Enzyme variants suitable for homogeneous immunoassays

Abstract

Provided is a β glucuronidase mutant suitable for the homogeneous immunoassay method. This β glucuronidase mutant is characterized in that methionine at position 516 in the amino acid sequence of β glucuronidase of E. coli is substituted with lysine, and tyrosine at position 517 is unsubstituted or substituted with an aromatic amino acid other than tyrosine.

Description

[Technical field]

[0001] The present invention relates to a β-glucuronidase mutant suitable for homogeneous immunoassay, a fusion protein containing the mutant, and an antigen detection method and antigen detection kit using the fusion protein. [Background technology]

[0002] Immunoassays are becoming increasingly important measurement techniques in clinical diagnosis. In addition to improving sensitivity and specificity, rapid and simple measurement are also major factors in the adoption of each immunoassay. In the currently mainstream immunoassays, the sandwich method is used as the measurement principle for detecting protein biomarkers, and the competitive method is used for detecting small molecules. However, both of these methods are often enzyme immunoassays that measure the activity of the enzyme used for labeling after several reactions and washings, which is troublesome and takes several hours to measure. In contrast, homogeneous immunoassays, which mix the sample and measurement reagent, react, and detect, have attracted attention in recent years because they allow simple and rapid measurement.

[0003] As for homogeneous immunoassay, the present inventors have recently reported a method using a mutant of β-glucuronidase (GUS) (Patent Document 1). GUS shows activity by forming a tetramer, but if there is a mutation in the amino acid sequence (for example, a mutation in which the 516th methionine and the 517th tyrosine of E. coli GUS are replaced by lysine and glutamic acid, respectively), the affinity between monomers decreases, and although a dimer is formed, a tetramer is not formed under normal conditions. The above-mentioned measurement method utilizes such properties of GUS and uses two types of fusion proteins: a fusion protein containing the VH region of an antibody and a mutant of GUS, and a fusion protein containing the VL region of an antibody and a mutant of GUS. The principle of this measurement method is as follows. When an antigen is not present in a sample, the interaction between the VH region and the VL region remains weak, so that the dimer of the mutant of GUS linked to the VH region and the VL region remains as it is and hardly forms a tetramer. On the other hand, when an antigen is present in a sample, the interaction between the VH and VL regions is strengthened, and this interaction causes dimers of the GUS mutant linked to the VH and VL regions to bind to form tetramers and become active. Therefore, the amount of antigen in a sample can be measured by measuring the activity of GUS. [Prior art documents] [Patent documents]

[0004] [Patent Document 1] International Publication No. 2017 / 130610 Summary of the Invention [Problem to be solved by the invention]

[0005] Although it is possible to detect antigens with high sensitivity by using the GUS mutant described in Patent Document 1, a detection method with even higher sensitivity is required for use in the medical field, such as clinical diagnosis. The present invention has been made under such circumstances, and aims to provide a GUS mutant that enables antigen detection with higher sensitivity. [Means for solving the problem]

[0006] As a result of extensive research into solving the above-mentioned problems, the present inventors have found that in an antigen detection method utilizing the GUS mutant described in Patent Document 1, by using a GUS mutant in which the 516th methionine and the 517th tyrosine in the amino acid sequence of Escherichia coli GUS are replaced by lysine and tryptophan, respectively, GUS activity (signal value) in the presence of an antigen is significantly increased while GUS activity (background value) in the absence of the antigen is significantly reduced. Based on this finding, the present inventors have completed the present invention.

[0007] That is, the present invention provides the following (1) to (8). (1) A β-glucuronidase mutant, characterized in that the 516th methionine in the amino acid sequence of Escherichia coli β-glucuronidase is replaced by lysine, and the 517th tyrosine is either not replaced or is replaced by an aromatic amino acid other than tyrosine.

[0008] (2) A β-glucuronidase mutant according to (1), characterized in that the 517th tyrosine in the amino acid sequence of Escherichia coli β-glucuronidase is replaced with tryptophan.

[0009] (3) The β-glucuronidase mutant according to (1) or (2), further characterized in that in the amino acid sequence of Escherichia coli β-glucuronidase, asparagine at position 27 is replaced with tyrosine, phenylalanine at position 51 is replaced with tyrosine, alanine at position 64 is replaced with valine, aspartic acid at position 185 is replaced with asparagine, isoleucine at position 349 is replaced with phenylalanine, glycine at position 368 is replaced with cysteine, asparagine at position 369 is replaced with serine, tyrosine at position 525 is replaced with phenylalanine, glycine at position 559 is replaced with serine, lysine at position 567 is replaced with arginine, phenylalanine at position 582 is replaced with tyrosine, glutamine at position 585 is replaced with histidine, and glycine at position 601 is replaced with aspartic acid.

[0010] (4) A β-glucuronidase mutant according to (3), characterized in that the 368th cysteine ​​in the amino acid sequence of Escherichia coli β-glucuronidase is replaced with serine.

[0011] (5) A fusion protein characterized by comprising a β-glucuronidase mutant described in any one of (1) to (4), a linker peptide that binds to this β-glucuronidase mutant, and a VH region or VL region of an antibody that binds to this linker peptide.

[0012] (6) A nucleic acid encoding the fusion protein according to (5).

[0013] (7) A method for detecting an antigen in a sample, comprising the steps of contacting the sample with the fusion protein described in (5) containing an antibody VH region and the fusion protein described in (5) containing an antibody VL region, and detecting tetramer formation of the β-glucuronidase mutant based on a change in enzyme activity.

[0014] (8) An antigen detection kit, comprising the fusion protein according to (5) containing an antibody VH region and the fusion protein according to (5) containing an antibody VL region.

[0015] (9) A fusion protein comprising a β-glucuronidase mutant described in any one of (1) to (4), a linker peptide that binds to the β-glucuronidase mutant, and a VH region of a heavy chain antibody that binds to the linker peptide.

[0016] (10) A nucleic acid encoding the fusion protein according to (9).

[0017] (11) A method for detecting an antigen in a sample, comprising the steps of contacting the sample with the fusion protein described in (9) and detecting tetramer formation of the β-glucuronidase mutant based on a change in enzyme activity.

[0018] (12) An antigen detection kit comprising the fusion protein according to (9).

[0019] This specification includes the contents described in the specification and / or drawings of Japanese patent application No. 2019-021450, which is the priority basis of this application. Effect of the Invention

[0020] The present invention provides GUS mutants suitable for homogeneous immunoassays. [Brief description of the drawings]

[0021] [Figure 1] FIG. 1 shows the activity of VH / VL(NP)-GUS(IV-5)KE in the presence and absence of NP (N=3). [Diagram 2] FIG. 1 shows the activity of GUS(IV-5)ME in the presence and absence of anti-His6 antibody (N=3). [Diagram 3] FIG. 1 shows the activity of GUS(IV-5)KY in the presence and absence of an anti-His6 antibody (N=3). [Figure 4] FIG. 1 shows the activity of GUS(IV-5)MY in the presence and absence of anti-His6 antibody (N=3). [Diagram 5] FIG. 1 shows the activity of GUS(IV-5)KW in the presence and absence of an anti-His6 antibody (N=3). [Figure 6] FIG. 1 shows the activity of GUS(IV-5)KW in the presence and absence of an anti-His6 antibody (N=3). [Figure 7] Electrophoresis of VH / VL(NP)-GUS(IV-5)KW. Lane 1: precipitate of bacterial cell lysate, lane 2: supernatant of bacterial cell lysate, lane 3: Talon metal affinity gel non-binding fraction, lane 4: Talon metal affinity gel binding fraction. Arrows in the figure indicate VH(NP)GUS(IV-5)KW or VL(NP)GUS(IV-5)KW. [Figure 8]FIG. 13 shows the activity of VH / VL(NP)-GUS(IV-5)KW in the presence and absence of anti-His6 antibody or NIP. [Figure 9] FIG. 1 shows the relationship between the fluorescence intensity of VH / VL(NP)-GUSm (left) or VH / VL(NP)-GUS(IV-5)KW (right) and the antigen concentration. [Figure 10] FIG. 1 shows the activity of VHH(Caf)-GUS(IV-5)KW in the presence and absence of caffeine. [Figure 11] FIG. 1 shows the relationship between the fluorescence intensity of VHH(Caf)-GUS(IV-5)KW and the caffeine concentration. [Figure 12] FIG. 1 shows the specific activity kcat of GUS(IV-5)KW (left) and wild-type GUS (right). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0022] The present invention will be described in detail below. (1) β-glucuronidase mutants The β-glucuronidase mutant of the present invention is characterized in that methionine at position 516 in the amino acid sequence of Escherichia coli β-glucuronidase is replaced by lysine, and tyrosine at position 517 is either not replaced or replaced by an aromatic amino acid other than tyrosine.

[0023] Here, "aromatic amino acids other than tyrosine" include, for example, tryptophan and phenylalanine.

[0024] The 517th tyrosine in the amino acid sequence of E. coli β-glucuronidase may be unsubstituted or substituted with an aromatic amino acid other than tyrosine, but is preferably substituted with tryptophan.

[0025] The β-glucuronidase mutant of the present invention may have a mutation other than the above mutation. Examples of such mutations include mutations that improve thermostability. Many publications (e.g., Flores H. et al., J. Mol. Biol. 315, 325-37, 2002) describe what kind of mutations should be introduced to improve the thermostability of β-glucuronidase, so those skilled in the art can identify the mutations according to these publications. Specific examples of mutations that improve the thermostability of β-glucuronidase include a mutation in which asparagine at position 27 in the amino acid sequence of E. coli β-glucuronidase is replaced with tyrosine, a mutation in which phenylalanine at position 51 is replaced with tyrosine, a mutation in which alanine at position 64 is replaced with valine, a mutation in which aspartic acid at position 185 is replaced with asparagine, a mutation in which isoleucine at position 349 is replaced with phenylalanine, a mutation in which glycine at position 368 is replaced with cysteine, a mutation in which asparagine at position 369 is replaced with serine, a mutation in which tyrosine at position 525 is replaced with phenylalanine, a mutation in which glycine at position 559 is replaced with serine, a mutation in which lysine at position 567 is replaced with arginine, a mutation in which phenylalanine at position 582 is replaced with tyrosine, a mutation in which glutamine at position 585 is replaced with histidine, and a mutation in which glycine at position 601 is replaced with aspartic acid (these mutations are described in Flores H. et al., J. Mol. Biol. 315, 325-37, 2002. ) can be mentioned. All of the above mutations may be introduced into the β-glucuronidase mutant, or only some of the mutations may be introduced. When glycine at position 368 in the amino acid sequence of E. coli β-glucuronidase is substituted with cysteine, this cysteine ​​may form an SS bond with the antibody domain, so in order to avoid this, it may be substituted with serine instead of cysteine.

[0026] The positions of the above-mentioned amino acid mutations indicate the positions in the amino acid sequence of E. coli-derived β-glucuronidase, and therefore, in the amino acid sequence of β-glucuronidase derived from other organisms, there may be cases where the amino acid corresponding to the above-mentioned positions does not exist. In such cases, the amino acid sequence is aligned with the amino acid sequence of E. coli-derived β-glucuronidase based on the identity of the amino acid sequence, thereby identifying the positions of the amino acid mutations. The amino acid sequence of wild-type E. coli-derived β-glucuronidase is shown in SEQ ID NO:1.

[0027] (2) Fusion proteins and nucleic acids The fusion protein of the present invention is characterized by comprising a β-glucuronidase mutant of the present invention, a linker peptide that binds to this β-glucuronidase mutant, and a VH region or VL region of an antibody that binds to this linker peptide.

[0028] The linker peptide may be any peptide that allows the β-glucuronidase mutant, the VH region, and the VL region to function normally. If the distance between the β-glucuronidase mutant and the VH region or the VL region is insufficient, the β-glucuronidase mutant may not exhibit activity, so the linker peptide must have a certain length. The length of the linker peptide varies depending on the type of β-glucuronidase mutant or antibody used, but is usually 10 to 60 Å, preferably 30 to 40 Å. The number of amino acids in the linker peptide may be any number of amino acids that results in the above-mentioned length, but is usually 5 to 50, preferably 15 to 20. The amino acid sequence of the linker peptide may be the same as the amino acid sequence of a general linker peptide used in the preparation of a fusion protein. Specific examples include a repeating sequence of Gly-Gly-Gly-Gly-Ser (G4S) (the number of repeats is usually 2 to 5), a repeating sequence of Glu-Ala-Ala-Ala-Lys (EAAAK), and a repeating sequence of Asp-Asp-Ala-Lys-Lys (DDAKK).

[0029] The VH or VL region of an antibody can be selected from any antibody VH or VL region depending on the antigen to be detected, and is not limited to a specific antibody VH or VL region. Specifically, the VH or VL region of an antibody that specifically binds to the antigen to be detected, which will be described later, can be used. The VH region of an antibody includes not only the VH region of a normal antibody (an antibody that binds to an antigen at two regions, the VL region and the VH region), but also the VH region of a heavy chain antibody (e.g., a heavy chain antibody derived from a camelid), i.e., a VHH antibody.

[0030] The fusion protein of the present invention may consist of only three components, ie, a β-glucuronidase mutant, a linker peptide, and a VH or VL region, but may also contain other peptides, proteins, etc. Examples of such peptides, etc. include a tag sequence for purification such as His-Tag, and a tag sequence for solubilizing an expressed protein such as a solubilization tag sequence derived from thioredoxin or amyloid precursor protein.

[0031] In the fusion protein of the present invention, the β-glucuronidase mutant, linker peptide, and VH region or VL region are arranged in that order, but the β-glucuronidase mutant may be at the N-terminus and the VH region or VL region at the C-terminus, or conversely, the β-glucuronidase mutant may be at the C-terminus and the VH region or VL region at the N-terminus.

[0032] The fusion protein may contain one β-glucuronidase variant, but may also contain two or more. When two β-glucuronidase variants are contained, they are arranged adjacent to each other via a linker. The linker used in this case may be the same as the linker arranged between the β-glucuronidase variant and the VH region or the VL region.

[0033] The present invention includes not only the above-mentioned fusion protein, but also a nucleic acid encoding the fusion protein. Here, the term "nucleic acid" refers primarily to deoxyribonucleic acid, but also includes ribonucleic acid and modified forms of these nucleic acids.

[0034] (3) Antigen detection method The method for detecting an antigen of the present invention is a method for detecting an antigen in a sample, and is characterized by comprising a step of contacting the sample with the fusion protein of the present invention containing an antibody VH region and the fusion protein of the present invention containing an antibody VL region, and a step of detecting the tetramer formation of the β-glucuronidase mutant based on a change in enzyme activity. However, when the fusion protein of the present invention is a fusion protein containing a heavy chain antibody VH region, only the fusion protein containing the heavy chain antibody VH region may be contacted with the sample. Furthermore, the two fusion proteins each may contain a single chain antibody (single chain variable fragment, scFv) in which the VH region and the VL region are linked by a linker, and the enzyme activity may be induced by the binding of the three by contacting them with a sample containing a multivalent antigen such as a protein or a bacterial cell.

[0035] This method utilizes the principle of the open sandwich method (H. Ueda et al., Nat. Biotechnol. 14, 1714-8, 1996) developed by the present inventors, that is, the principle that the interaction between the VH region and the VL region is enhanced by the presence of an antigen, or the principle that the interaction between two VHHs is enhanced by the presence of an antigen, and further the principle of the sandwich method using two antibody variable regions. Conventional antigen detection methods using the open sandwich method (e.g., T. Yokozeki, H. Ueda, R. Arai, W. Mahoney and T. Nagamune. Anal. Chem. 74, 2500-4, 2002 and H. Ueda et al., J. Immunol. Methods 279, 209-18, 2003) used N-terminal deletion mutants and C-terminal deletion mutants, but in the present invention, antigen detection is performed using a β-glucuronidase mutant. This detection principle is described below. β-glucuronidase becomes active by forming a tetramer. The β-glucuronidase mutant of the present invention forms a dimer because a mutation that reduces the binding affinity between some monomers has been introduced, but does not form a tetramer under normal conditions. When an antigen is not present in a sample, the interaction between the VH region and the VL region remains weak, so the dimer of the β-glucuronidase mutant linked to the VH region and the VL region also remains as it is and hardly forms a tetramer. On the other hand, when an antigen is present in a sample, the interaction between the VH region and the VL region is strengthened, and due to this interaction, the dimer of the β-glucuronidase mutant linked to the VH region and the VL region also binds to form a tetramer and becomes active. Therefore, by measuring the β-glucuronidase activity, it is possible to determine whether an antigen is present in a sample.

[0036] The antigen to be detected is not particularly limited, and may be a low molecular weight compound (for example, a compound having a molecular weight of 1000 or less), or may be a high molecular weight compound such as a protein. In addition, since the method of the present invention can be used for disease diagnosis, food toxicity testing, environmental analysis, etc., it is preferable to detect substances related to these. Specifically, examples of the antigen to be detected include neonicotinoid pesticides such as imidacloprid, environmental pollutants such as polychlorinated biphenyls and bisphenol A, toxic substances such as mycotoxins, biological substances such as osteocalcin (effective for diagnosing osteoporosis), corticoids, estradiol, aldosterone, and lysozyme (e.g., hen egg white lysozyme), and drugs such as digoxin.

[0037] The sample may be anything that may contain the antigen to be detected, such as samples taken from humans (blood, saliva, urine, etc.), potentially contaminated water or soil, food, or food ingredients.

[0038] The method of contacting the sample with the fusion protein is not particularly limited, but is usually performed by allowing the sample and the fusion protein to coexist in a solution. Alternatively, the sample may be allowed to coexist with cells expressing the fusion protein, rather than the fusion protein itself. Conditions such as temperature, time, pH of the solution, and amount of the fusion protein used in this contact step may be conditions generally used for β-glucuronidase. For example, the temperature in this contact step is preferably about 20 to 37°C, the contact time is preferably about 10 to 60 minutes, the pH of the solution is preferably about 6.8 to 7.5, and the concentration of the fusion protein in the solution is preferably about 10 to 100 nM.

[0039] The tetramer formation of the β-glucuronidase mutant can be detected by a change (increase or expression) in the activity of the β-glucuronidase mutant contained in the fusion protein. The activity of the β-glucuronidase mutant contained in the fusion protein can be measured by an activity measurement method commonly used for β-glucuronidase. For example, the activity can be measured by adding a chromogenic or fluorescent substrate for β-glucuronidase and quantifying the substance generated from the substrate. Examples of the chromogenic substrate for β-glucuronidase include X-Gluc, 4-nitrophenyl α-glucopyranoside, and 4-nitrophenyl β-D-glucuronide, and examples of the fluorescent substrate include 4-methylumbelliphenyl-β-D-glucuronide, fluorescein di-β-D-glucuronide, fluorescein di-β-D-glucuronide, and dimethyl ester. The quantity of the substance generated from these substrates can be determined by measuring the absorbance at a specific wavelength, the fluorescence intensity, and the like. For example, if the substrate is 4-nitrophenyl β-D-glucuronide, the product can be quantified by measuring the absorbance at around 405 nm. If the substrate is 4-methylumbelliphenyl-β-D-glucuronide, the product can be excited by fluorescence at 340 nm and quantified by measuring the fluorescence intensity at around 480 nm.

[0040] (4) Antigen detection kit The antigen detection kit of the present invention is characterized by including the fusion protein of the present invention containing the VH region of an antibody and the fusion protein of the present invention containing the VL region of an antibody. However, when the fusion protein of the present invention is a fusion protein containing the VH region of a heavy chain antibody, the fusion protein contained in the kit may be only the fusion protein containing the VH region of the heavy chain antibody. This kit can detect an antigen in a sample based on the above-mentioned principle of antigen detection.

[0041] This kit may contain something other than the fusion protein of the present invention containing the VH region of an antibody and the fusion protein of the present invention containing the VL region of an antibody. For example, a substrate is necessary for measuring the enzyme activity, so this may be included. In addition, the kit may contain reagents or equipment for quantifying a substance generated from the substrate, or a substance for stabilizing the fusion protein or substrate. EXAMPLES

[0042] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these examples.

[0043] [Example 1] Construction of an expression vector encoding GUS(IV-5)KE As an E. coli β-glucuronidase mutant with high thermostability and activity greater than that of the wild type, IV-5 (N27Y, F51Y, A64V, D185N, I349F, G368C, N369S, Y517F, Y525F, G559S, K567R, F582Y, Q585H, G601D) described in H. Flores and AD Ellington, J. Mol. Biol., 315, 325-37, 2002 was selected, and DNA was artificially synthesized (Eurofin Genomics, Tokyo, Japan) by adding the following three mutations to this gene, namely, C368S to avoid the possibility of forming a SS bond with the antibody domain, and M516K and F517E to reduce inter-dimer interactions (the sequence of this DNA is shown in SEQ ID NO: 2. The amino acid sequence of the protein encoded by the DNA is shown in SEQ ID NO: 3). The DNA encoded by the plasmid was amplified by PCR using primers GUS_NotBack (ATAAGAATGCGGCCGCTATGTTACGTCCTGTAGAAA) (sequence number 4) and GUSmIV5_XhoFor (GCCCTCGAGTCATTGTTTGTCTCCCTG) (sequence number 5) and KOD-Plus-Neo DNA polymerase (Toyobo) at 94°C for 2 minutes, followed by 30 cycles of 94°C for 30 seconds, 55°C for 30 seconds, and 68°C for 1 minute. The amplified GUS(IV-5)KE fragment was cleaved with restriction enzymes NotI and XhoI (New England Biolabs Japan, Tokyo) and inserted into the GUSm portion of pET32-VH(NP)-GUSm and pET32-VL(NP)-GUSm (Su et al., Analyst, 143, 2096-101, 2018), which were cleaved with the same two restriction enzymes, and the sequence was confirmed.

[0044] Example 2: Expression and purification of fusion proteins E. coli SHuffle T7 lysY was transformed with pET32-VH(NP)-GUS(IV-5)KE and pET32-VL(NP)-GUS(IV-5)KE. The E. coli carrying the plasmid were then grown at OD 2 at 30°C in 500 mL of LBA medium (10 g / L tryptone, 5 g / L yeast, 5 g / L NaCl, 100 μg / mL ampicillin). 600 After culturing until the pH reached 0.6, 0.5 mM IPTG was added and the cells were further cultured at 16°C for 16 hours. After collecting the cells by centrifugation, the E. coli cells suspended in 40 mL of Extraction buffer (50 mM sodium phosphate, 300 mM sodium chloride, pH 7.0) were disrupted using a cell disrupter (Constant Systems, UK) to prepare a bacterial lysate. The cells were centrifuged at 1000 g for 20 minutes, the supernatant was collected, and purified by immobilized metal affinity chromatography. Specifically, an appropriate amount of Talon metal affinity gel (Takara Bio, Clontech) was added to the supernatant, stirred for 2 hours, transferred to a Talon disposable column, washed three times with 10 mL of Extraction buffer, and the protein bound to the gel was eluted using 2.5 ml of Extraction buffer containing 150 mM imidazole. The purified thioredoxin (Trx) fusion protein was analyzed by SDS-PAGE.

[0045] [Example 3] Antigen-dependent evaluation of GUS activity Purified Trx-VH(NP)-GUS(IV-5)KE and Trx-VL(NP)-GUS(IV-5)KE were buffer exchanged into PBST (10 mM phosphate, 137 mM NaCl, 2.7 mM KCl, 0.05% Tween20; pH 7.4) and prepared in a black half-well microplate (675077, Greiner Bio-One) to a final concentration of 0.1 μM (n=3). The antigen NP (4-hydroxy-3-nitrophenyl acetyl) or PBST was added to the plate to a final concentration of 0.1 μM, incubated at 25°C for 5 min, and then diluted with 0.3 mg mL-1 The fluorescent substrate 4-methylumbelliphenyl-β-D-glucuronide (MUG, Wako Pure Chemical Industries) was added to make a total of 100 μL, and the fluorescence intensity of each well was measured at 2-minute intervals (excitation 340 nm, emission 480 nm). The results are shown in Figure 1. When Trx-VH(NP)-GUS(IV-5)KE and Trx-VL(NP)-GUS(IV-5)KE were included but NP was not added, the absorbance after 26 minutes was almost unchanged, whereas when NP was added, the absorbance, i.e., GUS activity, increased slightly. Although the increase was lower than expected, the background activity, which was a problem in the conventional GUSm system, was significantly reduced. In addition, when the protein was stored overnight at 4°C, the concentration dependence of the fluorescence at 14 minutes after the start of the reaction, that of the antigen NP and its analogue 5-iodo-NP (NIP), which has a 10-fold higher binding constant, was examined, and it was found that the change was small but that it showed antigen dependence. In addition, since GUSm (M516K, Y517E mutants) was previously degraded during storage under these conditions, it was suggested that GUS(IV-5)KE has higher storage stability.

[0046] [Example 4] Construction of mutants at the interdimer interface residues and activity measurement Although GUS(IV-5)KE is highly stable, it has the problem that the increase in activity during tetramer formation is small. Therefore, we screened for mutants that show a higher increase in activity by mutating the amino acids at this site. Specifically, ME, KY, and MY were constructed by returning either or both of the interface residues KE of pET32-VL(NP)-GUS(IV-5) to the wild type by site-directed mutagenesis using overlap PCR. Proteins were then prepared in the same manner as in Example 2.

[0047] To tetramerize these, we used the His6 tag in the linker region between Trx and VL (NP) instead of the antigen, reacted with an equimolar amount of PentaHis antibody (Qiagen) or anti-His6 antibody (9C11, Wako Pure Chemical Industries), and then added a fluorescent substrate to measure activity (time course of fluorescence every minute). As a result, as shown in Figures 2 to 4, a high S / B ratio (activity ratio with and without antibody, 6.0) was obtained, especially in the KY mutant, and a very low S / B ratio was obtained as expected in the wild-type sequence MY. Therefore, we determined that Lys at position 516 is important for activity control, and constructed the KW mutant in which position 516 is replaced by Lys and position 517 is replaced by a similar aromatic Trp. This mutant protein was prepared in the same manner as above, and activity was measured with and without the PentaHis antibody. The KW mutant showed extremely high average S / B ratios of 13.0 up to 11 min after the start of the reaction (Fig. 5), and 42.3 up to 20 min after the start of the reaction (Fig. 6). Furthermore, the fluorescence intensity at 11 min after the start of the reaction when the antibody was added was significantly higher than that of GUS(IV-5)MY or GUS-KE (Fig. 5), and was more than three times higher at 20 min after the start of the reaction (Fig. 6).

[0048] Example 5: Characterization of KW mutants The high-performance GUS(IV-5)KW clarified in Example 4 was also constructed as a VH(NP) fusion type, and expression and purification were performed in the same manner as in Example 2, and it was possible to obtain a sufficient degree of purification on SDS-PAGE (Figure 7). When the two were mixed, the antigen NIP or anti-His6 antibody was added, and the time change in fluorescence intensity after the addition of MUG was measured, a significantly higher signal was obtained compared to when there was no antigen or antibody (Figure 8). Therefore, the antigens NP and NIP were added at various concentrations, and the fluorescence intensity (GUS activity) was measured 18 minutes after the addition of MUG (Figure 9). Compared to the conventional system using GUSm, the system using GUS(IV-5)KW was able to detect antigens with higher sensitivity and signal intensity.

[0049] To evaluate the thermal stability, 0.1 μM each of Trx-VH(NP)-GUS(IV-5)KW or His6-GUS(IV-5)KW was incubated in PBST at temperatures ranging from 25°C to 80°C for 10 minutes, and the activity in the presence or absence of anti-His antibody was measured by fluorescence as described above. As a result, Trx-VH(NP)-GUS(IV-5)KW and His6-GUS(IV-5)KW maintained 46.2% and 59.7% of the activity of the sample treated at 25°C for 10 minutes when the antibody was added, even after treatment at 50°C for 10 minutes. In contrast, under the same conditions, the activity of VH-GUS(KE) after treatment at 50°C was only 0.29%. Furthermore, the activity in the absence of antibody at 25°C was 49.0% of that in the presence of antibody, and 65.6% at 37°C, suggesting once again that the structural change associated with GUS degradation leads to background activity.

[0050] Example 6 V H Caffeine concentration measurement using H To apply the highly efficient thermostable mutant GUS(IV-5)KW to caffeine detection using a nanobody known to form a dimer in the presence of the antigen caffeine (Sonneson, GJ and Horn, JR, Biochemistry, 48, 6693-5, 2009), a synthetic gene (Eurofin Japan) (sequence number 6) of the variable region VHH(Caf) of the anti-caffeine nanobody with the restriction enzyme sites NcoI and HindIII at the termini was inserted upstream of the GUS(IV-5)KW gene using the restriction enzymes NcoI / HindIII to construct a Trx-VHH(Caf)-GUS(IV-5)KW fusion protein expression vector.

[0051] Using this vector, protein was prepared in the same manner as in Example 2, and the antigen dependency of GUS activity was evaluated in the same manner as in Example 3. Because the high-performance GUS(IV-5)KW was used as the reporter enzyme, background activity was reduced and the S / B ratio was increased (Figure 10). Furthermore, 0.1 μM of the fusion protein was mixed with 0 to 10 μM of caffeine to measure antigen concentration dependency. The fluorescent substrate 4-methylumbelliferyl-β-D-glucuronide was added at a final concentration of 0.3 mg mL -1 The fluorescence intensity was measured 20 minutes after the addition of caffeine at 340 nm and fluorescence at 480 nm. The results showed that GUS activity was significantly caffeine concentration-dependent (Figure 11). 50 The calculated sensitivity was 1.2±0.1 μM and LOD was 40 nM. This sensitivity was sufficient to measure the caffeine concentration in beverages (140 μM in black tea and 5 mM in coffee) (Lisko, JG, et al., Nicotine Tob. Res., 19, 484-92, 2017).

[0052] [Example 7] Measurement of specific activity of GUS(IV-5)KW enzyme To evaluate the specific activity of the mutant GUS(IV-5)KW, the specific activity (turnover number) k of the tetramerized Trx-VL(NP)-GUS(IV-5)KW protein was measured by adding a PentaHis antibody (Qiagen) that recognizes the His-tag. cat The k of tetramerized GUS(IV-5)KW was measured and compared with that of wild-type GUS. After mixing 1 / 2 molar amount of anti-PentaHis antibody with 4.75 μg / ml of Trx-VL(NP)-GUS(IV-5)KW, 0.3 mg / ml of the substrate 4-methylumbelliphenyl-β-D-glucuronide was added, and the fluorescence intensity was measured every minute for 15 minutes (Figure 12, left). The slope of the graph was calculated, and the k of tetramerized GUS(IV-5)KW was cat is 1.25 s -1 On the other hand, the activity of wild-type GUS (2.88 μg / ml) was measured in the same manner using the Trx-VL(NP)-GUS protein (Fig. 12, right). cat is 1.19 s -1That is, the mutant GUS(IV-5)KW has a similar or higher k cat showed.

[0053] All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety. [Industrial Applicability]

[0054] The present invention is useful for disease diagnosis, food inspection, environmental analysis, and the like, and can be used in industrial fields related to these.

Claims

1. A mutant of β-glucuronidase, in which the 516th methionine in the amino acid sequence of E. coli β-glucuronidase is replaced by lysine, the 517th tyrosine is replaced by tryptophan, and the 27th asparagine is replaced by tyrosine, the 51st phenylalanine is replaced by tyrosine, the 64th alanine is replaced by valine, the 185th aspartic acid is replaced by asparagine, and the 349th isoleucine is replaced by tyrosine, in the amino acid sequence of E. coli β-glucuronidase. a β-glucuronidase mutant in which the 368th amino acid is replaced by phenylalanine, the 368th glycine is replaced by serine, the 369th asparagine is replaced by serine, the 525th tyrosine is replaced by phenylalanine, the 559th glycine is replaced by serine, the 567th lysine is replaced by arginine, the 582nd phenylalanine is replaced by tyrosine, the 585th glutamine is replaced by histidine, and the 601st glycine is replaced by aspartic acid.

2. A fusion protein comprising the β-glucuronidase mutant described in claim 1, a linker peptide that binds to the β-glucuronidase mutant, and a VH region or VL region of an antibody that binds to the linker peptide.

3. A nucleic acid encoding the fusion protein according to claim 2.

4. A method for detecting an antigen in a sample, comprising the steps of contacting the sample with a fusion protein described in claim 2 containing an antibody VH region and a fusion protein described in claim 2 containing an antibody VL region, and detecting tetramer formation of a β-glucuronidase mutant based on a change in β-glucuronidase activity.

5. 3. An antigen detection kit comprising the fusion protein according to claim 2 containing an antibody VH region and the fusion protein according to claim 2 containing an antibody VL region.

6. A fusion protein comprising the β-glucuronidase mutant described in claim 1, a linker peptide that binds to the β-glucuronidase mutant, and a VH region of a heavy chain antibody that binds to the linker peptide.

7. A nucleic acid encoding the fusion protein according to claim 6.

8. A method for detecting an antigen in a sample, comprising the steps of contacting the sample with the fusion protein described in claim 6 and detecting tetramer formation of a β-glucuronidase mutant based on a change in β-glucuronidase activity.

9. An antigen detection kit comprising the fusion protein according to claim 6.

Images