Compositions and methods containing nuclear small RNA (SnRNA) for the treatment of hereditary epilepsy

Abstract

SnRNA systems targeting the RNA sequences of SCN1A or SYNGAP1 are disclosed herein. Methods for treating hereditary epilepsy, such as Dravet syndrome or SYNGAP1-associated epilepsy, are further disclosed.

Description

TECHNICAL FIELD

[0001] (Related Applications) This application claims priority and benefit of U.S. Provisional Application No. 63 / 592,405 filed on October 23, 2023 and U.S. Provisional Application No. 63 / 592,727 filed on October 24, 2023, the contents of each of which are incorporated by reference in their entirety.

[0002] (Reference to Electronic Sequence Listing) The contents of the electronic sequence listing (LOCN_026_003WO_SeqList_ST26.xml, size: 492,530 bytes; and creation date: October 22, 2024) are incorporated herein by reference in their entirety.

[0003] (Field of the Invention) The present disclosure relates to molecular biology, gene therapy, and compositions and methods for modifying the expression and activity of RNA molecules. BACKGROUND ART

[0004] Nuclear small RNAs (snRNAs) are the smallest type of RNA, with an average size of approximately 150 nucleotides. snRNAs are functional non-coding RNAs. Eukaryotic genomes encode a wide variety of non-coding RNAs, including snRNAs, a highly abundant class of nuclei-localized RNAs that play crucial roles in intron splicing and RNA processing. snRNAs can form ribonucleoprotein particles (snRNPs) with other proteins during the pre-mRNA splicing process. These snRNPs and further proteins form a large particulate complex (spliceosome) bound to the unspliced ​​pre-mRNA transcript. In addition to splicing, snRNAs function in nuclear maturation of nascent transcripts, gene expression regulation, as splice donors in non-canonical systems, and in the 3' end processing of replication-dependent histone mRNA. U7 snRNAs can be programmed to bind to and regulate mRNA without exogenous protein expression, which ultimately reduces the risk of immunogenicity observed with other protein-based gene therapy approaches. Furthermore, the small size of these programmed snRNAs presents an opportunity to develop single-vector, highly specific (allele-specific), single-target and multi-target gene therapy approaches.

[0005] Hereditary epilepsy is a class of seizure disorders that have an underlying genetic cause due to genetic or spontaneous mutations in the genes. Dravet syndrome is a rare developmental and epileptic encephalopathy that typically begins within the first year of life. Symptoms of Dravet syndrome include frequent and prolonged seizures, intellectual disability, developmental delay, behavioral disturbances, and ataxia. Individuals with Dravet syndrome are also at high risk of sudden unexpected death (SUDEP) in epilepsy. The average age of onset for SUDEP is 4.6 years.

[0006] Approximately 80% of patients with Dravet syndrome have a novel heterozygous missense mutation or truncation in the SCN1A gene. SCN1A encodes the α subunit (Nav1.1) of voltage-gated sodium ion channel type 1, which is important in normal neuronal function. Nav1.1 is a major Na in GABAergic inhibitory interneurons. + It is a channel that induces rapid depolarization of the neuronal membrane during action potential initiation. Mutations in Nav1.1 result in haploinsufficiency of the Nav1.1 protein. The SCN1A gene is too large for gene replacement therapy, as it has 26 exons spanning 6030 bp.

[0007] Dravet syndrome is estimated to have a prevalence of approximately 1 in 15,700 in the United States. To date, treatment has included anticonvulsant therapy that only partially manages seizures and does not improve other comorbidities, ketogenic diet therapy that reduces seizure frequency, and supportive therapy to address neurodevelopmental challenges. Therefore, there remains an unmet need for new treatment approaches for Dravet syndrome.

[0008] SYNGAP1-associated epilepsy is a rare genetic disorder caused by variants in the SYNGAP1 gene. Many individuals develop epilepsy and / or autism spectrum disorder, as well as other behavioral, social, and sensory problems, with varying degrees of severity.

[0009] The SYNGAP1 gene is located on chromosome 6 and is responsible for the production of the synaptic Ras GTPase-activated protein 1 (SYNGAP1) protein. High levels of SYNGAP1 are present in the brain and are essential for proper function and development. SYNGAP1 is a key regulator of the neural mechanisms of learning and memory, where neurons communicate with each other (synapses). Types of seizures associated with SYNGAP1 include atypical and typical absence seizures, myoclonic seizures, cataplexy, eyelid myoclonus with absence (EMA), and epilepsy with myoclonic cataplexy (MAE or Douce syndrome). More frequently, individuals exhibit a combination of EMA and MAE features. A characteristic feature in individuals with this gene is myoclonic cataplexy or eyelid myoclonus that develops into cataplexy.

[0010] Seizures typically begin between approximately 4 months and 7 years of age, with an average age of 2 years. Seizure triggers are more frequent during the active phase of epilepsy, and some individuals may experience more than 100 seizures per day. Developmental delay or intellectual disability is present in almost all individuals affected by SYNGAP1. Typically, developmental delay is evident in the first two years of a child's life, which can lead to a diagnosis of intellectual disability. Two-thirds of children also exhibit hypotonia (low muscle tone), and a smaller group have ataxia (poor balance) and / or other gait abnormalities. The incidence of SYNGAP1 is estimated to be 1–4 per 10,000 individuals. Therefore, there remains an unmet need for new treatment approaches for SYNGAP1-associated epilepsy.

[0011] In some individuals with SYNGAP1-associated epilepsy, an immature stop codon is present in SYNGAP1 toxic exon 11, leading to nonsense mutation-dependent degradation mechanisms, transcript dysfunction, and haploinsufficiency, which in turn cause patients to experience symptoms associated with SYNGAP1-associated epilepsy. [Overview of the project]

[0012] A cRNA-targeting nucleic acid molecule containing nuclear small RNA (snRNA), wherein the snRNA contains a targeting sequence that binds to the RNA sequence of SCN1A or SYNGAP1.

[0013] In some embodiments, the SCN1A RNA sequence is exon 20N. In some embodiments, the SYNGAP1 RNA sequence is exon 11. In some embodiments, the SCN1A targeting sequence includes a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to the nucleic acid sequence described in any one of SEQ ID NOs. 16-83. In some embodiments, the SYNGAP1 targeting sequence includes the nucleic acid sequence described in any one of SEQ ID NOs. 181-279.

[0014] In some embodiments, the snRNA includes a stem-loop (SL). In some embodiments, the SL includes one or more nucleic acid sequences described in any one of SEQ ID NOs: 84-124. In some embodiments, the SL includes one or more nucleic acid sequences that are independently at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to the nucleic acid sequences described in any one of SEQ ID NOs: 84-124. In some embodiments, the SL includes or consists of nucleic acid sequences that are at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to the nucleic acid sequence described in SEQ ID NO: 97.

[0015] This disclosure provides an RNA-targeting nucleic acid molecule containing nuclear small RNA (snRNA), wherein the snRNA comprises a targeting sequence that binds to an SCN1A RNA sequence and an SL containing the nucleic acid sequence described in Sequence ID No. 97, and the targeting sequence is located at the 5' end of the SL.

[0016] In some embodiments, the SCN1A RNA sequence is exon 20N. In some embodiments, the SCN1A targeting sequence includes a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to the nucleic acid sequence described in any one of SEQ ID NOs. 16-83.

[0017] In some embodiments, the SCN1A RNA sequence is either a premRNA or an mRNA sequence. In some embodiments, the snRNA includes an Sm-binding domain (SmBD). In some embodiments, the SmBD is U1, U2, U4, or U5 SmBD. In some embodiments, the SmBD includes the nucleic acid sequence described in either SEQ ID NO: 160 or 161.

[0018] In some embodiments, the snRNA includes a 5' interaction stabilization domain (5'ISD). In some embodiments, the 5'ISD includes the nucleotide sequence ggagt, cctct, ggaggt, cctcct, agccag, ggaag, gaagaag, gttg, ccgaa, taaggag, gaag, or ggctt.

[0019] This disclosure provides vectors comprising one or more snRNAs of any embodiment of this disclosure. In some embodiments, the vector is an adeno-associated virus (AAV) vector. In some embodiments, the snRNA is operably ligated to a promoter. In some embodiments, the snRNA is operably ligated to either the U7 promoter or the U1 promoter.

[0020] In some embodiments, the snRNA is operably ligated to a downstream terminator (DT). In some embodiments, the snRNA is operably ligated to a U7 downstream terminator or a U1 downstream terminator.

[0021] In some embodiments, the vector comprises at least 1, at least 2, at least 3, at least 4, or at least 5 snRNAs. In some embodiments, the at least 1, at least 2, at least 3, at least 4, or at least 5 snRNAs each target the same target RNA sequence.

[0022] In some embodiments, each snRNA is separated by a buffer sequence. In some embodiments, the buffer sequence comprises a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage therebetween) identical to the nucleic acid sequence set forth in any one of SEQ ID NOs: 151 to 157.

[0023] In some embodiments, the vector comprises a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage therebetween) identical to the nucleic acid sequence set forth in any one of SEQ ID NOs: 162 to 180.

[0024] The present disclosure provides a method of targeting one or more target RNAs of interest and causing exon skipping in the one or more target RNAs, the method comprising contacting the snRNA of any embodiment of the present disclosure with a cell comprising the one or more target RNAs.

[0025] The present disclosure provides an SCN1A RNA-targeting nucleic acid molecule comprising a targeting sequence set forth in any one of SEQ ID NOs: 16 to 83. The present disclosure provides a SYNGAP1 RNA-targeting nucleic acid molecule comprising a targeting sequence set forth in any one of SEQ ID NOs: 181 to 279.

[0026] The present disclosure provides a polynucleotide or vector comprising a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage therebetween) identical to the nucleic acid sequence set forth in any one of SEQ ID NOs: 162 to 180.

[0027] The present disclosure provides a recombinant AAV (rAAV) comprising: (a) an AAV capsid comprising an AAV capsid protein; and (b) a vector genome comprising the snRNA or RNA-targeting nucleic acid molecule disclosed herein.

[0028] In some embodiments, the vector genome further comprises a 5' inverted terminal repeat (ITR) sequence and a 3' ITR. In some embodiments, the vector genome comprises, in the 5' to 3' direction, a 5' ITR sequence, the snRNA or RNA-targeting nucleic acid molecule, and a 3' ITR sequence.

[0029] The present disclosure provides a recombinant AAV (rAAV) comprising: an AAV capsid comprising an AAV capsid protein; and a vector genome comprising a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage therebetween) identical to the nucleic acid sequence set forth in any one of SEQ ID NOs: 162 to 180.

[0030] In some embodiments, the AAV capsid comprises an AAV capsid protein of an AAV serotype selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrh10, AAV11, AAV12, and variants thereof.

[0031] In some embodiments, the vector genome is single-stranded or self-complementary. In some embodiments, the rAAV is replication-defective. This disclosure provides pharmaceutical compositions comprising snRNA, RNA-targeted nucleic acid molecules, vectors, polynucleotides, or rAAVs as disclosed herein.

[0032] A method for targeting one or more target RNAs and skipping exons of one or more target RNAs, comprising contacting an snRNA, RNA-targeting nucleic acid molecule, vector, polynucleotide, or rAAV disclosed herein with a cell containing one or more target RNAs.

[0033] In some embodiments, one or more target RNAs of interest contain the toxic exon 20N of the human sodium channel Nav1.1 gene. This disclosure provides a method for treating a disease or disorder in a subject, comprising administering to the subject an snRNA, RNA-targeted nucleic acid molecule, vector, polynucleotide, rAAV, or pharmaceutical composition disclosed herein.

[0034] In some embodiments, the disease or disorder is hereditary epilepsy. In some embodiments, the disease or disorder is Dravet syndrome. In some embodiments, the disease or disorder is SYNGAP1-associated epilepsy.

[0035] In some embodiments, administration is systemic, intravenous, or intraventricular. This disclosure provides the use of snRNA or RNA-targeting nucleic acid molecules disclosed herein for targeting one or more target RNAs and skipping exons of one or more target RNAs.

[0036] In some embodiments, one or more target RNAs are contained within a cell. This disclosure provides the use of the snRNAs, RNA-targeted nucleic acid molecules, vectors, polynucleotides, rAAVs, or pharmaceutical compositions disclosed herein for treating diseases or disorders in a subject.

[0037] In some embodiments, the disease or disorder is hereditary epilepsy. In some embodiments, the disease or disorder is Dravet syndrome. In some embodiments, administration is systemic, intravenous, or intraventricular. [Brief explanation of the drawing]

[0038] [Figure 1A] This paper describes the mechanism of action of U7 snRNA-mediated skipping of SCN1A's toxic exon 20N to restore the frame and function of the sodium channel Nav1.1 in Dravet syndrome. U7 snRNA binds to splicing regulatory sequences (acceptor and donor sites or splicing enhancer sequences) within SCN1A's toxic exon 20N, promoting skipping and the restoration of frame and function. PTC: Immature stop codon. NMD: Nonsense mutation-dependent degradation mechanism. [Figure 1B] TapeStation images of RT-PCR products after U7 snRNA treatment using a single U7 spacer (in pcDNA) are shown, indicating either a band that did not skip exon 20N of SCN1A (containing the toxic exon, upper fragment) or a skipped product (exclusion of the toxic exon, lower band). Untargeted U7 (NT), empty pcDNA plasmid (pc), and untreated cells (UNT) were used as negative controls. [Figure 1C] Figure 1B shows the quantification of the gel, plotted as the percentage of toxic exon 20N inclusion after treatment with multiple U7 snRNA single spacers in HeLa cells. The dashed line represents the average toxic exon 20N inclusion under control conditions, such as untreated cells or cells transfected with empty plasmids or untargeted (NT) U7 snRNA. [Figure 2A]TapeStation images of RT-PCR products after U7 snRNA treatment using single and fused U7 spacers (cloned into pcDNA plasmids) are shown, indicating bands that do not skip exon 20N of SCN1A (including the toxic exon, upper fragment) or skipped products (exclusion of the toxic exon, lower band). Untargeted U7 (NT) and untreated cells (UNT) were used as negative controls. [Figure 2B] Figure 2A shows the quantification of the gel, plotted as the percentage of toxic exon 20N inclusion after treatment with multiple U7 snRNA spacers in HepG2 cells. [Figure 2C] This shows the expression of productive SCN1A (without toxic exon 20N) as determined by qRT-PCR after treatment with single and fusion U7 snRNA. [Figure 3A] This study quantifies the percentage of toxic exon 20N inclusion in RT-PCR products after U7 snRNA treatment using fusion-synthesized U7 spacers of z15 / z6 and z11 / z15 with further modifications to the ISD and stem-loop. Untargeted U7 (NT) and untreated cells (UNT) were used as negative controls. [Figure 3B] This shows the expression of productive SCN1A (without toxic exon 20N) as determined by qRT-PCR after treatment with U7 snRNA. [Figure 4A] TapeStation images of RT-PCR products for exon 20N skipping detection after U7 snRNA treatment using AAV9 (two U7 snRNA cassettes expressing fusion spacers under mouse U7 and mouse U1 promoters) with increased MOI are shown. The gel images show SCN1A toxic exon 20N (unskipped band, top) and skipped product (bottom band). AAV9 null (empty capsid) and untreated (UNT) cells were used as negative controls. [Figure 4B] Figure 4A shows the quantification of the gel, plotted as the percentage of toxic exon 20N inclusion after AAV9 transduction using two U7 snRNA vectors, A05290 and A05291. [Figure 4C] This shows the quantitative level of productive SCN1A RNA (without toxic exons) 7 days after transduction using AAV9 containing two U7 snRNA cassettes in SCN1A+ / -GABAergic neurons. [Figure 5A] The diagram shows the study design for an in vivo study in wild-type (WT) mice treated with scAAV9-U7 snRNA, which targets the toxic exon of SCN1A delivered to the ventricle (ICV) at P0 and collected at P20. [Figure 5B] Representative TapeStation images of cortical and hippocampal samples of RT-PCR products after U7 snRNA treatment using two read constructs, A05290 and A05291, are shown, indicating either a band that does not skip SCN1A toxic exon 21N (the mouse equivalent of toxic exon 20N in humans) (upper fragment containing the toxic exon) or a skipped product (exclusion of the toxic exon, lower band). Vehicle-treated samples were used as negative controls. [Figure 5C] Figure 5B shows the quantification of gels using samples from further cortical slices (1, 2, and 3) and hippocampal slices (1 and 2), plotted as the percentage of toxic exon 21N inclusion after AAV 9 transduction using two U7 snRNA vectors. [Figure 5D] This shows the quantification of productive SCN1A mRNA (i.e., toxic exon-free) levels in three cortical regions and two hippocampal regions 20 days after ICV injection using AAV9 expressing two U7 snRNA cassettes. [Figure 5E] This shows the SCN1A / Nav1.1 protein expression levels in the cortex (CTX) and hippocampus (Hippo) 20 days after ICV injection using AAV9 expressing two U7 snRNA cassettes. [Figure 5F] This shows snRNA expression in the cortex and hippocampus (Hipp) after treatment with AAV9 expressing snRNA. [Figure 6A]This schematic diagram shows the inclusion of toxic exon 11 of SYNGAP (shown as a shaded box), which contains an immature stop codon (PTC) and leads to nonsense mutation-dependent degradation (NMD), transcript degradation, and haploinsufficiency. [Figure 6B] This is a schematic diagram illustrating the mechanism of action of U7 snRNA-mediated toxic exon 11 skipping of SYNGAP to restore frame and function. The U7 snRNA was modified to bind to the splicing regulatory sequence within SYNGAP's toxic exon 11 to promote skipping and the restoration of frame and function. [Figure 6C] TapeStation images of RT-PCR products after U7 snRNA treatment using a single U7 spacer (z22, z23, and z24 in pcDNA), showing bands that do not skip toxic exon 11 of SYNGAP (upper fragment containing the toxic exon) or skipped products (exclusion of the toxic exon, lower band). Untargeted U7(NT) was used as a negative control. ASO, which has been previously shown to promote the exclusion of toxic exon 11, was used as a positive control. [Figure 6D] This graph shows the quantitative results of TapeStation, plotted as the percentage of toxic exon elimination after treatment with multiple single and fusion spacer U7 snRNAs targeting different regions of the SYNGAP1 premRNA in Hek293-T cells. [Figure 7A] This graph shows the quantification of the percentage of endogenous SYNGAP1 toxic exon 11 skipping determined by a splicing assay after treatment with a single synthetic U7 snRNA in HEK293-T cells. [Figure 7B] This graph shows the quantification of productive SYNGAP1 mRNA expression determined by qRT-PCR after treatment with a single synthetic U7 snRNA in HEK293-T cells. Untargeted U7(NT) was used as a negative control. [Figure 7C]This graph shows the quantification of the percentage of endogenous SYNGAP1 toxic exon 11 skipping determined by splicing assays after treatment with novel optimized single and fusion U7 snRNAs in HEK293-T cells. [Figure 7D] This graph shows the quantification of productive SYNGAP1 mRNA expression in HEK293-T cells, determined by qRT-PCR after treatment with novel optimized single and fusion U7 snRNAs. Untargeted U7(NT) was used as a negative control. [Figure 8A] TapeStation images of RT-PCR products at the exon 11 level of SYNGAP1 in neural progenitor cells (NPCs) of patients containing the R1240X mutation. Patient NPCS show high levels of toxic exon 11 inclusion of SYNGAP1 (upper band). [Figure 8B] This graph shows the quantification of RT-PCR products for the percentage of toxic exon 11 skipping of SYNGAP1 after U7 snRNA treatment in patient-derived NPCs. Untargeted U7(NT) was used as a negative control. [Figure 8C] This graph shows the quantitative expression of productive SYNGAP1 mRNA (without toxic exon 11) determined by qRT-PCR after treatment with U7 snRNA. [Modes for carrying out the invention]

[0039] This disclosure provides a gene therapy composition comprising a therapeutic RNA targeting platform consisting of nuclear small RNA (snRNA) that targets a precursor mRNA (premRNA) or mRNA sequence (SCN1A) encoding Nav1.1. The targeted premRNA or mRNA sequence may include the exon region of SCN1A and / or the splicing regulatory sequence of SCN1A.

[0040] This disclosure provides a gene therapy composition comprising a therapeutic RNA targeting platform consisting of a precursor mRNA (premRNA) or small nuclear RNA (snRNA) that targets a precursor mRNA or mRNA sequence encoding synaptic Ras GTPase activating protein 1 (SYNGAP1). The targeted premRNA or mRNA sequence may include the exon region of SYNGAP1 and / or the splicing regulatory sequence of SYNGAP1.

[0041] Compositions comprising nucleic acid molecules and vectors comprising one or more snRNA constructs targeting SCN1A are disclosed herein. The snRNA molecules of this disclosure may be non-natural, modified and / or engineered snRNAs (esnRNAs). In some embodiments, the SCN1A-targeting snRNAs or esnRNAs of this disclosure comprise a mutant snRNA stem-loop. In some embodiments, the SCN1A-targeting snRNAs of this disclosure comprise a natural stem-loop.

[0042] Compositions comprising nucleic acid molecules and vectors comprising one or more snRNA constructs targeting SYNGAP1 are disclosed herein. The snRNA molecules of this disclosure may be non-natural, modified and / or engineered snRNAs (esnRNAs). In some embodiments, the SYNGAP1-targeting snRNAs or esnRNAs of this disclosure comprise a mutant snRNA stem-loop. In some embodiments, the SYNGAP1-targeting snRNAs of this disclosure comprise a natural stem-loop.

[0043] Nuclear small ribonucleic acid (snRNA) is an essential component of nuclear small ribonucleoprotein complexes (snRNPs). When assembled with further proteins, they form a large ribonucleoprotein complex known as the spliceosome, a cellular mechanism designated to mediate the entire mRNA maturation process. The spliceosome is responsible for precursor mRNA splicing, the process of removing introns from RNA transcripts before protein production. Individual snRNAs are generally about 250 nucleotides or less in size. For example, U1 snRNA is 164 nucleotides long and is encoded by a gene that occurs in several copies within the human genome. U1 snRNA represents the ribonucleic acid component of the nuclear particle U1 snRNP. U1 snRNA has a three-dimensional stem-loop structure and, within its 5' region, contains a single-stranded sequence, generally about 9 nucleotides long, which can bind to a splicing donor site on the premRNA molecule via complementary base pairing. (Horowitz et al., 1994, Trends Genet., 10(3):100-6). Various spliceosome snRNAs have been named U1, U2, U4, U5, U6, U4ATAC, U6ATAC, U7, U11, and U12, based on the amount of uridylic acid they contain. (Mattaj et al., 1993, FASEB J, 15, 7:47-53).

[0044] snRNA systems can be used to treat toxic mutations. For example, antisense oligonucleotides that interfere with splice sites and regulatory elements within exons containing toxic mutations can induce skipping of specific exons at the preRNA level. Such antisense sequences can be packaged within snRNA sequences delivered using viral vectors that contain nucleic acid sequences to which the snRNA can be transcribed. U7 snRNAs are intrinsically involved in the 3' end processing of histone premRNAs, but slight alterations to the Sm / Lsm protein binding site can transform them into versatile tools for splicing regulation.

[0045] Most U-rich snRNPs are complexes that mediate premRNA splicing. The U7 snRNP is an exception. U7 is not involved in splicing, but rather is a key factor in the intrinsic 3' end processing of replication-dependent histone mRNA. By modifying the U7 snRNA histone-binding sequence and Sm motif, U7 can no longer be involved in the processing of histone premRNA and instead targets premRNA or smRNA for blocking or splicing regulation. In this way, U7 snRNA can be used as an effective gene therapy platform. The U7 snRNA platform also has the further advantages of being compact in size, having the ability to accumulate in the nucleus without causing cytotoxicity, and having little to no immunoreactivity. (Gadgil et al., 2021, J Gene Med, 23(4):e3321). The U7 snRNA platform is described in detail in International Patent Application Publication WO2023 / 168458 (which is incorporated herein by reference in its entirety).

[0046] In some embodiments, esnRNAs containing stem-loops (SLs) are disclosed herein. Compensatory modifications made to the native stem-loop sequence can create SLs that communicate (fold and anneal) more effectively with the snRNA interaction stabilization domain (ISD) compared to the native stem-loop sequence, thereby creating an snRNA platform with increased stability. U7 snRNAs have been previously shown to be programmable to modulate mRNA. This specification discloses improved programmed and manipulated snRNAs that can be used as gene therapy tools.

[0047] The snRNA systems disclosed herein are configured to bind to a target SCN1A or SYNGAP1 RNA sequence and regulate RNA splicing, which may result in single or multiple exon skipping or exon inclusion of the target sequence of the SCN1A or SYNGAP1 RNA. SCN1A-targeted snRNAs are configured to bind to an SCN1A premRNA molecule at a site that regulates RNA splicing. SYNGAP1-targeted snRNAs are configured to bind to a SYNGAP1 premRNA molecule at a site that regulates RNA splicing. The splicing regulatory site may include a splice acceptor sequence, a splice donor sequence, and an exon splice enhancer sequence. The snRNA sequences disclosed herein can induce exon skipping (of single or multiple exons) of a target exon sequence.

[0048] Nonproductive splicing events, such as the inclusion of toxic exons containing immature stop codons, are naturally occurring regulatory mechanisms to reduce the expression of unwanted genes during development or in specific tissues. SCN1A premRNA contains a "toxic exon" (exon 20N in humans, exon 21N in mice) containing an immature stop codon. SYNGAP1 premRNA contains a "toxic exon" (exon 11 in humans) containing an immature stop codon. Transcription of exons leads to a nonsense mutation-dependent degradation mechanism of RNA. While we do not wish to be bound by theory, it is hypothesized that using the U7 snRNA platform to facilitate the skipping of the "toxic exon" (exon 20N) from SCN1A premRNA would increase the expression of the full-length SCN1A transcript and thus promote the expression of a restored, functional Nav1.1 protein. Furthermore, although we do not wish to be bound by theory, we hypothesize that by using the U7 snRNA platform to facilitate the skipping of the "poison exon" (exon 11) from the SYNGAP1 premRNA, the expression of the full-length SYNGAP1 transcript will increase, and therefore the expression of the restored, functional SYNGAP1 protein will be promoted.

[0049] In one embodiment, these snRNAs are human snRNAs. In another embodiment, these snRNAs are mouse snRNAs. In another embodiment, the snRNAs are of any species. In another embodiment, the snRNAs are a combination of human and mouse snRNAs. In one embodiment, the U7 snRNA is either human U7 snRNA or mouse U7 snRNA. In another embodiment disclosed herein, the snRNAs include various types of snRNAs (such as U1-U12) by combining domains of endogenous snRNAs to fine-tune platform stabilization and / or reduce off-target effects. For example, in one embodiment, the snRNA system includes a combination of human or mouse U7 snRNA and human or mouse U1 snRNA components.

[0050] Additional elements that allow for fine-tuning of RNA processing and abundance can be further incorporated into snRNAs or esnRNAs containing SLs. In one embodiment, additional elements that allow for fine-tuning of esnRNA processing, stability, and abundance can be further incorporated into esnRNAs at the 5' or 3' end. In another embodiment, such elements may include, but are not limited to, stem-loops, hairpins, GC clamps, kissing loops, triple helixes, quadruple helixes, and protein-binding sites.

[0051] snRNA platforms and parts thereof can be used in therapeutic settings and situations, insofar as suitable spacers or target sequences (TS) are included in the design of the therapeutic composition. In certain embodiments, the therapeutic snRNA composition is used to treat diseases associated with dysregulation, mutation, or non-functional NaV1.1. In some embodiments, the disease or disorder is Dravet syndrome.

[0052] Targeted sequence An snRNA system can be programmed to include a targeting sequence (TS) (also called a “spacer”) that targets the RNA of interest. An snRNA system can be programmed using one or more targeting sequences that target one or more RNAs of interest. In some embodiments, the targeting sequence is a 5' targeting sequence (5'TS) that targets one or more RNAs of interest. In this context, 5' refers to the 5' end of the snRNA insert and not necessarily to the entire vector structure containing the snRNA insert(s). The TS may be located at or near the 5' end of the snRNA. In alternative embodiments, the targeting sequence (TS) may be located at or near the 3' position of the snRNA construct, particularly if the snRNA construct is not a U7-based snRNA, thereby generating a 3' targeting sequence (3'TS).

[0053] The targeting sequences of this disclosure, including the 5'TS and 3'TS, may be about 1 to about 200 nucleotides in length. In some embodiments, the targeting sequences of this disclosure are about 10 to about 150 nucleotides in length. In some embodiments, the targeting sequences of this disclosure are about 10 to about 100 nucleotides in length. In some embodiments, the targeting sequences of this disclosure are about 20 to about 60 nucleotides in length. In some embodiments, the targeting sequences of this disclosure are at least about 10, 20, 30, 40, 50, 60, or about 70 nucleotides in length.

[0054] The snRNA compositions of this disclosure may contain one or more targeting sequences, each of which binds to a different RNA sequence. In some embodiments, the snRNAs of this disclosure include a fusion targeting sequence. In some embodiments, the fusion targeting sequence is a nucleic acid sequence comprising two targeting sequences directly linked or linked by one or more linker nucleic acid sequences, each of which binds to a different target RNA sequence.

[0055] In one example, a U7 snRNA can be programmed by replacing its histone mRNA binding sequence with a sequence complementary to the target of interest. In some embodiments, the snRNA systems of this disclosure bind to the target mRNA or premRNA sequence of interest. Exemplary snRNA systems shown herein result in exon skipping (e.g., exon 20N skipping of SCN1A to treat Dravet syndrome; or exon 11 skipping of SYNGAP1 to treat SYNGAP1-associated epilepsy).

[0056] In some embodiments, the snRNAs of this disclosure target a premRNA or mRNA sequence encoding the NaV1.1 protein. SCN1A is the gene encoding the protein NaV1.1. Mutations in SCN1A are associated with Dravet syndrome. In some embodiments, the SCN1A RNA sequence targeted by the snRNA composition of this disclosure may be an SCN1A RNA sequence in any exon or intron. In some embodiments, the SCN1A RNA sequence targeted by the snRNA composition of this disclosure is an SCN1A RNA sequence in exon 20N or exon 21N. In some embodiments, the SCN1A RNA sequence targeted by the snRNA composition of this disclosure is an SCN1A RNA sequence in human exon 20N. In some embodiments, the SCN1A RNA sequence targeted by the snRNA composition of this disclosure is an SCN1A RNA sequence in mouse exon 21N. In some embodiments, the SCN1A RNA sequence targeted by the snRNA of this disclosure is a splice acceptor sequence, a splice donor sequence, or an exon splice enhancer sequence.

[0057] In some embodiments, the nucleic acid sequence encoding wild-type human SCN1A mRNA includes or consists of SEQ ID NO: 1. In some embodiments, the nucleic acid sequence encoding wild-type human SCN1A mRNA includes a sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence described in SEQ ID NO: 1.

[0058] In some embodiments, the nucleic acid sequence encoding wild-type human SCN1A mRNA includes or consists of SEQ ID NO: 2. In some embodiments, the nucleic acid sequence encoding wild-type human SCN1A mRNA includes a sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence described in SEQ ID NO: 2.

[0059] In some embodiments, the nucleic acid sequence encoding wild-type human SCN1A mRNA includes or consists of SEQ ID NO: 3. In some embodiments, the nucleic acid sequence encoding wild-type human SCN1A mRNA includes a sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence described in SEQ ID NO: 3.

[0060] In some embodiments, the nucleic acid sequence encoding wild-type human SCN1A mRNA includes or consists of SEQ ID NO: 4. In some embodiments, the nucleic acid sequence encoding wild-type human SCN1A mRNA includes a sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence described in SEQ ID NO: 4.

[0061] In some embodiments, the nucleic acid sequence encoding wild-type human SCN1A mRNA includes or consists of SEQ ID NO: 5. In some embodiments, the nucleic acid sequence encoding wild-type human SCN1A mRNA includes a sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence described in SEQ ID NO: 5.

[0062] In some embodiments, the nucleic acid sequence encoding wild-type human SCN1A mRNA includes or consists of SEQ ID NO: 6. In some embodiments, the nucleic acid sequence encoding wild-type human SCN1A mRNA includes a sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence described in SEQ ID NO: 6.

[0063] A includes or consists of Sequence ID 7. In some embodiments, the nucleic acid sequence encoding wild-type human SCN1A mRNA includes a sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence described in Sequence ID 7.

[0064] In some embodiments, the nucleic acid sequence encoding wild-type human SCN1A mRNA includes or consists of SEQ ID NO: 8. In some embodiments, the nucleic acid sequence encoding wild-type human SCN1A mRNA includes a sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence described in SEQ ID NO: 8.

[0065] In some embodiments, the nucleic acid sequence encoding wild-type human SCN1A mRNA includes or consists of SEQ ID NO: 9. In some embodiments, the nucleic acid sequence encoding wild-type human SCN1A mRNA includes a sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence described in SEQ ID NO: 9.

[0066] In some embodiments, the nucleic acid sequence encoding wild-type human SCN1A mRNA includes or consists of SEQ ID NO: 10. In some embodiments, the nucleic acid sequence encoding wild-type human SCN1A mRNA includes a sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence described in SEQ ID NO: 10.

[0067] In some embodiments, the nucleic acid sequence encoding wild-type human SCN1A mRNA includes or consists of SEQ ID NO: 11. In some embodiments, the nucleic acid sequence encoding wild-type human SCN1A mRNA includes a sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence described in SEQ ID NO: 11.

[0068] In some embodiments, the nucleic acid sequence encoding wild-type human SCN1A mRNA includes or consists of SEQ ID NO: 12. In some embodiments, the nucleic acid sequence encoding wild-type human SCN1A mRNA includes a sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence described in SEQ ID NO: 12.

[0069] In some embodiments, the nucleic acid sequence encoding wild-type human SCN1A mRNA includes or consists of SEQ ID NO: 13. In some embodiments, the nucleic acid sequence encoding wild-type human SCN1A mRNA includes a sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence described in SEQ ID NO: 13.

[0070] In some embodiments, the nucleic acid sequence encoding wild-type human SCN1A mRNA includes or consists of SEQ ID NO: 14. In some embodiments, the nucleic acid sequence encoding wild-type human SCN1A mRNA includes a sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence described in SEQ ID NO: 14.

[0071] In some embodiments, the nucleic acid sequence encoding wild-type human SCN1A mRNA includes or consists of SEQ ID NO: 15. In some embodiments, the nucleic acid sequence encoding wild-type human SCN1A mRNA includes a sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence described in SEQ ID NO: 15.

[0072] The target sequence that binds to exon 20N of SCN1A may contain, essentially be, or may be identical to, one or more of the following nucleotide sequences listed in Table 1 below, by at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between):

[0073] [Table 1]

[0074] In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 16. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 17. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 18. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 19. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 20. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 21. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 22. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 23. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 24. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 25. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 26. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 27. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 28. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 29. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 30. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 31. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 32. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 33. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 34.In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 35. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 36. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 37. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 38. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 39. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 40. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 41. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 42. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 43. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 44. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 45. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 46. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 47. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 48. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 49. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 50. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 51.

[0075] Fusion spaces can be generated by combining the sequences listed in Table 1. Any first sequence listed in Table 1 can be combined with any second sequence listed in the table. Exemplary fusion spacers are shown in Table 2. The target sequence that binds to exon 20N of SCN1A may contain, essentially be, or may be identical to at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) of the following nucleotide sequences listed in the table below.

[0076] [Table 2]

[0077] In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 52. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 53. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 54. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 55. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 56. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 57. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 58. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 59. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 60. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 61. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 62. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 63. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 64. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 65. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 66. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 67. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 68. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 69. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 70.In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 71. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 72. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 73. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 74. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 75. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 76. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 77. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 78. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 79. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 80. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 81. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 82. In some embodiments, the target sequence that binds to exon 20N of SCN1A includes the sequence described in SEQ ID NO: 83.

[0078] In some embodiments, the snRNAs of this disclosure target a premRNA or mRNA sequence encoding the synaptic Ras GTPase activating protein 1. SYNGAP1 is the gene encoding the protein synaptic Ras GTPase activating protein 1 (SYNGAP1). Mutations in SYNGAP1 are associated with SYNGAP1-associated epilepsy. In some embodiments, the SYNGAP1 RNA sequence targeted by the snRNA compositions of this disclosure may be a SYNGAP1 RNA sequence in any exon or intron. In some embodiments, the SYNGAP1 RNA sequence targeted by the snRNA compositions of this disclosure is a SYNGAP1 RNA sequence in exon 11 or toxic exon 11. In some embodiments, the SYNGAP1 RNA sequence targeted by the snRNA compositions of this disclosure is a SYNGAP1 RNA sequence in human exon 11 or toxic exon 11. In some embodiments, the SYNGAP1 RNA sequence targeted by the snRNA compositions of this disclosure is an SCN1A RNA sequence in mouse exon 11 or toxic exon 11. In some embodiments, the SYNGAP1 RNA sequence targeted by the snRNA of this disclosure is a splice acceptor sequence, a splice donor sequence, or an exon splice enhancer sequence.

[0079] In some embodiments, the nucleic acid sequence encoding wild-type human SYNGAP1 mRNA includes or consists of SEQ ID NO: 280. In some embodiments, the nucleic acid sequence encoding wild-type human SCN1A mRNA includes a sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence described in SEQ ID NO: 280.

[0080] Fusion spaces can be generated by combining the sequences listed in Table 3. Any first sequence listed in Table 3 can be combined with any second sequence listed in Table 3. Exemplary fusion spacers are shown in Table 3. Target sequences that bind to exon 11 or toxic exon 11 of SYNGAP1 may contain, essentially be, or may be identical to at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) nucleic acid sequences of one or more of the following nucleotide sequences listed in Table 3 below.

[0081] [Table 3-1]

[0082] [Table 3-2]

[0083] [Table 3-3]

[0084] In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 181. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 182. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 183. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 184. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 185. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 186. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 187. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 188. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 189. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 190. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 191. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 192. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 193. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 194. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 195.In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 196. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 197. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 198. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 199. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 200.

[0085] In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 201. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 202. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 203. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 204. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 205. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 206. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 207. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 208. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 209. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 210.

[0086] In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 211. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 212. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 213. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 214. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 215. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 216. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 217. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 218. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 219. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 220.

[0087] In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 221. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 222. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 223. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 224. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 225. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 226. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 227. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 228. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 229. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 230.

[0088] In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 231. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 232. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 233. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 234. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 235. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 236. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 237. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 238. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 239. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 240.

[0089] In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 241. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 242. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 243. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 244. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 245. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 246. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 247. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 248. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 249. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 250.

[0090] In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 251. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 252. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 253. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 254. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 255. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 256. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 257. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 258. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 259. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 260.

[0091] In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 261. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 262. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 263. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 264. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 265. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 266. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 267. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 268. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 269. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 270.

[0092] In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 271. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 272. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 273. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 274. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 275. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 276. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 277. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 278. In some embodiments, the target sequence that binds to exon 11 or toxic exon 11 of SYNGAP1 includes the sequence described in SEQ ID NO: 279.

[0093] stem loop The engineered snRNA (esnRNA) systems disclosed herein may include stem-loop (SL) sequences that involve compensatory modifications to the native snRNA stem-loop. These modifications result in increased stability of the engineered nuclear small ribonucleoprotein (esnRNP) compared to snRNPs containing unmodified stem-loop sequences. The SL sequences disclosed herein can be derived from any snRNP, such as U1-U12. In one embodiment, the SL is human or mouse U7 SL. In one embodiment, the SL is human SL. In one embodiment, the SL is mouse SL. In some embodiments, the SL is human and mouse SL. In some embodiments, the SL is non-human SL, e.g., mouse SL, pig, sheep SL, goat SL, cattle SL, dog SL, cattle SL, horse SL, or a combination thereof. In some embodiments, the SL sequence is not a native stem-loop sequence. In some embodiments, the nucleic acid sequence of the SL is not a natural stem-loop sequence by at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between). The stem-loop sequence is described in WO2023168458, the entire contents of which are incorporated herein by reference with respect to examples of SL sequences that may be used in the constructs described herein.

[0094] In some embodiments, human SL contains, is essentially, or consists of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) nucleic acid sequences identical to one or more of the following nucleotide sequences: ·ggctttctggctccttaccggaaagcc (Sequence ID 84), ·ggctttctgggaggttaccggaaagcc (Sequence No. 85) ·ggctttctggcctccttaccggaaagcc (SEQ ID NO: 86) ·ggctttctggggaggttaccggaaagcc (Sequence No. 87) ·ggctttctggctggctaccggaaagcc (Sequence ID 88), ·ggctttctggcttccccggaaagcc (Sequence ID 89), ·ggctttctggcttcttcccggaaagcc (SEQ ID NO: 90) ·ggctttctggcaacttaccggaaagcc (SEQ ID NO: 91) ·ggctttctggttcggtaccggaaagcc (SEQ ID NO: 92) ·ggctttctggaagccttaccggaaagcc (Sequence ID 93), ·ggctttctggcttcttaccggaaagcc (SEQ ID NO: 94), or ·GGCTTTCTGGCCTCCGCCGGAAAGCCCCT(Sequence ID 95).

[0095] In some embodiments, human SL includes the sequence described in sequence number 84. In some embodiments, human SL includes the sequence described in sequence number 85. In some embodiments, human SL includes the sequence described in sequence number 86. In some embodiments, human SL includes the sequence described in sequence number 87. In some embodiments, human SL includes the sequence described in sequence number 88. In some embodiments, human SL includes the sequence described in sequence number 89. In some embodiments, human SL includes the sequence described in sequence number 90. In some embodiments, human SL includes the sequence described in sequence number 91. In some embodiments, human SL includes the sequence described in sequence number 92. In some embodiments, human SL includes the sequence described in sequence number 93. In some embodiments, human SL includes the sequence described in sequence number 94. In some embodiments, human SL includes the sequence described in sequence number 95.

[0096] In some embodiments, mouse SL contains, is essentially, or consists of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) nucleic acid sequences identical to one or more of the following nucleotide sequences: ·ggctttctggctccttaccggaaagcccct(SEQ ID NO: 96) ·Ggttttctgacctccgtcggaaaacccct (SEQ ID NO: 97) ·ggttttctgacctccttcggtcggaaaacccct(SEQ ID NO: 98) ·Ggttttctgacctccgtcggaaaacc(SEQ ID NO: 99) ·GGTTTTCTGACACTCCGTCGGAAAACCCCT (Sequence ID 100), ·GGTTTTCTGATCTCCATCGGAAAACCCCT(Sequence ID 101), or · GGTTTTCCGACCTCCGTCGGAAAACCCCT (Sequence ID 102).

[0097] In some embodiments, mouse SL includes the sequence described in sequence number 96. In some embodiments, mouse SL includes the sequence described in sequence number 97. In some embodiments, mouse SL includes the sequence described in sequence number 98. In some embodiments, mouse SL includes the sequence described in sequence number 98. In some embodiments, mouse SL includes the sequence described in sequence number 100. In some embodiments, mouse SL includes the sequence described in sequence number 101. In some embodiments, mouse SL includes the sequence described in sequence number 102.

[0098] In some embodiments, human or mouse SL contains, is essentially, or consists of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) nucleic acid sequences identical to one or more of the following nucleotide sequences: ·GGCTTTCTGGCACTCCACCGGAAAGCCCCT (Sequence ID 103) ·GGCTTTCTGGCACTCCGCCGGAAAGCCCCT (Sequence ID 104), or ·GGCTTTCTGGCCTCCACCGGAAAGCCCCT(Sequence ID 105).

[0099] In some embodiments, the human or mouse SL includes the sequence described in SEQ ID NO: 103. In some embodiments, the human or mouse SL includes the sequence described in SEQ ID NO: 104. In some embodiments, the human or mouse SL includes the sequence described in SEQ ID NO: 105.

[0100] In some embodiments, dog or cat SL contains, essentially consists of, or comprises a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to the nucleotide sequence GGTTTTCCGGTCTCCACCGGAAAGCCCCC (SEQ ID NO: 106).

[0101] In some embodiments, cattle, sheep, or goat SL contains, essentially consists of, or comprises at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) nucleic acid sequences identical to one or more of the following nucleotide sequences: ·GGCTTTCCGGTCTCCACCGGAAAGCCCCT (Sequence ID 107), or ·GGCTTTCCGGCCTCCGCCGGAAAGCCCCT (Sequence code 108).

[0102] In some embodiments, the cattle, sheep, or goat SL includes the sequence described in Sequence ID No. 107. In some embodiments, the cattle, sheep, or goat SL includes the sequence described in Sequence ID No. 108.

[0103] In some embodiments, porcine SL contains, is essentially, or consists of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) nucleic acid sequences identical to one or more of the following nucleotide sequences: · GGTTTTCCGGTCTCCACCGGAAAACCCTT (Sequence ID 109), ·GGTTTTCCGTGCTCCCACGGAAAACCCTT (Sequence ID 110), ·GGTTTTCCGGCCTCCGCCGGAAAACCCTT(Sequence ID 111), ·GGTTTTCCGTGACTCCCACGGAAAACCCTT (Sequence ID 112), or ·GGTTTTCCGGCACTCCGCCGGAAAACCCTT(Sequence ID 113).

[0104] In some embodiments, porcine SL includes the sequence described in sequence number 109. In some embodiments, porcine SL includes the sequence described in sequence number 110. In some embodiments, porcine SL includes the sequence described in sequence number 111. In some embodiments, porcine SL includes the sequence described in sequence number 112. In some embodiments, porcine SL includes the sequence described in sequence number 113.

[0105] In some embodiments, horse SL contains, is essentially, or consists of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) nucleic acid sequences identical to one or more of the following nucleotide sequences: · GGTCTTCCGGTCTCCTCCGGAAGGCCCCC (Sequence ID 114), or ·GGTCTTCCGGCTCCCCGGAAGGCCCCC (Sequence No. 115).

[0106] In some embodiments, UmaSL includes the sequence described in SEQ ID NO: 114. In some embodiments, UmaSL includes the sequence described in SEQ ID NO: 115. In some embodiments, sheep SL contains, is essentially, or consists of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) nucleic acid sequences identical to one or more of the following nucleotide sequences: ·GGCTTTCCGTGCTCCCACGGAAAGCCCCT (Sequence ID 116), ·GGCTTTCCGTGACTCCCACGGAAAGCCCCT (Sequence ID 117), or ·GGCTTTCCGGCACTCCGCCGGAAAGCCCCT (Sequence ID 118).

[0107] In some embodiments, sheep SL includes the sequence described in sequence number 116. In some embodiments, sheep SL includes the sequence described in sequence number 117. In some embodiments, sheep SL includes the sequence described in sequence number 118.

[0108] In some embodiments, the stem-loop provides enhanced stability to the snRNA compared to the snRNA containing the native stem-loop. In some embodiments, the native snRNA stem-loop contains, is essentially, or consists of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) nucleic acid sequences identical to one or more of the following nucleotide sequences: ·Ggttttctgacttcggtcggaaaacccct(Sequence ID 119), ·ggttttctgacttcggtcggaaaacc (Sequence ID 120), ·Ggctttctggctttttaccggaaagcc (Sequence ID 121), ·ggctttctggctttttaccggaaagccCCT (Sequence ID 122), ·GGCTTTCCGGCCTCCGCCGGAAAGCCCCT (Sequence ID 123), or ·GGCTTTCCGGCCTCCGCCGGAAAGCC (Sequence code 124).

[0109] In some embodiments, the natural snRNA stem-loop includes the sequence described in SEQ ID NO: 119. In some embodiments, the natural snRNA stem-loop includes the sequence described in SEQ ID NO: 120. In some embodiments, the natural snRNA stem-loop includes the sequence described in SEQ ID NO: 121. In some embodiments, the natural snRNA stem-loop includes the sequence described in SEQ ID NO: 122.

[0110] 5' Interaction stability domain The SLs disclosed herein have more effective folding and annealing properties, possessing a 5' interaction stability domain (5'ISD), which results in increased stability of the esnRNA compared to unmanipulated snRNA. The 5'ISD has nucleotides complementary to the nucleotides in the SL, and although we do not wish to be bound by theory, the interaction between the 5'ISD and the SL is predicted to form a secondary structure that protects the 5' end of the snRNA. In some embodiments, the 5'ISD anneals and / or hybridizes with the SLs of this disclosure. In some embodiments, the 5'ISD is a sequence that is complementary and / or reverse complementary to the sequence present in the SLs of this disclosure. In some embodiments, the 5'ISD disclosed herein may include, or consist of, one of the following nucleotide sequences: ·ggagt, ·cctct, ·ggaggt, ·cctcct, ·agccag, ·ggaag, ·gaagaag, ·gttg, ·ccgaa, · taaggag, · gaag, and ·ggctt.

[0111] Sm-joint domain The snRNA systems disclosed herein utilize an Sm-binding domain (SmBD). The Sm protein rings that assemble around the Sm-binding domain (SmBD) to form snRNPs include SmB / B', SmD1, SmD2, SmD3, SmE, SmF, and SmG. The U7 Sm-binding site can be replaced with a non-U7 snRNA to recruit an endogenous RNA-binding factor and make the esnRNA more stable. In one embodiment, the SmBD is U1 SmBD, U2 SmBD, U4 SmBD, or SmBD. In another embodiment, the SmBD is derived from a pseudosnRNA. In yet another embodiment, the SmBD is a nucleotide sequence containing ATTTTT. In another embodiment, SmBD comprises the nucleotide sequence AATTTTTGG, AATTTGTGG, AATTTGTGG, AATTTCTGG, GATTTTTGG, AATTTTTGA, AATTTTTTG, AATTTTTGGAGCA (SEQ ID NO: 160), or AATTTTTGGAGTA (SEQ ID NO: 161).

[0112] Promoter array The gene therapies and RNA-targeted snRNA gene therapy compositions of this disclosure include promoter sequences derived from snRNA. A “promoter” is a regulatory sequence, which is a region of polynucleotide sequence on which the initiation and rate of transcription are controlled. It may include genetic elements to which regulatory proteins and molecules, such as RNA polymerase and other transcription factors, can bind.

[0113] The snRNA systems disclosed herein may include snRNA promoters derived from any of U1 to U12. In one embodiment, the snRNA promoter is the U7 promoter. In another embodiment, the U7 promoter is the human U7 promoter (hU7) or the mouse U7 promoter (mU7). In another embodiment, the U7 promoter is the endogenous human U7 promoter identical to Sequence ID No. 135:TACTGCCGAATCCAGGTCTCCGGGCTTAACAACAACGAAGGGGCTGTGACTGGCTGCTTTCTCAACCAATCAGCACCGAACTCATTTGCATGGGCTGAGAACAAATGTTCGCGAACTCTAGAAATGAATGACTTAAGTAAGTTCCTTAGAATATTATTTTTCCTACTGAAAGTTACCACATGCGTCGTTGTTTATACAGTAATAGGAACAAGAAAAAAGTCACCTAAGCTCACCCTCATCAATTGTGGAGTTCCTTTATATCCCATCTTCTCTCCAAACACATACGCA by at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) of the endogenous human U7 promoter.

[0114] In one embodiment, the snRNA promoter is the U1 promoter. In another embodiment, the U1 promoter is the human U1 promoter or the mouse U1 promoter. In another embodiment, the same snRNA promoter drives the expression of each copy of the snRNA insert. In yet another embodiment, each copy of the snRNA insert is identical. In yet another embodiment, different snRNA promoters drive each copy of the snRNA insert. In one embodiment, 2×snRNA includes a mouse U7 promoter that drives one copy of the snRNA insert, and a mouse U1 promoter that drives the other copy of the snRNA insert.

[0115] In other embodiments, the snRNA promoter is either a PolII promoter or a PolIII promoter. In other embodiments, the snRNA promoter contains, is essentially, or consists of nucleic acid sequences that are at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to the promoters and / or promoter sequences listed in Table 4 below.

[0116] [Table 4-1]

[0117] [Table 4-2]

[0118] [Table 4-3]

[0119] In some embodiments, the snRNA promoter includes the sequence described in SEQ ID NO: 125. In some embodiments, the snRNA promoter includes the sequence described in SEQ ID NO: 126. In some embodiments, the snRNA promoter includes the sequence described in SEQ ID NO: 127. In some embodiments, the snRNA promoter includes the sequence described in SEQ ID NO: 128. In some embodiments, the snRNA promoter includes the sequence described in SEQ ID NO: 129. In some embodiments, the snRNA promoter includes the sequence described in SEQ ID NO: 130. In some embodiments, the snRNA promoter includes the sequence described in SEQ ID NO: 131. In some embodiments, the snRNA promoter includes the sequence described in SEQ ID NO: 132. In some embodiments, the snRNA promoter includes the sequence described in SEQ ID NO: 133. In some embodiments, the snRNA promoter includes the sequence described in SEQ ID NO: 134. In some embodiments, the snRNA promoter includes the sequence described in SEQ ID NO: 135. In some embodiments, the snRNA promoter includes the sequence described in SEQ ID NO: 136. In some embodiments, the snRNA promoter includes the sequence described in SEQ ID NO: 137. In some embodiments, the snRNA promoter includes the sequence described in SEQ ID NO: 138. In some embodiments, the snRNA promoter includes the sequence described in SEQ ID NO: 139. In some embodiments, the snRNA promoter includes the sequence described in SEQ ID NO: 281. In some embodiments, the snRNA promoter includes the sequence described in SEQ ID NO: 282. In some embodiments, the snRNA promoter includes the sequence described in SEQ ID NO: 283. In some embodiments, the snRNA promoter includes the sequence described in SEQ ID NO: 284.

[0120] Terminator array The snRNA systems disclosed herein may include a downstream terminator (DT). The downstream terminator defines the end of a transcription unit such as esnRNA or snRNA. In another embodiment, the snRNA DT is a U7 DT containing the sequence CCTCTTATGATGTTTGTTGCCAATGATAGATTGTTTTCACTGTGCAAAAATTATGGGTAGTTTTGGTGGTCTTGATGCAGTTGTAAGCTTGGAG (SEQ ID NO: 147).

[0121] In one embodiment, the snRNA comprises an SL or eSL, one or more promoters, a TS, SmBD, 5'ISD, and DT targeting an SCN1A or SYNGAP1 RNA molecule. In another embodiment, the snRNA comprises a native stem-loop, one or more promoters, a TS, SmBD, and DT targeting an SCN1A or SYNGAP1 molecule. The promoter and DT sequences provided herein can be mixed and fitted in any combination.

[0122] In some embodiments, DT contains, is essentially, or consists of nucleic acid sequences that are at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to the DT sequences listed in Table 5 below.

[0123] [Table 5]

[0124] In some embodiments, DT includes the sequence described in SEQ ID NO: 140. In some embodiments, DT includes the sequence described in SEQ ID NO: 141. In some embodiments, DT includes the sequence described in SEQ ID NO: 142. In some embodiments, DT includes the sequence described in SEQ ID NO: 143. In some embodiments, DT includes the sequence described in SEQ ID NO: 144. In some embodiments, DT includes the sequence described in SEQ ID NO: 145. In some embodiments, DT includes the sequence described in SEQ ID NO: 146. In some embodiments, DT includes the sequence described in SEQ ID NO: 147. In some embodiments, DT includes the sequence described in SEQ ID NO: 148. In some embodiments, DT includes the sequence described in SEQ ID NO: 149. In some embodiments, DT includes the sequence described in SEQ ID NO: 150. In some embodiments, DT includes the sequence described in SEQ ID NO: 285. In some embodiments, DT includes the sequence described in SEQ ID NO: 286. In some embodiments, DT includes the sequence described in SEQ ID NO: 287. In some embodiments, DT includes the sequence described in SEQ ID NO: 288. In some embodiments, DT includes the sequence described in SEQ ID NO: TTTTTT.

[0125] In one embodiment, snRNA is delivered via an AAV vector. In some embodiments, the AAV vector contains multiple copies of snRNA. In some embodiments, the multiple copies of snRNA are 2, 3, 4, 5, 6, 7, 8, 9, or 10 copies of snRNA (2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x, or 10x). In some embodiments, the multiple copies of snRNA are four or more copies of snRNA.

[0126] In some embodiments, each of the multiple copies of the snRNA is separated by a nucleic acid buffer sequence derived from a human non-coding genome sequence downstream of the snRNA. In one embodiment, the buffer sequence is derived from a human genome sequence downstream of U7.

[0127] In one embodiment, the buffer sequence is one of the following nucleic acid sequences: Buffer 1 (30 bp): CAAACTACAGAGCCAAGTGCTATCCACAGA (Sequence ID 151), • Buffer 2 (30 bp): GAGCTTTCTGGGTTGCCATCTCAAGCAGAC (Sequence ID 152), Buffer 3 (30 bp): TACAAGGCCATCAGCTCATACTCACAATTG (SEQ ID NO: 153), or • A combination of those.

[0128] In another embodiment, the buffer sequence is one of the following nucleic acid sequences: Buffer 1 (100 bp): CAAACTACAGAGCCAAGTGCTATCCACAGAGAGCTTTCTGGGTTGCCATCTCAAGCAGACTACAAGGCCATCAGCTCATACTCACAATTGACTTTGAGAG (Sequence ID 154), · Buffer 2 (100bp): TTGACCACATACGTGCTCTTTCAAAGTTCTGTGTTTGAAGTTATGTTAGTAACAACTGATGCCCATCCTGCAATGACAAATCCAATTCTCAGTGCAGCTC (Sequence ID 155), or • A combination of those.

[0129] In another embodiment, the buffer sequence is one of the following nucleic acid sequences: · Buffer 1 (500bp): CAAACTACAGAGCCAAGTGCTATCCACAGAGAGCTTTCTGGGTTGCCATCTCAAGCAGACTACAAGGCCATCAGCCTCATACTCACAATTGACTTTGAGAGTCATTTTTCCAATGCTCCTACACACCCCTTCTTCTACAATCCCAAAATCTGAGGCTGGAACTTGGTACCATAACAATCATTACATTATTTCACCAGAAGTACACCTTGCCTGGGAAGATTGGCATTATAGCATCTTCTAACATTGTGAAAGTTAGTGACCAATGGAGATCCAAGTCAGTTCCAGTTGGATTTCTCTACTCTATAATAAATATATATGGTGTTCTTCAACAATAGGACTTTGCCATCCAGTGATGCTAAAAAATCAATAACAATGGCAATAACCTGCCTGTTTGGAAAGCCTCTGGCTTCCATGACTAACAATTCAAGGCAGGTCTCCTATACCTAGTACTGAGATTTTTTGTATAAACTATAATCTTCTGGGAGGAGAAGCATTTGT (sequence number 156), · Buffer 2 (500bp): TTGACCACATACGTGCTCTTTCAAAGTTCTGTGTTTGAAGTTATGTTAGTAACAACTGATGCCCATCCTGCAAATCCAATTCTCAGTGCAGCTCTCTGAAAATAGTTTTGCTTCTCTCTAGGTCTGTTCTATACTCCTAACTCTCCAGGAGTTTTACAAAGGAATAAAATCTCTTCTCCAAATTGCTTTCTTGCAACAACTGGACCATACTGAAAGCTGAGGCCCACAATTGCAATCTAGGGTTAGCAGG TAATCATTTGTGTGAGGTCCTCCCCTTCCCCAGGCTCGTTTTGTATTGGGGAGCAGGAAATTTTTGCTAGAGCAGCACTGCCATCTCTCACACTCCACCTGGTGTGGATGGAGAGAAATGGACATTCCCAACACAGCTCCTCTTTCACATCTGCTCACCTGCCACAGGATACTTTCCACCATGCATACTGGGCTCTGCACCAACCATTCAGCAGTGATGAAGGAAAACTTGAAC (sequence number 157), or · those combinations。

[0130] The 100bp and 500bp buffer 1 sequences are derived from a sequence starting 100bp downstream of the mouse U7 pseudogene 8 (location: chromosome 14: 4,409,359-4,409,421 reverse strand). (See GRCm39:CM001007.3). The 100bp and 500bp buffer 2 sequences are derived from a sequence starting 130bp downstream of the human U7 pseudogene 5 (chromosome X: 140,451,148-140,451,208 forward strand GRCh38:CM000685.2). (See CM000685.2). Both 100bp buffers are the first 100bp of the corresponding 500bp buffer (for example, "buffer 1 (100bp)" consists of the first 100bp of "buffer 1 (500bp)"). 30bp buffers 1, 2, and 3 are consecutive 30bp sequences within "100bp buffer 1" downstream of the mouse U7 pseudogene 8. These downstream sequences were selected due to the absence of repetitive sequences, a total buffer content of 40–60%, a 40–60% GC content in the 20bp regions at both ends of the buffer, and minimal sequence complexity, in addition to the absence of any known regulatory sites or genes within or near the sequence (using Gencode / Ensembl).

[0131] snRNA sequence The snRNA sequences disclosed herein may include any combination of the characteristics of esnRNA or snRNA described herein.

[0132] In some embodiments, the snRNA includes a targeting sequence that binds to the SCN1A RNA sequence and a SL. In some embodiments, the SCN1A targeting sequence includes a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to the nucleic acid sequence described in any one of SEQ ID NOs. 16-83. In some embodiments, the SL includes a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to the nucleic acid sequence described in any one of SEQ ID NOs. 84-124. In some embodiments, the SL includes or consists of the nucleic acid sequence described in SEQ ID NO. 97.

[0133] In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to the nucleic acid sequence described in any one of SEQ ID NOs. 16-83, and an SL that includes a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to the nucleic acid sequence described in any one of SEQ ID NOs. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing a nucleic acid sequence described in any one of SEQ ID NOs. 16-83, and the SL includes the nucleic acid sequence described in SEQ ID NO. 97.

[0134] In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 16, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 17, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 18, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 19, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 20, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 21, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 22, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 23, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 24, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 25, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 26, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 27, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97.In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 28, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 29, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 30, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 31, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 32, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 33, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 34, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 35, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 36, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 37, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 38, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 39, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97.In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 40, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 41, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 42, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 43, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 44, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 45, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 46, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 47, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 48, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 49, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 50, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 51, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97.In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 52, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 53, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 54, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 55, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 56, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 57, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 58, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 59, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 60, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 61, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 62, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 63, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97.In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 64, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 65, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 66, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 67, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 68, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 69, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 70, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 71, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 72, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 73, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 74, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 75, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97.In some embodiments, the snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 76, and the SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, the snRNA is a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 77. In some embodiments, snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 97, and SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 79, and SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 80, and SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 81, and SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 82, and SL includes the nucleic acid sequence described in SEQ ID NO: 97. In some embodiments, snRNA includes a targeting sequence that binds to an SCN1A RNA sequence containing the nucleic acid sequence described in SEQ ID NO: 83, and SL includes the nucleic acid sequence described in SEQ ID NO: 97.

[0135] In some embodiments, the SCN1A targeting sequence is located at 5' of the SL. Polynucleotides and vectors Polynucleotides and vectors (e.g., recombinant expression vectors) containing snRNAs targeting SCN1A or SYNGAP1 are also provided herein.

[0136] In some embodiments of the compositions and methods of the present disclosure, polynucleotides or vectors comprising an snRNA system targeting SCN1A or SYNGAP1 are provided herein. In some embodiments of the compositions and methods of the present disclosure, polynucleotides or vectors comprising an snRNA system targeting SCN1A are provided herein. In some embodiments of the compositions and methods of the present disclosure, polynucleotides or vectors comprising an snRNA system targeting SYNGAP1 are provided herein. In some embodiments, the vector is a single vector or one vector.

[0137] This specification provides polynucleotides or vectors comprising a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to the nucleic acid sequence described in any one of SEQ ID NOs: 162 to 180. In some embodiments, the polynucleotide or vector comprises the nucleic acid sequence described in SEQ ID NO: 162. In some embodiments, the polynucleotide or vector comprises the nucleic acid sequence described in SEQ ID NO: 163. In some embodiments, the polynucleotide or vector comprises the nucleic acid sequence described in SEQ ID NO: 164. In some embodiments, the polynucleotide or vector comprises the nucleic acid sequence described in SEQ ID NO: 165. In some embodiments, the polynucleotide or vector comprises the nucleic acid sequence described in SEQ ID NO: 166. In some embodiments, the polynucleotide or vector comprises the nucleic acid sequence described in SEQ ID NO: 167. In some embodiments, the polynucleotide or vector comprises the nucleic acid sequence described in SEQ ID NO: 168. In some embodiments, the polynucleotide or vector comprises the nucleic acid sequence described in SEQ ID NO: 169. In some embodiments, the polynucleotide or vector includes the nucleic acid sequence described in SEQ ID NO: 170. In some embodiments, the polynucleotide or vector includes the nucleic acid sequence described in SEQ ID NO: 171. In some embodiments, the polynucleotide or vector includes the nucleic acid sequence described in SEQ ID NO: 172. In some embodiments, the polynucleotide or vector includes the nucleic acid sequence described in SEQ ID NO: 173. In some embodiments, the polynucleotide or vector includes the nucleic acid sequence described in SEQ ID NO: 174. In some embodiments, the polynucleotide or vector includes the nucleic acid sequence described in SEQ ID NO: 175. In some embodiments, the polynucleotide or vector includes the nucleic acid sequence described in SEQ ID NO: 176. In some embodiments, the polynucleotide or vector includes the nucleic acid sequence described in SEQ ID NO: 177. In some embodiments, the polynucleotide or vector includes the nucleic acid sequence described in SEQ ID NO: 178. In some embodiments, the polynucleotide or vector includes the nucleic acid sequence described in SEQ ID NO: 179.In some embodiments, the polynucleotide or vector comprises the nucleic acid sequence described in SEQ ID NO: 180.

[0138] In some embodiments, the snRNA system can target one or more SCN1A RNA sequences. In some embodiments, the SCN1A RNA sequence is an SCN1A premRNA sequence. In some embodiments, the snRNA system can target one or more SYNGAP1 RNA sequences. In some embodiments, the SYNGAP1 RNA sequence is a SYNGAP1 premRNA sequence. In some embodiments, the snRNA system can target multiple (i.e., two or more) target RNAs. In some embodiments, the two or more target RNAs may be the same premRNA molecule but may be different sequences within the premRNA molecule.

[0139] One type of vector is a "plasmid," which refers to a circular double-stranded DNA loop into which DNA segments can be inserted in addition to the desired nucleotides by standard molecular cloning techniques, etc. Another type of vector is a viral vector, in which a viral-derived DNA or RNA sequence is present within the vector for packaging into a virus (e.g., retroviruses, replication-deficient retroviruses, adenoviruses, replication-deficient adenoviruses, and adeno-associated viruses). Viral vectors also contain polynucleotides held by the virus for transfection into host cells. In some embodiments, the vector is a lentivirus (e.g., integration-deficient lentivirus vector) or an adeno-associated virus (AAV) vector. Vectors, such as bacterial vectors with bacterial origins of replication and episomatic mammalian vectors, may be capable of self-replication in the host cell into which they are introduced, while other vectors, such as non-episomatic mammalian vectors, are integrated into the host cell's genome upon introduction into the host cell and thereby replicate together with the host genome.

[0140] In some embodiments, vectors, such as expression vectors, can direct the expression of the genes they contain. Common expression vectors are often in the form of plasmids. In some embodiments, recombinant expression vectors contain nucleic acids provided herein, such as esnRNA in a form suitable for RNA expression in host cells. Recombinant expression vectors may contain one or more regulatory elements operably ligated to the nucleic acid sequence to be expressed, which may be selected based on the host cell used for expression. In recombinant expression vectors, "operably ligated" is intended to mean, for example, in an in vitro transcription / translation system, or in the host cell if the vector is introduced into a host cell, that the nucleotide sequence of interest is ligated to the regulatory element in a manner that enables the expression of the nucleotide sequence. In some embodiments, the regulatory element is a promoter as described herein. In some embodiments, the regulatory element is a terminator as provided herein.

[0141] The specific embodiment of the vector depends on factors such as the selection of the host cell to be transformed and the desired expression level. The vector can be introduced into host cells to produce transcripts, proteins, or peptides containing fusion proteins or peptides encoded by the nucleic acids described herein, such as snRNA, CRISPR transcripts, proteins, enzymes, their variant forms, their fusion proteins, etc.

[0142] In some embodiments of the compositions and methods of this disclosure, the expression vectors, viral vectors, or nonviral vectors provided herein include, but are not limited to, expression regulatory elements. As used herein, “expression regulatory elements” refers to any sequence that regulates the expression of a coding sequence, such as a gene. Exemplary expression regulatory elements include, but are not limited to, promoters, enhancers, microRNAs, post-transcriptional regulatory elements, polyadenylated signal sequences, and introns. Expression regulatory elements may be, for example, constitutive, inducible, repressive, or tissue-specific. A “promoter” is a regulatory sequence that is a region of polynucleotide sequence on which the initiation and rate of transcription are controlled. It may include genetic elements to which regulatory proteins and molecules, such as RNA polymerase and other transcription factors, can be bound. An “enhancer” is a region of DNA that can be bound by an activating protein to increase the likelihood or frequency of transcription.

[0143] In some embodiments of the compositions and methods of this disclosure, the expression vector, viral vector, or nonviral vector provided herein includes, but is not limited to, vector elements such as buffer sequences derived from downstream human genome sequences of snRNAs, and thus has the ability to encode multiple snRNAs from a single construct.

[0144] In some embodiments, the snRNA constructs disclosed herein include a bidirectional snRNA promoter for expressing the snRNA. In another embodiment, the vector configuration may include a linker, a signal sequence, and / or tags.

[0145] Viral vector In some embodiments, the vector is a viral vector. In some embodiments, the vector is an adenovirus vector, an adeno-associated virus (AAV) vector, or a lentivirus vector. In some embodiments, the vector is a retrovirus vector, an adenovirus / retrovirus chimeric vector, a herpes simplex virus I or II vector, a parvovirus vector, a reticuloendotheliosis virus vector, a poliovirus vector, a papillomavirus vector, a vaccinia virus vector, or any hybrid or chimeric vector incorporating preferred embodiments of two or more viral vectors.

[0146] In some embodiments, the vector further comprises one or more expression control elements operably linked to a polynucleotide. In some embodiments, the vector further comprises one or more selectable markers. In some embodiments, the AAV vector has low toxicity. In some embodiments, the AAV vector is not integrated into the host genome and is therefore unlikely to induce insertional mutagenesis. In some embodiments, the AAV vector can encode a total polynucleotide range of 4.5kb to 4.75kb. In some embodiments, exemplary AAV vectors that may be used in any of the compositions, systems, methods, and kits described herein include AAV1 vector, modified AAV1 vector, AAV2 vector, modified AAV2 vector, AAV2-Tyr variant vector, AAV3 vector, modified AAV3 vector, AAV4 vector, modified AAV4 vector, AAV5 vector, modified AAV5 vector, AAV6 vector, modified AAV6 vector, AAV7 vector, modified AAV7 vector, AAV8 vector, AAV The lentiviral vectors may include rh8 vectors, AAV9 vectors, AAV.rh10 vectors, modified AAV.rh10 vectors, AAVrh.74, AAV.rh32 / 33 vectors, modified AAV.rh32 / 33 vectors, AAV.rh43 vectors, modified AAV.rh43 vectors, AAV.rh64R1 vectors, and modified AAV.rh64R1 vectors, AAV-Tyr mutant vectors, AAV-Tyr-Ser mutant vectors, AAV-Tyr-Ser-Thr mutant vectors, and any combination or equivalent thereof. In some embodiments, the lentiviral vector is an integrase-competent lentiviral vector (ICLV). In some embodiments, the lentiviral vector may refer to a transgene plasmid vector, and a transgene plasmid vector combined with an associated plasmid (e.g., a packaging plasmid, a rev expression plasmid, an envelope plasmid), as well as lentivirus-based particles that can introduce exogenous nucleic acids into cells via a virus or virus-like entry mechanism.

[0147] In some embodiments, the viral vector includes a sequence isolated or derived from a retrovirus. In some embodiments, the viral vector includes a sequence isolated or derived from a lentivirus. In some embodiments, the viral vector includes a sequence isolated or derived from an adenovirus. In some embodiments, the viral vector includes a sequence isolated or derived from an adeno-associated virus (AAV). In some embodiments, the viral vector is non-replicable. In some embodiments, the viral vector is isolated or recombinant. In some embodiments, the viral vector is self-complementary.

[0148] In some embodiments, the vector further comprises one or more expression regulatory elements operably linked to a polynucleotide. In some embodiments, the vector further comprises one or more selectable markers. In some embodiments, the vector has low toxicity. In some embodiments, the vector is not integrated into the host genome and is therefore less likely to induce insertional mutagenesis.

[0149] lentiviral vectors Lentiviral vectors are well known in the art (see, for example, Trono D. (2002) Lentiviral vectors, New York: Spring-Verlag Berlin Heidelberg and Durand et al. (2011) Viruses 3(2):132-159 doi:10.3390 / v3020132). In some embodiments, exemplary lentiviral vectors that may be used in any of the compositions, systems, methods, and kits described herein include human immunodeficiency virus (HIV) 1 vector, modified human immunodeficiency virus (HIV) 1 vector, human immunodeficiency virus (HIV) 2 vector, modified human immunodeficiency virus (HIV) 2 vector, and simian immunodeficiency virus (SIV) derived from Sutie Mangabey. SM ) Vector, modified Sutie Mangabei-derived simian immunodeficiency virus (SIV) SM) Vector, African green monkey-derived immunodeficiency virus (SIV) AGM ) Vector, modified African green monkey-derived immunodeficiency virus (SIV) AGM This may include vectors such as equine infectious anemia virus (EIAV), modified equine infectious anemia virus (EIAV), feline immunodeficiency virus (FIV), modified feline immunodeficiency virus (FIV), visna / maedi virus (VNV / VMV), modified visna / maedi virus (VNV / VMV), capine arthritis / encephalitis virus (CAEV), modified capine arthritis / encephalitis virus (CAEV), bovine immunodeficiency virus (BIV), or modified bovine immunodeficiency virus (BIV).

[0150] Adeno-associated virus vector In some aspects, the vectors described herein are AAV virus vectors. The terms “adeno-associated virus” or “AAV” as used herein refer to members of a class of viruses belonging to the genus Depend Parvovirus and the family Parvoviridae, as associated with this name. Adeno-associated viruses are single-stranded DNA viruses that replicate in cells where co-infection with helper viruses provides a specific function. General information and reviews of AAV can be found, for example, in Carter, 1989, Handbook of Parvoviruses, Vol. 1, pp. 169–228, and Berns, 1990, Virology, pp. 1743–1764, Raven Press, (New York). Since it is well known that various serotypes are very closely related structurally, functionally, and even at the genetic level, it is quite foreseeable that the same principles described in these reviews may be applicable to additional AAV serotypes characterized after the publication date of the reviews. (See, for example, Blacklowe, 1988, pp. 165-174 of Parvoviruses and Human Disease, JR Pattison, ed.; and Rose, Comprehensive Virology 3:1-61 (1974)). For example, all AAV serotypes are thought to exhibit very similar replication characteristics mediated by homologous rep genes, and all possess three related capsid proteins, such as those expressed in AAV2. The degree of relevance is further suggested by heteroduplex analysis revealing extensive cross-hybridization between serotypes along genome length, and by the presence of similar self-annealing segments at the terminals corresponding to “reverse terminal repeats” (ITRs). Similar infectivity patterns also suggest that replication function in each serotype is under similar regulatory control. Multiple serotypes of this virus are known to be suitable for gene delivery, and all known serotypes can infect cells from various tissue types.

[0151] AAV possesses unique and attractive properties as a vector for delivering foreign DNA to cells, such as in gene therapy. AAV infection of cells in culture is non-cellular, and natural infection in humans and other animals is silent and asymptomatic. Furthermore, AAV infects many mammalian cells, enabling the potential to target many different tissues in vivo. Additionally, AAV can transduce slowly dividing and non-dividing cells and essentially persist as a transcriptionally active nuclear episome (extrachromosomal element) for the lifespan of those cells. The AAV proviral genome is inserted into plasmids as cloned DNA, allowing for the construction of recombinant genomes. Moreover, since the signals directing AAV replication and genomic capsid formation are contained within the ITR of the AAV genome, an AAV vector can be generated by replacing part or all of the approximately 4.3kb inside the genome (encoding the replication and structural capsid proteins, rep-cap) with foreign DNA. The rep and cap proteins can be supplied trans. Another important characteristic of AAV is that it is a highly stable and potent virus. Because AAV can easily withstand the conditions used to inactivate adenoviruses (56-65°C for several hours), refrigeration of AAV is not very important. AAV can also be freeze-dried. Finally, AAV-infected cells are not resistant to co-infection.

[0152] The recombinant AAV (rAAV) genome of the present invention may, essentially consist of, or be composed of, at least one nucleic acid molecule encoding an esnRNA and one or more AAV ITRs adjacent to the nucleic acid molecule. The production of pseudotype rAAV is disclosed, for example, in WO2001083692. Other types of rAAV variants, e.g., rAAV with capsid mutations, are also intended. See, for example, Marsic et al., Molecular Therapy, 22(11):1900-1909 (2014). Nucleotide sequences of genomes of various AAV serotypes are known in the art.

[0153] The AAV vectors described herein may comprise, be essentially comprised of, or be comprised of, one or more nucleic acid molecules and one or more AAV ITRs. In some embodiments, the nucleic acid molecules encode the esnRNA of the Disclosure. Such AAV vectors may be replicated and packaged into infectious viral particles, for example, by transfection of a host cell, if present in a host cell providing functionality for rep and cap gene products. In some embodiments, the AAV vector comprises a promoter, at least one nucleic acid capable of encoding at least one protein or RNA, and / or enhancers and / or terminators in adjacent ITRs that are packaged into infectious AAV particles. The capsid-formed nucleic acid portion may be referred to as the AAV vector genome. Plasmids containing the AAV vector may also contain elements for production purposes, such as antibiotic resistance genes, origin sequences, etc., which are not capsid-formed and therefore do not form part of the AAV particle.

[0154] In some embodiments, the AAV vector may comprise at least one nucleic acid encoding the esnRNA of the Disclosure. In some embodiments, the AAV vector may comprise at least one regulatory sequence. In some embodiments, the AAV vector may comprise at least one AAV reverse end (ITR) sequence. In some embodiments, the AAV vector may comprise a first ITR sequence and a second ITR sequence. In some embodiments, the AAV vector may comprise at least one promoter sequence. In some embodiments, the AAV vector may comprise at least one enhancer sequence. In some embodiments, the AAV vector may comprise at least one terminator sequence. In some embodiments, the AAV vector may comprise at least one poly(A) sequence. In some embodiments, the AAV vector may comprise at least one linker sequence. In some embodiments, the AAV vector may comprise at least one buffer sequence. In some embodiments, the AAV vector of the Disclosure may comprise at least one nuclear localization signal, or a nuclear export signal, and / or both. In some embodiments, the AAV vector may comprise a first AAV ITR sequence, a promoter sequence, an snRNA sequence and / or an esnRNA sequence, a terminator sequence, and a second AAV ITR sequence. In some embodiments, the AAV vector may comprise, in the 5' to 3' direction, a first AAV ITR sequence, a promoter sequence, an esnRNA sequence, a terminator sequence, and a second AAV ITR sequence. In some embodiments, the AAV vector may comprise, in the 5' to 3' direction, a first AAV ITR sequence, a promoter sequence, an snRNA sequence, a terminator sequence, and a second AAV ITR sequence.

[0155] In some embodiments, the AAV vector may include a first AAV ITR sequence, a first promoter sequence, a first snRNA sequence, a terminator sequence, a second promoter sequence, a second snRNA sequence, a second terminator sequence, and a second AAV ITR sequence. In some embodiments, the AAV vector may include a first AAV ITR sequence, a first promoter sequence, a first snRNA sequence, a terminator sequence, a second promoter sequence, a second snRNA sequence, a second terminator sequence, a third promoter sequence, a third snRNA sequence, a third terminator sequence, and a second AAV ITR sequence. In some embodiments, the AAV vector may include a first AAV ITR sequence, a first promoter sequence, a first snRNA sequence, termination, a second promoter sequence, a second snRNA sequence, a second terminator sequence, a third promoter sequence, a third snRNA sequence, a third terminator sequence, a fourth promoter sequence, a fourth snRNA sequence, a fourth terminator sequence, and a second AAV ITR sequence.

[0156] In some embodiments of the compositions and methods of this disclosure, the viral vector comprises a sequence isolated or derived from adeno-associated virus (AAV). In some embodiments, the viral vector comprises an ITR sequence or capsid sequence isolated or derived from an AAV of serotype AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrh10, AAV11, or AAV12. In some embodiments, the AAV serotype is AAVrh.74. In one embodiment, the AAV vector comprises a modified capsid. In one embodiment, the AAV vector is an AAV2-Tyr variant vector. In one embodiment, the AAV vector comprises a capsid having a non-tyrosine amino acid at a position corresponding to the surface-exposed tyrosine residue at positions Tyr252, Tyr272, Tyr275, Tyr281, Tyr508, Tyr612, Tyr704, Tyr720, Tyr730, or Tyr673 of wild-type AAV2. See also WO 2008 / 124724, which is incorporated herein in its entirety. In some embodiments, the AAV vector comprises an engineered capsid. AAV vectors comprising an engineered capsid include, but are not limited to, AAV2.7m8, AAV9.7m8, AAV2 2tYF, and AAV8 Y733F. In some embodiments, the capsid is a ubiquitination-resistant capsid. In another embodiment, the ubiquitinated capsid is an AAV2 capsid containing tyrosine (Y) and serine (S) mutations. In another embodiment, the AAV2 capsid includes Y, S, and threonine (T) mutations. In another embodiment, the AAV2 capsid includes, but is not limited to, AAV2 capsid variants such as T455V, T491V, T550V, T659V, Y444+500+730F, and Y444+500+730F+T491V. In some embodiments, the viral vector is non-replicable. In some embodiments, the viral vector is isolated or recombinant (rAAV). In some embodiments, the viral vector is self-complementary (scAAV). In some embodiments, the viral vector is single-stranded (ssAAV).

[0157] In some embodiments, the snRNAs provided herein are contained within single-stranded AAVs (ssAAVs). In some embodiments, the snRNAs provided herein are contained within self-complementary AAVs (scAAVs). The single-stranded nature of parvovirus genomes necessitates the use of cellular mechanisms to provide complementary strands for gene expression. This cellular recruitment activity is considered the rate-limiting factor in the efficiency of transduction and gene expression in parvoviruses and parvovirus particles. The use of scAAV versus ssAAV solves this well-known problem by packaging both strands as a single double-stranded DNA molecule (or reverse repeat genome) that can be folded into dsDNA as a result of the self-complementary viral genome sequence. In this regard, the need for DNA synthesis or base pairing between multiple viral genomes is eliminated.

[0158] AAV ITR array In some embodiments of the compositions and methods of the present disclosure, the AAV reverse-terminal repeat sequence may include any AAV ITR sequence known in the art. In some embodiments, the AAV ITR sequence may include or consist of the AAV1 ITR sequence, AAV2 ITR sequence, AAV3 ITR sequence, AAV4 ITR sequence, AAV5 ITR sequence, AAV6 ITR sequence, AAV7 ITR sequence, AAV8 ITR sequence, AAV9 ITR sequence, AAV10 ITR sequence, AAVrh10 ITR sequence, AAV11 ITR sequence, AAV12 ITR sequence, AAV13 ITR sequence, or AAVrh74 ITR sequence.

[0159] In some embodiments, the ITR sequence may include a modified AAV ITR sequence. In some embodiments, an AAV ITR sequence may, essentially be, or may be identical to, a nucleic acid sequence of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) of sequence number 158 or sequence number 159.

[0160] In some embodiments, the AAV vectors provided herein include first and second AAV ITR sequences. In some embodiments, the first AAV ITR sequence may, essentially be, or may be, a nucleic acid sequence identical to at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) of SEQ ID NO: 158 or SEQ ID NO: 159, and the second AAV ITR sequence may, essentially be, or may be, a nucleic acid sequence identical to at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) of SEQ ID NO: 158 or SEQ ID NO: 159. In some embodiments, the first AAV ITR sequence is located at 5' of the AAV vector. In some embodiments, the second AAV ITR sequence is located at 3' of the AAV vector.

[0161] In some embodiments, the first AAV ITR sequence includes the sequence described in SEQ ID NO: 158 or SEQ ID NO: 159. In some embodiments, the second AAV ITR sequence includes the sequence described in SEQ ID NO: 158 or SEQ ID NO: 159. In some embodiments, the AAV vector provided herein includes a first AAV ITR sequence containing the sequence described in SEQ ID NO: 158 and a second AAV ITR sequence containing the sequence described in SEQ ID NO: 59. In some embodiments, the first AAV ITR sequence is located at 5' of the AAV vector. In some embodiments, the second AAV ITR sequence is located at 3' of the AAV vector.

[0162] In some embodiments of the compositions and methods of this disclosure, the viral vector comprises a sequence isolated or derived from adeno-associated virus (AAV). In some embodiments of the compositions and methods of the Disclosure, the vectors of the Disclosure are nonviral vectors. In some embodiments, the vectors comprise or consist of nanoparticles, micelles, liposomes or lipoplexes, polymerosomes, polyplexes or dendrimers. In some embodiments, the vectors are expression vectors or recombinant expression systems. As used herein, the term “recombinant expression system” refers to a gene construct for the expression of a particular genetic material formed by recombinant.

[0163] snRNA vector construct A vector construct targeting SCN1A, containing the snRNA construct described herein, is also provided herein. A vector construct targeting SYNGAP1, containing the snRNA construct described herein, is also provided herein.

[0164] An exemplary AAV vector of this disclosure that targets exon 20N of SCN1A is A05290. The elements of A05290 are listed in Table 6. In some embodiments, the nucleic acid sequence encoding the AAV vector A05290 includes SEQ ID NO: 162.

[0165] [Table 6]

[0166]

[0167] Another exemplary AAV vector of this disclosure that targets exon 20N of SCN1A is A05291. The elements of A05291 are listed in Table 7. In some embodiments, the nucleic acid sequence encoding the AAV vector A05291 includes SEQ ID NO: 163.

[0168] [Table 7]

[0169]

[0170] Another exemplary AAV vector of this disclosure that targets exon 20N of SCN1A is A05378. The elements of A05378 are listed in Table 8. In some embodiments, the nucleic acid sequence encoding the AAV vector A05378 includes SEQ ID NO: 164.

[0171] [Table 8]

[0172]

[0173] Another exemplary AAV vector of this disclosure that targets exon 20N of SCN1A is A05379. The elements of A05379 are listed in Table 9. In some embodiments, the nucleic acid sequence encoding the AAV vector A05379 includes SEQ ID NO: 165.

[0174] [Table 9]

[0175]

[0176] Another exemplary AAV vector of this disclosure that targets exon 20N of SCN1A is A05380. The elements of A05380 are listed in Table 10. In some embodiments, the nucleic acid sequence encoding the AAV vector A05380 includes SEQ ID NO: 166.

[0177] [Table 10]

[0178]

[0179] Another exemplary AAV vector of this disclosure that targets exon 20N of SCN1A is A05381. The elements of A05381 are listed in Table 11. In some embodiments, the nucleic acid sequence encoding the AAV vector A05381 includes SEQ ID NO: 167.

[0180] [Table 11]

[0181]

[0182] Another exemplary AAV vector of this disclosure that targets exon 20N of SCN1A is A05382. The elements of A05382 are listed in Table 12. In some embodiments, the nucleic acid sequence encoding the AAV vector A05382 includes SEQ ID NO: 168.

[0183] [Table 12]

[0184] Another exemplary AAV vector of this disclosure that targets exon 20N of SCN1A is A05383. The elements of A05383 are listed in Table 13. In some embodiments, the nucleic acid sequence encoding the AAV vector A05383 includes SEQ ID NO: 169.

[0185] [Table 13]

[0186]

[0187] Another exemplary AAV vector of this disclosure that targets exon 20N of SCN1A is A05384. The elements of A05384 are listed in Table 14. In some embodiments, the nucleic acid sequence encoding the AAV vector A05384 includes SEQ ID NO: 170.

[0188] [Table 14]

[0189]

[0190] Another exemplary AAV vector of this disclosure that targets exon 20N of SCN1A is A05865. The elements of A05865 are listed in Table 15. In some embodiments, the nucleic acid sequence encoding the AAV vector A05865 includes SEQ ID NO: 171.

[0191] [Table 15]

[0192]

[0193] Another exemplary AAV vector of this disclosure that targets exon 20N of SCN1A is A05866. The elements of A05866 are listed in Table 16. In some embodiments, the nucleic acid sequence encoding the AAV vector A05866 includes SEQ ID NO: 172.

[0194] [Table 16]

[0195]

[0196] Another exemplary AAV vector of this disclosure that targets exon 20N of SCN1A is A05867. The elements of A05867 are listed in Table 17. In some embodiments, the nucleic acid sequence encoding the AAV vector A05867 includes SEQ ID NO: 173.

[0197] [Table 17]

[0198]

[0199] Another exemplary AAV vector of this disclosure that targets exon 20N of SCN1A is A05868. The elements of A05868 are listed in Table 18. In some embodiments, the nucleic acid sequence encoding the AAV vector A05868 includes SEQ ID NO: 174.

[0200] [Table 18]

[0201]

[0202] Another exemplary AAV vector of this disclosure that targets exon 20N of SCN1A is A06047. The elements of A06047 are listed in Table 19. In some embodiments, the nucleic acid sequence encoding the AAV vector A06047 includes SEQ ID NO: 175.

[0203] [Table 19]

[0204]

[0205] Another exemplary AAV vector of this disclosure that targets exon 20N of SCN1A is A06048. The elements of A06048 are listed in Table 20. In some embodiments, the nucleic acid sequence encoding the AAV vector A06048 includes SEQ ID NO: 176.

[0206] [Table 20]

[0207]

[0208] Another exemplary AAV vector of this disclosure that targets exon 20N of SCN1A is A05869. The elements of A05869 are listed in Table 21. In some embodiments, the nucleic acid sequence encoding the AAV vector A05869 includes SEQ ID NO: 177.

[0209] [Table 21]

[0210]

[0211] Another exemplary AAV vector of the present disclosure targeting exon 20N of SCN1A is A05870. The elements of A05870 are set forth in Table 22. In some embodiments, the nucleic acid sequence encoding AAV vector A05870 comprises SEQ ID NO: 178.

[0212] [Table 22]

[0213]

[0214] Another exemplary AAV vector of this disclosure that targets exon 20N of SCN1A is A06049. The elements of A06049 are listed in Table 23. In some embodiments, the nucleic acid sequence encoding the AAV vector A06049 includes SEQ ID NO: 179.

[0215] [Table 23]

[0216]

[0217] Another exemplary AAV vector of this disclosure that targets exon 20N of SCN1A is A06050. The elements of A06050 are listed in Table 24. In some embodiments, the nucleic acid sequence encoding the AAV vector A06050 includes SEQ ID NO: 180.

[0218] [Table 24]

[0219]

[0220] This specification provides SCN1A-targeting vector constructs that include a nucleic acid sequence identical to any one of SEQ ID NOs: 162-180 by at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between). In some embodiments, the SCN1A-targeting vector construct includes the nucleic acid sequence described in SEQ ID NO: 162. In some embodiments, the SCN1A-targeting vector construct includes the nucleic acid sequence described in SEQ ID NO: 163. In some embodiments, the SCN1A-targeting vector construct includes the nucleic acid sequence described in SEQ ID NO: 164. In some embodiments, the SCN1A-targeting vector construct includes the nucleic acid sequence described in SEQ ID NO: 165. In some embodiments, the SCN1A-targeting vector construct includes the nucleic acid sequence described in SEQ ID NO: 166. In some embodiments, the SCN1A-targeting vector construct includes the nucleic acid sequence described in SEQ ID NO: 167. In some embodiments, the SCN1A-targeting vector construct includes the nucleic acid sequence described in SEQ ID NO: 168. In some embodiments, the SCN1A-targeting vector construct includes the nucleic acid sequence described in SEQ ID NO: 169. In some embodiments, the SCN1A-targeting vector construct includes the nucleic acid sequence described in SEQ ID NO: 170. In some embodiments, the SCN1A-targeting vector construct includes the nucleic acid sequence described in SEQ ID NO: 171. In some embodiments, the SCN1A-targeting vector construct includes the nucleic acid sequence described in SEQ ID NO: 172. In some embodiments, the SCN1A-targeting vector construct includes the nucleic acid sequence described in SEQ ID NO: 173. In some embodiments, the SCN1A-targeting vector construct includes the nucleic acid sequence described in SEQ ID NO: 174. In some embodiments, the SCN1A-targeting vector construct includes the nucleic acid sequence described in SEQ ID NO: 175. In some embodiments, the SCN1A-targeting vector construct includes the nucleic acid sequence described in SEQ ID NO: 176. In some embodiments, the SCN1A-targeting vector construct includes the nucleic acid sequence described in SEQ ID NO: 177.In some embodiments, the SCN1A-targeting vector construct includes the nucleic acid sequence described in SEQ ID NO: 178. In some embodiments, the SCN1A-targeting vector construct includes the nucleic acid sequence described in SEQ ID NO: 179. In some embodiments, the SCN1A-targeting vector construct includes the nucleic acid sequence described in SEQ ID NO: 180.

[0221] nucleic acid The NOI (Nucleotide of Interest) includes, but is not limited to, any nucleotide sequence or transgene that can be delivered by a vector. The NOI may be synthetic, derived from naturally occurring DNA or RNA, codon-optimized, recombinant RNA / DNA, cDNA, partial genomic DNA, and / or combinations thereof. The NOI may be a coding region or a partial coding region, but does not have to be a coding region. The NOI may be RNA / DNA in sense or antisense direction. The NOI may be snRNA. The NOI is also referred to herein as a transgene, heterologous sequence, gene, or therapeutic gene, but is not limited to these terms. The NOI may also encode RNA (ribonucleoprotein complex), POI (Protein of Interest), partial POI, a variant version or variant of POI. The POI may be similar to or corresponding to a wild-type protein. The POI may also be a fusion protein or ribonucleoprotein complex, e.g., snRNP. In some embodiments, the RNA sequences disclosed herein may be represented as DNA sequences, and deriving RNA sequences from DNA sequences is within the capabilities of those skilled in the art. For example, the spacer sequences of this disclosure may represent the uracil base as either U or T. Those skilled in the art will readily understand that the RNA sequence may use T or U interchangeably to represent uracil.

[0222] Codon optimization In some embodiments, the NOI or transgene, such as the nucleic acid sequence of this disclosure, is a codon-optimized nucleic acid sequence.

[0223] Codon optimization is a well-known technique in the art. Codon optimization refers to the fact that different cells use certain codons with different frequencies. This codon bias corresponds to a bias in the relative abundance of a particular tRNA in a given cell type. It is possible to increase expression by modifying codons in a sequence to match the relative abundance of the corresponding tRNA. It is also possible to decrease expression by intentionally selecting codons for which the corresponding tRNA is known to be rare in a particular cell type. Codon frequency tables are known in the art for mammalian cells and for various other organisms. Based on the genetic code, nucleic acid sequences can be generated. In some embodiments, such sequences are optimized for expression in host or target cells, e.g., host cells used to express snRNA or cells in which the disclosed method is carried out (e.g., mammalian cells, e.g., human cells). Using codon preferences and codon frequency tables for a particular species, isolated nucleic acid molecules encoding snRNAs that take advantage of the codon preferences of that particular species can be manipulated. In some embodiments, an isolated nucleic acid molecule (which may be part of a vector) comprises at least one codon-optimized coding sequence for expression in eukaryotic cells, or at least one codon-optimized coding sequence for expression in human cells. In one embodiment, such a codon-optimized coding sequence has at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with its corresponding wild-type or origin sequence. In another embodiment, a codon-optimized nucleic acid sequence in eukaryotic cells encodes an snRNA having at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with its corresponding wild-type or origin sequence. In yet another embodiment, various clones containing functionally equivalent nucleic acids, e.g., nucleic acids with different sequences but encoding the same sequence, can be conventionally generated.Silent mutations in coding sequences arise from the degeneracy (i.e., redundancy) of the genetic code, where one or more codons can encode the same amino acid residue. For example, leucine may be encoded by CTT, CTC, CTA, CTG, TTA, or TTG; serine by TCT, TCC, TCA, TCG, AGT, or AGC; asparagine by AAT or AAC; aspartic acid by GAT or GAC; cysteine ​​by TGT or TGC; alanine by GCT, GCC, GCA, or GCG; glutamine by CAA or CAG; tyrosine by TAT or TAC; and isoleucine by ATT, ATC, or ATA. Tables showing the standard genetic code can be found in various sources (see, for example, Stryer, 1988, Biochemistry, 3rd edition, WH5, Freeman and Co., NY).

[0224] In some embodiments, codon-optimized sequences exhibit at least 5%, at least 10%, at least 20%, at least 30%, at least 50%, at least 75%, at least 100%, at least 200%, at least 300%, at least 500%, or at least 1000% increased transcription or translation in human subjects compared to wild-type or non-codon-optimized nucleic acid sequences.

[0225] In some embodiments, codon-optimized nucleic acid sequences exhibit increased stability. In some embodiments, codon-optimized nucleic acid sequences exhibit increased stability through increased resistance to hydrolysis. In some embodiments, codon-optimized sequences exhibit increased stability of at least 5%, at least 10%, at least 20%, at least 30%, at least 50%, at least 75%, at least 100%, at least 200%, at least 300%, at least 500%, or at least 1000% compared to wild-type or non-codon-optimized nucleic acid sequences. In some embodiments, codon-optimized sequences exhibit increased resistance to hydrolysis of at least 5%, at least 10%, at least 20%, at least 30%, at least 50%, at least 75%, at least 100%, at least 200%, at least 300%, at least 500%, or at least 1000% in human subjects compared to wild-type or non-codon-optimized nucleic acid sequences.

[0226] In some embodiments, the codon-optimized nucleic acid sequence may not contain donor splice sites. In some embodiments, the codon-optimized nucleic acid sequence may contain about 1, or about 2, or about 3, or about 4, or about 5, or about 6, or about 7, or about 8, or about 9, or about 10 or fewer donor splice sites. In some embodiments, the codon-optimized nucleic acid sequence contains at least 1, or at least 2, or at least 3, or at least 4, or at least 5, or at least 6, or at least 7, or at least 8, or at least 9, or at least 10 fewer donor splice sites compared to a non-codon-optimized nucleic acid sequence.

[0227] While not wishing to be bound by theory, removal of donor splice sites in codon-optimized nucleic acid sequences can unexpectedly and unpredictably increase the expression of the target protein in vivo, as potential splicing is prevented. Furthermore, potential splicing may vary between different subjects, which means that the expression level of a protein comprising a donor splice site may vary unpredictably between different subjects. Such unpredictability is not acceptable in the context of human therapy. Accordingly, codon-optimized nucleic acid sequences lacking donor splice sites unexpectedly and surprisingly enable increased protein expression in human subjects and regularize protein expression across different human subjects.

[0228] In some embodiments, the codon-optimized nucleic acid sequence may have a GC content different from that of a non-codon-optimized nucleic acid sequence. In some embodiments, the GC content of the codon-optimized nucleic acid sequence is more uniformly distributed throughout the entire nucleic acid sequence as compared to a non-codon-optimized nucleic acid sequence.

[0229] While not wishing to be bound by theory, by distributing the GC content more uniformly throughout the entire nucleic acid sequence, the codon-optimized nucleic acid sequence exhibits a more uniform melting temperature ("Tm") over the length of the transcript. Because transcription and / or translation of the nucleic acid sequence occurs without significant stalling of polymerase and / or ribosome, the uniformity of the melting temperature unexpectedly results in increased expression of the codon-optimized nucleic acid in human subjects.

[0230] In some embodiments, the codon-optimized nucleic acid sequence may have fewer inhibitory microRNA target binding sites as compared to a non-codon-optimized nucleic acid sequence. In some embodiments, the codon-optimized nucleic acid sequence may have at least 1, or at least 2, or at least 3, or at least 4, or at least 5, or at least 6, or at least 7, or at least 8, or at least 9, or at least 10, or at least 10 fewer inhibitory microRNA target binding sites as compared to a non-codon-optimized nucleic acid sequence.

[0231] While we do not wish to be constrained by theory, codon-optimized nucleic acid sequences, by having fewer repressive microRNA target binding sites, unexpectedly show increased expression in human subjects.

[0232] While not always explicitly stated, it should be understood that the sequences provided herein may be used to provide expression products and to provide substantially identical sequences for expressing and producing RNA or proteins having the same biological properties. These “biologically equivalent,” “biologically active,” or “equivalent” polypeptides are encoded by equivalent polynucleotides described herein. They may have primary amino acid sequences that are at least 60%, or alternatively at least 65%, or alternatively at least 70%, or alternatively at least 75%, or alternatively at least 80%, or alternatively at least 85%, or alternatively at least 90%, or alternatively at least 95%, or alternatively at least 98% identical to the reference polypeptide when compared using a sequence identity method performed under default conditions. Specific polypeptide sequences are provided as examples of specific embodiments. Modification of the sequence to amino acids by alternative amino acids having similar charges. Furthermore, an equivalent polynucleotide is a polynucleotide that hybridizes to a reference polynucleotide or its complement under stringent conditions, or, with respect to a polypeptide, a polypeptide encoded by a polynucleotide that hybridizes to a reference coding polynucleotide or its complementary chain under stringent conditions. Alternatively, an equivalent polypeptide or protein is expressed from an equivalent polynucleotide.

[0233] Hybridization refers to a reaction in which one or more polynucleotides react to form a complex that is stabilized via hydrogen bonds between the bases of nucleotide residues. Hydrogen bonds can arise through Watson-Crick base pairing, Hoogsteen bonds, or any other sequence-specific mode. The complex may consist of two strands forming a double-stranded structure, three or more strands forming a multi-stranded complex, a single self-hybridized strand, or any combination thereof. Hybridization reactions may constitute a step in a broader process, such as the initiation of a polynucleotide cross-sectional area reaction (PC) or the enzymatic cleavage of polynucleotides by ribozymes.

[0234] Examples of stringent hybridization conditions include incubation temperatures of approximately 25°C to 37°C; hybridization buffer concentrations of approximately 6×SSC to 10×SSC; formamide concentrations of approximately 0% to 25%; and washing solutions of approximately 4×SSC to 8×SSC. Examples of moderate hybridization conditions include incubation temperatures of approximately 40°C to 50°C; buffer concentrations of approximately 9×SSC to 2×SSC; formamide concentrations of approximately 30% to 50%; and washing solutions of approximately 5×SSC to 2×SSC. Examples of highly stringent conditions include incubation temperatures of approximately 55°C to 68°C; buffer concentrations of approximately 1×SSC to 0.1×SSC; formamide concentrations of approximately 55% to 75%; and washing solutions of approximately 1×SSC, 0.1×SSC, or deionized water. Generally, the incubation time for hybridization is 5 minutes to 24 hours, accompanied by one, two, or more washing steps, with washing incubation times of approximately 1, 2, or 15 minutes. SSC (Soluble Stabilization Scale) is 0.15 M NaCl and 15 mM citrate buffer. It should be understood that equivalents of SSC using other buffer systems can be used.

[0235] "Homologie," "identity," or "similarity" refers to sequence similarity between two peptides or two nucleic acid molecules. Homologie can be determined by comparing the positions within each sequence that can be aligned for comparison. Molecules are homologous at a position if the positions within the sequences being compared are occupied by the same base or amino acid. The degree of homology between sequences is a function of the number of identical or homologous positions shared by the sequences. "Unrelated" or "non-homologous" sequences share less than 40% identity, or alternatively less than 25% identity, with one of the sequences of the present invention.

[0236] cell Cells comprising RNA targeting systems and expression constructs described herein are also provided herein. In some embodiments of the compositions and methods of this disclosure, the cells of this disclosure are prokaryotic cells.

[0237] In some embodiments of the compositions and methods of the Disclosure, the cells of the Disclosure are eukaryotic cells. In some embodiments, the cells are mammalian cells. In some embodiments, the cells are bovine, mouse, cat, horse, pig, dog, monkey, or human cells. In some embodiments, the cells are non-human mammalian cells, such as non-human primate cells.

[0238] In some embodiments, the cells of the Disclosure are somatic cells. In some embodiments, the cells of the Disclosure are germline cells. In some embodiments, the germline cells of the Disclosure are not human cells.

[0239] In some embodiments of the compositions and methods of the Disclosure, the cells of the Disclosure are stem cells. In some embodiments, the cells of the Disclosure are embryonic stem cells. In some embodiments, the embryonic stem cells of the Disclosure are not human cells. In some embodiments, the cells of the Disclosure are pluripotent stem cells. In some embodiments, the cells of the Disclosure are adult stem cells. In some embodiments, the cells of the Disclosure are induced pluripotent stem cells (iPSCs). In some embodiments, the cells of the Disclosure are hematopoietic stem cells (HSCs).

[0240] In some embodiments of the compositions and methods disclosed herein, the somatic cells of the disclosure are muscle cells. In some embodiments, the muscle cells of the disclosure are myoblasts or muscle cells. In some embodiments, the muscle cells of the disclosure are cardiomyocytes, skeletal muscle cells, or smooth muscle cells. In some embodiments, the muscle cells of the disclosure are striated muscle cells. In one embodiment, the cells of a patient treated with the compositions disclosed herein include, but are not limited to, skeletal muscle (developing and mature muscle fibers and satellite cells), neuromuscular junctions, cardiomyocytes, smooth muscle cells, peripheral nervous system (neurons), peripheral motor neurons, and / or sensory neurons.

[0241] In some embodiments of the compositions and methods disclosed herein, somatic cells of the disclosure are nerve cells. In one embodiment, the cells of a patient treated with the compositions disclosed herein include, but are not limited to, central nervous system (neurons), peripheral nervous system (neurons), peripheral motor neurons, sensory neurons, cortical or GABAergic inhibitory interneurons. In one embodiment, nerve cells are glial cells.

[0242] In some embodiments of the compositions and methods of the Disclosure, the somatic cells of the Disclosure are fibroblasts or epithelial cells. In some embodiments, the epithelial cells of the Disclosure form squamous epithelial cells, cuboidal epithelial cells, columnar epithelial cells, stratified epithelial cells, pseudostratified columnar epithelial cells, or transitional epithelial cells. In some embodiments, the epithelial cells of the Disclosure form glands including, but not limited to, the pineal gland, thymus, pituitary gland, thyroid gland, adrenal gland, apocrine gland, holocrine gland, merocrine gland, serous gland, mucous gland, and sebaceous gland. In some embodiments, the epithelial cells of the Disclosure are in contact with the outer surface of organs including, but not limited to, the lungs, spleen, stomach, pancreas, bladder, intestine, kidney, gallbladder, liver, larynx, or pharynx. In some embodiments, the epithelial cells of the Disclosure are in contact with the outer surface of blood vessels or veins.

[0243] In some embodiments of the present disclosure, somatic cells are ophthalmic cells. Ophthalmic cells include, but are not limited to, corneal epithelial cells, keratinocytes, retinal pigment epithelial (RPE) cells, lens epithelial cells, iris pigment epithelial cells, conjunctival fibroblasts, non-pigmented ciliary epithelial cells, trabecular meshwork cells, ocular choroidal fibroblasts, and conjunctival epithelial cells. In some embodiments, ophthalmic cells are retinal cells or corneal cells. In one embodiment, retinal cells are photoreceptor cells or retinal pigment epithelial cells. In another embodiment, retinal cells are ganglion cells, amacrine cells, bipolar cells, horizontal cells, Müller glial cells, rod cells, or cone cells. In some embodiments of the compositions and methods of the present disclosure, somatic cells of the present disclosure are primary cells.

[0244] In some embodiments of the compositions and methods of the present disclosure, the somatic cells of the present disclosure are cultured cells. In some embodiments of the compositions and methods of the present disclosure, the somatic cells of the present disclosure are in vivo, in vitro, ex vivo, or in situ.

[0245] In some embodiments of the compositions and methods of the Disclosure, the somatic cells of the Disclosure are self or allogeneic. How to use This disclosure provides a method for encoding RNA or expressing NOI in cells using the snRNA system disclosed herein. In one embodiment, this disclosure provides a method for modifying the activity of RNA, or a protein encoded by an RNA molecule, comprising contacting a target RNA molecule with a composition of this disclosure under conditions suitable for binding to an RNA molecule.

[0246] This disclosure provides a method for modifying the expression level of a protein encoded by an RNA molecule of the RNA molecule of the present disclosure, comprising contacting the composition of the present disclosure with a cell containing an RNA molecule under conditions suitable for binding to the RNA molecule. In some embodiments, the cell is in vivo, in vitro, ex vivo, or in situ. In some embodiments, the composition of the present disclosure comprises a vector containing an snRNA sequence. In some embodiments, the vector is an AAV.

[0247] This disclosure provides a method for modifying the expression level of an RNA molecule of the Disclosure or a protein encoded by an RNA molecule, comprising contacting the RNA molecule with a composition of the Disclosure under conditions suitable for knockdown, blocking, splicing, multi-targeting, frame recovery, or editing of a target RNA. In some embodiments, the composition of the Disclosure comprises a vector containing an snRNA sequence. In some embodiments, the vector is an AAV.

[0248] This disclosure provides a method for modifying the activity of a target RNA or a protein encoded by a target RNA molecule, comprising contacting a composition with a cell containing the RNA molecule under conditions suitable for knockdown, blocking, splicing, multi-targeting, frame recovery, or editing of the target RNA. In some embodiments, the cell is in vivo, in vitro, ex vivo, or in situ. In some embodiments, the composition comprises a vector containing an snRNA sequence disclosed herein. In some embodiments, the vector is an AAV.

[0249] This disclosure provides a method for treating a disease or disorder, comprising administering a therapeutically effective amount of the snRNA composition of this disclosure to a target. This disclosure provides a method for treating a patient's disease requiring such treatment, comprising administering a therapeutically effective amount of the snRNA composition disclosed herein to the patient, the composition comprising a vector containing the snRNA sequence disclosed herein, the composition restoring frame and function and increasing the expression level of the target RNA (compared to the expression level of the target RNA treated with an untargeted (NT) control or compared to no treatment). In another embodiment, the level of increase is 1x or greater. In another embodiment, the level of increase is 2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x or 10x. In another embodiment, the level of increase is 10x or greater. In another embodiment, the level of increase is 10x to 20x. In another embodiment, the level of increase is 11x, 12x, 13x, 14x, 15x, 16x, 17x, 18x, 19x or 20x. In another embodiment, the gene therapy composition disclosed herein, when administered to a patient, results in 20% to 100% recovery and / or function. In one embodiment, the % recovery and / or function is any of 20-99%, 25-99%, 50-99%, 80-99%, 90-99%, or 95-99%. In another embodiment, the % recovery and / or function is 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In yet another embodiment, in gene therapy, the sequences disclosed herein promote an increase in the expression level of a precise RNA transcript, thereby improving protein expression and function. In yet another embodiment, the % upregulation is 1.5 times or more of the target RNA. In some embodiments, the target RNA is SCN1A. In some embodiments, the target RNA is exon 20N of SCN1A. In some embodiments, the target RNA is SYNGAP1. In some embodiments, the target RNA is exon 11 or toxic exon 11 of SYNGAP1.

[0250] This disclosure further provides a method for treating a disease or disorder in a subject, comprising administering an RNA-targeted nucleic acid molecule (i.e., the snRNA of this disclosure) or an AAV vector containing the snRNA of this disclosure.

[0251] In some embodiments, the disease or disorder is epilepsy. In some embodiments, the epilepsy is hereditary epilepsy. In some embodiments, the disease or disorder is Dravet syndrome. In some embodiments, the RNA-targeting nucleic acid molecule or AAV vector targets an RNA sequence encoding NaV1.1(SCN1A). In some embodiments, the RNA sequence encoding SCN1A includes an intron or exon sequence. In some embodiments, the exon sequence includes exon 20N of SCN1A or its adjacent region.

[0252] In some embodiments, the disease or disorder is SYNGAP1-associated epilepsy. In some embodiments, the RNA-targeting nucleic acid molecule or AAV vector targets an RNA sequence encoding synaptic Ras GTPase-activating protein 1 (SYNGAP1). In some embodiments, the RNA sequence encoding SYNGAP1 includes an intron or exon sequence. In some embodiments, the exon sequence includes exon 11 or toxic exon 11 of SYNGAP1 or its adjacent region.

[0253] In some embodiments of the methods of the Disclosure, the subject of the Disclosure is diagnosed with a disease to be treated. In some embodiments, the subject of the Disclosure exhibits at least one sign or symptom of the disorder or disease to be treated. In some embodiments, the subject of the Disclosure exhibits at least one sign or symptom of the disease.

[0254] In some embodiments of the methods of the Disclosure, the subject of the Disclosure is female. In some embodiments of the methods of the Disclosure, the subject of the Disclosure is male. In some embodiments, the subject of the Disclosure has two XX or XY chromosomes. In some embodiments, the subject of the Disclosure has two XX or XY chromosomes and a third chromosome that is either X or Y.

[0255] In some embodiments of the methods of this disclosure, the subject of the disclosure is a newborn, infant, child, adult, elderly, or aged person. In some embodiments of the methods of this disclosure, the subject of the disclosure is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or 31 days old. In some embodiments of the methods of this disclosure, the subject of the disclosure is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months old. In some embodiments of the methods of the Disclosure, the subject of the Disclosure is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 years old, or any age or part of age in between.

[0256] In some embodiments of the methods disclosed herein, the subject matter of the disclosure is mammals. In some embodiments, the subject matter of the disclosure is non-human mammals. In some embodiments of the methods disclosed herein, the subject of the disclosure is a human being.

[0257] In some embodiments of the methods of the present disclosure, the therapeutic dose comprises a single dose of the composition of the present disclosure. In some embodiments, the therapeutic dose comprises a therapeutic dose comprising at least one dose of the composition of the present disclosure. In some embodiments, the therapeutic dose comprises a therapeutic dose comprising one or more doses of the composition of the present disclosure.

[0258] In some embodiments of the methods of this disclosure, a therapeutically effective dose eliminates signs or symptoms of the disease or disorder. In some embodiments, a therapeutically effective dose reduces the severity of signs or symptoms of the disease or disorder. Signs and symptoms of Dravet syndrome that can be reduced or eliminated in severity using the compositions described herein include seizures (e.g., focal seizures, generalized seizures, febrile convulsions or grand mal seizures), ataxia, hypotonia, and stomp gait. In some embodiments, seizures are not adequately controlled with standard seizure medications (e.g., valproic acid, clobazam, topiramate, stiripentol, fenfluramine, and / or cannabidiol).

[0259] In some embodiments of the methods disclosed herein, a therapeutically effective dose eliminates a disease or disorder (e.g., Dravet syndrome). In some embodiments of the methods disclosed herein, a therapeutically effective dose eliminates a disease or disorder (e.g., SYNGAP1-associated epilepsy).

[0260] In some embodiments of the methods disclosed herein, a therapeutically effective dose prevents the onset of a disease or disorder. In some embodiments, a therapeutically effective dose delays the onset of a disease or disorder. In some embodiments, a therapeutically effective dose of the compositions described herein delays the onset of SYNGAP1-associated epilepsy or Dravet syndrome to age 2, 3, 4, 5, 10, 15, 20, or 25 years.

[0261] In some embodiments, the therapeutically effective dose improves the prognosis of the subject. In some embodiments of the methods of the present disclosure, the compositions of the present disclosure are administered to a subject by intracerebral administration. In some embodiments of the methods of the present disclosure, the compositions of the present disclosure are administered to a subject by intracerebral injection. In some embodiments, the compositions of the present disclosure are administered to a subject by an intrastriatal route. In some embodiments, the compositions of the present disclosure are administered to a subject by stereotactic injection or infusion. In some embodiments, the compositions are administered intravenously. In some embodiments, the compositions are administered into the brain. In some embodiments of the methods of the present disclosure, the compositions of the present disclosure are administered topically to a subject.

[0262] In some embodiments, the compositions disclosed herein are formulated as pharmaceutical compositions. Briefly, pharmaceutical compositions for use as disclosed herein may comprise, in combination with one or more pharmaceutically or physiologically acceptable carriers, diluents, or excipients, proteins or protein-encoding polynucleotides optionally contained in AAV, which are also optionally immunoorthogonal. Such compositions may comprise buffers, e.g., neutral buffered saline, phosphate-buffered saline; carbohydrates, e.g., glucose, mannose, sucrose, or dextran, mannitol; proteins; polypeptides or amino acids, e.g., glycine; antioxidants; chelating agents, e.g., EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and preservatives. The compositions of this disclosure may be formulated for routes of administration such as oral, enteral, topical, transdermal, intranasal, and / or inhalation, and for routes of administration by injection or infusion such as intravenous, intramuscular, subpia, intrathecal, intraparenchymal, intrastriatal, subcutaneous, intradermal, intraperitoneal, intratumoral, intravenous, intraocular, and / or parenteral administration. In certain embodiments, the compositions of this disclosure may be formulated for intracerebral or intrastriatal administration. [Examples]

[0263] The examples described herein are illustrative only and are not intended to limit the claimed invention. Example 1: Elimination of the toxic exon 20N of SCN1A Materials and methods In vitro assay Toxic exon skipping and quantification of productive SCN1A mRNA Splicing assays to evaluate exon skipping were performed in HeLa or HepG2 cells transfected with plasmids expressing snRNA or synthetic snRNA. For SNC1A+ / -GABAergic neurons, cells were transduced for 7 days using AAV9-2x snRNA cassettes of different MOIs (A05290 or A05291). RNA was extracted by KingFisher using the Flex MirVana RNA extraction kit or Zymo's Direct-zol-96 MagBead RNA extraction kit. cDNA was constructed using SuperScript IV RT for exon skipping. PCR was performed using KOD Xtreme Hot Start polymerase and primers that anneal to exons 20 and 21. 1 μL of PCR product was analyzed using a D1000 TapeStation. For productive SCN1A, qRT-PCR was performed using Ultraplex 1-Step Toughmix (QuantaBio) and primers and probes targeting the SCN1A exon-exon junction of exons 20 / 21. Reference genes were quantified for normalization using custom GAPDH or ATP5b primers and probes. Relative SCN1A mRNA levels were calculated using the ΔΔCt method.

[0264] In vivo, WT mice were injected with 5E10vg / animal AAV9 A05290 or A05291 via ICV during phase 0. Multiple regions of the cortex and hippocampus were collected during phase 20, and snRNA expression, exon 20N skipping of SCN1A, and expression of productive SNC1A RNA and protein were analyzed.

[0265] result In vitro evaluation of U7 snRNA targeting exon 20N of SCN1A. U7 snRNA was manipulated to bind to splicing regulatory sequences (acceptor and donor sites or splicing enhancer sequences) within SCN1A venom exon 20N, thereby promoting skipping and restoration of frame and function (Figure 1A).

[0266] Figure 1B shows the band in HeLa cells that does not skip exon 20N of SCN1A (the upper fragment at 669 bp containing the toxic exon), or the skipped product (exclusion of the toxic exon, the lower band at 605 bp). The results are quantified in Figure 1C. Figure 2A shows TapeStation images of RT-PCR products after U7 snRNA treatment using single and fusion U7 spacers (cloned into pcDNA plasmids), showing the band in HepG2 cells that does not skip exon 20N of SCN1A, or the skipped product. The data are quantified in Figure 2B. Figure 2C shows the expression levels of productive SCN1A (without toxic exon 20N) determined by qRT-PCR after treatment with single and fusion U7 snRNA.

[0267] Conclusion: These data indicate that multiple U7 snRNA spacers (single and fused) promote toxic exon 20N skipping and increase productive SCN1A mRNA expression in vitro. Fusion spacers show stronger skipping in vitro.

[0268] Figure 3A shows the quantification of RT-PCR products for the percentage of toxic exon 20N inclusion after U7 snRNA treatment in HepG2 cells using z15 / z6 and z11 / z15 fusion synthetic U7 spacers with further modifications to the ISD and stem-loop. Similarly, Figure 3B shows the expression of productive SCN1A (without toxic exon 20N) determined by qRT-PCR after treatment with U7 snRNA in HepG2 cells transfected with synthetic U7 snRNA. The following snRNA synthetic RNAs were tested: SR220251: untargeted; SR220516: untargeted mod1; SR220519: untargeted mod2; SR220522: untargeted mod3; SR220346: z15 / z6; SR220517: z15 / z6 mod1; SR220520: z15 / z6 mod2; SR220523: z15 / z6 mod3; SR220347: z11 / z15; SR220518: z11 / z15 mod1; SR220521: z11 / z15 mod2; and SR220524: z11 / z15 mod3 (mod1 - no ISD, mod2 - mouse natural loop / no ISD, mod3 - sheep loop / no ISD).

[0269] Conclusion: These data indicate that further optimization of snRNA ISD and loops enhances the elimination of SCN1A toxic exon 20N in HepG2 cells. Exon 20N skipping activity of U7 snRNA constructs in Dravet syndrome neurons Based on in vitro exon 20N skipping activity, two best antisense U7 snRNA sequences were selected and packaged into a self-complementary AAV9 (scAAV9) genome, followed by AAV production. This snRNA packaging strategy, which minimizes repetitive sequences within the genome, results in a high-titer, full-length self-complementary AAV preparation with the intended genome (containing 2× snRNA), as confirmed by long-read sequencing (data not shown). The scAAV9 construct targeting toxic exons was delivered to SCN1+ / - GABAergic inhibitory neurons (in vitro) and P0 neonatal BL6 wild-type mice (in vivo) by intraventricular (ICV) injection. In vitro AAV9 nulls (empty capsids) and untreated (UNT) cells were used as negative controls.

[0270] Figure 4A shows TapeStation images of RT-PCR products for exon 20N skipping detection in SCN1A+ / - activating neurons and cells after U7 snRNA treatment using AAV9 (two U7 snRNA cassettes expressing fusion spacers under mouse U7 and mouse U1 promoters), A05290 (U7 fusion z15+z6), and A05291 (U7 fusion z11+z15) with increased MOI.

[0271] The data are quantified in Figures 4B and 4C. Seven days after AAV9 transduction, complete elimination of SCN1A toxic exon 20N by U7 snRNA and a tenfold increase in productive SCN1A RNA were observed in SCN1A+ / -GABAergic neurons (Figure 4C).

[0272] Conclusion: These data demonstrate the elimination of SCN1A toxic exons by two read U7 snRNA constructs 7 days after transduction with AAV9 in SCN1A+ / -GABAergic neurons.

[0273] Read constructs A05290 and A05291 (both containing a 2×U7 fusion spacer cassette) were further evaluated in vivo. The study design is shown in Figure 5A. Figure 5B shows representative TapeStation images of cortical and hippocampal samples of RT-PCR products after U7 snRNA treatment with A05290 and A05291, indicating bands that did not skip SCN1A toxic exon 21N (the mouse equivalent of toxic exon 20N in humans) or skipped products. Vehicle-treated samples were used as negative controls. Data from different slices of the cortex and hippocampus are quantified in Figure 5C. These data indicate that U7 snRNA delivered by scAAV9 can promote efficient skipping of SCN1A toxic exon in mouse cortex and hippocampus after neonatal ICV delivery.

[0274] Figure 5D shows the levels of productive SCN1A mRNA (excluding toxic exons) 20 days after ICV injection using AAV9 expressing two U7 snRNA cassettes in three regions of the cortex and two regions of the hippocampus. Figure 5E shows the SCN1A / Nav1.1 protein expression levels in the cortex and hippocampus 20 days after ICV injection using AAV9 expressing two U7 snRNA cassettes. Figure 5F shows snRNA expression in the cortex and hippocampus after treatment with AAV9 expressing snRNA. These data indicate that U7 snRNA delivered by scAAV9 increases productive SCN1A mRNA and protein in the mouse cortex and hippocampus after neonatal ICV delivery.

[0275] Conclusion: Dose-dependent U7 snRNA expression and complete toxic exon 20N skipping were observed in Dravet syndrome neurons 7 days after treatment. Similarly, complete exon skipping was observed in mouse cortical and hippocampal regions, resulting in an approximately 2.0-fold increase in productive SCN1A mRNA and Nav1.1 protein 3 weeks after treatment. Overall, these data demonstrate that SCN1A toxic exons can be successfully targeted using AAV-delivered snRNA to rescue haploinsufficiency in vitro and in vivo.

[0276] Example 2: Elimination of SYNGAP1 toxic exon 11 Inclusion of SYNGAP toxic exon 11 (shown as a shaded box containing an immature stop codon (PTC)) leads to nonsense mutation-dependent degradation (NMD), transcript degradation, and haploinsufficiency (Figure 6A). Figure 6B shows the mechanism of action of SYNGAP toxic exon 11 skipping by U7 snRNA to restore frame and function. U7 snRNA was engineered to bind to a splicing regulatory sequence within SYNGAP1 toxic exon 11 to promote skipping and restoration of frame and function. Figure 6C shows TapeStation images of RT-PCR products after U7 snRNA treatment using a single U7 spacer (z22, z23, and z24 in pcDNA), showing bands that did not skip SYNGAP toxic exon 11 (upper fragment containing the toxic exon) or skipped products (lower band excluding the toxic exon). Untargeted U7(NT) was used as a negative control. ASO, which has been previously shown to promote the elimination of toxic exon 11, was used as a positive control. (Figure 6D) Quantitative results from TapeStation plotted as the percentage of toxic exon elimination after treatment with multiple single and fusion spacer U7 snRNAs targeting different regions of SYNGAP1 premRNA in Hek293-T cells (shown in the graph and figure below).

[0277] Conclusion: U7 snRNA can bind to multiple regions of SYNGAP1 pre-mRNA and promote toxic exon 11 skipping in HEK293T cells. In HEK293-T cells, the percentage of endogenous SYNGAP1 toxic exon 11 skipping, determined by splicing assay (Figure 7A), or the expression of productive SYNGAP1 mRNA, determined by qRT-PCR (Figure 7B), was quantified after treatment with a single synthetic U7 snRNA. Untargeted U7(NT) was used as a negative control. In HEK293-T cells, the percentage of endogenous SYNGAP1 toxic exon 11 skipping, determined by splicing assay (Figure 7C), or the expression of productive SYNGAP1 mRNA, determined by qRT-PCR (Figure 7D), was quantified after treatment with novel optimized single and fusion U7 snRNAs. Untargeted U7(NT) was used as a negative control.

[0278] Conclusion: Optimized synthetic U7 snRNA single and fusion spacers promote efficient skipping of SYNGAP1 toxic exon 11 in HEK293T cells, increasing the expression of productive SYNGAP1 mRNA.

[0279] Figure 8A shows a TapeStation image of RT-PCR products at the exon 11 level of SYNGAP1 in neural progenitor cells (NPCs) of a patient containing the R1240X mutation. Patient NPCS show high levels of SYNGAP1 toxic exon 11 inclusion (upper band). Quantification of RT-PCR products for the percentage of SYNGAP1 toxic exon 11 skipping after U7 snRNA treatment in patient-derived NPCs (Figure 8B). Untargeted U7 (NT) was used as a negative control. Figure 8C shows quantification of the expression of productive SYNGAP1 mRNA (without toxic exon 11) as determined by qRT-PCR after treatment with U7 snRNA.

[0280] Conclusion: Multiple U7 snRNAs promote efficient skipping of SYNGAP1 toxic exon 11 and increase the expression of productive SYNGAP1 mRNA in patient-derived NPCs.

[0281] Embedding by reference All documents referenced herein, including cross-references or related patents or applications, are incorporated herein by reference in their entirety unless expressly excluded or limited. The reference of any document does not constitute prior art with respect to any invention disclosed or embodied herein, nor does it imply, either alone or in combination with any other reference, that it teaches, suggests, or discloses any such invention. Furthermore, in the event of any conflict between the meaning or definition of a term in this document and the meaning or definition of the same term in a document incorporated by reference, the meaning or definition assigned to that term in this document shall prevail.

[0282] Other Embodiments While specific embodiments of this disclosure are illustrated and described, various other changes and modifications can be made without departing from the spirit and scope of this disclosure. The scope of the appended claims includes all such changes and modifications that fall within the scope of this disclosure.

Claims

1. An RNA-targeting nucleic acid molecule containing nuclear small RNA (snRNA), wherein the snRNA contains a targeting sequence that binds to an SCN1A RNA sequence.

2. The RNA-targeting nucleic acid molecule according to claim 1, wherein the SCN1ARNA sequence is exon 20N.

3. The RNA-targeted nucleic acid molecule according to claim 1 or 2, wherein the SCN1A targeting sequence includes a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to the nucleic acid sequence described in any one of Sequence IDs 16 to 83.

4. The RNA-targeting nucleic acid molecule according to any one of claims 1 to 3, wherein the snRNA includes a stem-loop (SL).

5. The RNA-targeting nucleic acid molecule according to claim 4, wherein the SL comprises, independently of any one of the nucleic acid sequences described in Sequence ID No. 84 to 124, one or more nucleic acid sequences that are identical in at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between).

6. The RNA-targeting nucleic acid molecule according to claim 4 or 5, wherein the SL contains or comprises a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to the nucleic acid sequence described in Sequence ID No.

97.

7. An RNA-targeting nucleic acid molecule comprising nuclear small RNA (snRNA), wherein the snRNA comprises a targeting sequence that binds to an SCN1A RNA sequence and an SL containing the nucleic acid sequence described in Sequence ID No. 97, and the targeting sequence is located at the 5' end of the SL.

8. The RNA-targeting nucleic acid molecule according to claim 7, wherein the SCN1A RNA sequence is exon 20N.

9. The RNA-targeted nucleic acid molecule according to claim 7 or 8, wherein the SCN1A targeting sequence includes a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to the nucleic acid sequence described in any one of Sequence IDs 16 to 83.

10. The RNA-targeting nucleic acid molecule according to any one of claims 1 to 9, wherein the SCN1A RNA sequence is a pre-mRNA or an mRNA sequence.

11. The RNA-targeting nucleic acid molecule according to any one of claims 1 to 10, wherein the snRNA includes an Sm-binding domain (SmBD).

12. The RNA-targeting nucleic acid molecule according to claim 11, wherein the SmBD is U1, U2, U4, or U5 SmBD.

13. The RNA-targeting nucleic acid molecule according to claim 11 or 12, wherein the SmBD comprises the nucleic acid sequence described in either SEQ ID NO: 160 or 161.

14. The RNA-targeting nucleic acid molecule according to any one of claims 1 to 13, wherein the snRNA comprises a 5' interaction stabilization domain (5'ISD).

15. The RNA-targeted nucleic acid molecule according to claim 14, wherein the 5'ISD comprises the nucleotide sequence ggagt, cctct, ggagt, cctcct, agccag, ggaag, gaagaag, gttg, ccgaa, taaggag, gaag, or ggctt.

16. A vector comprising one or more snRNAs according to any one of claims 1 to 15.

17. The vector according to claim 16, wherein the vector is an adeno-associated virus (AAV) vector.

18. The vector according to claim 16 or 17, wherein the snRNA is operably linked to a promoter.

19. The vector according to any one of claims 16 to 18, wherein the snRNA is operably linked to a U7 promoter or a U1 promoter.

20. The vector according to any one of claims 16 to 19, wherein the snRNA is operably ligated to a downstream terminator (DT).

21. The vector according to any one of claims 16 to 20, wherein the snRNA is operably linked to a U7 downstream terminator or a U1 downstream terminator.

22. The vector according to any one of claims 16 to 21, wherein the vector comprises at least one, at least two, at least three, at least four, or at least five snRNAs.

23. The vector according to claim 22, wherein at least one, at least two, at least three, at least four, or at least five snRNAs each target the same target RNA sequence.

24. The vector according to claim 22 or 23, wherein each snRNA is separated by a buffer sequence.

25. The vector according to claim 24, wherein the buffer sequence contains a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to the nucleic acid sequence described in any one of sequence numbers 151 to 157.

26. The vector according to claim 16 or 17, wherein the vector contains a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to the nucleic acid sequence described in any one of Sequence IDs 162 to 180.

27. An SCN1A RNA-targeted nucleic acid molecule containing the targeting sequence described in any one of sequence numbers 16 to 83.

28. A polynucleotide or vector containing a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to the nucleic acid sequence described in any one of Sequence IDs 162 to 180.

29. Recombinant AAV (rAAV), (a) AAV capsid containing AAV capsid protein, (b) Recombinant AAV (rAAV) comprising a vector genome containing the snRNA described in any one of claims 1 to 15 or the RNA-targeting nucleic acid molecule described in any one of claims 1 to 15 and 27.

30. The rAAV according to claim 29, wherein the vector genome further comprises a 5' reverse terminal repeat (ITR) sequence and a 3' ITR.

31. The rAAV according to claim 29 or 30, wherein the vector genome comprises a 5' ITR sequence, the snRNA or the RNA-targeting nucleic acid molecule, and a 3' ITR sequence in the 5' to 3' direction.

32. Recombinant AAV (rAAV), (a) AAV capsid containing AAV capsid protein, Recombinant AAV (rAAV) comprising a vector genome containing polynucleotides as described in Embodiment 28.

33. The rAAV according to any one of claims 29 to 32, wherein the AAV capsid comprises an AAV capsid protein of an AAV serotype selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrh10, AAV11, AAV12, and their variants.

34. The rAAV according to any one of claims 29 to 32, wherein the vector genome is single-stranded or self-complementary.

35. The rAAV according to any one of claims 28 to 34, wherein the rAAV is defective in replication.

36. A pharmaceutical composition comprising an snRNA according to any one of claims 1 to 15, an RNA-targeting nucleic acid molecule according to any one of claims 1 to 15 and 27, a vector according to any one of claims 16 to 26, a polynucleotide or vector according to claim 28, or an rAAV according to any one of claims 29 to 35.

37. A method for targeting one or more target RNAs and skipping exons of the one or more target RNAs, comprising contacting a cell containing the one or more target RNAs with an snRNA according to any one of claims 1 to 15, an RNA-targeting nucleic acid molecule according to any one of claims 1 to 15 and 27, a vector according to any one of claims 16 to 26, a polynucleotide or vector according to claim 28, or an rAAV according to any one of claims 29 to 35.

38. The method according to claim 37, wherein one or more target RNAs of the purpose include toxic exon 20N of the human sodium channel Nav1.1 gene.

39. A method for treating a disease or disorder in a subject, comprising administering to the subject an snRNA according to any one of claims 1 to 15, an RNA-targeted nucleic acid molecule according to any one of claims 1 to 15 and 27, a vector according to any one of claims 16 to 26, a polynucleotide or vector according to claim 28, an rAAV according to any one of claims 29 to 35, or a pharmaceutical composition according to claim 36.

40. The method according to claim 39, wherein the disease or disorder is hereditary epilepsy.

41. The method according to claim 39 or 40, wherein the disease or disorder is Dravet syndrome.

42. The method according to any one of claims 39 to 41, wherein the administration is systemic, intravenous, or intraventricular.

43. Use of an snRNA according to any one of claims 1 to 15 or an RNA-targeting nucleic acid molecule according to any one of claims 1 to 15 and 27 to target one or more target RNAs and to skip exons of the one or more target RNAs.

44. The use according to claim 43, wherein one or more target RNAs are contained in the cell.

45. Use of an snRNA according to any one of claims 1 to 15, an RNA-targeted nucleic acid molecule according to any one of claims 1 to 15 and 27, a vector according to any one of claims 16 to 26, a polynucleotide or vector according to claim 28, an rAAV according to any one of claims 29 to 35, or a pharmaceutical composition according to claim 36 for treating a disease or disorder in a subject.

46. The use according to claim 45, wherein the disease or disorder is hereditary epilepsy.

47. The use according to claim 45 or 46, wherein the disease or disorder is Dravet syndrome.

48. The use according to any one of claims 45 to 47, wherein the administration is systemic, intravenous, or intraventricular.

Images