), TRAMP-C2 (1 x 10) 6 (individual cells), Colon26 (1x10) 6 (individual cells). When tumors were established, mice were randomized based on tumor size and treated with the indicated molecules and doses by intraperitoneal injection on the indicated days. For the ID8-VEGF / huMUC16-delta test, human CD3 / MUC16 knock-in mice were resuspended in RMPI1640 medium and treated with 1x10⁶ cells. 7Individual tumor cells were subcutaneously transplanted, and the treatment was administered by intravenous injection. Tumor growth was monitored over time using caliper measurements (length x width). 2 Calculated as ) / 2. The tumor was 2000 mm 3 When the tumor reached its limit or became severely ulcerated, the mice were euthanized. For tumor re-challenge experiments, 3 x 10 5 Individual MC38 cells or 1 x 10 7 Individual ID8-VEGF cells were transplanted into the left flank of mice without a corresponding tumor, more than 75 days after they had undergone and rejected the challenge of their primary tumor.

[0143] The following mAbs were used for the immune cell depletion study: mouse IgG2a isotype control (300 μg) clone C1.18.4 (BioXCell-BE0085), rat IgG2b isotype control (500 μg) clone LFT-2 (BioXCell-BE0090), anti-NK1.1 (300 μg) clone PK136 (BioXCell-BE0036), anti-CD4 (500 μg) clone GK1.5 (BioXCell BE0003-1), and anti-CD8 (300 μg) clone 2.43 (BioXCell-BE0061). The depletion mAbs were administered by intraperitoneal injection two days before the start of PD1-IL2Ra-IL2 therapy. A total of four doses of the depletion mAbs were administered twice weekly. PD1-IL2Ra-IL2 (0.5 mg / kg) was administered every 3-4 days in a total of three doses. FTY-720 (Sigma-SML0700-25MG) was diluted in saline and administered by intraperitoneal injection one day before the start of PD1-IL2Ra-IL2 administration. FTY-720 (60 μg) was administered according to the administration scheme in Figure 11A. Blood samples were collected twice over a two-week period to verify the expected depletion of the peripheral lymphocyte population.

[0144] CAR-T cell generation and in vivo efficacy: To generate mouse anti-huMUC16 CAR T cells, CD3+ T cells were isolated from the spleen of huCD3 / huMUC16 knock-in mice using the Untouched® mouse T cell isolation kit (Invitrogen #11413D) prior to activation with CD3 / CD28 Dynabeads (Invitrogen #11161D) and recombinant human IL-2 (20 U / ml; Peprotech #200-02). After 16 hours, the T cells were transduced with a retrovirus encoding anti-huMUC16 CAR containing mouse CD3z and human 4-1BB intracellular signaling domains by spin infection on a retronectin (Takara #T100B) coated plate. CAR T cells binding to unrelated antigens were simultaneously generated and used as controls. To evaluate PD-1 expression by CAR T cells in the presence of target cells expressing the same antigen, anti-huMUC16 CAR T cells or control CAR T cells were mixed with ID8-VEGF or ID8-VEGF / huMUC16-delta tumor cells in a 1:1 ratio for 16 hours, and then flow cytometry analysis of PD-1 expression was performed on gated CAR+ cells.

[0145] To test the combination of PD1-IL2Ra-IL2 and CAR T-cell therapy, huCD3 / huMUC16 knock-in mice were subjected to lymphocyte depletion by sublethal dose whole-body irradiation (400 cGy) for one day, followed by the administration of 1x10¹⁶ cells to the right flank. 7 Individual ID8-VEGF / huMUC16-delta tumor cells were subcutaneously transplanted. One day after tumor transplantation, mice were given 4x10 6 One anti-huMUC16 CAR T cell or control CAR T cell was intravenously injected. On the same day, the mice were intraperitoneally administered isotype (10 mg / kg), anti-mPD1 (10 mg / kg), NT-IL2Ra-IL2 (1 mg / kg), or mPD1-IL2Ra-IL2 (10 mg / kg). Two days after CAR T cell injection, the mice received an additional dose of the same protein molecule. Tumor volume was measured twice a week using calipers, (length x width)2 It was calculated as ) / 2.

[0146] Immunophenotyping by flow cytometry: For flow cytometry analysis of lymphocyte populations, blood, spleen, and tumors from treated mice were collected on the indicated days. Blood samples were erythrolyzed using ACK buffer (Lonza Bioscience) on ice for 5 min, quenched with complete RPMI, and washed twice before staining. Spleens were ground through a 100 μm Corning® cell strainer and then erythrolyzed. Tumors were excised and weighed before mincing. Fragments were digested in single-cell suspension using the Miltenyi Tumor Isolation Kit (130-096-730).

[0147] Cells were initially stained with a near-infrared LIVE / DEAD dye (Invitrogen, #L34976) that could be immobilized according to the manufacturer's protocol, and then stained with a cocktail of fluorophore-conjugated antibodies for cell surface and intracellular markers. The staining antibodies were diluted in BD Horizon Brilliant Buffer (BD / 563794) and surface staining was performed on ice for 30 minutes in the presence of 2% normal rat serum (ImmunoReagents-SP-006-VX2), 2% normal mouse serum (Jackson Immunoresearch-015-000-120), and a 1:100 CD16 / CD32 block (BD-553141). The antibody clones used for staining were CD45 (30-F11), CD90.2 (53-2.1), CD8α (53-6.7 or CT-CD8a), CD4 (GK1.5 or RM4-4), CD19 (1D3), NK1.1 (PK136), NKp46 (29A1.4), Ki-67 (16A8), mPD-1 (29F.1A12), hPD-1 (EH12.1), CD44 (IM7), CD62L (MEL-14), Foxp3 (MF23), CD25 (PC61), TCF1 (C63D9), CD11b (M1 / 70), Ly6G (1A8), and Ly6C (HK1.4). For dextramer staining, SPAS-1 dextramer (Immudex-JA3973-PE) was first incubated with cells at room temperature for 10 minutes, followed by incubation with surface staining antibody on ice for 30 minutes. Intracellular staining was performed using the eBioscience® FoxP3 staining buffer set (Invitrogen 00-5523-00) according to the manufacturer's protocol. Stained samples were acquired on a BD LSR Fortessa X-20 or Cytek® Aurora flow cytometer, and data were analyzed using FlowJo software.

[0148] Single-cell RNA-seq and TCR-seq: To prepare TIL samples for single-cell RNA-seq and TCR-seq, MC38 tumor cells were subcutaneously transplanted into both the left and right flanks of human PD-1 knock-in mice. Once the tumors were established, the mice were randomized and treated with the indicated molecules by intraperitoneal injection on days 10 and 13 post-tumor engraftment. On day 16 post-tumor engraftment, the mice were euthanized, the tumors were shredded, and dissociated in single-cell suspension using a tumor isolation kit (Miltenyi 130-096-730). Tumors from the right and left flanks of the same mice were pooled. Single-cell suspensions were enriched for CD45+ tumor-infiltrating lymphocytes using positive selection with magnetic beads (Miltenyi 130-110-618) to achieve CD45+ purity of over 95% in viable cells, as assessed by flow cytometry (Miltenyi 130-110-797).

[0149] Surface plasmon resonance (SPR) assay for binding to IL-2 receptor protein: The SPR assay was performed on a Biacore S200 instrument (Cytiva®). To prepare the capture sensor surface, an anti-hFab capture antibody (Cytiva®, catalog no. 28958325) was immobilized onto the surface of a CM5 sensor chip (Cytiva®, catalog no. BR-1005-30) using standard amine coupling chemistry. The coupling procedure was performed using filtered HBSEP (10 mM HEPES, 150 mM NaCl, 3 mM ethylenediaminetetraacetic acid [EDTA], 0.05% (v / v) polysorbate-20, pH 7.4) as the electrophoresis buffer. The sensor surface was activated by injecting a 1:1 (v / v) mixture of 0.4 M 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride and 0.1 M N-hydroxysuccinimide onto the chip surface at a flow rate of 30 μL / min for 7 minutes. Anti-hFab (20 μg / mL in 10 mM sodium acetate, pH 5.0) was injected onto the activated chip surface at a flow rate of 30 μL / min for 7 minutes to reach a surface density of approximately 10,000 RU. The remaining active groups on the CM5 sensor chip surface were blocked by injecting 1 M ethanolamine at a flow rate of 30 μL / min for 7 minutes. The sensor chip surface was then washed with HBS-EP and subjected to binding experiments.

[0150] The binding of recombinant hIL2RA (R&D Systems, catalog no. 10305-RL-050), hIL2RB, and hIL2RG proteins to PD1-ILR2-IL2 was measured at pH 7.4 and 25°C using HBS-EP as an electrophoretic buffer. PD1-IL2Ra-IL2 or the control reagent (parent PD-1 mAb, PD1-IL2) was captured by surface-coupled anti-hFab until a signal of approximately 400–600 RU was reached. IL-2R protein at a concentration of 1 μM was selected because it was close to equilibrium binding affinity and technically feasible. In the "ABA" injection method, recombinant IL2R protein "A" was individually injected at a flow rate of 15 μL / min over 60 seconds onto the captured PD1-ILRa-IL2 or control reagent surface. Immediately afterward, sample solution "B" (i.e., a second injection containing a mixture of IL-2 receptor components) was injected over 60 seconds, followed by flanking solution "A" over 60 seconds, and then a 2-minute separation period. The resulting binding signal charge was recorded, and the capture level and binding response for each injection step were evaluated using Scrubber software.

[0151] Fab Arm Exchange and Mass Spectrometry: aPD1 mAb, aPD1-IL2, and aPD1-IL2Ra-IL2 molecules were treated with PNGase F (New England Biolabs Inc.) and N-glycan chains were removed from the respective heavy chain CH2 domains using 1 IUB milliunit per 10 μg of protein in 50 mM Tris-HCl (pH 7.0) at 45°C for 1 hour. To set up the Fab Arm Exchange experiment, aliquots of deglycosylated aPD1 mAb were mixed with deglycosylated PD1-IL2 or PD1-IL2Ra-IL2 molecules, and the corresponding mixtures were subjected to limited reduction with 2 mM DTT (Pierce®, No-Weigh® format) in 50 mM Tris-HCl buffer, pH 7.5 (Thermo Fisher Scientific) at 37°C for 30 min to reduce only the interchain disulfide bonds.

[0152] The products of Fab arm exchange were monitored by desalting size exclusion chromatography (desalting SEC-MS) coupled with mass spectrometry. Desalting SEC was performed on an UltiMate 3000 UHPLC System (Thermo Fisher Scientific, Bremen, Germany) equipped with an Acquity BEH200 SEC guard column (4.6 x 30 mm, 1.7 μm, 200 Å; Waters, Milford, MA) with the column compartment set to 30°C. Online desalting was performed before native MS analysis by applying an isocratic flow of 0.4 mL / mL 150 mM ammonium acetate. To enable online native MS analysis, the analytical flow was divided into a microflow (<10 μL / min) for nanoelectron spray ionization (NSI)-MS detection and the remaining high-speed flow for UV detection. A Thermo Q Exactive UHMR (Thermo Fisher Scientific, Bremen, Germany) equipped with a microflow-nanospray electron spray ionization (MnESI) source and a microfabricated monolithic multi-nozzle (M3) emitter (Newomics, Berkley, CA) was used for native MS analysis (Yan, 2020). Intact mass spectra derived from desalting SEC-MS analysis were analyzed using Intact Mass® software from Protein Metrics. [Examples]

[0153] Different patterns of T cell expansion between tumors and spleens in MC38.Ova tumor-bearing mice administered mPD1-IL2Ra-IL2. This example relates to the section of Example 2, "PD1-IL2Ra-IL2 exhibits potent antitumor activity in syngeneic tumor models," and shows that mice carrying the MC38.Ova tumor exhibit different patterns of T cell expansion between the tumor and the spleen in response to mPD1-IL2Ra-IL2 administration.

[0154] Characterization of the binding and activity of mouse surrogate mPD1-IL2Ra-IL2 molecules: Because human IL-2 is highly cross-reactive on mouse cells (Mosmann et al., The Journal of Immunology 138, pp. 1813-1816 (1987)), the mouse surrogate molecules contained the same IL2Ra-IL2 moiety as the human construct, but instead were fused to an anti-mouse PD1 antibody on a mouse IgG1 isotype. CTLL-2 / STAT3-luciferase reporter cells overexpressing parental or mouse PD1 were incubated with titrators of the respective molecules, and STAT3 luciferase activity was evaluated after 4.5 hours of incubation. Compared to its isotype-matched, untargeted mNT-IL2Ra-IL2 control (IL2Ra-IL2 fusion against an unrelated anti-drug antibody), the mPD1-IL2Ra-IL2 surrogate molecule showed binding to activated mouse T cells and enhanced PD1-targeted activation of STAT3 signaling on the CTLL-2 mouse T cell line (Figure 18).

[0155] Flow cytometry analysis of MC38.Ova tumor-bearing mice after mPD1-IL2Ra-IL2 treatment: MC-38.Ova tumor cells (5x10) 5 (100 cells) were subcutaneously engrafted into C57BL / 6 mice and, after establishment, treated with either PBS or mPD1-IL2Ra-IL2 on the indicated days (Figure 19). Tumors and spleens were harvested and dissociated for flow cytometry analysis (n=4 per group) (Figure 19). Flow cytometry analysis of MC38.Ova tumor-bearing mice after mPD1-IL2Ra-IL2 treatment revealed different patterns of T cell expansion between tumors and spleens. Consistent with its potent antitumor activity, mPD1-IL2Ra-IL2 promoted the expansion of PD1+CD8+ T cells, but had minimal effect on Tregs in tumors (Figures 20A-20H, Figure 22). This contrasts with the immune cell profile observed in the spleen, where mPD1-IL2Ra-IL2 expanded both Tregs and PD1+CD8+ T cells compared to PBS controls (Figures 21A-21H, Figure 22). [Examples]

[0156] Changes in body weight and cytokine expression levels following administration of a combination of MUC16xCD3 and mPD1-IL2Ra-IL2 This example relates to Experiment 1 of Example 3 and demonstrates that administration of the combination of MUC16xCD3 and mPD1-IL2Ra-IL2 did not result in weight loss and had a favorable cytokine expression profile.

[0157] Mice derived from the test described in Experiment 1 of Example 3 above were evaluated for weight loss and cytokine increase. The combination of MUC16xCD3 and mPD1-IL2Ra-IL2 did not result in weight loss in mice (Figure 23). Serum cytokines were measured 24 hours after the first dose. Statistical analysis of tumor growth was performed using two-way ANOVA along with Bonferroni's multiple comparison test (ns, not significant, * P ≤ 0.05, ** P ≤ 0.01, *** P ≤ 0.001, **** (P ≤ 0.0001). Compared to the CD3 control group, the MUC16xCD3+mPD1-IL2Ra-IL2 combination therapy did not significantly increase cytokines, except for IL-5, which were also evaluated after the control CD3+mPD1-IL2Ra-IL2 combination therapy (Figure 24). Statistical analysis of tumor growth was performed using two-way ANOVA along with Bonferroni's multiple comparison test (ns, not significant, * P ≤ 0.05, ** P ≤ 0.01, *** P ≤ 0.001, **** (P ≤ 0.0001). These results indicate that targeted delivery of IL-2 signaling to PD-1+ T cells in tumors, combined with tumor-targeting CD3 BsAbs, can improve the efficacy of treating solid tumors without side effects. [Examples]

[0158] PD1-IL2Ra-IL2 enhances the antitumor efficacy of CAR-T cell therapy. This example relates to an in vivo study conducted to demonstrate the synergistic antitumor efficacy of PD1-targeting IL-2 immunocytokine (PD1-IL2Ra-IL2) treatment in combination with anti-huMUC16 CAR T cell therapy. This study is an extension of the study described in Example 4.

[0159] Despite being an effective therapy for some hematological malignancies, the therapeutic activity of CAR-T cells has been limited in many solid tumors, partly due to their low in vivo persistence and function. Numerous combination strategies have been explored to overcome these limitations of CAR-T cells in solid tumors (Young, 2022; Al-Haideri, 2022). To investigate whether PD1-IL2Ra-IL2 improves the antitumor activity of CAR-T cells in solid tumors, we evaluated the combined efficacy of anti-huMUC16 CAR-T cells and mPD1-IL2Ra-IL2 in controlling syngeneic ID8-VEGF / huMUC16Δ tumors, as anti-huMUC16 CAR-T cells upregulate PD-1 expression when co-cultured with target cells expressing huMUC16 (Figure 17A). CD3 / MUC16 dual-humanized mice were lymphocyte-depleted, transplanted with ID8-VEGF / huMUC16Δ tumor cells, and treated with either anti-huMUC16 or control CAR-T cells combined with 0.4 mg / kg of mPD1-IL2Ra-IL2 or a control molecule (Figure 25). Compared to control CAR-T cells combined with mNT-IL2Ra-IL2, huMUC16 CAR-T cells combined with mNT-IL2Ra-IL2 partially controlled tumor growth. The combination of huMUC16 CAR-T cells with mPD1-IL2Ra-IL2 resulted in a further enhancement of antitumor efficacy compared to the combination of huMUC16 CAR-T cells with mNT-IL2Ra-IL2 (Figures 26 and 27). Mice treated with control CAR-T cells did not show any therapeutic benefit from mPD1-IL2Ra-IL2, indicating that in these lymphocyte-depleted mice, mPD1-IL2Ra-IL2 activity is dependent on the introduced huMUC16 CAR-T cells (Figures 26 and 27). The combination of huMUC16 CAR-T cells and mPD1-IL2Ra-IL2 did not induce greater weight loss in mice compared to other treatment groups (Figure 28), nor did it result in higher cytokine release compared to the combination of control CAR-T cells and mPD1-IL2Ra-IL2 (Figure 29). Serum cytokines were measured 13 days after tumor transplantation.In summary, these results indicate that PD1-IL2Ra-IL2 enhances the in vivo antitumor activity of CAR-T cells.

[0160] References Bagchi et al., Annual Review of Pathology: Mechanisms of Disease 16, 223-249 (2021) June et al., Science 359, 1361-1365 (2018) van de Donk et al., The Lancet 402, 142-158 (2023) Waldman et al., Nature Reviews Immunology 20, 651-668 (2020) Fridman et al., Nature Reviews Cancer 12, 298-306 (2012) Waldmann et al., Cold Spring Harbor Perspectives in Biology 10, (2018) Spolski et al., Nature Reviews Immunology 18, 648-659 (2018) Rosenberg, The Journal of Immunology 192, 5451-5458 (2014) Dutcher et al., Journal for ImmunoTherapy of Cancer 2, 26 (2014) Vial, et al., Drug Safety 7, 417-433 (1992) Charych et al., Clinical Cancer Research 22, 680-690 (2016) Klein et al., OncoImmunology 6, e1277306 (2017) Lopes et al., Journal of ImmunoTherapy of Cancer 8, e000673 (2020) Ptacin et al., Nature Communications 12, 4785 (2021). Bentebibel et al., Cancer Discovery 9, 711–721. Cancer Research 81, LB041-LB041 (2021) . Proceedings of the National Academy of Sciences 112 , 3320–3325 ( 2015 ) Tzeng , et al. van Brummelen et al., Oncotarget 9, (2018) Waldhauer et al., mAbs 13, 1913791 (2021) Gros et al., The Journal of Clinical Investigation 124, 2246–2259 (2014). Gros et al., Nature Medicine 22, 433–438 (2016). Codarri Deak et al., Nature 610, 161–172 (2022). Ren et al., The Journal of Clinical Investigation 132, (2022) Raeber et al., Science Translational Medicine 14, eabo5409 (2022); Kalia et al., Immunity 32, 91–103 (2010). Myszka et al., Protein Science 5, 2468–2478 (1996). Davis et al., US Patent 10,556,952 (2016) Skokos et al., Science Translational Medicine 12, eaaw7888 (2020) van der Neut Kolfschoten et al., Science 317, 1554-1557 (2007) Ward et al., The Journal of Immunology 201, 2579-2592 (2018) Miragaia et al., Immunity 50, 493-504.e7 (2019) Siddiqui et al., Immunity 50, 195-211.e10 (2019) Miller et al., Nature Immunology 20, 326-336 (2019) Fasso et al., Proceedings of the National Academy of Sciences 105, 3509-3514 (2008) Teng et al., Cancer Research 75, 2139-2145 (2015) Vilain et al., Clinical Cancer Research 23, 5024-5033 (2017) Burova et al., Molecular Cancer Therapeutics 16, 861-870 (2017) Crawford et al., Molecular Cancer Therapeutics 20, 1350-1358 (2021) Arvedson et al., Annual Review of Cancer Biology 6, 17-34 (2022) Belmontes et al., Science Translational Medicine 13, eabd1524 (2021) Crawford et al., Science Translational Medicine 11, eaau7534 (2019) Krieg et al., Proceedings of the National Academy of Sciences 107, 11906-11911 (2010) Wu et al., Nature Cancer 4, 1309-1325 (2023) LaPorte et al., Journal for ImmunoTherapy of Cancer 11, e006611 (2023) Hashimoto et al. Nature 610, 173-181 (2022) Lanitis et al., Annals of Oncology 28, xii18-xii32 (2017) Tichet et al., Immunity 56, 162-179.e6 (2023) Young et al., Cancer Discovery 12, 1625-1633 (2022) Al-Haideri et al., Cancer Cell International 22, 365 (2022) Yan et al., J. Am. Soc. Mass Spectrom, 31:2171-2179 (2020) Macdonald et al., Proceedings of the National Academy of Sciences 111, 5147-5152 (2014) Murphy et al., Proceedings of the National Academy of Sciences 111, 5153-5158 (2014) Hao et al., Cell 184, 3573-3587.e29 (2021) Kawalekar et at., Immunity 44, 380-90 (2016)

Claims

1. A method for treating or inhibiting tumor growth, (a) Selecting subjects who have cancer; and (b) The subject is administered a therapeutically effective dose of targeted immunocytokine in combination with a therapeutically effective dose of TAAxCD3 bispecific antibody. Includes, Combination therapy is a method that results in increased antitumor efficacy compared to subjects treated with targeted immunocytokines as monotherapy.

2. The method according to claim 1, wherein the targeted immunocytokine comprises (i) an immunoglobulin antigen-binding domain of a checkpoint inhibitor and (ii) a fusion protein comprising an IL2 moiety.

3. The method according to claim 2, wherein the checkpoint inhibitor is an inhibitor of PD1, PD-L1, PD-L2, LAG-3, CTLA-4, TIM3, A2aR, B7H1, BTLA, CD160, LAIR1, TIGHT, VISTA, or VTCN1.

4. The method according to claim 2 or 3, wherein the checkpoint inhibitor is an inhibitor of PD1.

5. The method according to any one of claims 2 to 4, comprising: the IL2 portion being IL2 receptor alpha (IL2Ra) or a fragment thereof; and IL2 or a fragment thereof.

6. The method according to any one of claims 2 to 5, wherein the Ig antigen-binding domain of the checkpoint inhibitor comprises three heavy chain complementarity-determining regions (CDRs) (HCDR1, HCDR2, and HCDR3) contained within a heavy chain variable region (HCVR) selected from the group consisting of SEQ ID NOs: 1, 11, and 20, and three light chain CDRs (LCDR1, LCDR2, and LCDR3) contained within a light chain variable region (LCVR) selected from the group consisting of SEQ ID NOs: 5 and 15.

7. The Ig antigen-binding domain of the checkpoint inhibitor comprises three heavy chain complementarity-determining regions (CDRs) (HCDR1, HCDR2, and HCDR3) and three light chain CDRs (LCDR1, LCDR2, and LCDR3), where, HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, and LCDR3 each contain the amino acid sequences of SEQ ID NOs: 2, 3, 4, 6, 7, and 8, respectively; HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, and LCDR3 each contain the amino acid sequences of SEQ ID NOs. 12, 13, 14, 16, 7, and 17, respectively; or HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, and LCDR3 each contain the amino acid sequences of SEQ ID NOs. 21, 22, 23, 6, 7, and 8, respectively. The method according to any one of claims 2 to 6.

8. The method according to any one of claims 2 to 7, wherein the antigen-binding domain of the checkpoint inhibitor comprises an HCVR / LCVR amino acid sequence pair selected from SEQ ID NOs: 1 / 5, 11 / 15, and 20 / 5.

9. The method according to any one of claims 2 to 8, wherein the antigen-binding domain of the checkpoint inhibitor comprises the HCVR / LCVR amino acid sequence pair of SEQ ID NO: 20 / 5.

10. The method according to any one of claims 2 to 9, wherein the fusion protein comprises a heavy chain including an HClV of the IgG1 or IgG4 isotype and a heavy chain constant region.

11. The fusion protein includes a heavy chain and a light chain, where, The heavy chain contains the amino acid sequence of SEQ ID NO: 24, and the light chain contains the amino acid sequence of SEQ ID NO: 25; The heavy chain contains the amino acid sequence of SEQ ID NO: 9, and the light chain contains the amino acid sequence of SEQ ID NO: 10; or The heavy chain contains the amino acid sequence of SEQ ID NO: 18, and the light chain contains the amino acid sequence of SEQ ID NO:

19. The method according to any one of claims 2 to 10.

12. The method according to claim 10 or 11, wherein the IL2 portion is attached to the C-terminus of the heavy chain via a linker containing the amino acid sequence of SEQ ID NO: 30 or 31.

13. The method according to any one of claims 2 to 12, wherein the IL2 portion includes IL2 having the amino acid sequence of SEQ ID NO:

29.

14. The method according to any one of claims 2 to 13, wherein the IL2 portion includes IL2 or a fragment thereof connected to the C-terminus of IL2Ra or a fragment thereof via a linker.

15. The method according to claim 14, wherein IL2Ra or a fragment thereof comprises the amino acid sequence of SEQ ID NO:

28.

16. The method according to any one of claims 2 to 15, wherein the IL2 portion includes the amino acid sequence of SEQ ID NO:

27.

17. The TAA in the TAAxCD3 bispecific antibody includes AFP, ALK, BAGE protein, BCMA, BIRC5 (Survivin), BIRC7, β-catenin, brc-abl, BRCA1, BORIS, CA9, carbonic anhydrase IX, caspase-8, CALR, CCR5, CD19, CD20 (MS4A1), CD22, CD30, CD40, CDK4, CEA, CTLA4, and cyclin-B.

1. CYP1B1, EGFR, EGFRvIII, ErbB2 / Her2, ErbB3, ErbB4, ETV6-AML, EpCAM, EphA2, Fra-1, FOLR1, GAGE ​​protein (e.g., GAGE-1, -2), GD2, GD3, GloboH, Glypican-3, GM3, gp100, Her2, HLA / B-raf, HLA / k-ras, HLA / MAGE-A3, hTERT, LM P2, MAGE proteins (e.g., MAGE-1, -2, -3, -4, -6, and -12), MART-1, Mesothelin, ML-IAP, Muc1, Muc2, Muc3, Muc4, Muc5, Muc16 (CA-125), MUM1, NA17, NY-BR1, NY-BR62, NY-BR85, NY-ESO1, OX40, p15, p53, PAP, PAX3, PAX5, PCTA-1, PLA The method according to any one of claims 1 to 16, selected from C1, PRLR, PRAME, PSMA (FOLH1), RAGE protein, Ras, RGS5, Rho, SART-1, SART-3, STEAP1, STEAP2, TAG-72, TGF-β, TMPRSS2, Thompson-nouvelle antigen (Tn), TRP-1, TRP-2, tyrosinase, and uroplakin-3.

18. The method according to any one of claims 1 to 17, wherein TAA is MUC16.

19. The method according to claim 18, wherein the MUC16xCD3 bispecific antibody is a bispecific antibody or an antigen-binding fragment thereof, comprising: a first binding arm that specifically binds to CD3 containing three heavy chain complementarity-determining regions (CDRs) (A1-HCDR1, A1-HCDR2, and A1-HCDR3) contained within a heavy chain variable region (HCVR) having the amino acid sequence of SEQ ID NO: 34 and three light chain CDRs (LCDR1, LCDR2, and LCDR3) contained within a light chain variable region (LCVR) having the amino acid sequence of SEQ ID NO: 39; and a second binding arm that specifically binds to MUC16 containing three heavy chain complementarity-determining regions (CDRs) (A2-HCDR1, A2-HCDR2, and A2-HCDR3) contained within an HCVR having the amino acid sequence of SEQ ID NO: 44 and three light chain CDRs (LCDR1, LCDR2, and LCDR3) contained within an LCVR having the amino acid sequence of SEQ ID NO:

39.

20. The method according to claim 19, wherein the MUC16xCD3 bispecific antibody or its antigen-binding fragment of the second therapy, A1-HCDR1, A1-HCDR2, A1-HCDR3, LCDR1, LCDR2, LCDR3, A2-HCDR1, A2-HCDR2, A2-HCDR3, LCDR1, LCDR2, and LCDR3, each comprises the amino acid sequences of SEQ ID NOs. 35, 36, 37, 40, 41, 42, 45, 46, 47, 40, 41, and 42, respectively.

21. The method according to claim 19 or 20, wherein the MUC16xCD3 bispecific antibody or its antigen-binding fragment comprises (i) a first binding arm comprising an HCVR comprising the amino acid sequence of SEQ ID NO: 34 and / or an LCVR comprising the amino acid sequence of SEQ ID NO: 39, and (ii) a second binding arm comprising an HCVR comprising the amino acid sequence of SEQ ID NO: 44 and / or an LCVR comprising the amino acid sequence of SEQ ID NO:

39.

22. The method according to claim 19 or 20, wherein the MUC16xCD3 bispecific antibody or its antigen-binding fragment comprises a first binding arm comprising a heavy chain and a light chain, wherein the heavy chain has the amino acid sequence of SEQ ID NO: 33 and / or the light chain has the amino acid sequence of SEQ ID NO: 38; and a second binding arm comprising a heavy chain and a light chain, wherein the heavy chain has the amino acid sequence of SEQ ID NO: 43 and / or the light chain has the amino acid sequence of SEQ ID NO:

38.

23. The method according to any one of claims 19 to 22, wherein the MUC16xCD3 bispecific antibody or its antigen-binding fragment is BSMUC16 / CD3-001.

24. The method according to any one of claims 1 to 23, wherein the cancer is selected from anal cancer, angiosarcoma, basal cell carcinoma, bladder cancer, osteosarcoma, brain tumor, breast cancer, cervical cancer, bile duct cancer, chondrosarcoma, colon cancer, colorectal cancer, cutaneous squamous cell carcinoma, endometrial cancer, esophageal cancer, glioblastoma multiforme, head and neck squamous cell carcinoma, hepatocellular carcinoma, kidney cancer, liver cancer, lung cancer, Merkel cell carcinoma, melanoma, myeloma, non-small cell lung cancer, ovarian cancer, pancreatic cancer, prostate cancer, salivary gland cancer, skin cancer, soft tissue sarcoma, gastric cancer, testicular cancer, and uterine cancer.

25. The method according to any one of claims 1 to 24, wherein the targeted immunocytokine is administered to the subject before or concurrently with the administration of the TAAxCD3 bispecific antibody.

26. The method according to any one of claims 1 to 24, wherein the targeted immunocytokine is administered to the subject after administration of a TAAxCD3 bispecific antibody.

27. A method for increasing the efficacy of targeted immunocytokine therapy, (a) Selecting subjects who have cancer; and (b) The subject is administered a therapeutically effective dose of targeted immunocytokine in combination with a therapeutically effective dose of TAAxCD3 bispecific antibody. Includes, Combination therapy is a method that results in increased antitumor efficacy compared to subjects treated with targeted immunocytokines as monotherapy.

28. The method according to claim 27, wherein the targeted immunocytokine comprises (a) an immunoglobulin antigen-binding domain comprising a heavy chain variable region having the amino acid sequence of SEQ ID NO: 20 and a light chain variable region having the amino acid sequence of SEQ ID NO: 5; and (b) a fusion protein comprising an IL2 moiety comprising IL2 or a fragment thereof linked via a linker to the C-terminus of IL2Ra or a fragment thereof.

29. The TAA in the TAAxCD3 bispecific antibody includes AFP, ALK, BAGE protein, BCMA, BIRC5 (Survivin), BIRC7, β-catenin, brc-abl, BRCA1, BORIS, CA9, carbonic anhydrase IX, caspase-8, CALR, CCR5, CD19, CD20 (MS4A1), CD22, CD30, CD40, CDK4, CEA, CTLA4, and cyclin -B1, CYP1B1, EGFR, EGFRvIII, ErbB2 / Her2, ErbB3, ErbB4, ETV6-AML, EpCAM, EphA2, Fra-1, FOLR1, GAGE ​​protein (e.g., GAGE-1, -2), GD2, GD3, GloboH, Glypican-3, GM3, gp100, Her2, HLA / B-raf, HLA / k-ras, HLA / MAGE-A3, hTE RT, LMP2, MAGE proteins (e.g., MAGE-1, -2, -3, -4, -6, and -12), MART-1, Mesothelin, ML-IAP, Muc1, Muc2, Muc3, Muc4, Muc5, Muc16 (CA-125), MUM1, NA17, NY-BR1, NY-BR62, NY-BR85, NY-ESO1, OX40, p15, p53, PAP, PAX3, PAX5, PCT The method according to claim 28, selected from A-1, PLAC1, PRLR, PRAME, PSMA (FOLH1), RAGE protein, Ras, RGS5, Rho, SART-1, SART-3, STEAP1, STEAP2, TAG-72, TGF-β, TMPRSS2, Thompson-nouvelle antigen (Tn), TRP-1, TRP-2, tyrosinase, and uroplakin-3.

30. The method according to any one of claims 27 to 29, wherein the TAA in the TAAxCD3 bispecific antibody is MUC16.

31. The TAAxCD3 bispecific antibody specifically binds to CD3 and comprises a first binding arm containing three heavy chain complementarity-determining regions (CDRs) (A1-HCDR1, A1-HCDR2, and A1-HCDR3) contained within a heavy chain variable region (HCVR) having the amino acid sequence of SEQ ID NO: 34, and three light chain CDRs (LCDR1, LCDR2, and LCDR3) contained within a light chain variable region (LCVR) having the amino acid sequence of SEQ ID NO: 39; and MUC16 The method according to any one of claims 27 to 30, wherein the MUC16xCD3 bispecific antibody specifically binds to and comprises a second binding arm containing three heavy chain complementarity determining regions (CDRs) (A2-HCDR1, A2-HCDR2, and A2-HCDR3) contained within an HCVR having the amino acid sequence of SEQ ID NO: 44 and three light chain CDRs (LCDR1, LCDR2, and LCDR3) contained within an LCVR having the amino acid sequence of SEQ ID NO: 39.

Images