Novel minimal UTR sequence

Abstract

To provide RNA molecules harboring novel UTR sequences being extremely short and at the same time allowing for high translation efficiencies of the RNA molecules.SOLUTION: Disclosed is an RNA molecule comprising: (a) a coding region, including a start codon at its 5' end, coding a polypeptide; and (b) directly upstream the coding sequence, a UTR selected from the group consisting of (b1), which is a UTR of a sequence R2-CGCCACC or a UTR of a sequence where part of the sequence is substituted, where R2 is an RNA sequence corresponding to the part of a promoter region starting with the nucleotide where a DNA-dependent RNA-polymerase initiates RNA synthesis, where the R2 is selected from the group consisting of specific sequences (i) to (iv), where the RNA molecule comprises a poly-A tail at the 3' end, when R2 is (i) or (ii), the maximal length of the UTR is 14 nucleotides, and when the R2 is (iii) or (iv), the maximal length of the UTR is 12 nucleotides.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to a DNA molecule that can be transcribed into an mRNA harboring a novel UTR sequence, which combines the advantages of being extremely short and at the same time allowing high translation efficiency of an RNA molecule containing said UTR sequence.Furthermore, the present invention relates to a vector comprising said DNA molecule and a host cell comprising said vector.Furthermore, the present invention relates to a corresponding RNA molecule containing said UTR.Furthermore, the present invention relates to a pharmaceutical composition comprising said RNA molecule and optionally a pharma- ceutically acceptable carrier, and to the use of said UTR for translating the coding region of an RNA molecule into a polypeptide or protein encoded by said coding region. [Background technology]

[0002] In recent years, messenger RNA (mRNA) has become increasingly important as a novel drug entity. In contrast to DNA-based gene therapy, mRNA does not need to be transported to the nucleus and is directly translated into protein in the cytoplasm (J Control Release, 2011, 150:238-247, and Eur J Pharm Biopharm, 2009, 71:484-489). This makes mRNA safer to avoid potential insertional mutagenesis, a rare but real risk of DNA gene medicines. As a result, mRNA therapy is emerging as a promising alternative to gene and protein replacement therapy in a wide variety of medical indications (J Control Release, 2011, 150:238-247; Eur J Pharm Biopharm, 2009, 71:484-489; Nat Biotech, 2011, 29:154-157, and Nat Rev Genet, 2011, 12:861-874). However, to further establish the clinical applicability of mRNA, the strong immunogenicity and limited stability of conventional mRNA must be overcome. In this regard, the stability of mRNA and especially the translation rate of mRNA are essential parameters for the envisioned medical applications. This is because the translation rate of mRNA determines the dosage and administration interval of mRNA drugs.

[0003] Several strategies have proven successful in both increasing stability and reducing the immunogenic response caused by mRNA administered to cells or organisms. These include chemically modified nucleotides; Current Opinion in Drug Discovery and Development, 2007, 10:523. Kormann et al. showed that replacing only 25% of uridine and cytidine residues with 2-thiouridine and 5-methyl-cytidine is sufficient to increase mRNA stability and reduce the activation of innate immunity caused by exogenously administered mRNA in vitro (WO 2012 / 0195936A1; WO 2007024708A2).

[0004] It has also been reported that the untranslated region (UTR) of mRNA plays a central role in controlling both mRNA stability and mRNA translation. UTR is known to affect translation initiation, elongation, and termination, as well as mRNA stabilization and subcellular localization, through interactions with RNA-binding proteins (Briefings in Bioinformatics, 2000, 1:236-249 and Cold Spring Harbor Monograph Archive, 2007, 48:87-128). Depending on the specific motifs within the UTR, UTRs can increase or decrease mRNA turnover (Cell. Mol. Life Sci., 2012, 69:3613-3634; Nucleic Acids Research, 2005, 33:D141-D146; Science, 2005, 309:1514-1518 and Current Protein & Peptide Science, 2012, 13:294-304). Recently, data on mRNA half-life and the corresponding UTR sequences have been published (Nucleic Acids Research, 2011, 39:556-566 and Nucleic acids research, 37, e115).

[0005] UTRs are the regions of an mRNA molecule that are located upstream of the start codon and downstream of the stop codon of the mRNA. These regions are regions that are not translated, i.e. sequences that are not translated. These regions are transcribed together with the coding region and therefore are the exons present in the mature mRNA. The UTR upstream of the start codon of the mRNA is called the 5'UTR and, once transcribed, harbors, among other things, a sequence that corresponds to the (remaining 3') part of the promoter and the so-called Kozak sequence.

[0006] The Kozak consensus sequence, Kozak consensus, or Kozak sequence, is a sequence known to occur in eukaryotic mRNAs, with the consensus (gcc)gccRccAUGG. The Kozak consensus sequence plays a key role in the initiation of the translation process. The sequence is named after the person who made it famous, Marilyn Kozak. This sequence in an RNA molecule is recognized by ribosomes at the translation start site, from which a protein is encoded in that mRNA molecule. The ribosome needs this sequence, or a possible variant of it, to begin translation. The sequences are identified by the symbol (gcc)gccRccAUGG, which summarizes data analyzed by Kozak from a wide range of sources (about 699 in total), as follows: lower case letters indicate the most common base at a position (although the base can vary); upper case letters indicate highly conserved bases, i.e., the "AUGG" sequence is constant and rarely, if ever, varies; the R indicates that a purine (adenine or guanine) is always observed at that position (Kozak argues that adenine is more frequent); the sequence in brackets ((gcc)) is of unknown origin.

[0007] The Kozak consensus sequence was originally defined as ACCAUGG by analysis of point mutations around the translation initiation codon (AUG, where A defines position +1 in this context) of the preproinsulin gene. More detailed mutagenesis of 699 vertebrate mRNAs yielded the consensus sequence GCCGCCACCAUGG, in which the A at position -3 upstream of the AUG initiation codon can also be a G (Nucleic Acids Res., 1987, 15 (20):8125-8148). Studies of preproinsulin and alpha-globin translation in eukaryotic cells have revealed that a purine (usually A) at position -3 is essential for efficient translation initiation, and in its absence, a G at position +4 is essential (J. Cell Biol., 1989, 108:229-41). The amount of protein synthesized from an mRNA molecule is strongly dependent on the sequence of the Kozak element. Right: The AUG start codon, which codes for the N-terminal methionine of the protein, is the most important. For a strong consensus, the nucleotides at positions +4 (G) and -3 (A or G) must both match the consensus. A sufficient consensus sequence has only one of these two sites, while a weak consensus sequence does not meet the requirement at either position +4 or -3. The two cytidine residues at -1 and -2 are less conserved (Cell, 1986, 44 (2):283-92), while the G at position -6 is important for translation initiation. (Br. J. Haematol., 2004, 124 (2):224-31). Summary of the Invention [Problem to be solved by the invention]

[0008] Although the prior art has already described means and methods for increasing the stability of mRNA, reducing the immunogenic response caused by the mRNA administered to a cell or organism, and increasing the expression efficiency (i.e., transcription efficiency and / or translation efficiency), there is still a need for improvement, especially with regard to additional or alternative means for increasing the expression efficiency (i.e., transcription efficiency and / or translation efficiency), since the expression efficiency is an essential parameter for the envisaged medical applications, for example, since it determines the dosage and administration interval of the mRNA drug, and ultimately the bioavailability of the final product, i.e., the encoded peptide or protein. At the same time, there is also a certain need to reduce the cost of producing mRNA drugs, increase the yield of the produced mRNA molecules, and increase the space available for the actual transgene, i.e., the coding region that codes for the desired polypeptide, in the produced mRNA molecules.

[0009] The present application addresses this need by providing embodiments as defined in the claims. [Means for solving the problem]

[0010] In particular, the present application has surprisingly found that it is possible to reduce the size of the UTR sequence to a "minimal UTR" sequence, thereby reducing the production cost of the mRNA drug, increasing the yield of the generated mRNA molecule, and increasing the space available for the actual transgene, i.e. the coding region encoding the desired polypeptide, in the generated mRNA molecule.Furthermore, at the same time, it has surprisingly found that this minimal UTR sequence maintains and even improves the expression rate compared to conventional UTR sequences, while modifications in this minimal UTR sequence even increase the expression rate of the mRNA molecule.

[0011] This discovery leads to the provision of the embodiments characterized in the claims, in particular the provision of DNA molecules that allow the generation of RNA molecules harboring such "minimal UTR" sequences and the provision of the corresponding RNA molecules.

[0012] In the first embodiment, the corresponding molecules are described at the DNA level, whereas further below, in the second embodiment, the corresponding molecules are described at the RNA level.

[0013] Thus, in a first aspect, the present invention provides a DNA molecule capable of being transcribed into mRNA, comprising the following elements: (a) a coding region including an initiation codon at its 5' end and encoding a polypeptide; (b) a sequence immediately upstream of the coding sequence selected from the group consisting of: (b1) and (b2); or a complementary strand, (b1) is R1-CGCCACC (SEQ ID NO:1); or In said sequence, C at position 6 of SEQ ID NO:1 is replaced with A, at position 7 of SEQ ID NO:1, C is replaced with G; and / or at position 5 of SEQ ID NO:1, A is replaced with G; (b2) is R1-CNGCCACC (SEQ ID NO:2), in which nucleotide N at position 2 of SEQ ID NO:2 is a nucleotide selected from the group consisting of T, G, C, or A; or In said sequence, C at position 7 of SEQ ID NO:2 is replaced with A, and / or a substitution of A at position 6 of SEQ ID NO:2 with G; R1 refers to a DNA molecule that is a promoter recognized by a DNA-dependent RNA polymerase.

[0014] A DNA sequence is called "sense" if its sequence is the same as that of the messenger RNA copy that is translated into protein. The sequence of the opposite, complementary strand is called the "antisense" sequence. While the DNA molecules of the present invention are defined above in (a) and (b) by reference to the sense strand, the corresponding complementary antisense strand can be easily determined by one skilled in the art, taking into account base pairing rules.

[0015] The DNA molecule of the present invention is a DNA molecule that can be transcribed into an mRNA molecule.Transcription is the first step of gene expression, in which a specific segment of a DNA molecule is copied into an mRNA molecule by the enzyme RNA polymerase.During transcription, the DNA sequence is read by RNA polymerase to produce a complementary, non-parallel RNA strand, called the primary transcription product.

[0016] Only one of the two DNA strands acts as a template for transcription. Antisense DNA The strand is read from the 3' end to the 5' end during transcription (3'→5') by a DNA-dependent RNA polymerase. A complementary RNA is made on the opposite side in a 5'→3' direction, which matches the sequence of the sense strand, except that uracil is switched to thymine. This directionality is because RNA polymerase can only add nucleotides to the 3' end of the growing mRNA strand. The non-template sense strand of DNA is called the coding strand, since its sequence is the same as the newly made RNA transcript (except for the replacement of uracil with thymine). This is the strand used by convention in the context of the present invention to present the DNA sequence.

[0017] A DNA molecule of the present invention can be double-stranded, single-stranded, or partially double-stranded and partially single-stranded.

[0018] The DNA molecule of the present invention comprises two main modules (also called "items"): (a) a coding region encoding a polypeptide and including an initiation codon at its 5' end, and (b) a sequence immediately upstream of said coding region, as defined herein above in (b1) or (b2). Such a DNA molecule, when transcribed, results in an mRNA with a very short UTR sequence providing the above-mentioned advantages.

[0019] Furthermore, the DNA molecules of the present invention preferably contain sequences which, when transcribed into mRNA, give rise to UTRs downstream of the coding region. Thus, the DNA molecules of the present invention preferably harbor a coding region and sequences which, upon transcription, give rise to (5' and 3') untranslated regions (UTRs) in the resulting mRNA molecule.

[0020] As used in accordance with the present invention, the term "coding region comprising an initiation codon at its 5' end" refers to a DNA sequence composed of codons, which can be transcribed by a DNA-dependent RNA polymerase into an mRNA molecule, and the corresponding mRNA molecule can be decoded according to the information provided by the "genetic code" and translated into a protein by the ribosome. A coding region generally begins with an initiation codon at its 5' end and ends with a stop codon. In general, the initiation codon is an ATG triplet (corresponding to an AUG triplet at the RNA level) and the stop codons are TAA, TAG, or TGA (corresponding to UAA, UAG, or UGA at the RNA level). In addition to encoding a protein, a coding region portion may function as a control sequence for a pre-mRNA, as an exon splicing enhancer or exon splicing silencer. The coding region of a gene encoding a polypeptide or protein for use in accordance with the present invention is also known as a coding sequence or CDS (from coding DNA sequence) and is the DNA sequence of the gene. A portion of a nucleic acid or RNA that is composed of exons and codes for a polypeptide or protein. The coding region of an mRNA is flanked by a 5' untranslated region (5'UTR) and a 3' untranslated region (3'UTR), which are also part of the exons. In addition, an mRNA molecule may further comprise a so-called 5' cap and a polyA tail. The 5' cap, 5'UTR, 3'UTR, and polyA tail are regions of an mRNA molecule that are not translated into a protein.

[0021] As used in accordance with the present invention, the term "untranslated region" or "UTR" refers to the area of ​​the mRNA upstream of the start codon and downstream of the stop codon that is not translated, and is therefore referred to as the 5 prime untranslated region (5'UTR) and the 3 prime untranslated region (3'UTR), respectively. These regions are transcribed together with the coding region, and therefore, they are exons, since they are present in the mature mRNA.

[0022] As used herein, 3' untranslated region (3'UTR) refers to the region of a messenger RNA (mRNA) that immediately follows the translation termination codon. 3'UTR refers to the region that contains regulatory regions within the 3' untranslated region that are known to affect polyadenylation and mRNA stability. Many 3'UTRs also contain AU-rich elements (AREs). In addition, the 3'UTR may preferably contain the sequence AAUAAA, which directs the addition of several hundred adenine residues, called a poly(A) tail, to the end of the mRNA transcript.

[0023] The 5´ untranslated region (5´UTR), also known as the leader sequence or leader RNA, is the region of an mRNA immediately upstream of the start codon. The 5´UTR begins at the transcription start site and ends one nucleotide (nt) before the start codon of the coding region (usually AUG in the mRNA). In eukaryotes, the length of the 5´UTR is generally between 100 and several thousand nucleotides long, although sometimes shorter UTRs occur in eukaryotes.

[0024] In the present invention, the sequence between the promoter and the coding region (as defined in (b1) or (b2) above) is extremely short, resulting in an mRNA molecule, upon transcription, with a very short "minimal" UTR sequence.

[0025] A module of a DNA molecule, i.e., "a coding region comprising an initiation codon at its 5' end and encoding a polypeptide" (module (a)), is not particularly limited and can be any desired coding region expressed in a given cell. Thus, this module can be a coding region encoding a desired polypeptide, i.e., a desired end product. The present invention is not limited with respect to "a coding region comprising an initiation codon at its 5' end and encoding a polypeptide", since the nature of the coding region depends on the desired product to be produced in the cell. Such a coding region can also be a nucleotide sequence that differs from a known native sequence and contains mutations (i.e., point mutations, insertion mutations, deletions, and combinations thereof). Furthermore, such a coding region can be a codon-optimized sequence derived from a native sequence, partially or fully, used as module (a). Codon optimization is a technique that maximizes protein expression by increasing the translation efficiency of mRNA derived from a gene of interest. It is known that native genes do not use available codons randomly, but rather show certain preferences for certain codons for the same amino acid. Therefore, due to the degeneracy of the genetic code - one amino acid can be coded for by several codons - the nucleotide sequence of the subject gene is transformed into the preferred codon set of the same or another species.

[0026] As mentioned, module (a) is not particularly limited and can be any desired coding region that is expressed in a given cell. Thus, in the context of the present invention, a "coding region" is understood to mean any poly-desoxyribonucleotide molecule that, when introduced into a cell, can be transcribed into an mRNA molecule that is translatable into a polypeptide / protein or a fragment thereof. The terms "polypeptide" and "protein" as used herein encompass any type of amino acid sequence, i.e., two or more amino acid chains linked together via peptide bonds, including peptides and fusion proteins. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0027] In a preferred embodiment, the "coding region comprising an initiation codon at its 5' end and encoding a polypeptide" contains a deoxyribonucleotide sequence encoding a polypeptide / protein or a fragment thereof whose function is required or beneficial in or near a cell, e.g. a protein whose defective or defective form triggers a disease or disorder, whose provision can alleviate or prevent a disease or disorder, or a protein that can promote a process beneficial to the body in or near a cell. The coding region may contain the sequence of a complete protein or a functional variant thereof. Furthermore, the deoxyribonucleotide sequence of the coding region may encode a protein or a functional fragment thereof that acts as a factor, inducer, regulator, stimulator, or enzyme, where the protein is required for its function to treat a disorder, particularly a metabolic disorder, or to initiate a process in vivo, such as the formation of new blood vessels, tissue, etc. Herein, functional variants are used. A variant is understood to mean a fragment which assumes in a cell a function of a protein whose function is necessary in the cell or whose defective or defective form is pathogenic.

[0028] In a preferred embodiment, the "coding region comprising an initiation codon at its 5' end and encoding a polypeptide" encodes a therapeutically or medically active polypeptide or protein having a therapeutic or prophylactic effect. Thus, the DNA molecule of the present invention comprising said "coding region comprising an initiation codon at its 5' end and encoding a polypeptide" and capable of being transcribed into mRNA can be used in nucleic acid therapy and related applications. In this context, according to the present invention, the transcription of the DNA molecule of the present invention into mRNA and further translation into a polypeptide or protein may be intended to compensate or complement endogenous gene expression, particularly when the endogenous gene is defective or silent, resulting in no product of gene expression or insufficient or defective or dysfunctional product, such as in the case of many metabolic and genetic diseases, such as cystic fibrosis, hemophilia, or muscular dystrophy, to name a few. The transcription of the DNA molecule of the present invention into mRNA and further translation into a polypeptide or protein may also be intended to cause the expression product to interact or interfere with any endogenous cellular process, such as the regulation of gene expression, signal transduction, and other cellular processes. The transcription of the DNA molecule of the present invention into mRNA and further translation into a polypeptide or protein may also be intended to generate an immune response in an organism in which the transduced or transduced cell is present or has been made to be present. An example is the genetic modification of antigen-presenting cells, such as dendritic cells, to present antigens for vaccination. Another example is the transcription of the DNA molecule of the present invention into mRNA and further translation into a polypeptide or protein, where the coding region codes for a cytokine. This may be desirable, for example, in tumors, to induce a tumor-specific immune response. Furthermore, the transcription of the DNA molecule of the present invention into mRNA and further translation into a polypeptide or protein may also be intended to generate transiently genetically modified cells for cell therapy, such as modified T cells or precursors or stem cells or other cells, in vivo or ex vivo, for regenerative medicine.

[0029] In another preferred embodiment, the "coding region comprising an initiation codon at its 5' end and encoding a polypeptide" may encode a protein that plays a role in growth processes and angiogenesis, which is necessary, for example, for controlling regeneration, and thus can be specifically formed by the introduction of the RNA molecule of the present invention. This may be useful, for example, in implants and transplants for growth processes or for the treatment of bone and tissue abnormalities.

[0030] As mentioned, the DNA molecules and, in particular, the correspondingly transcribed RNA molecules of the present invention, which comprise a "coding region that includes an initiation codon at its 5' end and encodes a polypeptide", can be suitably used when the body must be provided with a polypeptide or protein that would naturally occur in the body, but which is absent or present in a defective form or in very low amounts due to a genetic defect or disease. Proteins and the genes encoding them, the deficiencies or defects of which are associated with diseases, are known. The intact versions of the respective coding regions encoding the intact polypeptides or proteins can be used according to the present invention.

[0031] Many genetic disorders caused by mutations in a single gene are known and are candidates for mRNA therapeutic approaches. Cystic fibrosis, hemophilia, and many other disorders caused by single gene mutations can be dominant or recessive in terms of the likelihood of a trait being expressed in offspring. A dominant allele expresses a phenotype in individuals who have only one copy of the allele, whereas for a recessive allele to be dominant, an individual must have two copies, one from each parent. In contrast, polygenic disorders are caused by more than one gene. The expression of each disease is often dynamic and related to environmental factors. Examples of polygenic disorders are high blood pressure, elevated cholesterol levels, cancer, neurodegenerative disorders, psychiatric disorders, and others. In these cases, therapeutic mRNAs that represent one or more of these genes may also be beneficial to the patient. Furthermore, genetic disorders may also be caused by new mutations that should not have been inherited from the genes of the parents. In these cases, therapeutic mRNAs that represent the correct gene sequence may also be beneficial to the patient.

[0032] Currently, an online catalog containing 22,993 entries of human genetic disorders, together with a description of each gene and its phenotype, is available at the ONIM (Online Mendelian Inheritance in Man) webpage (http: / / onim.org); the respective sequences are available at the Uniprot database (http: / / www.uniprot.org). As a non-limiting example, the following Table 1 lists some congenital diseases and their corresponding genes. Due to the high degree of interaction of cell signaling pathways, mutations in a certain gene cause a multiplicity of pathogenic symptoms, of which only characteristic ones are listed in Table 1.

[0033] In some embodiments of the invention, the therapeutic protein is selected from the cellular proteins listed in Table 1. Thus, a DNA molecule of the invention can encode a therapeutic cellular protein, where the encoded therapeutic protein is one listed in Table 1 or a homolog thereof.

[0034] In another embodiment of the invention, the therapeutic protein is selected from the secreted proteins listed in Table 1. Thus, the DNA molecule of the invention may encode a therapeutic fusion protein, the encoded therapeutic protein or a homologue thereof being one listed in Table 1, and the second protein being a signal peptide that allows secretion of the therapeutic protein. A signal peptide is a short, typically 5-30 amino acid long, amino acid sequence present at the N-terminus of said therapeutic protein, which directs the fusion protein through certain organelles (i.e., the endoplasmic reticulum, the Golgi apparatus, or endosomes) into the cellular secretory pathway. Thus, such fusion proteins are either secreted from a cell or organelle, or inserted into a cell membrane (e.g., multispanning transmembrane proteins) of a cell compartment or cell surface.

[0035] Thus, in a preferred embodiment of the invention, the "coding region comprising an initiation codon at its 5' end and encoding a polypeptide" (module (a)) may encode, but is not limited to, the following genes that cause, predispose to, or protect against disease: Non-limiting examples of such disorders that may be treated (or prevented) include those in which the polypeptide, protein, or peptide is selected from the group consisting of those outlined in Table 1 below.

[0036] In some embodiments, the "coding region encoding a polypeptide, comprising an initiation codon at its 5' end" can be transcribed and translated into a partial or full-length protein that has the same or higher level of cellular activity as the native protein. In some embodiments, the "coding region encoding a polypeptide, comprising an initiation codon at its 5' end" encodes a therapeutically or pharma- ceutically active polypeptide, protein or peptide having a therapeutic or prophylactic effect, said polypeptide, protein or peptide being selected from the group consisting of those outlined in Table 1 below. The "coding region encoding a polypeptide, comprising an initiation codon at its 5' end" can be used to express a partial or full-length protein that has the same or lower level of cellular activity as the native protein. This can allow for the treatment of diseases for which administration of RNA molecules may be indicated.

[0037] Non-Limiting Examples of Human Genes and Genetic Disorders [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] [Table 1-6] [Table 1-7] [Table 1-8] [Table 1-9] [Table 1-10] [Table 1-11]

[0038] Table 1 above shows examples of genes whose defects lead to diseases that can be treated with RNA molecules transcribed from the DNA molecules of the invention, said DNA molecules (and the correspondingly transcribed RNA molecules) comprising a "coding region that includes an initiation codon at its 5' end and codes for a polypeptide" that codes for an intact version of the protein of the defective gene disclosed above or a functional fragment thereof. In a particularly preferred embodiment, the following genetic diseases may be mentioned: genetic diseases affecting the lungs, such as SPB (surfactant protein B) deficiency, ABCA3 deficiency, cystic fibrosis, and α1-antitrypsin deficiency, or genetic diseases affecting plasma proteins, such as congenital hemochromatosis (hepcidin deficiency), thrombotic thrombocytopenic purpura (TPP, ADAMTS13 deficiency), causing coagulation disorders (e.g. hemophilia a and b) and complement deficiencies (e.g. protein C deficiency). Hereditary diseases, immune deficiencies, such as SCID (caused by mutations in different genes such as RAG1, RAG2, JAK3, IL7R, CD45, CD3δ, CD3ε) or due to deficiency, for example, of adenosine deaminase (ADA-SCID), septic granulomatous disease (caused by mutations, for example, in the gp-91-phox, p47-phox, p67-phox or p33-phox genes), as well as Gaucher disease, Fabry disease, Krabbe disease, MPS I, MPS Storage diseases such as HSP II (Hunter syndrome), MPS VI, glycogen storage disease type II, or mucopolysaccharidoses.

[0039] Other disorders for which the invention may be useful that include a "coding region that includes an initiation codon at its 5' end and that encodes a peptide" include the following disorders: SMN1-associated spinal muscular atrophy (SMA); amyotrophic lateral sclerosis (ALS); GALT-associated galactosemia; cystic fibrosis (CF); SLC3A1-associated disorders, including cystinuria; COL4A5-associated disorders, including Alport syndrome; galactocerebrosidase deficiency; X-linked adrenoleukodystrophy and adrenomyeloneuropathy; Friedreich's ataxia; Pelizaeus-Merzbacher disease; TSC1- and TSC2-associated tuberous sclerosis; Sanfilippo B syndrome (MPS) IIIB);CTNS-associated cystinosis;FMR1-related disorders including fragile X syndrome, fragile X-associated tremor / ataxia syndrome and fragile X premature ovarian failure syndrome;Prader-Willi syndrome;Hereditary hemorrhagic telangiectasia (AT);Niemann-Pick disease type C1;Juvenile neuronal ceroid lipofuscinosis (JNCL), Juvenile Batten disease, Santavoli-Hartzia disease, Jansky-Beer disease Neuronal ceroid lipofuscin-related disorders including Skofski disease and PTT-1 and TPP1 deficiencies; childhood ataxia with central nervous system hypomyelination / white matter loss associated with EIF2B1, EIF2B2, EIF2B3, EIF2B4 and EIF2B5; transient ataxia type 2 associated with CACNA1A and CACNB4; MECP2-related disorders including classic Rett syndrome, MECP2-related severe neonatal encephalopathy and PPM-X syndrome; CDKL5-related atypical Rett syndrome; Kennedy autosomal dominant cerebral arteriopathy with Notch-3-related cortical infarctions and leukoencephalopathy (CADASIL); SCN1A and SCN1B-related seizure disorders; polymerase G-related disorders including Alpers-Huttenlocher syndrome, POLG-related sensory ataxic neuropathy, dysarthria and ophthalmoplegia, and autosomal dominant and recessive progressive external ophthalmoplegia with mitochondrial DNA deletions; X-linked adrenal hypoplasia; X-linked agammaglobulinemia; Fabry disease; and Wilson's disease.

[0040] In all these diseases, a protein, e.g., an enzyme, is missing, which can be treated by treatment with RNA transcribed from the DNA molecule of the present invention, making the protein or functional fragment thereof encoded by the missing gene available. Transcript replacement therapy / enzyme replacement therapy does not affect the underlying genetic defect, but increases the concentration of the enzyme that is missing in the patient. As an example, in Pompe disease, transcript replacement therapy / enzyme replacement therapy replaces the missing lysosomal enzyme acid alpha-glucosidase (GAA).

[0041] Thus, non-limiting examples of proteins that may be encoded by the "coding region comprising an initiation codon at its 5' end and encoding a polypeptide" of module (a) of the present invention are growth factors such as erythropoietin (EPO), growth hormone (somatotropin, hGH), cystic fibrosis transmembrane conductance regulator (CFTR), GM-SCF, G-CSF, MPS, protein C, hepcidin, ABCA3 and surfactant protein B. Further examples of diseases treatable with the RNA of the present invention are hemophilia A / B, Fabry disease, CGD, ADAMTS13, Hurler disease, X-mediated A-gamma-globulinemia, adenosine deaminase-associated immunodeficiency and neonatal respiratory distress syndrome associated with SP-B. Particularly preferably, the "coding region comprising an initiation codon at its 5' end and encoding a polypeptide" of the DNA molecule of the present invention contains the sequence of surfactant protein B (SP-B) or erythropoietin. Further examples of proteins that may be encoded by the "coding region comprising an initiation codon at its 5' end and encoding a polypeptide" of the DNA molecule of the present invention are growth factors such as human growth hormone hGH, BMP-2 or angiogenic factors.

[0042] Alternatively, the nucleic acid may encode a full-length antibody or a smaller antibody (e.g., both heavy and light chains) to confer immunity to a subject. In another embodiment, the "coding region that includes an initiation codon at its 5' end and encodes a polypeptide" may encode a functional monoclonal or polyclonal antibody that may be useful for targeting and / or inactivating a biological target (e.g., a stimulatory cytokine such as tumor necrosis factor). Similarly, the "coding region that includes an initiation codon at its 5' end and encodes a polypeptide" may encode a functional anti-nephrotic factor antibody that is useful, for example, for treating membranoproliferative glomerulonephritis type II or acute hemolytic uremic syndrome, or an anti-vascular endothelial growth factor (VEGF) antibody that is useful for treating VEGF-mediated diseases, such as cancer.

[0043] Module (a), i.e., "containing an initiation codon at its 5' end and encoding a polypeptide" A "coding region that encodes a polypeptide or protein that can be used in genome editing technology" can be a coding region that encodes a polypeptide or protein that can be used in genome editing technology. Genome editing is a type of genetic engineering that uses nucleases to insert, delete, or replace DNA in the genome of an organism. These nucleases create site-specific double-strand breaks (DSBs) at the desired location in the genome. The induced double-strand breaks are repaired by non-homologous end joining or homologous recombination, resulting in the insertion of the target gene into the genome. This results in selective mutations, thereby "editing" the genome. Numerous genome editing systems that utilize different polypeptides or proteins are known in the art, such as CRISPR-Cas systems, meganucleases, zinc finger nucleases (ZFNs) and transcription activator-like effector-based nucleases (TALENs). Genome engineering methods are reviewed in Biotechnology, 2013, 31 (7), 397-405.

[0044] Thus, in a preferred embodiment, the "coding region comprising an initiation codon at its 5' end and encoding a polypeptide" comprises a deoxyribonucleotide sequence encoding a polypeptide or protein of the Cas (CRISPR associated protein) protein family, preferably Cas9 (CRISPR associated protein 9). The Cas protein family protein, preferably Cas9, can be used in CRISPR / Cas9-based methods and / or CRISPR / Cas9 genome editing technology. The CRISPR-Cas system for genome editing, control and targeting is reviewed in Nat. Biotechnol., 2014, 32(4):347-355.

[0045] In another preferred embodiment, the "coding region comprising an initiation codon at its 5' end and encoding a polypeptide" contains a deoxyribonucleotide sequence encoding a meganuclease. Meganucleases are endodeoxyribonucleases that, in contrast to "conventional" endodeoxyribonucleases, recognize large recognition sites (e.g., double-stranded DNA sequences of 12-40 base pairs). As a result, each site occurs only a few times, preferably only once, in any given genome. Therefore, meganucleases are considered to be the most specific naturally occurring restriction enzymes and are therefore suitable tools in genome editing technology.

[0046] In another preferred embodiment, the "coding region comprising an initiation codon at its 5' end and encoding a polypeptide" contains a deoxyribonucleotide sequence encoding a zinc finger nuclease (ZFN). ZFNs are artificial restriction enzymes generated by fusing a zinc finger DNA binding domain to a DNA cleavage domain. The zinc finger domain can be engineered to target specific desired DNA sequences, allowing the zinc finger nuclease to target unique sequences within complex genomes. By utilizing endogenous DNA repair mechanisms, ZFNs can be used to precisely modify the genome of higher organisms, making them a suitable tool for genome editing technology.

[0047] In another preferred embodiment, the "coding region comprising an initiation codon at its 5' end and encoding a polypeptide" contains a deoxyribonucleotide sequence encoding a transcription activator-like effector nuclease (TALEN). A TALEN is a restriction enzyme that can be engineered to cleave a specific sequence of DNA. A TALEN is a fusion protein in which a TAL effector DNA binding domain is fused to a DNA cleavage domain of a nuclease. A transcription activator-like effector (TALE) can be engineered to bind to practically any desired DNA sequence. Thus, when combined with a nuclease, it is possible to cleave DNA at a specific desired location.

[0048] The DNA module of the present invention comprises as a second module (b) a sequence located immediately upstream of the coding sequence.

[0049] More specifically, the DNA module of the present invention comprises a module (b) immediately upstream of the coding sequence, the module (b) being a sequence selected from the group consisting of the following (b1) and (b2): (b1) is R1-CGCCACC (SEQ ID NO:1); or In said sequence, C at position 6 of SEQ ID NO:1 is replaced with A, at position 7 of SEQ ID NO:1, C is replaced with G; and / or at position 5 of SEQ ID NO:1, A is replaced with G; (b2) is R1-CNGCCACC (SEQ ID NO: 2), a sequence in which nucleotide N at position 2 of ID NO:2 is a nucleotide selected from the group consisting of T, G, C, or A; or In said sequence, C at position 7 of SEQ ID NO:2 is replaced with A, and / or a substitution of A at position 6 of SEQ ID NO:2 with G; R1 is the promoter recognized by the DNA-dependent RNA polymerase.

[0050] The sequences defined in item (b) herein above are not particularly limited to the specific sequences above, but also relate to sequences that exhibit nucleotide additions compared to such sequences, said added nucleotides may be added to the 5' end of R1 of said sequences. The added nucleotides include a polynucleotide chain of up to 0 (unchanged), 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides, preferably up to 20 nucleotides. More preferably, 11, 12, 13, 14, 15, 16, 18, or 19 nucleotides are added to the 5' end. Even more preferably, up to 30 nucleotides are added to the 5' end.

[0051] Since the addition of nucleotides upstream of promoter R1 does not alter the above-mentioned functional properties of the UTR of the present invention, the length of the addition of nucleotides can be up to 40, 50, 60, 70, 80, 90, or even 100 nucleotides, or even up to 200, 300, 400, or 500 nucleotides.

[0052] As mentioned above, a double-stranded DNA molecule comprises two antiparallel strands, one of which is called the "sense" strand if its sequence is the same as that of the messenger RNA copy that is translated into protein. The opposite, complementary strand sequence is called the "antisense" sequence. Thus, the DNA molecule of the present invention not only relates to the above DNA molecule corresponding to an mRNA, comprising a single strand having the above elements (a) and (b), but also to a DNA molecule comprising a complementary strand, i.e., an antisense strand that can be transcribed into an mRNA. This complementary strand of the DNA molecule of the present invention is defined by reference to the antisense strand, which can be easily determined given the base pairing rules.

[0053] The DNA molecule of the invention also comprises within module (b) a promoter R1 recognised by the DNA-dependent RNA polymerase, preferably linked directly, i.e. without the occurrence of any intervening nucleotides, to the remaining sequences defined in item (b1) or (b2).

[0054] The nature of the promoter R1 recognized by the DNA-dependent RNA polymerase is not particularly limited. Any promoter (and its variants) can be used as long as the corresponding DNA-dependent RNA polymerase is capable of recognizing the respective sequence. A large number of RNA polymerases (also known as DNA-dependent RNA polymerases, often abbreviated as RNAP or RNApol) are known in the art. These enzymes are capable of generating a primary transcript RNA. As outlined above, DNA-dependent RNA polymerases are capable of synthesizing an RNA strand using DNA as a template in a process called transcription. DNA-dependent RNA polymerases initiate transcription at a specific DNA sequence known as a promoter. DNA-dependent RNA polymerases then generate an RNA strand complementary to the template DNA strand. The process of adding nucleotides to an RNA strand is known as an elongation reaction. That is, in the context of the present invention, the term "recognize" preferably refers to the fact that the DNA-dependent RNA polymerase is capable of synthesizing the RNA strand using the DNA as a template. It does not only mean that the corresponding promoter sequence R1 can be specifically detected / bound, but also that the DNA-dependent RNA polymerase can initiate transcription and then generate an RNA molecule during the elongation reaction.

[0055] Those skilled in the art can determine whether a given DNA-dependent RNA polymerase can recognize the respective promoter by methods known in the art. Furthermore, by using well-known methods for evaluating protein / DNA interactions, it is possible to identify the corresponding (unknown) promoter sequence R1 of a given DNA-dependent RNA polymerase, and vice versa.

[0056] Thus, the ability of the DNA-dependent RNA polymerase to recognize / bind to its promoter R1 and, preferably, to initiate transcription can be determined by methods known in the art, for example as described in Journal of Biological Chemistry, 1993, 268(26):19299-19304. While the discovery of multiple DNA-dependent RNA polymerases has been reported in the Journal of Biological Chemistry, 2005, 280(52): 42477-42485).

[0057] In a preferred embodiment, the promoter R1 recognised by the DNA-dependent RNA polymerase is a bacteriophage promoter.

[0058] By way of example only, it is known in the art that T7 DNA-dependent RNA polymerase recognizes the sequence TAATACGACTCACTATAGGGAGA (SEQ ID NO:3), T3 DNA-dependent RNA polymerase recognizes the sequence AATTAACCCTCACTAAAGGGAGA (SEQ ID NO:4), SP6 DNA-dependent RNA polymerase recognizes the sequence ATTTAGGTGACACTATAGAAG (SEQ ID NO:5) and K11 DNA-dependent RNA polymerase recognizes the sequence AATTAGGGCACACTATAGGGA (SEQ ID NO:6). However, these examples are provided for illustrative purposes only, since the invention is not limited to these promoters and corresponding DNA-dependent RNA polymerases. In fact, any promoter (and its variants) can be used, as long as the corresponding DNA-dependent RNA polymerase, preferably a bacteriophage DNA-dependent RNA polymerase, is capable of recognizing the respective sequence.

[0059] In a preferred embodiment, R1 is: (i) TAATACGACTCACTATAGGGAGA (SEQ ID NO:3), or a sequence that exhibits 1 to 6 substitutions compared to SEQ ID NO:3 and is recognized by T7 DNA-dependent RNA polymerase; (ii) AATTAACCCTCACTAAAGGGAGA (SEQ ID NO:4), or a sequence which exhibits one to six substitutions compared to SEQ ID NO:4 and which is recognized by T3 DNA-dependent RNA polymerase; (iii) ATTTAGGTGACACTATAGAAG (SEQ ID NO:5), or a sequence that exhibits 1 to 6 substitutions compared to SEQ ID NO:5 and is recognized by SP6 DNA-dependent RNA polymerase; and (iv) AATTAGGGCACACTATAGGGA (SEQ ID NO:6), or a sequence that exhibits 1 to 6 substitutions compared to SEQ ID NO:6 and is recognized by K11 DNA-dependent RNA polymerase.

[0060] In another preferred embodiment, the sequence may be a sequence that exhibits 1-3, 4, or 5 substitutions, provided that the corresponding sequence is still capable of being recognized by T7, T3, SP6, and K11 DNA-dependent RNA polymerases, respectively. In a further preferred embodiment, the sequence may be a sequence that exhibits 1-2 substitutions, provided that the corresponding sequence is still capable of being recognized by T7, T3, SP6, and K11 DNA-dependent RNA polymerases, respectively. Provided that it can be recognized by T3, SP6, and K11 DNA-dependent RNA polymerases, respectively. Most preferably, the sequence may be one that exhibits a single substitution, provided that the corresponding sequence is still capable of being recognized by T7, T3, SP6, and K11 DNA-dependent RNA polymerases, respectively.

[0061] In other embodiments, the promoter sequence R1 recognized by the DNA-dependent RNA polymerase is not particularly limited to any of the sequences of SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6, or sequences showing 1 to 6 substitutions compared thereto, but may also be sequences showing 1 to 7, 8, 9, 10, 11, or 12 substitutions, provided that the corresponding sequences can still be recognized by the T7, T3, SP6, and K11 DNA-dependent RNA polymerases, respectively.

[0062] In a preferred embodiment, said substitutions in the sequences TAATACGACTCACTATAGGGAGA (SEQ ID NO:3), AATTAACCCTCACTAAAGGGAGA (SEQ ID NO:4), ATTTAGGTGACACTATAGAAG (SEQ ID NO:5) or AATTAGGGCACACTATAGGGA (SEQ ID NO:6) exclude the substitution with the 5 nucleotides "CACTA" at positions 11-12 of said sequences of SEQ ID NOs:3-6, since these 5 nucleotides are conserved between the four sequences.

[0063] In another preferred embodiment, said substitutions in the sequences of SEQ ID NOs:3-6 exclude the substitution of the nucleotide "T" in position 4 of said sequences of SEQ ID NOs:3-6, since this nucleotide is conserved among the four sequences.

[0064] In another preferred embodiment, said substitutions in the sequences of SEQ ID NOs:3-6 exclude the substitution of nucleotide "A" in position 5 of said sequences of SEQ ID NOs:3-6, since this nucleotide is conserved among the four sequences.

[0065] In another preferred embodiment, said substitutions in the sequences of SEQ ID NOs:3-6 exclude the substitution of the nucleotide "G" at position 18 of said sequences of SEQ ID NOs:3-6, since this nucleotide is conserved among the four sequences.

[0066] The ability of T7, T3, SP6 and K11 DNA-dependent RNA polymerases to recognize / bind to their promoter R1 can be determined by methods known in the art, as outlined above.

[0067] In a more preferred embodiment, the DNA molecule of the present invention is a DNA molecule comprising a module (b1) immediately upstream of said coding sequence, wherein in said module (b1), nucleotide N at position 2 of SEQ ID NO:2 is a nucleotide selected from the group consisting of T, G, or C, and nucleotide N is not A.

[0068] In an even more preferred embodiment, said nucleotide at position N in SEQ ID NO:2 is T.

[0069] In a preferred embodiment, the DNA molecule of the present invention is a DNA molecule in which the nucleotide immediately following the start codon is not the nucleotide G. In another preferred embodiment, the DNA molecule of the present invention is a DNA molecule in which the nucleotide immediately following the start codon is a nucleotide selected from the group consisting of A, T, and C.

[0070] In an even more preferred embodiment, the DNA molecule of the present invention is a DNA molecule comprising module (b1) as defined above, said module (b1) being a DNA molecule having the sequence: at position 6 of SEQ ID NO:1, C is substituted with A, at position 7 of SEQ ID NO:1, C is substituted with G; and / or at position 5 of SEQ ID NO:1, A is substituted with G, and the nucleotide immediately downstream of the start codon is a nucleotide selected from the group consisting of A, T, and C.

[0071] In another even more preferred embodiment, the DNA molecule of the invention is a DNA molecule comprising module (b2) as defined above, said module (b2) being a DNA molecule having the sequence: at position 7 of SEQ ID NO:2, C is substituted by A, at position 8 of SEQ ID NO:2, C is substituted by G; and / or at position 6 of SEQ ID NO:2, A is substituted by G, and the nucleotide immediately downstream of the start codon is a nucleotide selected from the group consisting of A, T, and C.

[0072] In molecular biology and genetics, upstream and downstream both refer to the relative positions of a DNA molecule. In the context of the present invention, upstream is toward the 5' end of the sense strand of the DNA molecule and downstream is toward the 3' end of the molecule.

[0073] Thus, in the present invention, the sequence defined in item (b) above is located immediately upstream of the coding region of item (a), more specifically immediately upstream of the start codon of the coding region. Thus, "immediately upstream" in this context means that there are no further nucleotides between the sequence defined in item (b) and the coding sequence beginning with the start codon. Thus, the coding region beginning with the start codon is directly adjacent to the sequence defined in item (b) above herein.

[0074] The DNA molecules of the present invention can be produced / synthesized recombinantly (e.g., in an in vivo or in vitro system) or synthetically (e.g., by a PCR reaction or in a chemical reaction) by methods known to those of skill in the art.

[0075] A DNA molecule of the invention is preferably a recombinant nucleic acid molecule, i.e., the DNA molecule of the invention is composed of elements that do not occur in nature in this combination. A nucleic acid molecule of the invention can be synthetic or semi-synthetic.

[0076] The DNA molecule may be in the form of a fusion DNA sequence of modules (a) and (b) (as defined in items (a) and (b) above, respectively), i.e. in the form of a (fusion) DNA molecule formed by combining at least two nucleotide sequences containing said modules. Typically, as will be explained in further more detail below, this can be achieved by cloning the cDNA into an expression vector allowing transcription into an RNA molecule. Thus, the DNA molecule of the invention may be a fusion DNA sequence, i.e. a chimeric molecule formed by linking two or more polynucleotides via a phosphate group attached to the 3' carbon of one nucleotide from another, forming phosphodiester bonds between each end of one module and the end of another module. In this way, said DNA molecule containing at least two modules is linked together in the form of a DNA molecule. Such a recombinant DNA molecule, once cloned in frame, can then be transcribed into its corresponding RNA nucleic acid sequence encoding said protein, polypeptide or enzymatic molecule.

[0077] The DNA molecule of the present invention can be introduced into a vector, preferably an expression vector, by standard molecular biology techniques (see, for example, Sambrook et al., Molecular Cloning, A laboratory manual, 2nd Ed, 1989). In the sense of the present invention, the term "expression vector" or " The term "vector", such as "cloning vector", is understood as a circular double-stranded DNA unit that self-replicates in a cell independently of chromosomal DNA and is used as a vehicle to carry genetic material into the cell, where it is replicated and / or expressed (i.e., transcribed into RNA and translated into amino acid sequences). A vector containing foreign DNA is referred to as recombinant DNA. The vector itself is generally a DNA sequence that typically consists of an insert (e.g., the nucleic acid molecule / DNA molecule of the present invention) and a larger sequence that serves as the "backbone" of the vector. Plasmids in the sense of the present invention are most frequently found in bacteria and are used in recombinant DNA research to transfer genes between cells, and as such are a subpopulation of "vectors" as used in the sense of the present invention.

[0078] It will be apparent to those skilled in the art that further control sequences may be added to the DNA molecule of the present invention. For example, transcription enhancers and / or sequences that allow inducible expression may be utilized. Suitable inducible systems are described, for example, in Gossen and Bujard, Proc. Natl. Acad. Sci. USA 89 (1992), 5547-5551) and Gossen, Trends Biotech. 12 (1994), 58-62, etc. or the dexamethasone-inducible gene expression system as described, for example, by Crook, EMBO J. 8 (1989), 513-519.

[0079] The present invention also relates to a vector, preferably an expression vector, which comprises a DNA molecule of the present invention.

[0080] The vector of the present invention may be, for example, a plasmid, a cosmid, a virus, a bacteriophage or another vector conventionally used, for example, in genetic engineering, and may contain further genes, such as marker genes, which allow the selection of said vector in a suitable host cell and under suitable conditions.

[0081] The DNA molecules of the present invention preferably also contain a polyA signal which ensures the termination of transcription and stabilization of the transcript by addition of a polyA tail.

[0082] The DNA molecules and vectors of the invention can be designed for direct introduction into cells or via liposomes, viral vectors (e.g., adenovirus, retrovirus), electroporation, ballistic (e.g., gene gun), or other delivery systems. Additionally, baculovirus systems can be used as eukaryotic expression systems for the nucleic acid molecules of the invention.

[0083] The present invention also relates to a host cell comprising the vector of the present invention. Thus, the present invention relates to a host transfected or transformed with a vector of the present invention or a non-human host carrying a vector of the present invention, i.e. a host cell or host genetically engineered with a DNA molecule of the present invention or a vector comprising such a DNA molecule. The term "genetically engineered" means that the host cell or host contains, in addition to its native genome, a DNA molecule or vector of the present invention introduced into the cell or host or one of its ancestors / parents. The DNA molecule or vector may be present in the genetically engineered host cell or host as an independent molecule outside the genome, preferably as a replicable molecule, or may be stably integrated into the genome of the host cell or host. Transformation of a host cell with a vector of the present invention may be carried out as described, for example, in Sambrook and Russell (2001), Molecular Cloning: A Laboratory Manual, CSH Press, Cold Spring Harbor, NY, USA; Methods in Yeast Genetics, A Laboratory Course Manual, Cold Spring Harbor Laboratory Press, 1990. The host cells are cultured in a nutrient medium which meets the requirements of the particular host cells used, in particular with regard to pH value, temperature, salt concentration, aeration, antibiotics, vitamins, trace elements, etc.

[0084] The host cell of the present invention can be any prokaryotic or eukaryotic cell. Suitable prokaryotic cells are those commonly used for cloning, such as E. coli or Bacillus subtilis. Furthermore, eukaryotic cells include, for example, fungal or animal cells. Examples of suitable fungal cells are yeast cells, preferably of the genus Saccharomyces, most preferably of the species Saccharomyces cerevisiae. Suitable animal cells are, for example, insect cells, vertebrate cells, preferably mammalian cells, such as HEK293, NSO, CHO, COS-7, MDCK, U2-OSHela, NIH3T3, MOLT-4, Jurkat, PC-12, PC-3, IMR, NT2N, Sk-n-sh, CaSki, C33A, etc. Further suitable cell lines known in the art are, for example, those available from the Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSMZ) or the American Type Culture Collection (ATCC). The host cells are available from cell line depositories. It is further envisaged according to the invention that primary cells / cell cultures may serve as host cells. The cells may be derived in particular from insects (such as insects of the Drosophila or Cockroach species) or mammals (such as humans, pigs, mice or rats). The host cells may also include cells from and / or derived from cell lines such as neuroblastoma cell lines. The above primary cells are well known in the art and include, inter alia, primary astrocytes, (mixed) spinal cord cultures or hippocampal cultures.

[0085] The present invention also relates to a composition comprising a DNA molecule of the invention, a vector of the invention or a host cell of the invention.

[0086] In a second aspect, the present invention provides a method for producing a composition comprising the steps of: (a) a coding region including an initiation codon at its 5' end and encoding a polypeptide; (b) a UTR immediately upstream of the coding sequence selected from the group consisting of: (b1) and (b2): (b1) is a UTR of the sequence R2-CGCCACC (SEQ ID NO:1); or In the UTR sequence, C at position 6 of SEQ ID NO:1 is replaced with A; a UTR of SEQ ID NO:1, in which C at position 7 is replaced with G; and / or A at position 5 is replaced with G; (b2) is a UTR of the sequence R2-CNGCCACC (SEQ ID NO:2), in which nucleotide N at position 2 of SEQ ID NO:2 is a nucleotide selected from the group consisting of U, G, C, or A, or in which, in said UTR sequence, C at position 7 of SEQ ID NO:2 is replaced with A, C at position 8 of SEQ ID NO:2 is replaced with G; and / or A at position 6 of SEQ ID NO:2 is replaced with G; R2 is an RNA sequence that corresponds to a portion of the promoter region beginning with the nucleotide at which DNA-dependent RNA polymerase initiates RNA synthesis.

[0087] Ribonucleic acid (RNA) molecules as used according to the invention refer to polymeric molecules assembled as a chain of nucleotides designated G, A, U, and C. Each nucleotide of RNA contains a ribose sugar with carbons numbered 1' to 5'. The nitrogenous base is generally attached to the 1' position of adenine (A), cytosine (C), guanine (G), or uracil (U). In polymeric RNA molecules, a phosphate group is attached to the 3' position of one ribose and the 5' position of the next. Thus, the nucleotides of a polymeric RNA molecule are covalently linked to each other, with the phosphate group from one nucleotide attached to the 3' carbon of the subsequent nucleotide, thereby forming a phosphodiester bond. Thus, RNA chains have 5' and 3' ends and are therefore named after the carbons on the ribose ring. By convention, upstream and downstream refer to the 5' to 3' direction in which RNA transcription occurs. Preferably, the RNA molecule is a messenger RNA (mRNA) molecule. mRNA is a large RNA molecule that carries genetic information from DNA to the ribosomes, where the amino acid sequence of the protein product of gene expression is specified. A family of molecules. Following transcription of the primary transcript mRNA (known as pre-mRNA) by RNA polymerase, the processed mature mRNA is translated into polymers of amino acids: proteins, as summarized in the central dogma of molecular biology. As in DNA, the genetic information of mRNA is contained in a sequence of nucleotides, which are arranged in codons, each of which consists of three bases. Each codon codes for a specific amino acid, except for the stop codon, which terminates protein synthesis.

[0088] The RNA molecule of the present invention comprises two main modules as defined in the above items (a) and (b). In addition, the RNA molecule of the present invention preferably comprises a UTR at its 3' end. Thus, in terms of its structure, the RNA molecule of the present invention resembles a naturally occurring "normal" mRNA molecule, harboring a coding region and (5' and 3') untranslated regions (UTRs) and optionally a polyA tail.

[0089] The term "coding region comprising an initiation codon at its 5' end" as used according to the present invention relates to a sequence composed of codons that are decoded by the ribosomes and translated into a protein according to the information provided by the genetic code. A coding region generally begins with an initiation codon at its 5' end and ends with a stop codon. Typically, the initiation codon is an AUG triplet and the stop codons are UAA, UAG or UGA. In addition to encoding a protein, parts of the coding region may function as control sequences for pre-mRNA, as exon splicing enhancers or exon splicing silencers. The coding region of a gene that encodes a polypeptide or protein for use according to the present invention is also known as the coding sequence or CDS (from coding DNA sequence) and is the sequence of the gene. A portion of DNA or RNA that consists of exons and codes for a polypeptide or protein. The coding region of an mRNA is flanked by a 5' untranslated region (5'UTR) and a 3' untranslated region (3'UTR), which are also part of the exons. In addition, an mRNA molecule may further comprise a so-called 5' cap and a polyA tail. The 5' cap, 5'UTR, 3'UTR, and polyA tail are regions of an mRNA molecule that are not translated into a protein.

[0090] As used in accordance with the present invention, the term "untranslated region" or "UTR" refers to the area of ​​the mRNA upstream of the start codon and downstream of the stop codon that is not translated, and is therefore referred to as the 5 prime untranslated region (5'UTR) and the 3 prime untranslated region (3'UTR), respectively. These regions are transcribed together with the coding region and are therefore exonic since they are present in the mature mRNA.

[0091] As used herein, 3' untranslated region (3'UTR) refers to the region of messenger RNA (mRNA) immediately following the translation termination codon. 3'UTR may contain regulatory regions within the 3' untranslated region that are known to affect polyadenylation and mRNA stability. Many 3'UTRs also contain AU-rich elements (AREs). In addition, 3'UTRs may preferably contain the sequence AAUAAA, which directs the addition of several hundred adenine residues, called poly(A) tails, to the end of the mRNA transcript.

[0092] As used herein, the 5' untranslated region (5'UTR), also known as the leader sequence or leader RNA, is the region of an mRNA immediately upstream of the start codon. The 5'UTR begins at the transcription start site and ends one nucleotide (nt) before the start codon of the coding region (usually AUG). In eukaryotes, the length of the 5'UTR is generally between 100 and several thousand nucleotides long, although shorter UTRs may occasionally occur in eukaryotes.

[0093] In the present invention, since it is an object of the present invention to provide a minimal UTR sequence, the 5'UTR is extremely short.

[0094] The RNA molecules of the present invention may also contain a polyA tail. A polyA tail is a long sequence of adenine nucleotides (often hundreds) that is added to the 3' end of a pre-mRNA by a process called polyadenylation. This tail facilitates nuclear export and translation and protects the mRNA from degradation. Polyadenylation is the addition of a poly(A) tail to a messenger RNA. A poly(A) tail consists of multiple adenosine monophosphates; in other words, a poly(A) tail is a stretch of RNA that has only adenine bases. In eukaryotes, polyadenylation is part of the process that produces a mature messenger RNA (mRNA) for translation.

[0095] One module of the RNA molecule, i.e. the "coding region comprising an initiation codon at its 5' end and encoding a polypeptide" (module (a)), is not particularly limited and can be any desired coding region expressed in a given cell. With regard to the preferred embodiment of the term "coding region comprising an initiation codon at its 5' end and encoding a polypeptide" (module (a)), the same as stated above in the context of the DNA of the invention applies mutatis mutandis to the RNA molecule of the invention.

[0096] The RNA molecule of the invention comprises a module (b) immediately upstream of said coding sequence, said module (b) being a UTR selected from the group consisting of (b1) and (b2) below: (b1) is a UTR of sequence R2-CGCCACC (SEQ ID NO:1); or the UTR sequence of SEQ ID NO:1, in which C at position 6 is replaced by A, and C at position 7 of SEQ ID NO:1 is replaced by G; and / or A at position 5 of SEQ ID NO:1 is replaced by G; (b2) is a UTR of the sequence R2-CNGCCACC (SEQ ID NO:2), in which nucleotide N at position 2 of SEQ ID NO:2 is a nucleotide selected from the group consisting of U, G, C, or A, or in which, in said UTR sequence, C at position 7 of SEQ ID NO:2 is replaced with A, C at position 8 of SEQ ID NO:2 is replaced with G; and / or A at position 6 of SEQ ID NO:2 is replaced with G. R2 is an RNA sequence that corresponds to a portion of the promoter region beginning with the nucleotide at which DNA-dependent RNA polymerase initiates RNA synthesis.

[0097] The nature of R2 is not particularly limited. Any RNA sequence can be used that corresponds to a part of the promoter region starting with the nucleotide at which DNA-dependent RNA polymerase starts RNA synthesis. A person skilled in the art is in a position to easily determine the part of the promoter region that starts with the nucleotide at which DNA-dependent RNA polymerase starts RNA synthesis. This RNA sequence R2 is a promoter sequence that corresponds to the part of the promoter that is transcribed, that is, it is actually present in the transcript once it is transcribed.

[0098] In a preferred embodiment, promoter R2 is an RNA sequence which corresponds to a part of the promoter region starting with the nucleotide at which the DNA-dependent RNA polymerase from a bacteriophage initiates RNA synthesis.

[0099] In a preferred embodiment, promoter R2 is an RNA sequence corresponding to a portion of the promoter region beginning with the nucleotide at which T7 DNA-dependent RNA polymerase, T3 DNA-dependent RNA polymerase, SP6 DNA-dependent RNA polymerase, or K11 DNA-dependent RNA polymerase initiates RNA synthesis.

[0100] To illustrate this, and as a non-limiting example, R2 may be selected from the group consisting of the following: TAATACGACTCAC TATA GGGGAGA (SEQ ID NO:3; i.e., a promoter recognized by T7 DNA-dependent RNA polymerase), AATTAACCCTCACTAAA GGGGAGA (SEQ ID NO:4; i.e., a promoter recognized by T3 DNA-dependent RNA polymerase), ATTTAGGTGACACTATA GAA (SEQ ID NO:5; i.e., a promoter recognized by SP6 DNA-dependent RNA polymerase), and AATTAGGGCACACTATA GGGA(SEQ ID NO:6; i.e., the promoter recognized by K11 DNA-dependent RNA polymerase), the underlined sequence corresponds to the portion of each promoter where DNA-dependent RNA polymerase initiates RNA synthesis, and thus the sequence is actually present in the RNA molecule (i.e., in the transcript) once it is transcribed.

[0101] A UTR sequence having any of the above substitutions compared to the UTR of sequence R2-CGCCACC (SEQ ID NO:1) or compared to the UTR of sequence R2-CNGCCACC (SEQ ID NO:2) may result in an RNA molecule that exhibits the same or similar, preferably higher, translation efficiency as an RNA molecule comprising a UTR of sequence R2-CGCCACC (SEQ ID NO:1) and an RNA molecule comprising a UTR of sequence R2-CNGCCACC (SEQ ID NO:2), respectively. The translation efficiency of a given RNA molecule comprising a UTR as described herein may be determined by the skilled artisan by methods known in the art and described below.

[0102] Translation efficiency is the rate of mRNA translation into polypeptide or protein in cells. The translation efficiency of a given mRNA is measured as the number of proteins or polypeptides translated per mRNA per unit of time. Translation is the process by which cellular ribosomes generate proteins, which is well known to those skilled in the art. Briefly, in translation, messenger RNA (mRNA), which is generated by transcription from DNA, is decoded by ribosomes to generate a specific amino acid chain or polypeptide or protein.

[0103] Thus, the translation efficiency of a given RNA molecule harboring a modified UTR sequence with any of the above substitutions is preferably the same as or higher than the translation efficiency of an RNA with a UTR of R2-CGCCACC (SEQ ID NO:1) or R2-CNGCCACC (SEQ ID NO:2), respectively, as defined above, for the same given RNA. Thus, the number of proteins or polypeptides encoded by the coding region of an RNA molecule harboring a modified UTR sequence with any of the above substitutions translated per RNA per unit time is at least the same as, or preferably higher than, the number of proteins or polypeptides encoded by the coding region of an RNA molecule harboring a UTR of R2-CGCCACC (SEQ ID NO:1) or R2-CNGCCACC (SEQ ID NO:2), respectively, as defined above, translated per RNA per unit time.

[0104] In the context of the present invention, translation efficiency is preferably the ratio of mRNA translated into protein in a cell at a given time to the amount of mRNA encoding each protein in the cell at the same time. Thus, translation efficiency is the quotient of the amount of mRNA translated into protein in a cell at a given time and the amount of mRNA encoding each protein. Both parameters, i.e. the amount of mRNA translated into protein and the amount of mRNA encoding each protein, can be determined by methods known in the art. As a non-limiting example, the amount of mRNA translated into protein in a cell can be determined, for example, by flow cytometry (FC), while the amount of mRNA encoding each protein can be measured, for example, by qPCR.

[0105] The UTRs as defined in item (b) above herein are specifically limited to the specific sequences listed above. It also relates to UTR sequences that contain sequences that exhibit nucleotide additions compared to such sequences, and the added nucleotides may be added to the 5' end of said UTR. The added nucleotides include a polynucleotide chain of up to 0 (unchanged), 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides, preferably up to 20 nucleotides. More preferably, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides are added to the 5' end. Even more preferably, up to 30 nucleotides are added to the 5' end.

[0106] In view of the reason that the addition of nucleotides is unlikely to alter the above-mentioned functional properties of each UTR, the length of the addition of nucleotides may be up to 40, 50, 60, 70, 80, 90, or 100 nucleotides, or even 200, 300, 400, or 500 nucleotides, as long as these sequences have a similar function (in terms of translation efficiency as above) as the UTRs defined in item (b) herein.

[0107] In a preferred embodiment, the maximum length of a UTR as defined in item (b1) herein above is 11, 12, or 13 nucleotides. Preferably, the maximum length of a UTR as defined in item (b1) herein above is 13 nucleotides when R2 is GGGAGA (SEQ ID NO:7) or GGGAGA (SEQ ID NO:8).

[0108] Suitably, the maximum length of a UTR as defined in item (b1) herein above is 11 nucleotides when R2 is GAAG (SEQ ID NO:9) or GGGA (SEQ ID NO:10).

[0109] In another preferred embodiment, the maximum length of a UTR as defined in item (b2) herein above is 12, 13 or 14 nucleotides. Preferably, the maximum length of a UTR as defined in item (b2) herein above is 14 nucleotides when R2 is GGGAGA (SEQ ID NO:7) or GGGAGA (SEQ ID NO:8).

[0110] Suitably, the maximum length of a UTR as defined in item (b2) herein above is 12 nucleotides when R2 is GAAG (SEQ ID NO:9) or GGGA (SEQ ID NO:10).

[0111] RNA molecules of the invention containing the above-mentioned UTRs can be produced / synthesized recombinantly (eg, in in vivo or in vitro systems) or synthetically by methods known to those of skill in the art.

[0112] In vitro transcription of RNA usually requires a linear DNA template containing a double-stranded promoter region to which DNA-dependent RNA polymerase binds and initiates RNA synthesis, while the coding region can be double-stranded or single-stranded. If the linear DNA template contains a single-stranded coding region, the antisense strand of the coding region (i.e., the strand read by the DNA-dependent polymerase) is part of the template. Common DNA-dependent RNA polymerases are T7 polymerase, T3 polymerase, SP6 polymerase, and K11 polymerase. The complete sequences of their respective promoters are shown in SEQ ID NOs: 3-6.

[0113] Transcription templates for in vitro transcription include, for example, cDNA templates synthesized from RNA precursors, templates generated by PCR, chemically synthesized oligonucleotides, and plasmid constructs. Many widely used plasmid cloning vectors have phage polymerase promoters located on either side of the multiple cloning site to allow transcription of either strand of nucleotide sequence inserted into the multiple cloning site. Commonly used cloning vectors include, for example, Invitrogen's pCRII, Promega's pGEM, and Stratagene's B Ambion's pTRIPLEscript family of vectors contains three phage polymerase promoters in tandem, all on the same side of the multiple cloning site, allowing the use of any of the three polymerases, SP6, T7, or T3.

[0114] The RNA molecules of the present invention can be produced recombinantly in in vivo systems by methods known to those of skill in the art.

[0115] Alternatively, the RNA molecule of the present invention can be produced in an in vitro system, for example, by using an in vitro transcription system.In vitro transcription systems are generally known and usually require a purified linear DNA template containing the DNA sequence "encoding" the RNA molecule, said DNA sequence being under the control of a suitable promoter.In addition, in vitro transcription systems also generally require a buffer system containing ribonucleotide triphosphates, DTT and magnesium ions, and a suitable RNA polymerase to provide the enzymatic activity for in vitro transcription of the DNA sequence into the corresponding RNA molecule of the present invention.

[0116] Furthermore, RNA molecules can be chemically synthesized by conventional chemical synthesis, for example in an automated nucleotide sequence synthesizer using a solid phase support and standard techniques, or by chemical synthesis of individual DNA sequences followed by in vitro or in vivo transcription of the DNA sequences.

[0117] In accordance with the above, the present invention provides an RNA molecule / polyribonucleic acid molecule, preferably a modified polyribonucleic acid molecule, in which one module of said RNA molecule, i.e. the "coding region comprising an initiation codon at its 5' end" (module (a)), codes for a polypeptide. The terms nucleic acid and polynucleotide are used interchangeably and include any compound and / or substance comprising a polymer of nucleotides. The terms nucleotide include deoxynucleotides and ribonucleotides. The terms ribonucleic acid and polyribonucleotide are used interchangeably and include, in an embodiment, any compound and / or substance comprising a polymer of nucleotides in which more than 50% of the nucleotides are ribonucleotides. In an embodiment, polyribonucleotide comprises a nucleotide polymer in which 60%, 70%, 75%, 80%, more than 90%, more than 95%, more than 99% or 100% of the nucleotides are ribonucleotides. A polyribonucleotide in which one or more nucleotides are modified nucleotides may be referred to as a modified polyribonucleotide. However, the term polyribonucleotide may include modified polyribonucleotides.

[0118] The sequence of the RNA molecule / polyribonucleotide may be derived from any suitable nucleic acid, for example, comprising the genetic information of the gene of interest. Examples of nucleic acids include genomic DNA, RNA, or cDNA from any bacterial or archaeal cell comprising the gene of interest. The polynucleotide may be derived from a nucleic acid carrying a mutant gene and a genetic polymorphism. The RNA molecule / polyribonucleotide of the invention comprises, but is not limited to, a sequence as module A, which may comprise any desired coding region to be expressed in a given cell. In a preferred embodiment, said sequence may be a coding region encoding a desired polypeptide / protein as outlined above. Advantageously, in accordance with the above, the RNA molecule / polyribonucleotide further comprises a non-translated sequence located upstream (5') of the start codon of module A, a non-translated sequence located downstream (3') of the stop codon of module A, or both a non-translated sequence located upstream (5') of the start codon of module A and a non-translated sequence located downstream (3') of the stop codon of module A. In a preferred embodiment, the RNA molecule / polyribonucleotide of the invention may be a modified RNA molecule / polyribonucleotide.

[0119] In addition to the four classical ribonucleotides, namely adenosine, guanosine, cytidine and uridine, there are many analogues of each of these nucleic acid bases.In some cases, throughout and in the literature, these analogues, or the RNA molecules / polyribonucleotides that contain one or more of these analogues, are said to be modified (e.g., modified nucleotide or modified ribonucleotide).Some analogues may exist in nature, although they are different from the above-mentioned standard nucleic acid bases.Other analogues do not exist in nature.Any type of analogue is considered.

[0120] In some embodiments, the RNA molecules / polyribonucleotides of the present invention comprise nucleotide analogs (e.g., the polyribonucleotide comprises a modified polyribonucleotide). Exemplary nucleotide analogs are provided below (e.g., analogs of U; analogs of C; analogs of A; analogs of G). Furthermore, in some embodiments, the RNA molecules / polyribonucleotides or other nucleic acids of the present disclosure may comprise (additionally or alternatively) modifications in the phosphodiester backbone or in the linkages between the nucleobases. Exemplary nucleic acids that can form part or all of the RNA molecules / polyribonucleotides of the present disclosure include, but are not limited to, ribonucleic acid (RNA), deoxyribonucleic acid (DNA), threose nucleic acid (TNA), glycol nucleic acid (GNA), peptide nucleic acid (PNA), locked nucleic acid (LNA including LNA having a beta-D-ribo configuration, alpha-LNA (a diastereomer of LNA) having an alpha-L-ribo configuration, 2'-amino-LNA having a 2'-amino functionalization, and 2'-amino-alpha-LNA having a 2'-amino functionalization) or hybrids thereof.

[0121] In some embodiments, the modification may be on one or more nucleosides or on the backbone of the nucleic acid / polynucleotide molecule. In some embodiments, the modification may be on both the nucleoside and the backbone linkage. In some embodiments, the modification may be introduced into the polynucleotide in vitro. In some embodiments, the modified ribonucleotide / nucleotide may also be synthesized post-transcriptionally by covalent modification of classical / natural ribonucleotide / nucleotide.

[0122] The RNA molecule / polyribonucleotide of the present invention may be a modified RNA molecule / polyribonucleotide, which in some embodiments may include purine analogs and / or pyrimidine analogs. In certain embodiments, the modified RNA molecule / polyribonucleotide of the present invention includes pyrimidine analogs, such as uridine analogs and / or cytidine analogs. In some embodiments, the modified RNA molecule / polyribonucleotide of the present invention includes uridine analogs and cytidine analogs. In some embodiments, the modified RNA molecule / polyribonucleotide does not include adenosine analogs and / or guanosine analogs. In some embodiments, the RNA molecule / polyribonucleotide includes a single type of uridine analog and a single type of cytidine analog (e.g., a single type of analog, but not a single molecule of analog - a single analog may be present in any of the several percentages described herein). In other embodiments, the RNA molecule / polyribonucleotide contains two or more types of analogues of uridine and / or cytidine, and optionally, if present, one or more analogues of adenosine and / or guanosine (i.e., neither one nor both).

[0123] In some cases, the modified uridine (e.g., an analog of uridine) is selected from 2-thiouridine, 5'-methyluridine, pseudouridine, 5-iodouridine (I5U), 4-thiouridine (S4U), 5-bromouridine (Br5U), 2'-methyl-2'-deoxyuridine (U2'm), 2'-amino-2'-deoxyuridine (U2'NH2), 2'-azido-2'-deoxyuridine (U2'N3), and 2'-fluoro-2'-deoxyuridine (U2'F). In some cases, the modified cytidine (e.g., a cytidine analog) is selected from 2-thiouridine, 5'-methyluridine, pseudouridine, 5-iodouridine (I5U), 4-thiouridine (S4U), 5-bromouridine (Br5U), 2'-methyl-2'-deoxyuridine (U2'm), 2'-amino-2'-deoxyuridine (U2'NH2), 2'-azido-2'-deoxyuridine (U2'N3), and 2'-fluoro-2'-deoxyuridine (U2'F). The cytidine analogue (C2'm), 2'-methyl-2'-deoxycytidine (C2'NH2), 2'-fluoro-2'-deoxycytidine (C2'F), 5-iodocytidine (I5C), 5-bromocytidine (Br5C) and 2'-azido-2'-deoxycytidine (C2'N3) are selected from 5-methylcytidine, 3-methylcytidine, 2-thio-cytidine, 2'-methyl-2'-deoxycytidine (C2'm), 2'-amino-2'-deoxycytidine (C2'NH2), 2'-fluoro-2'-deoxycytidine (C2'F). It should be noted that when referring to analogues, the above also refers to their 5' triphosphate forms. In one embodiment, the cytidine analogue is 5-iodocytidine and the uridine analogue is 5-iodouridine.

[0124] In some embodiments, the RNA molecule / polyribonucleotide is a modified RNA molecule / polyribonucleotide. In some cases, the modified RNA molecule / polyribonucleotide is at least 25% more stable than unmodified (or unmodified) RNA molecule / polyribonucleotide. In some cases, the modified RNA molecule / polyribonucleotide can be at least 30% more stable, at least 35% more stable, at least 40% more stable, at least 45% more stable, at least 50% more stable, at least 55% more stable, at least 60% more stable, at least 65% more stable, at least 70% more stable, at least 75% more stable, at least 80% more stable, at least 85% more stable, at least 90% more stable, at least 95% more stable than unmodified RNA molecule / polyribonucleotide. In some embodiments, the stability is measured in vivo. In certain embodiments, the stability is measured in vitro. In some embodiments, the stability is quantified by measuring the half-life of the polyribonucleotide.

[0125] The RNA molecule / polyribonucleotide of the present invention may have nucleotides modified in the same manner or a mixture of different modified nucleotides. Modified nucleotides may have modifications that occur naturally or do not occur naturally in messenger RNA. It is possible to use a mixture of various modified nucleotides. For example, one or more modified nucleotides in the RNA molecule / polyribonucleotide may have a natural modification, and another part has a modification that is not naturally found in mRNA. Furthermore, some modified nucleotides may have base modifications, while other modified nucleotides have sugar modifications. Similarly, all modifications may be base modifications, or all modifications may be sugar modifications, or any suitable mixture thereof. In some cases, the stability of the modified RNA molecule / polyribonucleotide may be selectively optimized by changing the nature of the modified base in the modified polyribonucleotide.

[0126] Non-limiting examples of analogues of U [Table 2]

[0127] Non-limiting examples of analogues of C [Table 3-1] [Table 3-2]

[0128] Non-limiting examples of analogues of A [Table 4-1] [Table 4-2]

[0129] Non-limiting examples of analogues of G [Table 5]

[0130] In certain embodiments, the analog (e.g., modified nucleotide) can be selected from the group including: pyridin-4-one ribonucleoside, 5-iodouridine, 5-iodocytidine, 5-aza-uridine, 2'-amino-2'-deoxycytidine, 2'-fluoro-2'-deoxycytidine, 2-thio-5-aza-uridine, 2-thiouridine. , 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxyuridine, 3-methyluridine, 5-carboxymethyl-uridine, 1-carboxymethyl-pseudouridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurinomethyluridine, 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine, 1-taurinomethyl-4-thio-uridine, 5-methyl-uridine, 1-methyl-pseudouridine, 4-thio-l-methyl- Pseudouridine, 2-thio-l-methyl-pseudouridine, 1-methyl-l-deaza-pseudouridine, 2-thio-1-methyl-l-deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, 5-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N 4-Acetylcytidine, 5-Formylcytidine, 5-Methylcytidine, N4-Methylcytidine, 5-Hydroxymethylcytidine, 1-Methyl-pseudoisocytidine, Pyrrolo-cytidine, Pyrrolo-pseudoisocytidine, 2-Thio-cytidine, 2-Thio-5-Methyl-cytidine, 4-Thio-pseudoisocytidine, 4-Thio-l-Methyl-pseudoisocytidine, 4-Thio-l-Methyl-1-deaza-pseudoisocytidine, 1-Methyl-l-deaza-pseudoisocytidine, Zebularine, 5-Aza-zebularine phosphorus, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy-l-methyl-pseudoisocytidine, 2-aminopurine, 2,6-diaminopurine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2-aminopurine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-Diaminopurine, 1-Methyladenosine, N6-Methyladenosine, N6-Isopentenyladenosine, N6-(cis-Hydroxyisopentenyl)adenosine, 2-Methylthio-N6-(cis-Hydroxyisopentenyl)adenosine, N6-Glycinylcarbamoyladenosine, N6-Threonylcarbamoyladenosine, 2-Methylthio-N6-Threonylcarbamoyladenosine, N6,N6-Dimethyladenosine, 7-Methyladenine, 2-Methylthio-adenine, 2-Methoxy-adenine, Inosine, 1-Methyl-inosine, 7-Methoxy-adenine, 1-Methyl-inosine, 1-Methyl-inosine, 1-Methyl-1-butyrate ... -deaza-guanosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine, 6-methoxy-guanosine, 1-methylguanosine, N2-methylguanosine, N2,N2-dimethylguanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, and N2,N2-dimethyl-6-thio-guanosine.

[0131] In certain embodiments, the modified RNA molecules / polyribonucleotides of the present invention do not include pseudouridine. In certain embodiments, the modified RNA molecules / polyribonucleotides of the present invention do not include 5-methylcytidine. In certain embodiments, the modified RNA molecules / polyribonucleotides of the present invention do not include 5-methyluridine. In certain embodiments, the modified RNA molecules / polyribonucleotides of the present invention include U analogs and C analogs, where the U analogs may all be the same analog or different analogs (e.g., multiple types of analogs) and the C analogs may all be the same analog or different analogs (e.g., multiple types of analogs). In certain embodiments, the modified RNA molecules / polyribonucleotides of the present invention do not include adenosine analogs and guanosine analogs.

[0132] As described in detail herein, when the RNA molecule / polyribonucleotide comprises modified polyribonucleotides, the analogs may be present as a particular proportion of nucleotides in the compound (e.g., a given percentage of a given nucleobase may be present as a particular proportion of nucleotides, as described herein). may be an analogue).

[0133] The RNA molecule / polyribonucleotide that comprises at least one modified nucleotide is a modified RNA molecule / polyribonucleotide.In some embodiments, at least about 5% of the modified RNA molecule / polyribonucleotide comprises modified or non-naturally occurring (e.g., analog or modified) adenosine, cytidine, guanosine, or uridine, such as the analog nucleotide described herein.In some cases, at least about 5%, 10%, 15%, 20%, 25%, 30%, 40%, 45%, 50% of the modified RNA molecule / polyribonucleotide comprises modified or non-naturally occurring (e.g., analog or modified) adenosine, cytidine, guanosine, or uridine. In some examples, at most about 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5% of the modified RNA molecules / polyribonucleotides contain modified or non-naturally occurring adenosines, cytidines, guanosines, or uridines.

[0134] In a preferred embodiment, the RNA molecule of the present invention contains a combination of modified and unmodified nucleotides. Preferably, the RNA molecule of the present invention contains a combination of modified and unmodified nucleotides as described in WO 2011 / 012316. Such RNA molecules are known and are also commercialized as "SNIM®-RNA". The RNA molecules described in WO 2011 / 012316 have been reported to exhibit increased stability and reduced immunogenicity. In a preferred embodiment, in such modified RNA molecules, 5-50% of the cytidine nucleotides and 5-50% of the uridine nucleotides are modified. The adenosine and guanosine containing nucleotides may be unmodified. The adenosine and guanosine nucleotides may be unmodified or partially modified, and are preferably present in unmodified form. Preferably, 10-35% of the cytidine nucleotides and uridine nucleotides are modified, and particularly preferably, the content of modified cytidine nucleotides is in the range of 7.5-25%, and the content of modified uridine nucleotides is in the range of 7.5-25%. In fact, it has been found that a relatively low content, for example, only 10% of modified cytidine and uridine nucleotides, respectively, can achieve the desired properties. Particularly preferred are modified cytidine nucleotides being 5-methylcytidine residues and modified uridine nucleotides being 2-thiouridine residues. Most preferably, the content of modified cytidine nucleotides and the content of modified uridine nucleotides are each 25%.

[0135] In some other embodiments, 5-50% of the cytidines are C analogs and 5-50% of the uridines are U analogs in the modified RNA / polyribonucleotide molecule. In some embodiments, 5-40% of the cytidines are C analogs and 5-40% of the uridines are U analogs in the modified polyribonucleotide molecule. In some embodiments, 5-30% of the cytidines are C analogs and 5-30% of the uridines are U analogs in the modified RNA / polyribonucleotide molecule. In some embodiments, 10-30% of the cytidines are C analogs and 10-30% of the uridines are U analogs in the modified RNA / polyribonucleotide molecule. In some embodiments, 5-20% of the cytidines are C analogs and 5-20% of the uridines are U analogs in the modified polyribonucleotide molecule. In some embodiments, 5-10% of the cytidine nucleotides and 5-10% of the uridine nucleotides are modified in the modified RNA / polyribonucleotide molecule. In some embodiments, 25% of the cytidine nucleotides and 25% of the uridine nucleotides are modified in the modified RNA / polyribonucleotide molecule. In some embodiments, the adenosine and guanosine containing nucleotides may be unmodified. In some embodiments, the adenosine and guanosine nucleotides may be unmodified or partially modified, preferably present in unmodified form.

[0136] As noted above, in certain embodiments, an analog of U refers to a single type of analog of U. In some embodiments, an analog of U refers to two or more types of analogs of U. In some embodiments, an analog of C refers to a single type of analog of C. In some embodiments, an analog of C refers to two or more types of analogs of C.

[0137] In some embodiments, the percentage of cytidine in the RNA molecule / polyribonucleotide that is an analog of cytidine is not the same as the percentage of uridine in the RNA molecule / polyribonucleotide that is an analog of uridine.In some embodiments, the percentage of cytidine analog is lower than the percentage of uridine analog.As mentioned above, this may be with or without adenosine and guanosine analog, but in some embodiments, there is no adenosine or guanosine analog.In certain embodiments, the polyribonucleotide of the present disclosure comprises less than 15%, less than 10%, less than 5%, or less than 2% adenosine analog, guanosine analog, or both.

[0138] In one embodiment, the RNA molecule / polyribonucleotide of the present invention comprises a cytidine analog and a uridine analog, with 5-20% of the cytidines being cytidine analogs and 25-45% of the uridines being uridine analogs. In other words, the RNA molecule / polyribonucleotide comprises modified and unmodified cytidines and modified and unmodified uridines, with 5-20% of the cytidines being cytidine analogs, while 25-45% of the uridines being uridine analogs. In another embodiment, the RNA molecule / polyribonucleotide comprises 5-10% cytidine analogs and 30-40% uridine analogs, with 7-9% cytidine analogs, for example about 7, 7.5, or 8%, and 32-38% uridine analogs, for example about 33, 34, 35, 36%.

[0139] In some embodiments, any of the uridine and cytidine analogs described herein may be used, optionally excluding pseudouridine. In some embodiments, the analog of cytidine includes or consists of 5-iodocytidine (e.g., when consisting of, a single analog type is used) and the analog of uridine includes or consists of 5-iodouridine (e.g., when consisting of, a single analog type is used).

[0140] In certain embodiments of any of the above, the percentage of analogs of a given nucleotide refers to an input percentage (e.g., the percentage of analogs in an initiating reaction, such as the initiation of an in vitro transcription reaction). In certain embodiments of any of the above, the percentage of analogs of a given nucleotide refers to an output (e.g., the percentage in a synthesized or transcribed compound).

[0141] The RNA molecules / polyribonucleotide molecules of the invention can be produced recombinantly in in vivo systems by methods known to those skilled in the art and described in more detail below.

[0142] Alternatively, the modified polyribonucleotide molecules of the invention can be produced in an in vitro system, for example, using an in vitro transcription system described in more detail below. An in vitro transcription system capable of producing RNA molecules / polyribonucleotides requires an input mixture of modified and unmodified nucleoside triphosphates to produce modified RNA molecules / polyribonucleotides with the desired properties of the invention. In one embodiment, 5-50% of the cytidines in the input mixture are cytidine analogs and 5-50% of the uridines in the input mixture are uridine analogs. In one embodiment, 5-40% of the cytidines in the input mixture are cytidine analogs and 5-40% of the uridines in the input mixture are uridine analogs. In one embodiment, 5-30% of the cytidines in the mixture are cytidine analogs and 5-30% of the uridines in the mixture are uridine analogs. In one embodiment, 5-30% of the cytidines in the mixture are cytidine analogs and 5-30% of the uridines in the mixture are uridine analogs. In one embodiment, 5-30% of the cytidines in the mixture are cytidine analogs. 5-30% of the cytidine is a cytidine analog and 10-30% of the uridine in the mixture is a uridine analog. In some embodiments, 5-20% of the cytidine is a cytidine analog and 5-20% of the uridine in the mixture is a uridine analog. In some embodiments, 5-10% of the cytidine is a cytidine analog and 5-10% of the uridine in the mixture is a uridine analog. In some embodiments, 25% of the cytidine is a cytidine analog and 25% of the uridine in the mixture is a uridine analog. In some embodiments, the input mixture does not include analogs of adenosine and / or guanosine. In other embodiments, optionally, the input mixture includes one or more analogs of adenosine and / or guanosine (i.e., none of either or both).

[0143] In some embodiments, the percentage of the cytidine analog, cytidine, in the input mixture is not the same as the percentage of the uridine analog, uridine, in the input mixture. In some embodiments, the percentage of the cytidine analog in the input mixture is lower than the percentage of the uridine analog in the input mixture. As above, this can be the case with or without adenosine and guanosine analogs in the input mixture, but in some embodiments, there are no adenosine or guanosine analogs in the input mixture.

[0144] In one embodiment, the nucleotide input mixture for an in vitro transcription system generating the RNA molecules / polyribonucleotides of the invention comprises a cytidine analog and a uridine analog, wherein 5-20% of the cytidines in the input mixture are cytidine analogs and 25-45% of the uridines in the input mixture are uridine analogs. In other words, the input mixture comprises modified and unmodified cytidines and modified and unmodified uridines, wherein 5-20% of the cytidines in the input mixture are cytidine analogs while 25-45% of the uridines in the input mixture are uridine analogs. In another embodiment, the input mixture comprises 5-10% cytidine analogs and 30-40% uridine analogs, wherein 7-9% cytidine analogs, e.g., about 7, 7.5 or 8%, and 32-38% uridine analogs, e.g., about 33, 34, 35, 36%.

[0145] In some embodiments, any of the uridine and cytidine analogs described herein can be used, optionally excluding pseudouridine. In some embodiments, the cytidine analog comprises or consists of 5-iodocytidine (e.g., a single C analog type is used) and the uridine analog comprises or consists of 5-iodouridine (e.g., a single U analog type is used).

[0146] Exemplary analogs are listed in the table above. For modified polyribonucleotides encoding the desired polypeptide (module (a)), the analogs and modification levels are considered throughout the entire polyribonucleotide encoding the desired polypeptide (module (a)), including the 5' and 3' untranslated regions, unless otherwise indicated (e.g., modification levels are based on input ratios of analogs in an in vitro transcription reaction such that the analogs can be incorporated at transcription positions).

[0147] Furthermore, modified RNA molecules / polyribonucleotide molecules can be chemically synthesized, for example, by conventional chemical synthesis in an automated nucleotide sequence synthesizer using a solid phase support and standard techniques, or by chemical synthesis of individual DNA sequences followed by their in vitro or in vivo transcription.

[0148] In molecular biology and genetics, upstream and downstream are both complementary terms in an RNA molecule. In the context of the present invention, upstream is towards the 5' end of the RNA molecule and downstream is towards the 3' end of the molecule.

[0149] Therefore, in the present invention, the UTR defined in item (b) above is located immediately upstream of the coding region of item (a), more specifically, immediately upstream of the start codon of the coding region.Therefore, "immediately upstream" in this context means that there are no further nucleotides between the UTR defined in item (b) and the coding sequence starting with the start codon.Therefore, the coding region starting with the start codon is directly adjacent to said UTR sequence.

[0150] The RNA molecule may be in the form of a fusion RNA sequence of modules (a) and (b) (as defined in points (a) and (b) above, respectively), i.e. in the form of a (fusion) DNA molecule formed by the expression of a hybrid gene created by combining at least two nucleotide sequences encoding said modules. Typically, as will be explained in more detail further below, this can be achieved by cloning a cDNA into an expression vector allowing transcription into an RNA molecule. Thus, a DNA molecule encoding an RNA molecule of the invention may be a fusion DNA sequence, i.e. a chimeric molecule formed by linking two or more polynucleotides via a phosphate group attached to the 3' carbon of one nucleotide from another, forming phosphodiester bonds between each end of one module and the end of another module. Thus, said DNA molecules encoding said at least two modules are linked together in the form of a DNA molecule. Such a recombinant DNA molecule is then transcribed into its corresponding RNA nucleic acid sequence.

[0151] In one preferred embodiment, R2 is: (i) GGGAGA (SEQ ID NO:7); (ii) GGGAGA (SEQ ID NO:8); (iii) GAAG (SEQ ID NO:9); and (iv) GGGA (SEQ ID NO:10).

[0152] In a preferred embodiment, the RNA molecule is an RNA molecule comprising the sequence R2-CNGCCACC (SEQ ID NO:2), wherein nucleotide N at position 2 of SEQ ID NO:2 is a nucleotide selected from the group consisting of U, G, or C, and wherein nucleotide N is not A.

[0153] In another preferred embodiment, said nucleotide N at position 2 of SEQ ID NO:2 is U.

[0154] In a preferred embodiment, an RNA molecule of the invention is an RNA molecule in which the nucleotide immediately following the start codon is not the nucleotide G. In another preferred embodiment, an RNA molecule of the invention is an RNA molecule in which the nucleotide immediately following the start codon is a nucleotide selected from the group consisting of A, U, and C.

[0155] In an even more preferred embodiment, the RNA molecule of the invention is an RNA molecule comprising a module (b1) as defined above, said module (b1) being a sequence in which C at position 6 of SEQ ID NO:1 is substituted by A, C at position 7 of SEQ ID NO:1 is substituted by G; and / or A at position 5 of SEQ ID NO:1 is substituted by G, and the nucleotides immediately downstream of the start codon are selected from the group consisting of A, U, and C.

[0156] In another even more preferred embodiment, the RNA molecule of the invention is an RNA molecule comprising a module (b2) as defined above, said module (b2) having SEQ ID NO: and / or a substitution of A at position 6 of SEQ ID NO:2 with G, wherein the nucleotide immediately downstream of the start codon is a nucleotide selected from the group consisting of A, U, and C.

[0157] As noted above, the Kozak consensus sequence (gcc) gccRccAUGG, specifically with respect to the nucleotide at position -3 (i.e., three nucleotides upstream from the start codon AUG) designated "R," may be variant as long as that position is a purine (i.e., adenine or guanine). In the UTRs described above, the nucleotide corresponding to that position is defined as "A." However, the present invention also relates to RNA molecules that contain the corresponding UTRs with "G" at that position.

[0158] Thus, in a preferred embodiment, the RNA molecule of the invention comprises a UTR as defined in item (b1) above, wherein in said UTR sequence of (b1), A at position 5 of SEQ ID NO:1 is substituted with G; or in said UTR sequence of (b2), A at position 6 of SEQ ID NO:2 is substituted with G.

[0159] As mentioned above, the RNA molecule of the present invention may also harbor a polyA tail. As used herein, polyA tail refers to a sequence of adenine nucleotides located at the 3' end of an RNA. A polyA tail is generally added to the 3' end of an RNA by a process called polyadenylation. Thus, the present invention relates to any of the above RNAs, wherein the RNA molecule comprises a polyA tail at the 3' end.

[0160] The length of the polyA tail is not particularly limited. However, in a preferred embodiment, the RNA molecule of the present invention comprises a polyA tail at the 3' end, and the length of the polyA tail is at least 50, 60, 70, 80, 90, 100, or 110 nucleotides. In a more preferred embodiment, the RNA molecule of the present invention comprises a polyA tail at the 3' end, and the length of the polyA tail is at least 120 nucleotides. In another preferred embodiment, the RNA molecule of the present invention comprises a polyA tail at the 3' end, and the length of the polyA tail is at least 150, 200, 250, 300, 350, 400, 500, 600, 700, 800, 900, or 1000 nucleotides.

[0161] When the RNA molecules of the invention are produced by the in vitro transcription method further described herein below, a polyA tail is located at the 3' end of the RNA adjacent to the UTR at the 3' end of the RNA molecule, while the plasmid harboring the RNA molecule of the invention is linearized prior to in vitro transcription downstream of the polyA tail to ensure that the in vitro transcribed RNA molecule contains said polyA tail.

[0162] As mentioned above, the RNA molecule of the invention may be in the form of a fusion RNA sequence of modules (a) and (b), i.e. in the form of a (fusion) RNA molecule formed by transcription of a hybrid gene created by combining at least two nucleotide sequences encoding said modules. Typically, this is achieved by cloning the cDNA into an expression vector allowing the transcription of the entire RNA molecule. Various methods of creating fusion constructs are known, including nucleic acid synthesis, hybridization and / or amplification to generate a synthetic double-stranded nucleic acid molecule that "encodes" the RNA molecule of the invention. Such a double-stranded nucleic acid molecule (i.e. a DNA molecule) harbors on one strand (i.e. the coding or sense strand) a DNA sequence corresponding to the RNA molecule of the invention, thus "encoding" the RNA molecule of the invention. In other words, such a double-stranded nucleic acid / DNA molecule contains, on one strand, the genetic information corresponding to the transcribed RNA molecule of the invention as defined herein above. The term "encode" or "encode" in the context of the present invention has its conventional meaning, i.e. the ability to encode a protein. The term "encode" is not only used in reference to the DNA of a gene encoding the module (and thus the genetic information that can be translated into the amino acid sequence of a polypeptide or protein). Rather, in the context of the present invention, in constructs in which the individual DNA sequences encoding modules (a) and (b) are "fused" or linked into a single (chimeric) DNA molecule, the construct also includes a component that is not translated into a protein (i.e., module (b)). Nevertheless, the DNA sequence corresponding to module (b) provides the information of the structure of the UTR, i.e., the "code", and thus the term "encode" in the present invention also relates to the genetic information of the UTR that can be expressed, i.e., transcribed, when present in, for example, a double-stranded nucleic acid molecule. Thus, although the term "encode" in the context of the present invention is generally used only in reference to coding / expressing a protein, it should be understood that a nucleic acid molecule can be transcribed into a corresponding RNA molecule harboring a portion that encodes a protein or polypeptide (i.e., module (a)) and a portion that "encodes" the UTR (i.e., module (b)), where the latter represents the final product when expressed, since the UTR is not translated into a protein or polypeptide. Such double-stranded nucleic acids can be synthesized using standard molecular biology techniques (see, for example, Sambrook et al., Molecular Biology, 1999, 144:131-132). (see Cloning, A laboratory manual, 2nd Ed, 1989) The term "vector", such as "expression vector" or "cloning vector" in the sense of the present invention, is understood as a circular double-stranded DNA unit that replicates independently of chromosomal DNA in a cell and is used as a vehicle to bring genetic material into the cell, where it can replicate and / or be expressed (i.e., transcribed into RNA and translated into amino acid sequences). A vector containing foreign DNA is referred to as recombinant DNA. The vector itself is generally a DNA sequence that typically consists of an insert (i.e., module (b) and module (a) coding regions that are not translated into proteins) and a larger sequence that serves as the "backbone" of the vector. Plasmids in the sense of the present invention are most frequently found in bacteria and are used in recombinant DNA research to transfer genes between cells, and as such are a subpopulation of "vectors" as used in the sense of the present invention.

[0163] Thus, the present invention also relates to a nucleic acid molecule encoding an RNA molecule of the present invention.

[0164] The nucleic acid is, for example, a DNA encoding the two main modules of the RNA molecule of the invention, namely module (a) and module (b). The nucleic acid molecule of the invention is preferably a recombinant nucleic acid molecule. The nucleic acid molecule of the invention can be synthetic or semi-synthetic.

[0165] It will be apparent to those skilled in the art that further regulatory sequences can be added to the nucleic acid molecules of the present invention that code for an RNA molecule. For example, transcription enhancers and / or sequences that allow inducible expression can be utilized. Suitable inducible systems are described, for example, in Gossen and Bujard, Proc. Natl. Acad. Sci. USA 89 (1992), 5547-5551) and Gossen, Trends Biotech. 12 (1994), 58-62, or the dexamethasone-inducible gene expression system as described in Crook, EMBO J. 8 (1989), 513-519. .

[0166] The present invention also relates to a vector, preferably an expression vector, which comprises a nucleic acid molecule of the invention.

[0167] As regards a vector comprising a nucleic acid molecule encoding an RNA molecule of the invention, the same applies mutatis mutandis as stated above in the context of a vector comprising a DNA molecule of the invention as defined above.

[0168] The present invention also relates to a host cell comprising a vector of the invention. The present invention therefore relates to a host cell transfected or transformed with a vector of the invention or a non-human host carrying a vector of the invention, i.e. a nucleic acid molecule of the invention or a vector comprising such a nucleic acid molecule. The present invention relates to a host cell or host that has been genetically modified with.

[0169] With regard to a host cell comprising a vector which comprises a nucleic acid molecule encoding an RNA molecule of the invention, the same applies mutatis mutandis as stated above in the context of a host cell comprising a vector which comprises a DNA molecule of the invention as defined above.

[0170] The present invention also relates to a method for producing an RNA molecule of the present invention by culturing a host cell harboring an expression vector encoding an individual module of the present invention or the entire RNA molecule of the present invention in a culture medium and recovering the RNA molecule from the host cell or the culture medium. The present invention may also relate to a method for producing an RNA molecule of the present invention comprising a step of culturing a host cell of the present invention and, optionally, a step of recovering the RNA molecule from the culture.

[0171] Methods for recovering and / or subsequently purifying the RNA molecules of the present invention are known to those skilled in the art.

[0172] The present invention also relates to a method for producing the RNA molecules of the present invention in an in vitro reaction by methods known to those skilled in the art. More specifically, the RNA molecules of the present invention can be produced in vitro using an in vitro transcription system. In vitro transcription systems are generally known and usually require a purified linear DNA template containing DNA sequences "encoding" module (b) and module (a), as outlined above, said DNA sequences being under the control of a suitable promoter. Furthermore, in vitro transcription systems also generally require a buffer system containing ribonucleotide triphosphates, DTT and magnesium ions, as well as a suitable RNA polymerase to provide the enzymatic activity for the in vitro transcription of the DNA sequence into the RNA molecules of the present invention.

[0173] Commonly used methods for generating RNA molecules using in vitro transcription are well known to those skilled in the art and are described, for example, in Methods Mol. Biol. 703 (2011):29-41. .

[0174] As mentioned above, when the RNA molecule of the present invention is produced by an in vitro transcription method as further described herein below, said poly A tail may be part of the RNA molecule of the present invention (not necessarily originally located on the cloning vector) and is located at the 3' end of the RNA molecule, for example adjacent to the UTR at the 3' end of the RNA.When the RNA molecule of the present invention is produced by an in vitro transcription method, the plasmid harboring the RNA molecule of the present invention is linearized before in vitro transcription downstream of the poly A tail to ensure that the in vitro transcribed RNA molecule contains said poly A tail.

[0175] Alternatively, RNA molecules of the present invention can also be chemically synthesized by conventional chemical synthesis, for example in an automated nucleotide sequence synthesizer using a solid phase support and standard techniques.

[0176] The present invention also relates to methods for producing the RNA molecules of the invention in in vitro reactions and recovering the RNA molecules from the reactions by methods known to those skilled in the art and outlined above.

[0177] Methods for recovering and / or subsequently purifying the RNA molecules of the present invention are known to those of skill in the art.

[0178] The RNA molecules of the present invention can be synthesized using in vitro methods known to those skilled in the art for the efficient expression of any desired polypeptide or protein encoded by the coding region of module (a). It can be easily used in ro translation systems.

[0179] In vitro translation systems are known in the art and can be used directly with the RNA molecules of the present invention. Alternatively, these in vitro translation systems can be combined with the in vitro transcription systems described above. Cell-free systems for in vitro transcription and / or in vitro translation are known and available. These cell-free systems for protein synthesis (also called in-vitro protein synthesis or CFPS for short) allow the expression / production of polypeptides or proteins using biological mechanisms without the use of living cells. In these systems, the in vitro protein synthesis environment is not restricted by cell walls or homeostatic conditions necessary to maintain cell viability, allowing direct access and control of the translation environment, which is advantageous for several applications, including protein production optimization, protein complex optimization, incorporation of unnatural amino acids, high throughput screens, and synthetic biology to study protein synthesis. Common components of cell-free reactions include cell extracts, energy sources, amino acid supplies, cofactors such as magnesium, and DNA or RNA encoding the desired polypeptide or protein. Cell extracts can be obtained by lysing the cells of interest and centrifuging away the cell walls, DNA genomes, and other debris. The rest is the necessary cellular machinery, including ribosomes, aminoacyl-tRNA synthetases, translation initiation and elongation factors, nucleases, etc. In cell-free systems for the synthesis of polypeptides or proteins starting from DNA (i.e., systems that include the steps of in vitro transcription and in vitro translation), two types of DNA are generally used: either plasmids or linear expression templates (LETs). In cell-free systems for the synthesis of polypeptides or proteins starting from RNA (i.e., systems that include only the step of in vitro translation), RNA can be used directly. These in vitro cell-free reactions require an energy source, usually provided by another mixture containing the necessary energy sources, along with an amino acid supply that is added to the extract for the reaction. Common energy sources are phosphoenolpyruvate, acetyl phosphate, and creatine phosphate.Commonly used common cell extracts are made from Escherichia coli (ECE), rabbit reticulocytes (RRL), wheat germ (WGE), and insect cells (ICE). All of these extracts are commercially available.

[0180] Thus, the present invention also relates to the use of an RNA molecule of the present invention for the in vitro translation of a desired polypeptide or protein encoded by a coding region contained in the RNA molecule of the present invention.

[0181] With regard to preferred embodiments for such a use of an RNA molecule of the invention, the same applies mutatis mutandis as stated above in the context of RNA as defined above.

[0182] The RNA molecule defined above is particularly useful in medical institutions and in the treatment of certain diseases, particularly in RNA-based treatment.Therefore, the present invention also relates to a pharmaceutical composition comprising the RNA molecule of the present invention, the nucleic acid molecule of the present invention, the vector of the present invention or the host cell of the present invention, and optionally a pharma-ceutically acceptable carrier.

[0183] The term "treatment" and the like are used herein generally to mean obtaining a desired pharmacological and / or physiological effect. Thus, the treatment of the present invention may relate to the treatment of the (acute) state of a particular disease, but also to prophylactic treatment, in that the disease or its symptoms are completely or partially prevented. Suitably, the term "treatment" should be understood as therapeutic, in that the disease and / or adverse effects and / or symptoms resulting from the disease are partially or completely cured. In this respect, "acute" means that the subject shows symptoms of the disease. In other words, the subject to be treated is in actual need of the treatment and, in the context of the present invention, The term "acute treatment" in relates to measures taken to actually treat the disease after the onset or occurrence of the disease. The treatment can be a preventive or prophylactic treatment, i.e. measures taken to prevent the disease, for example to prevent infection and / or the onset of the disease.

[0184] The pharmaceutical compositions of the present invention can be administered in a wide variety of dosage forms known to those of skill in the art, including, but not limited to, systemic, topical, oral, or via aerosol, including tablets, injections, use of inhalers, creams, foams, gels, lotions, and ointments.

[0185] As mentioned above, the present invention relates to a pharmaceutical composition comprising an effective amount of the above-mentioned RNA molecule (or nucleic acid molecule, vector or host cell) of the present invention and at least one pharma- ceutically acceptable excipient or carrier.

[0186] Excipients or carriers are inert substances that are formulated with the active ingredient, i.e., the RNA molecule of the present invention (or nucleic acid molecule, vector, or host cell), for the purpose of bulk formulations containing potent active ingredients. Excipients are often referred to as "bulking agents," "fillers," or "diluents." Bulking agents allow for convenient and accurate dispensing of drug substances when manufacturing dosage forms. They may also serve various therapeutic enhancement purposes, such as enhancing drug absorption or solubility, or other pharmacokinetic considerations. Excipients may also be useful in manufacturing processes to aid in handling of the associated active substance, such as by promoting powder flow or non-stick properties, in addition to aiding in vitro stability, such as preventing denaturation over the expected shelf life. The selection of appropriate excipients also depends on the route of administration and dosage form, as well as the active ingredient and other factors.

[0187] Thus, a pharmaceutical composition comprising an effective amount of an RNA molecule (or nucleic acid molecule, vector, or host cell) of the invention may be in solid, liquid, or gas form, in particular in the form of a powder, tablet, solution, or aerosol. The pharmaceutical composition preferably optionally comprises a pharma- ceutically acceptable carrier and / or diluent.

[0188] Examples of suitable pharmaceutical carriers, excipients, and / or diluents are well known in the art and include phosphate buffered saline, water, emulsions such as oil / water emulsions, various types of wetting agents, sterile solutions, etc. Compositions containing such carriers can be formulated by well-known conventional methods. These pharmaceutical compositions can be administered to subjects in appropriate dosages, i.e., "effective amounts," which can be easily determined by those skilled in the art by methods known in the art. Dosage regimes will be determined by the attending physician and clinical factors. As is well known in the medical field, the dosage for any one patient depends on many factors, including the size, body surface area, age, the specific compound administered, sex, time and route of administration, general health, and other drugs administered at the same time as the patient or subject.

[0189] Therefore, preferably, the RNA molecule (or nucleic acid molecule, vector, or host cell) of the present invention is contained in an effective amount. The term "effective amount" refers to an amount sufficient to induce a detectable therapeutic response in a subject to which the pharmaceutical composition is administered. In accordance with the above, the content of the RNA molecule (or nucleic acid molecule, vector, or host cell) of the present invention in the pharmaceutical composition is not limited as long as it is useful for treatment as described above, but preferably contains 0.0000001 to 10% by weight based on the total composition. Furthermore, the RNA molecule (or nucleic acid molecule, vector, or host cell) described herein is preferably utilized in a carrier. Generally, an appropriate amount of a pharma- cetically acceptable salt is used in the carrier to make the composition isotonic. Examples of carriers include, but are not limited to, saline, Ringer's solution, and dextrose solution. Preferably, the acceptable excipient, carrier, or stabilizer is non-toxic at the dosage and concentration utilized, and is preferably a buffer such as citrate, phosphate, and other organic acids. ; salt forming counterions, such as sodium and potassium; low molecular weight (>10 amino acid residues) polypeptides; proteins, such as serum albumin, or gelatin; hydrophilic polymers, such as polyvinylpyrrolidone; amino acids such as histidine, glutamine, lysine, asparagine, arginine, or glycine; carbohydrates, including glucose, mannose, or dextrin; monosaccharides; disaccharides; other sugars, such as sucrose, mannitol, trehalose, or sorbitol; chelating agents, such as EDTA; non-ionic surfactants, such as Tween, Pluronic, or polyethylene glycol; antioxidants, including methionine, ascorbic acid, and tocopherol; and / or preservatives, such as octadecyldimethylbenzylammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl, or benzyl alcohol; alkyl parabens, such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol). Suitable carriers and their formulation are described in more detail in Remington's Pharmaceutical Sciences, 17th ed., 1985, Mack Publishing Co.

[0190] The progress of treatment can be monitored by periodic evaluation. The RNA molecule (or nucleic acid molecule, vector, or host cell) of the present invention or the pharmaceutical composition of the present invention can be in sterile aqueous or non-aqueous solutions, suspensions, and emulsions, as well as creams and suppositories. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic / aqueous solutions, emulsions or suspensions, including saline and buffered media. Preservatives and other additives, such as antibacterial agents, antioxidants, chelating agents, and inert gases, may also be present. In addition, the pharmaceutical composition of the present invention can contain additional agents depending on the intended use of the pharmaceutical composition. The agents can be, for example, polyoxyethylene sorbitan monolaurate, commercially available under the trade name Tween, propylene glycol, EDTA, citrate, sucrose, and other agents well known to those skilled in the art that are suitable for the intended use of the pharmaceutical composition.

[0191] According to the present invention, the term "pharmaceutical composition" relates to a composition for administration to a patient, preferably a human patient.

[0192] The pharmaceutical composition of the present invention can be used for RNA-based therapy. As described above, the RNA molecule of the present invention comprising a "coding region encoding a polypeptide" can be used for RNA-based therapy, where the "coding region encoding a polypeptide" encodes a therapeutically or pharma- ceutical active polypeptide or protein having a therapeutic or prophylactic effect. Thus, in a preferred embodiment, the pharmaceutical composition of the present invention can be used for RNA-based therapy in the treatment or prevention of the diseases listed in Table 1 above. Thus, the RNA-based therapy of the present invention can be used for the treatment or prevention of the diseases listed in Table 1 above.

[0193] Thus, where a genetic defect as described in Table 1 above leads to a disease that can be treated or prevented by transcript replacement therapy / enzyme replacement therapy using an RNA molecule of the invention, the pharmaceutical composition of the invention can be used for RNA-based therapy, where the RNA molecule comprises a "polypeptide coding region" that encodes an intact version of a protein or a functional fragment thereof that compensates for the defective gene disclosed. In a particularly preferred embodiment, the pharmaceutical composition of the invention can be used for RNA-based therapy in the treatment or prevention of lysosomal diseases such as Gaucher disease, Fabry disease, MPS I, MPS II (Hunter syndrome), MPS VI, and glycogen storage diseases, such as glycogen storage diseases type I (von Gierke disease), type II (Pompe disease), type III (Coli disease), type IV (Anderson disease), type V (McArdle disease), type VI (Haas disease), type VII (Tarui disease), type VII, type IX, type X, type XI (Fanconi-Bickel syndrome), type XI, or type 0. Transcript replacement therapy / enzyme replacement therapy, beneficially, does not affect the underlying genetic defect, but instead increases the concentration of the enzyme that is deficient in the patient. As an example, in Pompe disease, transcript replacement therapy / enzyme replacement therapy replaces the deficient lysosomal enzyme acid alpha-glucosidase (GAA).

[0194] In another preferred embodiment, the pharmaceutical composition of the present invention can be used for RNA-based therapy according to the present invention, wherein the "coding region encoding a polypeptide" encodes a therapeutically or pharma- ceutical active polypeptide, protein or peptide having a therapeutic or prophylactic effect, said polypeptide, protein or peptide being selected from the group encoded by genes as outlined in Table 1.

[0195] In other preferred embodiments, the RNA-based therapy according to the present invention can be used to treat cancer, cardiovascular disease, viral infection, immune dysfunction, autoimmune disease, neurological disorder, inherited metabolic disorder, or genetic disease, or any disease in which protein or protein fragments produced in cells can have beneficial effects on patients.Examples of cancer include head and neck cancer, breast cancer, kidney cancer, bladder cancer, lung cancer, prostate cancer, bone cancer, brain cancer, cervical cancer, anal cancer, colon cancer, colorectal cancer, appendix cancer, eye cancer, stomach cancer, leukemia, lymphoma, liver cancer, skin cancer, ovarian cancer, penile cancer, pancreatic cancer, testicular cancer, thyroid cancer, vaginal cancer, vulvar cancer, uterine cancer, heart tumor and sarcoma.

[0196] Examples of cardiovascular diseases include atherosclerosis, coronary heart disease, pulmonary heart disease and cardiomyopathies.

[0197] Examples of immune deficiencies and autoimmune diseases include, but are not limited to, rheumatic diseases, multiple sclerosis and asthma.

[0198] Examples of viral infections include, but are not limited to, infections by human immunodeficiency virus, herpes simplex virus, human papilloma virus, and hepatitis B virus and hepatitis C virus.

[0199] Examples of neurological disorders include, but are not limited to, Parkinson's disease, multiple sclerosis, and dementia.

[0200] Examples of inherited metabolic disorders include, but are not limited to, Gaucher disease and phenylketonuria.

[0201] The present invention also relates to a method of RNA-based therapy.Therefore, the present invention relates to a method of treating diseases such as cancer, cardiovascular disease, viral infection, immune dysfunction, autoimmune disease, neurological disorder, inherited metabolic disorder or genetic disease with RNA-based therapy.With regard to the preferred embodiment of the treatment method, the same as mentioned above in the context of RNA molecule or pharmaceutical composition for use in RNA-based therapy as defined above applies mutatis mutandis.

[0202] In the present invention, the subject is, in preferred embodiments, a mammal, such as a dog, cat, pig, cow, sheep, horse, rodent, e.g., rat, mouse, and guinea pig, or a primate, e.g., gorilla, chimpanzee, and human. In the most preferred embodiment, the subject is a human.

[0203] As mentioned above, the RNA molecules defined above are particularly useful in medical practice and in the treatment of certain diseases, in particular in RNA-based therapies. Thus, the present invention also relates to a method for the preparation of an RNA molecule, a nucleic acid molecule, a vector or a host cell of the invention, optionally in a pharma- ceutical carrier. The present invention also relates to a pharmaceutical composition comprising the compound.

[0204] However, in RNA therapeutics, it is often desirable to quell the effect of the RNA molecule at some stage.

[0205] This can be done, for example, by using the RNAi (RNA interference) mechanism, using a nucleic acid strand that is complementary to the UTR sequence of the present invention.Indeed, the small size of the minimal UTR of the present invention makes this approach feasible, since this UTR does not form secondary or tertiary structures and is not present in normal cells.Therefore, after the treatment of the above-mentioned disease using the pharmaceutical composition of the present invention or after the above-mentioned RNA-based therapy, the complementary strand of this UTR sequence can be advantageously used in medical institutions, thereby silencing the therapeutic RNA molecule of the present invention.

[0206] Therefore, the RNAi-approach is also envisaged in the context of the present invention to be used for the preparation of pharmaceutical compositions for mitigating the effect of the therapeutic RNA molecules of the present invention.

[0207] The term "RNA interference" or "inhibiting RNA" (RNAi / iRNA) describes the use of double-stranded RNA to target a specific mRNA for degradation, thereby halting its expression. Suitable RNA-inhibiting molecules can be selected from the group consisting of double-stranded RNA (dsRNA), RNAi, siRNA, shRNA, and stRNA. dsRNA that matches the gene sequence is synthesized in vitro and introduced into the cell. dsRNA can also be introduced into the cell in the form of a vector that expresses the target gene sequence in sense and antisense orientation, for example in the form of a hairpin mRNA. The sense and antisense sequences can also be expressed from separate vectors, whereby the individual antisense and sense molecules form double-stranded RNA upon their expression. In some cases, it is known in the art that expression of a sequence in the sense orientation, or even expression of a promoter sequence, results in dsRNA, which in turn results in siRNA by endogenous amplification mechanisms in the cell. Thus, all means and methods that cause a decrease in the activity of the polypeptide or protein encoded by the coding region can be used in accordance with the present invention. For example, these siRNAs can be produced / introduced using sense constructs, antisense constructs, hairpin constructs, sense molecules, antisense molecules, and combinations thereof.dsRNA is fed into a natural, but only partially understood, process that involves the highly conserved nuclease Dicer, which cuts dsRNA precursor molecules into short interfering RNAs (siRNAs).The production and preparation of siRNAs and the method of inhibiting the expression of target genes are described, inter alia, in WO 02 / 055693, Wei (2000) Dev. Biol. 15:239-255;La Count (2000) Biochem. Paras. 111:67-76;Baker (2000) Curr. Biol. 10:1071-1074;Svoboda (2000) Development 127:4147-4156, or Marie (2000) Curr. Biol. 10:289-292.These siRNAs can be produced / introduced using the following methods: Next, a sequence-specific portion of the RNA-induced silencing complex (RISC), a multicomplex nuclease that destroys messenger RNAs homologous to the silencing trigger, is constructed. Elbashir (2001) EMBO J. 20:6877-6888 showed that a duplex of 21-nucleotide RNA can be used in cell culture to interfere with gene expression in mammalian cells. It is already known that RNAi is very efficiently mediated by siRNA in mammalian cells, but the generation of stable cell lines or non-human transgenic animals has been limited. However, a new generation of vectors, such as short hairpin RNAs (shRNAs), can be utilized to stably express siRNAs. Stable expression of siRNAs in mammalian cells is shown, inter alia, in Brummelkamp (2002) Science 296:550-553. Also, Paul (2002) Nat. Biotechnol. 20:505-508 describes the use of small interfering RNAs in human cells. Efficient expression of short interfering RNA and hairpin RNA in mammalian cells was also demonstrated by Yu (2002) PNAS 99:6047-6052. shRNA approaches to silencing are well known in the art and can involve the use of st (small) RNA; see, inter alia, Paddison (2002) Genes Dev. 16:948-958. These approaches can be vector-based, for example using pSUPER vectors or RNA pol III vectors, as exemplified in Yu (2002), loc. cit.; Miyagishi (2002), loc. cit. or Brummelkamp (2002), loc. cit., among others. The control sequences of the present invention can be used in pSUPER vectors or RNA pol It is envisioned that these will be used in a manner similar to that of the III vector-based system.

[0208] Methods for predicting and constructing siRNAs are known in the art and are described in Elbashir (2002) Methods 26:199-213, the internet websites of commercial vendors of siRNAs, e.g., Qiagen GmbH (https: / / www1.qiagen.com / GeneGlobe / Default.aspx); Dharmacon (www.dharmacon.com); Xeragon Inc. (http: / / www.dharmacon.com / Default.aspx), and Ambion (www.ambion.com) or the website of Tom Tuschl's research group (http: / / www.rockefeller.edu / labheads / tuschl / siRNA.html). In addition, methods for predicting siRNAs from a given mRNA sequence can be found in Programs are available online (e.g. http: / / www.ambion.com / techlib / misc / siRNA_finder.html or http: / / katahdin.cshl.org:9331 / RNAi / html / RNAi.html). Uridine residues in the 2-nt 3´ overhangs can be replaced with 2´ deoxythymidine without loss of activity, which may significantly reduce the cost of RNA synthesis and increase the tolerance of siRNA duplexes when applied to mammalian cells (Elbashir (2001) loc. cit). siRNAs can also be enzymatically synthesized using T7 or other RNA polymerases (Donze (2002) Nucleic Acids Res 30:e46). Short RNA duplexes that mediate siRNA (esiRNA) can also be generated by hydrolysis with Escherichia coli RNase III (Yang (2002) PNAS 99:9942-9947). Expression vectors have been developed that express double-stranded siRNAs linked to small hairpin RNA loops in cells (e.g., (Brummelkamp (2002) Science 296:550-553). All of these constructs can be developed with the aid of the programs named above. In addition, commercially available sequence prediction tools, either integrated into sequence analysis programs or sold separately, such as those provided by www.oligoEngine.com (Seattle, WA), can be used to construct the desired sequence. The provided siRNA Design Tool can be used for siRNA sequence prediction.

[0209] Therefore, specific interfering RNA can be used according to the present invention as antagonist / silencer of the expression and / or function of the polypeptide or protein encoded in the coding region of the RNA molecule of the present invention.These siRNAs are formed by complementary / antisense and sense strands, whereby the antisense / sense strand preferably comprises at least 10, more preferably at least 12, more preferably at least 14, more preferably at least 16, more preferably at least 18, more preferably at least 19, 20, 21 or 22 nucleotides.In an even more preferred embodiment, the antisense / sense strand preferably comprises 25 or more nucleotides.

[0210] As mentioned above, the method of preparing siRNA for use according to the present invention is well known in the art.Based on the teachings provided in the present invention, those skilled in the art can easily be in a position to not only prepare such siRNA, but also evaluate whether siRNA can antagonize / interfere / silence the polypeptide or protein encoded in the coding region of the RNA molecule of the present invention.It is considered herein that said siRNA can cause the degradation of the RNA molecule of the present invention that carries the coding region and UTR molecule that codes for the polypeptide or protein, thereby reducing the polypeptide / protein level of the polypeptide or protein encoded in the coding region of the RNA molecule of the present invention.

[0211] Thus, the present invention relates to RNA molecules that are complementary to the UTRs of the present invention, as described herein above.

[0212] In a preferred embodiment, the RNA molecule complementary to a UTR of the present invention comprises the sequence CAUGGUGGCGUCUCCC (SEQ ID NO:11 or a sequence exhibiting 1 to 4 substitutions compared to SEQ ID NO:11).

[0213] In another preferred embodiment, the RNA molecule complementary to a UTR of the present invention has the sequence CAUGGUGGCNGUCUCCC (SEQ ID NO:12), The present invention also provides a method for the preparation of a nucleic acid sequence comprising administering to a subject an RNA molecule comprising the steps of: (a) administering to said subject an RNA molecule comprising administering to said subject an RNA molecule comprising administering to said subject an RNA molecule comprising administering to said subject an RNA molecule comprising administering to said subject an RNA molecule comprising administering to said subject an RNA molecule comprising administering to said subject an RNA molecule comprising administering to said subject an RNA molecule comprising administering to said subject an RNA molecule comprising administering to said subject an RNA molecule comprising administering to said subject an RNA molecule comprising administering to said subject an RNA molecule comprising administering to said subject an RNA molecule comprising administering to said subject

[0214] In a preferred embodiment, said RNA molecule complementary to a UTR of the present invention comprises the sequence CAUCUUGGCGUCUCCC (SEQ ID NO:13) or a sequence exhibiting 1 to 4 substitutions compared to SEQ ID NO:13.

[0215] In another preferred embodiment, the RNA molecule complementary to a UTR of the present invention has the sequence CAUCUUGGCNGUCUCCC (SEQ ID NO:14), The present invention also provides a method for the preparation of a nucleic acid sequence comprising administering to a subject an RNA molecule of the present invention, the method comprising administering to a subject a nucleic acid sequence ...

[0216] In a preferred embodiment, said RNA molecule complementary to a UTR of the present invention comprises the sequence CAUGGCGGCGUCUCCC (SEQ ID NO:15) or a sequence which exhibits 1 to 4 substitutions compared to SEQ ID NO:15.

[0217] In another preferred embodiment, the RNA molecule complementary to a UTR of the present invention has the sequence CAUGGCGGCNGUCUCCC (SEQ ID NO:16), The present invention also provides a method for the preparation of a nucleic acid sequence comprising administering to a subject an RNA molecule comprising the steps of: (a) administering to a subject an RNA molecule comprising administering to a subject a nucleic acid sequence ...

[0218] In a preferred embodiment, said RNA molecule complementary to a UTR of the present invention comprises the sequence CAUCUCGGCGUCUCCC (SEQ ID NO:17) or a sequence exhibiting 1 to 4 substitutions compared to SEQ ID NO:17.

[0219] In another preferred embodiment, the RNA molecule complementary to a UTR of the present invention has the sequence CAUCUCGGCNGUCUCCC (SEQ ID NO:18), The present invention also relates to a nucleic acid sequence comprising a sequence, or a sequence exhibiting 1 to 4 substitutions compared to SEQ ID NO:18, in which nucleotide N at position 10 of SEQ ID NO:18 is a nucleotide selected from the group consisting of U, G, C, or A, with A being more preferred, which is capable of antagonizing / interfering with / silencing a polypeptide or protein encoded in the coding region of an RNA molecule of the present invention.

[0220] In another preferred embodiment, said RNA molecule complementary to a UTR of the invention comprises the sequence CAUGGUGGCGUCCC (SEQ ID NO:19) or a sequence exhibiting 1 to 4 substitutions compared to SEQ ID NO:19.

[0221] In another preferred embodiment, said RNA molecule complementary to a UTR of the present invention comprises the sequence CAUGGUGGCNGUCCC (SEQ ID NO:20), wherein nucleotide N at position 10 of SEQ ID NO:20 is a nucleotide selected from the group consisting of U, G, C, or A, or a sequence exhibiting 1 to 4 substitutions compared to SEQ ID NO:20, which is capable of antagonizing / interfering with / silencing a polypeptide or protein encoded in the coding region of an RNA molecule of the present invention.

[0222] In a preferred embodiment, said RNA molecule complementary to a UTR of the present invention comprises the sequence CAUCUUGGCGUCCC (SEQ ID NO:21) or a sequence exhibiting 1 to 4 substitutions compared to SEQ ID NO:21.

[0223] In another preferred embodiment, said RNA molecule complementary to a UTR of the present invention comprises the sequence CAUCUUGGCNGUCCC (SEQ ID NO:22), wherein nucleotide N at position 10 of SEQ ID NO:22 is a nucleotide selected from the group consisting of U, G, C, or A, with A being more preferred, or a sequence exhibiting 1 to 4 substitutions compared to SEQ ID NO:22, which is capable of antagonizing / interfering with / silencing a polypeptide or protein encoded in the coding region of an RNA molecule of the present invention.

[0224] In a preferred embodiment, the RNA molecule complementary to a UTR of the present invention has the sequence CAUGGCGGCGUCCC (SEQ ID NO:23) or :Contains sequences that exhibit 1 to 4 substitutions compared to 23.

[0225] In another preferred embodiment, said RNA molecule complementary to a UTR of the present invention comprises the sequence CAUGGCGGCNGUCCC (SEQ ID NO:24), wherein nucleotide N at position 10 of SEQ ID NO:24 is a nucleotide selected from the group consisting of U, G, C, or A, or a sequence exhibiting 1 to 4 substitutions compared to SEQ ID NO:24, which is capable of antagonizing / interfering with / silencing a polypeptide or protein encoded in the coding region of an RNA molecule of the present invention.

[0226] In a preferred embodiment, said RNA molecule complementary to a UTR of the present invention comprises the sequence CAUCUCGGCGUCCC (SEQ ID NO:25) or a sequence exhibiting 1 to 4 substitutions compared to SEQ ID NO:25.

[0227] In another preferred embodiment, said RNA molecule complementary to a UTR of the present invention comprises the sequence CAUCUCGGCNGUCCC (SEQ ID NO:26), wherein nucleotide N at position 10 of SEQ ID NO:26 is a nucleotide selected from the group consisting of U, G, C, or A, with A being more preferred, or a sequence exhibiting 1 to 4 substitutions compared to SEQ ID NO:26, which is capable of antagonizing / interfering with / silencing a polypeptide or protein encoded in the coding region of an RNA molecule of the present invention.

[0228] In another preferred embodiment, the RNA molecule complementary to a UTR of the present invention has the sequence CA UGGUGGCGCUUC (SEQ ID NO:27), or a sequence exhibiting 1 to 4 substitutions compared to SEQ ID NO:27.

[0229] In another preferred embodiment, said RNA molecule complementary to a UTR of the present invention comprises the sequence CAUGGUGGCNGCUUC (SEQ ID NO:28), wherein nucleotide N at position 10 of SEQ ID NO:28 is a nucleotide selected from the group consisting of U, G, C, or A, or a sequence exhibiting 1 to 4 substitutions compared to SEQ ID NO:28, which is capable of antagonizing / interfering with / silencing a polypeptide or protein encoded in the coding region of an RNA molecule of the present invention.

[0230] In a preferred embodiment, said RNA molecule complementary to a UTR of the present invention comprises the sequence CAUCUUGGCGCUUC (SEQ ID NO:29) or a sequence exhibiting 1 to 4 substitutions compared to SEQ ID NO:29.

[0231] In another preferred embodiment, said RNA molecule complementary to a UTR of the present invention comprises the sequence CAUCUUGGCNGCUUC (SEQ ID NO:30), where nucleotide N at position 10 of SEQ ID NO:30 is a nucleotide selected from the group consisting of U, G, C, or A, with A being more preferred, or a sequence exhibiting 1 to 4 substitutions compared to SEQ ID NO:30, which is capable of antagonizing / interfering with / silencing a polypeptide or protein encoded in the coding region of an RNA molecule of the present invention.

[0232] In a preferred embodiment, said RNA molecule complementary to a UTR of the present invention comprises the sequence CAUGGCGGCGCUUC (SEQ ID NO:31) or a sequence exhibiting 1 to 4 substitutions compared to SEQ ID NO:31.

[0233] In another preferred embodiment, said RNA molecule complementary to a UTR of the present invention comprises the sequence CAUGGCGGCNGCUUC (SEQ ID NO:32), wherein nucleotide N at position 10 of SEQ ID NO:32 is a nucleotide selected from the group consisting of U, G, C, or A, or a sequence exhibiting 1 to 4 substitutions compared to SEQ ID NO:32, which is capable of antagonizing / interfering with / silencing a polypeptide or protein encoded in the coding region of an RNA molecule of the present invention.

[0234] In a preferred embodiment, said RNA molecule complementary to a UTR of the present invention comprises the sequence CAUCUCGGCGCUUC (SEQ ID NO:33) or a sequence exhibiting 1 to 4 substitutions compared to SEQ ID NO:33.

[0235] In another preferred embodiment, said RNA molecule complementary to a UTR of the present invention comprises the sequence CAUCUCGGCNGCUUC (SEQ ID NO:34), wherein nucleotide N at position 10 of SEQ ID NO:34 is a nucleotide selected from the group consisting of U, G, C or A, with A being more preferred, or a sequence exhibiting 1 to 4 substitutions compared to SEQ ID NO:34, which is capable of antagonizing / interfering with / silencing a polypeptide or protein encoded in the coding region of an RNA molecule of the present invention.

[0236] In another preferred embodiment, the present invention provides a nucleic acid sequence encoding a polypeptide or protein of interest, comprising SEQ ID NO: 1, which harbors additional nucleotides at the 5' end extending beyond the triplet complementary to the start codon and is complementary to the sequence of a desired polypeptide or protein encoded in the coding region of an RNA molecule of the present invention. The present invention relates to an RNA molecule selected from the group consisting of SEQ ID NOs: 11-34. Preferably, the complementary sequence comprising the above sequence complementary to the UTR sequence of the present invention (i.e., an RNA molecule selected from the group consisting of SEQ ID NOs: 11-34) preferably comprises at least 15, more preferably at least 16, more preferably at least 17, more preferably at least 18, more preferably at least 19, more preferably at least 20, 21, 22, 23, or 24 nucleotides. In even more preferred embodiments, these sequences comprise 25, 30, 35, 40, or more nucleotides. It may be desirable to extend the length of the 5' end to prevent undesired side effects by increasing the specificity of the complementary sequence.

[0237] In another preferred embodiment, the present invention relates to any of the above RNA molecules as well as to an RNA molecule selected from the group consisting of SEQ ID NOs: 11-34, which contains up to 5%, 10%, 20%, or 30% mismatches to the above RNA molecules. Furthermore, the RNA molecule may be chemically modified as described herein above.

[0238] The present invention also relates to a kit comprising the DNA molecule of the invention, the RNA molecule of the invention, the nucleic acid molecule of the invention, the vector of the invention or the host cell of the invention. With regard to the preferred embodiments, the same applies mutatis mutandis as stated above in the context of the DNA molecule, RNA molecule, nucleic acid molecule, vector or host cell of the invention. Advantageously, the kit of the invention further optionally comprises buffers, storage solutions and / or remaining reagents or substances required for the implementation of the above and below uses and methods. Furthermore, the parts of the kit of the invention can be packaged individually in vials or bottles or combined in a vessel or multi-container unit. The kit of the invention can be advantageously used, inter alia, for the implementation of the method of the invention or the preparation of the RNA molecule of the invention and can be utilized in the various applications mentioned herein, for example in the uses outlined above and below. Another component that may be included in the kit are instructions for the use of the kit, directed to the user of the kit. The manufacture of the kit preferably follows standard procedures known to those skilled in the art.

[0239] The present invention also relates to the use of the UTRs described herein above for translating a coding region of an RNA molecule into a polypeptide or protein encoded by said coding region.

[0240] In a more preferred embodiment, the present invention also relates to the use of the UTRs described herein above to increase the efficiency of translation of the coding region of an RNA molecule into a polypeptide or protein encoded by said coding region.

[0241] With regard to the preferred embodiments of use the same applies mutatis mutandis as stated above in the context of the RNA molecules of the invention.

[0242] In a preferred embodiment, the present invention relates to the following, characterized by the following items 1 to 20:

[0243] 1. A DNA molecule capable of being transcribed into mRNA, comprising the following elements: (a) a coding region including an initiation codon at its 5' end and encoding a polypeptide; (b) a sequence immediately upstream of the coding sequence selected from the group consisting of: (b1) and (b2); or a complementary strand, (b1) is R1-CGCCACC (SEQ ID NO:1); or In said sequence, C at position 6 of SEQ ID NO:1 is replaced with A, at position 7 of SEQ ID NO:1, C is replaced with G; and / or at position 5 of SEQ ID NO:1, A is replaced with G; (b2) is R1-CNGCCACC (SEQ ID NO:2), in which nucleotide N at position 2 of SEQ ID NO:2 is a nucleotide selected from the group consisting of T, G, C, or A; or In said sequence, C at position 7 of SEQ ID NO:2 is replaced with A, and / or a substitution of A at position 6 of SEQ ID NO:2 with G; R1 is a DNA molecule that is a promoter recognized by a DNA-dependent RNA polymerase.

[0244] 2. The promoter recognized by DNA-dependent RNA polymerase is: (i) TAATACGACTCACTATAGGGAGA (SEQ ID NO:3), or a sequence that exhibits 1 to 6 substitutions compared to SEQ ID NO:3 and is recognized by T7 DNA-dependent RNA polymerase; (ii) AATTAACCCTCACTAAAGGGAGA (SEQ ID NO:4), or a sequence which exhibits one to six substitutions compared to SEQ ID NO:4 and which is recognized by T3 DNA-dependent RNA polymerase; (iii) ATTTAGGTGACACTATAGAAG (SEQ ID NO:5), or a sequence that exhibits 1 to 6 substitutions compared to SEQ ID NO:5 and is recognized by SP6 DNA-dependent RNA polymerase; and (iv) AATTAGGGCACACTATAGGGA (SEQ ID NO:6), or a sequence that exhibits 1 to 6 substitutions compared to SEQ ID NO:6 and is recognized by K11 DNA-dependent RNA polymerase.

[0245] 3. The DNA molecule according to item 1 or 2, wherein nucleotide N at position 2 of SEQ ID NO:2 is a nucleotide selected from the group consisting of T, G, or C, and nucleotide N is not A.

[0246] 4. The DNA molecule according to item 3, wherein the nucleotide N at position 2 of SEQ ID NO:2 is T.

[0247] 5. A vector comprising the DNA molecule of item 4.

[0248] 6. A host cell comprising the vector of item 5.

[0249] 7. A composition comprising the DNA molecule according to any one of items 1 to 4, the vector according to item 5, or the host cell according to item 6.

[0250] 8. (a) a coding region including an initiation codon at its 5' end and encoding a polypeptide; (b) a UTR selected from the group consisting of (b1) and (b2) immediately upstream of the coding sequence, (b1) is a UTR of the sequence R2-CGCCACC (SEQ ID NO:1), or a sequence in which, in said UTR sequence, C at position 6 of SEQ ID NO:1 is substituted with A, C at position 7 of SEQ ID NO:1 is substituted with G, and / or A at position 5 of SEQ ID NO:1 is substituted with G; (b2) is a UTR of the sequence R2-CNGCCACC (SEQ ID NO:2), in which nucleotide N at position 2 of SEQ ID NO:2 is a nucleotide selected from the group consisting of U, G, C, or A, or in which in said UTR sequence, C at position 7 of SEQ ID NO:2 is replaced with A and C at position 8 of SEQ ID NO:2 is replaced with C is replaced by G; and / or a UTR of a sequence in which A at position 6 of SEQ ID NO:2 is replaced by G; R2 is an RNA molecule that is an RNA sequence that corresponds to a portion of the promoter region beginning with the nucleotide at which DNA-dependent RNA polymerase initiates RNA synthesis.

[0251] 9.R2 is (i) GGGAGA (SEQ ID NO:7); (ii) GGGAGA (SEQ ID NO:8); (iii) GAAG (SEQ ID NO:9); and (iv) The RNA molecule according to item 8, selected from the group consisting of GGGA (SEQ ID NO: 10).

[0252] 10. The RNA molecule according to item 8 or 9, wherein nucleotide N at position 2 of SEQ ID NO:2 is a nucleotide selected from the group consisting of U, G, or C, and nucleotide N is not A.

[0253] 11. The RNA molecule according to item 10, wherein the nucleotide N at position 2 of SEQ ID NO:2 is U.

[0254] 12. The RNA molecule according to any one of items 8 to 11, comprising a poly A tail at the 3' end.

[0255] 13. The RNA molecule according to any one of items 8 to 12, wherein the length of the polyA tail is at least 120 nucleotides.

[0256] 14. A nucleic acid molecule encoding the RNA molecule of any one of items 8 to 13.

[0257] 15. A vector comprising the nucleic acid molecule of item 14.

[0258] 16. A host cell containing the vector of item 15.

[0259] 17. A pharmaceutical composition comprising the RNA molecule according to any one of items 8 to 13, the nucleic acid molecule according to item 14, the vector according to item 15, or the host cell according to item 16, optionally together with a pharma- ceutically acceptable carrier.

[0260] 18. The pharmaceutical composition of item 17 for use in RNA-based therapy.

[0261] 19. A kit comprising a DNA molecule according to any one of items 1 to 4, an RNA molecule according to any one of items 8 to 13, a nucleic acid molecule according to item 14, a vector according to item 5 or 15, or a host cell according to item 6 or 16.

[0262] 20. The use of a UTR as defined in item 8(b) for translating a coding region of an RNA molecule into a polypeptide or protein encoded by said coding region. [Brief description of the drawings]

[0263] [Figure 1] Figure 1 shows sequences harboring "minimal UTR" sequences along with the names of the individual luciferase reporter constructs used in the present invention. The sequences harbor a portion of the T7 promoter and a Kozak element followed by the start codon ATG. The first 10 bases, including the TATA sequence and the following 6 bases (GGGAGA), are sequences derived from the T7 promoter, while the remaining bases upstream of the start codon ATG belong to the Kozak element (GCCACC). "Sp30" is a random sequence of 30 nucleotides. The underlined sequence in SEQ ID NO: 9 is the 5'UTR sequence derived from human alpha globin ("hAg"), which is 30 nucleotides in length. Sequences 1-9 shown in Figure 1 correspond to SEQ ID NOs: 37-45, respectively. [Figure 2A]Figure 1 shows that the extra "C" in the "minimal UTR" is essential (SEQ ID NO: 1 and SEQ ID NO: 2 in Figure 1). Human alveolar epithelial cell line (A549) and human hepatocellular carcinoma cell line (HepG2) were seeded in 96-well plates at a density of 20,000 cells / well and 40,000 cells / well, respectively. 24 hours after seeding, cells were transfected with different luciferase encoding SNIM RNA constructs (SEQ ID NO: 1 and SEQ ID NO: 2 in Figure 1) using Lipofectamine® 2000. Luciferase expression was measured 24 hours after transfection. Values ​​represent the mean ± SD2 of triplicates and were plotted against transfection dose, and data analysis was performed by GraphPad Prism. In both A549 and HepG2 cells, removal of C resulted in lower expression. Therefore, this extra C was included in the design of all further constructs. [Figure 2B] Figure 1 shows that the extra "C" in the "minimal UTR" is essential (SEQ ID NO: 1 and SEQ ID NO: 2 in Figure 1). Human alveolar epithelial cell line (A549) and human hepatocellular carcinoma cell line (HepG2) were seeded in 96-well plates at a density of 20,000 cells / well and 40,000 cells / well, respectively. 24 hours after seeding, cells were transfected with different luciferase encoding SNIM RNA constructs (SEQ ID NO: 1 and SEQ ID NO: 2 in Figure 1) using Lipofectamine® 2000. Luciferase expression was measured 24 hours after transfection. Values ​​represent the mean ± SD2 of triplicates and were plotted against transfection dose, and data analysis was performed by GraphPad Prism. In both A549 and HepG2 cells, removal of C resulted in lower expression. Therefore, this extra C was included in the design of all further constructs. [Diagram 3]Figure 1 shows the effect of individual nucleotides as indicated and demonstrates the effect of the distance between the extra "C" and the Kozak element in A549 transfected cells. Cells were transfected and luciferase assays were performed as described in Materials and Methods. Only dose responses up to 62.5 ng / well are presented here because higher doses fell outside the linear range. The 5'UTR from human alpha globin was used as a positive control. Transfection experiments were performed with SNIM RNA molecules harboring sequences 3-8, respectively, of Figure 1. Human alveolar epithelial cell line (A549) were seeded in 96-well plates at a density of 20,000 cells / well. 24 hours after seeding, cells were transfected with different luciferase encoding SNIM RNA constructs (SEQ ID NOs: 3-8, Figure 1) using Lipofectamine® 2000. Luciferase expression was measured 24 hours after transfection. Values ​​were plotted against transfection dose and data analysis was performed with GraphPad Prism. Values ​​represent the mean ± SD of triplicates. In an alveolar epithelial cell line (A549), insertion of an extra "A" between the C and the Kozak element (SEQ ID NO: 3 in Figure 1) resulted in significantly lower expression (Figure 3). Insertion of a single "T" between the C and the Kozak element (SEQ ID NO: 4 in Figure 1) resulted in expression levels equivalent to those achieved with the 5'UTR of human alpha globin, used as a positive control. [Figure 4]Figure 1 shows the effect of individual nucleotides as indicated and demonstrates the effect of the distance between the extra "C" and the Kozak element in HepG2 transfected cells. Cells were transfected and luciferase assays were performed as described in Materials and Methods. Only dose responses up to 62.5 ng / well are presented here because higher doses fell out of the linear range. Transfection experiments were performed with SEQ ID NOs: 3-8 in Figure 1. Hepatocellular carcinoma cell line (HepG2) was seeded in 96-well plates at a density of 40,000 cells / well. 24 hours after seeding, cells were transfected with different luciferase encoding SNIM RNA constructs (SEQ ID NOs: 3-8 in Figure 1) using Lipofectamine® 2000. Luciferase expression was measured 24 hours after transfection. Values ​​were plotted against transfection dose and data analysis was performed with GraphPad Prism. Values ​​represent the mean ± SD of triplicates. In both cell lines (A549 cells (Figure 3) and HepG2 (Figure 4)), insertion of an extra "A" (SEQ ID NO: 3 in Figure 1) between C and the Kozak element resulted in significantly lower expression (Figures 3 and 4). In both cell types, insertion of a single "T" (SEQ ID NO: 4 in Figure 1) between C and the Kozak element resulted in expression levels equivalent to those achieved with the 5'UTR of human alpha globin, used as a positive control. In HepG2 cells, SEQ ID NO: 1 (Figure 1) was equally effective. [Diagram 5]Figure 5 shows the effect of TISU element on luciferase expression in A549 cells. Detailed dose response and curve fitting were performed for selected luciferase encoding constructs. Based on previous data in Figures 2-4, the TISU element was brought into combination with sequence 4 (Figure 1) containing two desired traits: (C between T7 promoter and Kozak element and extra T between C and Kozak element to achieve SEQ ID NO:9 in Figure 1). Human alveolar epithelial cell line (A549) (Figures 5A and B) and human hepatocellular carcinoma cell line (HepG2) (Figures 5C and D) were seeded in 96-well plates at a density of 20,000 cells / well and 40,000 cells / well, respectively. 24 hours after seeding, cells were transfected with different luciferase encoding SNIM RNA constructs using Lipofectamine® 2000. Luciferase expression was measured 24 and 48 hours after transfection (Figure 5E). Values ​​were plotted against transfection dose and data analyzed by GraphPad Prism. A459 (A, B) and HepG2 (C, D) cells were transfected with different luciferase encoding mRNAs as indicated. Luciferase activity was measured 24 hours (A, C) and 48 hours (B, D) after transfection. Values ​​represent the mean ± SD of triplicates. In both cell lines, significantly higher expression was obtained with luciferase constructs containing the TISU element at both measurement time points (Figure 5A-D). [Figure 6]Figure 6 shows the effect of TISU elements on luciferase expression in A549 cells (Figure 6A) and HepG2 cells (Figure 6B). Human alveolar epithelial cell line (A549) and human hepatocellular carcinoma cell line (HepG2) were seeded in 96-well plates at densities of 20,000 cells / well and 40,000 cells / well, respectively. 24 hours after seeding, cells were transfected with different luciferase encoding SNIM RNA constructs using Lipofectamine® 2000 (X-axis indicates ng amount of SNIM RNA per well of 96-well plate). Luciferase expression was measured 24 hours after transfection. Values ​​were plotted against transfection amount and data analysis was performed by GraphPad Prism. A459 (A) and HepG2 (B) were transfected with different luciferase encoding mRNAs as indicated. [Figure 7]Figure 7 shows the results of in vivo experiments in mice using different luciferase encoding mRNA constructs. The luciferase constructs shown in Figure 7 (see Figure 1 for each UTR sequence element) were tested in vivo in Balb / c mice (female, 6-8 weeks). In this set of experiments, an additional UTR element (WO 2012 / 170930A1) that has been shown to enhance transgene expression was also tested for its efficacy. The luciferase construct containing this UTR element is called Luc2-SUSA. 20 μg of each SNIM-RNA was combined with LF-44 and injected intravenously into Balb / c mice. In vivo imaging was performed 6 hours after injection using an IVIS imaging system and values ​​quantified as photons / sec / cm2 / sr were plotted. The results of whole animal imaging are shown in Figure 7A, and the results of whole organ imaging are shown in Figures 7B (liver), 7C (lungs), and 7D (spleen), respectively. Organs from animals were frozen in liquid nitrogen and homogenized. Cells were lysed in Tris-HCl lysis buffer and luciferase activity was measured. Results are shown in Figure 7E (liver), 7F (lung) and 7G (spleen), respectively. Insertion of the TISU element resulted in higher expression compared to the previously published 5´ and 3´UTR (WO 2012 / 170930A1). Addition of a single T between the C and Kozak (SEQ ID NO: 4 in Figure 1) resulted in expression levels comparable to those observed with the human α-globin UTR (SEQ ID NO: 8 in Figure 1). Addition of the TISU element to SEQ ID NO: 4 (Figure 1) further increased expression (SEQ ID NO: 9 in Figure 1). Surprisingly, it was found that the effect of the human α-globin UTR was not sequence specific. A random 30 nucleotide sequence supported expression levels similar to the human α-globin 5´UTR. Based on in vitro results in cell lines and in vivo experiments in mice, SEQ ID NOs: 1, 4, 7, and 9 (Figure 1) are proposed as promising candidates harboring "minimal UTRs" for transcript therapy. These minimal UTR sequences do not adversely affect RNA yield upon in vitro transcription, and the resulting mRNAs are translated more efficiently compared to mRNAs containing state-of-the-art UTRs. [Figure 8] Figure 8A shows the white blood cell count (WBC) (Figure 8A), red blood cell (RBC) (Figure 8B), platelet (Figure 8C), hemoglobin (Figure 8D), and hematocrit (Figure 8E) values ​​of mice with different luciferase encoding mRNA constructs. Experiments were essentially performed as described in Figure 7, and blood parameters were analyzed by utilizing a Sysmex KX-21N™ Automated Hematology Analyzer (IL, USA). [Figure 9] Figure 1 shows an expression experiment using TISU elements containing human EPO encoding mRNA compared to human EPO encoding mRNA containing 5' and 3' UTR (SUSA UTR) of WO 2012 / 170930A1, known to support very high EPO expression (WO 2012 / 170930A1: Figures 1 and 2). Human alveolar epithelial cell line (A549) and human hepatocellular carcinoma cell line (HepG2) were seeded in 96-well plates at a density of 20,000 cells / well and 40,000 cells / well, respectively. 24 hours after seeding, cells were transfected with 250 ng of different EPO encoding SNIM RNA constructs using Lipofectamine® 2000. EPO amount was quantified 24 hours after transfection by ELISA (Human Erythropoietin Quantikine IVD ELISA Kit from R&D Systems, Minnesota, USA) and data analysis was performed by GraphPad Prism. Values ​​represent the mean ± SD of triplicates. [Figure 10]Figure 10 shows expression experiments with human OTC. For human OTC, expression from TISU elements containing hOTC encoding mRNA was compared to expression from hOTC encoding mRNA containing 5' human alpha globin UTR, which was known to produce the highest expression compared to all other combinations known so far. Human hepatocellular carcinoma cell line (HepG2) was seeded in 96-well plates, and 24 hours after seeding, cells were transfected with different hOTC encoding SNIM RNA constructs using Lipofectamine2000. 24 hours after transfection, cells were lysed and OTC amount was quantified using Western blot. Both hAg and TISU elements containing hOTC encoding SNIM RNA resulted in similar levels of hOTC expression (Figure 10A). Vinculin was used as a housekeeper and band intensity was quantified and used as a quantification internal standard (Figure 10B). [Figure 11] FIG. 1 shows a random 30-nucleotide spacer (left) present in sequence 7 and a predicted secondary structure of the 5'UTR of human α-globin (right) present in sequence 8.

[0264] Other aspects and advantages of the present invention are described in the following examples, which are provided by way of illustration and not by way of limitation. Each publication, patent, patent application, or other document mentioned in this application is incorporated herein by reference in its entirety. EXAMPLES

[0265] I. Materials and Methods Plasmid vectors Each 5´UTR sequence was analyzed using GeneScriptG ( The luciferase reporter constructs were synthesized by Sigma-Aldrich (New Jersey, USA) and cloned in pUC57-Kan (GeneScript). In the case of EPO (codon-optimized human erythropoietin) and OTC (codon-optimized human ornithine transcarbamylase), the coding sequence luciferase gene was replaced with the coding sequence of EPO (SEQ ID NO:35) and OTC (SEQ ID NO:36) genes, respectively. The UTR sequences used in the constructs are shown in Figure 1 along with the name of each luciferase reporter construct.

[0266] mRNA generation To generate in vitro transcribed mRNA (IVT mRNA), the plasmid was linearized by BstBI digestion and purified by chloroform extraction and ethanol precipitation. The purified linearized plasmid was used as a template for in vitro transcription using the RiboMax Large Scale RNA production System-T7 (Promega, Germany). Anti-reverse cap analog (ARCA) was added to the reaction mixture to generate 5´ capped mRNA, and the mRNA was polyadenylated (Thermo Scientific) to generate a 3´ polyA tail.

[0267] In addition, for the production of SNIM mRNA, chemically modified nucleotides, namely methyl-CTP and thio-UTP (Jena Bioscience, Germany), were added to a final concentration of 7.57 mM ATP:CTP:UTP:methyl-CTP:thio-UTP:GTP:5.68 mM:5.68 mM:1.89 mM:1.89 mM:1.21 mM. The complete IVT mixture was incubated at 37°C for 2 h, followed by DNA digestion with DNasel for 20 min at 37°C. RNA was precipitated with ammonium acetate (final concentration 2.5 M) and washed with 70% EtOH. Two washing steps were performed. Finally, the RNA pellet was resuspended in RNAse-free water. All mRNAs were verified on a 1% agarose gel. The transcribed RNA is chemically modified in that approximately 25% of the uridine residues are 2-thiouridine (s2U) and approximately 25% of the cytidine residues are 5-methylcytidine (m5C). The sequences of the UTRs are provided in Figure 1.

[0268] In vitro gene transfer Human alveolar epithelial cell line (A549) and human hepatocellular carcinoma cell line (HepG2) were seeded in 96-well plates at a density of 20,000 cells / well and 40,000 cells / well, respectively. 24 hours after seeding, the cells were transfected with different luciferase encoding SNIM RNA constructs using the commercial transfection reagent Lipofectamine® 2000 at a ratio of 2.5 μL Lipofectamine® 2000 per μg of mRNA (X-axis in Figures 2-6 indicates ng amount of SNIM RNA per well of 96-well plate). Complex formation was prepared as follows: Lipofectamine® 2000 and mRNA were diluted separately in OptiMEM transfection medium and added to a total volume of 45 μL, respectively. These mixtures were incubated at room temperature for 5 minutes. The Lipofectamine® 2000 solution was then mixed with the mRNA solution and then incubated at room temperature for another 20 minutes. The cells were incubated at 37° C. (5% CO2 level) for 1 hour in a total transfection volume of 90 μL. The transfection medium was then removed and the cells were washed with PBS. The cells were then re-incubated with Leibovitz L-15 medium containing 10% FBS.

[0269] cell culture Human alveolar adenocarcinoma cell lines (A549, ATCC CCL-185) were grown in Ham's F12K medium supplemented with 10% FBS. Human hepatocellular carcinoma cell lines (HepG2, ATCC HB-8065) ​​were cultured in DMEM medium supplemented with 10% fetal bovine serum. All cell lines were grown in a humidified atmosphere with a 5% CO2 level.

[0270] Bioluminescence measurements Firefly luciferase (FFL) is a common reporter protein that is not endogenously present in mammals and can be easily detected by luminescence imaging. Luciferase catalyzes the reaction of luciferin with oxygen, which results in the emission of bioluminescent light.

[0271] Human alveolar epithelial cell line (A549) and human hepatocellular carcinoma cell line (HepG2) were seeded in 96-well plates at a density of 20,000 cells / well and 40,000 cells / well, respectively. 24 hours after seeding, cells were transfected with different luciferase encoding SNIM RNA constructs using Lipofectamine® 2000 (X-axis indicates ng amount of SNIM RNA per well of 96-well plate). Bioluminescence was measured 24 hours after transfection. Values ​​were plotted against transfection amount, and data analysis was performed using GraphPad Prism.

[0272] To quantify luciferase expression in homogenized tissue lysates, organs were harvested from animals, frozen in liquid nitrogen, homogenized, and cells were lysed in lysis buffer (25 mM Tris-HCl pH 7.5 with 0.1% Tritron-X100).

[0273] animal Female BALB / c mice aged 6-8 weeks were obtained from Janvier, Route Des Chenes Secs BP5, F-53940 Le Genest St. Isle, France, and maintained under specific pathogen-free conditions. Mice were acclimated to the animal facility environment for at least 7 days before the experiments. All animal procedures were approved and controlled by the local ethical committee and were performed in accordance with the guidelines of the German Animal Ecology Act.

[0274] Lipidoid preparations Lipidoids were formulated with mRNA as follows: C12-(2-3-2), DOPE, Chol, and DSPE-PEG2k (3.6:0.18:0.76:1 weight ratio) were dissolved in ethanol and rapidly injected into citrate buffer (10 mM citric acid, 150 mM NaCl, pH=4.5) containing chemically modified mRNA encoding firefly luciferase at a lipid / mRNA weight ratio of 10.5 to obtain a final ethanol concentration of 20% and dialyzed against water. The resulting lipidoid / mRNA complexes yielded positively charged nanoparticles (92.6±0.7 nm; 21.0±0.2 mV) that were injected intravenously into the tail vein of restrained mice. In a second experiment, lipidoid / mRNA complexes were adapted to PBS prior to intravenous injection, which yielded nearly uncharged nanoparticles (91.5±0.6 nm; -0.7±0.2 mV).

[0275] Measurement of Luc activity in mice using in vivo bioluminescence imaging 24 hours after dosing, mice were anesthetized with intraperitoneal injection of medetomidine (11.5 μg / kg BW), midazolam (115 μg / kg BW), and fentanyl (1.15 μg / kg BW). D-luciferin substrate (3 mg / 100 μL PBS per mouse) was applied by intravenous injection. After 10 minutes, the mice were imaged using the IVIS 100 Imaging Bioluminescence was measured using the following camera settings: Bin (HS), field of view 10, f1 f-stop, high-resolution binning, and 5 min exposure time. Signals were quantified and analyzed using Living Image Software version 2.50 (Xenogen, Alameda, USA).

[0276] Western blot analysis of OTC protein Frozen plates were thawed and direct cell lysis was performed in the plates. Protease inhibitors (cOmplete, EDTA-free, Roche Diagnostics, Germany) and DNase (DNase I solution (2500 U / mL), (Thermo Proteins were lysed using lysis buffer (25 mM TRIS, 0.1% Triton-X100, Sigma-Aldrich, Germany) supplemented with 10 mM Tris-Tris (Sigma-Aldrich, USA). After lysis, samples were mixed with NuPage® LDS Sample Buffer and Sample Reducing Agent (Thermo Fisher, USA) and heated at 70°C for 10 min. Gel electrophoresis was performed using 15 μL of lysate on NuPAGE 10% Bis-Tris Midi Gels using XCell4 SureLock™ Midi, Bio-Rad Criterion™ System (Thermo Fisher, USA). Proteins were transferred using TransBlot® Turbo™ Transfer System (Biorad, Germany) for 30 min. After transfer, the membrane was blocked with NET-gelatin for 30 min and then incubated overnight at 4° C. with primary antibody, diluted in NET-gelatin 1:2000 (OTC Polyclonal Antibody (Center), AP6928c-AB Biocat, Germany). After three washing steps with NET-gelatin, horseradish was added, diluted in NET-gelatin 1:10,000. A peroxidase-conjugated secondary antibody (goat anti-rabbit IgG-HRP, sc-2004, Santa Cruz Biotechnology, USA) was added for 1 h at room temperature. The membrane was again washed three times with NET-gelatin until the signal was visualized with a chemiluminescent substrate kit (Luminata Crescendo Western HRP Substrate, Merck Millipore, Germany) and visualized with the ChemiDoc™ MP System (Biorad, Germany).

[0277] material FBS, Leibovitz L-15 medium (Gibco), Lipofectamine® 2000, and OptiMEM (Gibco) were purchased from Invitrogen, Germany. Sterile PBS was prepared in-house. Ham F-12K, DMEM, and trypsin-EDTA were purchased from ccpro GmbH, Germany.

[0278] II. result II.a Cell culture experiments

[0279] Figures 2A and B show that the extra "C" between the T7 promoter and the Kozak element is essential. Removal of that base reduces expression in both of the cell types compared. For both constructs (SEQ ID NOs: 1 and 2 in Figure 1), the full dose range and linear range (exclusion value: doses above 62.5 ng / well were excluded from the analysis) are presented separately for ease of comparison. In both A549 and HepG2 cells, removal of the C resulted in lower expression. Therefore, this extra C was included in the design of all further constructs.

[0280] Based on the results obtained in A549 and HepG2 cells, further experiments were performed with a construct containing an extra "C" (SEQ ID NO:1: T7Luc2).

[0281] Figures 3 and 4 Sequence 1 was used as a template into which either a single nucleotide (A, T, G, or C: SEQ ID NOs: 3-6 in FIG. 1, respectively), or a random sequence 30 nucleotides long and lacking any predictable secondary structure (sequence 7), or the 5'UTR from human alpha globin (sequence 8) was incorporated between the "C" and the Kozak sequence to be investigated.

[0282] Cells were transfected and luciferase assays were performed as described in Materials and Methods. Only dose responses up to 62.5 ng / well are presented here because higher doses were outside the linear range. The 5'UTR from human alpha globin was used as a positive control.

[0283] Summarizing the above results, Figures 1-4 show that the extra "C" between the T7 promoter and the Kozak element is essential for achieving high protein expression using a minimalist 5'UTR. Removing nucleotides results in reduced expression. Adding an extra "A" between the extra "C" and the Kozak element has a negative effect on expression. Adding a pyrimidine base, most preferably a "T", at that position results in levels similar to those observed with the 5'UTR derived from hAg.

[0284] Then, we performed additional experiments: - To clarify the impact of TISU in combination with the best performing sequence (sequence 9), It will be determined whether the effect of the 5' UTR from -hAg is a cell-specific effect or whether the distance between the 5' cap and the start codon is important.

[0285] Figure 5 shows the effect of the TISU element on the expression of luciferase in A549 cells. The "TISU element" incorporates "AG" instead of "CC" in SEQ ID NO: 9 in Figure 1, compared to SEQ ID NO: 4 shown in Figure 1. A549 cells (Figures 5A and B) and HepG2 cells (Figures 5C and D) showed significantly higher luciferase expression 24 hours (A, C) and 48 hours (B, D) after transfection with luciferase containing the TISU element with "C" in SEQ ID NO: 1 and an additional "T" between this "C" and the Kozak element.

[0286] Figure 6 shows the results of an experiment similar to that of Figure 5, but with the addition of a 5'UTR containing a 30 nucleotide random sequence, allowing for an alignment comparison of the human alpha globin UTR (sequence 8 in Figure 1) with a random sequence of the same length (sequence 7 in Figure 1). Luciferase expression was measured in HepG2 (Figure 6A) and A549 cells (Figure 6B) 24 hours after transfection with SNIM RNA, as indicated.

[0287] Figure 9 shows the results of expression experiments using TISU elements containing hEPO encoding mRNA compared to hEPO encoding mRNA containing the 5' and 3' UTRs (SUSA UTR) of WO 2012 / 170930A1: Figures 1 and 2) used as a standard after transfection with SNIM RNA in A549 and HepG2 cells, respectively. EPO amounts were quantified 24 hours after transfection by ELISA. Values ​​represent the mean ± SD of triplicates.

[0288] In human A549 cells, integration of the TISU element resulted in higher expression compared to that achieved with integration of the 5' and 3' UTRs (Figure 9A). Comparable expression levels were also observed in HepG2 cells (Figure 9B). This is particularly surprising since integration of the SUSA 5' and 3' UTRs lengthens the RNA by approximately 200 nucleotides compared to the UTRs of the present invention.

[0289] Figure 10 shows an expression experiment with human OTC. For comparison, the TISU element containing hOTC encoding mRNA was compared to all other combinations known so far and compared to that from hOTC encoding mRNA containing the 5' human alpha globin UTR, which is known to produce the highest expression.

[0290] HepG2 cells were transfected with different hTOC encoding SNIM RNA constructs, lysed 24 h later, and the amount of OTC was quantified by Western blotting.

[0291] Both hAg and TISU elements, containing the hOTC encoding SNIM RNA, resulted in similar levels of hOTC expression (Figure 10A). Vinculin was used as a housekeeper and band intensities were compared using densitometry (Figure 10B).

[0292] II.b IV application of Luc2 constructs in mice The results are shown in Figures 7 and 8.

[0293] The following constructs were used for IV application in mice: Luc2(+8+A) Luc2(+8+T) Luc2(+8+T)+TISU Luc2-hAg Luc2-Sp30 Luc2-SUSA UTR

[0294] 20 μg of each SNIM-RNA was combined with LF-44 and injected IV into Balb / c mice. As an additional control, a Luc2 sequence flanked at the 5' end by the human CMV enhancer and at the 3' end by the human growth hormone 3'UTR (Luc2-SUSA) was also generated. The sequence used as the UTR in this construct was taken from the Shire patent (WO 2012 / 170930A1: sequence ID1 / Figure 1).

[0295] In vivo imaging was performed 6 hours after injection using an IVIS imaging system and values ​​quantified as photons / sec / cm2 / sr were plotted. Whole animal imaging results are shown in Figure 7A, and whole organ imaging results are shown in Figures 7B (liver), 7C (lungs), and 7D (spleen), respectively.

[0296] Organs from the animals were frozen in liquid nitrogen, homogenized, lysed, and luciferase activity was measured, and the results are shown in Figures 7E (liver), 7F (lung), and 7G (spleen), respectively.

[0297] Blood parameters of animals were analyzed by utilizing Sysmex KX-21N™ Automated Hematology Analyzer: White blood cell count (WBC) (Figure 8A), red blood cell (RBC) (Figure 8B), platelet (Figure 8C), hemoglobin (Figure 8D), hematocrit (Figure 8E) values ​​of mice with different luciferase encoding mRNA constructs showed no significant difference.

[0298] Figure 11: Predicted secondary structures of a random 30 nucleotide spacer present in sequence 7 (left) and the 5´UTR of human α-globin of the same length present in sequence 8 (right). Although the secondary structures of both sequences are not even similar, they produced similar expression levels (Figures 6A and 6B), both of which were equally low compared to T7Luc2(+8+T)-TISU.

Claims

1. (a) a coding region including an initiation codon at its 5' terminus and encoding a polypeptide; (b) a UTR immediately upstream of the coding sequence selected from the group consisting of: (b1) is an array R ２ - a UTR of CGCCACC (SEQ ID NO:1) or a sequence in which, in said UTR sequence, at position 6 of SEQ ID NO:1, C is replaced by A, at position 7 of SEQ ID NO:1, C is replaced by G; and / or at position 5 of SEQ ID NO:1, A is replaced by G, R ２ is an RNA sequence corresponding to a portion of the promoter region beginning with the nucleotide at which DNA-dependent RNA polymerase initiates RNA synthesis, R ２ teeth, (i) GGGAGA (SEQ ID NO: 7), (ii) GGGAGA (SEQ ID NO: 8), (iii) GAAG (SEQ ID NO:9), and (iv) selected from the group consisting of GGGA (SEQ ID NO:10); At the 3' end, it contains a poly A tail. R ２ When R is (i) or (ii), the maximum length of the UTR as defined in (b) is 14 nucleotides; or ２ (iii) or (iv), the maximum length of the UTR as defined in (b) is 12 nucleotides; 1. A pharmaceutical composition for translating a coding region of an RNA molecule into a polypeptide or protein encoded by said coding region, comprising:

2. The pharmaceutical composition of claim 1, wherein the length of the polyA tail of the RNA molecule is at least 120 nucleotides.

3. A nucleic acid molecule encoding the RNA molecule of claim 1 or 2.

4. A vector comprising the nucleic acid molecule of claim 3.

5. A host cell comprising the vector of claim 4.

6. 10. A pharmaceutical composition comprising an RNA molecule according to claim 1 or 2, a nucleic acid molecule according to claim 3, a vector according to claim 4, or a host cell according to claim 5, optionally together with a pharma- ceutically acceptable carrier.

7. The pharmaceutical composition of claim 6 for use in RNA-based therapy.

8. A kit comprising an RNA molecule described in claim 1 or 2, a nucleic acid molecule described in claim 3, a vector described in claim 4, or a host cell described in claim 5.

Images