Trans-splicing nucleic acid molecules and methods for using the same

Abstract

This disclosure provides compositions, systems, and methods for facilitating trans-splicing. In some examples, provided herein are compositions comprising or encoding trans-splicing nucleic acid molecules containing the 3' domain disclosed herein. In some embodiments, the 3' domain comprises one or more of the following domains: a nucleation domain, a stabilization domain, and a cleavage domain. In some embodiments, the 3' domain comprises a sequence or structure that functions as one, two, or all three of the nucleation domain, stabilization domain, and cleavage domain.

Description

[Technical Field]

[0001] Cross-reference of related applications This application claims priority to U.S. Provisional Patent Application No. 63 / 567,850, titled “NUCLEIC ACID MOLECULES TO PROMOTE TRANS-SPLICING,” filed on 20 March 2024, and to U.S. Provisional Patent Application No. 63 / 591,356, titled “RNA STRUCTUAL MOTIFS TO PROMOTE TRANS-SPLICING,” filed on 18 October 2023, each of which is incorporated herein by reference in its entirety for all purposes.

[0002] Submission of sequence listing The contents of the electronic sequence listing (309222000840SEQLIST.xml; size: 182,576 bytes; creation date: October 17, 2024) are incorporated herein by reference in their entirety.

[0003] Effective treatment of human genetic disorders may require the efficient repair of defective gene sequences within human cells. RNA transsplicing is an example of human gene therapy. [Background technology]

[0004] Effective treatment of human genetic disorders may require the efficient repair of defective gene sequences within human cells. RNA transsplicing is an example of human gene therapy. [Overview of the project]

[0005] In some embodiments, this specification provides transsplicing nucleic acid molecules comprising (a) an exon domain (e.g., one encoding a therapeutic sequence); (b) an intron domain configured to facilitate ribonucleic acid (RNA) transsplicing; (c) an antisense domain configured to bind to a target RNA molecule; and (d) a sequence or structure derived from or isolated from a ribozyme. In some embodiments, the ribozyme is selected from the group consisting of VS ribozymes, twister sister ribozymes, lanthanum ribozymes, pistol ribozymes, hairpin ribozymes, leadzymes, hatchet ribozymes, GIR1 branched ribozymes, glmS ribozymes, class I introns, class II introns, RNAse P, CoTC ribozymes, Hoylinc ribozymes, Varkud satellite ribozymes, CPEB3 ribozymes, and riboswitches. In some embodiments, the trans-splicing molecule further comprises a G-quadrilateral and / or pseudoknot, and optionally poly(A). In some embodiments, the trans-splicing molecule comprises, from 5' to 3', a G-quadrilateral and / or pseudoknot, and a sequence or structure derived from or isolated from a ribozyme, and optionally poly(A) at the 3' end. In some embodiments, the trans-splicing molecule comprises, from 5' to 3', a sequence or structure derived from or isolated from a ribozyme, a G-quadrilateral and / or pseudoknot, and optionally poly(A) at the 3' end. In any embodiment of this specification, the trans-splicing molecule may, but is not required to, include a hammerhead ribozyme, an HDV ribozyme, or a twister ribozyme.

[0006] In some embodiments, the Specified provides a transsplicing nucleic acid molecule comprising (a) an exon domain (e.g., one encoding a therapeutic sequence); (b) an intron domain configured to facilitate ribonucleic acid (RNA) transsplicing; (c) an antisense domain configured to bind to a target RNA molecule; and (d) a sequence or structure derived from or isolated from a ribozyme, wherein the transsplicing nucleic acid molecule does not contain 3' poly(A).

[0007] In some embodiments, the sequence or structure derived from or isolated from the ribozyme is located in the 3' domain of the transsplicing nucleic acid molecule. In some embodiments, the sequence or structure derived from or isolated from the ribozyme is located in the 5' domain of the transsplicing nucleic acid molecule.

[0008] In any embodiment of this specification, the ribozyme may be selected from the group consisting of hammerhead ribozyme, HDV ribozyme, twister ribozyme, twister sister ribozyme, lanthanum ribozyme, pistol ribozyme, hairpin ribozyme, VS ribozyme, leadzyme, hatchet ribozyme, GIR1 branched ribozyme, glmS ribozyme, class I intron, class II intron, RNAse P, CoTC ribozyme, Hoylinc ribozyme, Varkud satellite ribozyme, CPEB3 ribozyme, and riboswitch.

[0009] In any embodiment of this specification, the trans-splicing nucleic acid molecule may include a sequence or structure derived from or isolated from a twister sister ribozyme. In any embodiment of this specification, the trans-splicing nucleic acid molecule may include a sequence or structure derived from or isolated from a lanthanum ribozyme. In any embodiment of this specification, the trans-splicing nucleic acid molecule may include a sequence or structure derived from or isolated from a CPEB3 ribozyme. In some embodiments, the CPEB3 ribozyme is a mammalian CPEB3 ribozyme. In some embodiments, the CPEB ribozyme is a human CPEB3 ribozyme or a Pan troglodytes CPEB3 ribozyme. In any embodiment of this specification, the trans-splicing nucleic acid molecule may include a sequence or structure derived from or isolated from a VS ribozyme. In any embodiment of this specification, the trans-splicing nucleic acid molecule may include a sequence or structure derived from or isolated from a hatchet ribozyme.

[0010] In any embodiment of this specification, the ribozyme may be a ribozyme derived from or isolated from a eukaryote. In some embodiments, the eukaryote is a mammal. In some embodiments, the mammal is human or Pan troglodytes. In any embodiment of this specification, the ribozyme may be a ribozyme derived from or isolated from a virus. In any embodiment of this specification, the ribozyme may be a ribozyme derived from or isolated from a prokaryote. In some embodiments, the prokaryote is a bacterium.

[0011] In any of the embodiments herein, the ribozyme can be a mutant ribozyme. In any of the embodiments herein, the ribozyme can be an engineered ribozyme. In any of the embodiments herein, the ribozyme can be derived from or encoded by a lncRNA. In any of the embodiments herein, the ribozyme can be a self-cleaving ribozyme. In any of the embodiments herein, the ribozyme can be a self-alkylating ribozyme.

[0012] In any of the embodiments herein, the ribozyme can comprise one or more pseudoknots. In any of the embodiments herein, the ribozyme can be regulated by or can require one or more metal ion cofactors. In some embodiments, the one or more metal ion cofactors comprise a divalent cation. In some embodiments, the one or more metal ion cofactors are Mg 2+ comprising.

[0013] In any of the embodiments herein, the trans-splicing nucleic acid molecule can comprise a 3' domain comprising a cleavage domain, wherein the sequence or structure derived from or isolated from a ribozyme is a first ribozyme sequence or structure. In some embodiments, the cleavage domain comprises a second ribozyme sequence or structure that is the same as or different from the first ribozyme sequence or structure; a microprocessor substrate; an RNAse P / Z substrate; or any combination thereof. In some embodiments, the cleavage domain comprises a sequence or structure derived from or isolated from a ribozyme. In some embodiments, the cleavage domain does not comprise a sequence or structure derived from or isolated from a ribozyme.

[0014] In any of the embodiments of the present specification, the trans-splicing nucleic acid molecule may comprise a 3' domain that includes a stabilization domain. In some embodiments, the stabilization domain comprises a sequence or structure derived from or isolated from a ribozyme. In some embodiments, the stabilization domain does not comprise a sequence or structure derived from or isolated from a ribozyme. In some embodiments, the stabilization domain comprises a G-quadruplex and / or a pseudoknot. In some embodiments, the stabilization domain comprises a G-quadruplex. In some embodiments, the stabilization domain comprises a pseudoknot.

[0015] In any of the embodiments of the present specification, the trans-splicing nucleic acid molecule may comprise a 3' domain that includes a nuclear retention domain. Optionally, in some embodiments, the nuclear retention domain comprises a triple helix, a pseudoknot, a riboswitch, a G-quadruplex, RNAse P RNA, a stem-loop structure, snoRNA, or any combination thereof. In some embodiments, the triple helix is a viral helix. In some embodiments, the triple helix is a human triple helix. In some embodiments, the G-quadruplex is a telomerase G-quadruplex. In some embodiments, the nuclear retention domain comprises a sequence or structure derived from or isolated from a ribozyme. In some embodiments, the nuclear retention domain does not comprise a sequence or structure derived from or isolated from a ribozyme.

[0016] In any of the embodiments of the present specification, the trans-splicing nucleic acid molecule may comprise, from 5' to 3', a 3' domain comprising a G-quadruplex and / or a pseudoknot, as well as a sequence or structure derived from or isolated from a ribozyme. In any of the embodiments of the present specification, the trans-splicing nucleic acid molecule may comprise, from 5' to 3', a 3' domain comprising a sequence or structure derived from or isolated from a ribozyme, as well as a G-quadruplex and / or a pseudoknot.

[0017] In any embodiment of this specification, sequences or structures derived from or isolated from ribozymes can increase the trans-splicing efficiency of a trans-splicing nucleic acid molecule. In some embodiments, the increase in trans-splicing efficiency is at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 100%, at least about 200%, at least about 300%, at least about 400%, at least about 500%, at least about 600%, at least about 700%, at least about 800%, at least about 900%, or 1000% compared to a reference trans-splicing nucleic acid molecule that does not contain sequences or structures derived from or isolated from ribozymes.

[0018] In any embodiment of this specification, the transsplicing nucleic acid molecule may further comprise a G-quadruplicate and / or pseudoknot that increases the transsplicing efficiency of the transsplicing nucleic acid molecule. In some embodiments, the increase in transsplicing efficiency is at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 100%, at least about 200%, at least about 300%, at least about 400%, at least about 500%, at least about 600%, at least about 700%, at least about 800%, at least about 900%, or 1000% compared to a reference transsplicing nucleic acid molecule that does not contain a sequence or structure derived from or isolated therefrom the ribozyme and the G-quadruplicate and / or pseudoknot.

[0019] In any embodiment of this specification, the target RNA molecule may be intracellular. In any embodiment of this specification, the target RNA molecule may be messenger RNA (mRNA) or pre-mRNA. In any embodiment of this specification, the target RNA molecule may include mutations. In some embodiments, the mutation is selected from the group consisting of missense mutations, nonsense mutations, frameshift mutations, insertions, duplications, inversions, deletions, splice site mutations, and truncated mutations. In some embodiments, the mutation is a pathogenic mutation.

[0020] In any embodiment of this specification, the transsplicing nucleic acid molecule may be packaged within a viral vector for delivery to a target requiring it. In some embodiments, the viral vector is a herpes simplex virus (HSV) vector. In some embodiments, the viral vector is an adeno-associated virus (AAV) vector.

[0021] In some embodiments, the Specified herein provides compositions comprising any of the above-described viral vectors and pharmaceutically acceptable carriers or excipients. In any embodiment of the Specified herein, trans-splicing nucleic acid molecules may be packaged within lipid nanoparticles for delivery to a target requiring it.

[0022] In some embodiments, compositions comprising the above-mentioned lipid nanoparticles and a pharmaceutically acceptable carrier or excipient are provided herein. In any of the embodiments herein, the manipulated nucleic acids may be packaged in vesicles for delivery to a target requiring them. In some embodiments herein, compositions comprising the above-mentioned vesicles and a pharmaceutically acceptable carrier or excipient are provided herein.

[0023] Built-in by reference All publications, patents, and patent applications referenced herein are incorporated by reference to the same extent as each individual publication, patent, or patent application is specifically and individually incorporated by reference. To the extent that any publications, patents, or patent applications incorporated by reference conflict with any disclosures contained herein, the provisions of this specification shall prevail and supersede any such conflict.

[0024] The novel features of the present invention are specifically described in the appended claims. The features and advantages of the present invention will be better understood by referring to the following embodiments for carrying out the invention, which specify exemplary embodiments in which the principles of the present invention are utilized, and to the accompanying drawings (hereinafter referred to as "FIG." and "Figures"). [Brief explanation of the drawing]

[0025] [Figure 1] Figures A-C illustrate the problem of human genetic disorders and provide schematic diagrams of gene repair using trans-splicing nucleic acid molecules containing a 3' domain. Figure A illustrates the concept of human genetic disorders in which a mutated ("defective") DNA sequence is transcribed into RNA that directly contributes to the disease or translated into a pathogenic protein. Figure B illustrates an exemplary gene repair approach utilizing the trans-splicing described herein. In this example, a mutated gene is repaired by trans-splicing RNA containing a 3' domain. Figure C shows subdomains present in the 3' domain. Specifically, the 3' domain includes a nucleation domain, a stabilization domain, and a cleavage domain.

[0026] [Figure 2]Sections A-C illustrate challenges related to the trans-splicing technologies and solutions described herein. Section A describes the mechanism of truncated protein production by trans-splicing therapies. Specifically, truncated mRNA produced by trans-splicing RNA can cause toxicity in human cells. Sections B-C describe two exemplary mechanisms by which truncated proteins can be eliminated through the use of the 3' domain of trans-splicing RNA. Section B represents the activity of the cleavage domain, which results in the elimination of polyadenylated tails present on the trans-splicing RNA, thereby preventing translation of the trans-splicing RNA in the absence of the trans-splicing reaction. Section C demonstrates the activity of the 3' domain, thereby promoting nuclear retention of the trans-splicing RNA, and thereby increasing trans-splicing efficiency.

[0027] [Figure 3] This paper presents experimental data describing the relative capabilities of different 3' domains in increasing the editing efficiency of the target RNA (CEP290).

[0028] [Figure 4] Figures A–C illustrate schematic diagrams of gene repair using trans-splicing nucleic acid molecules (e.g., trans-splicing RNA) containing a 3' domain. Figure A illustrates the concept of human genetic disease in which a mutated ("defective") DNA sequence is transcribed into RNA directly contributing to the disease or translated into a pathogenic protein. Figure B illustrates an exemplary gene repair approach utilizing the trans-splicing described herein. In this example, a mutated gene is repaired by trans-splicing RNA containing a 3' domain. Figure C shows the 3' domain of the trans-splicing nucleic acid molecule. The 3' domain may include sequences or structures derived from or isolated from ribozymes, as well as optionally G-quadriplexes and / or pseudoknots.

[0029] [Figure 5]This shows the relative repair efficiency of various 3' domains.

[0030] [Figure 6A] This shows the trans-splicing efficiency of a trans-splicing system targeting CEP290. It also shows the distribution of trans-splicing efficiency of a trans-splicing system containing a specific ribozyme. [Figure 6B] This shows the transsplicing efficiency of a transsplicing system targeting CEP290. It also shows the transsplicing efficiency of a specific transsplicing nucleic acid molecule.

[0031] [Figure 7] This shows the relative editing efficiency of transsplicing systems targeting intron 8, intron 11, or intron 17 of SCN1A. [Modes for carrying out the invention]

[0032] Unless otherwise defined, all technical terms, notations, and other technical and scientific or specialized terms used herein are intended to have the same meaning as that generally understood by those skilled in the art in which the claimed subject matter relates. Where a term having a generally understood meaning is defined herein for clarity and / or immediate reference, the inclusion of such a definition herein should not necessarily be interpreted as meaning that there is a substantial difference from the generally understood definition in the art.

[0033] As used herein, the term “about” means that there is a normal range of error for each value, which will be readily apparent to those skilled in the art. In this specification, references to “about” with respect to a value or parameter include (and are described) embodiments directed toward the value or parameter itself.

[0034] As used herein, the singular forms of “a,” “an,” and “the” include multiple subjects unless the context clearly indicates otherwise. For example, “a” or “an” means “at least one” or “one or more.”

[0035] Throughout this disclosure, various aspects of the claimed subject matter are presented in scope form. It should be understood that the scope form is for convenience and brevity only and should not be interpreted as an inflexible limitation on the scope of the claimed subject matter. Where values ​​are described in scope form, such description should be understood to include all possible sub-scopes within that scope, as well as any specific numerical values ​​(whether such specific numerical values ​​or sub-scopes are explicitly stated or not). For example, if a range of values ​​is provided, each of the values ​​between the upper and lower limits of that range, and any other values ​​described or intervening within that scope, should be understood to be included within the scope of the claimed subject matter. These narrower upper and lower limits may, independently, be included within the narrower range, and are also included within the scope of the claimed subject matter, with the exception of any specifically excluded limits. If an explicitly stated scope includes one or both limits, the scope excluding either one or both of those included limits is also included within the claimed subject matter. This applies regardless of the width of the scope.

[0036] When the term "each" is used in reference to a set of items, it is intended to identify the individual items within the set, but does not necessarily refer to all items within the set unless explicitly stated otherwise or the context of use clearly indicates otherwise.

[0037] In the claims, the use of ordinal terms such as “first,” “second,” and “third” to modify claim elements does not, in itself, imply any priority, order, or temporal sequence in which each action of the method is performed relative to another claim element. The ordinal terms are merely used as labels to distinguish one claim element having a particular name from another element having the same name (which would otherwise be the same if the ordinal terms were not used). Similarly, the use of a), b), etc., or i), ii), etc., in the claims does not, in itself, imply any priority, order, or sequence of steps. Likewise, the use of these terms in the specification does not, in itself, imply any essential priority, order, or sequence.

[0038] The headings used in this specification are for organizational purposes only and should not be construed as limiting the subjects described.

[0039] overview This disclosure provides nucleic acid molecules (e.g., RNA molecules) that selectively bind to target RNA molecules to promote transsplicing reactions and possess a 3' domain that facilitates transsplicing reactions. This disclosure provides vectors, compositions, and cells that contain or encode transsplicing RNA molecules. This disclosure provides methods for using the transsplicing nucleic acid molecules, vectors, compositions, and cells of this disclosure to treat diseases or disorders.

[0040] In one embodiment, the present invention relates to a transsplicing nucleic acid molecule (e.g., a transsplicing RNA molecule), which comprises a sequence or structure derived from or isolated from a ribozyme and different types of domains. One domain type is an exon domain that is inserted into a target RNA molecule via a transsplicing reaction. A second domain type is an antisense domain complementary to the target RNA. A third domain type is an intron domain that facilitates the transsplicing reaction between the transsplicing RNA molecule and the target RNA. A fourth domain is a 3' domain having a sequence that increases the transsplicing efficiency.

[0041] In one embodiment, the Specified provides a transsplicing nucleic acid molecule comprising (a) an exon domain (e.g., one encoding a therapeutic sequence); (b) an intron domain configured to facilitate ribonucleic acid (RNA) transsplicing; (c) an antisense domain configured to bind to a target RNA molecule; and (d) a sequence or structure derived from or isolated from a ribozyme, wherein the ribozyme is selected from the group consisting of VS ribozymes, twister sister ribozymes, lanthanum ribozymes, pistol ribozymes, hairpin ribozymes, leadzymes, hatchet ribozymes, GIR1 branched ribozymes, glmS ribozymes, class I introns, class II introns, RNAse P, CoTC ribozymes, Hoylinc ribozymes, Varkud satellite ribozymes, mammalian CPEB3 ribozymes, and riboswitches.

[0042] In one embodiment, this specification provides a transsplicing nucleic acid molecule comprising (a) an exon domain (e.g., encoding a therapeutic sequence); (b) an intron domain configured to facilitate ribonucleic acid (RNA) transsplicing; (c) an antisense domain configured to bind to a target RNA molecule; (d) a sequence or structure derived from or isolated from a ribozyme; and (e) a 3' domain, wherein the 3' domain is poly(A). In some embodiments, the 3' domain comprises a sequence or structure derived from or isolated from a ribozyme. In some embodiments, the 3' domain does not comprise a sequence or structure derived from or isolated from a ribozyme. This novel domain increases transsplicing efficiency by promoting RNA processing phenomena favorable for efficient transsplicing. The 3' domain comprises up to three subdomains, namely a nucleation domain, a stabilization domain, and a cleavage domain. While not wishing to be constrained by any theory, the nucleation domain facilitates the localization of transsplicing RNA to the nucleus, which is the site of transsplicing activity. The stabilizing domain reduces the turnover of trans-splicing RNA. The cleavage domain removes the RNA tail, thereby reducing nuclear export and consequently decreasing the incidental RNA processing activity that interferes with trans-splicing. This novel combination of typical trans-splicing domains (exons, introns, and antisense domains) and the 3' domain promotes RNA trans-splicing in a manner sufficient to replace pathogenic RNA sequences in human cells to address disease. In fact, low efficiency is a major barrier to many nucleic acid editing approaches, including RNA trans-splicing. This disclosure provides compositions and methods for specifically targeting pathogenic RNA molecules and replacing pathogenic RNA sequences within these RNA molecules with high efficiency. Implementations of trans-splicing RNA molecules demonstrate utility in a variety of contexts, including the substitution of pathogenic sequences or the insertion of manipulated sequences into target RNA.The manipulated sequence can alter the translation or stability of the target RNA, thereby increasing or decreasing protein production or target RNA levels. This disclosure provides vectors, compositions, and cells containing or encoding transsplicing nucleic acid molecules (e.g., transsplicing RNA molecules), as well as methods for using transsplicing nucleic acid molecule (e.g., transsplicing RNA molecule) compositions.

[0043] In one embodiment, the present invention is an RNA technology that enables the substitution of any sequence in a specific RNA molecule within a living cell. This RNA trans-splicing technology utilizes naturally occurring spliceosomes in human cells to provide catalytic activity for this trans-splicing process. Typically, RNA splicing occurs within an RNA molecule, where exons are ligated and introns are removed from immature messenger RNA molecules (pre-mRNA) to form mature messenger RNA molecules (mRNA). This process is called cis-splicing and requires a group of enzymes and non-coding RNAs collectively known as spliceosomes. RNA trans-splicing is the process by which spliceosomes ligate exons derived from different, distinct RNA molecules. This process occurs rarely in human cells, but modern systems that facilitate RNA trans-splicing are active at low levels. The present invention includes compositions that increase the efficiency of RNA trans-splicing. These improved RNA trans-splicing compositions can be used to replace mutant sequences within target RNA molecules to address human diseases. The substitution of arbitrary RNA sequences is a common capability with countless specific applications, some of which are being explored as relevant experimental applications. RNA trans-splicing can insert an engineered sequence into a target RNA, thereby conferring new activity to the target RNA, such as altering RNA stability or RNA translation. This capability can be used to increase protein production by the target RNA. In its broadest sense, this RNA trans-splicing technique can introduce arbitrary changes to both the coding and non-coding regions of the target RNA.

[0044] The references describe the use of sequences derived from mRNA, long non-coding RNA, and synthetic sequences to modify the localization of various transcript types within the cell nucleus (Espinoza et al., 2007; Guo et al., 2020; Long et al., 2017; Lubelsky and Ulitsky, 2018; Miyagawa et al., 2012; Shukla et al., 2018; Wilusz et al., 2012). In fact, various RNA sequences placed in heterogeneous contexts are known to promote RNA accumulation in the nucleus. Typically, these sequences are derived from long non-coding RNAs such as MALAT1 and contain localization sequences that cleave the polyadenylated tail of RNA and promote tertiary structures that stabilize RNA and / or nuclear retention (Wilusz et al., 2012). However, little is known about whether heterogeneous sequences from other sources can combine to produce superior nuclear localization phenomena. Because the activity of many known RNA sequences is context-dependent, we considered a separate group of 3' domain sequences that would function in the context of transsplicing. This was confirmed by experiments showing that the activity of a 3' domain in other contexts does not necessarily predict its activity in transsplicing.

[0045] An important safety aspect associated with trans-splicing systems is their ability to prevent protein production from trans-splicing RNA before the trans-splicing reaction occurs. In some embodiments, the 3' domain is configured to prevent protein production from the trans-splicing molecule in the absence of the trans-splicing reaction. In some embodiments, the presence of the 3' domain includes three subdomains: a stabilizing domain, a nucleation domain, and a cleavage domain. In some embodiments, the activity of the 3' domain is configured to suppress the expression of a protein product encoded by the trans-splicing RNA molecule or a portion thereof in the absence of association of two or more exon domains. In some embodiments, the activity of the 3' domain is configured to suppress the expression of a protein product encoded by the trans-splicing RNA molecule or a portion thereof in the absence of a trans-splicing reaction between the trans-splicing RNA molecule and the target RNA. In some embodiments, the 3' domain is configured to remove the exon domain of the transsplicing RNA molecule in the absence of a transsplicing reaction between the transsplicing RNA molecule and the target RNA.

[0046] In some embodiments, the stabilizing domain forms a tertiary RNA structure. In some embodiments, the stabilizing domain is isolated from or derived from a sequence selected from the group consisting of RNA pseudoknots, RNA triple helix, riboswitches, and aptamers. In some embodiments, the cleavage domain facilitates the cleavage of the RNA molecule. In some embodiments, the stabilizing domain includes a sequence or structure derived from or isolated from a ribozyme. In some embodiments, the ribozyme is selected from the group consisting of hammerhead ribozymes, HDV ribozymes, twister ribozymes, twister sister ribozymes, lanthanum ribozymes, pistol ribozymes, hairpin ribozymes, VS ribozymes, reedzymes, hatchet ribozymes, GIR1 branched ribozymes, glmS ribozymes, class I introns, class II introns, RNase P, CoTC ribozymes, Hoylinc ribozymes, Varkud satellite ribozymes, mammalian CPEB3 ribozymes, and riboswitches.

[0047] In some embodiments, the cleavage domain comprises a sequence or structure derived from or isolated from a ribozyme. In some embodiments, the ribozyme is selected from the group consisting of hammerhead ribozymes, HDV ribozymes, twister ribozymes, twister sister ribozymes, lanthanum ribozymes, pistol ribozymes, hairpin ribozymes, VS ribozymes, leadzymes, hatchet ribozymes, GIR1 branched ribozymes, glmS ribozymes, class I introns, class II introns, RNase P, CoTC ribozymes, Hoylinc ribozymes, Varkud satellite ribozymes, mammalian CPEB3 ribozymes, and riboswitches.

[0048] In some embodiments, the nuclear retention domain facilitates the localization of trans-splicing RNA to the cell nucleus. In some embodiments, the nuclear retention domain is isolated from or derived from viral ENE (expression and nuclear retention element) sequences, human ENE sequences, NEAT1 ENE sequences, XIST, BORG, TUG1, MEG3, GAS5, human lncRNA, or mouse lncRNA. In some embodiments, each retention domain comprises a sequence or structure derived from or isolated from a ribozyme. In some embodiments, the ribozyme is selected from the group consisting of hammerhead ribozyme, HDV ribozyme, twister ribozyme, twister sister ribozyme, lanthanum ribozyme, pistol ribozyme, hairpin ribozyme, VS ribozyme, leadzyme, hatchet ribozyme, GIR1 branched ribozyme, glmS ribozyme, class I intron, class II intron, RNase P, CoTC ribozyme, Hoylinc ribozyme, Varkud satellite ribozyme, mammalian CPEB3 ribozyme, and riboswitch.

[0049] Transsplicing nucleic acid molecules may include RNA, DNA, DNA / RNA hybrids, nucleic acid analogs, chemically modified nucleic acids, chimeras composed of two or more nucleic acids or nucleic acid analogs, or any combination thereof. Transsplicing nucleic acid molecules containing DNA may be transcribed from DNA to RNA. Transsplicing nucleic acid molecules containing DNA may be transcribed from DNA to RNA when administered to a subject. Transsplicing nucleic acid molecules (e.g., transsplicing RNA molecules) may associate with target RNA via transsplicing. The target RNA sequence or a portion thereof may have mutated or missing sequences. The function of the target RNA sequence or a portion thereof may be treated or restored by binding and / or substitution of one or more exon domains of the target RNA sequence or a portion thereof.

[0050] The nucleic acid molecules of this disclosure may be provided intracellularly. The nucleic acid molecules provided herein may be administered to cells. The nucleic acid molecules provided herein may be delivered intracellularly. Cells may include human cells. For example, DNA molecules or RNA molecules may be provided intracellularly or delivered intracellularly. Target RNA may be present intracellularly. For example, target RNA may be present in human cells. Target RNA may be messenger RNA (mRNA) or pre-mRNA. The nucleic acid molecules provided herein may be for trans-splicing and may be referred to as trans-splicing nucleic acid molecules.

[0051] Incorporating localization sequences into the transsplicing nucleic acid molecules that form this RNA transsplicing technology is a common feature that further enables modification of non-coding sequences within target RNA. By efficiently replacing the 5' or 3' untranslated region of the target RNA, the present invention can modify RNA behavior such as translation or turnover. As a result of these combined effects, increased protein production from the target RNA or other downstream effects associated with RNA-level modification occur.

[0052] Nucleic acid molecules may contain or encode nucleic acid sequences that promote trans-splicing. For example, a trans-splicing nucleic acid molecule may contain one or more intron domains. One or more intron domains may possess binding sites that are preferentially targeted by RNA-binding proteins with pathogenic mutations. In some embodiments, pathogenic mutations may be insertions, duplications, inversions, deletions, splice site mutations, missense mutations, nonsense mutations, frameshift mutations, or truncated mutations. In some embodiments, the intron domains contain one or more trans-splicing enhancement sequences. In some embodiments, the trans-splicing enhancement sequences are configured to bind to engineered U1 snRNA (ESM). In some embodiments, the ESM contains engineered nuclear small RNA (esnRNA). Antisense domains are configured to bind to target mRNA or pre-mRNA. A trans-splicing nucleic acid molecule may contain one or more domains that bind to RNA-binding proteins. The nucleic acid sequences provided herein may contain or encode one or more engineered U1 snRNA (ESM). ESM may contain one or more engineered non-coding RNA molecules that can enhance trans-splicing. The engineered non-coding RNA molecules may include engineered snRNA (e.g., esnRNA) that can mobilize RNPs of the spliceosome. The trans-splicing nucleic acid molecule may contain one or more trans-splicing enhancers.

[0053] In some embodiments, the nucleic acid sequence of this disclosure is provided by a single nucleic acid molecule. In some embodiments, the nucleic acid sequence is provided by two or more nucleic acid molecules. In some embodiments, two or more nucleic acid molecules are provided to cells in a single vector. In some embodiments, two or more nucleic acid molecules are provided to cells in two or more vectors. In some embodiments, the vector is a recombinant virus.

[0054] composition In one embodiment, this specification provides a composition comprising an engineered nucleic acid molecule for RNA transsplicing (e.g., a transsplicing nucleic acid molecule).

[0055] In one embodiment, the Specified provides a transsplicing nucleic acid molecule comprising (a) an exon domain (e.g., one encoding a therapeutic sequence); (b) an intron domain configured to facilitate ribonucleic acid (RNA) transsplicing; (c) an antisense domain configured to bind to a target RNA molecule; and (d) a sequence or structure derived from or isolated from a ribozyme, wherein the ribozyme is selected from the group consisting of VS ribozymes, twister ribozymes, twister sister ribozymes, lanthanum ribozymes, pistol ribozymes, hairpin ribozymes, reedzymes, hatchet ribozymes, GIR1 branched ribozymes, glmS ribozymes, class I introns, class II introns, RNAse P, CoTC ribozymes, Hoylinc ribozymes, Varkud satellite ribozymes, mammalian CPEB3 ribozymes, and riboswitches.

[0056] In one embodiment, the Specified provides a transsplicing nucleic acid molecule comprising (a) an exon domain (e.g., encoding a therapeutic sequence); (b) an intron domain configured to facilitate ribonucleic acid (RNA) transsplicing; (c) an antisense domain configured to bind to a target RNA molecule; (d) a sequence or structure derived from or isolated from a ribozyme; and (e) a 3' domain, wherein the 3' domain is poly(A). In some embodiments, the 3' domain comprises a sequence or structure derived from or isolated from a ribozyme. In some embodiments, the 3' domain does not comprise a sequence or structure derived from or isolated from a ribozyme.

[0057] In some embodiments, the transsplicing nucleic acid molecule comprises a transsplicing RNA molecule. In some embodiments, the engineered nucleic acid molecule comprises two or more nucleic acid sequences, each encoding a portion of the transsplicing nucleic acid molecule (e.g., a transsplicing RNA molecule). The nucleic acid sequences may encode or include an antisense domain, a 3' domain, an exon domain, an intron domain, an antisense domain, a splicing enhancer, a domain that binds to an RNA-binding protein, or any combination thereof. In some embodiments, the composition further comprises an engineered U1 snRNA (ESM) that binds to the transsplicing RNA molecule and facilitates transsplicing.

[0058] In some embodiments, the trans-splicing molecule promotes trans-splicing in the absence of CRISPR / Cas. In some embodiments, the trans-splicing molecule promotes trans-splicing in the presence of CRISPR / Cas.

[0059] Antisense Domain This disclosure provides nucleic acid molecules comprising nucleic acid sequences that encode or contain one or more antisense domains. The nucleic acids may include RNA, DNA, DNA / RNA hybrids, and / or at least one of nucleic acid analogs, chemically modified nucleic acids, or chimeras composed of two or more nucleic acids or nucleic acid analogs. The nucleic acids may include RNA. A nucleic acid containing RNA may encode one or more antisense domains. A nucleic acid containing RNA may be a trans-splicing RNA molecule. The nucleic acids may include DNA. A nucleic acid containing DNA may encode one or more antisense domains. One or more antisense domains of a nucleic acid containing DNA may be transcribed into a trans-splicing RNA molecule containing one or more antisense domains. The antisense domains may facilitate the association of two or more exon domains.

[0060] One or more antisense domains may be provided on a nucleic acid molecule. An antisense domain may bind to another antisense domain. In some embodiments, an antisense domain binds to another antisense domain via covalent bonding. In some embodiments, an antisense domain binds to another antisense domain via non-covalent bonding. In some embodiments, an antisense domain comprises one or more nucleic acid sequences complementary to another antisense domain. An antisense domain may bind to a target RNA. In some embodiments, an antisense domain binds to a target RNA via covalent bonding. In some embodiments, an antisense domain binds to another target RNA via non-covalent bonding. In some embodiments, an antisense domain comprises one or more nucleic acid sequences complementary to a target RNA.

[0061] In some embodiments of the compositions of this disclosure, the target RNA molecule is a pathogenic RNA molecule. In some embodiments, the target RNA comprises a target sequence complementary to the antisense domain of the trans-splicing RNA of this disclosure.

[0062] In some embodiments of the compositions and methods of this disclosure, the target sequence comprises or consists of 5 to 500 nucleotides. In some embodiments, the target sequence comprises or consists of 50 to 250 nucleotides. In some embodiments, the target sequence comprises or consists of 5 to 50 nucleotides.

[0063] In some embodiments of the compositions and methods of this disclosure, the target sequence is contained within a single continuous stretch of target RNA. In some embodiments, the target sequence may consist of one or more nucleotides that are not spread across a single continuous stretch of target RNA.

[0064] In some embodiments of the present disclosure, the antisense domain of the present disclosure binds to a target sequence. In some embodiments of the present disclosure, the antisense domain of the present disclosure binds to a target RNA.

[0065] In some embodiments of this disclosure, the antisense domain is selected such that successful trans-splicing removes the microopen reading frame in the target RNA. In this way, the trans-splicing system removes the microopen reading frame and increases protein production from the target RNA.

[0066] In some embodiments of the compositions of this disclosure, the sequence containing the antisense domain has complementarity with respect to the target RNA sequence of at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or any percentage in between. In some embodiments, the antisense domain has 100% complementarity with respect to the target RNA sequence. The antisense domain contains or consists of approximately 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, or more nucleotides that are complementary to the target RNA sequence.

[0067] In some embodiments, the antisense domain is TNFRSF13B[ENSG00000240505] (unclassifiable immunodeficiency); ADA, CECR1[ENSG00000196839, ENSG00000093072] (adenosine deaminase deficiency); IL2RG[ENSG00000147168] (X-linked severe combined immunodeficiency); HBB[ENSG00000244734] (beta-thalassemia); HB A1, HBA2 [ENSG00000206172, ENSG00000188536] (Alpha-thalassemia); U2AF1 [ENSG00000160201] (Myelodysplastic syndrome); SOD1, TARDBP, FUS, MATR3, SOD1, C9ORF72 [ENSG00000142168, ENSG00000120948, ENSG00000089280, ENSG00000015479, ENSG0000 0142168, ENSG00000147894] (Amyotrophic Lateral Sclerosis); MAPT, PGRN [ENSG00000186868, ENSG00000030582] (Frontotemporal Dementia with Parkinsonian Syndrome); CDH23, MYO7A, USH2A [ENSG00000107736, ENSG00000137474, ENSG00000042781] (Usher Syndrome); GALC [ENSG000000 54983] (Krabbe disease); SMPD1, NPC1, NPC2 [ENSG00000166311, ENSG00000141458, ENSG00000119655] (Niemann-Pick disease); PRNP [ENSG00000171867] (Prion disease); SCN1A [ENSG00000144285] (Dravat syndrome); PINK1, ATPGAP2 [ENSG00000158828] (Juvenile Parkinson's disease);ATXN1, ATXN2, ATXN3, PLEKHG4, SPTBN2, CACNA1A, ATXN7, TTBK2, PPP2R2B, KCNC3, PRKCG, ITPR1, TBP, KCND1, FGF14[ENSG00000124788, ENSG00 000204842, ENSG00000066427, ENSG00000196155, ENSG00000173898, ENSG00000141837, ENSG00000163635, ENSG00000128881, ENSG00000156 475, ENSG00000131398, ENSG00000126583, ENSG00000150995, ENSG00000112592, ENSG00000102057, ENSG00000102466] (Spinocerebellar ataxia); SCN1A, SCN2A, CACNA1A, GRIN2B, GRIN2A, MECP2, FOXG1, SLC6A1, PRRT2, PTEN, KCNQ2, KCNQ3, STARD7, CLRN1 [ENSG00000144285, ENSG00000136531, ENSG0 [0000141837, ENSG00000273079, ENSG00000183454, ENSG00000169057, ENSG00000176165, ENSG00000157103, ENSG00000167371, ENSG00000171862, ENSG00000075043, ENSG00000184156, ENSG00000084090, ENSG00000163646] (Hereditary epilepsy); ATM [ENSG00000149311] (Ataxia with telangiectasia); GL B1[ENSG00000170266](GM1 gangliosidosis); GBA[ENSG00000177628](Gaucher disease); GM2A[ENSG00000196743](GM2 gangliosidosis); UBE3A[ENSG00000114062](Angelman syndrome); SLC2A1[ENSG00000117394](glucose transporter 1 deficiency); LAMP2[ENSG00000005893](Danon disease); GLA[ENSG00000102393](Fabry disease);PKD1, PKD2 [ENSG00000008710, ENSG00000118762] (Autosomal dominant polycystic kidney disease); GAA [ENSG00000171298] (Pompe disease); PCSK9, LDLR, APOB, APOE [ENSG00000169174, ENSG00000130164, ENSG00000084674, ENSG00000130203] (Familial hypercholesterolemia); MYOC, OPTN, TBK1, WDR36, CYPIB1 [ENSG00000034971, ENSG0000012 3240, ENSG00000183735, ENSG00000134987, ENSG00000138061] (Open-angle glaucoma); IDUA [ENSG00000127415] (Harler syndrome or mucopolysaccharidosis type 1); IDS [ENSG00000010404] (Hunter syndrome or mucopolysaccharidosis type 2); CLN3 [ENSG00000188603] (Batten disease); DMD [ENSG00000198947] (Duchenne muscular dystrophy); LMNA [ENSG00000160789] (Limb-girdle muscular dystrophy) (Type 1B); DYSF[ENSG00000135636] (Limb-girdle muscular dystrophy type 2B); SGCA[ENSG00000108823] (Limb-girdle muscular dystrophy type 2D); SGCB[ENSG00000163069] (Limb-girdle muscular dystrophy type 2E); SGCG[ENSG00000102683] (Limb-girdle muscular dystrophy type 2C); SGCD[ENSG00000170624] (Limb-girdle muscular dystrophy type 2F); DUX4[ENSG00000260596] (Facioscapulohumeral muscular dystrophy); F9[ENS G00000101981](Hemophilia B); F8[ENSG00000185010](Hemophilia A); USH2A, RPGR, RP2, RHO, PRPF31, USH1F, PRPF3, PRPF6[ENSG00000156313, ENSG00000102218, ENSG00000163914, ENSG00000105618, ENSG00000150275, ENSG00000117360, ENSG00000101161](Retinitis Pigmentosa); CFTR[ENSG00000001626](Cystic Fibrosis);It is inversely complementary to RNA transcribed from genes selected from the group consisting of GJB2, GJB6, STRC, DFNA1, WFS1 [ENSG00000165474, ENSG00000121742, ENSG00000242866, ENSG00000131504, ENSG00000109501] (autosomal dominant hearing impairment); and POU3F3 [ENSG00000198914] (non-syndromic hearing loss).

[0068] In some embodiments, the antisense domain(s) may be adjacent to the 5' end of the transsplicing molecule. In some embodiments, the antisense domain(s) may be located from the 5' end of the transsplicing molecule, starting from at least 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, 25 nucleotides, 26 nucleotides, 27 nucleotides, 28 nucleotides, 29 nucleotides, 30 nucleotides, 31 nucleotides, 31 nucleotides, 32 nucleotides, 33 nucleotides, 34 nucleotides, 35 nucleotides, 36 nucleotides, 37 nucleotides 100 nucleotides, 110 nucleotides, 120 nucleotides, 130 nucleotides, 140 nucleotides, 150 nucleotides, 160 nucleotides, 170 nucleotides, 180 nucleotides, 190 nucleotides, 200 nucleotides, 250 nucleotides, 300 nucleotides, 400 nucleotides, 400 nucleotides, 45 nucleotides, 46 nucleotides, 47 nucleotides, 48 ​​nucleotides, 49 nucleotides, 50 nucleotides, 55 nucleotides, 60 nucleotides, 65 nucleotides, 70 nucleotides, 75 nucleotides, 80 nucleotides, 85 nucleotides, 90 nucleotides, 95 nucleotides, or at least 500 nucleotides away from ethide.

[0069] In some embodiments, the antisense domain(s) may be adjacent to the 3' end of the transsplicing molecule. In some embodiments, the antisense domain(s) may be located from the 3' end of the transsplicing molecule, starting from at least 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, 25 nucleotides, 26 nucleotides, 27 nucleotides, 28 nucleotides, 29 nucleotides, 30 nucleotides, 31 nucleotides, 31 nucleotides, 32 nucleotides, 33 nucleotides, 34 nucleotides, 35 nucleotides, 36 nucleotides, 37 nucleotides 100 nucleotides, 110 nucleotides, 120 nucleotides, 130 nucleotides, 140 nucleotides, 150 nucleotides, 160 nucleotides, 170 nucleotides, 180 nucleotides, 190 nucleotides, 200 nucleotides, 250 nucleotides, 300 nucleotides, 400 nucleotides, 400 nucleotides, 45 nucleotides, 46 nucleotides, 47 nucleotides, 48 ​​nucleotides, 49 nucleotides, 50 nucleotides, 55 nucleotides, 60 nucleotides, 65 nucleotides, 70 nucleotides, 75 nucleotides, 80 nucleotides, 85 nucleotides, 90 nucleotides, 95 nucleotides, or at least 500 nucleotides away from ethide.

[0070] In some embodiments, the antisense domain(s) in the 5' direction have at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 31, 32, 33, 34, 35 nucleotides from the first nucleotide of the exon domain or antisense domain. The nucleotides are separated by 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 400, or at least 500 nucleotides or more.

[0071] In some embodiments, the antisense domain(s) in the 3' direction have at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 31, 32, 33, 34, 35 nucleotides from the last nucleotide of the exon domain or antisense domain. The rheotide is separated by 36 nucleotides, 37 nucleotides, 38 nucleotides, 39 nucleotides, 40 nucleotides, 41 nucleotides, 42 nucleotides, 43 nucleotides, 44 nucleotides, 45 nucleotides, 46 nucleotides, 47 nucleotides, 48 ​​nucleotides, 49 nucleotides, 50 nucleotides, 55 nucleotides, 60 nucleotides, 65 nucleotides, 70 nucleotides, 75 nucleotides, 80 nucleotides, 85 nucleotides, 90 nucleotides, 95 nucleotides, 100 nucleotides, 110 nucleotides, 120 nucleotides, 130 nucleotides, 140 nucleotides, 150 nucleotides, 160 nucleotides, 170 nucleotides, 180 nucleotides, 190 nucleotides, 200 nucleotides, 250 nucleotides, 300 nucleotides, 400 nucleotides, or at least 500 or more nucleotides.

[0072] In some embodiments, the trans-splicing molecule may include antisense domains. In some embodiments, the trans-splicing molecule may include two or more antisense domains. In some embodiments, the trans-splicing molecule includes 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 75, 100, 200, 300 or more antisense domains.

[0073] 3' Domain In some embodiments, the trans-splicing nucleic acid molecules of this disclosure encode or contain one or more 3' domains. The nucleic acid may include RNA, DNA, DNA / RNA hybrids, and / or at least one of nucleic acid analogs, chemically modified nucleic acids, or chimeras composed of two or more nucleic acids or nucleic acid analogs. The nucleic acid may include RNA. A nucleic acid containing RNA may contain one or more 3' domains. A nucleic acid containing RNA may be a trans-splicing RNA molecule. The nucleic acid may include DNA. A nucleic acid containing DNA may encode one or more 3' domains. A nucleic acid containing DNA encoding one or more 3' domains may be transcribed into RNA, for example, a trans-splicing RNA molecule.

[0074] The 3' domain is configured to facilitate the processing of transsplicing RNA in a manner that increases the safety and efficiency of the transsplicing therapeutic system. The 3' domain can prevent the production of translated protein products from the transsplicing RNA. If the transsplicing RNA fails to react with the target RNA, the 3' domain can prevent translation of the transsplicing RNA and avoid the production of truncated protein products encoded by the exon domain. The 3' domain can also promote nuclear retention of the transsplicing RNA in a manner that increases the efficiency of the transsplicing reaction. Thus, the 3' domain can reduce the frequency of adverse events resulting from exposure to the nucleic acid sequences provided herein. In some embodiments, the 3' domain can reduce the frequency of systemic toxicity.

[0075] In some embodiments, the 3' domain includes three subdomains: a stabilization domain, a nucleus-holding domain, and a cleavage domain.

[0076] In some embodiments, the cleavage domain is configured to remove the polyadenylated tail of mRNA. In some embodiments, the 3' domain is configured to eliminate the trans-splicing RNA molecule through nonsense-dependent or nonstop RNA degradation (NMD or NSD). In some embodiments, the cleavage domain contains or encodes one or more substrates for a cellular nuclease. In some embodiments, the 3' domain contains or encodes one or more ribozymes (e.g., ribonucleic acid enzymes). In some embodiments, the ribozyme encoded by the trans-splicing RNA provided herein cleaves the trans-splicing RNA molecule or a portion thereof. In some embodiments, the cleavage domain contains or encodes a nucleolytic ribozyme such as RNase P. In some embodiments, nucleolytic ribozymes include hairpin ribozymes, VS ribozymes, twister ribozymes, HDV ribozymes, TS ribozymes, hammerhead ribozymes, pistol ribozymes, or glmS ribozymes. In some embodiments, the cleavage domain is isolated from or derived from a sequence that is a substrate for small non-coding RNA processing, such as an integrator complex, a microprocessor complex, or other small non-coding RNA processing enzyme.

[0077] In some embodiments, the 3' domain of the present disclosure comprises GGTCTCcggagCAGTCTCGGTAAGACACGGTCGTCTCtGATAgtttgaaaaatgtgaaggactttcgtaacggaagtaattcaagatcaagagtaattaccaacttaatgtttttgcattggactttgagttaagattattttttaaatcctgaggactagcattaattgacagctgacccaggtgctacacagaagtggattcagtgaatctaggaagacagcagcagacaggattccaggaaccagtgtttgatgaagctaggactgaggagcaagcgagcaagcagcagttcgtggtgaagataggaaaagagtccaggagccagtgcgatttggtgaaggaagctaggaagaaggaaggagcgctaacgatttggtggtgaagctaggaaaaaggattccaggaaggagcgagtgcaatCCCAAtttttcttttGAATTCTCTAGAGAATTCttttgctttttCTTCaaaaagcaaaagacgctggtggctggcactcctggtttccaggacggggttcaagtccctgcggtgtctttgcttTACGtGAGACGGCAGAACTTACGAGCCAGTGccataGAGACC (SEQ ID NO: 103).

[0078] In some embodiments, the 3' domain of the present disclosure comprises GGTCTCcggagCAGTCTCGGTAAGACACGGTCGTCTCtGATAatttttaggtaaaatgctttttgttcatttctggtggtgggaggggactgaagcctttagtcttttccagatgcaaccttaaaatcagtgacaagaaacattccaaacaagcaacagtcttcaagaaattaaactggcaagtggaaatgtttaaacagttcagtgatctttagtgcattgtttatgtgtgggtttctctctcccctcccttggtcttaattcttacatgcaggaacactcagcagacacacgtatgcgaagggccagagaagccagacccagtaagaaaaaatagcctatttactttaaataaaccaaacattccattttaaatgtggggattgggaaccactagttctttcagatggtattcttcagactatagaaggaggattcgtcagtagggttgtaaaggtttttcttttcctgagaaaacaaccttttgttttctcaggttttgctttttggcctttccctagctttaaaaaaaaaaaagcaaaagacgctggtggctggcactcctggtttccaggacggggttcaagtccctgcggtgtctttgcttTACGtGAGACGGCAGAACTTACGAGCCAGTGccataGAGACC (SEQ ID NO: 104).

[0079] In some embodiments, the 3' domain of the present disclosure comprises GGTCTCcggagCAGTCTCGGTAAGACACGGTCGTCTCtGATAatttttaggtaaaatgctttttgttcatttctggtggtgggaggggactgaagcctttagtcttttccagatgcaaccttaaaatcagtgacaagaaacattccaaacaagcaacagtcttcaagaaattaaactggcaagtggaaatgtttaaacagttcagtgatctttagtgcattgtttatgtgtgggtttctctctcccctcccttggtcttaattcttacatgcaggaacactcagcagacacacgtatgcgaagggccagagaagccagacccagtaagaaaaaatagcctatttactttaaataaaccaaacattccattttaaatgtggggattgggaaccactagttctttcagatggtattcttcagactatagaaggagaagcaaagacaccgcagggacttgaaccccgtcctggaaaccaggagtgccagccaccagcgtcttttgcttttttttttttaaagctagggaaaggccaaaaagcaaaacctgagaaaacaaaaggttgttttctcaggaaaagaaaaacctttacaaccctactgacgaatcTACGtGAGACGGCAGAACTTACGAGCCAGTGccataGAGACC(SEQ ID NO: 105).

[0080] In some embodiments, the 3' domain of the present disclosure comprises GGTCTCcggagCAGTCTCGGTAAGACACGGTCGTCTCtGATAatttttaggtaaaatgctttttgttcatttctggtggtgggaggggactgaagcctttagtcttttccagatgcaaccttaaaatcagtgacaagaaacattccaaacaagcaacagtcttcaagaaattaaactggcaagtggaaatgtttaaacagttcagtgatctttagtgcattgtttatgtgtgggtttctctctcccctcccttggtcttaattcttacatgcaggaacactcagcagacacacgtatgcgaagggccagagaagccagacccagtaagaaaaaatagcctatttactttaaataaaccaaacattccattttaaatgtggggattgggaaccactagttctttcagatggtattcttcagactatagaaggagaaaggtttttcttttcctgagaaatttctcaggttttgctttttaaaaaaaaagcaaaagacgctggtggctggcactcctggtttccaggacggggttcaagtccctgcggtgtctttgcttTACGtGAGACGGCAGAACTTACGAGCCAGTGccataGAGACC (SEQ ID NO: 106).

[0081] In some embodiments, the 3' domain of the present disclosure comprises GGTCTCcggagCAGTCTCGGTAAGACACGGTCGTCTCtGATAatttttaggtaaaatgctttttgttcatttctggtggtgggaggggactgaagcctttagtcttttccagatgcaaccttaaaatcagtgacaagaaacattccaaacaagcaacagtcttcaagaaattaaactggcaagtggaaatgtttaaacagttcagtgatctttagtgcattgtttatgtgtgggtttctctctcccctcccttggtcttaattcttacatgcaggaacactcagcagacacacgtatgcgaagggccagagaagccagacccagtaagaaaaaatagcctatttactttaaataaaccaaacattccattttaaatgtggggattgggaaccactagttctttcagatggtattcttcagactatagaaggagCCCAAtttttcttttGAATTCTCTAGAGAATTCttttgctttttCTTCaaaaagcaaaagacgctggtggctggcactcctggtttccaggacggggttcaagtccctgcggtgtctttgcttTACGtGAGACGGCAGAACTTACGAGCCAGTGccataGAGACC (SEQ ID NO: 107).

[0082] In some embodiments, the 3' domain of the present disclosure comprises GGTCTCcggagCAGTCTCGGTAAGACACGGTCGTCTCtGATAtctgcagtattgcatgttagggataagtgcttatttttaagagctgtggagttcttaaatatcaaccatggcactttctcctgaccccttccctaggggatttcaggattgagaaatttttccatcgagcctttttaaaattgtaggacttgttcctgtgggcttcagtgatgggatagtacacttcactcagaggcatttgcatctttaaataatttcttaaaagcctctaaagtgatcagtgccttgatgccaactaaggaaatttgtttagcattgaatctctgaaggctctatgaaaggaatagcatgatgtgctgttagaatcagatgttactgctaaaatttacatgttgtgatgtaaattgtgtagaaaaccattaaatcattcaaaataataaactatttttattagagaatgtatacttttagaaagctgtctccttatttaaataaaatagtgtttgtctgtagttcagtgaaaggtttttcttttcctgagaaatttctcaggttttgctttttaaaaaaaaagcaaaagacgctggtggctggcactcctggtttccaggacggggttcaagtccctgcggtgtctttgcttTACGtGAGACGGCAGAACTTACGAGCCAGTGccataGAGACC (SEQ ID NO: 108).

[0083] In some embodiments, the 3' domain of the present disclosure comprises GGTCTCcggagCAGTCTCGGTAAGACACGGTCGTCTCtGATAtctgcagtattgcatgttagggataagtgcttatttttaagagctgtggagttcttaaatatcaaccatggcactttctcctgaccccttccctaggggatttcaggattgagaaatttttccatcgagcctttttaaaattgtaggacttgttcctgtgggcttcagtgatgggatagtacacttcactcagaggcatttgcatctttaaataatttcttaaaagcctctaaagtgatcagtgccttgatgccaactaaggaaatttgtttagcattgaatctctgaaggctctatgaaaggaatagcatgatgtgctgttagaatcagatgttactgctaaaatttacatgttgtgatgtaaattgtgtagaaaaccattaaatcattcaaaataataaactatttttattagagaatgtatacttttagaaagctgtctccttatttaaataaaatagtgtttgtctgtagttcagtgCCCAAtttttcttttGAATTCTCTAGAGAATTCttttgctttttCTTCaaaaagcaaaagacgctggtggctggcactcctggtttccaggacggggttcaagtccctgcggtgtctttgcttTACGtGAGACGGCAGAACTTACGAGCCAGTGccataGAGACC (SEQ ID NO: 109).

[0084] In some embodiments, the 3' domain of the present disclosure comprises GGTCTCcggagCAGTCTCGGTAAGACACGGTCGTCTCtGATAgattcttctctaatctttcagaaactttgtctgcgaacactctttaatggaccagatcaggatttgagcggaagaacgaatgtaactttaaggcaggaaagacaaattttattcttcataaagtgatgagcatataataattccaggcacatggcaatagaggccctctaaataaggaataaataacctcttagacaggtgggagattatgatcagagtaaaaggtaattacacattttatttccagaaagtcaggggtctataaattgacagtgattagagtaatactttttcacatttccaaagtttgcatgttaactttaaatgcttacaatcttagagtggtaggcaatgttttacactattgaccttatatagggaagggagggggtgcctgtggggttttaaagaattttcctttgcagaggcataaaggtttttcttttcctgagaaatttctcaggttttgctttttaaaaaaaaagcaaaagacgctggtggctggcactcctggtttccaggacggggttcaagtccctgcggtgtctttgcttTACGtGAGACGGCAGAACTTACGAGCCAGTGccataGAGACC (SEQ ID NO: 110).

[0085] In some embodiments, the 3' domain of the present disclosure comprises GGTCTCcggagCAGTCTCGGTAAGACACGGTCGTCTCtGATAgattcttctctaatctttcagaaactttgtctgcgaacactctttaatggaccagatcaggatttgagcggaagaacgaatgtaactttaaggcaggaaagacaaattttattcttcataaagtgatgagcatataataattccaggcacatggcaatagaggccctctaaataaggaataaataacctcttagacaggtgggagattatgatcagagtaaaaggtaattacacattttatttccagaaagtcaggggtctataaattgacagtgattagagtaatactttttcacatttccaaagtttgcatgttaactttaaatgcttacaatcttagagtggtaggcaatgttttacactattgaccttatatagggaagggagggggtgcctgtggggttttaaagaattttcctttgcagaggcatCCCAAtttttcttttGAATTCTCTAGAGAATTCttttgctttttCTTCaaaaagcaaaagacgctggtggctggcactcctggtttccaggacggggttcaagtccctgcggtgtctttgcttTACGtGAGACGGCAGAACTTACGAGCCAGTGccataGAGACC (SEQ ID NO: 111).

[0086] In some embodiments, the 3' domain of the present disclosure comprises gtttgaaaaatgtgaaggactttcgtaacggaagtaattcaagatcaagagtaattaccaacttaatgttttgcattggactttgagttaagattttttaaatcctgaggactagcattaattgacagctgacccaggtgctacagagaagtggattcagtgaatctaggaagacagcagcagacaggattccaggaaccagtgtttgatgaagctagactgaggagcaagcgagcaagcagttcgtggtgaagataggaaaagagtccaggaggagcagtgcgatttggtgaagctaggaagaaggaaggcgctaacgatttggtggtgaagctaggaaaaaggattccaggaaggagcgagtgcaataaaggttttctttcctgagaaatttctcaggttgcttttaaaaaagcaaaagacgctggtggctggcactcctggtttccaggacggggttcaagtccctgcggtgtctttgctt (SEQ ID NO: 112).

[0087] In some embodiments, the 3' domain of the present disclosure includes (SEQ ID NO: 113).

[0088] Exon Domain In some embodiments, what is described herein is a trans-splicing ribonucleic acid comprising an exon domain. In some embodiments, the exon domain is derived from or isolated from a target RNA. In some embodiments, the exon domain is a heterologous sequence. In some embodiments, the exon domain encodes an engineered protein. In some embodiments, the exon domain encodes a molecule (e.g., a protein) that has a function in immunotherapy. In some embodiments, the exon domain is a chimeric antigen receptor.

[0089] In some embodiments, the exon domains consist of sequences derived from or isolated from human genes. In some embodiments of the compositions of this disclosure, the sequences comprising the exon domains have identity with human genes of at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 87%, 90%, 95%, 97%, 99%, or any percentage in between. In some embodiments, the exon domains have about 100% identity with sequences derived from or isolated from human genes. In some embodiments, the exon domain contains or consists of approximately 2 nucleotides, approximately 5 nucleotides, approximately 10 nucleotides, approximately 20 nucleotides, approximately 30 nucleotides, approximately 40 nucleotides, approximately 50 nucleotides, approximately 60 nucleotides, approximately 70 nucleotides, approximately 80 nucleotides, approximately 90 nucleotides, approximately 100 nucleotides, approximately 110 nucleotides, approximately 120 nucleotides, approximately 130 nucleotides, approximately 140 nucleotides, approximately 150 nucleotides, approximately 160 nucleotides, approximately 170 nucleotides, approximately 180 nucleotides, approximately 190 nucleotides, approximately 200 nucleotides, approximately 210 nucleotides, approximately 220 nucleotides, approximately 230 nucleotides, approximately 240 nucleotides, approximately 250 nucleotides, approximately 260 nucleotides, approximately 270 nucleotides, approximately 270 nucleotides, or more.

[0090] The exon domain is not limited to the following genes (gene accession ID in square brackets and associated disease in parentheses): TNFRSF13B [ENSG00000240505] (unclassifiable immunodeficiency); ADA, CECR1 [ENSG00000196839, ENSG00000093072] (adenosine deaminase deficiency); IL2RG [ENSG00000147168] (X-linked severe combined immunodeficiency); HBB [ENSG00000 244734] (Beta-thalassemia); HBA1, HBA2 [ENSG00000206172, ENSG00000188536] (Alpha-thalassemia); U2AF1 [ENSG00000160201] (Myelodysplastic syndrome); SOD1, TARDBP, FUS, MATR3, SOD1, C9ORF72 [ENSG00000142168, ENSG00000120948, ENSG00000089280, ENSG00000015479, EN SG00000142168, ENSG00000147894] (Amyotrophic Lateral Sclerosis); MAPT, PGRN [ENSG00000186868, ENSG00000030582] (Frontotemporal Dementia with Parkinsonian Syndrome); CDH23, MYO7A, USH2A, PCDH15 [ENSG00000107736, ENSG00000137474, ENSG00000042781, ENSG00000150275] (Usher Syndrome); G ALC [ENSG00000054983] (Krabbe disease); SMPD1, NPC1, NPC2 [ENSG00000166311, ENSG00000141458, ENSG00000119655] (Niemann-Pick disease); PRNP [ENSG00000171867] (prion disease); SCN1A [ENSG00000144285] (Dravat syndrome); PINK1, ATPGAP2 [ENSG00000158828] (juvenile Parkinson's disease);ATXN1, ATXN2, ATXN3, PLEKHG4, SPTBN2, CACNA1A, ATXN7, TTBK2, PPP2R2B, KCNC3, PRKCG, ITPR1, TBP, KCND1, FGF14[ENSG00000124788, ENSG00 000204842, ENSG00000066427, ENSG00000196155, ENSG00000173898, ENSG00000141837, ENSG00000163635, ENSG00000128881, ENSG00000156 475, ENSG00000131398, ENSG00000126583, ENSG00000150995, ENSG00000112592, ENSG00000102057, ENSG00000102466] (Spinocerebellar ataxia); SCN1A, SCN2A, CACNA1A, GRIN2B, GRIN2A, MECP2, FOXG1, SLC6A1, PRRT2, PTEN, KCNQ2, KCNQ3, STARD7, CLRN1 [ENSG00000144285, ENSG00000136531, ENSG0 [0000141837, ENSG00000273079, ENSG00000183454, ENSG00000169057, ENSG00000176165, ENSG00000157103, ENSG00000167371, ENSG00000171862, ENSG00000075043, ENSG00000184156, ENSG00000084090, ENSG00000163646] (Hereditary epilepsy); ATM [ENSG00000149311] (Ataxia with telangiectasia); GL B1[ENSG00000170266](GM1 gangliosidosis); GBA[ENSG00000177628](Gaucher disease); GM2A[ENSG00000196743](GM2 gangliosidosis); UBE3A[ENSG00000114062](Angelman syndrome); SLC2A1[ENSG00000117394](glucose transporter 1 deficiency); LAMP2[ENSG00000005893](Danon disease); GLA[ENSG00000102393](Fabry disease);PKD1, PKD2 [ENSG00000008710, ENSG00000118762] (Autosomal dominant polycystic kidney disease); GAA [ENSG00000171298] (Pompe disease); PCSK9, LDLR, APOB, APOE [ENSG00000169174, ENSG00000130164, ENSG00000084674, ENSG00000130203] (Familial hypercholesterolemia); MYOC, OPTN, TBK1, WDR36, CYPIB1 [ENSG00000034971, ENSG0000012 3240, ENSG00000183735, ENSG00000134987, ENSG00000138061] (Open-angle glaucoma); IDUA [ENSG00000127415] (Harler syndrome or mucopolysaccharidosis type 1); IDS [ENSG00000010404] (Hunter syndrome or mucopolysaccharidosis type 2); CLN3 [ENSG00000188603] (Batten disease); DMD [ENSG00000198947] (Duchenne muscular dystrophy); LMNA [ENSG00000160789] (Limb-girdle muscular dystrophy) (Type 1B); DYSF[ENSG00000135636] (Limb-girdle muscular dystrophy type 2B); SGCA[ENSG00000108823] (Limb-girdle muscular dystrophy type 2D); SGCB[ENSG00000163069] (Limb-girdle muscular dystrophy type 2E); SGCG[ENSG00000102683] (Limb-girdle muscular dystrophy type 2C); SGCD[ENSG00000170624] (Limb-girdle muscular dystrophy type 2F); DUX4[ENSG00000260596] (Facioscapulohumeral muscular dystrophy); F9[ENS G00000101981](Hemophilia B); F8[ENSG00000185010](Hemophilia A); USH2A, RPGR, RP2, RHO, PRPF31, USH1F, PRPF3, PRPF6[ENSG00000156313, ENSG00000102218, ENSG00000163914, ENSG00000105618, ENSG00000150275, ENSG00000117360, ENSG00000101161](Retinitis Pigmentosa); CFTR[ENSG00000001626](Cystic Fibrosis);GJB2, GJB6, STRC, DFNA1, WFS1 [ENSG00000165474, ENSG00000121742, ENSG00000242866, ENSG00000131504, ENSG00000109501] (autosomal dominant hearing impairment); POU3F3 [ENSG00000198914] (non-syndromic hearing loss), CEP290 [ENSG0000019870 This may include nucleic acid (e.g., RNA) sequences derived from or isolated from [7](LCA10), COL7A1[ENSG00000114270](epidermolysis bullosa), ATP7B[ENSG00000123191](Wilson's disease), ABCA4[ENSG00000198691](Stargardt disease), and OTOF[ENSG00000115155](Otoferlin syndrome).

[0091] In some embodiments, the exon domain can be codon-optimized. In some embodiments, the exon domain can be codon-optimized in a way that increases stability, translation, or other desirable features.

[0092] In addition to nucleic acid sequences derived from or isolated from human genes, exon domains may include nucleic acid sequences derived from or isolated from other organisms to modify the stability, translation, processing, or localization of target RNA. In some embodiments, exon domains derived from or isolated from non-human sources may include, but are not limited to, nucleic acid sequences that increase protein production, such as the woodchuck hepatitis virus (WHV) post-transcriptional regulatory element (WPRE), the MALAT1-derived triple-stranded hepatitis B virus PRE (HPRE), and sequences derived from or isolated from iron-responsive elements in the form of CAGYCX (Y=U or A; X=U, C, or A).

[0093] The compositions described herein can modulate the level of protein produced. In addition to replacing specific mutant sequences in target RNA with non-mutant sequences, another useful operation of the compositions described herein may be to increase the production of the protein encoded by the target RNA. For this purpose, one or more exon domains may be configured to amplify the translation of the target RNA. Furthermore, the exon domains described herein may have higher target specificity to produce a therapeutic effect on appropriate target RNA, thereby increasing the production of the protein encoded by the target RNA.

[0094] An exon domain may include one or more untranslated regions that enhance the translation of the exon domain. In some embodiments, the exon domain further includes a 3' untranslated region and / or a 5' untranslated region. In some embodiments, the untranslated regions that enhance the translation of the exon domain include sequences derived from or isolated from the group consisting of woodchuck hepatitis virus (WHV) post-transcriptional regulatory elements (WPREs), MALAT1-derived triples, hepatitis B virus PREs (HPREs), and iron-responsive elements.

[0095] The exon domain may encode a regulatory element. In some embodiments, the regulatory element includes a promoter capable of expressing the exon domain or trans-splicing RNA molecule in eukaryotic cells. In some embodiments, the promoter is a tissue-specific promoter. In some embodiments, tissue-specific expression of the trans-splicing RNA molecule can be achieved by a tissue-specific promoter.

[0096] Intron Domain The compositions provided herein may comprise nucleic acid sequences encoding one or more intron domains. The nucleic acid may comprise RNA, DNA, DNA / RNA hybrids, and / or at least one of nucleic acid analogs, chemically modified nucleic acids, or chimeras composed of two or more nucleic acids or nucleic acid analogs. The nucleic acid may comprise DNA encoding one or more intron domains. One or more intron domains may be transcribed into RNA. A nucleic acid comprising DNA encoding one or more intron domains may be transcribed into trans-splicing RNA. The nucleic acid may comprise RNA encoding one or more intron domains. The intron domains may be configured to facilitate RNA splicing of one or more exon domains of a trans-splicing RNA molecule or a portion thereof. In some embodiments, the intron domains may possess binding sites that are preferentially targeted by RNA-binding proteins with pathogenic mutations. In some embodiments, the dissociation constants of these mutant RNA-binding proteins and the intron domains may be lower than those of non-mutant RNA-binding proteins and the intron domains.

[0097] In some embodiments, the intron domain further comprises one or more nucleic acid sequences configured to enhance the trans-splicing of one or more exon domains. In some embodiments, the one or more sequences configured to enhance the trans-splicing of exon domains may be trans-splicing enhancer sequences (or trans-splicing enhancement sequences). In some embodiments, one or more sequences may be configured to bind to engineered U1 snRNA (ESM). In some embodiments, the ESM may comprise engineered nuclear small RNA (esnRNA). In some embodiments, one or more sequences may comprise a binding site preferentially targeted by the engineered snRNA. In some embodiments, the engineered nuclear small RNA may be a modified version of U1 snRNA. In some embodiments, this modified U1 snRNA may increase the trans-splicing efficiency of the trans-splicing nucleic acid molecule. In some embodiments, the engineered snRNA (esnRNA) disclosed herein comprises any of the esnRNAs described in US2024 / 0011026A1, which is incorporated herein in whole by reference for any purpose.

[0098] In some embodiments, the trans-splicing enhancer sequence comprises 5'-X1X2X3X4X5X6-3', where X1 is uracil (U) or guanine (G); X2 is adenine (A), uracil (U), or guanine (G); X3 is adenine (A), uracil (U), and guanine (G); X4 is adenine (A), uracil (U), cytosine (C), or guanine (G); X5 is adenine (A), cytosine (C), uracil (U), or guanine (G); and X6 is adenine (A), uracil (U), or guanine (G).

[0099] In some embodiments, the trans-splicing enhancer sequence comprises 5'-X1X2X3X4X5X6-3', where X1 is selected from the group comprising adenine (A), uracil (U), and guanine (G); X2 is selected from the group comprising adenine (A), uracil (U), and guanine (G); X3 is selected from the group comprising adenine (A), uracil (U), and guanine (G); X4 is selected from the group comprising adenine (A), uracil (U), and guanine (G); X5 is selected from the group comprising adenine (A), uracil (U), and guanine (G); and X6 is selected from the group comprising uracil (U) and guanine (G).

[0100] In some embodiments, the trans-splicing enhancer sequence comprises 5'-X1X2X3X4X5X6-3', where X1 is selected from the group comprising adenine (A), uracil (U), and guanine (G); X2 is selected from the group comprising uracil (U) and guanine (G); X3 is selected from the group comprising adenine (A), uracil (U), and guanine (G); X4 is selected from the group comprising uracil (U) and guanine (G); X5 is selected from the group comprising uracil (U) and guanine (G); and X6 is selected from the group comprising uracil (U) and guanine (G).

[0101] In some embodiments, the transsplicing enhancer sequences described herein may include any sequence that facilitates transsplicing in an efficient manner. In some embodiments, the transsplicing enhancer sequences are TTACGG (UUACGG in RNA sequences), TAACGG (UAACGG in RNA sequences), GGGTTT (GGGUUU in RNA sequences), GTTTTG (GUUUUG in RNA sequences), GGTTTT (GGUUUU in RNA sequences), GGTTTG (GGUUUG in RNA sequences), GGTTGG (GGUUGG in RNA sequences), GTTAGG (GUUAGG in RNA sequences), TGGTTG (in RNA sequences) UGGUUG), GGGTAG (GGGUAG in RNA sequence), GGTAGG (GGUAGG in RNA sequence), GGTAGT (GGUAGU in RNA sequence), GTAGTT (GUAGUU in RNA sequence), GTTGGT (GUUGGU in RNA sequence), GTGGTT (GUGGUU in RNA sequence), GGTGGT (GGUGGU in RNA sequence), TGGTGG (UGGUGG in RNA sequence), TTGGTG (UUGGUG in RNA sequence), GTAAGG (GU in RNA sequence) AAGG), TAAGGG (UAAGGG in RNA sequence), TTAGGG (UUAGGG in RNA sequence), TAGGGG (UAGGGG in RNA sequence), TTGGGG (UUGGGG in RNA sequence), GTTGGG (GUUGGG in RNA sequence), GTAGGG (GUAGGG in RNA sequence), TATTGG (UAUUGG in RNA sequence), TGTTGG (UGUUGG in RNA sequence), TATGGG (UAUGGG in RNA sequence), TTTGGG (UUUGG in RNA sequence) G), TGTGGG (UGUGGG in RNA sequence), TTGTGG (UUGUGG in RNA sequence), GAGTGT (GAGUGU in RNA sequence), GAGGTA (GAGGUA in RNA sequence), GGAGGT (GGAGGU in RNA sequence), TGGGAG (UGGGAG in RNA sequence), GGGGTG (GGGGUG in RNA sequence), GGGGGA (GGGGGA in RNA sequence), GGGGGT (GGGGGU in RNA sequence), GGGGTA (GGGGUA in RNA sequence),GGGAGG (GGGAGG in RNA sequence), GGGTGG (GGGUGG in RNA sequence), GGAGGG (GGAGGG in RNA sequence), GGTGGG (GGUGGG in RNA sequence), GAGGGG (GAGGGG in RNA sequence), GTGGGG (GUGGGG in RNA sequence), GAGTGG (GAGUGG in RNA sequence), GTATGG (GUAUGG in RNA sequence), GGTATT (GGUAUU in RNA sequence), GTATTT (GUAUUU in RNA sequence), GTATTG (GUAUUG in RNA sequence), AGTTTA (AGUUUA in RNA sequence), AGGTTA (AGGUUA in RNA sequence), GTAACG (GUAACG in RNA sequence), AGGTAA (AGGUAA in RNA sequence), GGTAAG (GGUAAG in RNA sequence), TGGGGG (UGGGGG in RNA sequence), AGGGTT (AGGGUU in RNA sequence), AGGTTG (RN The RNA sequence may contain one or more of the following: AGGUUG (in RNA sequence), AGGTAG (AGGUAG in RNA sequence), ATTTGG (AUUUGG in RNA sequence), AGTTGG (AGUUGG in RNA sequence), TCTGGG (UCUGGG in RNA sequence), AGAGTG (AGAGUG in RNA sequence), AGAGGG (AGAGGG in RNA sequence), AGTGTG (AGUGUG in RNA sequence), AGAGGT (AGAGGU in RNA sequence), AGGGAG (AGGGAG in RNA sequence), AGGGTG (AGGGUG in RNA sequence), AGGGGG (AGGGGG in RNA sequence), AGGGGT (AGGGGU in RNA sequence), AGTGGG (AGUGGG in RNA sequence), AGTATG (AGUAUG in RNA sequence), AGGTAT (AGGUAU in RNA sequence), GTATTC (GUAUUC in RNA sequence), and GGTAAC (GGUAAC in RNA sequence).

[0102] In some embodiments, the thymidine bases of the trans-splicing enhancement sequence may not be substituted with uracil at all, or some or all of them may be substituted with uracil.

[0103] Nuclear holding domain The compositions provided herein may further comprise one or more nucleic acid sequences encoding or containing a nuclear-retaining domain. The nucleic acid may comprise RNA, DNA, DNA / RNA hybrids, and / or at least one of nucleic acid analogs, chemically modified nucleic acids, or chimeras composed of two or more nucleic acids or nucleic acid analogs. The nucleic acid sequence may comprise RNA. A nucleic acid sequence comprising RNA may comprise a nuclear-retaining domain. In some embodiments, the nucleic acid sequence may comprise DNA encoding the nuclear-retaining domain. In some embodiments, the DNA encoding the nuclear-retaining domain may be transcribed into a trans-splicing RNA molecule or a portion thereof. The nuclear-retaining domain may increase the accumulation of the exon domain within the nucleus or within specific structures within the nucleus, such as nuclear speckles or paraspeckles. In some embodiments, the nuclear-retaining domain is configured to promote the activity of trans-splicing of the exon domain to target RNA. In some embodiments, the nuclear-retaining domain is configured to promote the occurrence of a trans-splicing event. In some embodiments, the nuclear-retaining domain is configured to reduce the translation of the trans-splicing RNA.

[0104] In some embodiments, the trans-splicing molecule (e.g., a trans-splicing RNA molecule) or a portion thereof includes a nuclear retention domain. In some embodiments, the trans-splicing molecule provided herein does not include a nuclear retention domain. In some embodiments, a nuclear retention domain that increases trans-splicing activity or the occurrence of trans-splicing may also increase the level of the trans-splicing molecule in the nucleus. In some embodiments, the nuclear retention domain is derived from or isolated from mRNA, long non-coding RNA, or synthetic sequences that can modify the localization of various types of transcripts in the cell nucleus. In some embodiments, the nuclear retention domain functions specifically within the context of RNA trans-splicing. In some embodiments, the localization sequences described herein can function universally (e.g., in any system).

[0105] The nuclear-retaining domain is configured to facilitate the transport of trans-splicing nucleic acid molecules to the cell nucleus or a specific location within the cell nucleus. The nuclear-retaining domain may include one or more localization sequences that bind to enzymes involved in transcription (e.g., polymerase II or transcription-related enzymes), RNA splicing, or nuclear speckle formation. Various means exist for facilitating RNA trans-splicing, and this disclosure focuses on RNA trans-splicing mediated by cellular spliceosomes. Because components on the spliceosome may be located inside and within the cell nucleus, the nuclear-retaining domain is configured to enhance RNA trans-splicing activity by facilitating the accumulation of RNA trans-splicing molecules at the spliceosome site. In other embodiments, this disclosure provides compositions comprising nucleic acid sequences encoding trans-splicing nucleic acid molecules.

[0106] In some embodiments, the nucleus-holding domain can contain sequences that promote the nuclear localization of trans-splicing molecules, such as CDKN2B-AS1[NR_003529];BANCR[NR_047671];CASC15[NR_015410];CRNDE[NR_034105];EMX2OS[NR_002791];EVF2[NR_015448];FENDRR[NR_036444];FTX[NR_028379];GAS5[NR_002578];HOTAIR[NR_003716];HOTAIRM1 [NR_038366];HOXA-AS3[NR_038832];HOXA11-AS[NR_002795];JPX[NR_024582];LHX5-AS1[NR_126425];LINC01578[NR_037600];LINC00261[N R_001558];MALAT1[NR_002819.4];MEG3[NR_046473];TUNAR[NR_038861];MIAT[NR_033320];NEAT1[NR_028272];NR2F1-AS1[NR_021490];LINC -PINT[NR_015431];PSMA3-AS1[NR_029434];EMX2OS[ENSG00000229847];PVT1[NR_003367];MEG8[NR_024149];RMST[NR_024037];SENCR[NR_0 38908];SIX3-AS1[NR_103786];SOX21-AS1[NR_046514];TERC[NR_001566];TUG1[NR_002323];XIST[NR_001564], malat1[NR_002847.3], Nfx1[ It is derived from or isolated from a gene selected from the group consisting of [NM_023739.3], Ogt[NM_139144.4], Nlrp6[NM_133946.2], Mlxipl[NM_021455.5], Leng8[NM_001374609.1], Gcgr[NM_008101.2], Gck[NM_001287386.1], Acly[NM_001199296.1], Ccnl1[NM_001355433.1], Ccnl2[NM_207678.2], and Chkb[NM_007692.6].

[0107] In some embodiments, the nuclear-retaining domain can bind to polymerase II and is derived from or isolated from an aptamer or long non-coding RNA.

[0108] In some embodiments, the nucleus-holding domain is derived from or isolated from short-chain scattered elements (SINEs). In some embodiments, the SINEs are ENSMUST00000064097, ENSMUST00000066988, ENSMUST00000074862, ENSMUST00000093950, ENSMUST00000095448, ENSMUST00000099693, ENSMUST00000105109, ENSMUST00000108741, ENSMUST00000109431, ENSMUST00000123368, ENSMUST00000124068, ENSMU ST00000124095, ENSMUST00000124363, ENSMUST00000124434, ENSMUST00000124813, ENSMUST00000124848, ENSMUST00000125374, ENSMUST 00000126063, ENSMUST00000126467, ENSMUST00000127001, ENSMUST00000127328, ENSMUST00000128305, ENSMUST00000129082, ENSMUST000 00129910, ENSMUST00000130092, ENSMUST00000130362, ENSMUST00000130582, ENSMUST00000130679, ENSMUST00000131042, ENSMUST00000 132070, ENSMUST00000132337, ENSMUST00000132370, ENSMUST00000132414, ENSMUST00000133960, ENSMUST00000134264, ENSMUST0000013 4795, ENSMUST00000134921, ENSMUST00000135423, ENSMUST00000135564, ENSMUST00000135987, ENSMUST00000136555, ENSMUST000001367 49, ENSMUST00000137629, ENSMUST00000137706, ENSMUST00000137776, ENSMUST00000138291, ENSMUST00000138295, ENSMUST00000138574,ENSMUST00000139190、ENSMUST00000139424、ENSMUST00000139529、ENSMUST00000139576、ENSMUST00000139973、ENSMUST00000140009、ENSMUST00000140203、ENSMUST00000140298、ENSMUST00000141088、ENSMUST00000141452、ENSMUST00000141869、ENSMUST00000142279、ENSMUST00000142569、ENSMUST00000142581、ENSMUST00000143133、ENSMUST00000143260、ENSMUST00000143346、ENSMUST00000143649、ENSMUST00000143964、ENSMUST00000144006、ENSMUST00000144043、ENSMUST00000144368、ENSMUST00000144607、ENSMUST00000145549、ENSMUST00000146043、ENSMUST00000146372、ENSMUST00000146404、ENSMUST00000146531、ENSMUST00000146587、ENSMUST00000146644、ENSMUST00000146690、ENSMUST00000146963、ENSMUST00000147541、ENSMUST00000147722、ENSMUST00000148405、ENSMUST00000148534、ENSMUST00000148548、ENSMUST00000149025、ENSMUST00000149382、ENSMUST00000149481、ENSMUST00000149618、ENSMUST00000149815、ENSMUST00000150171、ENSMUST00000150265、ENSMUST00000150455、ENSMUST00000150482、ENSMUST00000150628、ENSMUST00000151038、ENSMUST00000151599、ENSMUST00000151979、ENSMUST00000152025、ENSMUST00000152172、ENSMUST00000152439、ENSMUST00000152815、ENSMUST00000152825、ENSMUST00000152987、ENSMUST00000153589、ENSMUST00000153817、ENSMUST00000154085、ENSMUST00000155540、ENSMUST00000155758、ENSMUST00000156149、ENSMUST00000156150、ENSMUST00000156331、ENSMUST00000156350、ENSMUST00000156633、ENSMUST00000162565、ENSMUST00000163052、ENSMUST00000163302、ENSMUST00000164379、ENSMUST00000165505、ENSMUST00000170933、ENSMUST00000172285、ENSMUST00000172817、ENSMUST00000172838、ENSMUST00000174057、ENSMUST00000174630、ENSMUST00000174768、ENSMUST00000176201、ENSMUST00000176366、ENSMUST00000177104、ENSMUST00000177482、ENSMUST00000178424、ENSMUST00000178920、ENSMUST00000179324、ENSMUST00000180379、ENSMUST00000180382、ENSMUST00000180383、ENSMUST00000180404、ENSMUST00000180410、ENSMUST00000180411、ENSMUST00000180426、ENSMUST00000180434、ENSMUST00000180445、ENSMUST00000180452、ENSMUST00000180466、ENSMUST00000180467、ENSMUST00000180468、ENSMUST00000180477、ENSMUST00000180485、ENSMUST00000180495、ENSMUST00000180505、ENSMUST00000180506、ENSMUST00000180509、ENSMUST00000180512、ENSMUST00000180518、ENSMUST00000180527、ENSMUST00000180529、ENSMUST00000180534、ENSMUST00000180538、ENSMUST00000180558、ENSMUST00000180562、ENSMUST00000180576、ENSMUST00000180586、ENSMUST00000180590、ENSMUST00000180595、ENSMUST00000180598、ENSMUST00000180599、ENSMUST00000180601、ENSMUST00000180609、ENSMUST00000180613、ENSMUST00000180623、ENSMUST00000180650、ENSMUST00000180653、ENSMUST00000180670、ENSMUST00000180671、ENSMUST00000180679、ENSMUST00000180682、ENSMUST00000180685、ENSMUST00000180691、ENSMUST00000180693、ENSMUST00000180712、ENSMUST00000180732、ENSMUST00000180733、ENSMUST00000180738、ENSMUST00000180741、ENSMUST00000180748、ENSMUST00000180750、ENSMUST00000180751、ENSMUST00000180779、ENSMUST00000180783、ENSMUST00000180785、ENSMUST00000180797、ENSMUST00000180800、ENSMUST00000180807、ENSMUST00000180809、ENSMUST00000180812、ENSMUST00000180815、ENSMUST00000180832、ENSMUST00000180834、ENSMUST00000180841、ENSMUST00000180842、ENSMUST00000180855、ENSMUST00000180860、ENSMUST00000180864、ENSMUST00000180865、ENSMUST00000180875、ENSMUST00000180876、ENSMUST00000180882、ENSMUST00000180892、ENSMUST00000180896、ENSMUST00000180908、ENSMUST00000180917、ENSMUST00000180926、ENSMUST00000180927、ENSMUST00000180936、ENSMUST00000180942、ENSMUST00000180969、ENSMUST00000180970、ENSMUST00000180975、ENSMUST00000180981、ENSMUST00000181000、ENSMUST00000181003、ENSMUST00000181005、ENSMUST00000181020、ENSMUST00000181022、ENSMUST00000181029、ENSMUST00000181030、ENSMUST00000181041、ENSMUST00000181052、ENSMUST00000181056、ENSMUST00000181066、ENSMUST00000181073、ENSMUST00000181083、ENSMUST00000181085、ENSMUST00000181090、ENSMUST00000181097、ENSMUST00000181106、ENSMUST00000181113、ENSMUST00000181119、ENSMUST00000181124、ENSMUST00000181125、ENSMUST00000181133、ENSMUST00000181140、ENSMUST00000181144、ENSMUST00000181148、ENSMUST00000181149、ENSMUST00000181152、ENSMUST00000181153、ENSMUST00000181160、ENSMUST00000181167、ENSMUST00000181175、ENSMUST00000181180、ENSMUST00000181191、ENSMUST00000181193、ENSMUST00000181197、ENSMUST00000181200、ENSMUST00000181203、ENSMUST00000181206、ENSMUST00000181207、ENSMUST00000181220、ENSMUST00000181230、ENSMUST00000181255、ENSMUST00000181262、ENSMUST00000181265、ENSMUST00000181270、ENSMUST00000181274、ENSMUST000001、 81301、ENSMUST00000181302、ENSMUST00000181303、ENSMUST00000181304、ENSMUST00000181305、ENSMUST00000181307、ENSMUST00000181311、ENSMUST00000181315、ENSMUST00000181317、ENSMUST00000181328、ENSMUST00000181371、ENSMUST00000181382、ENSMUST00000181395、ENSMUST00000181400、ENSMUST00000181405、ENSMUST00000181416、ENSMUST00000181418、ENSMUST00000181425、ENSMUST00000181426、ENSMUST00000181440、ENSMUST00000181453、ENSMUST00000181454、ENSMUST00000181457、ENSMUST00000181458、ENSMUST00000181460、ENSMUST00000181462、ENSMUST00000181481、ENSMUST00000181482、ENSMUST00000181486、ENSMUST00000181491、ENSMUST00000181498、ENSMUST00000181499、ENSMUST00000181500、ENSMUST00000181503、ENSMUST00000181506、ENSMUST00000181522、ENSMUST00000181526、ENSMUST00000181531、ENSMUST00000181534、ENSMUST00000181538、ENSMUST00000181539、ENSMUST00000181540、ENSMUST00000181546、ENSMUST00000181552、ENSMUST00000181555、ENSMUST00000181556、ENSMUST00000181561、ENSMUST00000181570、ENSMUST00000181574、ENSMUST00000181576、ENSMUST00000181578、ENSMUST00000181587、ENSMUST00000181612、ENSMUST00000181617, ENSMUST00000181631, ENSMUST00000181637, ENSMUST00000181664, ENSMUST00000181668, ENSMUST0000 0181680, ENSMUST00000181682, ENSMUST00000181687, ENSMUST00000181706, ENSMUST00000181713, ENSMUST00000181717, ENS MUST00000181719, ENSMUST00000181720, ENSMUST00000181723, ENSMUST00000181727, ENSMUST00000181729, ENSMUST0000018 1732, ENSMUST00000181746, ENSMUST00000181765, ENSMUST00000181769, ENSMUST00000181771, ENSMUST00000181801, ENSMUS T00000181803, ENSMUST00000181805, ENSMUST00000181807, ENSMUST00000181811, ENSMUST00000181831, ENSMUST0000018184 2, ENSMUST00000181846, ENSMUST00000181858, ENSMUST00000181866, ENSMUST00000181872, ENSMUST00000181875, ENSMUST00 It is derived from or isolated from a gene selected from the group consisting of 000181885, ENSMUST00000181890, ENSMUST00000181891, ENSMUST00000181915, ENSMUST00000181918, ENSMUST00000181920, ENSMUST00000181925, ENSMUST00000181928, ENSMUST00000181942, and ENSMUST00000181973.

[0109] In some embodiments, the nuclear-retaining domain can bind to proteins involved in transcription. In some embodiments, the nuclear-retaining domain can bind to proteins involved in RNA splicing.

[0110] In some embodiments, the nuclear-holding domain can promote the accumulation of trans-splicing molecules in nuclear paraspeckles. In some embodiments, the nuclear-holding domain is configured to promote the accumulation of trans-splicing molecules in nuclear paraspeckles, such as lnc-LTBP3-10[lnc-LTBP3-10], SLC29A2[ENSG00000174669.12], SNHG1[ENSG00000255717.7], MUS81[ENSG00000172732.12], TCIRG1[ENSG00000110719.10], and INPPL1[ENSG00000165458.14]. ], lnc-ANAPC11-7[lnc-ANAPC11-7], IL18BP[ENSG00000137496.18], POLA2[ENSG00000014138.9], PCNX3[ENSG00000197136.4], PC[E NSG00000173599.15], RBM4[ENSG00000173933.20], lnc-KCNK7-6[lnc-KCNK7-6], EML3[ENSG00000149499.11], PGGHG[ENSG00000142 102.16], RBM14[ENSG00000239306.4], LTBP3[ENSG00000168056.16], ATG2A[ENSG00000110046.13], XLOC_026224[XLOC_026224], HE RC2P2[ENSG00000276550.4], WDR90[ENSG00000161996.19], lnc-LTBP3-2[lnc-LTBP3-2], LENG8[ENSG00000167615.16], TPCN2[ENSG 00000162341.18], lnc-TCIRG1-1[lnc-TCIRG1-1], ATG16L2[ENSG00000168010.11], MROH1[ENSG00000179832.17], CCDC57[ENSG0000 0176155.19], lnc-LTBP3-11[lnc-LTBP3-11], PIDD1[ENSG00000177595.18], lnc-VSTM5-1[lnc-VSTM5-1], NEAT1[ENSG00000245532.9]、XLOC_079850[XLOC_079850]、XLOC_028656[XLOC_028656]、DNHD1[ENSG00000179532.12]、ABCA7[ENSG00000064687.12]、XLOC_00000064687.12] 636]、MAN2C1[ENSG00000140400.17]、lnc-SSH3-5[lnc-SSH3-5]、MIRLET7BHG[ENSG00000197182.14]、MAMDC4[ENSG00000177943.14]、NAA40[ENSG00000177943.14] 000110583.13], ANKRD13D[ENSG00000172932.14], lnc-NUMA1-3[lnc-NUMA1-3], ADAMTS10[ENSG00000142303.14], XLOC_083799[XLOC_083799], ARHGEF17[ENSG00000110237.5], CDC42BPG[ENSG00000171219.9], SNAPC4[ENSG00000165684.4], lnc-CFL1-1[lnc-CFL1-1], B4GALNT4[ENSG0000018227 2.12]、XLOC_027567[XLOC_027567]、XLOC_000644[XLOC_000644]、XLOC_024022[XLOC_024022]、LTO1[ENSG00000149716.12]、AC064843.1[ENSG0000016.12] 0286621.1]、CHRND[ENSG00000135902.10]、ASPSCR1[ENSG00000169696.16]、RAD9A[ENSG00000172613.8]、lnc-RTN4R-1[lnc-RTN4R-1]、lnc-MRPL11 -1[lnc-MRPL11-1]、SSH3[ENSG00000172830.13]、XLOC_000637[XLOC_000637]、AP000873.2[ENSG00000247137.9]、lnc-TRPT1-4[lnc-TRPT1-4]、XLO C_027568[XLOC_027568]、LINC01503[ENSG00000233901.6]、RNASEH2C[ENSG00000172922.9]、XLOC_000634[XLOC_000634]、MYO7A[ENSG00000137474.22]、XLOC_000633[XLOC_000633]、lnc-BCL3-1[lnc-BCL3-1]、MTMR9LP[ENSG00000220785.7]、AP5B1[ENSG00000254470.3]、lnc-EDF1-2[lnc-EDF1-2]、lnc-UNC93B1-1[lnc-UNC93B1-1]、GOLGA8B[ENSG00000215252.11]、MSH5[ENSG00000204410.15]、AP003119.1[ENSG00000254632.2]、GUSBP11[ENSG00000228315.12]、RPS6KB2[ENSG00000175634.15]、EME2[ENSG00000197774.13]、XLOC_028057[XLOC_028057]、FRMD8[ENSG00000126391.14]、lnc-OGFOD3-1[lnc-OGFOD3-1]、XLOC_152482[XLOC_152482]、XLOC_028434[XLOC_028434]、ZNF276[ENSG00000158805.12]、AP000944.5[ENSG00000285816.1]、NRBP2[ENSG00000185189.18]、NDOR1[ENSG00000188566.13]、lnc-PHYHD1-1[lnc-PHYHD1-1]、lnc-RECQL4-3[lnc-RECQL4-3]、lnc-UAP1L1-4[lnc-UAP1L1-4]、MSH5-SAPCD1[ENSG00000255152.8]、lnc-P2RY6-1[lnc-P2RY6-1]、RELT[ENSG00000054967.13]、CPNE7[ENSG00000178773.15]、XLOC_028557[XLOC_028557]、XLOC_156663[XLOC_156663]、CORO6[ENSG00000167549.18]、RTEL1[ENSG00000258366.8]、MIR34AHG[ENSG00000228526.7]、STPG3-AS1[ENSG00000275549.1]、lnc-WFIKKN2-4[lnc-WFIKKN2-4]、SYNGAP1[ENSG00000197283.17]、LRRC45[ENSG00000169683.8]、KIAA0895L[ENSG00000196123.13]、PNKP[ENSG00000039650.12]、lnc-EIF1AD-5[lnc-EIF1AD-5]、TM7SF2[ENSG00000149809.15]、NSUN5P2[ENSG00000106133.18]、lnc-POLR2L-1[lnc-POLR2L-1]、lnc-PPP1R27-1[lnc-PPP1R27-1]、AC110285.2[ENSG00000262877.5]、lnc-LRRC32-5[lnc-LRRC32-5]、AC131009.4[ENSG00000279283.1]、BBS1[ENSG00000174483.20]、XLOC_061408[XLOC_061408]、lnc-SERPINH1-3[lnc-SERPINH1-3]、AC027601.6[ENSG00000287431.1]、lnc-NFAM1-3[lnc-NFAM1-3]、EXD3[ENSG00000187609.16]、AC009022.1[ENSG00000196696.12]、MC1R[ENSG00000258839.3]、PKD1P6[ENSG00000250251.6]、lnc-KLHL35-6[lnc-KLHL35-6]、Z97832.2[ENSG00000272374.1]、C19orf25[ENSG00000119559.16]、lnc-TMEM138-3[lnc-TMEM138-3]、AL031595.3[ENSG00000280434.1]、lnc-LRRC56-3[lnc-LRRC56-3]、lnc-STIP1-2[lnc-STIP1-2]、XLOC_095699[XLOC_095699]、SSSCA1-AS1[ENSG00000260233.3]、NPDC1[ENSG00000107281.10]、lnc-NR1D1-1[lnc-NR1D1-1]、lnc-RPL12-1[lnc-RPL12-1]、lnc-MRPL49-1[lnc-MRPL49-1]、XLOC_061398[XLOC_061398]、TOB1-AS1[ENSG00000229980.5]、AC127502.1[ENSG00000215302.8]、XLOC_149046[XLOC_149046]、lnc-TRMT112-4[lnc-TRMT112-4]、LINC02593[ENSG00000223764.2]、KLHL17[ENSG00000187961.14]、lnc-KLHL35-7[lnc-KLHL35-7]、lnc-TMEM258-2[lnc-TMEM258-2]、AP002495.1[ENSG00000254469.7]、XLOC_024025[XLOC_024025]、GPSM1[ENSG00000160360.13]、XLOC_152839[XLOC_152839]、LBHD1[ENSG00000162194.12]、GATD1[ENSG00000177225.17]、XLOC_149045[XLOC_149045]、LENG8-AS1[ENSG00000226696.6]、MAP4K2[ENSG00000168067.12]、C11orf80[ENSG00000173715.16]、MAPK8IP3[ENSG00000138834.12]、XLOC_090526[XLOC_090526]、KIFC2[ENSG00000167702.12]、LRP5L[ENSG00000100068.13]、SEC31B[ENSG00000075826.17]、XLOC_024171[XLOC_024171]、PPP2R5B[ENSG00000068971.14]、lnc-GIPC3-3[lnc-GIPC3-3]、AC020916.1[ENSG00000267519.6]、XLOC_156901[XLOC_156901]、AP006333.1[ENSG00000256341.1]、lnc-ZNF778-3[lnc-ZNF778-3]、lnc-LAMA5-1[lnc-LAMA5-1]、lnc-TMEM106A-3[lnc-TMEM106A-3]、lnc-ACER3-1[lnc-ACER3-1]、RHPN1[ENSG00000158106.14]、XLOC_028558[XLOC_028558]、XLOC_088401[XLOC_088401]、BX255925.3[ENSG00000284976.1]、GUCY2EP[ENSG00000204529.4]、XLOC_152506[XLOC_152506]、NOXA1[ENSG00000188747.8]、lnc-ARRDC1-2[lnc-ARRDC1-2]、XLOC_145191[XLOC_145191]、BSCL2[ENSG00000168000.14]、lnc-MACROD1-1[lnc-MACROD1-1]、AL162586.1[ENSG00000225032.5]、AP000944.7[ENSG00000287917.1]、AC091196.1[ENSG00000285581.1]、Z. NRD2[ENSG00000173465.8]、XLOC_026268[XLOC_026268]、OSBPL7[ENSG00000006025.12]、lnc-SSH3-4[lnc-SSH3-4]、C9orf106[ENSG00000179082.3]、AP000437.1[ENSG00000279549.1]、lnc-NCOA3-14[lnc-NCOA3-14]、NADSYN1[ENSG00000172890.13]、XLOC_060204[XLOC_060204]、lnc-SHANK2-1[lnc-SHANK2-1]、MEGF6[ENSG00000162591.16]、AC099811.1[ENSG00000236194.3]、ME3[ENSG00000151376.16]、XLOC_028655[XLOC_028655]、GDPD5[ENSG00000158555.15]、lnc-SPDYC-2[lnc-SPDYC-2]、AC008105.3[ENSG00000267121.6]、lnc-NCOA3-21[lnc-NCOA3-21]、lnc-FEN1-6[lnc-FEN1-6]、lnc-HYOU1-1[lnc-HYOU1-1]、AC102953.2[ENSG00000273230.1]、XLOC_095073[XLOC_095073]、LINC00235[ENSG00000277142.1]、AL355987.4[ENSG00000273066.5]、XLOC_152404[XLOC_152404]、lnc-CDK12-1[lnc-CDK12-1]、XLOC_028004[XLOC_028004]、lnc-CCDC154-2[lnc-CCDC154-2]、lnc-CCDC87-1[lnc-CCDC87-1]、INPP5E[ENSG00000148384.13]、XLOC_021222[XLOC_021222]、AJM1[ENSG00000232434.2]、HSF4[ENSG00000102878.16]、LINC00313[ENSG00000185186.10]、lnc-UNC93B1-7[lnc-UNC93B1-7]、lnc-PIDD1-2[lnc-PIDD1-2]、lnc-CSNK1G2-5[lnc-CSNK1G2-5]、lnc-UNC93B1-5[lnc-UNC93B1-5]、AP006621.3[ENSG00000255284.2]、CCDC78[ENSG00000162004.17]、lnc-HAAO-7[lnc-HAAO-7]、EFEMP2[ENSG00000172638.13]、XLOC_000635[XLOC_000635]、XLOC_147952[XLOC_147952]、lnc-PKNOX1-1[lnc-PKNOX1-1]、lnc-LTBP3-9[lnc-LTBP3-9]、AC008895.1[ENSG00000279948.1]、lnc-TBC1D3H-7[lnc-TBC1D3H-7]、lnc-TMEM250-3[lnc-TMEM250-3]、lnc-CDC42EP2-1[lnc-CDC42EP2-1]、AC087741.1[ENSG00000262580.5]、XLOC_156972[XLOC_156972]、lnc-PC-3[lnc-PC-3]、AC090589.3[ENSG00000270060.1]、XLOC_045084[XLOC_045084]、TIAF1[ENSG00000221995.5]、lnc-CYBA-4[lnc-CYBA-4]、lnc-SLC11A2-7[lnc-SLC11A2-7]、AC141586.1[ENSG00000215154.6]、AP003559.1[ENSG00000256443.1]、XLOC_095076[XLOC_095076]、PNPLA7[ENSG00000130653.16]、lnc-RNF166-5[lnc-RNF166-5]、XLOC_023911[XLOC_023911]、AC092127.1[ENSG00000260417.1]、lnc-TRPT1-3[lnc-TRPT1-3]、XLOC_028195[XLOC_028195]、XLOC_080106[XLOC_080106]、XLOC_026739[XLOC_026739]、lnc-NUP98-1[lnc-NUP98-1]、HDAC10[ENSG00000100429.It may be derived from or isolated from a gene selected from the group consisting of

[18] , DRD4[ENSG00000069696.7], lnc-DOC2B-3[lnc-DOC2B-3], lnc-DOLK-1[lnc-DOLK-1], CNIH2[ENSG00000174871.11], RGL3[ENSG00000205517.12], GALT[ENSG00000213930.11], AP001107.9[ENSG00000255468.7], lnc-MKNK2-1[lnc-MKNK2-1], and AL033543.1[ENSG00000279175.1].

[0111] In some embodiments, the nuclear-retaining domain can promote the accumulation of trans-splicing molecules into nuclear speckles. In some embodiments, the nuclear-retaining domain is configured to promote the accumulation of trans-splicing molecules into nuclear speckles and may be derived from or isolated from a gene selected from the group consisting of MALAT1[NR_002819.4], MEG3[ENSG00000214548], and XLOC_003526[ENSG00000250657]. In some embodiments, the nuclear retention domain is configured to facilitate the accumulation of trans-splicing molecules into nuclear speckles via binding to a protein selected from the group consisting of SRSF1[ENSG00000136450], SRSF2[ENSG00000161547], SRSF3[ENSG00000112081], SRSF4[ENSG00000116350], SFSF6[ENSG00000124193], SFSF7[ENSG00000115875], SRSF10[ENSG00000188529], SRSF11[ENSG00000116754], CLK1[ENSG00000013441], and CLK2[ENSG00000176444].

[0112] In some embodiments, the nuclear holding domain can facilitate the accumulation of trans-splicing molecules in nuclear speckles via association with proteins. In some embodiments, this protein is ADNP[ENSG00000101126], ANXA7[ENSG00000138279], API5[ENSG00000166181], AQR[ENSG00000021776], ATAD2[ENSG00000156802], BAZ1B[ENSG00000009954], BCLAF1[ENSG00000029363], BTAF1[ENSG00000095564], CCAR1[ENSG00000060339], CCAR 2[ENSG00000158941], CDC5L[ENSG00000096401], CDC73[ENSG00000134371], CDK11B[ENSG00000248333], CDK12[ENSG00000167258], CDK N2AIP[ENSG00000168564], CHD3[ENSG00000170004], CHD4[ENSG00000111642], CHTF18[ENSG00000127586], CPSF1[ENSG00000071894], C STF3[ENSG00000176102], CTR9[ENSG00000198730], CUL3[ENSG00000036257], CUL4B[ENSG00000158290], CWC22[ENSG00000163510], CW F19L1[ENSG00000095485], DDX23[ENSG00000174243], DDX39A[ENSG00000123136], DDX42[ENSG00000198231], DDX46[ENSG00000145833] , DHX16[ENSG00000204560], DHX38[ENSG00000140829], DNMT1[ENSG00000130816], ELOA[ENSG00000011007], EWSR1[ENSG00000182944], FAF1[ENSG00000185104], FBXO22[ENSG00000167196], FKBP5[ENSG00000096060], FUBP1[ENSG00000162613], FUBP3[ENSG00000107164],GPATCH8[ENSG00000186566]、GPS1[ENSG00000169727]、GTF3C1[ENSG00000077235]、GTF3C4[ENSG00000125484]、GTF3C5[ENSG00000148308]、HCFC1[ENSG00000172534]、HELLS[ENSG00000119969]、IK[ENSG00000113141]、ILF2[ENSG00000143621]、INTS13[ENSG00000064102]、KDM1A[ENSG00000004487]、KHDRBS1[ENSG00000121774]、KHSRP[ENSG00000088247]、LIG1[ENSG00000105486]、MATR3[ENSG00000280987]、METTL1[ENSG00000037897]、MRE11[ENSG00000020922]、MSH2[ENSG00000095002]、MSH3[ENSG00000113318]、MSH6[ENSG00000116062]、NBN[ENSG00000104320]、NCBP1[ENSG00000136937]、NONO[ENSG00000147140]、PAF1[ENSG00000006712]、PDS5B[ENSG00000083642]、POLD1[ENSG00000062822]、POLR2A[ENSG00000181222]、POLR2B[ENSG00000047315]、PPM1G[ENSG00000115241]、PPP1R10[ENSG00000204569]、PRPF19[ENSG00000110107]、PRPF3[ENSG00000117360]、PRPF31[ENSG00000105618]、PRPF40A[ENSG00000196504]、PRPF4B[ENSG00000112739]、PRPF6[ENSG00000101161]、PSPC1[ENSG00000121390]、PTBP2[ENSG00000117569]、PUS7[ENSG00000091127]、RAD21[ENSG00000164754]、RAD50[ENSG00000113522]、RALY[ENSG00000125970]、RBM10[ENSG00000182872]、RBM12[ENSG00000244462]、RBM14[ENSG00000239306]、RBM17[ENSG00000134453]、RBM25[ENSG00000119707]、RBM26[ENSG00000139746]、RBM4[ENSG00000173933]、RBMX[ENSG00000147274]、RFC1[ENSG00000035928]、RFC4[ENSG00000163918]、RNF20[ENSG00000155827]、RNF40[ENSG00000103549]、RNMT[ENSG00000101654]、RPL35A[ENSG00000182899]、RPRD1B[ENSG00000101413]、RPRD2[ENSG00000163125]、SAMHD1[ENSG00000101347]、SART1[ENSG00000175467]、SART3[ENSG00000075856]、SBNO1[ENSG00000139697]、SF3A1[ENSG00000099995]、SF3B1[ENSG00000115524]、SF3B2[ENSG00000087365]、SFPQ[ENSG00000116560]、SIN3A[ENSG00000169375]、SLC4A1AP[ENSG00000163798]、SMARCC1[ENSG00000173473]、SMU1[ENSG00000122692]、SON[ENSG00000159140]、STAG2[ENSG00000101972]、SUGT1[ENSG00000165416]、SUPT5H[ENSG00000196235]、SUPT6H[ENSG00000109111]、SYMPK[ENSG00000125755]、TARDBP[ENSG00000120948]、TCERG1[ENSG00000113649]、THOC2[ENSG00000125676]、THOC5[ENSG00000100296]、TP53BP1[ENSG00000067369]、TRMT1[ENSG00000104907]、TRMT1L[ENSG00000121486]、TSR1[ENSG00000167721]、UBR5[ENSG00000104517]、UHRF1[ENSG00000276043]、USP39[ENSG00000168883], USP48[ENSG00000090686], USP7[ENSG00000187555], WAC[ENSG0000009 5787], WDHD1[ENSG00000198554], WRNIP1[ENSG00000124535], XPO5[ENSG00000124571], XPO7[ENSG The group is selected from the following: [00000130227], XPOT[ENSG00000184575], YLPM1[ENSG00000119596], ZC3H11A[ENSG00000058673], ZC3H14[ENSG00000100722], ZMYND8[ENSG00000101040], and ZNF326[ENSG00000162664].

[0113] In some embodiments, the nuclear-retained domain sequence(s) may be isolated from or derived from long non-coding RNAs involved in transcriptional regulation. In some embodiments, long non-coding RNAs include Air, alpha-250 / alpha-280, ANRIL, beta-globin transcript, beta-MHC antisense transcript, CAR intergenic 10, CCND1-related ncRNA, COLDAIR, COOLAIR, DHFR upstream transcript, Emx2os, Evf2, fbp1+ promoter RNA, GAL10-ncRNA, H19, H19 antisense, H19 upstream conserved regions 1 and 2, H19 ICR ncRNA, HOTAIRM1, HOTTIP, Hoxa11as, ICR1, Kcnq1ot1, Khps1a, L1PA16, LINoCRb, MEG3, Mistral, Msx1as, Nespas, ncR-Upar, PHO5 lncRNA, PHO84 antisense, pRNA, PWR1, RTL, SRG1, TEA This includes ncRNA, TIR1axut, TPO1axut, Tsix, Xist, 7SK, B2 SINE RNA, GAS5, HOTAIR, Jpx, LXRBSV, PR antisense transcript, VL30 RNA, Adapt33, antiPeg11, Gtl2-as, HOXA3as, HOXA6as, linc1242, linc1257, linc1368, linc1547, linc1582, linc1609, linc1610, lincRNA-p21, lincRNA-RoR b, Malat1-as, MEG9, NDM29, NEAT1, PANDA, PCAT-1, Rian, SatIII transcript, SNHG3, SRA, Tmevpg1, TncRNA, TUG1, or other combinations thereof.

[0114] In some embodiments, the nuclear-retained domain sequence(s) may be isolated from or derived from long non-coding RNAs involved in splicing regulation. In some embodiments, the long non-coding RNAs include MIAT, LUST, Malat1, SAF, VL30 RNA, Zeb2NAT, or any combination thereof.

[0115] In some embodiments, the nucleus-holding domain sequence(s) may be directly adjacent to the antisense domain. In some embodiments, the nucleus-holding domain sequence(s) may be directly adjacent to the exon domain.

[0116] In some embodiments, the nuclear-holding domain sequence(s) can be adjacent to the 5' end of the trans-splicing molecule. In some embodiments, the nuclear-holding domain(s) can be located from the 5' end of the trans-splicing molecule as follows: 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, 25 nucleotides, 26 nucleotides, 27 nucleotides, 28 nucleotides, 29 nucleotides, 30 nucleotides, 31 nucleotides, 31 nucleotides, 32 nucleotides, 33 nucleotides, 34 nucleotides, 35 nucleotides, 36 nucleotides, 37 nucleotides, 38 nucleotides nucleotides, 39 nucleotides, 40 nucleotides, 41 nucleotides, 42 nucleotides, 43 nucleotides, 44 nucleotides, 45 nucleotides, 46 nucleotides, 47 nucleotides, 48 ​​nucleotides, 49 nucleotides, 50 nucleotides, 55 nucleotides, 60 nucleotides, 65 nucleotides, 70 nucleotides, 75 nucleotides, 80 nucleotides, 85 nucleotides, 90 nucleotides, 95 nucleotides, 100 nucleotides, 110 nucleotides, 120 nucleotides, 130 nucleotides, 140 nucleotides, 150 nucleotides, 160 nucleotides, 170 nucleotides, 180 nucleotides, 190 nucleotides, 200 nucleotides, 250 nucleotides, 300 nucleotides, 400 nucleotides, 500 nucleotides, 500 nucleotides or more, or any number of nucleotides in between.

[0117] In some embodiments, the nucleus-holding domain(s) may be adjacent to the 3' end of the trans-splicing molecule. In some embodiments, the nucleus-holding domain(s) may be adjacent to the 3' end of the trans-splicing molecule, starting from nucleotide 1, nucleotide 2, nucleotide 3, nucleotide 4, nucleotide 5, nucleotide 6, nucleotide 7, nucleotide 8, nucleotide 9, nucleotide 10, nucleotide 11, nucleotide 12, nucleotide 13, nucleotide 14, nucleotide 15, nucleotide 16, nucleotide 17, nucleotide 18, nucleotide 19, nucleotide 20, nucleotide 21, nucleotide 22, nucleotide 23, nucleotide 24, nucleotide 25, nucleotide 26, nucleotide 27, nucleotide 28, nucleotide 29, nucleotide 30, nucleotide 31, nucleotide 31, nucleotide 32, nucleotide 33, nucleotide 34, nucleotide 35, nucleotide 36, nucleotide 37, nucleotide 38 nucleotides, 39 nucleotides, 40 nucleotides, 41 nucleotides, 42 nucleotides, 43 nucleotides, 44 nucleotides, 45 nucleotides, 46 nucleotides, 47 nucleotides, 48 ​​nucleotides, 49 nucleotides, 50 nucleotides, 55 nucleotides, 60 nucleotides, 65 nucleotides, 70 nucleotides, 75 nucleotides, 80 nucleotides, 85 nucleotides, 90 nucleotides, 95 nucleotides, 100 nucleotides, 110 nucleotides, 120 nucleotides, 130 nucleotides, 140 nucleotides, 150 nucleotides, 160 nucleotides, 170 nucleotides, 180 nucleotides, 190 nucleotides, 200 nucleotides, 250 nucleotides, 300 nucleotides, 400 nucleotides, 500 nucleotides, 500 nucleotides or more, or any number of nucleotides in between.

[0118] In some nucleotide domains, the nucleus-holding domains are, in the 5' direction, starting from the first nucleotide of the exon domain or antisense domain, 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 1 nucleotide, 22 nucleotides, 23 nucleotides, 1 nucleotide, 2 nucleotides, 4 nucleotides, 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, 25 nucleotides, 26 nucleotides, 27 nucleotides. Otide may be separated by 28, 29, 30, 31, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 400, 500, 500 or more nucleotides, or any number of nucleotides in between.

[0119] In some embodiments, the nucleus-holding domain(s) are arranged in the 3' direction, starting from the last nucleotide of the exon domain or antisense domain, as follows: 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, 25 nucleotides, 26 nucleotides, 27 nucleotides, 28 nucleotides, 29 nucleotides, 30 nucleotides, 31 nucleotides, 31 nucleotides, 32 nucleotides, 33 nucleotides, 34 nucleotides, 35 nucleotides, 36 nucleotides, 37 nucleotides Most likely, the distance between nucleotides is 38 nucleotides, 39 nucleotides, 40 nucleotides, 41 nucleotides, 42 nucleotides, 43 nucleotides, 44 nucleotides, 45 nucleotides, 46 nucleotides, 47 nucleotides, 48 ​​nucleotides, 49 nucleotides, 50 nucleotides, 55 nucleotides, 60 nucleotides, 65 nucleotides, 70 nucleotides, 75 nucleotides, 80 nucleotides, 85 nucleotides, 90 nucleotides, 95 nucleotides, 100 nucleotides, 110 nucleotides, 120 nucleotides, 130 nucleotides, 140 nucleotides, 150 nucleotides, 160 nucleotides, 170 nucleotides, 180 nucleotides, 190 nucleotides, 200 nucleotides, 250 nucleotides, 300 nucleotides, 400 nucleotides, 500 nucleotides, 500 nucleotides or more, or any number of nucleotides in between.

[0120] In some embodiments, the trans-splicing molecule may include a nuclear-holding domain. In some embodiments, the trans-splicing molecule may include two or more nuclear-holding domains. In some embodiments, the trans-splicing molecule includes 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 75, 100, 200, 300 or more nuclear-holding domains.

[0121] The compositions comprising localization sequences disclosed herein may include any sequences that promote the nuclear or intranuclear localization of trans-splicing molecules. Non-limiting examples of localization sequences include sequences that promote the localization of trans-splicing molecules from the cytoplasm to the cell nucleus, or to specific intranuclear structures such as nuclear speckles or paraspeckles. In some embodiments, localization sequences may also include sequences that promote the association of trans-splicing molecules with nuclear localized proteins and protein complexes, such as spliceosomes, transcription proteins, or splicing factors.

[0122] Stabilization domain The compositions provided herein may comprise one or more stabilizing domains for preventing or attenuating the degradation of nucleic acid molecules and / or trans-splicing molecules provided herein. The nucleic acid may comprise RNA, DNA, DNA / RNA hybrids, and / or at least one of nucleic acid analogs, chemically modified nucleic acids, or chimeras composed of two or more nucleic acids or nucleic acid analogs. In some embodiments, the RNA molecules provided herein comprise one or more stabilizing domains for preventing the degradation of the RNA molecule. Nucleic acid molecules containing DNA may encode one or more stabilizing domains. A DNA molecule encoding one or more stabilizing domains may be transcribed into an RNA molecule containing one or more stabilizing domains (for example, a stabilizing domain in an RNA trans-splicing molecule may be a complement to a stabilizing domain in a DNA molecule encoding an RNA trans-splicing molecule). Degradation of nucleic acids may be caused, for example, by the activity of exonucleases. Exonucleases may act in the 5'-to-3' or 3'-to-5' direction. In some embodiments, the stabilizing domains protect the 5' end of the nucleic acid molecules and / or trans-splicing molecules provided herein. In some embodiments, the stabilizing domain protects the 3' end of the nucleic acid molecule and / or transsplicing molecule provided herein. In some embodiments, the stabilizing domain is located within the 3' domain of the RNA transsplicing molecule and protects the 3' end of the RNA transsplicing molecule from degradation.

[0123] In some embodiments, the stabilizing domain includes RNA. In some embodiments, the stabilizing domain includes DNA. In some embodiments, the DNA-containing stabilizing domain encodes the RNA-containing stabilizing domain. In some embodiments, the DNA molecule is transcribed into messenger RNA.

[0124] In some embodiments of the compositions of this disclosure, the stabilizing domain is derived from a flavivirus. In some embodiments, the stabilizing domain is an exonuclease-resistant RNA ("xrRNA") that blocks 5'-3' exonuclease activity, including: Cub macular mosaic virus, Apoi virus, Aloa virus, Bagaza virus, Vanzi virus, Boubouui virus, Bukaras bat virus, Cacipacore virus, Carrie Island virus, Dakar bat virus, Cowborn Ridge virus, Dengue virus, Edgehill virus, Entebbe bat virus, Gadget Gary virus, Ilheus virus, Israeli turkey meningoencephalitis virus, Japanese encephalitis virus, Jugra virus, Jutiapa virus, Kadam virus, Kunzin virus, Kedugu virus, Kokobella virus, Kotango virus, Kasanur Forest It is derived from or isolated from a viral genome selected from the group consisting of Hayashi disease virus, Langat virus, Looping ill virus, Mivan virus, Modoc virus, Montana Myotis leukoencephalitis virus, Malay Valley encephalitis virus, Ntaya virus, Omsk hemorrhagic fever virus, Phnom Penh bat virus, Poissant virus, Rio Bravo virus, Royal Farm virus, Saboya virus, St. Louis encephalitis virus, Salvia virus, San Perlita virus, Soma Lezleaf virus, Sepik virus, Tembus virus, tick-borne encephalitis virus, Thuleni virus, Uganda S virus, Wesselsbron virus, Usutu virus, West Nile virus, Yaoundé virus, yellow fever virus, Yokose virus, and Zika virus.

[0125] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction includes or comprises a sequence derived from Kunzin virus. The sequence may include a DNA sequence. The sequence may include an RNA sequence. In some embodiments, the Kunzin virus-derived sequence includes or comprises TTAGTGAGGATGTCAGACCACGGCCATGGCGTGCCACTCTGCGGAGAGTGCAGTCTGCGACAGTGCCCCAGGAGGACTGGG (SEQ ID NO: 1). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 1. In some embodiments, the stabilizing domain includes the sequence encoded by SEQ ID NO: 1. The stabilizing domain can be transcribed into an RNA molecule.

[0126] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction includes or comprises a sequence derived from a cell-fusion virus. The sequence may include a DNA sequence. The sequence may include a DNA sequence. The sequence may include an RNA sequence. In some embodiments, the cell-fusion virus-derived sequence includes or comprises ACAGGAGCAGGGCATGAAAATGTCGGGCATGACGAACCCGCTCCCCCGAGTCCCCTGGCAACAGGGT (SEQ ID NO: 2). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 2. In some embodiments, the stabilizing domain includes the sequence encoded by SEQ ID NO: 2. The stabilizing domain can be transcribed into an RNA molecule.

[0127] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a sequence derived from flavivirus tick-borne encephalitis virus. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, the sequence derived from flavivirus tick-borne encephalitis virus comprises or consists of CACAGATCATGGAATGATGCGGCAGCGCGCGAGAGCAACGGGGAAGTGGTGGCACCCGACGCACCATCCATGAAGCAATACTTCGTGAGACCCCCCCTGACCAGCAAAGGGGGCAGACCGGTCAGGGGTGAGGAATGCCCCCAGAGTGCATTACGGCAGCACGCCAGTGAGAGTGGCGACGGGAAAATGGTCGATCCCGACGTAGGGCACTCTGAAAAATTTTGTGAGACC (SEQ ID NO: 3). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by Sequence ID No. 3. In some embodiments, the stabilizing domain contains the sequence encoded by Sequence ID No. 3. The stabilizing domain can be transcribed into an RNA molecule.

[0128] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction includes or comprises a sequence derived from mouse leukemia virus. The sequence may include a DNA sequence. The sequence may include an RNA sequence. In some embodiments, the mouse leukemia virus-derived sequence includes or comprises TGGAAAAAATGCGAGTGAGGGCAACTCTGGGATTAGCTCAATGGGTGTGACGACCCTACCCTTCCGCATTTGTAAATAATTGAGCCAGTCATTTCCGTAGGGAAGAGAGTTATTCGCTCCTCTCGAGATTGAGCGGCCTGCTCCTTGGAGCATGAGATGGGAGGCCCGAA (SEQ ID NO: 4). In some embodiments, the stabilizing domain includes at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 4. In some embodiments, the stabilization domain includes the sequence encoded by Sequence ID No. 4. The stabilization domain can be transcribed into an RNA molecule.

[0129] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number AF346759.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number AF346759.1 comprises or consists of GAAAGGCAAGGTACGGATTAGCCGTAGGGGCTTGAGAACCCCCCCTCCCCACTCATTTTATTTCCTCTATGAGGAAGG (SEQ ID NO: 5). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 5. In some embodiments, the stabilizing domain comprises the sequence encoded by SEQ ID NO: 5. The stabilizing domain can be transcribed into RNA molecules.

[0130] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number AF346759.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number AF346759.1 comprises or consists of TTTGGGCAAGGTGCAGGTTAGCTGCAGGGGCTTGAAAAACCCCCCCCCCCATTCAAGACTTTTAGTGCATTAGTT (SEQ ID NO: 6). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 6. In some embodiments, the stabilizing domain comprises the sequence encoded by SEQ ID NO: 6. The stabilizing domain can be transcribed into RNA molecules.

[0131] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_008604.2. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_008604.2 comprises or consists of ACCCCGTAAGGAAGGACAAGGCTGTCCTTGAGTACTAACGACACTCCGGCCCCAGTTCCCAGAGCCAGGGTTTTAGCTCC (SEQ ID NO: 7). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 7. In some embodiments, the stabilizing domain comprises the sequence encoded by SEQ ID NO: 7. The stabilizing domain can be transcribed into RNA molecules.

[0132] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_008604.2. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_008604.2 comprises or consists of CGCGCGCAAGGAAGGACATGGCTGTCCTTGGGTACGAACGACACCCCGCCCCCAGTTCTCAAGGTTAGAGTTATAACCTC (SEQ ID NO: 8). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 8. In some embodiments, the stabilizing domain comprises the sequence encoded by SEQ ID NO: 8. The stabilizing domain can be transcribed into RNA molecules.

[0133] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_008604.2. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_008604.2 comprises or consists of CCATCGCAAGGGAGGATTTTCCTCGGGTACTGACCATACCCCGACCCCAGTCCGATAGGTCATGGAATGACCCC (Sequence ID 9). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by Sequence ID 9. In some embodiments, the stabilizing domain comprises the sequence encoded by Sequence ID 9. The stabilizing domain can be transcribed into RNA molecules.

[0134] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_008604.2. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_008604.2 comprises or consists of CTCCCGTAAGGAAAGCGCAAGCTTTGAGCATTGACAACGCTCCGGCCCCAGTCCCCCAGGTTATGGGAGAATAACCC (Sequence ID 10). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by Sequence ID 10. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 10. The stabilization domain can be transcribed into an RNA molecule.

[0135] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genomic accession number HE574574.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genomic accession number HE574574.1 comprises or consists of CTAGCGCAAGGAAGGAAAGTCGCAGACTACCTTGGGTGTTGACGACACTCCGCCCCCAGTCACCTTGGCCGAAGGTTAAACGGCAT (SEQ ID NO: 11). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 11. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 11. The stabilization domain can be transcribed into an RNA molecule.

[0136] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or consists of a flavivirus-derived sequence having genome accession number HE574574.1. The sequence may include a DNA sequence. The stabilizing domain may include an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number HE574574.1 comprises or consists of CCACGCAATGGGAGGCATCATTTCGCCTCCGGGTGCTGACTACTCCCCGTCCCCGTCCCTAGGTCAAGTGAATGACCCCGTGATGTTGTGATGACATCATACCAGGCTTGGCATCCTGGCAACTGCCACCCGCAAGGGGAGGGTTTTCTAACTCTCCGGGTGTTGACGACACCCCGGCCCCAGTCCCCAAGGTCTTGGGAAAAAGACCCCGAAGTGTTGCAAGGACACTAATCACCGAAAGGTGAGGGCGCACAGGATC (SEQ ID NO: 12). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 12. In some embodiments, the stabilizing domain contains the sequence encoded by SEQ ID NO: 12. The stabilizing domain can be transcribed into an RNA molecule.

[0137] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genomic accession number HE574574.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genomic accession number HE574574.1 comprises or consists of CACCCGCAAGGGGAGGGTTTTCTAACTCTCCGGGTGTTGACGACACCCCGGCCCCAGTCCCCAAGGTCTTGGGAAAAAGACCCC (SEQ ID NO: 13). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 13. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 13. The stabilization domain can be transcribed into an RNA molecule.

[0138] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_012671.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_012671.1 comprises or consists of TCAGCGCAAGGAAGGGAAGCTTGAGGCTACCTTAGGTGGTGACGACACCTCGCCCCCAGTCTCCCGGGTTGGGGATAATACAACCTC (SEQ ID NO: 14). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 14. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 14. The stabilization domain can be transcribed into an RNA molecule.

[0139] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_012671.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_012671.1 comprises or consists of CCCCCGCAAGGAGGGGTGTGTGTTTCACGCCCCTGGGAGTTAACGATTCTCCGGCCCCAGTTCCTAGGTCCAGGGAGGGCCCC (SEQ ID NO: 15). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 15. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 15. The stabilization domain can be transcribed into an RNA molecule.

[0140] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_012671.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_012671.1 comprises or consists of CCCGCGCAAGGAAGGACACGTAAATCACGTGTTCTTGGGAGTTGACGACTCTCCGCCCCCAGTCCCCAGGTCAGGGTATGACTCC (SEQ ID NO: 16). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 16. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 16. The stabilization domain can be transcribed into an RNA molecule.

[0141] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_012671.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_012671.1 comprises or consists of CCACCGCAAGGGAGAGGGATCCCCTCTCGGGTTTGGACGACACCCCGGCCCCAGTCCCCCAGGTCATGGGAAAAACTGACCCC (SEQ ID NO: 17). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 17. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 17. The stabilization domain can be transcribed into an RNA molecule.

[0142] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-to-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_021069.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_021069.1 comprises or consists of TCAGCGCAAGGAAGGAAAGCTGGACGCTACCTTAGGTGGTGACGACACCTCGCCCCCAGTCTCCCAGGTTGGGGATCGTACAACTTC (SEQ ID NO: 18). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 18. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 18. The stabilization domain can be transcribed into an RNA molecule.

[0143] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_021069.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_021069.1 comprises or consists of CCCCCGCAAGGAGGGACGTGTGCATCACGTTTCTGGGAGTTAACGGCTCTCCGGCCCCAGTTCCTAGGTCCAGGTAGGATCCC (SEQ ID NO: 19). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 19. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 19. The stabilization domain can be transcribed into an RNA molecule.

[0144] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_021069.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_021069.1 comprises or consists of CCCGCGCAAGGAAGGATGCGATGAAAACGCTTGTCCTTGGGAGTTGACGACTCTCCGCCCCCAGTCCCCAGGTCAGGGTATGACCCC (SEQ ID NO: 20). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 20. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 20. The stabilization domain can be transcribed into an RNA molecule.

[0145] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_021069.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_021069.1 comprises or consists of CCACCGCAAGGGAGAGGGATTCCCTCTCGGGTGTGGACGACACCCCGGCCCCAGTCCCCTAGGTCATGGGAAAAACTGACCCC (SEQ ID NO: 21). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 21. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 21. The stabilization domain can be transcribed into an RNA molecule.

[0146] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genomic accession number KX652378.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genomic accession number KX652378.1 comprises or consists of CTAGCGCAAGGAAGGAAAGTCGCAGACTACCTTGGGTGTTGACGACACTCCGCCCCCAGTCACCTTGGCCAAAGGTTAAATGGCAT (SEQ ID NO: 22). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 22. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 22. The stabilization domain can be transcribed into an RNA molecule.

[0147] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genomic accession number KX652378.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genomic accession number KX652378.1 comprises or consists of CCCACGCAAGGGGAGGCATCATATTGCCTCCGGGTGCTGACGACACCCCGTCCCCAGTCCCTAGGTCAAGTGAATGACCCC (SEQ ID NO: 23). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 23. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 23. The stabilization domain can be transcribed into an RNA molecule.

[0148] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genomic accession number KX652378.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genomic accession number KX652378.1 comprises or consists of CACCCGCAAGGGGGGAGTTTTCTAACTCCCCGGGTGTTGACGACACCCCGGCCCCAGTCCCCAAGGTCTTGGGAAAAAGACCCC (SEQ ID NO: 24). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 24. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 24. The stabilization domain can be transcribed into an RNA molecule.

[0149] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_001564.2. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_001564.2 comprises or consists of ACAGGAGCAGGGCATGAAAATGTCGGGCATGACGAACCCGCTCCCCCGAGTCCCCTGGCAACAGGGTGTGTTCC (SEQ ID NO: 25). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 25. In some embodiments, the stabilizing domain comprises the sequence encoded by SEQ ID NO: 25. The stabilizing domain can be transcribed into RNA molecules.

[0150] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_001564.2. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_001564.2 comprises or consists of TTCGAGCAGGGCACATTAGTGTCGGGCGTGACGCACCCGCTCCCCTCAGTCCCCTGTGCAACAGGGAGGGCACTT (SEQ ID NO: 26). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 26. In some embodiments, the stabilizing domain comprises the sequence encoded by SEQ ID NO: 26. The stabilizing domain can be transcribed into RNA molecules.

[0151] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_001564.2. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_001564.2 comprises or consists of ACGGGGCAACAGGGAGAAATCCCGGGGTAGCGAACCTCCTCCGTTAATGTGAAAAAGTATGGGGAAAGAACTCATCT (SEQ ID NO: 27). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 27. In some embodiments, the stabilizing domain comprises the sequence encoded by SEQ ID NO: 27. The stabilizing domain can be transcribed into RNA molecules.

[0152] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_012932.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_012932.1 comprises or consists of TCAGAGCAGGGCACAATAGTGTCGGGCCTGACGACCCCGCTCCCCCGAGTCGCCCAACGGAGTTTGGCTCAACTCTAA (SEQ ID NO: 28). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 28. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 28. The stabilization domain can be transcribed into an RNA molecule.

[0153] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_012932.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_012932.1 comprises or consists of GCAGCGCAGGGCATGAAAATGTCGGGCCTGACGAACCCGCGCACCCGAGTCCCCCAGTTGGGGAAGGGATCCTTGCAT (SEQ ID NO: 29). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 29. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 29. The stabilization domain can be transcribed into an RNA molecule.

[0154] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_012932.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_012932.1 comprises or consists of GCGGAGCAACAGGGAGAAATCCCGGGGAATTGCGAACCCCCTCCGAAATGTGAAAAATTATGGGGAAAAGTACCCATCT (SEQ ID NO: 30). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 30. In some embodiments, the stabilizing domain comprises the sequence encoded by SEQ ID NO: 30. The stabilizing domain can be transcribed into RNA molecules.

[0155] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number KJ741266.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number KJ741266.1 comprises or consists of GAGCAGGGCACAACAGTGTCGGGCCTGACGACCCCGCTCCCCCGAGTCACCAACTGGAGTTTGGCTCAACTCCAA (SEQ ID NO: 31). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 31. In some embodiments, the stabilizing domain comprises the sequence encoded by SEQ ID NO: 31. The stabilizing domain can be transcribed into RNA molecules.

[0156] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_031327.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_031327.1 comprises or consists of GGAAGGCAACACACCAGTAATCTGGTGGGGTGAGTTGCGACACCCCCTTGTGAGCAACCGACCTAGCCGGTCTATTGACCGGCTTG (SEQ ID NO: 32). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 32. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 32. The stabilization domain can be transcribed into an RNA molecule.

[0157] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_024299.2. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_024299.2 comprises or consists of ACAGGGCAACAGGGATCGCCAACATCAGATCCCGGGTGAGTGACGACACCCCCCATGTGAATCGTCAACTTAGGAACACATTCAAATAGAGGA (SEQ ID NO: 33). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 33. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 33. The stabilization domain can be transcribed into an RNA molecule.

[0158] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-to-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_024299.2. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_024299.2 comprises or consists of ACAGGGCAACAGGGATCACCAACATCAGATCCCGGGTGAGTGACGACACCCCCCATGTGAATCGTCGATACAAAAACACGATAGG (SEQ ID NO: 34). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 34. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 34. The stabilization domain can be transcribed into an RNA molecule.

[0159] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_024299.2. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_024299.2 comprises or consists of ACACCGCAAGGAAGAGAAATCTTGGGTGGTAACAACACCCCGGCCCCAGTTCTCGCGTGCCACGAGTCATTGGCACAA (SEQ ID NO: 35). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 35. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 35. The stabilization domain can be transcribed into an RNA molecule.

[0160] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-to-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_024299.2. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_024299.2 comprises or consists of AAACCGCAAGGAAGGAGCAATCCTTGGGTATTAACGACACCCCGGCCCCAGTTCCCGAAGTCAAGGGGACCCTTGACCC (SEQ ID NO: 36). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 36. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 36. The stabilization domain can be transcribed into an RNA molecule.

[0161] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_034242.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_034242.1 comprises or consists of CATTGCAGCAGAGATTTATCTCGGGGGAGTTACGCCCCTCCATTGCCAGTAGAGTTTGCATGTCTCTATAAACATGACGTT (SEQ ID NO: 37). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 37. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 37. The stabilization domain can be transcribed into an RNA molecule.

[0162] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_027817.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_027817.1 comprises or consists of CCATTGCCAGTAGAGTTTGCATGTCTCTATAAACATGACGTTCTGACTGACTA (SEQ ID NO: 102). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 102. In some embodiments, the stabilizing domain comprises the sequence encoded by SEQ ID NO: 102. The stabilizing domain can be transcribed into RNA molecules.

[0163] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_027817.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_027817.1 comprises or consists of AATATGGCAGCAGAGCTTGTCTCGGGGATTCACGCTCCCCCCATTGTGAGTGTGTCGAACTGGTTTCGAAGGACGTCTAGAA (SEQ ID NO: 38). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 38. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 38. The stabilization domain can be transcribed into an RNA molecule.

[0164] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_027817.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_027817.1 comprises or consists of ATCCGGCAACAGAGAGTTTATGTCTCGGGGCCTCACGCACCCCCCGTTGTGAGTGAAGTCCTTTCTGGCCATTTAGTGGTCAGGAAGGG (SEQ ID NO: 39). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 39. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 39. The stabilization domain can be transcribed into an RNA molecule.

[0165] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_027817.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_027817.1 comprises or consists of GCAGGGCAACAAAGTTCTAACGAACTAGGGTGAGTAGCGTCACCCCCCGGTTGTGAAAACGATTGCGACTAGAACTAAAGTCGAGAGTCTC (SEQ ID NO: 40). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 40. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 40. The stabilization domain can be transcribed into an RNA molecule.

[0166] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_005064.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_005064.1 comprises or consists of TTAGAGCAGGGCACGAAAGTGTCGGGCATGACGCACCCGCTCCCCCGAGTCCCCTGAAAATAGGGTGGGCAATGCACTCCT (SEQ ID NO: 41). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 41. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 41. The stabilization domain can be transcribed into an RNA molecule.

[0167] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_005064.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_005064.1 comprises or consists of TTTGAGCAGGGCACGAAAGTGTCGGGCCTGACGCACCCGCTCCCCCGAGTCCCCTGGAAACAGGGTGGGCCTCGAAAAATCCACCGT (SEQ ID NO: 42). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 42. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 42. The stabilization domain can be transcribed into an RNA molecule.

[0168] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_027819.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_027819.1 comprises or consists of GCAGGGCAACAGGAAGAAATTCCGGGTGATTAGCCACACCCCCCGAAACGTGATTTATATGATGACAAGAATCAGA (SEQ ID NO: 43). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 43. In some embodiments, the stabilizing domain comprises the sequence encoded by SEQ ID NO: 43. The stabilizing domain can be transcribed into RNA molecules.

[0169] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_034017.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_034017.1 comprises or consists of TGGGGGCAGCCGGGGGAAACCCTGGGGCTTGGCGACCTCCCCCCACAAGCCATCATGCGAAATTAAGGCAGCCGCGAG (SEQ ID NO: 44). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 44. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 44. The stabilization domain can be transcribed into an RNA molecule.

[0170] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_034204.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_034204.1 comprises or consists of TGGGGGCAGCCGGGAGTCAAACTCCCGGGGCCTGGCGACCCCCCCCTTCCGCCTCCAAAAATTAAGGCAGCCCCGAGGGAGCTCTCCTCGGTGTGA (SEQ ID NO: 45). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 45. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 45. The stabilization domain can be transcribed into an RNA molecule.

[0171] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_020902.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_020902.1 comprises or consists of CAAGGGCAGGTTGAAAGGGGCTTGGCGACCCCCCCCTAACCAGCCACGCGCACTGTGCGTGCGC (SEQ ID NO: 46). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 46. In some embodiments, the stabilizing domain comprises the sequence encoded by SEQ ID NO: 46. The stabilizing domain can be transcribed into RNA molecules.

[0172] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_020902.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_020902.1 comprises or consists of CCGGGGCAGGTTGAAAGGGGTTTCACGCACCCCCCCCTACCAGTGCCGTCGTTGGTAACGCG (SEQ ID NO: 47). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 47. In some embodiments, the stabilizing domain comprises the sequence encoded by SEQ ID NO: 47. The stabilizing domain can be transcribed into RNA molecules.

[0173] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number MF438044.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number MF438044.1 comprises or consists of CAAGGGCAGGTTGAAAGGGGCTTGGCGACCCCCCCCTAACTAGCCACGCGCACTGATGTGCGCGG (SEQ ID NO: 48). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 48. In some embodiments, the stabilizing domain comprises the sequence encoded by SEQ ID NO: 48. The stabilizing domain can be transcribed into RNA molecules.

[0174] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number MF438044.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number MF438044.1 comprises or consists of CCGGGGCAGGTTGAAAGGGGCATCACGCACCCCCCCCTACCAGTGCCGTCGTTGGTAACGCG (SEQ ID NO: 49). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 49. In some embodiments, the stabilizing domain comprises the sequence encoded by SEQ ID NO: 49. The stabilizing domain can be transcribed into RNA molecules.

[0175] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number AF070476.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number AF070476.1 comprises or consists of ACGGGCAAGGAGCGCAAGCTGGGGCTTTCCGACCCCCCCCCCCAGGACGATTCCCCGCTTGGTAAAAAGGGCCAGGCCA (SEQ ID NO: 50). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 50. In some embodiments, the stabilizing domain comprises the sequence encoded by SEQ ID NO: 50. The stabilizing domain can be transcribed into RNA molecules.

[0176] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_001837.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_001837.1 comprises or consists of CTCCAGGCAGCAGCAGACGCAAGTCTGGGGGAAACGATCGCTCCTCCCTCTGCAGATCTCTAGCTCGGATAGAGCGG (SEQ ID NO: 51). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 51. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 51. The stabilization domain can be transcribed into an RNA molecule.

[0177] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number KF234530.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number KF234530.1 comprises or consists of ATGTGGCAAGGGGCCTGCTAACACAGGCCGGGGCTTCCTGACCCCCCCACCCCAAGGCTGTTCCCCGCTCGGTAAAAAGGGCCGGGCCA (SEQ ID NO: 52). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 52. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 52. The stabilization domain can be transcribed into an RNA molecule.

[0178] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genomic accession number KT166442.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genomic accession number KT166442.1 comprises or consists of ATGAGGCAAGGAGCCTGCTAACACAGGCTGGGGCTTCCTGACCCCCCCTCCCCAAGGCGGTTCCCCGCTCGGTAAAAAGGGCCGGG (SEQ ID NO: 53). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 53. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 53. The stabilization domain can be transcribed into an RNA molecule.

[0179] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_024377.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_024377.1 comprises or consists of GTGAGGCAAGGAGACATTCCAGGAATGTCTGGGGCTTTCCGACCCCCCCTCCCCAGGACGGTTCCCCGCTGAGTAAAAAGGGCT (SEQ ID NO: 54). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 54. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 54. The stabilization domain can be transcribed into an RNA molecule.

[0180] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number KF234529.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number KF234529.1 comprises or consists of AATTGTGGCAAGGGGCCTGTCCAAGACAGGCCGGGGCTTTCCGACCCCCCACCCCCAGGACGGTTCCCCGCTCGGTAAAAAGGGCCGGGCTA (SEQ ID NO: 55). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 55. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 55. The stabilization domain can be transcribed into an RNA molecule.

[0181] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number AB008335.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number AB008335.1 comprises or consists of TTGCGGCAAGGTCGGCCGACTGATCATCGGCTGAGGAGGTTCCCGCCCTCCCCGCCCCAGGGGTCTCCCCGCTGGGTAAAAAGGGCCCGGCCT (SEQ ID NO: 56). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 56. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 56. The stabilization domain can be transcribed into an RNA molecule.

[0182] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_001710.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_001710.1 comprises or consists of TTGCGGCAAGGTCTGGTGACTGATCATCACCGGAGGAGGTTCCCGCCCTCCCCGCCCCAGGGGTCTCCCCGCTGGGTAAAAAGGGCCCGGCCT (SEQ ID NO: 57). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 57. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 57. The stabilization domain can be transcribed into an RNA molecule.

[0183] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number AB018667.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number AB018667.1 comprises or consists of TTGCGGCAAGGTCGGGCGACTGATCATCGCCTGAGGAGGTTCCCGCCCTCCCCGCCCCAGGGGTCTCCCCGCTGGGTAAAAAGGGCCCGGCCT (SEQ ID NO: 58). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 58. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 58. The stabilization domain can be transcribed into an RNA molecule.

[0184] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_027998.2. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_027998.2 comprises or consists of AGCGAGGGTGAAGTCAGCTGTACCCACGGCTGGCTGAAACCGGGGCTTGACGACCCCCCCTATCCGAGTTGGGCAAGGTAACATCACGGGTGTGACGACCCC (SEQ ID NO: 59). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 59. In some embodiments, the stabilizing domain includes the sequence encoded by Sequence ID No. 59. The stabilizing domain can be transcribed into an RNA molecule. In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-to-3' direction includes or comprises a flavivirus-derived sequence having genome accession number KC796093.1. The sequence may include a DNA sequence. The sequence may include an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number KC796093.1 includes or comprises TTCCGGCAAGGTGCGCCGGGGGGGCCTTCACGGGCCCTTCTAGCGCAGGGGTTTGAGACACCCCCCGCCCCACTCCTTCCCAGGGTTGGCAACCTGGGTC (Sequence ID No. 60). In some embodiments, the stabilizing domain has at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 60.The stabilizing domain can be transcribed into RNA molecules.

[0185] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number KC796084.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number KC796084.1 comprises or consists of GTAAGGCAAGGTGTGCACTGGCAGCCTTAACGGGCTGTTGGGGCGCAGGGGCTTGAGCACCCCCCTTCCCCACTCCCAGCGGGGCTTGGCAACCCTG (SEQ ID NO: 61). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 61. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 61. The stabilization domain can be transcribed into an RNA molecule.

[0186] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or consists of a flavivirus-derived sequence having genome accession number KC796084.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number KC796084.1 comprises or consists of GTTAGCAAGGCGCTGTCATGGTGCTTCTAACGAGGCATGAGGCAGCGGGGGCGTGAGAACCCCCCTTCCCCACTCCGGCGTGTAGATTGGCAATCTTGCGCT (SEQ ID NO: 62). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 62. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 62. The stabilization domain can be transcribed into an RNA molecule.

[0187] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number KC796084.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number KC796084.1 comprises or consists of ACTTGGCAAGGCACCCCCTGGCTAGTGGCTGCACTTAACTGAGTGGCCGGCTAGTCGGTGGGTGGGGGCACGTGACTCCCCCTTCCCCACACCGGCGGCGGCCGTAAAACGCCCC (SEQ ID NO: 63). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 63. In some embodiments, the stabilizing domain contains the sequence encoded by SEQ ID NO: 63. The stabilizing domain can be transcribed into an RNA molecule.

[0188] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_038435.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_038435.1 comprises or consists of TCCTGGCAAGGGCTACTCTGAAAGCTGCTAACGTGGTGATCGGCGTAGCGGGGCGTGAGGAACCCCCCACCCCACTCCTGGGTCAGCTTGGTAACTGGCCCA (SEQ ID NO: 64). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 64. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 64. The stabilization domain can be transcribed into an RNA molecule.

[0189] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_038434.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_038434.1 comprises or consists of GCGGGCAGAGACTGGGCCTCGCTGGCGCGTGAGCTCCTGTGGGATCCGGCCTGTTCCATGCCACCTGTTCTCGATCAGGGGGAGGGGATCTTACCCCCTGAACTGT (SEQ ID NO: 65). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 65. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 65. The stabilization domain can be transcribed into an RNA molecule.

[0190] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genomic accession number KC796079.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genomic accession number KC796079.1 comprises or consists of GTAAGGCAAGGTGTGCACTGGCAGCCTTAACGGGCTGTTGGGACACAGGGGCTTGAGCACCCCCCTTCCCCACTCCCAGCGGGGCTTGGCAACCCCCC (SEQ ID NO: 66). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 66. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 66. The stabilization domain can be transcribed into an RNA molecule.

[0191] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_021154.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_021154.1 comprises or consists of TTGGGGCAGGCACGCTTGCGTGGGGGAGTTGCGCCCCCCCCCAGCCAGCACTCGTCATGATGTGTCGGATGCCAGTGATAGGCAGCCTC (SEQ ID NO: 67). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 67. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 67. The stabilization domain can be transcribed into an RNA molecule.

[0192] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_038433.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_038433.1 comprises or consists of GCCCGGCAAGGTTAACAGGGGGAGTAGTGCCCCCCCCGCCCCAACTCGGGTAGCGCGTACGCTC (SEQ ID NO: 68). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 68. In some embodiments, the stabilizing domain comprises the sequence encoded by SEQ ID NO: 68. The stabilizing domain can be transcribed into RNA molecules.

[0193] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_038433.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_038433.1 comprises or consists of TCCAAGGCAACAGGCTTCGGCCGGGGGAGTAGCGCCCCCCCCTTTGTGAGCTCGTAACCCCCTTTTGGGGCT (SEQ ID NO: 69). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 69. In some embodiments, the stabilizing domain comprises the sequence encoded by SEQ ID NO: 69. The stabilizing domain can be transcribed into RNA molecules.

[0194] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_030291.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_030291.1 comprises or consists of ACATGGCAAGGGTGCTTCGGCATGGGGGAGTAGCGTCCCTCCCACCCCAGCGAGGCTGCAAGCCTAT (SEQ ID NO: 70). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 70. In some embodiments, the stabilizing domain comprises the sequence encoded by SEQ ID NO: 70. The stabilizing domain can be transcribed into RNA molecules.

[0195] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number HM047196.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number HM047196.1 comprises or consists of ACCTGGCAACAGCCCCGTCGGGGCGGGGGAGTAGCGCCCCCCCCAGTGTGAGCGAGGTGGGAAACCACCTA (SEQ ID NO: 71). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 71. In some embodiments, the stabilizing domain comprises the sequence encoded by SEQ ID NO: 71. The stabilizing domain can be transcribed into RNA molecules.

[0196] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_038437.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_038437.1 comprises or consists of CAAGGGCAAGGTGTCTTGCGAGACAGGGGCTTAACGCACCCCCCCCCCCAGTGAGGGGGGCTGATCCCCCA (SEQ ID NO: 72). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 72. In some embodiments, the stabilizing domain comprises the sequence encoded by SEQ ID NO: 72. The stabilizing domain can be transcribed into RNA molecules.

[0197] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_021154.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_021154.1 comprises or consists of ACCGGGCAAGGGCTCACGCGGAGTGTGACAAGCTCCCCCCCCCAGTCCATGGCCGTGGATCGGCTC (SEQ ID NO: 73). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 73. In some embodiments, the stabilizing domain comprises the sequence encoded by SEQ ID NO: 73. The stabilizing domain can be transcribed into RNA molecules.

[0198] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_025677.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_025677.1 comprises or consists of GAATAGGCAGGGAGGAGTCCAAGAACCGTCTCGGGGACTCTTTGGGGCTTGACGAACCCCCCTACCCGAGTCTATATTCAGTGGCTGGAACC (SEQ ID NO: 74). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 74. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 74. The stabilization domain can be transcribed into an RNA molecule.

[0199] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number KY370101.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number KY370101.1 comprises or consists of AAAGGCAGGGAGAGGCTTAAGAACCGTCTCGGGAGCCTCTTGGGGCTTGACGAACCCCCCAACCCGAGTCAAGTCCTTCAACAGTACCGTTTCGAG (SEQ ID NO: 75). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 75. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 75. The stabilization domain can be transcribed into an RNA molecule.

[0200] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_038964.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_038964.1 comprises or consists of TGAAAGGGGCAAGTGGCCGTATAGGCTGGGGCGATCGCCGTACCCCCCCTTTACCAGGCGCCTCAACCCCATGTACCATGGGGTT (SEQ ID NO: 76). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 76. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 76. The stabilization domain can be transcribed into an RNA molecule.

[0201] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genomic accession number KY370100.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genomic accession number KY370100.1 comprises or consists of ACACGGCAAGGTGCTAGAAGCTGAAACCGACTCGGAGCTCTAGCAGGGGGACTGGCGACCCTCCCGCCCCAGCTGGCCTCTGGCAGAAACGACTCGTGCCATT (SEQ ID NO: 77). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 77. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 77. The stabilization domain can be transcribed into an RNA molecule.

[0202] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number MH282908.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number MH282908.1 comprises or consists of AAGAGGCAAGGGGAGGCAGCTAGCCTCCGGGGCCTGACGACCCCCCTTCCCCAGTCATTGAAGGCAAGGGGCTGC (SEQ ID NO: 78). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 78. In some embodiments, the stabilizing domain comprises the sequence encoded by SEQ ID NO: 78. The stabilizing domain can be transcribed into RNA molecules.

[0203] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number MH282908.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number MH282908.1 comprises or consists of AAAGGGCAAGGCACCACACGGCTAGTGTGGTGAGGGATTGACAACCCCTCCTCCCCAGTCGGCATGAACTT (SEQ ID NO: 79). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 79. In some embodiments, the stabilizing domain comprises the sequence encoded by SEQ ID NO: 79. The stabilizing domain can be transcribed into RNA molecules.

[0204] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number MH282908.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number MH282908.1 comprises or consists of AAAGGGCAAGGCACCACATGGAAATGTGGTGAGGGTTTGACCTCCCCTCCCCCCCAGTCAACCATACATAAAACTTGAAAAACACATATTGGTACT (SEQ ID NO: 80). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 80. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 80. The stabilization domain can be transcribed into an RNA molecule.

[0205] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_001655.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_001655.1 comprises or consists of CAGCGGCAACAGGGGAGACCCCGGGCTTAACGACCCCGCCGATGTGAGTTTGGCGACCATGGTGGATCAG (SEQ ID NO: 81). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 81. In some embodiments, the stabilizing domain comprises the sequence encoded by SEQ ID NO: 81. The stabilizing domain can be transcribed into RNA molecules.

[0206] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_031950.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_031950.1 comprises or consists of CAATGGCAACAGCACTCTCTTAGGTGCGGGGTATGGCGAACCCCCCAATGTGAGCTCCTCCCCGGATGGGGCG (SEQ ID NO: 82). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 82. In some embodiments, the stabilizing domain comprises the sequence encoded by SEQ ID NO: 82. The stabilizing domain can be transcribed into RNA molecules.

[0207] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_038430.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_038430.1 comprises or consists of TTCGGGCAAGGCATGCGAGATAAAAAGGGTCTCGTATGAGGGCGTGGCAACCCCTCCCCCCCAGCTGCGGCGGCACAAAAGCGTCTCGCGTGTCGTC (SEQ ID NO: 83). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 83. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 83. The stabilization domain can be transcribed into an RNA molecule.

[0208] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_040815.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_040815.1 comprises or consists of TAGCGGCAGGGAGCAGGGTAGACCAACCTGCAGGGGCTTGACGACCCCCCCGTCCCGAGTCAGCCAGGAGGCAGAAGCGACTCGC (SEQ ID NO: 84). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 84. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 84. The stabilization domain can be transcribed into an RNA molecule.

[0209] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number KY370094.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number KY370094.1 comprises or consists of TGAGGGCAGGATAGGCCAAGAATCGTCTCGAGGCTGATTGGGGCTTCACGCACCCCCCCATCCGAGTGCCTCTCATCTTCCAAAACCGTCTCGGGGGAGATGAGAC (SEQ ID NO: 85). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 85. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 85. The stabilization domain can be transcribed into an RNA molecule.

[0210] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number KX905133.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number KX905133.1 comprises or consists of AAAGGGCAGCGGTGCCGGACGGCATTGGGGCTTGGCGACCCCCCCCACGCGAGCTACCCACCATTGGTGGGTTC (SEQ ID NO: 86). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 86. In some embodiments, the stabilizing domain comprises the sequence encoded by SEQ ID NO: 86. The stabilizing domain can be transcribed into RNA molecules.

[0211] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_021153.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_021153.1 comprises or consists of CAGGGGCAGAGGCCGGTTGATTATCATTGCAGCCGTAGGGGCTTGGCGACCCCCCCCCCTCGAGCCAGCCTTTCAACAAAACCGTCTCGGGTTGGAAGG (SEQ ID NO: 87). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 87. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 87. The stabilization domain can be transcribed into an RNA molecule.

[0212] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-to-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number NC_038428.1. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number NC_038428.1 comprises or consists of ACACTGCAACAGGGGAAACCCGGGGATTTCCGATCCCCCAGATGTGAGGAGGCTGGTTGCCTAACAACCTG (SEQ ID NO: 88). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 88. In some embodiments, the stabilizing domain comprises the sequence encoded by SEQ ID NO: 88. The stabilizing domain can be transcribed into RNA molecules.

[0213] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genome accession number KJ412989. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genome accession number KJ412989 comprises or consists of CTCCCGTAAGGAAAGCGCAAGCTTTGAGCATTGACAACGCTCCGGCCCCAGTCCCCCAGGTTATGGAGGAATAACCC (SEQ ID NO: 89). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 89. In some embodiments, the stabilizing domain comprises the sequence encoded by SEQ ID NO: 89. The stabilizing domain can be transcribed into RNA molecules.

[0214] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genomic accession number MN242370. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genomic accession number MN242370 comprises or consists of AAGGGGCAGGATATGGACAGAACCGTCTCGGGTCCAGAAGGGGCTTGGCGACCCCCCCCATCCGAGCCACCCCTCTAGGAAGACCGTCTCGGCCTAGAGG (SEQ ID NO: 90). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 90. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 90. The stabilization domain can be transcribed into an RNA molecule.

[0215] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a flavivirus-derived sequence having genomic accession number MH824541. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, this flavivirus-derived sequence having genomic accession number MH824541 comprises or consists of AAGGGGCAGCCATGCCGCAGAACCGTCTCGGGCGGCAAGGGGCTTAGCGACCCCCCCCTGGCGAGCTGTATGAGTGTGATAAGGGCGACATAGC (SEQ ID NO: 91). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 91. In some embodiments, the stabilization domain includes the sequence encoded by SEQ ID NO: 91. The stabilization domain can be transcribed into an RNA molecule.

[0216] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 5'-3' direction comprises or consists of a sequence derived from bat tamana virus (AF346759.1). The sequence may include a DNA sequence. The sequence may include an RNA sequence. In some embodiments, the bat tamana virus sequence comprises or consists of AF346759.1, position: 10305-10380:TTTGGGCAAGGTGCAGGTTAGCTGCAGGGGCTTGAAAAACCCCCCCCCCCATTCAAGACTTTTAGTGCATTAGTT (SEQ ID NO: 6). The stabilizing domain can be transcribed into an RNA molecule.

[0217] In some embodiments, the stabilizing domain prevents or attenuates the activity of exonucleases acting in the 3'-5' direction on RNA. In some examples, the prevention or attenuation of exonuclease activity increases the effectiveness of the trans-splicing molecule.

[0218] In some embodiments of the compositions of this disclosure, the stabilizing domains form a tertiary structure. In some embodiments of the compositions of this disclosure, the tertiary structure is a triple chain.

[0219] In some embodiments, the stabilizing domain forms an RNA triple that blocks 3'-5' exonuclease activity and is derived from or isolated from a vertebrate gene or microbial genome selected from the group consisting of: MALAT1[ENSG00000251562], NEAT1[ENSG00000245532], turtle macular mosaic virus genome, Kaposi's sarcoma-associated herpesvirus genome, TER telomerase-associated RNA[ENSG00000270141], and SAM-II bacterial riboswitch.

[0220] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 3' to 5' direction includes or comprises a sequence derived from the MALAT1 gene. The sequence may include a DNA sequence. The sequence may include an RNA sequence. In some embodiments, the sequence derived from the MALAT1 gene includes or comprises AAGCTGATTCTCCAATGCTCTTCAGTAGGGTCATGAAGGTTTTTCTTTTCCTGAGAAAACAACACGTATTGTTTTCTCAGGTTTTGCTTTTTGGCCTTTTTCTAGCTTAAAAAAAAAAAAAGCAAAAGATGCTGGTGGTTGGCACTCCTGGTTTCCAGGACGGGGTTCAAAT (SEQ ID NO: 92). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 92. The sequence can be transcribed into an RNA molecule.

[0221] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 3' to 5' direction comprises or consists of a sequence derived from rhesus razinovirus. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, the sequence derived from rhesus razinovirus comprises or consists of CGTTTGTGTTGGTTTTTATGACCAGCTTGGTACAAAACCTGCTGGTGATTTTTTACCCAACAAATATTA (SEQ ID NO: 93). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 93. In some embodiments, the stabilizing domain comprises the sequence encoded by SEQ ID NO: 93. The stabilizing domain can be transcribed into an RNA molecule.

[0222] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 3' to 5' direction comprises or consists of a sequence derived from equine herpesvirus 2. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, the sequence derived from equine herpesvirus 2 comprises or consists of AAGAATATTTTTAAAGACTTTTTTCCCCAACCTCTGGGTTGGGTTTTTTCTCTTTAAAATATTCAATA (SEQ ID NO: 94). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 94. In some embodiments, the stabilizing domain comprises the sequence encoded by SEQ ID NO: 94. The stabilizing domain can be transcribed into an RNA molecule.

[0223] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 3' to 5' direction comprises or consists of a sequence derived from Kaposi's sarcoma-associated herpesvirus. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, the sequence derived from Kaposi's sarcoma-associated herpesvirus comprises or consists of TGTTTTGTGTTTTGGCTGGGTTTTTCCTTGTTCGCACCGGACACCTCCAGTGACCAGACGGCAAGGTTTTTATCCCAGTGTATATATT (SEQ ID NO: 95). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 95. In some embodiments, the stabilizing domain comprises the sequence encoded by SEQ ID NO: 95. The stabilizing domain can be transcribed into RNA molecules.

[0224] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 3' to 5' direction comprises or consists of a sequence derived from Plautia stali enterovirus. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, the sequence derived from Plautia stali enterovirus comprises or consists of ATTGGCAGTAGAGTTTTTCCCCAGGGAGCTTCACTGGGTTTTCTCTACT (SEQ ID NO: 96). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 96. In some embodiments, the stabilizing domain comprises the sequence encoded by SEQ ID NO: 96. The stabilizing domain can be transcribed into an RNA molecule.

[0225] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 3' to 5' direction comprises or consists of a sequence derived from Cotesia congregata brachovirus. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, the sequence derived from Cotesia congregata brachovirus comprises or consists of TTCATCAAGGAGGTTTTTTCCCAGCCTAGCTGGGTTTTCCTCCTTTGGGGACA (SEQ ID NO: 97). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 97. In some embodiments, the stabilizing domain comprises the sequence encoded by SEQ ID NO: 97. The stabilizing domain can be transcribed into an RNA molecule.

[0226] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 3' to 5' direction comprises or consists of a sequence derived from Cotesia sesamiae brachovirus. The sequence may comprise a DNA sequence. The sequence may comprise an RNA sequence. In some embodiments, the sequence derived from Cotesia sesamiae brachovirus comprises or consists of TTTTCGAGGAGGTTTTTTCCTAGCACCACTAGGTTTTCCTCCTCTGGGAAC (SEQ ID NO: 98). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 98. In some embodiments, the stabilizing domain comprises the sequence encoded by SEQ ID NO: 98. The stabilizing domain can be transcribed into an RNA molecule.

[0227] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 3' to 5' direction includes or comprises a sequence derived from Acanthamoeba polyphaga mimivirus. The sequence may include a DNA sequence. The sequence may include an RNA sequence. In some embodiments, the sequence derived from Acanthamoeba polyphaga mimivirus includes or comprises ATTTACTGTTGGTTTTCTTCTCTGATTTTCATAAGAACTTTTCCCAACA (SEQ ID NO: 99). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 99. In some embodiments, the stabilizing domain includes the sequence encoded by SEQ ID NO: 99. The stabilizing domain can be transcribed into an RNA molecule.

[0228] In some embodiments, the stabilizing domains form a tertiary structure. In some embodiments of the compositions of this disclosure, the tertiary structure is a pseudoknot.

[0229] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 3' to 5' direction includes: group 1 self-splicing introns derived from Azoarcus, Tetrahymena, or Twort; Drosophila sytl pre-mRNA; human CPEB3 ribozyme; E. coli RydC gene; prokaryotic plasmid I-complex or IncL / M or ColIB / P9; leuA mRNA of Mycobacterium bovis; GlmS riboswitch ribozyme; metA gene of Agrobacterium tumefa-ciens; L- and c-myc genes; human interferon gamma mRNA; ornithine decarboxylase antizyme; prion mRNA (human, bovine, yeast); human and Tetrahymena telomerase; 16S rRNA; 16S rRNA, 18S V4 region; 23S rRNA; and M1 of bacterial RNase P. RNA components, Neurospora VS ribozyme, pyrimidine nucleotide synthase ribozyme, alcohol dehydrogenase ribozyme (1-ribox02), ribozyme, aptamer, foot-and-mouth disease virus genome, Mengovirus genome, Paraecovirus 1 genome, Aichivirus genome, Hepatoviridae genome, HCV, classical swine fever virus genome, bovine viral diarrhea virus genome, porcine tescovirus, cricket paralysis virus-like virus genome, Giardia lamblia virus genome, tobacco etch virus genome, retroviridae genome, Nidovirales genome, Totiviridae genome, Luteoviridae genome, Myoviridae genome, ListeriaThe list includes or comprises sequences that form pseudoknots derived from or isolated from a list consisting of monocytogenes phage genomes, mouse leukemia virus genomes, hepatitis C virus genomes, influenza A and B virus genomes, turnip macular mosaic virus genomes, tobacco mosaic virus-like virus genomes, bamboo mosaic virus genomes, strawberry chlorotic fleck-associated virus genomes, potato yellow vein virus genomes, tomato bushy stunt virus genomes, turnip crinkle virus genomes, encephalomyocarditis virus genomes, enterovirus genomes, dengue virus genomes, yellow fever virus genomes, Japanese encephalitis virus genomes, tick-borne encephalitis virus genomes, cauliflower mosaic virus genomes, barley yellow wilt virus genomes, bacteriophage Qβ genomes, avian leukemia virus genomes, peach latent mosaic viroid genomes, macropospiviroid genomes, Sat C satellite RNA of the turnip crinkle virus genome, hepatitis delta virus genomes, and Marek's disease virus genomes.

[0230] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 3' to 5' direction includes or comprises a sequence that forms a pseudoknot derived from mouse leukemia virus. The sequence may include a DNA sequence. The sequence may include an RNA sequence. In some embodiments, the mouse leukemia virus-derived sequence includes or comprises GGGTCAGGAGCCCCCCCCCTGAACCCAGGATAACCCTCAAAGTCGGGGGGCAACCC (SEQ ID NO: 100). In some embodiments, the stabilizing domain includes at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 100. In some embodiments, the stabilizing domain includes the sequence encoded by SEQ ID NO: 100. The stabilizing domain can be transcribed into an RNA molecule.

[0231] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 3' to 5' direction includes or comprises a sequence that forms a pseudoknot derived from the evopreQ1 riboswitch aptamer. The sequence may include a DNA sequence. The sequence may include an RNA sequence. In some embodiments, the sequence derived from the evopreQ1 riboswitch aptamer includes or comprises TTGACGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAAA (SEQ ID NO: 101). In some embodiments, the stabilizing domain includes at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 101. In some embodiments, the stabilizing domain includes the sequence encoded by SEQ ID NO: 101. The stabilizing domain may be transcribed into an RNA sequence.

[0232] In some embodiments, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 3' to 5' direction includes or comprises a sequence that forms a G quadruple chain, a sequence isolated from or derived from ribosomal RNA, a sequence isolated from or derived from a ribozyme, or a sequence isolated from or derived from prion mRNA.

[0233] Disconnected domain In some embodiments, the cleavage domains disclosed herein are hammerhead ribozymes, hammerhead ribozymes, tRNA(gly), tRNA-Gly-CCC-1-1, tRNA-Gly-CCC-1-2, tRNA-Gly-CCC-3-1, tRNA-Gly-CCC-2-2, tRNA-Gly-CCC-2-1, tRNA-Gly-GCC-2-4, tRNA-Gly-GCC-2-5, tRNA-Gly-GCC-2-6, tRNA-Gly-GCC-2-1, tRNA-Gly-GCC-2-2, tRNA-Gly-GCC-1-1, tRNA-Gl y-GCC-1-3, tRNA-Gly-GCC-1-4, tRNA-Gly-GCC-1-5, tRNA-Gly-GCC-3-1, tRNA-Gly-GCC-4-1, tRNA-Gly-GCC-5-1, tRNA-Gly-TCC-3-1, tRNA-Gly-TCC-1-1, t RNA-Gly-TCC-2-1, tRNA-Gly-TCC-2-2, tRNA-Gly-TCC-2-3, tRNA-Gly-TCC-2-4, tRNA-Gly-TCC-2-5, tRNA-Gly-TCC-2-6, tRNA-Gly-TCC-4-1, rice tRNA, MALAT1 mascRNA, 7QR4_2|strand B|RNA CPEB3 ribozyme|Homo sapiens(9606), 7QR3_2|strand C, D|chimpanzee CPEB3 ribozyme|Pan troglodytes(9598), 4R4P_1|strand A|VS ribozyme RNA|NEUROSPORA(5140), 4R4P_1|strand A|VS ribozyme RNA|NEUROSPORA(5140)[tandem dimer], 4R4V_1|strand A|VS ribozyme RNA|NEUROSPORA(5140), 4R4V_1|strand A|VS ribozyme RNA|NEUROSPORA(5140)[tandem dimer], histone 3'UTR (including SLBP and HDE H1-4), histone 3'UTR (including SLBP and HDE Histone 3'UTR (including H2BC21D), histone 3'UTR (SLBP and HDE, including H2AC20), histone 3'UTR (SLBP and HDE, including H2BC13), histone 3'UTR (SLBP and HDE(Containing H2AC25), Pri-miR-16-1, Pri-miR-30a, artificial microprocessor substrate, eIF4H exon 5, Pri-miR-7, targeted pseudo-lysylated snoRNA-1, targeted pseudo-lysylated snoRNA-2, scaRNA-9, scaRNA-2, 5K7C_1|strand A|RNA47-MER|synthetic construct (32630), 5T5A_1|strand A|DNA / RNA(71-MER)|metagenogene (256318), 4OJI_1|strand A|RNA(52-MER)|null, 4RGE_1|strand A, B, C|env22 twister ribozyme| The molecule contains the sequence or structure of any one or more molecules selected from the group consisting of synthetic (32630), 6JQ5_1|strand A, B|RNA(82-MER)|synthetic construct (32630), 6JQ5_1|strand A, B|RNA(82-MER)|synthetic construct (32630) dimer, Pri-miR-31(51+51), Pri-miR-31(51+51) / Pre-miR-HBV, Pri-miR-31(38+40) / Pre-miR-HBV, Pri-miR-31(30+31) / Pre-miR-HBV, and Pri-miR-31(22+21) / Pre-miR-HBV. In some embodiments, the cleavage domains have at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the aforementioned intramolecular sequences.

[0234] Manipulated U1 snRNA The compositions provided herein may comprise nucleic acid sequences encoding engineered U1 snRNA (enzyme staple molecules or "ESM"). The nucleic acid may comprise RNA, DNA, DNA / RNA hybrids, and / or at least one of nucleic acid analogs, chemically modified nucleic acids, or chimeras composed of two or more nucleic acids or nucleic acid analogs. Nucleic acids, including DNA, may encode an ESM. DNA may be transcribed into RNA, for example, engineered nuclear small RNA (snRNA). In some embodiments, the ESM comprises engineered snRNA. Engineered snRNA (e.g., esnRNA) can recruit members of a spliceosome. In some embodiments, the engineered snRNA is configured to facilitate RNA splicing. In some embodiments, the engineered snRNA is configured to facilitate the RNA splicing of a trans-splicing RNA molecule or a portion thereof to form a full-length trans-splicing RNA molecule. In some embodiments, the engineered snRNA is configured to facilitate the RNA splicing of an exon domain to replace a portion of a target RNA. Manipulated snRNAs can interact with nucleic acid sequences, or transcribed copies thereof, to enhance the transsplicing of nucleic acid sequences. Thus, manipulated snRNAs can facilitate the association of exon domains with target RNA, thereby resulting in the transsplicing of exon domains to target RNA. Manipulated snRNAs can also facilitate the association of a portion of a transsplicing RNA molecule with another portion of the transsplicing RNA molecule, thereby resulting in a full-length transsplicing RNA molecule.

[0235] In some embodiments, the engineered snRNA can interact with intron domains to increase the trans-splicing efficiency of trans-splicing nucleic acid molecules. In some embodiments, the engineered snRNA domain includes sequences derived from or isolated from human nuclear small RNA genes. In some embodiments, the human nuclear small RNA genes include U1, U2, U4, U5, U6, U7, U11, and U12 snRNAs. In some embodiments, there may be engineered snRNA sequences configured to promote trans-splicing. In some embodiments, the engineered snRNA may be derived from or isolated from the human U1 snRNA gene. In some embodiments, the sequence of the engineered snRNA may be derived from or isolated from a U1 snRNA variant.In some embodiments of the compositions of this disclosure, the U1 snRNA variant is tU1.1[chr1:16713367-16712967], tU1.2[chr1:16866030-16865630], vU1.1[chr1:142438700-142438300], vU1.2[chr1:142464813-142464413], vU1.4[chr1:143022739-143022339], vU1.5[chr1:143202968-143202568], vU1.7[chr 1:144680790-144680390], vU1.8[chr1:145022927-145022527], vU1.9[chr1:145977791-145977391], vU1.10[chr1:146301 289-146300889], vU1.11[chr1:146327427-146327027], vU1.15[chr1:146871696-146871296], vU1.16[chr1:147033726-14 7033326], vU1.17[chr1:147460893-147460493], vU1.18[chr1:147490845-147490445], vU1.19[chr1:147780880-1477804 80], tU1.3[chr1:16939762-16940162], tU1.4[chr1:17095226-17095626], vU1.3[chr1:142478876-142479276], vU1.6[chr The selection is made from a list consisting of [1:144094114-144094514], vU1.12[chr1:146341486-146341886], vU1.13[chr1:146460770-146461170], vU1.14[chr1:146608089-146608489], and vU1.20[chr1:147872535-147872935] (the values ​​in parentheses after the names indicate the genomic location according to UCSC Human Genome Assembly 2006).

[0236] In some embodiments, the ESM includes or consists of the following sequence:CGAGCTCTCTgcaggggagataccaTGATCAcgaaggtggttttcccagggcgaggcttatccattgcactccggatgtgctgacccctgcgatttccccaaatgtgggaaactcgactgcataatttgtggtagtCACCTTCGTGATCATGGTATCTCCCCCG (SEQ ID NO: 124). In some embodiments, the ESM includes or consists of the following sequence:CGAGCTCTCTgcaggggagataccaTGATCAcgaaggtggttttcccagggcgaggcttatccattgcactccggatgtgctgacccctgcgatttccccaaatgtgggaaactcgactgcataatttgtggtagtgggggactgcgttcgcgctttcccctg (SEQ ID NO: 125).

[0237] Ribozyme Ribozymes, like enzymes, are non-coding RNAs that catalyze specific biochemical transformations. Some ribozymes can catalyze or perform RNA splicing. Ribozymes can cleave or ligate RNA and DNA, and can catalyze peptide bond formation. Within ribosomes, ribozymes can function as part of ribosomal RNA, a large subunit for linking amino acids during protein synthesis.

[0238] In some embodiments, the transsplicing nucleic acid molecule of the present disclosure comprises (a) an exon domain (e.g., one encoding a therapeutic sequence); (b) an intron domain configured to facilitate ribonucleic acid (RNA) transsplicing; (c) an antisense domain configured to bind to a target RNA molecule; and (d) a sequence or structure derived from or isolated from a ribozyme, the ribozyme being selected from the group consisting of VS ribozymes, twister ribozymes, twister sister ribozymes, lanthanum ribozymes, pistol ribozymes, hairpin ribozymes, leadzymes, hatchet ribozymes, GIR1 branched ribozymes, glmS ribozymes, class I introns, class II introns, RNAse P, CoTC ribozymes, Hoylinc ribozymes, Varkud satellite ribozymes, mammalian CPEB3 ribozymes, and riboswitches. In some embodiments, the transsplicing nucleic acid molecule further comprises a G-quadricone and / or pseudoknot. In some embodiments, the transsplicing nucleic acid molecule further comprises poly(A). In some embodiments, the transsplicing nucleic acid molecule comprises, from 5' to 3', a G-quadrilateral and / or pseudoknot, a sequence or structure derived from or isolated from a ribozyme, and poly(A). In some embodiments, the transsplicing nucleic acid molecule comprises, from 5' to 3', a sequence or structure derived from or isolated from a ribozyme, a G-quadrilateral and / or pseudoknot, and poly(A). In some embodiments, the transsplicing nucleic acid molecule comprises, from 5' to 3', a G-quadrilateral and / or pseudoknot, and a sequence or structure derived from or isolated from a ribozyme, and the transsplicing nucleic acid molecule does not include a 3' poly(A) tail. In some embodiments, the transsplicing nucleic acid molecule comprises, from 5' to 3', a sequence or structure derived from or isolated from a ribozyme, and a G-quadrilateral and / or pseudoknot, and the transsplicing nucleic acid molecule does not include a 3' poly(A) tail.

[0239] In some embodiments, the transsplicing nucleic acid molecule of the present disclosure comprises (a) an exon domain (e.g., one encoding a therapeutic sequence); (b) an intron domain configured to facilitate ribonucleic acid (RNA) transsplicing; (c) an antisense domain configured to bind to a target RNA molecule; (d) a sequence or structure derived from or isolated from a ribozyme; and (e) a 3' domain, the 3' domain being poly(A). In some embodiments, the 3' domain comprises a sequence or structure derived from or isolated from a ribozyme. In some embodiments, the 3' domain is not derived from or isolated from a ribozyme. In some embodiments, the ribozyme is selected from the group consisting of hammerhead ribozyme, HDV ribozyme, twister ribozyme, twister sister ribozyme, lanthanum ribozyme, pistol ribozyme, hairpin ribozyme, VS ribozyme, leadzyme, hatchet ribozyme, GIR1 branched ribozyme, glmS ribozyme, class I intron, class II intron, RNase P, CoTC ribozyme, Hoylinc ribozyme, Varkud satellite ribozyme, mammalian CPEB3 ribozyme, and riboswitch. In some embodiments, the 3' domain includes a cleavage domain. In some embodiments, the cleavage domain includes a sequence or structure derived from or isolated from the ribozyme. In some embodiments, the cleavage domain does not include a sequence or structure derived from or isolated from the ribozyme. In some embodiments, the stabilization domain includes a sequence or structure derived from or isolated from the ribozyme. In some embodiments, the stabilizing domain does not include sequences or structures derived from or isolated from the ribozyme. In some embodiments, the stabilizing domain includes a G-quadruplicate. In some embodiments, the stabilizing domain includes a pseudoknot. In some embodiments, the 3' domain includes a nucleus-holding domain. In some embodiments, the nucleus-holding domain includes sequences or structures derived from or isolated from the ribozyme.In some embodiments, the nucleus-holding domain does not include any sequence or structure derived from or isolated from the ribozyme. In some embodiments, the 3' domain includes a 5'-to-3':G ​​quadruple chain and / or pseudoknot, as well as a sequence or structure derived from or isolated from the ribozyme. In some embodiments, the 3' domain includes a 5'-to-3':G ​​quadruple chain and / or pseudoknot, as well as a sequence or structure derived from or isolated from the ribozyme. In some embodiments, the 3' domain includes a 5'-to-3':G ​​quadruple chain and a sequence or structure derived from or isolated from the ribozyme. In some embodiments, the 3' domain includes a 5'-to-3':G ​​quadruple chain and a sequence or structure derived from or isolated from the ribozyme. In some embodiments, the 3' domain includes a sequence or structure derived from or isolated therefrom the 5'-3' pseudoknot and ribozyme.

[0240] In some embodiments, the ribozyme is a twister-ribozyme. In some embodiments, the ribozyme is a twister-ribozyme comprising the sequence described in Sequence ID No. 115. In some embodiments, the ribozyme is an env22 twister-ribozyme. In some embodiments, the ribozyme is an env22 twister-ribozyme comprising the sequence described in Sequence ID No. 116. In some embodiments, the ribozyme is a twister-sister ribozyme. In some embodiments, the ribozyme is a twister-sister ribozyme comprising the sequence described in Sequence ID No. 114. A twister-sister ribozyme is described, for example, in Zheng et al, Structure-based insights into self-cleavage by a four-way junctional twister-sister ribozyme, Nat Commun (2017) Oct 30;8(1):1180, which is incorporated herein by reference in its entirety. In some embodiments, the ribozyme is a hammerhead ribozyme. In some embodiments, the ribozyme is a hammerhead ribozyme containing the sequence described in SEQ ID NO: 123. Hammerhead ribozymes are described, for example, in Scott et al, (2013) Prog Mol Bio Trans Sci. 120:1-23, which is incorporated herein by reference in its entirety. In some embodiments, the ribozyme is an Rzb hammerhead ribozyme. In some embodiments, the ribozyme is a self-cleaving hammerhead ribozyme. In some embodiments, the ribozyme is a class I intron. In some embodiments, the ribozyme is a class II intron. In some embodiments, the ribozyme is RNAse P. In some embodiments, the ribozyme is peptidyltransferase 23S rRNA. In some embodiments, the ribozyme is a GIR1 branched ribozyme. In some embodiments, the ribozyme is a reedzyme. In some embodiments, the ribozyme is a hairpin ribozyme. In some embodiments, the ribozyme is a hepatitis delta virus (HDV) ribozyme.In some embodiments, the ribozyme is a VS ribozyme. In some embodiments, the ribozyme is a mutant VS ribozyme. In some embodiments, the mutant VS ribozyme contains the G638A mutation. In some embodiments, the mutant VS ribozyme contains the A756G mutation. In some embodiments, the ribozyme is a VS ribozyme containing the G638A mutation. In some embodiments, the ribozyme is a VS ribozyme containing the A756G mutation. In some embodiments, the ribozyme is a pistol ribozyme. In some embodiments, the ribozyme is a hatchet ribozyme. In some embodiments, the ribozyme is a tandem dimer hatchet ribozyme. In some embodiments, the ribozyme contains one copy of a hatchet ribozyme. In some embodiments, the ribozyme is a mammalian CPEB3 ribozyme (see Chadalavada DM, et al., The human HDV-like CPEB3 ribozyme is intrinsically fast-reacting; Biochemistry 2010, 49, 25, 5321-5330; and Chen C et al, Inhibition of Cpeb3 ribozyme elevates CPEB3 protein expression and polyadenylation of its target mRNAs and enhances object location memory, eLife 2024, DOI:10.7554 / eLife.90116, each of which is incorporated herein by reference in its entirety). In some embodiments, the ribozyme is a human CPEB3 ribozyme. In some embodiments, the ribozyme contains the sequence described in Sequence ID No. 121. In some embodiments, the ribozyme is a chimpanzee CPEB3 ribozyme. In some embodiments, the ribozyme is a CPEB3 ribozyme derived from Pan troglodytes. In some embodiments, the ribozyme contains the sequence described in Sequence ID No. 122. In some embodiments, the ribozyme is a CoTC ribozyme.In some embodiments, the ribozyme is a glmS ribozyme. In some embodiments, the ribozyme is a ribozyme derived from or encoded by lncRNA. In some embodiments, the ribozyme is a Hovlinc ribozyme (see, for example, Chen et al, Hovlink is a recently evolved class of ribozyme found in human lncRNA, Nat Chem Biol 2021, 17:601-607, which is incorporated herein by reference in its entirety). In some embodiments, the ribozyme is a lantern ribozyme (see, for example, Zhou et al, Human lantern ribozymes: smallest known self-cleaving ribozymes, ELife reviewed preprint posted September 11, 2023, which is incorporated herein by reference in its entirety). In some embodiments, the ribozyme is a self-alkylating ribozyme (see, for example, Krochmal et al, Structural basis for substrate binding and catalysis by a self-alkylating ribozyme, Nat Chem Biol 2022 18:376-384, which is incorporated herein by reference in its entirety). In some embodiments, the ribozyme is a Varkud satellite ribozyme.

[0241] In some embodiments, the ribozyme is a prokaryotic ribozyme. In some embodiments, the ribozyme is derived from or isolated from a prokaryote. In some embodiments, the ribozyme is derived from or isolated from a bacterium or archaea. In some embodiments, the ribozyme is a ribozyme derived from T. thermophila. In some embodiments, the ribozyme is a eukaryotic ribozyme. In some embodiments, the ribozyme is derived from or isolated from a eukaryote. In some embodiments, the ribozyme is derived from or isolated from a mammal. In some embodiments, the ribozyme is derived from or isolated from a human. In some embodiments, the ribozyme derived from or isolated from a human is the CPEB3 ribozyme. In some embodiments, the ribozyme is derived from or isolated from a chimpanzee (Pan troglodytes). In some embodiments, the ribozyme derived from or isolated from a chimpanzee is the CPEB3 ribozyme.

[0242] In some embodiments, the ribozyme is a self-cleaving ribozyme. In some embodiments, the self-cleaving ribozyme is a hammerhead ribozyme. In some embodiments, the ribozyme cleaves the target RNA molecule. In some embodiments, the ribozyme does not cleave the target RNA molecule. In some embodiments, the ribozyme acts as a steric hindrance to the target RNA molecule. In some embodiments, the ribozyme acts as a steric hindrance to the target RNA molecule. In some embodiments, the ribozyme acting as a steric hindrance to the target RNA molecule improves or assists in the nuclear retention of the target RNA molecule. In some embodiments, the ribozyme acting as a steric hindrance to the target RNA molecule prevents or inhibits cleavage of the target RNA molecule by spliceosomes. In some embodiments, the ribozyme is a self-alkylated ribozyme.

[0243] In some embodiments, the ribozyme is regulated by the presence of one or more metal ions. In some embodiments, the secondary structure of the ribozyme is regulated or altered by the presence or absence of one or more metal ions. In some embodiments, the tertiary structure of the ribozyme is regulated or altered by the presence or absence of one or more metal ions. In some embodiments, the catalytic function of the ribozyme is regulated or altered by the presence or absence of one or more metal ions. In some embodiments, the one or more metal ions are Mg 2+ It is a cation. In some embodiments, the ribozyme is not regulated by the presence or absence of one or more metal ions. In some embodiments, the catalytic function of the ribozyme arises from an acid-base catalytic reaction. The mechanisms of ribozyme catalytic reactions are described, for example, in Lilley, Mechanisms of RNA Catalysis, Philos Trans R Soc Lond B Biol Sci. 2011 Oct 27;366(1580):2910-2917, and in Ren et al., Structure-based mechanistic insights into catalysis by small self-cleaving ribozymes, Curr Opin Chem Biol 2017 Dec:41:71-83, which are incorporated herein by reference in their entirety. In some embodiments, regulation or modification means that the ribozyme undergoes a conformational change when bound to one or more metal ions. In some embodiments, being modulated or altered means that a ribozyme undergoes a change in its conformation when bound to one or more metal ion cofactors, thereby increasing its ability to catalyze biochemical reactions.

[0244] In some embodiments, the ribozyme includes a pseudoknot. In some embodiments, the ribozyme includes a first pseudoknot and a second pseudoknot. In some embodiments, the ribozyme includes one or more pseudoknots. In some embodiments, the ribozyme includes two or more pseudoknots. In some embodiments, the ribozyme is a twister ribozyme having or including a secondary structure of three stems joined by internal and terminal loops. In some embodiments, the ribozyme is a twister ribozyme including two pseudoknot structures. In some embodiments, the two pseudoknots of the twister ribozyme provide tertiary structural contacts important for catalytic activity (see, for example, Roth et. al., A widespread self-cleaving ribozyme class is revealed by bioinformatics. Nature Chemical Biology 10, 56-60 (2014), which is incorporated herein by reference in its entirety). In some embodiments, the ribozyme is a twister-sister ribozyme containing a four-way branched junction precatalytic structure (see, for example, Zheng et al., Structure-based insights into self-cleavage by a four-way junctional twister-sister ribozyme, Nat Comm 2017 8(1180), which is incorporated herein by reference in its entirety).

[0245] In some embodiments, ribozymes increase the trans-splicing efficiency of trans-splicing molecules. In some embodiments, ribozymes increase the trans-splicing efficiency of trans-splicing molecules by at least about 20%, at least about 25%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, at least about 300%, at least about 350%, at least about 400%, at least about 450%, at least about 500%, at least about 550%, at least about 600%, at least about 650%, at least about 700%, at least about 750%, at least about 800%, at least about 850%, at least about 900%, at least about 950%, at least about 1000%, or more.

[0246] In some embodiments, G-quadruplicates and / or pseudoknots increase the trans-splicing efficiency of trans-splicing molecules. In some embodiments, G-quadruplicates and / or pseudoknots increase the trans-splicing efficiency by at least about 20%, at least about 25%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, at least about 300%, at least about 350%, at least about 400%, at least about 450%, at least about 500%, at least about 550%, at least about 600%, at least about 650%, at least about 700%, at least about 750%, at least about 800%, at least about 850%, at least about 900%, at least about 950%, at least about 1000%, or more.

[0247] In some embodiments, the ribozyme comprises a nucleic acid sequence selected from SEQ ID NOs: 114-123. In some embodiments, the ribozyme comprises a nucleic acid sequence having a sequence homology of at least about 80%, at least about 85%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or higher, with respect to any one of SEQ ID NOs: 114-123. [Table 1]

[0248] nucleic acid Trans-splicing nucleic acid molecules In some embodiments, the disclosure provides transsplicing nucleic acid molecules comprising one or more exon domains. The nucleic acid may include RNA, DNA, DNA / RNA hybrids, and / or at least one of nucleic acid analogs, chemically modified nucleic acids, or chimeras composed of two or more nucleic acids or nucleic acid analogs. In some embodiments, the transsplicing nucleic acid molecule may be provided by the reconstitution of two or more exon domains. In some embodiments, the transsplicing nucleic acid molecule comprises a transsplicing RNA molecule. In some embodiments, the nucleic acid molecules provided herein encode one or more transsplicing RNA molecules or a portion thereof. In some embodiments, the transsplicing RNA molecule or a portion thereof comprises one or more exon domains. In some embodiments, the transsplicing RNA molecule may be reconstituted from one or more exon domains. In some embodiments, the transsplicing RNA molecule or a portion thereof comprises one or more antisense domains. In some embodiments, one or more antisense domains facilitate association with the transsplicing RNA and target RNA.

[0249] In some embodiments, the transsplicing RNA molecule comprises one or more exon domains. In some embodiments, the transsplicing RNA molecule comprises one or more antisense domains. In some embodiments, the transsplicing RNA molecule comprises (a) one or more intron domains that promote transsplicing, (b) one or more antisense domains that are inversely complementary to the target RNA, (c) one or more exon domains, and (d) a 3' domain configured to increase the safety and efficiency of the transsplicing molecule. In some embodiments, the 3' domain comprises a nuclear retention domain configured to promote the retention of the transsplicing RNA molecule in the nucleus, and thus increases transsplicing activity or the occurrence of transsplicing. In some embodiments, the 3' domain further comprises a stabilization domain that prevents the degradation of the transsplicing RNA molecule by nucleases. In some embodiments, the 3' domain further comprises a cleavage domain that results in the cleavage of the transsplicing RNA within or adjacent to the cleavage domain. The compositions provided herein may further comprise nucleic acids encoding the manipulated U1 snRNA. In some embodiments, the intron domain of the transsplicing RNA molecule contains a sequence that binds to the manipulated U1 snRNA.

[0250] In some embodiments, the trans-splicing nucleic acid molecule comprises RNA, DNA, a DNA / RNA hybrid, and / or at least one of a nucleic acid analog, a chemically modified nucleic acid, or a chimera composed of two or more nucleic acids or nucleic acid analogs. As used herein, the term “nucleic acid analog” refers to a compound having structural similarity to the canonical purine or pyrimidine bases present in DNA or RNA. Nucleic acid analogs may contain modified sugars and / or modified nucleic acid bases compared to the purine or pyrimidine bases naturally present in DNA or RNA. In some embodiments, the nucleic acid analogs are 2'-deoxyribonucleosides, 2'-ribonucleosides, 2'-deoxyribonucleotides, or 2'-ribonucleotides, where the nucleic acid bases include modified bases (e.g., xanthine, uridine, oxanine (oxanosine), 7-methylguanosine, dihydrouridine, 5-methylcytidine, C3 spacer, 5-methyldC, 5-hydroxybutynyl-2'-deoxyuridine, 5-nitroindole, 5-methylisodeoxycytosine, isodeoxyguanosine, deoxyuridine, isodeoxycytidine, other 0-1 purine analogs, N-6-hydroxylaminopurine, nebularin, 7-deazahypoxanthine, other 7-deazapurines, and 2-methylpurine). In some embodiments, the nucleic acid analog may be selected from the group consisting of inosine, 7-deaza-2'-deoxyinosine, 2'-aza-2'-deoxyinosine, PNA-inosine, morpholino-inosine, LNA-inosine, phosphoramidate-inosine, 2'-O-methoxyethyl-inosine, and 2'-OMe-inosine. In other embodiments, the nucleic acid analog is a nucleic acid mimetic (e.g., artificial nucleic acids and xeno nucleic acids (XNA)).

[0251] The nucleic acids of this disclosure may be chemically modified from naturally occurring nucleic acids. In some embodiments, the modification may improve the stability of the nucleic acid. In some embodiments, the modification includes N6-methyladenosine (m6A), N6,2'-O-dimethyladenosine (m6Am), 8-oxo-7,8-dihydroguanosine (8-oxoG), pseudouridine (Ψ), 5-methylcytidine (m5C), or N4-acetylcytidine (ac4C).

[0252] In some embodiments, the transsplicing RNA molecule further comprises a 5' untranslated region. In some embodiments, the 5' untranslated region increases the stability of the transsplicing nucleic acid molecule. In some embodiments, the 5' untranslated region modifies the localization of the transsplicing nucleic acid molecule. In some embodiments, the 5' untranslated region modifies the processing of the transsplicing nucleic acid molecule.

[0253] In some embodiments, the transsplicing RNA molecule further includes a 3' untranslated region. In some embodiments, the 3' untranslated region increases the stability of the transsplicing nucleic acid molecule. In some embodiments, the 3' untranslated region modifies the localization of the transsplicing nucleic acid molecule. In some embodiments, the 3' untranslated region modifies the processing of the transsplicing nucleic acid molecule.

[0254] In some embodiments, this specification provides transsplicing nucleic acid molecules configured to transsplice with intracellular target RNA, such as pre-mRNA. In some embodiments, the transsplicing nucleic acid molecules are configured to transsplice with target RNA involved in a disease or condition.

[0255] Sequence of trans-splicing molecules Furthermore, provided herein are nucleic acid sequences encoding trans-splicing nucleic acid molecules disclosed herein for use in the gene transfer and expression technologies described herein. Although not necessarily expressly stated, the sequences provided herein should be understood to be usable not only to provide expression products but also to provide substantially identical sequences that produce proteins having the same biological properties. These “biologically equivalent,” “biologically active,” or “equivalent” polypeptides are encoded by equivalent polynucleotides described herein. These may have nucleic acid sequences that are at least 60%, or alternatively at least 65%, or alternatively at least 70%, or alternatively at least 75%, or alternatively at least 80%, or alternatively at least 85%, or alternatively at least 90%, or alternatively at least 95%, or alternatively at least 98% identical to the reference nucleic acid sequence when compared using a sequence identity method performed under default conditions. Specific sequences are provided as examples of particular embodiments. In addition, equivalent polynucleotides hybridize to the reference polynucleotide or its complement under stringent conditions.

[0256] The nucleic acid sequences (e.g., polynucleotide sequences) disclosed herein can be codon-optimized. Codon optimization refers to the fact that the usage frequency of certain codons differs across different cells. This codon bias corresponds to a bias in the relative abundance of a particular tRNA in that cell type. Expression can be increased by modifying codons in the sequence to match the relative abundance of the corresponding tRNA. Expression can also be decreased by intentionally selecting codons where the corresponding tRNA is rare in a particular cell type, using a codon usage table or the like. Based on the genetic code, nucleic acid sequences encoding various exon domains can be generated. In some embodiments, such sequences are optimized for expression in host cells (mammalian cells, e.g., human cells) or target cells, such as host cells used to express a trans-splicing RNA molecule containing the exon domain on which the method of this disclosure is carried out.

[0257] Using codon preference and codon use tables for a specific species, isolated nucleic acid molecules encoding exon domains (such as those encoding proteins with at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to their corresponding wild-type proteins) can be manipulated to take advantage of the codon use preferences of that particular species. For example, the exon domains disclosed herein can be designed to have codons that are preferentially used by the specific organism in question. In one example, the exon domain nucleic acid sequence is optimized for expression in human cells, such as having at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with respect to its corresponding wild-type nucleic acid sequence or the original nucleic acid sequence. In some embodiments, an isolated trans-splicing nucleic acid molecule encoding at least one exon domain (which may be part of a vector) contains at least one exon domain that is codon-optimized for expression in eukaryotic cells, or at least one exon domain that is codon-optimized for expression in human cells. In one embodiment, such a codon-optimized exon domain has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with respect to its corresponding wild-type sequence or original sequence.

[0258] In some embodiments, the codon-optimized nucleic acid sequence of a eukaryotic cell encodes an exon domain having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with respect to its corresponding wild-type or original protein. In another embodiment, various clones containing functionally equivalent nucleic acids, such as nucleic acids encoding the same exon domain protein sequence but with different sequences, may be generated by conventional methods. Silent mutations in the exon domain result from the degeneracy (i.e., redundancy) of the genetic code, where multiple codons can encode the same amino acid residue. Therefore, for example, leucine may be encoded by CTT, CTC, CTA, CTG, TTA, or TTG; serine may be encoded by TCT, TCC, TCA, TCG, AGT, or AGC; asparagine may be encoded by AAT or AAC; aspartic acid may be encoded by GAT or GAC; cysteine ​​may be encoded by TGT or TGC; alanine may be encoded by GCT, GCC, GCA, or GCG; glutamine may be encoded by CAA or CAG; tyrosine may be encoded by TAT or TAC; and isoleucine may be encoded by ATT, ATC, or ATA. Tables showing standard genetic codes can be found in various sources (see, for example, Stryer, 1988, Biochemistry, 3rd Edition, WH5, Freeman and Co., NY).

[0259] vector This composition provides a vector for delivering any one of the compositions, nucleic acids, or systems described herein, or for use in any one of the methods described herein. In some embodiments of the compositions and methods of this disclosure, the vector of this disclosure is a viral vector. In some embodiments, the viral vector comprises a sequence isolated from or derived from a retrovirus. In some embodiments, the viral vector comprises a sequence isolated from or derived from a lentivirus. In some embodiments, the viral vector comprises a sequence isolated from or derived from an adenovirus. In some embodiments, the viral vector comprises a sequence isolated from or derived from an adeno-associated virus (AAV). In some embodiments, the viral vector comprises a sequence isolated from or derived from herpes simplex virus (HSV). In some embodiments, the viral vector is non-replicable. In some embodiments, the viral vector is isolated or recombinant. In some embodiments, the viral vector is self-complementary.

[0260] In some embodiments, the vector is a viral vector. In some embodiments, the vector is an adenovirus vector, an adeno-associated virus (AAV) vector, or a lentivirus vector. In some embodiments, the vector is a retrovirus vector, an adenovirus / retrovirus chimeric vector, a herpes simplex virus I or II vector, a parvovirus vector, a reticuloendotheliopathy virus vector, a poliovirus vector, a papillomavirus vector, a vaccinia virus vector, or any hybrid or chimeric vector incorporating preferred embodiments of two or more viral vectors. In some embodiments, the vector further comprises one or more expression control elements operably linked to a polynucleotide. In some embodiments, the vector further comprises one or more selectable markers.

[0261] In some embodiments of the compositions and methods of this disclosure, the viral vector comprises a sequence isolated from or derived from adeno-associated virus (AAV). In some embodiments, the viral vector comprises a terminal inverted repeat sequence or capsid sequence isolated from or derived from AAV of serotype AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, or AAV12. In some embodiments, the viral vector is non-replicable. In some embodiments, the viral vector is isolated or recombinant (rAAV). In some embodiments, the viral vector is self-complementary (scAAV). In some embodiments, the AAV vector is low toxicity. In some embodiments, the AAV vector is not integrated into the host genome, thereby reducing the probability of insertional mutagenesis. In some embodiments, the AAV vector may encode a total polynucleotide in the range of 0.3kb to 4.75kb. In some embodiments, AAV vectors that may be used in any of the compositions, systems, methods, and kits described herein may include AAV1 vector, modified AAV1 vector, AAV2 vector, modified AAV2 vector, AAV3 vector, modified AAV3 vector, AAV4 vector, modified AAV4 vector, AAV5 vector, modified AAV5 vector, AAV6 vector, modified AAV6 vector, AAV7 vector, modified AAV7 vector, AAV8 vector, AAV9 vector, AAV.rh10 vector, modified AAV.rh10 vector, AAV.rh32 / 33 vector, modified AAV.rh32 / 33 vector, AAV.rh43 vector, modified AAV.rh43 vector, AAV.rh74 vector, modified AAV.rh74 vector, AAV.rh64R1 vector, and modified AAV.rh64R1 vector, as well as any combination or equivalent thereof.

[0262] In some embodiments, the lentiviral vector is an integrase-competent lentiviral vector (ICLV). In some embodiments, the lentiviral vector may refer not only to a transgene plasmid vector, but also to a transgene plasmid vector combined with an associated plasmid (e.g., a packaging plasmid, a rev expression plasmid, an envelope plasmid), and to lentiviral particles capable of introducing exogenous nucleic acids into cells via a virus or virus-like entry mechanism. In some embodiments, lentiviral vectors that may be used in any of the compositions, systems, methods, and kits described herein include human immunodeficiency virus (HIV) 1 vector, modified human immunodeficiency virus (HIV) 1 vector, human immunodeficiency virus (HIV) 2 vector, modified human immunodeficiency virus (HIV) 2 vector, Suti-mangabasal immunodeficiency virus (SIVSM) vector, modified Suti-mangabasal immunodeficiency virus (SIVSM) vector, African green monkey immunodeficiency virus (SIVAGM) vector, modified African green Possible vectors include risal immunodeficiency virus (SIVAGM), equine infectious anemia virus (EIAV), modified equine infectious anemia virus (EIAV), feline immunodeficiency virus (FIV), modified feline immunodeficiency virus (FIV), visna / maedi virus (VNV / VMV), modified visna / maedi virus (VNV / VMV), canine arthritis encephalitis virus (CAEV), modified canine arthritis encephalitis virus (CAEV), bovine immunodeficiency virus (BIV), or modified bovine immunodeficiency virus (BIV).

[0263] In some embodiments, the vectors of this disclosure are nonviral vectors. In some embodiments, the vectors include or consist of lipid nanoparticles, micelles, liposomes or lipoplexes, polymerosomes, polyplexes, exosomes or dendrimers. In some embodiments, the vectors are expression vectors or recombinant expression systems. As used herein, the term “recombinant expression system” refers to a gene construct for expressing a particular genetic material formed by recombinant means.

[0264] In some embodiments, the liposomes, lipoplexes, or lipid nanoparticles may further comprise noncationic lipids, PEG-conjugated lipids, sterols, or any combination thereof.

[0265] In some embodiments, the liposome, lipoplex, or lipid nanoparticle further comprises a noncationic lipid, where the nonionic lipid is distearoyl-sn-glycerophosphoethanolamine, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POP C) Palmitoyloleoylphosphatidylethanolamine (POPE), dioleoylphosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoylphosphatidylethanolamine (DSPE), monomethylphosphatidylethanolamine (e.g., 16-O-monomethylPE), dimethylphosphatidylethanolamine (e.g., 16-O-dimethylPE), 18-1-transPE, 1-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE), hydrogenated soybean phosphatidylcholine (HSPC), egg phosphatidylcholine (EPC), dioleoylphosphatidylserine (DOPS), sphingomyelin (SM), dimyristoylphosphatidylcholine (DMPC), dimyristoylphosphatidylglycerol (DMPG), distearoylphosphatidylglycerol (DSPG), dierucoylphosphatidylcholine (DEPC), palmitoyloleoylphosphatidylglycerol (POPG), dielaidoyl-phosphatidylethanolamine (DEPE), lecithin, phosphatidylethanolamine, lysolecithin, lysophosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, sphingomyelin, egg sphingomyelin (ESM), cephalin, cardiolipin, phosphatidic acid, cerebroside, dicetyl phosphate, lysophosphatidylcholine, dilinoleoylphosphatidylcholine, and non-cationic lipids described in, for example, WO2017 / 099823 or US2018 / 0028664, are selected from the group consisting of the foregoing.

[0266] In some embodiments, the liposome, lipoplex, or lipid nanoparticle further comprises a conjugated lipid, wherein the conjugated lipid is selected from the group consisting of PEG-diacylglycerol (DAG) (such as 1-(monomethoxy-polyethylene glycol)-2,3-dimyristoylglycerol (PEG-DMG)), PEG-dialkyloxypropyl (DAA), PEG-phospholipid, PEG-ceramide (Cer), pegylated phosphatidylethanolamine (PEG-PE), PEG succinate diacylglycerol (PEGS-DAG) (such as 4-O-(2',3'-di(tetradecanoyloxy)propyl-1-O-(ω-methoxy(polyethoxy)ethyl)butanedioate (PEG-S-DMG)), PEG dialkoxypropylcarbam, and N-(carbonyl-methoxypolyethylene glycol 2000)-1,2-distearoyl-sn-glycero-3-phosphoethanolamine sodium salt.

[0267] In some embodiments, the liposome, lipoplex, or nanoparticle further comprises cholesterol or a cholesterol derivative.

[0268] In some embodiments, the liposome, lipoplex, or nanoparticle further comprises an ionizable lipid, a non-cationic lipid, a conjugated lipid that inhibits aggregation of particles, and a sterol. The amounts of the ionizable lipid, non-cationic lipid, conjugated lipid that inhibits aggregation of particles, and sterol can be varied independently. In some embodiments, the lipid nanoparticle comprises the ionizable lipid in an amount of about 20 mol% to about 90 mol% of the total lipid present in the particle, the non-cationic lipid in an amount of about 5 mol% to about 30 mol% of the total lipid present in the particle, the conjugated lipid that inhibits aggregation of particles in an amount of about 0.5 mol% to about 20 mol% of the total lipid present in the particle, and the sterol in an amount of about 20 mol% to about 50 mol% of the total lipid present in the particle.

[0269] The ratio of total lipid to DNA vector can be varied as needed. For example, the ratio of total lipid to DNA vector (by mass or weight) can be from about 10:1 to about 30:1.

[0270] In some embodiments of the compositions and methods of the present disclosure, the expression vector, viral vector or non-viral vector provided herein includes, but is not limited to, an expression control element. As used herein, "expression control element" refers to any sequence that modulates the expression of an exon domain such as a gene. Expression control elements include, but are not limited to, promoters, enhancers, microRNAs, post-transcriptional regulatory elements, polyadenylation signal sequences, 5' or 3' untranslated regions, and introns.

[0271] Expression regulatory elements can be, for example, constitutive, inductive, repressive, or tissue-specific. A “promoter” is a regulatory sequence that is a region of polynucleotide sequence that controls the initiation and rate of transcription. Promoters may contain gene elements to which regulatory proteins and molecules, such as RNA polymerase and other transcription factors, can bind. In some embodiments, expression regulation by promoters is tissue-specific. Non-limiting examples of promoters include the CMV, CBA, CAG, Cbh, EF-1a, PGK, UBC, GUSB, UCOE, hAAT, TBG, Desmin, MCK, C5-12, NSE, Synapsin, PDGF, MecP2, CaMKII, mGluR2, NFL, NFH, nβ2, PPE, ENK, EAAT2, GFAP, MBP, H1, and U6 promoters. In some embodiments, a promoter is a sequence isolated from or derived from a promoter capable of driving the expression of transfer RNA (tRNA). In some embodiments, the promoter is isolated from or derived from an alanine-tRNA promoter, arginine-tRNA promoter, asparagine-tRNA promoter, aspartate-tRNA promoter, cysteine-tRNA promoter, glutamine-tRNA promoter, glutamate-tRNA promoter, glycine-tRNA promoter, histidine-tRNA promoter, isoleucine-tRNA promoter, leucine-tRNA promoter, lysine-tRNA promoter, methionine-tRNA promoter, phenylalanine-tRNA promoter, proline-tRNA promoter, serine-tRNA promoter, threonine-tRNA promoter, tryptophan-tRNA promoter, tyrosine-tRNA promoter, or valine-tRNA promoter. In some embodiments, the promoter is isolated from or derived from a valine-tRNA promoter.

[0272] An "enhancer" is a region of DNA to which an activating protein can bind, thereby increasing the likelihood or frequency of transcription. Non-limiting examples of enhancers and post-transcriptional regulatory elements include CMV enhancers and WPREs.

[0273] In some embodiments of the compositions and methods of this disclosure, the expression vectors, viral vectors, or nonviral vectors provided herein, without limitation, include vector elements such as IRESs or 2A peptide sites for constructing “multicistronic,” “polycistronic,” “biscistronic,” or “tricistronic” constructs, i.e., constructs having double, triple, or multiple coding regions or exons, thereby having the ability to express two or more proteins from mRNA from a single construct. Multicistronic vectors express two or more distinct proteins simultaneously from the same mRNA. Two strategies widely used to construct multicistronic structures are by the use of IRESs or 2A self-cleavage sites. “IRESs” refers to intra-sequence ribosome entry sites or parts thereof of viral, prokaryotic, or eukaryotic origin used within polycistronic vector constructs. In some embodiments, IRESs are RNA elements that enable cap-dependent translation initiation. The terms “self-cleaving peptide,” “sequence encoding a self-cleaving peptide,” or “2A self-cleaving site” refer to a ligation sequence used in a vector construct to incorporate a site that facilitates ribosome skipping and thus generates two polypeptides from a single promoter. Such self-cleaving peptides include, but are not limited to, T2A and P2A peptides or sequences encoding self-cleaving peptides.

[0274] In some embodiments of the compositions and methods of the present disclosure, the vector comprises or encodes a transsplicing nucleic acid molecule of the present disclosure. In some embodiments, the vector comprises or encodes at least one transsplicing nucleic acid molecule of the present disclosure. In some embodiments, the vector comprises or encodes one or more transsplicing nucleic acid molecules of the present disclosure. In some embodiments, the vector comprises or encodes two or more transsplicing nucleic acid molecules of the present disclosure.

[0275] Cells and tissues This disclosure provides compositions, systems, nucleic acid molecules, and methods for use within cells or tissues. In some embodiments, the target RNA is located within a cell. In some embodiments of the compositions and methods of this disclosure, the cells include eukaryotic cells. In some embodiments, the cells include mammalian cells. In some embodiments, the cells include cells of cattle, mice, cats, horses, pigs, dogs, monkeys, or humans. In some embodiments, the cells include non-human mammalian cells, such as non-human primate cells.

[0276] In some embodiments, the cells include somatic cells. In some embodiments, the cells include germline cells. In some embodiments, the germline cells of this disclosure include cells that are not human cells.

[0277] In some embodiments, the cells include stem cells. In some embodiments, the cells include embryonic stem cells. In some embodiments, the embryonic stem cells include non-human cells. In some embodiments, the cells include pluripotent stem cells or pluripotent stem cells. In some embodiments, the cells include adult stem cells. In some embodiments, the cells include induced pluripotent stem cells (iPSCs). In some embodiments, the cells of this disclosure include hematopoietic stem cells (HSCs).

[0278] In some embodiments, the cells include immune cells. In some embodiments, the immune cells include lymphocytes. In some embodiments, the immune cells include T lymphocytes (also referred to herein as T cells). Examples of T cells in this disclosure include, but are not limited to, naive T cells, effector T cells, helper T cells, memory T cells, regulatory T cells (Treg), and gamma delta T cells. In some embodiments, the immune cells include B lymphocytes. In some embodiments, the immune cells include natural killer cells. In some embodiments, the immune cells include antigen-presenting cells.

[0279] In some embodiments, the cells are muscle cells. In some embodiments, the muscle cells include myoblasts or muscle cells. In some embodiments, the muscle cells include cardiomyocytes, skeletal muscle cells, or smooth muscle cells. In some embodiments, the muscle cells are striated muscle cells.

[0280] In some embodiments, the cells are somatic cells. In some embodiments, the somatic cells include epithelial cells. In some embodiments, the epithelial cells include squamous cell epithelium, cuboidal cell epithelium, columnar cell epithelium, stratified cell epithelium, pseudostratified columnar cell epithelium, or transitional cell epithelium. In some embodiments, the epithelial cells form glands, including, but not limited to, the pineal gland, thymus, pituitary gland, thyroid gland, adrenal gland, apocrine gland, holocrine gland, merocrine gland, serous gland, mucous gland, and sebaceous gland. In some embodiments, the epithelial cells are in contact with the outer surface of organs, including, but not limited to, the lungs, spleen, stomach, pancreas, bladder, intestine, kidney, gallbladder, liver, larynx, or pharynx. In some embodiments, the epithelial cells of this disclosure are in contact with the outer surface of blood vessels or veins.

[0281] In some embodiments, the cells provided herein are nerve cells. In some embodiments, nerve cells include neurons. In some embodiments, nerve cells include glial cells or glial cells. In some embodiments, glial cells include glial cells of the central nervous system, for example, but not limited to oligodendrocytes, astrocytes, ependymal cells, and microglia. In some embodiments, the glial cells of this disclosure include glial cells of the peripheral nervous system, for example, but not limited to Schwann cells and satellite cells.

[0282] In some embodiments, the cells provided herein include liver cells. In some embodiments, the liver cells include hepatocytes. In some embodiments, the liver cells include hepatic stellate cells. In some embodiments, the liver cells include Kupffer cells. In some embodiments, the liver cells include sinusoidal endothelial cells.

[0283] In some embodiments, the cells provided herein include retinal cells. In some embodiments, the retinal cells include photoreceptor cells. In some embodiments, the photoreceptor cells include rods. In some embodiments, the retinal cells include cones. In some embodiments, the retinal cells include bipolar cells. In some embodiments, the retinal cells include ganglion cells. In some embodiments, the retinal cells include horizontal cells. In some embodiments, the retinal cells include amacrine cells.

[0284] In some embodiments, the cells provided herein include cardiac cells. In some embodiments, the cardiac cells are cardiomyocytes. In some embodiments, the cardiac cells include cardiac pacemaker cells.

[0285] In some embodiments, somatic cells include primary cells. In some embodiments, somatic cells include cultured cells. In some embodiments, somatic cells include in vivo, in vitro, ex vivo, or in situ somatic cells.

[0286] In some embodiments, somatic cells include autologous or allogeneic cells.

[0287] method In some embodiments, this specification describes methods for repairing target RNA using a transsplicing molecule (e.g., a transsplicing RNA molecule) with a novel transsplicing system. In some embodiments, the transsplicing RNA molecule or a part thereof comprises two or more exon domains and one or more antisense domains. The antisense domains may facilitate the association of the transsplicing RNA with the target RNA, and thus promote the transsplicing reaction and the RNA repair process of the target RNA. The transsplicing RNA molecule may then replace one or more exon domains of the target RNA. The nucleic acid sequence may encode one or more 3' domains that suppress protein production in the absence of a transsplicing event. The 3' domains may, alternatively or additionally, promote nuclear retention and / or increase transsplicing efficiency by localizing the transsplicing RNA to the nucleus. In some embodiments, the transsplicing system comprises any nucleic acid sequence encoding or containing one or a combination thereof of the domains provided herein. The effectiveness of transsplicing can be significantly improved with more regulatory domains.

[0288] In certain embodiments, the method includes providing a transsplicing RNA molecule comprising one or more exon domains; intron domains; one or more antisense domains; and a 3' domain. In certain embodiments, the method includes providing a transsplicing RNA molecule further comprising any one of the domains provided herein. In certain embodiments, the method includes providing a transsplicing RNA molecule comprising any one or more of a nuclear retention domain, a stabilization domain, a cleavage domain, and / or a sequence capable of binding to an engineered U1 snRNA.

[0289] The methods provided herein can promote RNA trans-splicing in a manner sufficient to repair pathogenic RNA sequences in human cells to address diseases. Indeed, low efficiency is a major barrier to many nucleic acid editing approaches, including RNA trans-splicing. The present disclosure provides compositions and methods for specifically repairing RNA sequences within these RNA trans-splicing molecules with high efficiency. Implementation of trans-splicing RNA molecules demonstrates utility in a variety of contexts, including repair of pathogenic sequences or insertion of engineered sequences into target RNA. The engineered sequences can alter the translation or stability of the target RNA, increasing or decreasing protein production or target RNA levels.

[0290] In some embodiments, the method comprises administering a treatment comprising a therapeutically effective amount of a composition or system described herein to a subject in need thereof. In some embodiments, the subject suffers from, has been diagnosed with, or is suspected of having a genetic disease. In some embodiments, the disease includes myotonic dystrophy, Duchenne muscular dystrophy, Dravet syndrome, LCA10, dystrophic epidermolysis bullosa, retinitis pigmentosa, otoferlin syndrome, hemophilia A, and dysferlinopathy.

[0291] Definitions Whenever the term "at least", "greater than", or "greater than or equal to" precedes (follows the last number of) the first number in a series of two or more numerical values, the term "at least", "greater than", or "greater than or equal to" applies to each numerical value in that series. For example, 1, 2, or 3 or greater is equivalent to 1 or greater, 2 or greater, or 3 or greater.

[0292] Whenever the term "no more than", "less than", or "less than or equal to" follows the last number in a series of two or more numerical values, the term "no more than", "less than", or "less than or equal to" applies to each numerical value in that series. For example, 3, 2, or 1 or less is equivalent to 3 or less, 2 or less, or 1 or less.

[0293] As used herein, the term “bond” may refer to a weak or strong interaction between two or more atoms or molecules. The interaction may be mediated directly or indirectly by one or more molecules.

[0294] Hybridization refers to a reaction in which one or more polynucleotides react to form a stabilized complex via hydrogen bonds between the bases of nucleotide residues. Hydrogen bonds can arise through Watson-Crick base pairs, Hoagstein bonds, or any other sequence-specific mode. Complexes can include double-stranded structures, three or more strands forming multi-stranded complexes, single-stranded structures that self-hybridize, or any combination thereof. Hybridization reactions can constitute one step in a broader process, such as the initiation of a polynucleotide cross-compound reaction or enzymatic cleavage of polynucleotides by ribozymes.

[0295] Examples of stringent hybridization conditions include incubation temperatures of approximately 25°C to 37°C; hybridization buffer concentrations of approximately 6x SSC to 10x SSC; formamide concentrations of approximately 0% to 25%; and washing solutions of approximately 4x SSC to 8x SSC. Examples of moderate hybridization conditions include incubation temperatures of approximately 40°C to 50°C; buffer concentrations of approximately 9x SSC to 2x SSC; formamide concentrations of approximately 30% to 50%; and washing solutions of approximately 5x SSC to 2x SSC. Examples of highly stringent conditions include incubation temperatures of approximately 55°C to 68°C; and buffer concentrations of approximately 1x SSC to 0.1x SSC.

[0296] "Homologie," "identity," or "similarity" refers to sequence similarity between two peptides or two nucleic acid molecules. Homologie can be determined by comparing positions in each sequence that can be aligned for comparison purposes. If a position in the comparison sequence is occupied by the same base or amino acid, the molecules are homologous at that position. The degree of homology between sequences is a function of the number of matching or homologous positions shared by the sequences. "Irrelevant" or "non-homologous" sequences share less than 40% identity, less than 35% identity, less than 30% identity, less than 25% identity, or less than 20% identity with one of the sequences of the present invention.

[0297] "Nucleic acid," "nucleic acid molecule," or "nucleic acid sequence" may refer to RNA, DNA, or DNA / RNA hybrids. A nucleic acid may include at least one of a nucleic acid analog, a chemically modified nucleic acid, or a chimera composed of two or more nucleic acids or nucleic acid analogs. A nucleic acid may be artificial, such as by synthesis, manipulation, or modification. As used herein, the term "nucleic acid analog" refers to a compound that has structural similarity to the canonical purine or pyrimidine bases present in DNA or RNA.

[0298] Permuted tRNA (or permutated tRNA) is the gene product of a permuted RNA gene. As used herein, permuted tRNA may refer to the pre-tRNA gene product (e.g., a circular tRNA intermediate) or the final permuted tRNA of a permuted RNA gene. Permuted tRNA can be found in unicellular algae (e.g., red algae, green algae, or chlorarachniofyte algae) or archaea (e.g., crenarchaea).

[0299] While various embodiments of the present invention have been shown and described herein, it will be apparent to those skilled in the art that such embodiments are provided only as examples. Those skilled in the art will be able to make numerous modifications, changes, and substitutions without departing from the spirit of the invention. It should be understood that various alternatives to the embodiments of the present invention described herein may be adopted. References Espinoza, C.A., Goodrich, J.A., and Kugel, J.F. (2007). Characterization of the structure, function, and mechanism of B2 RNA, an ncRNA repressor of RNA polymerase II transcription. RNA 13, 583-596. 10.1261 / rna.310307. Guo, C.J., Xu, G., and Chen, L.L. (2020). Mechanisms of Long Noncoding RNA Nuclear Retention. Trends Biochem Sci 45, 947-960. 10.1016 / j.tibs.2020.07.001. Long, Y., Wang, X., Youmans, D.T., and Cech, T.R. (2017). How do lncRNAs regulate transcription? Sci Adv 3, eaao2110. 10.1126 / sciadv.aao2110. Lubelsky, Y., and Ulitsky, I. (2018). Sequences enriched in Alu repeats drive nuclear localization of long RNAs in human cells. Nature 555, 107-111. 10.1038 / nature25757. Miyagawa, R., Tano, K., Mizuno, R., Nakamura, Y., Ijiri, K., Rakwal, R., Shibato, J., Masuo, Y., Mayeda, A., Hirose, T., and Akimitsu, N. (2012). Identification of cis- and trans-acting factors involved in the localization of MALAT-1 noncoding RNA to nuclear speckles. RNA 18, 738-751. 10.1261 / rna.028639.111. Shukla, CJ, McCorkindale, AL, Gerhardinger, C., Korthauer, KD, Cabili, MN, Shechner, DM, Irizarry, RA, Maass, PG, and Rinn, JL (2018). High-throughput identification of RNA nuclear enrichment sequences. EMBO J 37.10.15252 / embj.201798452. Wilusz, JE, JnBaptiste, CK, Lu, LY, Kuhn, CD, Joshua-Tor, L., and Sharp, PA (2012). A triple helix stabilizes the 3'ends of long noncoding RNAs that lack poly(A)tails. Genes Dev 26,2392-2407.10.1101 / gad.204438.112. [Examples]

[0300] The following examples are included for illustrative purposes only and are not intended to limit the scope of the present invention.

[0301] Example 1: Identification of 3' domain subdomain combinations In this example, the 3' domain of the transsplicing RNA contains three subdomains: a stabilizing domain, a cleavage domain, and a nuclear retention domain. High-throughput screening can be used to identify combinations of these heterogeneous sequences that have the desired effect of increasing the safety and efficiency of the transsplicing RNA. High-throughput screening can test various combinations of the stabilizing domain, cleavage domain, and nuclear retention domain in the transsplicing RNA, as well as factors that affect RNA processing and stability, such as adjacent RNA sequences (despite their known activity in different contexts), to identify transsplicing RNAs that have various desired effects, such as nuclear retention, stability, and / or the ability to be cleaved (to block translation of truncated mRNA).

[0302] A pool of trans-splicing RNAs containing a mixture of different sequences at each subdomain position in the 3' domain was generated using Golden Gate DNA assembly. The subdomains were arranged relative to each other within the 3' domain, from 5' to 3', in the following manner: a nucleation domain, a stabilization domain, and a cleavage domain.

[0303] The following were some of the various sequences present in the stabilization domain of this screening (136 sequences): MMLV pseudoknot (mpknot), KSHV PAN ENE, RRV ENE (with A tract), 2x RRV ENE A tract, EHV2 ENE A tract, 2x EHV ENE A tract, KSHV PAN ENE (79b), KSHV PAN ENE + A tract, 5x KSHV PAN ENE (79b), PSIV ENE, PSIV ENE + A tract, 2x PSIV ENE, cc Brachovirus ENE + A tract, 2x cc Brachovirus ENE + A tract, cs Brachovirus ene + A tract, 2x cs Brachovirus ene + A tract, ap Mimivirus ene (with 26 base spacer), 2x ap Mimivirus ene (with 26 base spacer), KSHV + RRV ENE, MMTV pseudoknot, SRV-1 pseudoknot, human telomerase pseudoknot, bacteriophage T2 pseudoknot, ydaO_riboswitch_Bs, ydaO_riboswitch_Tl, ydaO_riboswitch_Tp, ydaO_riboswitch_Tt, ToxI_Pa, SAM-II_riboswitch, SAM-I_riboswitch, SAH_riboswitch, KUNV, CPEB3_rz_Rn, CPEB3_rz_Pt, CPEB3_rz_Oc, CPEB3_rz_Mm, CPEB3_rz_Md, CPEB3_rz_La, CPEB3_rz_Hs, CPEB3_rz_Cf, CPEB3_rz_Bt, IFNG_P K_S_scrofa, IFNG_PK_M_musculus, IFNG_PK_C_jacchus, IFNG_PK_C_familiaris, IFNG_PK_B_taurus, IFNG_PK, PDV3, ApMV3, PNRSV3, FCiLV3, HJLV3, APLPV3, LiRMV3, EMoV3, AV-2_3, CVV3, CiLRV3, SpLV3, TAMV1, PMoV3, BCRV1, SNSV1, CCR5_PRF, CMMV_psiA, R2_rz_Da, SESV, MIDV, MVEV, drz_Cjap_1, drz_Agam_2_1, Tetrahymena self-splicing intron (PDB1U6B), Group I self-splicing intron P4-P6 domain mutant U131A (PDB 6D8L), Self-splicing Group I intron (with both exons) (e coli, PDB 1U6B, strand AB), Cryo-electron microscopy structure of conformation 5 of Tetrahymena ribozyme in the second stage of self-splicing (PDB 7yG8), Lariat-type structure of chimeric derivative of Oceanobacillus iheyensis Group II intron in the presence of NH4+ and MG2+ (PDB 5J01), Relaxed pre-Tet-S1 state of G264A mutant Tetrahymena Group I intron with 6nt 3' / 5' exons and 2-aminopurine nucleoside (PDB 8HD6), 3DEG_1|strand A|A / L-tRNA|Escherichia coli(562), 3DEG_2|strand B|P-tRNA|Eschericha coli(562), 3DEG_5|strand E[auth G]|50S RNA helix 42-44|Eschericha coli(562), 1ZZN_1|strand A[auth B]|197-MER|null, 7QR4_2|strand B|RNA CPEB3 ribozyme|Homo sapiens(9606), 7QR3_2|strand C,D|chimpanzee CPEB3 ribozyme|Pan troglodytes(9598), leader region of repA mRNA of pMU720, plasmid ColIb-P9 REPZ RNA, Mycobacterium bovis leuA mRNA pseudoknot, 4MEG_1|strand A|glmS triple mutant ribozyme|null, 3B4A_2|strand B|glmS ribozyme RNA|Thermoanaerobacter tengcongensis(119072), 3L3C_3|strand C[auth P], F[auth Q], I[auth R], L[auth S]|GLMS ribozyme|null, 1YMO_1|strand A|telomerase RNA P2b-P3 pseudoknot|null, 5KMZ_1|strand A|telomerase RNA pseudoknot|Tetrahymena thermophila(5911), 486D_3|strand C|70S ribosome A-site tRNA|Saccharomycescerevisiae(4932), 486D_5|strand E|E-site tRNA of 70S ribosome|Thermus thermophilus(274), 486D_6|strand F|Pennisetmate stem of 16S rRNA in 70S ribosome|Thermus thermophilus(274), 486D_1|strand A|P-site tRNA of 70S ribosome|Escherichia coli(562), 4P8Z_1|strand A|Didymium iridis partial IGS, 18S rRNA gene, I-DirI gene and partial ITS1|Didymium iridis(5793), 2NOQ_1|strand A|CrPV IRES|null, triple hairpin 1, triple hairpin 2, triple hairpin 3, triple hairpin 4, 5ML7_1|strand A, B|23S ribosomal RNA|Haloarcula marismortui(2238), 5NPM_2|strand B|23S ribosomal RNA|Thermus thermophilus(274), 1FG0_1|strand A|23S ribosomal RNA|Haloarcula marismortui(2238), 4V6U_21|strand U[auth A2]|16S rRNA|Pyrococcus furiosus(186497), 4V6U_67|strand SB[auth B1]|23S rRNA|Pyrococcus furiosus(186497), U64877.1:1-316Acholeplasma laidlawii ribonuclease P RNA (rnpB) gene, (partial sequence), M19021.1:1-417B.stearothermophilus ribonuclease P RNA gene, CP000023.1:237422-237789 Streptococcus thermophilus LMG 18311, complete genome, AGFN01000347.1:c13926-13555 Streptococcus thermophilus CNCM I-1630 contig 0409, whole genome shotgun sequence, Pyrobaculum aerophilum RNase P RNA, Caidivirga maquillingensis RNase PRNA, 4R4P_1|Chain A|VS Ribozyme RNA|NEUROSPORA(5140), 4R4P_1|Chain A|VS Ribozyme RNA|NEUROSPORA(5140) (tandem dimer), 4R4V_1|Chain A|VS Ribozyme RNA|NEUROSPORA(5140), 4R4V_1|Chain A|VS Ribozyme RNA|NEUROSPORA(5140) (tandem dimer), RNA ligase, Class I ribozyme, B6.61 polymerase ribozyme, RNA ligase ribozyme construct b1-248, RNA ligase ribozyme, construct b1-207, 6H1K_1|Chain A|DNA (28-MER)|Human immunodeficiency virus 1(11676)[4X], 6H1K_1|Chain A|DNA (28-MER)|Human immunodeficiency virus 1(11676)[2X], 2M27_1|Chain A|DNA_(5'-D( * CP * GP * GP * GP * GP * CP * GP * GP * GP * CP * CP * TP * TP * GP * GP * GP * CP * GP * GP * GP * GP * T)-3')_|Homo sapiens(9606)[4X], 2M27_1|Chain A|DNA_(5'-D( * CP * GP * GP * GP * GP * CP * GP * GP * GP * CP * CP * TP * TP * GP * GP * GP * CP* GP * GP * GP * GP * T)-3')_|Homo sapiens(9606)[2X], GGGGCC hexanucleotide repeat (4x), GGGGCC hexanucleotide repeat (8x), TERRA(UUAGGG)4 telomere repeat-containing RNA, TERRA(UUAGGG)4 telomere repeat-containing RNA[2x], TERRA(UUAGGG)4 telomere repeat-containing RNA[6x], Nkx2-5 5'UTR G quadruplex, immunoglobulin switch (S) region G quadruplex, Ribox02 ribozyme, 6PRV_1|strand A, B, C, D|23S rRNA|Escherichia coli(562), 2Z74_2|strand B|glmS ribozyme RNA|, 2Z74_2|strand B|glmS ribozyme RNA|+target.

[0304] The various sequences present in the cleavage subdomains of this screening were as follows (63 sequences): hammerhead ribozyme, hammerhead ribozyme, tRNA(gly), tRNA-Gly-CCC-1-1, tRNA-Gly-CCC-1-2, tRNA-Gly-CCC-3-1, tRNA-Gly-CCC-2-2, tRNA-Gly-CCC-2-1, tRNA-Gly-GCC-2-4, tRNA-Gly-GCC-2-5, tRNA-Gly-GCC-2-6, tRNA-Gly-GCC-2-1, tRNA-Gly-GCC-2-2, tRNA-Gly-GCC-1-1, tRNA-Gly-GCC-1-3, tRNA-Gly-GCC-1-4, tRNA-Gly-GCC-1-5, tRNA-Gly-GCC-3-1, tRNA-Gly-GCC-4-1, tRNA-Gly-GCC-5-1, tRNA-Gly-TCC-3-1, tRNA-Gly-TCC-1- 1, tRNA-Gly-TCC-2-1, tRNA-Gly-TCC-2-2, tRNA-Gly-TCC-2-3, tRNA-Gly-TCC-2-4, tRNA-Gly-TCC-2-5, tRNA-Gly-TCC-2-6, tRNA-Gly-TCC-4-1, rice tRNA, MALAT1 mascRNA, 7QR4_2|strand B|RNA CPEB3 ribozyme|Homo sapiens(9606), 7QR3_2|strand C, D|chimpanzee CPEB3 ribozyme|Pan troglodytes(9598), 4R4P_1|strand A|VS ribozyme RNA|NEUROSPORA(5140), 4R4P_1|strand A|VS ribozyme RNA|NEUROSPORA(5140)[tandem dimer], 4R4V_1|strand A|VS ribozyme RNA|NEUROSPORA(5140), 4R4V_1|strand A|VS ribozyme RNA|NEUROSPORA(5140)[tandem dimer], histone 3'UTR (including SLBP and HDE H1-4), histone 3'UTR (including SLBP and HDE Histone 3'UTR (including H2BC21D), histone 3'UTR (SLBP and HDE, including H2AC20), histone 3'UTR (SLBP and HDE, including H2BC13), histone 3'UTR (SLBP and HDE(Containing H2AC25), Pri-miR-16-1, Pri-miR-30a, artificial microprocessor substrate, eIF4H exon 5, Pri-miR-7, targeted pseudo-lysylated snoRNA-1, targeted pseudo-lysylated snoRNA-2, scaRNA-9, scaRNA-2, 5K7C_1|strand A|RNA47-MER|synthetic construct (32630), 5T5A_1|strand A|DNA / RNA(71-MER)|metagenogene (256318), 4OJI_1|strand A|RNA(52-MER)|null, 4RGE_1|strand A, B, C| env22 twister ribozyme | synthetic (32630), 6JQ5_1 | strand A, B | RNA(82-MER) | synthetic construct (32630), 6JQ5_1 | strand A, B | RNA(82-MER) | synthetic construct (32630) dimer, Pri-miR-31(51+51), Pri-miR-31(51+51) / Pre-miR-HBV, Pri-miR-31(38+40) / Pre-miR-HBV, Pri-miR-31(30+31) / Pre-miR-HBV, Pri-miR-31(22+21) / Pre-miR-HBV.

[0305] The following were some of the various sequences present in the nuclear retention subdomains of this screening (13 sequences): MALATI-NucRet(5471-5951)Shukla et al. 2018, MALATI-NucRet(5971-6401)Shukla et al. 2018, MALATI-NucRet(6851-7241)Shukla et al. 2018, MalatI-NucRet(SpeckleF2)Wilusz et al. 2012, MALATI-NucRet(MALAT-E)Miyagawa et al. 2012, MALATI-NucRet(MALAT-M)Miyagawa et al. 2012, Jpx #9 lncRNA nuclear localization (Lubelsky 2018), Pvt1 lncRNA nuclear localization (Lubelsky 2018), Nr2f1-as1 lncRNA nuclear localization (Lubelsky 2018), Emx2os lncRNA nuclear localization (Lubelsky 2018), Alusx lncRNA nuclear localization (Lubelsky 2018), SIRLOIN lncRNA nuclear localization (Lubelsky 2018).

[0306] The resulting DNA library contained 13 × 63 × 136 = 111,384 distinct 3' domains. This library of transsplicing RNA was applied to cells, and the identity of the 3' domain that promoted the best transsplicing efficiency was determined using long-read sequencing techniques. These subdomain combinations were then used in subsequent follow-up experiments to identify high-quality 3' domain designs that increased transsplicing efficiency.

[0307] Example 2: Evaluation of RNA repair efficiency of the CEP290 gene in vitro To further investigate the activity of transsplicing RNA molecules with effective 3' domain design, transsplicing RNA was applied to cells expressing CEP290 via transfection. RNA was extracted from these cells, and both CEP290 and the repaired version of CEP290 that underwent the transsplicing reaction were reverse transcribed. The resulting RNA was subjected to qPCR and digital PCR to evaluate the efficiency of the transsplicing reaction. Transsplicing molecule editing efficiency was calculated by dividing the amount of transspliced ​​CEP290 by the total amount of transspliced ​​and untransspliced ​​CEP290.

[0308] Example 3: Evaluation of the relative repair efficiency of various 3' domains A library of trans-splicing RNAs targeting CEP290 intron 26, containing various 3' domains, was constructed. Each 3' domain was associated with a unique set of barcodes. These barcodes were used to measure the relative RNA editing efficiency of each trans-splicing RNA 3' domain design. The library was transfected into HEK293 cells, and the barcodes were amplified from the edited CEP290 gene. Long-read sequencing using the Oxford Nanopore system revealed the relative RNA editing activity of different 3' domains (Figure 3). "C15 v1" refers to the sequence with sequence number 111, "C15 v2" refers to the sequence with sequence number 109, "C15 v3" refers to the sequence with sequence number 107, "wt triple-stranded v1" refers to the sequence with sequence number 113, "wt triple-stranded v2" refers to the sequence with sequence number 104, "C14 v1" refers to the sequence with sequence number 108, "C14 v2" refers to the sequence with sequence number 106, "C15 v4" refers to the sequence with sequence number 103, and "C14 v3" refers to the sequence with sequence number 112.

[0309] Example 4: Evaluation of relative repair efficacy of various 3' domains In this experiment, the inventors compared the activity of thousands of different trans-splicing systems by performing an activity pool screening. First, the inventors assembled double-stranded DNA sequences encoding various trans-splicing molecular components, including intron domains and 3' domains. Random barcodes were also incorporated into these Golden Gate assembly reactions. The results of these reactions were randomized combinations of regions with predefined positions for each subtype. Each individual plasmid additionally possessed a unique 33-nucleotide barcode.

[0310] Next, these libraries were subjected to long-read sequencing using an Oxford Nanopore sequencer, and barcodes were mapped to specific combinations of parts. The same libraries were then applied to HEK293 cells expressing the CEP290 gene. As reported in the figure, the trans-spliced ​​CEP290 gene products were sequenced using a long-read sequencer, and the editing efficiency of each design was evaluated using barcode counting.

[0311] Each bar in Figure 5 represents a specific combination of regions where the intron domain remains constant and only the 3' domain is altered. The 3' domain consists of two parts (shown in Table 2), and the trans-splicing molecules contain the sequences shown in Sequence IDs 126-130 below. In summary, the combination of specific structured sequences with twister ribozymes is superior to that of twister ribozymes alone. For example, the presence of a TERRA G quadruple chain upstream of a twister ribozyme improves editing efficiency compared to the ribozyme alone. Other structured sequences, such as CPEB3 ribozymes, also improve editing efficiency when combined with twister ribozymes. In addition, the use of specific ribozymes promotes efficient trans-splicing. [Table 2]

[0312] The trans-splicing molecule in this embodiment includes the following sequence:

[0313]

[0314]

[0315]

[0316]

[0317]

[0318] Example 5: Splicing efficiency of a trans-splicing system targeting CEP290 Using Golden Gate assembly technology, a library of trans-splicing systems targeting intron 26 of CEP290 was constructed. This library contained a unique 33-nucleotide barcode identifying each trans-splicing system, along with the intron domain, antisense domain, and 3' prime terminal domain, including the ribozyme and triple helix. A stationary exon domain containing the first 26 exons of the CEP290 gene was incorporated. This assembly process yielded a library containing 3,825 distinct trans-splicing systems, which were then amplified in bacterial cultures and characterized using long-read sequencing technology to obtain detailed information about the gene constructs.

[0319] Using Oxford nanopore sequencing of the library, each unique barcode was mapped to a specific combination of assembled domains, ensuring that all combinations of intron, antisense, and 3' prime terminal domains could be unambiguously ligated to at least one unique barcode. This mapping was used to evaluate the performance of each trans-splicing system in the library. A mixture of DNA-encoded barcoded trans-splicing systems was introduced into HEK293 cells engineered to overexpress the CEP290 gene via promoter knock-in. 48 hours after transfection, RNA was extracted from these cells, and both the trans-spliced ​​RNA products and their corresponding barcodes were amplified using polymerase chain reaction (PCR).

[0320] As shown in Figure 6A, the amplified barcodes were quantified and correlated with specific combinations of each domain. The abundance of each barcode served as an indicator of RNA repair activity, allowing for the determination of the relative trans-splicing activity of each system within the library. For each 3' terminal domain, separate panels were generated to visualize the activity distribution of the trans-splicing systems. The dark gray distribution represents the activity level of systems containing a particular 3' prime terminal domain, while the light gray distribution reflects the activity level across the entire library of trans-splicing systems. The quality of the trans-splicing systems was assessed based on two key metrics: distribution shift and area under the curve (AUC). A further shift to the right of the distribution indicates higher trans-splicing activity, and a larger AUC indicates a greater overall representation of systems with the enumerated 3' domains. Other types of ribozymes and structured sequences tested (data not shown) included MALAT1 triple helix, lanthanum Rz2, chimpanzee CPEB3 ribozyme, pistol ribozyme, human CPEB3 ribozyme, env22 twister ribozyme, and hatchet ribozyme. As shown in Figures 6A-6B, ribozymes such as twister-SNV, twister sister, twister WT (wild type), and lanthanum were superior to other types of ribozymes. TSMs include the sequences shown in Table 4 below.

[0321] Example 6: Splicing efficiency of a trans-splicing system targeting SCN1A Using Golden Gate assembly technology, a library of trans-splicing systems targeting introns 8, 11, and 17 of SCN1A was constructed. This library contained a unique 33-nucleotide barcode identifying each trans-splicing system, along with intron domains, antisense domains, and 3' prime-terminal domains, including ribozymes and triple helices. Constant exon domains containing either exons 1-8, 1-11, or 1-17 of SCN1A were incorporated according to their respective target introns. This assembly process yielded a library containing approximately 200,000 distinct trans-splicing systems, which were then amplified in bacterial cultures and characterized using long-read sequencing technology to obtain detailed information about the gene constructs.

[0322] Using Oxford nanopore sequencing of the library, each unique barcode was mapped to a specific combination of assembled domains, ensuring that all combinations of intron, antisense, and 3' prime terminal domains could be unambiguously ligated to at least one unique barcode. This mapping was used to evaluate the performance of each trans-splicing system in the library. A mixture of DNA-encoded barcoded trans-splicing systems was introduced into HEK293 cells engineered to overexpress the SCN1A gene via promoter knock-in. 48 hours after transfection, RNA was extracted from these cells, and both the trans-spliced ​​RNA products and their corresponding barcodes were amplified using polymerase chain reaction (PCR).

[0323] The amplified barcodes were quantified and correlated with specific combinations of each domain. The abundance of each barcode served as an indicator of RNA repair activity, enabling the determination of the relative trans-splicing activity of each system in the library. For each of the three 3' terminal domains, separate curves of relative trans-splicing activity were generated, showing the relative trans-splicing activity across each intron among the trans-splicing systems containing the annotated 3' terminal domains (Figure 7).

[0324] The upper designs in Figure 7 were selected and constructed as individual plasmids based on their relative editing efficiency for each intron. These selected designs were then subjected to digital PCR to measure the percentage of edited target SCN1A RNA. The results are shown in the accompanying bar graph below. The components of constructs P2594, P2585, P2566, and P2572 are shown in Table 3. The TSMs contain the sequences listed in Table 4 below. [Table 3] [Table 4-1] [Table 4-2] [Table 4-3] [Table 4-4] [Table 4-5] [Table 4-6] [Table 4-7] [Table 4-8] [Table 4-9]

[0325] This disclosure is not intended to limit its scope to any specific disclosed embodiments provided to illustrate various aspects thereof. Various modifications to the compositions and methods described herein will become apparent from the description and teachings herein. Such modifications may be made without departing from the true scope and spirit of this disclosure and are intended to be included within the scope of this disclosure.

Claims

1. Trans-splicing nucleic acid molecules, (a) Exon domain; (b) Intron domains configured to facilitate ribonucleic acid (RNA) transsplicing; (c) Antisense domains configured to bind to target RNA molecules; and (d) A transsplicing nucleic acid molecule comprising a sequence or structure derived from or isolated therefrom a ribozyme, wherein the ribozyme is selected from the group consisting of VS ribozyme, twister ribozyme, twister sister ribozyme, lanthanum ribozyme, pistol ribozyme, hairpin ribozyme, leadzyme, hatchet ribozyme, GIR1 branched ribozyme, glmS ribozyme, class I intron, class II intron, RNAse P, CoTC ribozyme, Hoylinc ribozyme, Varkud satellite ribozyme, CPEB3 ribozyme, and riboswitch.

2. The trans-splicing nucleic acid molecule according to claim 1, further comprising a G-quadricone and / or pseudoknot, and optionally poly(A).

3. 5' to 3': The trans-splicing nucleic acid molecule according to claim 2, comprising the G-quadrilateral and / or the pseudoknot, and the sequence or structure derived from or isolated therefrom a ribozyme, and optionally the poly(A) at the 3' end.

4. 5' to 3': The trans-splicing nucleic acid molecule according to claim 2, comprising the sequence or structure derived from or isolated therefrom a ribozyme, the G-quadrilateral and / or the pseudoknot, and optionally the poly(A) at the 3' end.

5. The trans-splicing nucleic acid molecule according to any one of claims 1 to 4, wherein the trans-splicing nucleic acid molecule does not contain hammerhead ribozyme or HDV ribozyme.

6. Trans-splicing nucleic acid molecules, (a) Exon domain; (b) Intron domains configured to facilitate ribonucleic acid (RNA) transsplicing; (c) Antisense domains configured to bind to target RNA molecules; and d) comprising a sequence or structure derived from or isolated from a ribozyme, The trans-splicing nucleic acid molecule wherein the trans-splicing nucleic acid molecule does not contain 3' poly(A).

7. The transsplicing nucleic acid molecule according to claim 6, wherein the sequence or structure derived from or isolated from the ribozyme is located in the 3' domain of the transsplicing nucleic acid molecule.

8. The transsplicing nucleic acid molecule according to claim 6, wherein the sequence or structure derived from or isolated from the ribozyme is located in the 5' domain of the transsplicing nucleic acid molecule.

9. A transsplicing nucleic acid molecule according to any one of claims 6 to 8, comprising a sequence or structure derived from or isolated therefrom the ribozyme, wherein the ribozyme is selected from the group consisting of hammerhead ribozyme, HDV ribozyme, twister ribozyme, twister sister ribozyme, lanthanum ribozyme, pistol ribozyme, hairpin ribozyme, VS ribozyme, leadzyme, hatchet ribozyme, GIR1 branched ribozyme, glmS ribozyme, class I intron, class II intron, RNAse P, CoTC ribozyme, Hoylinc ribozyme, Varkud satellite ribozyme, CPEB3 ribozyme, and riboswitch.

10. A transsplicing nucleic acid molecule according to any one of claims 1 to 9, comprising a sequence or structure derived from or isolated therefrom a twister ribozyme or a twister sister ribozyme.

11. A transsplicing nucleic acid molecule according to any one of claims 1 to 10, comprising a sequence or structure derived from or isolated therefrom a lanthanum ribozyme.

12. A transsplicing nucleic acid molecule according to any one of claims 1 to 11, comprising a sequence or structure derived from or isolated therefrom a CPEB3 ribozyme, wherein the CPEB3 ribozyme is optionally a mammalian CPEB3 ribozyme, optionally a human CPEB3 ribozyme or a Pan troglodytes CPEB3 ribozyme.

13. A transsplicing nucleic acid molecule according to any one of claims 1 to 12, comprising a sequence or structure derived from or isolated therefrom a VS ribozyme.

14. A transsplicing nucleic acid molecule according to any one of claims 1 to 13, comprising a sequence or structure derived from or isolated therefrom a hatchet ribozyme.

15. The trans-splicing nucleic acid molecule according to any one of claims 1 to 14, wherein the ribozyme is a ribozyme derived from or isolated from a eukaryote, optionally the eukaryote is a mammal, and optionally the mammal is a human or Pan trogloides.

16. The transsplicing nucleic acid molecule according to any one of claims 1 to 14, wherein the ribozyme is a ribozyme derived from or isolated from a virus.

17. The transsplicing nucleic acid molecule according to any one of claims 1 to 14, wherein the ribozyme is derived from or isolated from a prokaryote, and optionally the prokaryote is a bacterium.

18. The transsplicing nucleic acid molecule according to any one of claims 1 to 17, wherein the ribozyme is a mutant ribozyme.

19. The transsplicing nucleic acid molecule according to any one of claims 1 to 17, wherein the ribozyme is an engineered ribozyme.

20. The transsplicing nucleic acid molecule according to any one of claims 1 to 19, wherein the ribozyme is derived from or encoded by lncRNA.

21. The transsplicing nucleic acid molecule according to any one of claims 1 to 20, wherein the ribozyme is a self-cleaving ribozyme.

22. The transsplicing nucleic acid molecule according to any one of claims 1 to 20, wherein the ribozyme is a self-alkylated ribozyme.

23. The trans-splicing nucleic acid molecule according to any one of claims 1 to 22, wherein the ribozyme comprises one or more pseudoknots.

24. The trans-splicing nucleic acid molecule according to any one of claims 1 to 23, wherein the ribozyme is modified by or requires one or more metal ion cofactors.

25. The trans-splicing nucleic acid molecule according to claim 24, wherein the one or more metal ion cofactors include a divalent cation.

26. The one or more metal ion cofactors mentioned above are Mg ２＋ A trans-splicing nucleic acid molecule according to claim 25, comprising:

27. A transsplicing nucleic acid molecule according to any one of claims 1 to 23, comprising a 3' domain including a cleavage domain, wherein the sequence or structure derived from or isolated from the ribozyme is a first ribozyme sequence or structure, and optionally comprising a second ribozyme sequence or structure in which the cleavage domain is the same as or different from the first ribozyme sequence or structure; a microprocessor substrate; an RNAse P / Z substrate; or any combination thereof.

28. The transsplicing nucleic acid molecule according to claim 27, wherein the cleavage domain comprises the sequence or structure derived from or isolated from the ribozyme.

29. The transsplicing nucleic acid molecule according to claim 27, wherein the cleavage domain does not include the sequence or structure derived from or isolated from the ribozyme.

30. A transsplicing nucleic acid molecule according to any one of claims 1 to 29, comprising a 3' domain containing a stabilizing domain.

31. The transsplicing nucleic acid molecule according to claim 30, wherein the stabilizing domain comprises the sequence or structure derived from or isolated from the ribozyme.

32. The trans-splicing nucleic acid molecule according to claim 30, wherein the stabilizing domain does not include the sequence or structure derived from or isolated from the ribozyme.

33. The transsplicing nucleic acid molecule according to claim 32, wherein the stabilizing domain comprises a G-quadrilateral and / or a pseudoknot.

34. The trans-splicing nucleic acid molecule according to claim 33, wherein the stabilizing domain includes a G-quadrilateral.

35. The trans-splicing nucleic acid molecule according to claim 33, wherein the stabilizing domain includes a pseudoknot.

36. A transsplicing nucleic acid molecule according to any one of claims 1 to 35, comprising a 3' domain including a nuclear-holding domain, wherein the nuclear-holding domain optionally comprises a triple helix (optionally a viral or human triple helix), a pseudoknot, a riboswitch, a G-quadrilateral (optionally a telomerase G-quadrilateral), RNAseP RNA, a stem-loop structure, snoRNA, or any combination thereof.

37. The transsplicing nucleic acid molecule according to claim 36, wherein the nuclear-holding domain comprises the sequence or structure derived from or isolated from the ribozyme.

38. The transsplicing nucleic acid molecule according to claim 36, wherein the nuclear-holding domain does not include the sequence or structure derived from or isolated from the ribozyme.

39. 5' to 3': A transsplicing nucleic acid molecule according to any one of claims 1 to 38, comprising a 3' domain containing the G-quadruplicate and / or the pseudoknot and the sequence or structure derived from or isolated therefrom the ribozyme.

40. 5' to 3': A transsplicing nucleic acid molecule according to any one of claims 1 to 38, comprising the sequence or structure derived from or isolated therefrom the ribozyme, and a 3' domain comprising the G-quadruplicate and / or the pseudoknot.

41. From 5' to 3', the following operably linked domains: (a) Exon domain; (b) Intron domains containing a 5' splice site, a branching site, and a polypyrimidine tract; (c) Antisense domains configured to bind to target RNA molecules; and (d) A transsplicing nucleic acid molecule comprising a 3' domain containing a sequence or structure derived from or isolated from a ribozyme, The transsplicing nucleic acid molecule configured to transsplice the exon domain into the exons of the target RNA molecule.

42. The transsplicing nucleic acid molecule according to claim 41, wherein the antisense domain is configured to hybridize to an intron of the target RNA molecule located on the 5' side of the exon of the target RNA molecule.

43. From 5' to 3', the following operably linked domains: (a) Antisense domains configured to bind to target RNA; (b) Intron domains including branching sites, polypyrimidine tracts, and 3' splice sites; (c) Exon domains; and (d) A transsplicing nucleic acid molecule comprising a 3' domain containing a sequence or structure derived from or isolated from a ribozyme, The transsplicing nucleic acid molecule configured to transsplice the exon domain into the exons of the target RNA molecule.

44. The transsplicing nucleic acid molecule according to claim 43, wherein the antisense domain is configured to hybridize to an intron of the target RNA molecule located on the 3' side of the exon of the target RNA molecule.

45. The transsplicing nucleic acid molecule according to any one of claims 41 to 44, wherein the intron domain includes an intron splicing enhancer sequence.

46. The trans-splicing nucleic acid molecule according to claim 41 or claim 42, wherein the intron domain comprises the 5' splice site, the intron splicing enhancer sequence, the branching site, and the polypyrimidine tract.

47. The trans-splicing nucleic acid molecule according to claim 43 or claim 44, wherein the intron domain comprises an intron splicing enhancer sequence, the branching site, the polypyrimidine tract, and the 3' splice site.

48. The transsplicing nucleic acid molecule according to any one of claims 41 to 47, wherein the exon domain comprises an exon splicing enhancer sequence.

49. The transsplicing nucleic acid molecule according to any one of claims 41 to 48, wherein the 3' domain further comprises a structured sequence located on the 5' side of the sequence or structure derived from or isolated therefrom the ribozyme.

50. The transsplicing nucleic acid molecule according to claim 49, wherein the structured sequence comprises a G quadruple chain, a pseudoknot, and / or a triple helix.

51. A transsplicing nucleic acid molecule according to any one of claims 41 to 50, further comprising a nucleus-holding domain.

52. The transsplicing nucleic acid molecule according to claim 51, wherein the 3' domain comprises the nucleus-holding domain located on the 5' side of the sequence or structure derived from or isolated therefrom the ribozyme.

53. The transsplicing nucleic acid molecule according to claim 52, wherein the 3' domain comprises, from 5' to 3', the nucleus-holding domain, the structured sequence, and the sequence or structure derived from or isolated from the ribozyme.

54. The transsplicing nucleic acid molecule according to any one of claims 41 to 53, wherein the 3' domain does not contain one or more of the following: a triple helix, an RNase P cleavage site, a tRNA-like domain, and a poly(A) tail.

55. A transsplicing nucleic acid molecule according to any one of claims 41 to 54, which does not contain one or more of the following: a triple helix, an RNase P cleavage site, a tRNA-like domain, and a poly(A) tail.

56. The transsplicing nucleic acid molecule according to any one of claims 41 to 55, wherein the ribozyme is selected from the group consisting of VS ribozyme, twister ribozyme, twister sister ribozyme, lanthanum ribozyme, pistol ribozyme, hairpin ribozyme, leadzyme, hatchet ribozyme, GIR1 branched ribozyme, glmS ribozyme, class I intron, class II intron, RNAse P, CoTC ribozyme, Hoylinc ribozyme, Varkud satellite ribozyme, CPEB3 ribozyme, and riboswitch.

57. The transsplicing nucleic acid molecule according to any one of claims 41 to 56, wherein the sequence or structure derived from or isolated therefrom the ribozyme has cleavage activity.

58. The transsplicing nucleic acid molecule according to any one of claims 41 to 56, wherein the sequence or structure derived from or isolated from the ribozyme does not have cleavage activity.

59. From 5' to 3', the following operably linked domains: (a) Exon domain; (b) Intron domains containing a 5' splice site, a branching site, and a polypyrimidine tract; (c) Antisense domains configured to bind to target RNA molecules; and (d) 5' to 3': A transsplicing nucleic acid molecule comprising (i) a G-quadrilateral or pseudoknot, and (ii) a 3' domain comprising a sequence or structure derived from or isolated from a twister ribozyme or twister sister ribozyme, The transsplicing nucleic acid molecule configured to transsplice the exon domain into the exons of the target RNA molecule.

60. A transsplicing nucleic acid molecule according to claim 59, which does not contain one or more of the following: a triple helix, an RNase P cleavage site, a tRNA-like domain, and a poly(A) tail.

61. The transsplicing nucleic acid molecule according to any one of claims 1 to 60, wherein the sequence or structure derived from or isolated therefrom the ribozyme increases the transsplicing efficiency of the transsplicing nucleic acid molecule.

62. The transsplicing nucleic acid molecule according to claim 61, wherein the transsplicing efficiency is increased by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 100%, at least about 200%, at least about 300%, at least about 400%, at least about 500%, at least about 600%, at least about 700%, at least about 800%, at least about 900%, or 1000% compared to a reference transsplicing nucleic acid molecule that does not contain the sequence or structure derived from or isolated therefrom the ribozyme.

63. The transsplicing nucleic acid molecule according to claim 61 or claim 62, further comprising a G-quadrilateral and / or the pseudoknot that increases the transsplicing efficiency of the transsplicing nucleic acid molecule.

64. The trans-splicing nucleic acid molecule according to claim 63, wherein the trans-splicing efficiency is increased by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 100%, at least about 200%, at least about 300%, at least about 400%, at least about 50%, at least about 600%, at least about 700%, at least about 800%, at least about 900%, or 1000% compared to a reference trans-splicing nucleic acid molecule that does not contain the sequence or structure derived from or isolated therefrom the ribozyme and the G-quadruplicate and / or the pseudoknot.

65. The trans-splicing nucleic acid molecule according to any one of claims 1 to 64, wherein the target RNA molecule is located within a cell.

66. The trans-splicing nucleic acid molecule according to any one of claims 1 to 64, wherein the target RNA molecule is messenger RNA (mRNA) or pre-mRNA.

67. The trans-splicing nucleic acid molecule according to any one of claims 1 to 64, wherein the target RNA molecule includes a mutation.

68. The trans-splicing nucleic acid molecule according to claim 67, wherein the mutation is selected from the group consisting of missense mutations, nonsense mutations, frameshift mutations, insertions, replications, inversions, deletions, splice site mutations, and truncated mutations.

69. The trans-splicing nucleic acid molecule according to claim 67, wherein the mutation is a pathogenic mutation.

70. The transsplicing nucleic acid molecule according to any one of claims 1 to 69, wherein the transsplicing nucleic acid molecule is packaged in or encoded within a viral vector for delivery to a target requiring it.

71. The transsplicing nucleic acid molecule according to claim 70, wherein the viral vector is a herpes simplex virus (HSV) vector.

72. The transsplicing nucleic acid molecule according to claim 70, wherein the viral vector is an adeno-associated virus (AAV) vector.

73. The transsplicing nucleic acid molecule according to any one of claims 1 to 72, wherein the exon domain comprises one or more functional exons of a gene associated with a disease or condition.

74. A composition comprising a viral vector according to any one of claims 70 to 72 and a pharmaceutically acceptable carrier or excipient.

75. The trans-splicing nucleic acid molecule according to any one of claims 1 to 69, wherein the trans-splicing nucleic acid molecule is packaged in or thereby encoded within a nucleic acid in a lipid particle for delivery to an object that requires it.

76. A composition comprising lipid nanoparticles as described in claim 75 and a pharmaceutically acceptable carrier or excipient.

77. The transsplicing nucleic acid molecule according to any one of claims 1 to 69, wherein the manipulated nucleic acid is packaged in or thereby encoded within a nucleic acid in a vesicle for delivery to an object that requires it.

78. A composition comprising the vesicles described in claim 77 and a pharmaceutically acceptable carrier or excipient.

79. A cell comprising a trans-splicing nucleic acid molecule or composition according to any one of claims 1 to 78.

80. A trans-splicing nucleic acid molecule, composition, or cell according to any one of claims 1 to 79, for use in treating a disease and / or correcting a gene defect in a subject requiring treatment of a disease and / or correction of a gene defect.

81. Use of a trans-splicing nucleic acid molecule, composition, or cell according to any one of claims 1 to 79 for the treatment of a disease and / or the correction of a gene defect in a subject requiring treatment of a disease and / or correction of a gene defect.

82. Use of a trans-splicing nucleic acid molecule, composition, or cell according to any one of claims 1 to 79 in the manufacture of a pharmaceutical product for treating a disease and / or correcting a gene defect in a subject requiring treatment of a disease and / or correction of a gene defect.

83. A method for treating a disease and / or correcting a gene defect in a subject requiring treatment of a disease and / or correction of a gene defect, comprising administering to the subject a therapeutically effective amount of a trans-splicing nucleic acid molecule, composition, or cell according to any one of claims 1 to 79.

84. A method for processing cells, comprising contacting the cells with a trans-splicing nucleic acid molecule or composition according to any one of claims 1 to 78.

85. The method according to claim 84, wherein the method is carried out in vitro, and optionally the cells are primary cells isolated from the subject, cultured cells, or transformed cells.

Images