Inorganic porous substrate, inorganic porous carrier, and method for producing nucleic acid

Abstract

The purpose of the present invention is to provide: an inorganic porous substrate which can be served as a precursor of an inorganic porous support capable of further improving purity or the like in an efficient nucleic acid production method, particularly in the production of a nucleic acid; an inorganic porous support; and a method for producing a nucleic acid using the inorganic porous support. The present invention provides: an inorganic porous substrate having silyl groups respectively represented by (i) and (ii) and having the characteristic properties (iii) to (v); an inorganic porous support derived from the inorganic porous substrate; and a method for producing a nucleic acid using the inorganic porous support. (i) A silyl group (A): a silyl group represented by formula (i-1); (ii) a silyl group (B): at least one silyl group selected from the group consisting of silyl groups respectively represented by (ii-1), (ii-2) and (ii-3); (iii) the particle diameter is 1 μm or more; (iv) the pore diameter is 20 nm or more; and (v) the cumulative pore volume in a pore diameter range of 40 to 1000 nm is more than 0.32 mL / g and 4 mL / g or less.

Description

[Technical field]

[0001] This patent application claims priority and the benefit of Japanese Patent Application No. 2020-084641 (filed May 13, 2020) under the Paris Convention, the entire contents of which are incorporated herein by reference.

[0002] The present invention relates to an inorganic porous substrate, an inorganic porous carrier derived from the inorganic porous substrate, and a method for producing nucleic acid using the inorganic porous carrier. [Background technology]

[0003] As a chemical synthesis method of nucleic acid, solid-phase synthesis method by phosphoramidite method is widely used. In this method, first, a functional group such as an amino group is introduced on an inorganic porous body using a silane coupling agent or the like, and a nucleoside that will be the 3' end of the nucleic acid is bound to the functional group. Then, a nucleic acid extension reaction is performed on a solid-phase support starting from the nucleoside. In the solid-phase synthesis method, the synthesis efficiency decreases rapidly, especially when the chain length of the nucleic acid to be synthesized becomes long, and a large amount of by-products tends to be mixed in. For this reason, the purity of the synthesized nucleic acid is not necessarily satisfactory, and the synthesis is not efficient.

[0004] In addition, in the solid phase synthesis method, since various reaction substrates / solvents are reacted sequentially with the solid phase support, it is possible that the surface functional groups of the solid phase support and the solvent affinity of the solid phase support surface derived therefrom may affect the reaction. For example, a case where a solid phase support was modified with methyltrimethoxysilane has been reported (see Patent Document 1). [Prior art documents] [Patent documents]

[0005] [Patent Document 1] JP 3-181334 Summary of the Invention [Problem to be solved by the invention]

[0006] The present invention has been made in consideration of the above-mentioned circumstances, and aims to provide an inorganic porous base material that serves as a precursor to an inorganic porous carrier that can further improve the purity, etc., in the production of nucleic acids, an inorganic porous carrier, and a method for producing nucleic acids using the inorganic porous carrier. [Means for solving the problem]

[0007] The present inventors have conducted extensive research to achieve the above object, and have found that in the synthesis of nucleic acid, by substituting the silanol (SiOH) group on the surface of the inorganic porous carrier with a specific silyl group, the formation of by-products in the production of oligonucleic acid products can be suppressed.Therefore, the present invention provides an inorganic porous base material that is a precursor of the inorganic porous carrier, which has a silyl group with a specific structure and has a certain pore size, an inorganic porous carrier, and a method for producing nucleic acid using the inorganic porous carrier.

[0008] In order to solve the above problems, specific aspects include, but are not limited to, the following aspects. [1] An inorganic porous substrate having silyl groups represented by the following (i) and (ii) and having the following characteristics (iii) to (v): (i) Silyl group (A): a silyl group represented by the following formula (i-1): (ii) Silyl group (B): at least one silyl group selected from the group consisting of silyl groups represented by the following formulas (ii-1), (ii-2), and (ii-3): (iii) The particle size is 1 μm or more; (iv) the pore size is 20 nm or more; (v) The cumulative pore volume in the pore diameter range of 40 nm to 1000 nm is greater than 0.32 mL / g and less than or equal to 4 mL / g. [ka] [In formula (i-1), X1 represents a bond to an inorganic porous substrate; Y1 each independently represents any one selected from the group consisting of a bond to an inorganic porous substrate, a hydroxyl group, an amino group, an alkoxy group having 1 to 6 carbon atoms, and an alkylamino group having 1 to 12 carbon atoms; Z1 each independently represents an alkyl group having 1 to 6 carbon atoms or an aryl group having 6 to 12 carbon atoms; a represents an integer represented by 2-b; b represents an integer of 0 to 2; A1 represents an organic group having 1 to 20 carbon atoms, and B1 represents any one selected from the group consisting of a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, and an aryl group having 6 to 12 carbon atoms. [ka] , [ka] , [ka] , [In the formula (ii-1), (ii-2), or (ii-3), P1 represents a bond to an inorganic porous substrate; Q1 and R1 each independently represent any one selected from the group consisting of a bond to an inorganic porous substrate, a hydroxyl group, an amino group, an alkoxy group having 1 to 6 carbon atoms, and an alkylamino group having 1 to 12 carbon atoms; J1 represents an alkyl group having 2 to 20 carbon atoms or an aryl group having 7 to 20 carbon atoms; Each K1 independently represents an alkyl group having 1 to 20 carbon atoms or an aryl group having 6 to 20 carbon atoms; M1 represents an alkylene group having 1 to 6 carbon atoms, and N1 represents an alkyl group having 2 to 20 carbon atoms or an aryl group having 6 to 20 carbon atoms. [2] The inorganic porous substrate according to [1], wherein the pore diameter of the inorganic porous substrate is 40 nm or more and 500 nm or less. [3] The specific surface area of ​​the inorganic porous substrate is 0.1 m 2 / g or more, 200m 2 / g or less. [4] The inorganic porous substrate according to any one of [1] to [3], wherein the inorganic porous substrate is composed of silica, silica gel, zeolite, or glass. [5] The inorganic porous substrate according to any one of [1] to [4], wherein the amount of active NH groups represented by the following formula (NH-1) satisfies the following mathematical formula (NH#1): [ka] [In formula (NH-1), A1 represents an organic group having 1 to 20 carbon atoms; B1 represents any one selected from the group consisting of a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, and an aryl group having 6 to 12 carbon atoms, An NH group that satisfies the above structural requirements is defined as an active NH group.

number

[10] An inorganic porous carrier having the following silyl groups (vi) and (vii) and the following characteristic (viii): (vi) Silyl group (C): a silyl group represented by the following formula (vi-1): (vii) Silyl group (D): at least one silyl group selected from the group consisting of silyl groups represented by the following formulas (vii-1), (vii-2), and (vii-3): (viii) The pore size is 20 nm or more. [ka] [In formula (vi-1), X01 represents a bond to an inorganic porous carrier; Y01 each independently represents any one selected from the group consisting of a bond to an inorganic porous carrier, a hydroxyl group, an amino group, an alkoxy group having 1 to 6 carbon atoms, and an alkylamino group having 1 to 12 carbon atoms; Z1 each independently represents an alkyl group having 1 to 6 carbon atoms or an aryl group having 6 to 12 carbon atoms; a represents an integer represented by 2-b; b represents an integer of 0 to 2; A01 represents an organic group having 1 to 20 carbon atoms; B1 represents any one selected from the group consisting of a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, and an aryl group having 6 to 12 carbon atoms, C1 represents a group having a nucleoside or nucleotide structure in which a reactive group is protected or deprotected. [ka] , [ka] , [ka] [In formula (vii-1), (vii-2), or (vii-3), P01 represents a bond with an inorganic porous carrier; Q01 and R01 each independently represent any one selected from the group consisting of a bond to an inorganic porous carrier, a hydroxyl group, an amino group, an alkoxy group having 1 to 6 carbon atoms, and an alkylamino group having 1 to 12 carbon atoms; J1 represents an alkyl group having 2 to 20 carbon atoms or an aryl group having 7 to 20 carbon atoms; Each K1 independently represents an alkyl group having 1 to 20 carbon atoms or an aryl group having 6 to 20 carbon atoms; M1 represents an alkylene group having 1 to 6 carbon atoms, and N1 represents an alkyl group having 2 to 20 carbon atoms or an aryl group having 6 to 20 carbon atoms.]

[11] The inorganic porous carrier according to

[10] , wherein the pore diameter of the inorganic porous carrier is 40 nm or more and 500 nm or less.

[12] The inorganic porous carrier according to any one of

[10] to

[11] , characterized in that the inorganic porous carrier has a cumulative pore volume in the pore diameter range of 40 nm to 1000 nm that is greater than 0.32 mL / g and not greater than 4 mL / g.

[13] The specific surface area of ​​the inorganic porous carrier is 0.1 m 2 / g or more, 200m 2 / g or less.

[14] The inorganic porous support according to any one of

[10] to

[13] , wherein the inorganic porous body is composed of silica, silica gel, zeolite, or glass.

[15] The inorganic porous carrier according to any one of

[10] to

[14] , characterized in that the amount of a group containing a nucleoside or nucleotide structure in which a reactive group is protected or deprotected satisfies the following mathematical formula (Nu#1).

number

[16] The inorganic porous support according to any one of

[10] to

[15] , wherein C1 in the general formula (vi-1) contains a succinyl linker.

[17] The inorganic porous carrier according to any one of

[10] to

[16] , which has a silyl group represented by the above formula (vii-3) as the silyl group (D).

[18] The inorganic porous carrier according to any one of

[10] to

[17] , wherein the silyl group represented by the above formula (vii-3) is a silyl group represented by the following formula (vii-3-1): [ka] [In formula (ii-3-1), P01 represents a bond with an inorganic porous carrier; Each K2 independently represents an alkyl group having 1 to 6 carbon atoms or an aryl group having 6 to 10 carbon atoms; M2 represents an alkylene group having 1 to 4 carbon atoms, and N2 represents an alkyl group having 2 to 6 carbon atoms or an aryl group having 6 to 10 carbon atoms.]

[19] The inorganic porous carrier according to any one of

[10] to

[18] , wherein A01 in the above formula (vi-1) is an alkylene group having 1 to 20 carbon atoms which may contain one or more of an acylimino group, an oxy group, or a thio group.

[20] The inorganic porous carrier according to any one of

[10] to

[19] , wherein the silyl group (C) is represented by the following formula (vi-1-1): [ka] [In formula (vi-1-1), X01 represents a bond to an inorganic porous carrier; Z1 each independently represents an alkyl group having 1 to 6 carbon atoms or an aryl group having 6 to 12 carbon atoms; A02 represents an alkylene group having 1 to 15 carbon atoms which may contain at least one of an acylimino group, an oxy group, and a thio group; B2 represents any one selected from the group consisting of a hydrogen atom and an alkyl group having 1 to 2 carbon atoms, and C2 represents a group having a nucleoside or nucleotide structure containing a succinyl linker and a reactive group that is protected or deprotected.

[21] Using an inorganic porous support having a group having a nucleoside or nucleotide structure in which a hydroxyl group as a reactive group is protected in C1 in the above formula (vi-1), (A) a step of deprotecting the protecting group of the hydroxyl group at the 5' position of the nucleoside; a step (B) of producing a phosphite by condensing the hydroxyl group at the 5' position of the nucleoside produced in the step (A) with an amidite compound having a second nucleoside base; A step (C) of oxidizing the phosphite produced in the step (B) to produce a nucleotide; and A step (D) of deprotecting the protecting group of the hydroxyl group at the 5' position of the nucleotide produced in the step (C). A method for producing a nucleic acid, comprising:

[22] A step (B') of further condensing the product produced in the step (D) with an amidite compound having a nucleoside base to be introduced next to produce a phosphite; A step (C') of oxidizing the phosphite produced in the step (B') to produce an oligonucleotide; and A step (D') of deprotecting the protecting group of the hydroxyl group at the 5'-position of the oligonucleotide chain end generated in the step (C') The method for producing a nucleic acid according to

[21] , comprising:

[23] The method for producing a nucleic acid according to

[22] , further comprising repeating the series of steps (B'), (C') and (D') m times (m is an integer of 1 or more) to react m amidite compounds and then excising the extended nucleic acid (E).

[24] Use of the inorganic porous carrier according to any one of

[10] to

[20] in the production of nucleic acid by the phosphoramidite method. Effect of the Invention

[0009] The present invention provides an inorganic porous base material that serves as a precursor to an inorganic porous carrier, which can improve purity even in the synthesis of long-chain nucleic acids by replacing silanol groups on the surface of the inorganic porous carrier with specific silyl groups, an inorganic porous carrier, and a method for producing high-purity nucleic acids using the inorganic porous carrier. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0010] The inorganic porous substrate of the present invention has silyl groups represented by the following (i) and (ii) and has the following characteristics (iii) to (v): (i) Silyl group (A): a silyl group represented by the following formula (i-1): (ii) Silyl group (B): at least one silyl group selected from the group consisting of silyl groups represented by the following formulas (ii-1), (ii-2), and (ii-3): (iii) The particle size is 1 μm or more; (iv) the pore size is 20 nm or more; (v) The cumulative pore volume in the pore diameter range of 40 nm to 1000 nm is greater than 0.32 mL / g and less than or equal to 4 mL / g.

[0011] [ka] [In formula (i-1), X1 represents a bond to an inorganic porous substrate; Y1 each independently represents any one selected from the group consisting of a bond to an inorganic porous substrate, a hydroxyl group, an amino group, an alkoxy group having 1 to 6 carbon atoms, and an alkylamino group having 1 to 12 carbon atoms; Z1 each independently represents an alkyl group having 1 to 6 carbon atoms or an aryl group having 6 to 12 carbon atoms; a represents an integer represented by 2-b; b represents an integer of 0 to 2; A1 represents an organic group having 1 to 20 carbon atoms, and B1 represents any one selected from the group consisting of a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, and an aryl group having 6 to 12 carbon atoms. [ka] , [ka] , [ka] [In the formula (ii-1), (ii-2), or (ii-3), P1 represents a bond to an inorganic porous substrate; Q1 and R1 each independently represent any one selected from the group consisting of a bond to an inorganic porous substrate, a hydroxyl group, an amino group, an alkoxy group having 1 to 6 carbon atoms, and an alkylamino group having 1 to 12 carbon atoms; J1 represents an alkyl group having 2 to 20 carbon atoms or an aryl group having 7 to 20 carbon atoms; Each K1 independently represents an alkyl group having 1 to 20 carbon atoms or an aryl group having 6 to 20 carbon atoms; M1 represents an alkylene group having 1 to 6 carbon atoms, and N1 represents an alkyl group having 2 to 20 carbon atoms or an aryl group having 6 to 20 carbon atoms.

[0012] In the above formula (i-1), the bond to the inorganic porous substrate in X1 is specifically a bond via an --O-- bond on the surface of the inorganic porous substrate.

[0013] In the above formula (i-1), each Y1 independently represents any one selected from the group consisting of a bond to an inorganic porous substrate, a hydroxyl group, an amino group, an alkoxy group having 1 to 6 carbon atoms, and an alkylamino group having 1 to 12 carbon atoms. Here, the bond with the inorganic porous substrate in Y1 is the same as that in X1 above. The alkoxy group having 1 to 6 carbon atoms for Y1 is preferably an alkoxy group having 1 to 3 carbon atoms, and specific examples thereof include a methoxy group, an ethoxy group, an n-propoxy group, and an i-propoxy group. The alkylamino group having 1 to 12 carbon atoms in Y1 is preferably an alkylamino group having 1 to 6 carbon atoms. The alkylamino group here may be a monoalkylamino group or a dialkylamino group, and preferably a dialkylamino group. Specific examples include a dimethylamino group, a diethylamino group, a di(n-propyl)amino group, and a di(i-propyl)amino group.

[0014] In the above formula (i-1), Z1 represents an alkyl group having 1 to 6 carbon atoms or an aryl group having 6 to 12 carbon atoms. The alkyl group having 1 to 6 carbon atoms in Z1 may include a linear or branched alkyl group and a cycloalkyl group, and preferably means a linear or branched alkyl group. Specific examples include a methyl group, an ethyl group, an n-propyl group, an n-butyl group, an n-pentyl group, an n-hexyl group, an i-propyl group, an i-butyl group, a sec-butyl group, a tert-butyl group, a cyclopentyl group, and a cyclohexyl group. Preferred are a methyl group, an ethyl group, an n-propyl group, an n-butyl group, an i-propyl group, an i-butyl group, a sec-butyl group, and a cyclohexyl group, more preferably an ethyl group, an n-propyl group, an n-butyl group, an i-propyl group, an i-butyl group, a sec-butyl group, and a cyclohexyl group, further preferably an ethyl group, an n-butyl group, and an i-propyl group, and particularly preferably an i-propyl group.

[0015] The aryl group having 6 to 12 carbon atoms in Z1 includes a phenyl group and a phenyl group having one or more substituents. The substituent of the phenyl group having a substituent includes an alkyl group having 1 to 6 carbon atoms and an alkoxy group having 1 to 6 carbon atoms.

[0016] In the above formula (i-1), a represents an integer represented by 2-b, and b represents an integer of 0 to 2. Preferably, b is 2 (in this case, a is 0). When a is 2, the two Y1's may be the same or different groups. From the viewpoint of synthesis, it is preferable that they are the same. When b is 2, the two Z1's may be the same or different groups. From the viewpoint of synthesis, it is preferable that they are the same.

[0017] In the above formula (i-1), A1 represents an organic group having 1 to 20 carbon atoms. Specific examples include an alkylene group having 1 to 20 carbon atoms, an arylene group having 1 to 20 carbon atoms, an alkylene group having 1 to 20 carbon atoms which may contain one or more of an imino group, an oxy group, or a thio group, and an arylene group having 1 to 20 carbon atoms which may contain one or more of an imino group, an oxy group, or a thio group.

[0018] In the above formula (i-1), B1 represents any one selected from the group consisting of a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, and an aryl group having 6 to 12 carbon atoms. Specific and preferred examples of the alkyl group having 1 to 6 carbon atoms in B1 include the same as the alkyl group having 1 to 6 carbon atoms in Z1. Specific and preferred examples of the aryl group having 6 to 12 carbon atoms in B1 include the same as the aryl group having 6 to 12 carbon atoms in Z1.

[0019] In formula (ii-1), P1 represents a bond to the inorganic porous substrate, and the bond to the inorganic porous substrate in P1 is the same as the bond to the inorganic porous substrate in X1 above.

[0020] In formula (ii-1), Q1 and R1 each independently represent any one selected from the group consisting of a bond to an inorganic porous substrate, a hydroxyl group, an amino group, an alkoxy group having 1 to 6 carbon atoms, and an alkylamino group having 1 to 6 carbon atoms. Here, the bond to an inorganic porous substrate in Q1 and R1 is the same as X1 above. In addition, the alkoxy group having 1 to 6 carbon atoms and the alkylamino group having 1 to 6 carbon atoms in Q1 and R1 are as defined in Y1 above.

[0021] J1 represents an alkyl group having 2 to 20 carbon atoms or an aryl group having 7 to 20 carbon atoms. The alkyl group having 2 to 20 carbon atoms in J1 is preferably an alkyl group having 2 to 6 carbon atoms, and specific examples thereof include an ethyl group, an n-propyl group, an n-butyl group, an n-pentyl group, an n-hexyl group, an i-propyl group, an i-butyl group, a sec-butyl group, a tert-butyl group, a cyclopentyl group, and a cyclohexyl group. The alkyl group having 2 to 20 carbon atoms in J1 may have one or more substituents. Examples of the substituents include a fluoro group, a chloro group, a bromo group, a cyano group, an aryl group having 6 to 10 carbon atoms, an alkoxy group having 1 to 6 carbon atoms, an aryloxy group having 6 to 10 carbon atoms, an acyloxy group having 1 to 10 carbon atoms, an acyl group having 1 to 10 carbon atoms, an alkylcarbamoyl group having 1 to 6 carbon atoms, and an arylcarbamoyl group having 6 to 10 carbon atoms. The aryl group having 7 to 20 carbon atoms in J1 is preferably an aryl group having 7 to 10 carbon atoms, and specific examples thereof include a phenyl group having at least one alkyl group having 1 to 6 carbon atoms, and a phenyl group having one or more other substituents. Examples of the other substituent in the phenyl group having a substituent include a fluoro group, a chloro group, a bromo group, a cyano group, an alkoxy group having 1 to 6 carbon atoms, an aryloxy group having 6 to 10 carbon atoms, an acyloxy group having 1 to 10 carbon atoms, an acyl group having 1 to 10 carbon atoms, an alkylcarbamoyl group having 1 to 6 carbon atoms, and an arylcarbamoyl group having 6 to 10 carbon atoms.

[0022] In formula (ii-2), P1 represents a bond to the inorganic porous substrate, and the bond to the inorganic porous support in P1 is defined the same as the above X1 and P1 in formula (ii-1). Q1 represents any one selected from the group consisting of a bond to an inorganic porous substrate, a hydroxyl group, an amino group, an alkoxy group having 1 to 6 carbon atoms, and an alkylamino group having 1 to 12 carbon atoms, where the alkoxy group having 1 to 6 carbon atoms and the alkylamino group having 1 to 12 carbon atoms are each defined as in formula (ii-1) above.

[0023] In formula (ii-2), K1 represents an alkyl group having 1 to 20 carbon atoms or an aryl group having 6 to 20 carbon atoms. The alkyl group having 1 to 20 carbon atoms is preferably an alkyl group having 1 to 6 carbon atoms, and specific examples thereof include a methyl group, an ethyl group, an n-propyl group, an n-butyl group, an n-pentyl group, an n-hexyl group, an i-propyl group, an i-butyl group, a sec-butyl group, a tert-butyl group, a cyclopentyl group, and a cyclohexyl group. The alkyl group having 1 to 20 carbon atoms in K1 may have one or more substituents. Examples of the substituents include a fluoro group, a chloro group, a bromo group, a cyano group, an aryl group having 6 to 10 carbon atoms, an alkoxy group having 1 to 6 carbon atoms, an aryloxy group having 6 to 10 carbon atoms, an acyloxy group having 1 to 10 carbon atoms, an acyl group having 1 to 10 carbon atoms, an alkylcarbamoyl group having 1 to 6 carbon atoms, and an arylcarbamoyl group having 6 to 10 carbon atoms. The aryl group having 6 to 20 carbon atoms is preferably an aryl group having 6 to 10 carbon atoms, and specific examples thereof include a phenyl group and a phenyl group having one or more substituents. Examples of the substituent of the phenyl group having a substituent include a fluoro group, a chloro group, a bromo group, a cyano group, an alkoxy group having 1 to 6 carbon atoms, an aryloxy group having 6 to 10 carbon atoms, an acyloxy group having 1 to 10 carbon atoms, an acyl group having 1 to 10 carbon atoms, an alkylcarbamoyl group having 1 to 6 carbon atoms, and an arylcarbamoyl group having 6 to 10 carbon atoms.

[0024] In formula (ii-3), P1 represents a bond to the inorganic porous substrate, and the bond to the inorganic porous support in P1 is defined as X1 above and P1 in formula (ii-1) or (ii-2) above. K1 represents an alkyl group having 1 to 20 carbon atoms or an aryl group having 6 to 20 carbon atoms, each of which is the same as defined in the above formula (ii-2).

[0025] In formula (ii-3), M1 represents a divalent alkylene group having 1 to 6 carbon atoms. The alkylene group having 1 to 6 carbon atoms in M1 is preferably an alkylene group having 1 to 4 carbon atoms, specifically, a methylene group, an ethylene group, an n-propylene group, and an n-butylene group. More preferably, a methylene group and an ethylene group are used.

[0026] In formula (ii-3), N1 represents an alkyl group having 2 to 20 carbon atoms or an aryl group having 6 to 20 carbon atoms. The alkyl group having 2 to 20 carbon atoms in N1 is preferably an alkyl group having 2 to 10 carbon atoms, more preferably an alkyl group having 2 to 6 carbon atoms, specifically, an ethyl group, a propyl group, a butyl group, a pentyl group, and a hexyl group. The alkyl group having 2 to 20 carbon atoms in N1 may have one or more substituents. Examples of the substituents include a fluoro group, a chloro group, a bromo group, a cyano group, an aryl group having 6 to 10 carbon atoms, an alkoxy group having 1 to 6 carbon atoms, an aryloxy group having 6 to 10 carbon atoms, an acyloxy group having 1 to 10 carbon atoms, an acyl group having 1 to 10 carbon atoms, an alkylcarbamoyl group having 1 to 6 carbon atoms, and an arylcarbamoyl group having 6 to 10 carbon atoms. The aryl group having 6 to 20 carbon atoms in N1 is preferably an aryl group having 6 to 10 carbon atoms. Specific examples include a phenyl group and a phenyl group having one or more substituents. Examples of the substituent of the phenyl group having a substituent include a fluoro group, a chloro group, a bromo group, a cyano group, an alkoxy group having 1 to 6 carbon atoms, an aryloxy group having 6 to 10 carbon atoms, an acyloxy group having 1 to 10 carbon atoms, an acyl group having 1 to 10 carbon atoms, an alkylcarbamoyl group having 1 to 6 carbon atoms, and an arylcarbamoyl group having 6 to 10 carbon atoms.

[0027] In view of application to nucleic acid synthesis, the inorganic porous substrate in the present invention has a pore diameter of 20 nm or more. The inorganic porous substrate to be used can be appropriately selected according to the chain length of the nucleic acid to be synthesized. Usually, when the chain length of the nucleic acid to be synthesized is long, it is preferable to select a substrate with a large pore diameter. The preferred pore diameter is 20 nm or more and 500 nm or less, more preferably 25 nm or more and 500 nm or less, even more preferably 30 nm or more and 500 nm or less, even more preferably 40 nm or more and 500 nm or less, and particularly preferably 40 nm or more and 300 nm or less. The pore diameter here can be determined by analyzing an inorganic molded body, which is the raw material of the inorganic porous substrate, by mercury intrusion porosimetry, and in the resulting pore size distribution graph (a graph in which the X-axis is the pore diameter value and the Y-axis is the value obtained by differentiating the pore volume with the pore diameter) the pore diameter (mode diameter) obtained from the X-axis value at the maximum value of the Y-axis can be determined.

[0028] The particle size of the inorganic porous substrate of the present invention is characterized by being 1 μm or more from the viewpoint of preventing blockage of piping when used in a nucleic acid synthesizer after being led to an inorganic porous carrier described later. It is preferably 5 μm or more, more preferably 10 μm or more, even more preferably 20 μm or more, and particularly preferably 30 μm or more. The particle size can be controlled by sieving the inorganic molded body or inorganic porous substrate, which is the raw material, through a sieve with an opening of the corresponding particle size or more to remove fine particles. The particle size of the inorganic porous substrate of the present invention can be determined by observing the raw inorganic molded body with a scanning electron microscope at a magnification of 200 times and taking the average of the major axis lengths of 50 particles selected from the observation.

[0029] The inorganic porous substrate of the present invention is characterized in that the cumulative pore volume in the range of pore diameters from 40 nm to 1000 nm is greater than 0.32 mL / g and less than 4 mL / g from the viewpoint of application to nucleic acid synthesis as described below. The cumulative pore volume in the same range is preferably greater than 0.35 mL / g and less than 3.5 mL / g, more preferably greater than 0.4 mL / g and less than 3 mL / g, even more preferably greater than 0.43 mL / g and less than 3 mL / g, and even more preferably greater than 0.45 mL / g and less than 2.5 mL / g. The cumulative pore volume in the range of pore diameters from 40 nm to 1000 nm here can be determined by analyzing the inorganic molded body described below, which is the raw material, by mercury intrusion porosimetry.

[0030] The method for preparing the inorganic porous substrate of the present invention is described below. The inorganic porous substrate is produced by reacting the starting inorganic molded body with a specific silane coupling agent to introduce silyl groups (A) and (B) having active NH groups. The active NH group herein refers to an NH group having the structure of the following formula (NH-1). [ka] [In formula (NH-1), A1 represents an organic group having 1 to 20 carbon atoms; B1 represents any one selected from the group consisting of a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, and an aryl group having 6 to 12 carbon atoms, An NH group that satisfies the above structural requirements is defined as an active NH group.

[0031] Specific and preferred examples of A1 and B1 in the above formula (NH-1) are the same as A1 and B1 in the above formula (i-1), respectively.

[0032] [Method of manufacturing inorganic molded body] The inorganic molded body, which is the raw material of the inorganic porous substrate of this embodiment, has a pore distribution with a pore size of 20 nm or more, and is an inorganic molded body having a hydroxyl group that can support a silyl group using a silane coupling agent.Typical examples of such inorganic molded bodies include those containing silanol groups, and examples of constituent materials include silica, silica gel, zeolite, glass, and quartz.Preferably, silica, silica gel, zeolite, or glass.These may be commercially available or may be prepared by the following synthesis method.

[0033] Examples of methods for producing inorganic molded bodies containing silanol groups include dry methods and wet methods. Specific examples of the former include the combustion method and the arc method, and specific examples of the latter include synthesis methods such as the precipitation method, the sol-gel method, and the hydrothermal synthesis method (Reference: TOSOH Research & Technology Review Vol. 45 (2001)). Such inorganic porous bodies are prepared by the above-mentioned synthesis methods using, for example, silicates, alkoxysilanes, chlorosilanes, etc. as raw materials, and a solvent and template agent.

[0034] The inorganic molded body can be given a porous structure by, for example, 1. a method of precipitating silica and then removing the solvent contained in the silica skeleton, 2. a method of mixing a different metal other than silica, such as aluminum or boron, precipitating a solid, then phase-separating the silica component and the non-silica component, and then removing the non-silica component, 3. a method of mixing an ammonium salt or a polymer as a template agent to precipitate silica, then removing the template agent, or 4. a method of aggregating the precipitated silica. Two or more of these methods may be used in combination. The method for removing the solvent or template agent may include drying, supercritical extraction, calcination, and the like.

[0035] The inorganic molded body obtained is preferably in the form of particles, and may be molded into a spherical shape, or may be in a lump or crushed shape. When using these as a carrier, the spherical or crushed shape is preferred from the viewpoint of packing into a nucleic acid synthesis column. The molding method is not particularly limited, but spray drying method, emulsion method, etc. can be used. In addition, crushing, sieving, etc. may be performed as appropriate.

[0036] [Method of manufacturing inorganic porous substrate] The inorganic porous substrate is manufactured by reacting the inorganic molded body with a silane coupling agent containing a silyl group (A) structure and a silane coupling agent containing a silyl group (B) structure. As a result, these silane coupling agents react with the hydroxyl groups on the surface of the inorganic molded body to introduce silyl groups (A) and (B). In addition, in this reaction, a solvent may be used as appropriate.

[0037] In the reaction between the inorganic molded body and the silane coupling agent containing a silyl group (A) structure and the silane coupling agent containing a silyl group (B) structure, the inorganic molded body may be reacted with the silane coupling agent containing a silyl group (A) structure and then with the silane coupling agent containing a silyl group (B) structure, the inorganic molded body may be reacted with the silane coupling agent containing a silyl group (B) structure and then with the silane coupling agent containing a silyl group (A) structure, or the inorganic molded body may be reacted with the silane coupling agent containing a silyl group (A) structure and the silane coupling agent containing a silyl group (B) structure simultaneously.

[0038] As a silane coupling agent that contains the structure of the silyl group (A) and imparts the silyl group (A) to an inorganic molded body, a silane coupling agent represented by the following formula (i-1a) or (i-1b) can be used. [ka] [In formula (i-1a), Each Y0 independently represents any one selected from the group consisting of a hydroxyl group, an amino group, an alkoxy group having 1 to 6 carbon atoms, and an alkylamino group having 1 to 12 carbon atoms; h represents an integer represented by 3-b; b represents an integer of 0 to 2, and Z1, A1, and B1 each represent the same groups as Z1, A1, and B1 in the formula (i-1), respectively. [ka] [In formula (i-1b), Each Y0 independently represents any one selected from the group consisting of a hydroxyl group, an amino group, an alkoxy group having 1 to 6 carbon atoms, and an alkylamino group having 1 to 12 carbon atoms; a represents an integer represented by 2-b; b represents an integer of 0 to 2, and Z1, A1, and B1 each represent the same groups as Z1, A1, and B1 in the formula (i-1), respectively.]

[0039] Specific examples and preferred examples of the alkoxy group having 1 to 6 carbon atoms and the alkylamino group having 1 to 12 carbon atoms in Y0 in the above formula (i-1a) and Y0 in the above formula (i-1b) include the same as the specific examples and preferred examples of the alkoxy group having 1 to 6 carbon atoms and the alkylamino group having 1 to 12 carbon atoms in Y1 in the above formula (i-1).

[0040] As a silane coupling agent that contains the structure of the silyl group (B) and imparts the silyl group (B) to an inorganic molded body, silane coupling agents represented by the following formulas (ii-1a), (ii-2a), and (ii-3a) can be used. [ka] , [ka] , [ka] [In formulas (ii-1a), (ii-2a), and (ii-3a), Q0, R0, and S0 each independently represent any one selected from the group consisting of a hydroxyl group, an amino group, a chloro group, a bromo group, an iodo group, an alkoxy group having 1 to 6 carbon atoms, and an alkylamino group having 1 to 12 carbon atoms; and J1, K1, M1, and N1 represent the same groups as J1, K1, M1, and N1 in the formulae (ii-1), (ii-2), and (ii-3).]

[0041] Specific examples and preferred examples of the alkoxy group having 1 to 6 carbon atoms and the alkylamino group having 1 to 12 carbon atoms in Q0, R0 and S0 in the above formulae (ii-1a), (ii-2a) and (ii-3a) can be the same as the specific examples and preferred examples of the alkoxy group having 1 to 6 carbon atoms and the alkylamino group having 1 to 12 carbon atoms in Q1 and R1 in the above formulae (ii-1), (ii-2) and (ii-3).

[0042] In the reaction between the inorganic molded body and the silane coupling agent, the inorganic molded body may be reacted with the silane coupling agent represented by the above formula (i-1a) or (i-1b), and then the silane coupling agent represented by the above formula (ii-1a), formula (ii-2a) or formula (ii-3a) may be reacted; alternatively, the inorganic molded body may be reacted with the silane coupling agent represented by the above formula (ii-1a), formula (ii-2a) or formula (ii-3a), and then the silane coupling agent represented by the above formula (i-1a) or (i-1b) may be reacted; alternatively, the inorganic molded body may be reacted with the silane coupling agent represented by the above formula (i-1a) or (i-1b) and the silane coupling agent represented by the above formula (ii-1a), formula (ii-2a) or formula (ii-3a) simultaneously.

[0043] Specific examples of the silane coupling agent represented by the above formula (i-1a) or (i-1b) include the following. [ka] [ka] [ka] [ka] [ka] [ka]

[0044] Specific examples of the silane coupling agent represented by the above formula (ii-1a) include the following. [ka]

[0045] Specific examples of the silane coupling agent represented by the above formula (ii-2a) include the following. [ka]

[0046] Specific examples of the silane coupling agent represented by the above formula (ii-3a) include the following. [ka]

[0047] [ka]

[0048] [ka]

[0049] [ka]

[0050] [ka]

[0051] The amount of the silane coupling agent represented by the above formula (i-1a) or (i-1b) to be added is such that the amount of active NH groups is 0.05 to 60 μmol / m with respect to the specific surface area per mass of the inorganic molded article determined by nitrogen adsorption / desorption measurement. 2 The amount is preferably 0.05 to 6.0 μmol / m 2 The specific surface area per mass of the inorganic molded body can be determined by measuring the nitrogen adsorption / desorption isotherm of the raw inorganic molded body and calculating the average slope in the range of αs=1.7 to 2.1 by the αs-plot method.

[0052] The amount of the silane coupling agent containing a silyl group (B) structure to be added is not particularly limited. However, in the case of reacting an inorganic molded body with a silane coupling agent containing a silyl group (B) structure and then reacting with a silane coupling agent containing a silyl group (A) structure, and in the case of simultaneously reacting an inorganic molded body with a silane coupling agent containing a silyl group (A) structure and a silane coupling agent containing a silyl group (B) structure, it is desirable to appropriately adjust the amount of the silane coupling agent containing a silyl group (B) structure to be added so that the amount of silyl group (A) introduced is not significantly inhibited.

[0053] The solvent that may be used when reacting the inorganic molded body with the silane coupling agent containing the structure of the silyl group (A) and the silane coupling agent containing the structure of the silyl group (B) is not particularly limited, but pentane, hexane, heptane, toluene, xylene, mesitylene, 1,2,3,4-tetrahydronaphthalene, anisole, chlorobenzene, dichloromethane, tetrahydrofuran, acetonitrile, 2-heptanone, propylene glycol monomethyl ether acetate, N,N-dimethylformamide, water, etc., or a mixture of two or more of these can be used. Among these, pentane, hexane, heptane, toluene, xylene, mesitylene, and 1,2,3,4-tetrahydronaphthalene are preferred, and toluene, xylene, and mesitylene are more preferred.

[0054] In the silane coupling agent represented by the above formula (ii-1a), formula (ii-2a) or formula (ii-3a), when any of Q0, R0 and S0 contains a chloro group, a bromo group and an iodine group, a nitrogen-containing organic base may be used in the reaction between the inorganic molded body and the silane coupling agent represented by the above formula (ii-1a), formula (ii-2a) or formula (ii-3a).Specific examples of the nitrogen-containing organic base include nitrogen-containing aromatic heterocyclic compounds such as 1-methylimidazole, 2,6-lutidine, pyridine and 4-dimethylaminopyridine, and tertiary alkylamines such as N,N-diisopropylethylamine and triethylamine.

[0055] The inorganic molded body and the solvent are preferably dehydrated before use from the viewpoint of suppressing polymerization between the silane coupling agents and promoting the reaction between the silane coupling agent and the surface of the inorganic molded body. The dehydration method is not particularly limited, but includes, for example, a method of heating the inorganic molded body under normal pressure or reduced pressure, and a method of dispersing the inorganic molded body in a solvent and then distilling off the solvent under normal pressure or reduced pressure to perform azeotropic dehydration.

[0056] The reaction between the inorganic molded body and the silane coupling agent may be heated to promote the reaction, but is not limited thereto, and may be performed at room temperature or cooled to room temperature or lower. The same applies when two or more solvents are used in combination. The reaction is usually carried out for about 1 to 12 hours, but the reaction time may be lengthened or shortened as appropriate. After the reaction, the inorganic porous substrate is washed with a solvent such as tetrahydrofuran or ethanol, and then dried to obtain an inorganic porous substrate.

[0057] As a preferred example of the inorganic porous substrate of the present invention, from the viewpoint of use in nucleic acid synthesis, the inorganic porous substrate has a specific surface area of ​​0.1 m 2 / g or more, 200m 2 The specific surface area can be determined by measuring the nitrogen adsorption / desorption isotherm of the inorganic molded body as the raw material, and calculating the average gradient in the range of αs=1.7 to 2.1 by the αs-plot method. The specific surface area is preferably 1 m 2 / g or more, 150m 2 / g or less, more preferably 5m 2 / g or more, 100m 2 / g or less, more preferably 8m 2 / g or more, 80m 2 / g or less, particularly preferably 10m 2 / g or more, 60m 2 / g or less. The specific surface area of ​​the inorganic porous substrate is adjusted depending on the specific surface area of ​​the inorganic molded body that is the raw material of the inorganic porous substrate, and it is desirable to use an inorganic molded body within the above range as the raw material.

[0058] As the inorganic material used for the inorganic porous substrate, various inorganic materials can be used, but it is preferable to use one that contains silicon oxide with silanol groups.Specifically, it is preferable to use one that is made of silica, silica gel, zeolite, or glass, and it is preferable to use an inorganic molded body made of such an inorganic material as a raw material.

[0059] In one preferred embodiment of the present invention, the amount of active NH groups contained in the inorganic porous substrate satisfies the following formula (NH#1).

number

[0060] In the above formula (NH#1), the amount (μmol / g) of the active NH group supported can be determined by the following method. The amount of active NH groups supported in the inorganic porous substrate is measured by the 2-nitrobenzenesulfonic acid adsorption method. The "2-nitrobenzenesulfonic acid adsorption method" refers to a method for quantifying primary to tertiary amino groups based on the amount of 2-nitrobenzenesulfonic acid ionically bonded to the primary to tertiary amino groups.

[0061] The amount of primary to tertiary amino groups can be measured by the 2-nitrobenzenesulfonic acid adsorption method as follows. About 30 mg of inorganic porous substrate is collected in a filter such as a Pasteur pipette plugged with absorbent cotton, and 1 mL of a tetrahydrofuran (THF) solution of N,N-diisopropylethylamine (DIPEA) (DIPEA 5% by volume) is passed through to wash. Next, 1 mL of a THF solution of 2-nitrobenzenesulfonic acid (2-nitrobenzenesulfonic acid 50 mM) is passed through four times, and then 1 mL of THF is passed through to wash four times. Next, a mixed solution of dilute ammonia water (a solution of 28% ammonia water and water mixed at a volume ratio of 1:100) and acetonitrile mixed at a volume ratio of 1:1 is passed through a container such as a 10 mL measuring flask as a receiver. An aqueous solution of acetonitrile (acetonitrile 15% by volume) is added to the effluent received in the receiver to make 10 mL, and the solution is analyzed using high performance liquid chromatography (HPLC) to measure the peak area value of 2-nitrobenzenesulfonic acid. The HPLC analysis conditions are not particularly limited as long as they allow the measurement of 2-nitrobenzenesulfonic acid. For example, the analysis conditions shown below are exemplified. Example of HPLC analysis conditions Column: Scherzo SM-C18 (Imtakt), 4.6 mmφ×150 mm, 3 μm Mobile phase: Solution A 10 mM ammonium formate aqueous solution Solution B: Acetonitrile Gradient conditions: A / B = 85% / 15% (constant) Flow rate: 1.0mL / min Column temperature: 40℃ Detection wavelength: 210nm Injection volume: 10μL When the peak area value of the 2-nitrobenzenesulfonic acid is AR, the mass of the inorganic porous substrate used in the analysis is MA, the slope of the calibration curve prepared using a standard solution of 2-nitrobenzenesulfonic acid is a01, and the intercept of the calibration curve is b01, the amount of primary to tertiary amino groups can be calculated as follows: In the following formula, "203.17" is the molecular weight of 2-nitrobenzenesulfonic acid (C6H5NO5S).

number

number

[0062] The preferred range for I1 / S1 is 0.1 or more and 5.0 or less, more preferably 0.2 or more and 3.0 or less, and further preferably 0.3 or more and 2.0 or less.

[0063] The amount of silyl group (B) introduced into the inorganic porous substrate can be determined by the following method. That is, the inorganic porous substrate is mixed with a deuterated solvent containing an alkaline component such as sodium hydroxide, and then an internal standard such as 1,3,5-trioxane is added thereto and mixed. The resulting mixture is filtered, and the filtrate is 1H NMR is measured. The components derived from the free silyl group (B) contained in the filtrate are quantified from the integral ratio with the internal standard. The obtained quantitative value is divided by the weight of the inorganic porous substrate used to determine the amount of silyl group (B) supported (μmol / g). The following is one specific example. 3.60wt%NaOD aq. / Dimethylsulfoxide-d 6 Mixture solution (3.60 wt% NaOD aq. / dimethyl sulfoxide-d 6 60 to 200 mg of the precursor inorganic porous substrate is weighed out in a glass container and the 3.60 wt% NaOD aq. / dimethyl sulfoxide-d 6 Add 800 to 1200 mg of the mixed solution. The mixture is subjected to ultrasonic treatment at 45°C for 2 hours. To the mixture after ultrasonic treatment, add an aqueous solution of 1,3,5-trioxane (30 mg) as an internal standard and mix. The obtained mixture is introduced into a filter such as a Pasteur pipette plugged with glass wool, and the solid content is filtered off to obtain the filtrate. The obtained filtrate is 1 H NMR is measured, and the components derived from the silyl group (B)-1 introduced by the silane coupling agent, which were liberated by the reaction with NaOD contained in the filtrate, are quantified from the integral ratio with the internal standard. The amount of silyl group (B) supported (μmol / g) can be calculated by dividing the obtained quantitative value by the weight of the inorganic porous substrate used. The amount of the silyl group (B) supported may be calculated as follows, using the value of the specific surface area of ​​the inorganic porous substrate defined below.

number

[0064] As one of the preferred embodiments of the present invention, there is provided an inorganic porous substrate having a silyl group represented by the above formula (ii-3) as the silyl group (B). Among the silyl groups represented by formula (ii-3), the silyl group represented by the following formula (ii-3-1) is preferred. [ka] [In formula (ii-3-1), P1 represents a bond to an inorganic porous substrate; Each K2 independently represents an alkyl group having 1 to 6 carbon atoms or an aryl group having 6 to 10 carbon atoms; M2 represents an alkylene group having 1 to 4 carbon atoms, and N2 represents an alkyl group having 2 to 6 carbon atoms or an aryl group having 6 to 10 carbon atoms.]

[0065] The definition of P1 in the above formula is as described above in the specification.

[0066] In formula (ii-3-1), each K2 independently represents an alkyl group having 1 to 6 carbon atoms or an aryl group having 6 to 10 carbon atoms. Specific and preferred examples of the alkyl group having 1 to 6 carbon atoms in K2 include the same as the alkyl group having 1 to 6 carbon atoms in K1. Specific and preferred examples of the aryl group having 6 to 10 carbon atoms in K2 include the same as the aryl group having 6 to 10 carbon atoms in K1.

[0067] In formula (ii-3-1), M2 represents an alkylene group having 1 to 4 carbon atoms, preferably an alkylene group having 1 to 2 carbon atoms, and specific examples thereof include a methylene group and an ethylene group.

[0068] In formula (ii-3-1), N2 represents an alkyl group having 2 to 6 carbon atoms or an aryl group having 6 to 10 carbon atoms. Specific and preferred examples of the alkyl group having 2 to 6 carbon atoms in N2 include the same as the alkyl group having 2 to 6 carbon atoms in N1. Specific and preferred examples of the aryl group having 6 to 10 carbon atoms for N2 include the same as the aryl group having 6 to 10 carbon atoms for N1.

[0069] A specific example of the silyl group represented by the above formula (ii-3-1) is the following formula (ii-3-1-A).

[0070] [ka] In formula (ii-3-1-A), * represents a bond to an inorganic porous substrate or an inorganic porous carrier.

[0071] A preferred example of the inorganic porous substrate of the present invention is one in which A1 in the above formula (i-1) is an alkylene group having 1 to 20 carbon atoms which may contain at least one of an imino group, an oxy group, and a thio group. Specific examples of A1 include the following formula (A1-ex).

[0072] [ka] [In formula (A1-ex), (N) represents a bond to N in the above general formula (i-1), and (Si) represents a bond to Si in the above general formula (i-1).

[0073] A preferred example of the inorganic porous carrier of the present invention is one in which the silyl group (A) is represented by the following formula (i-1-1). [ka] [In formula (i-1-1), X1 represents a bond to an inorganic porous substrate; Z1 represents an alkyl group having 1 to 6 carbon atoms or an aryl group having 6 to 12 carbon atoms; A2 represents an alkylene group having 1 to 15 carbon atoms which may contain at least one of an imino group, an oxy group, and a thio group, and B2 represents any one selected from the group consisting of a hydrogen atom and an alkyl group having 1 to 2 carbon atoms.]

[0074] The definitions of X1 and Z1 in the above formula are as defined above in the specification.

[0075] In formula (i-1-1), A2 represents an alkylene group having 1 to 15 carbon atoms which may contain any one of an imino group, an oxy group, and a thio group. Specific examples of A2 include (A1-1) to (A1-16) in the above formula (A1-ex).

[0076] In formula (i-1-1), B2 represents either a hydrogen atom or an alkyl group having 1 to 2 carbon atoms. Examples of the alkyl group having 1 to 2 carbon atoms in B2 include a methyl group and an ethyl group. Preferred B2 is a hydrogen atom or a methyl group, and more preferably a hydrogen atom.

[0077] For the group represented by the above formula (i-1-1), examples of preferred combinations of X1, Z1, A2, and B2 are shown in the following formula (i-1-1#). [ka] [In formula (i-1-1#), * represents a bond to the inorganic porous substrate.]

[0078] The present invention also provides an inorganic porous carrier having the following silyl groups (vi) and (vii) and the following characteristic (viii). (vi) Silyl group (C): a silyl group represented by the following formula (vi-1): (vii) Silyl group (D): at least one silyl group selected from the group consisting of silyl groups represented by the following formulas (vii-1), (vii-2), and (vii-3): (viii) The pore size is 20 nm or more. [ka] [In formula (vi-1), X01 represents a bond to an inorganic porous carrier; Y01 each independently represents any one selected from the group consisting of a bond to an inorganic porous carrier, a hydroxyl group, an amino group, an alkoxy group having 1 to 6 carbon atoms, and an alkylamino group having 1 to 12 carbon atoms; Z1 each independently represents an alkyl group having 1 to 6 carbon atoms or an aryl group having 6 to 12 carbon atoms; a represents an integer represented by 2-b; b represents an integer of 0 to 2; A01 represents an organic group having 1 to 20 carbon atoms; B1 represents any one selected from the group consisting of a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, and an aryl group having 6 to 12 carbon atoms, C1 represents a group having a nucleoside or nucleotide structure in which a reactive group is protected or deprotected. [ka] , [ka] , [ka] , [In formula (vii-1), (vii-2), or (vii-3), P01 represents a bond with an inorganic porous carrier; Q01 and R01 each independently represent any one selected from the group consisting of a bond to an inorganic porous carrier, a hydroxyl group, an amino group, an alkoxy group having 1 to 6 carbon atoms, and an alkylamino group having 1 to 12 carbon atoms; J1 represents an alkyl group having 2 to 20 carbon atoms or an aryl group having 7 to 20 carbon atoms; Each K1 independently represents an alkyl group having 1 to 20 carbon atoms or an aryl group having 6 to 20 carbon atoms; M1 represents an alkylene group having 1 to 6 carbon atoms, and N1 represents an alkyl group having 2 to 20 carbon atoms or an aryl group having 6 to 20 carbon atoms.]

[0079] In the above formula (vi-1), the bond to the inorganic porous carrier in X01 is specifically a bond via an --O-- bond on the surface of the inorganic porous carrier.

[0080] In the above formula (vi-1), each Y01 independently represents any one selected from the group consisting of a bond to an inorganic porous support, a hydroxyl group, an amino group, an alkoxy group having 1 to 6 carbon atoms, and an alkylamino group having 1 to 12 carbon atoms. The bond to the inorganic porous carrier in Y01 is the same as that in X01. Specific and preferred examples of the alkoxy group having 1 to 6 carbon atoms and the alkylamino group having 1 to 12 carbon atoms for Y01 are the same as the alkoxy group having 1 to 6 carbon atoms and the alkylamino group having 1 to 12 carbon atoms for Y1.

[0081] Specific and preferred examples of Z1, a, b, and B1 in the above formula (vi-1) are the same as Z1, a, and b in the above formula (i-1).

[0082] A01 represents an organic group having 1 to 20 carbon atoms. Specific examples thereof include an alkylene group having 1 to 20 carbon atoms, an arylene group having 1 to 20 carbon atoms, an alkylene group having 1 to 20 carbon atoms which may contain one or more of an acylimino group, an oxy group, or a thio group, and an arylene group having 1 to 20 carbon atoms which may contain one or more of an acylimino group, an oxy group, or a thio group. The acylimino group in A01 is an imino group in A1 in the above formula (i-1) contained in the inorganic porous substrate, which is a precursor of the inorganic porous carrier, which is induced into an acylimino group by the following capping treatment. Specific examples of the acylimino group in A01 include -N(COCH3)- and -N(COCH2OPh)-, and -N(COCH3)- is preferred.

[0083] In the above formulae (vii-1), (vii-2), and (vii-3), the bond to the inorganic porous carrier in P01 is the same as that in X01.

[0084] Q01 and R01 each independently represent any one selected from the group consisting of a bond to an inorganic porous support, a hydroxyl group, an amino group, an alkoxy group having 1 to 6 carbon atoms, and an alkylamino group having 1 to 12 carbon atoms. The bonds to the inorganic porous carrier in Q01 and R01 are the same as those in X01. Specific and preferred examples of the alkoxy group having 1 to 6 carbon atoms and the alkylamino group having 1 to 12 carbon atoms in Q01 and R01 are the same as the alkoxy group having 1 to 6 carbon atoms and the alkylamino group having 1 to 12 carbon atoms in Q1 and R1 above.

[0085] In the above formulae (vii-1), (vii-2), and (vii-3), J1, K1, M1, and N1 have the same meanings as J1, K1, M1, and N1 in the above formulae (ii-1), (ii-2), and (ii-3), respectively.

[0086] In view of application to nucleic acid synthesis, the inorganic porous carrier in the present invention has a pore size of 20 nm or more.The inorganic porous carrier to be used can be appropriately selected according to the chain length of the nucleic acid to be synthesized.Normally, when the chain length of the nucleic acid to be synthesized is long, it is preferable to select one with a large pore size.Preferred pore size is 40 nm or more and 500 nm or less, more preferably 45 nm or more and 300 nm or less, even more preferably 50 nm or more and 250 nm or less, and particularly preferably 60 nm or more and 200 nm or less. The pore diameter here can be determined by analyzing an inorganic molded body, which is the raw material of the inorganic porous support, by mercury intrusion porosimetry, and plotting the resulting pore size distribution graph (the X-axis is the pore size value, and the Y-axis is the value obtained by differentiating the pore volume with the pore size) as the pore diameter (mode diameter) obtained from the X-axis value at the maximum value of the Y-axis.

[0087] [Method of manufacturing inorganic porous carrier] The method for producing the inorganic porous carrier of the present invention will now be described. The inorganic porous carrier of the present invention is produced by introducing a group having a nucleoside or nucleotide structure (C1 in the above formula (vi-1) or C2 in the following formula (vi-1-1)) in which a reactive group has been protected or deprotected, into the active NH group in the inorganic porous base material. From the viewpoint of carrier synthesis and nucleic acid synthesis, a good example of the inorganic porous carrier of the present invention is one in which C1 in the above general formula (vi-1) or C2 in the following formula (vi-1-1) contains a succinyl linker or universal linker. More preferably, it is preferable to introduce a group having a nucleoside structure linked by a succinyl linker, as described below. A specific example of the production method is a production method in which a compound having a nucleoside structure with a protected reactive group and a succinyl linker is reacted with the active NH group in the inorganic porous substrate. A preferred example of the compound having a nucleoside structure with a protected reactive group and a succinyl linker is one having a carboxylic acid terminal (hereinafter, sometimes referred to as nsuc compound). A specific example is one represented by the following formula (nsuc-1). A preferred reaction is a condensation reaction between the active NH group in the inorganic porous substrate and the nsuc compound.

[0088] [ka] [In formula (nsuc-1), * represents a hydroxyl group, a salt of a hydroxyl group and pyridine, or a salt of a hydroxyl group and triethylamine, and TBDMS represents a tert-butyldimethylsilyl group.]

[0089] The condensation reaction here is carried out by mixing the inorganic porous substrate, the nsuc compound, the condensation agent, and a suitable solvent, and usually shaking the mixture at room temperature or by raising the temperature to promote the condensation reaction. This condensation reaction may be carried out by leaving the mixture stationary without shaking, or by stirring the mixture. The condensation reaction is carried out for about 4 to 30 hours, but the reaction time may be lengthened or shortened as appropriate.

[0090] The condensing agent used in the condensation reaction may be any agent generally used in amide condensation.Specific examples of the condensing agent include N,N'-dicyclohexylcarbodiimide (DCC), N,N'-diisopropylcarbodiimide (DIC), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDAC), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC), 1-[bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxide hexafluorophosphate (HATU), 1-[bis(dimethylamino)methylene]-1H-1,2,3-benzotriazolium 3-oxide hexafluorophosphate (HBTU), 1 Examples include -[bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxide tetrafluoroborate (TATU), 1-[bis(dimethylamino)methylene]-1H-1,2,3-benzotriazolium 3-oxide tetrafluoroborate (TBTU), (1-cyano-2-ethoxy-2-oxoethylideneaminooxy)dimethylaminomorpholinocarbenium hexafluorophosphate (COMU), and O-[(ethoxycarbonyl)cyanomethyleneamino]-N,N,N',N'-tetramethyluronium hexafluorophosphate (TOTU). In the condensation reaction, additives such as N,N-dimethyl-4-aminopyridine (DMAP), N,N-diisopropylethylamine, and 1-methylimidazole may be added as appropriate.

[0091] After the condensation reaction, the solid content is filtered and washed. Examples of the washing solvent include acetonitrile. The unreacted active NH group and the amino group having other NH sites contained in the silyl group on the inorganic porous carrier are subjected to a capping treatment. The reagent used in the capping treatment can be a mixture of an acid anhydride and a nitrogen-containing organic base. Specific examples of the acid anhydride include acetic anhydride and phenoxyacetic anhydride, and preferably acetic anhydride. Specific examples of the nitrogen-containing organic base include nitrogen-containing aromatic heterocyclic compounds such as 1-methylimidazole, 2,6-lutidine, pyridine, and 4-dimethylaminopyridine, and tertiary alkylamines such as triethylamine. The amount of the reagent used in the capping treatment is 10 times the molar equivalent of the amount of NH groups contained in the inorganic porous substrate for the acid anhydride, and 10 times the molar equivalent of the amount of the acid anhydride used for the nitrogen-containing organic base. When the amount is such, the NH groups contained in the inorganic porous substrate are sufficiently capped. The reagent used in the capping treatment may be used in combination with an organic solvent, specifically, tetrahydrofuran, dichloromethane, acetonitrile, etc. The amount of the organic solvent used is preferably a volume that can fully immerse the solid content. After the capping treatment, the inorganic porous carrier is washed with acetonitrile or the like and dried to obtain the inorganic porous carrier.

[0092] The particle size of the inorganic porous carrier of the present invention is characterized by being 1 μm or more from the viewpoint of preventing blockage of the piping of a nucleic acid synthesizer in the production of nucleic acid described below. It is preferably 5 μm or more, more preferably 10 μm or more, even more preferably 20 μm or more, and particularly preferably 30 μm or more. The particle size can be controlled by sieving the inorganic molded body, inorganic porous base material, or inorganic porous carrier, which is the raw material, through a sieve with an opening of the corresponding particle size or more to remove fine particles. The particle size of the inorganic porous carrier of the present invention can be determined by observing the inorganic molded material as the raw material under a scanning electron microscope at a magnification of 200 times and taking the average of the major axes of 50 particles selected from the observation.

[0093] In the inorganic porous carrier of the present invention, from the viewpoint of application to nucleic acid synthesis, the cumulative pore volume in the range of pore diameters from 40 nm to 1000 nm is greater than 0.32 mL / g and less than 4 mL / g. The cumulative pore volume in the same range is preferably greater than 0.35 mL / g and less than 3.5 mL / g, more preferably greater than 0.4 mL / g and less than 3 mL / g, even more preferably greater than 0.43 mL / g and less than 3 mL / g, and even more preferably greater than 0.45 mL / g and less than 2.5 mL / g. The cumulative pore volume in the range of pore diameters from 40 nm to 1000 nm here can be determined by analyzing the inorganic molded body, which is the raw material, by mercury intrusion porosimetry.

[0094] As a preferred example of the inorganic porous carrier of the present invention, from the viewpoint of use in nucleic acid synthesis, the inorganic porous carrier has a specific surface area of ​​0.1 m 2 / g or more, 200m 2 The specific surface area can be determined by measuring the nitrogen adsorption / desorption isotherm of the inorganic molded body as the raw material, and calculating the average gradient in the range of αs=1.7 to 2.1 by the αs-plot method. The specific surface area is preferably 1 m 2 / g or more, 150m 2 / g or less, more preferably 5m 2 / g or more, 100m 2 / g or less, more preferably 8m 2 / g or more, 80m 2 / g or less, particularly preferably 10m 2 / g or more, 60m 2 / g or less. The specific surface area of ​​the inorganic porous carrier is adjusted depending on the specific surface area of ​​the inorganic molded material used as the raw material, and it is desirable to use an inorganic molded material within the above range as the raw material.

[0095] As the inorganic material used for the inorganic porous carrier, various inorganic materials can be used, but it is preferable to use one containing silicon oxide with silanol groups. Specifically, it is preferable to use one made of silica, silica gel, zeolite, or glass, and it is preferable to use an inorganic molded body made of such an inorganic material as a raw material.

[0096] The inorganic porous material of the present invention is characterized in that the amount of groups having a nucleoside or nucleotide structure in which a reactive group has been protected or deprotected satisfies the following formula (Nu#1).

number

[0097] The amount of a group having a nucleoside or nucleotide structure in which a reactive group is protected or deprotected in an inorganic porous carrier (hereinafter, sometimes referred to as the amount of nucleoside supported) can be determined by the following measurement method when a protecting group such as a 4,4'-dimethoxytrityl group is introduced. That is, first, 70% perchloric acid is diluted with methanol to prepare a 30% perchloric acid solution. Next, 20 to 50 mg of the inorganic porous carrier is taken in a measuring flask and diluted to 10 mL with a 30% perchloric acid solution. After further diluting this solution 10 times with a 30% perchloric acid solution, the absorbance at 498 nm of the eliminated 4,4'-dimethoxytrityl cation is measured, and the amount of nucleoside supported is calculated.

[0098] The preferred range for I01 / S01 is 0.1 or more and 2.0 or less, more preferably 0.3 or more and 1.8 or less, and further preferably 0.4 or more and 1.6 or less.

[0099] A preferred example of the inorganic porous carrier of the present invention, from the viewpoint of carrier synthesis and nucleic acid synthesis, is an inorganic porous carrier in which C1 in the general formula (i-1) above contains a succinyl linker or a universal linker. A universal linker has a functional group (typically a hydroxyl group) that forms a phosphite with the hydroxyl group of a nucleotide that serves as the starting point of nucleic acid synthesis, and a functional group that has the ability to bond with the above-mentioned active NH group, and also has, within the same molecule, an adjacent protected functional group (e.g., a protected amino group, hydroxyl group, or thiol group) that has the ability to nucleophilically attack the phosphorus atom of the phosphate under the conditions for cleaving the synthesized nucleic acid. More specifically, the succinyl linker includes a linking group represented by the following formula L10#, and the universal linker includes a linking group represented by the following formula L11#.

[0100] [ka] , [ka]

[0101] In formula L10# and formula L11#, the bond marked with ● represents a bond to N in the above formula (i-1). The bond marked with ▲ represents a bond to the oxygen atom of a primary or secondary hydroxyl group in a nucleoside or nucleotide structural portion in which the reactive group in C1 is protected or deprotected. In formula L11#, ZH represents a protected amino group, a hydroxyl group, or a thiol group. ZC represents any group containing a carbon atom, and the oxygen atom and ZH bonded to ZC represent groups adjacent to each other (for example, they are present vicinal, and the carbon atoms in ZC to which they are bonded are directly bonded to each other). L12 represents a group connecting N in the above formula (i-1) and ZC in the above formula (L11#) (specifically, for example, a group represented by L10# can be mentioned).

[0102] In addition, when a universal linker is used, regardless of the type of nucleoside or nucleotide at the 3'-end of the nucleic acid to be synthesized, the nucleoside phosphoramidite that will become the 3'-end can be introduced by reacting in the same manner as in the process of extending a nucleic acid in a normal automated nucleic acid synthesis. Examples of such universal linkers include, but are not limited to, compounds described in the following documents: Literature: AP Guzaev, and M. Manoharan, J Am Chem Soc, 2003, 125, 2380-2381. Literature: RK Kumar, AP Guzaev, C. Rentel, and VT Ravikumar, Tetrahedron, 2006, 62, 4528.

[0103] Among those in which C1 in the above general formula (i-1) contains a succinyl linker or a universal linker, those containing a succinyl linker are more preferred.

[0104] The nucleoside or nucleotide structural portion in which the reactive group in C1 is protected or deprotected is preferably one in which the 5'-hydroxyl group of the nucleoside, which serves as the starting point of the nucleic acid elongation reaction, is protected with a trityl-based protecting group (e.g., a 4,4'-dimethoxytrityl (DMTr) group, etc.). Similarly, when a universal linker is used, it is preferable that the hydroxyl group serving as the starting point of the nucleic acid elongation reaction is protected with a trityl-based protecting group (eg, 4,4'-dimethoxytrityl (DMTr) group, etc.).

[0105] A specific example of C1 containing a succinyl linker is represented by the following formula (nsuc-2).

[0106] [ka] [In formula (nsuc-2), * represents a bond to N in the above general formula (vi-1)]

[0107] A preferred example of the inorganic porous carrier of the present invention is an inorganic porous carrier having a silyl group represented by the above formula (vii-3) as the silyl group (D), and among these, an inorganic porous carrier having a silyl group represented by the following formula (vii-3-1) as the silyl group (D) is preferred. [ka] [In formula (ii-3-1), P01 represents a bond with an inorganic porous carrier; Each K2 independently represents an alkyl group having 1 to 6 carbon atoms or an aryl group having 6 to 10 carbon atoms; M2 represents an alkylene group having 1 to 4 carbon atoms, and N2 represents an alkyl group having 2 to 6 carbon atoms or an aryl group having 6 to 10 carbon atoms.]

[0108] In formula (vii-3-1), P01, K2, M2, and N2 are the same as P1, K2, M2, and N2 in formula (ii-3-1), respectively. A specific example of the silyl group represented by formula (vii-3-1) above is formula (ii-3-1-A) above.

[0109] A preferred example of the inorganic porous carrier of the present invention is one in which A01 in the above formula (vi-1) is an alkylene group having 1 to 20 carbon atoms which may contain one or more of an acylimino group, an oxy group, or a thio group. Specific examples of A01 include the following formula (A01-ex).

[0110] [ka] [In formula (A01-ex), (N) represents a bond to N in the above general formula (vi-1), (Si) represents a bond to Si in the above general formula (vi-1), and CAP is a capping group introduced by the above-mentioned capping treatment, and a specific example is an acetyl group.]

[0111] A preferred example of the inorganic porous carrier of the present invention is one in which the silyl group (C) is a silyl group represented by the following formula (vi-1-1). [ka] [In formula (vi-1-1), X01 represents a bond to an inorganic porous carrier; Z1 each independently represents an alkyl group having 1 to 6 carbon atoms or an aryl group having 6 to 12 carbon atoms; A02 represents an alkylene group having 1 to 15 carbon atoms which may contain at least one of an acylimino group, an oxy group, and a thio group; B2 represents a hydrogen atom or an alkyl group having 1 to 2 carbon atoms, and C2 represents a group having a nucleoside or nucleotide structure containing a succinyl linker and a reactive group that is protected or deprotected.

[0112] In the above formula (vi-1-1), X01 has the same meaning as X01 in the above formula (vi-1).

[0113] In formula (vi-1-1), A02 represents an alkylene group having 1 to 15 carbon atoms which may contain any one of an acylimino group, an oxy group, and a thio group. The acylimino group in A02 is the imino group in A2 in the above formula (i-1-1) contained in the inorganic porous base material, which is the precursor of the inorganic porous carrier, which is derived into the acylimino group by the above capping treatment. Specific examples of the acylimino group in A02 include -N(COCH3)- and -N(COCH2OPh)-, and preferably -N(COCH3)-. Specific examples of A02 include (A01-1) to (A01-16) in the above formula (A01-ex).

[0114] In formula (vi-1-1), B2 represents either a hydrogen atom or an alkyl group having 1 to 2 carbon atoms. Examples of the alkyl group having 1 to 2 carbon atoms in B2 include a methyl group and an ethyl group. Preferred B2 is a hydrogen atom or a methyl group, and more preferably a hydrogen atom.

[0115] In formula (vi-1-1), C2 represents a group having a nucleoside or nucleotide structure containing a succinyl linker and a reactive group that is protected or deprotected. Specific examples thereof include those represented by the above formula (nsuc-2).

[0116] In the group represented by the above formula (vi-1-1), examples of preferred combinations of X01, Z1, A02, and B2 are shown in the following formula (vi-1-1#). [ka] [In formula (vi-1-1#), (C2) represents a bond to C2 in (vi-1-1); * denotes a bond to an inorganic porous support, and CAP is a capping group introduced by the above-mentioned capping treatment, and a specific example is an acetyl group.]

[0117] The solid phase carrier of this embodiment is suitable as a base material for solid-phase synthesis of nucleic acids (DNA, RNA). In particular, the solid phase carrier of this embodiment is particularly suitable for synthesis of RNA, which is considered to be less stable than DNA.

[0118] Hereinafter, a method for producing a nucleic acid will be described with reference to the reaction pathways (condensation reaction, oxidation, deprotection) shown below, taking solid-phase synthesis of RNA as an example. Note that the reaction pathways shown below are examples in which a group having a nucleoside structure is used at C1 in the above formula (vi-1).

[0119] Example reaction pathways [ka]

[0120] In the above chemical formula showing the reaction pathway, R 4 is a base; Tr is a protecting group; X is -H, -OH or -OR 5 (R 5 represents a protecting group), and SP represents the portion of the inorganic porous carrier other than the nucleoside structure.

[0121] The inorganic porous support (Sp-Nu) having a nucleoside structure and the base (R 4 ) is usually a natural base constituting a nucleic acid, typically RNA, but unnatural bases may also be used as appropriate. Examples of such unnatural bases include modified analogs of natural or unnatural bases.

[0122] R 4 Examples of the base represented by the formula (I) include purine bases such as adenine, isoguanine, xanthine, hypoxanthine, and guanine; and pyrimidine bases such as cytosine, uracil, and thymine.

[0123] Also, R 4Examples of the base represented by the formula (I) include alkyl derivatives such as 2-aminoadenine and 6-methylated purine; alkyl derivatives such as 2-propylated purine; 5-halouracil and 5-halocytosine; 5-propynyluracil and 5-propynylcytosine; 6-azouracil, 6-azocytosine and 6-azothymine; 5-uracil (pseudouracil), 4-thiouracil, 5-halouracil, 5-(2-aminopropyl)uracil, 5-aminoarisyl ... uracil;8-halo, aminated, thiolated, thioalkylated, hydroxylated and other 8-substituted purines;5-trifluoromethylated and other 5-substituted pyrimidines;7-methylguanine;5-substituted pyrimidines;6-azapyrimidines;N-2, N-6 and O-6 substituted purines (including 2-aminopropyladenine);5-propynyluracil and 5-propynylcytosine;dihydrouracil;3-deaza-5-azacytosine;2-amino Purine;5-Alkyluracil;7-Alkylguanine;5-Alkylcytosine;7-Deazaadenine;N6,N6-Dimethyladenine;2,6-Diaminopurine;5-Amino-allyl-uracil;N3-Methyluracil;Substituted 1,2,4-triazoles;2-Pyridinone;5-Nitroindole;3-Nitropyrrole;5-Methoxyuracil;Uracil-5-oxyacetic acid;5-Methoxycarbonylmethyluracil;5-Methyl-2-thio Examples of such bases include auracil; 5-methoxycarbonylmethyl-2-thiouracil; 5-methylaminomethyl-2-thiouracil; 3-(3-amino-3-carboxypropyl)uracil; 3-methylcytosine; 5-methylcytosine; N4-acetylcytosine; 2-thiocytosine; N6-methyladenine; N6-isopentyladenine; 2-methylthio-N6-isopentenyladenine; N-methylguanine; and O-alkylated bases.

[0124] Further, examples of the purine compounds and pyrimidine compounds include those disclosed in U.S. Pat. No. 3,687,808, Concise Encyclopedia Of Polymer Science And Engineering, pp. 858-859, edited by Kroschwitz JI, John Wiley & Sons, 1990, and Englisch et al., Angewandte Chemie, International Edition, 1991, Vol. 30, p. 613.

[0125] A suitable amidite monomer (Am-1) is a compound represented by the following chemical formula (Am-1′): 5 protected by tert-butyldimethylsilyl (TBDMS) group, bis(2-acetoxy)methyl (ACE) group, (triisopropylsilyloxy)methyl (TOM) group, (2-cyanoethoxy)ethyl (CEE) group, (2-cyanoethoxy)methyl (CEM) group, p-tolylsulfonylethoxymethyl (TEM) group, (2-cyanoethoxy)methoxymethyl (EMM) group, etc., are TBDMS amidites (TBDMS RNA Amidites, trade name, ChemGenes Corporation), ACE amidites, TOM amidites, CEE amidites, CEM amidites, and TEM amidites (see Chakhmakhcheva's review: Protective Groups in the Chemical Synthesis of Oligoribonucleotides, Russian Journal of Bioorganic Chemistry, 2013, Vol. 39, No. 1, pp. 1-21.), EMM amidite (described in WO 2013 / 027843), and the like.

[0126] [ka] [In the formula, R 5 R represents a protecting group for a hydroxyl group. 4 indicates a protected nucleobase.

[0127] The inorganic porous carrier of this embodiment can also be used to incorporate a divalent group other than a nucleoside or a nucleotide into a nucleic acid sequence. For example, an amidite having a proline backbone (such as amidite P described below) can be incorporated into a nucleic acid sequence by the amidite method (see a method similar to the method in Example A4 of WO 2012 / 017919). In addition, amidites represented by the following structural formulas (Am-11), (Am-12) and (Am-13) (see Examples A1 to A3 of WO 2013 / 103146) can also be used.

[0128] [ka]

[0129] [In the formula, iPr represents an isopropyl group, DMTr represents a 4,4'-dimethoxytrityl group, and Tfa represents a trifluoroacetyl group.]

[0130] [Solid-phase synthesis of RNA] The Tr group of the inorganic porous carrier (Sp-Nu) is deprotected to obtain a solid phase carrier (Am-2). Then, the amidite monomer (Am-1) and the solid phase carrier (Am-2) are subjected to a condensation reaction to obtain a reaction product (Am-3). Then, the reaction product (Am-3) is oxidized to obtain a product (Am-4). Then, the product (Am-4) is deprotected (-Tr) to obtain a product (Am-5). Next, the amidite monomer (Am-1) and the product (Am-5) are further subjected to a condensation reaction to extend the phosphodiester bond. In this way, a series of cycles of deprotection, condensation reaction, and oxidation are repeated as many times as necessary to obtain the hydroxyl group at the 5' position of the extended oligonucleotide chain end to obtain the desired sequence, and then, by cutting it out from the solid phase carrier, a nucleic acid molecule of the desired sequence can be produced.

[0131] More specifically, the nucleic acid is produced by a production method including the following steps. Step (A): using an inorganic porous support in which R in the general formula (2) represents a nucleoside or nucleotide in which a hydroxyl group as a reactive group is protected, a step of deprotecting the protecting group of the hydroxyl group at the 5'-position of the nucleoside; Step (B): A condensation step of condensing the hydroxyl group at the 5' position of the nucleoside produced in step (A) with an amidite compound having a second nucleoside base to produce a phosphite; Step (C): an oxidation step of oxidizing the phosphite produced in step (B) to produce a nucleotide; and Step (D): A step of deprotecting the protecting group of the hydroxyl group at the 5'-position of the nucleotide produced in the step (C).

[0132] The production method including the above steps (A) to (D) optionally includes the following steps: Step (B'): A step of further condensing the product produced in the step (D) with an amidite compound having a nucleoside base to be introduced next to produce a phosphite; Step (C'): A step of oxidizing the phosphite generated in step (B') to generate an oligonucleotide; Step (D'): A step of deprotecting the protecting group of the hydroxyl group at the 5'-position of the oligonucleotide chain end generated in the step (C'); and Step (E): A step of repeating the series of steps (B'), (C') and (D') m times (m is an integer of 1 or more) to react m amidite compounds (nucleic acid extension reaction), and then excising the extended nucleic acid.

[0133] The nucleic acid extension reaction in this embodiment can be carried out according to the general procedure of the phosphoramidite method. In this specification, the term "nucleic acid extension reaction" refers to a reaction in which nucleotides are sequentially linked via phosphodiester bonds to extend a nucleic acid chain, particularly an RNA chain. The nucleic acid extension reaction may be carried out using an automatic nucleic acid synthesizer that employs the phosphoramidite method.

[0134] In the deprotection step, the protecting group of the hydroxyl group at the 5' position of the RNA strand end supported on the solid support is deprotected. A trityl-based protecting group (typically, a DMTr group) is generally used as a protecting group. The deprotection can be carried out using an acid. Examples of the acid for deprotection include trifluoroacetic acid, trichloroacetic acid, dichloroacetic acid, trifluoromethanesulfonic acid, methanesulfonic acid, hydrochloric acid, acetic acid, and p-toluenesulfonic acid.

[0135] In the condensation step, a nucleoside phosphoramidite is bound to the 5' hydroxyl group of the RNA chain end deprotected in the deprotection step to generate a phosphite. The nucleoside phosphoramidite used has the 5' hydroxyl group protected with a protecting group (e.g., DMTr group).

[0136] The condensation step can be carried out using an activator that activates the nucleoside phosphoramidite. Examples of the activator include 5-benzylthio-1H-tetrazole (BTT), 1H-tetrazole, 4,5-dicyanoimidazole (DCI), 5-ethylthio-1H-tetrazole (ETT), N-methylbenzimidazolium triflate (N-MeBIT), benzimidazolium triflate (BIT), N-phenylimidazolium triflate (N-PhIMT), imidazolium triflate (IMT), 5-nitrobenzimidazolium triflate (NBT), 1-hydroxybenzotriazole (HOBT), and 5-(bis-3,5-trifluoromethylphenyl)-1H-tetrazole (Activator-42).

[0137] After the condensation step, the unreacted hydroxyl group at the 5'-position may be appropriately capped using a known capping solution such as an acetic anhydride-tetrahydrofuran solution or a phenoxyacetic acid / N-methylimidazole solution.

[0138] The oxidation step is a step of oxidizing the phosphite formed in the condensation step. The oxidation step can be carried out using an oxidizing agent. Examples of the oxidizing agent include iodine, m-chloroperbenzoic acid, tert-butyl hydroperoxide, 2-butanone peroxide, bis(trimethylsilyl) peroxide, 1,1-dihydroperoxycyclododecane, and hydrogen peroxide. The oxidation step may be carried out after the capping step, or conversely, the capping step may be carried out after the oxidation step, and this order is not limited.

[0139] After the oxidation step, the process returns to the deprotection step, and the above-mentioned series of steps of condensation reaction, oxidation, and deprotection are repeated depending on the nucleotide sequence of the RNA to be synthesized, thereby synthesizing RNA having the desired sequence.

[0140] After the synthesis of an RNA strand having a desired sequence is completed, the RNA strand is cleaved from the solid support using ammonia or amines and then recovered. Examples of amines include methylamine, ethylamine, isopropylamine, ethylenediamine, diethylamine, and triethylamine. When a universal linker is used, after the synthesis of the RNA chain is completed, it is cleaved from the solid support using ammonia or amines, and the universal linker is removed using a nucleophilic reagent. When the removal is completed, the 3' position of the terminal nucleotide becomes a hydroxyl group, and the phosphate binds to the universal linker to form a cyclic phosphodiester. The recovered RNA may be purified by a known method as appropriate.

[0141] In addition, by applying the inorganic porous carrier of this embodiment to nucleic acid synthesis, highly pure oligonucleic acids can be obtained in good yield.

[0142] In this specification, "RNA yield" refers to the ratio (%) of RNA actually isolated to the amount of RNA theoretically calculated from the amount of nucleosides used in the reaction. The amount of nucleic acid is calculated from UV absorbance measurement. Specifically, the nucleic acid is dissolved in water or a buffer solution and placed in a cell with a light path length of 1 cm. Using a UV spectrophotometer, the optical density C is calculated from the absorbance at a wavelength of 260 nm using the following formula to calculate the amount of nucleic acid. The coefficient α is 40 μg / mL.

number

[0143] "RNA purity" refers to the percentage (%) of nucleic acid of the desired chain length obtained. It is calculated by the area percentage value (i.e., area percentage value) in a chromatogram obtained by liquid chromatography, or the 10% width of the main peak. EXAMPLES

[0144] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these examples.

[0145] Representative reaction schemes for producing the inorganic porous carrier of the present invention are described below, but the production method of the present invention is not limited thereto. [ka]

[0146] <Production of Inorganic Molded Body> (Production Example 1) A zeolite molded body (1) was obtained in the same manner as in Example 1 described in Japanese Patent No. 5875843. The zeolite molded body (1) was sieved through a sieve with a mesh size of 38 μm to remove fine particles. The sieved product (50 g) was placed in an autoclave, to which 1.6 mol / L potassium hydroxide aqueous solution (500 g) was added, and the mixture was stirred at about 20° C. for 5 hours, after which the solid was separated by filtration. After this, the mixture was washed three times with water (500 g). Next, the mixture was washed three times with a 20 wt % ammonium chloride aqueous solution (500 g), and then further washed three times with water (500 g). Finally, the mixture was dried to obtain an inorganic molded body SP (1).

[0147] <Production of inorganic porous substrate> (Production Example 2) 3-Aminopropyldiisopropylethoxysilane (87 mg) and toluene (12.43 g) were mixed in a glass vial to prepare a 3-aminopropyldiisopropylethoxysilane / toluene solution. Inorganic molded body SP (1) (7.13 g) was placed in a round-bottom flask, toluene (61 g) was added, and then the prepared 3-aminopropyldiisopropylethoxysilane / toluene solution (3.11 g) was added under stirring at room temperature. The round-bottom flask was heated in an oil bath and refluxed for 11.5 hours. After that, it was cooled to room temperature and left to stand for 10 hours, and then refluxed for another 5 hours. The reaction mixture was filtered, the solids were washed with toluene, and then dried under reduced pressure to obtain an inorganic porous substrate precursor 1.

[0148] Example 1 Inorganic porous substrate precursor 1 (0.40 g) was placed in a round-bottom flask and toluene (61 g) was added. A mixture of N,N-diisopropylethylamine (210 mg) and toluene (4.0 g) was further added under stirring at room temperature, followed by a mixture of tributylchlorosilane (379 mg) and toluene (4.0 g), and the flask was heated in an oil bath and refluxed for 5 hours. The reaction solution was then filtered, and the solids were washed with a 5 vol% N,N-diisopropylethylamine / ethanol solution (13 mL), followed by washing with tetrahydrofuran (14 mL). The washed material was dried under reduced pressure to obtain inorganic porous substrate 1.

[0149] Example 2 An inorganic porous substrate 2 was obtained by synthesis in accordance with Example 1, except that chloro(hexyl)dimethylsilane (287 mg) was used instead of tributylchlorosilane (379 mg) used in Example 1.

[0150] Example 3 An inorganic porous substrate 3 was obtained by synthesis in accordance with Example 1, except that benzylchlorodimethylsilane (293 mg) was used instead of tributylchlorosilane (379 mg) used in Example 1.

[0151] Example 4 An inorganic porous substrate 4 was obtained by synthesis in accordance with Example 1, except that (3-cyanopropyl)dimethylchlorosilane (261 mg) was used instead of tributylchlorosilane (379 mg) used in Example 1.

[0152] Example 5 An inorganic porous substrate 5 was obtained by synthesis in accordance with Example 1, except that 2-acetoxyethyldimethylchlorosilane (290 mg) was used instead of tributylchlorosilane (379 mg) used in Example 1.

[0153] (Reference example 1) Inorganic porous substrate precursor 1 (0.40 g) was placed in a round-bottom flask, and toluene (61 g) was added. A mixture of hexamethyldisilazane (262 mg) and toluene (4.0 g) was added under stirring at room temperature, and the flask was heated in an oil bath and refluxed for 5 hours. The reaction solution was then filtered, and the solid matter was washed with a 5 vol% N,N-diisopropylethylamine / ethanol solution (13 mL), and then washed with tetrahydrofuran (14 mL). The washed matter was dried under reduced pressure to obtain inorganic porous substrate 6.

[0154] (Reference example 2) An inorganic porous substrate 7 was obtained by synthesis according to Reference Example 1, except that trimethoxy(methyl)silane (52 mg) was used instead of hexamethyldisilazane (262 mg) used in Reference Example 1.

[0155] (Reference example 3) An inorganic porous substrate 8 was obtained by synthesis according to Reference Example 1, except that triethoxyphenylsilane (57 mg) was used instead of hexamethyldisilazane (262 mg) used in Reference Example 1.

[0156] (Reference example 4) An inorganic porous substrate 9 was obtained by synthesis according to Reference Example 1, except that 2-(4-pyridylethyl)triethoxysilane (61 mg) was used instead of hexamethyldisilazane (262 mg) used in Reference Example 1.

[0157] <Production of Inorganic Porous Carrier> Example 6 In a glass vial, U-succinate (5'-O-dimethoxytrityl-2'-O-tert-butyldimethylsilyl-3'-O-succinyluridine) (311.3 mg), 1-[bis(dimethylamino)methylene]-1H-1,2,3-benzotriazolium 3-oxide hexafluorophosphate (HBTU) (155.2 mg), N,N-diisopropylethylamine (90.1 μL), and acetonitrile (25 mL) were mixed. The prepared mixed solution (3.08 mL) and inorganic porous substrate 1 (300 mg) were added to a test tube. After standing at 25 ° C for 18 hours, it was filtered and the solid was washed with acetonitrile (10 mL). To the washed solid, acetic anhydride, a solution of 2,6-lutidine in tetrahydrofuran (acetic anhydride / 2,6-lutidine / tetrahydrofuran, volume ratio 1 / 1 / 8) (1 mL), and a solution of 1-methylimidazole in tetrahydrofuran (1-methylimidazole / tetrahydrofuran, volume ratio 16 / 84) (1 mL) were added. After standing for 1 minute, the mixture was filtered and the solid was washed with acetonitrile (10 mL). The washed solid was dried in a vacuum to obtain an inorganic porous carrier 1 carrying a group having a nucleoside structure.

[0158] [ka] (U-succinate)

[0159] Example 7 A reaction was carried out in the same manner as in Example 6 except that the inorganic porous substrate 2 was used in place of the inorganic porous substrate 1, to obtain an inorganic porous carrier 2.

[0160] Example 8 A reaction was carried out in the same manner as in Example 6 except that inorganic porous substrate 3 was used in place of inorganic porous substrate 1, to obtain inorganic porous carrier 3.

[0161] Example 9 A reaction was carried out in the same manner as in Example 6 except that inorganic porous substrate 4 was used in place of inorganic porous substrate 1, to obtain inorganic porous carrier 4.

[0162] Example 10 A reaction was carried out in the same manner as in Example 6 except that inorganic porous substrate 5 was used in place of inorganic porous substrate 1, to obtain inorganic porous carrier 5.

[0163] Comparative Example 1 A reaction was carried out in accordance with Example 6 using the inorganic porous substrate precursor 1 instead of the inorganic porous substrate 1 to obtain an inorganic porous carrier 6. The data of Comparative Example 1 are data in the case where no cap was used.

[0164] (Reference example 5) A reaction was carried out in the same manner as in Example 6 except that inorganic porous substrate 6 was used in place of inorganic porous substrate 1, to obtain inorganic porous carrier 7.

[0165] (Reference example 6) A reaction was carried out in the same manner as in Example 6 except that inorganic porous substrate 7 was used in place of inorganic porous substrate 1, to obtain inorganic porous carrier 8.

[0166] (Reference example 7) A reaction was carried out in the same manner as in Example 6 except that inorganic porous substrate 8 was used in place of inorganic porous substrate 1, to obtain inorganic porous carrier 9.

[0167] (Reference example 8) A reaction was carried out in the same manner as in Example 6 except that the inorganic porous substrate 9 was used in place of the inorganic porous substrate 1, to obtain an inorganic porous carrier 10.

[0168] The obtained series of inorganic molded bodies, inorganic porous substrate precursors, inorganic porous substrates, and inorganic porous carriers were measured for pore diameter by mercury intrusion method, particle diameter by scanning electron microscope measurement, cumulative pore volume in the range of pore diameter from 40nm to 1000nm, specific surface area by nitrogen adsorption method, active NH group loading amount, silyl group (B) loading amount, and nucleoside loading amount, respectively, using the above-mentioned methods. The results are shown in Table 2 below.

[0169] <Solid-phase synthesis of oligonucleotides> An oligonucleotide consisting of the following sequence (A) was synthesized from the 3' to the 5' side using a nucleic acid synthesizer (product name NTS M-4-MX-E, manufactured by Nippon Techno Service Co., Ltd.) based on the phosphoramidite method (see reaction pathway (condensation reaction, oxidation, deprotection)). The inorganic porous carrier produced above was used for such solid phase synthesis. In addition, the amidite monomers used were adenosine EMM amidite (described in Example 4 of U.S. Patent Application Publication No. 2012 / 035246), cytidine EMM amidite (described in Example 3 of the same U.S. document), guanosine EMM amidite (described in Example 5 of the same U.S. document), and uridine EMM amidite (described in Example 2 of the same U.S. document).

[0170] Sequence (A): 5'-AUAACUCAAUUUGUAAAAAAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3' (SEQ ID NO: 1)

[0171] [ka]

[0172] In addition, in this solid-phase synthesis, a high-purity trichloroacetic acid toluene solution was used as the deblocking solution, 5-benzylmercapto-1H-tetrazole was used as the condensing agent, an iodine solution was used as the oxidizing agent, and a phenoxyacetic acid solution and a 1-methylimidazole solution were used as the capping solutions.

[0173] After the synthesis, the inorganic porous carrier was placed in a glass vial with a lid, and a 1:1 or 2:1 solution of 28% aqueous ammonia and EtOH was added. Then, the mixture was left to stand at 40°C for 4 hours. The solution after the reaction was filtered and washed with water and EtOH. The resulting solution was dried to obtain undeprotected crude oligonucleotides, which were then deprotected by the action of tetra-n-butylammonium fluoride (TBAF) in the presence of nitromethane to obtain a crude product.

[0174] [Measurement of oligonucleotide purity] A solution prepared using the obtained crude oligonucleotide was separated into its components by high performance liquid chromatography (HPLC) (wavelength 260 nm, column DNAPacTM PA100 4 x 250 mm), and the peak width at 10% of the height of the apex of the LC peak of the main product in the obtained chromatogram was calculated as the "10% width". In order to verify the effect of each inorganic porous carrier, the "10% width" value of each inorganic porous carrier was divided by the "10% width" value of the inorganic porous carrier 6 (Comparative Example 2) that does not have a silyl group (B), and the "relative 10% width" was defined and calculated. Here, when the purity is high, the "relative 10% width" has a small value, and when the purity is low, the "relative 10% width" has a large value.

[0175] Example 11 Using the inorganic porous carrier 1, solid-phase synthesis of an oligonucleic acid was carried out for sequence (A) according to the above-mentioned method.

[0176] Example 12 Using the inorganic porous carrier 2, solid-phase synthesis of an oligonucleic acid was carried out for sequence (A) according to the above-mentioned method.

[0177] Example 13 Using the inorganic porous carrier 3, solid phase synthesis of an oligonucleic acid was carried out for sequence (A) according to the above-mentioned method.

[0178] Example 14 Using the inorganic porous carrier 4, solid-phase synthesis of an oligonucleic acid was carried out for sequence (A) according to the above-mentioned method.

[0179] Example 15 Using the inorganic porous carrier 5, solid-phase synthesis of an oligonucleic acid was carried out for sequence (A) according to the above-mentioned method.

[0180] Comparative Example 2 Solid phase synthesis of oligonucleic acid was carried out for sequence (A) according to the above-mentioned method using the inorganic porous carrier 6. The data of Comparative Example 2 are the data in the case where no cap was used.

[0181] (Reference example 9) Using the inorganic porous carrier 7, solid-phase synthesis of an oligonucleic acid was carried out for sequence (A) according to the above-mentioned method.

[0182] (Reference example 10) Using the inorganic porous carrier 8, solid phase synthesis of an oligonucleic acid was carried out for sequence (A) according to the above-mentioned method.

[0183] (Reference example 11) Using the inorganic porous carrier 9, solid-phase synthesis of an oligonucleic acid was carried out for sequence (A) according to the above-mentioned method.

[0184] (Reference example 12) Using the inorganic porous carrier 10, solid-phase synthesis of oligonucleic acid was carried out for sequence (A) according to the above-mentioned method.

[0185] The results of solid phase synthesis of oligonucleotides having a series of sequences (A) are shown in Table 1. [Table 1] [In Table 1, * indicates a bond to an inorganic porous substrate, a bond to an inorganic porous carrier, or a bond to an inorganic porous substrate precursor.]

[0186] In the solid-phase synthesis of the oligonucleic acid of sequence (A), the inorganic porous carriers used in Examples 11 to 15 showed a lower relative 10% width than the inorganic porous carriers used in Comparative Example 2 and Reference Examples 9 to 12, indicating that the obtained oligonucleic acid was of higher purity. [Industrial Applicability]

[0187] The present invention provides an inorganic porous carrier, an inorganic porous substrate as a raw material thereof, and a method for producing an oligonucleic acid, which can improve the purity of the oligonucleic acid in the production of the oligonucleic acid. The oligonucleic acid obtained by the present invention is useful as a raw material for pharmaceuticals, etc. [Sequence List Free Text]

[0188] SEQ ID NO:1 in the sequence listing represents the base sequence of an oligonucleotide produced according to the production method of the present invention.

Claims

1. The inorganic porous substrate has the following (i) silyl group (A) and (ii) silyl group (B), and has the following characteristics (iii) to (v). (i) Silyl group (A): a silyl group represented by the following formula (i-1): (ii) Silyl group (B): at least one silyl group selected from the group consisting of silyl groups represented by the following formulas (ii-1), (ii-2), and (ii-3): (iii) the particle size is 1 μm or more; (iv) the pore size is 20 nm or more; (v) The cumulative pore volume in the pore diameter range of 40 nm to 1000 nm is greater than 0.32 mL / g and less than or equal to 4 mL / g. 【Chemistry 1】 [In formula (i-1), X1 represents a bond to an inorganic porous substrate; Each Y1 independently represents any one selected from the group consisting of a bond to an inorganic porous substrate, a hydroxyl group, an amino group, an alkoxy group having 1 to 6 carbon atoms, and an alkylamino group having 1 to 12 carbon atoms (the alkylamino group represents a monoalkylamino group or a dialkylamino group); Z1's each independently represent an alkyl group having 1 to 6 carbon atoms (the alkyl group is a linear or branched alkyl group or a cycloalkyl group), a phenyl group, or a phenyl group having one or more substituents (the substituents are selected from the group consisting of alkyl groups having 1 to 6 carbon atoms and alkoxy groups having 1 to 6 carbon atoms); a represents an integer represented by 2-b; b represents an integer of 0 to 2; A1 represents an alkylene group having 1 to 20 carbon atoms which may contain one or more of an imino group, an oxy group, or a thio group; or an arylene group having 1 to 20 carbon atoms which may contain one or more of an imino group, an oxy group, or a thio group, and B1 represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms (the alkyl group represents a linear or branched alkyl group or a cycloalkyl group), a phenyl group, or a phenyl group having one or more substituents (the substituents are selected from the group consisting of alkyl groups having 1 to 6 carbon atoms and alkoxy groups having 1 to 6 carbon atoms). 【Chemistry 2】 、 【Chemistry 3】 、 【Chemistry 4】 、 [In formulas (ii-1), (ii-2), (ii-3), P1 represents a bond to an inorganic porous substrate; Q1 and R1 each independently represent any one selected from the group consisting of a bond to an inorganic porous substrate, a hydroxyl group, an amino group, an alkoxy group having 1 to 6 carbon atoms, and an alkylamino group having 1 to 12 carbon atoms (the alkylamino group represents a monoalkylamino group or a dialkylamino group); J1 represents an alkyl group having 2 to 20 carbon atoms which may have one or more substituents (the substituents are selected from the group consisting of a fluoro group, a chloro group, a bromo group, a cyano group, an aryl group having 6 to 10 carbon atoms, an alkoxy group having 1 to 6 carbon atoms, an aryloxy group having 6 to 10 carbon atoms, an acyloxy group having 1 to 10 carbon atoms, an acyl group having 1 to 10 carbon atoms, an alkylcarbamoyl group having 1 to 6 carbon atoms, and an arylcarbamoyl group having 6 to 10 carbon atoms), or a phenyl group having at least one alkyl group having 1 to 6 carbon atoms (the phenyl group may have one or more substituents selected from the group consisting of a fluoro group, a chloro group, a bromo group, a cyano group, an alkoxy group having 1 to 6 carbon atoms, an aryloxy group having 6 to 10 carbon atoms, an acyloxy group having 1 to 10 carbon atoms, an acyl group having 1 to 10 carbon atoms, an alkylcarbamoyl group having 1 to 6 carbon atoms, and an arylcarbamoyl group having 6 to 10 carbon atoms); K1 each independently represents an alkyl group having 1 to 20 carbon atoms which may have one or more substituents (the substituents are selected from the group consisting of a fluoro group, a chloro group, a bromo group, a cyano group, an aryl group having 6 to 10 carbon atoms, an alkoxy group having 1 to 6 carbon atoms, an aryloxy group having 6 to 10 carbon atoms, an acyloxy group having 1 to 10 carbon atoms, an acyl group having 1 to 10 carbon atoms, an alkylcarbamoyl group having 1 to 6 carbon atoms, and an arylcarbamoyl group having 6 to 10 carbon atoms), a phenyl group, or a phenyl group having one or more substituents (the substituents are selected from the group consisting of a fluoro group, a chloro group, a bromo group, a cyano group, an alkoxy group having 1 to 6 carbon atoms, an aryloxy group having 6 to 10 carbon atoms, an acyloxy group having 1 to 10 carbon atoms, an acyl group having 1 to 10 carbon atoms, an alkylcarbamoyl group having 1 to 6 carbon atoms, and an arylcarbamoyl group having 6 to 10 carbon atoms); M1 represents an alkylene group having 1 to 6 carbon atoms; and N1 represents an alkyl group having 2 to 20 carbon atoms which may have one or more substituents (the substituents are selected from the group consisting of a fluoro group, a chloro group, a bromo group, a cyano group, an aryl group having 6 to 10 carbon atoms, an alkoxy group having 1 to 6 carbon atoms, an aryloxy group having 6 to 10 carbon atoms, an acyloxy group having 1 to 10 carbon atoms, an acyl group having 1 to 10 carbon atoms, an alkylcarbamoyl group having 1 to 6 carbon atoms, and an arylcarbamoyl group having 6 to 10 carbon atoms), a phenyl group, or a phenyl group having one or more substituents (the substituents are selected from the group consisting of a fluoro group, a chloro group, a bromo group, a cyano group, an alkoxy group having 1 to 6 carbon atoms, an aryloxy group having 6 to 10 carbon atoms, an acyloxy group having 1 to 10 carbon atoms, an acyl group having 1 to 10 carbon atoms, an alkylcarbamoyl group having 1 to 6 carbon atoms, and an arylcarbamoyl group having 6 to 10 carbon atoms).

2. The inorganic porous substrate according to claim 1, wherein the pore diameter of the inorganic porous substrate is 40 nm or more and 500 nm or less.

3. The specific surface area of ​​the inorganic porous substrate is 0.1 m ２ / g or more, 200m ２ The inorganic porous substrate according to any one of claims 1 to 2, wherein the molecular weight is 1 / g or less.

4. The inorganic porous substrate according to any one of claims 1 to 3, wherein the inorganic porous substrate is composed of silica, silica gel, zeolite, or glass.

5. The inorganic porous substrate according to any one of claims 1 to 4, characterized in that the amount of active NH groups represented by the following formula (NH-1) satisfies the following formula (NH #1). 【number】 [In formula (NH-1), A1 represents an alkylene group having 1 to 20 carbon atoms which may contain one or more of an imino group, an oxy group, or a thio group; or an arylene group having 1 to 20 carbon atoms which may contain one or more of an imino group, an oxy group, or a thio group, B1 represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms (the alkyl group represents a linear or branched alkyl group or a cycloalkyl group), a phenyl group, or a phenyl group having one or more substituents (the substituents are selected from the group consisting of alkyl groups having 1 to 6 carbon atoms and alkoxy groups having 1 to 6 carbon atoms), An NH group that satisfies the above structural requirements is defined as an active NH group. [0010] I1: amount of active NH groups in the inorganic porous base material (μmol / g), S1: The specific surface area (m ) of the inorganic porous substrate obtained by nitrogen adsorption / desorption isotherm measurement ２ / g)

6. The inorganic porous substrate according to any one of claims 1 to 5, having a silyl group represented by the above formula (ii-3) as the silyl group (B).

7. The inorganic porous substrate according to any one of claims 1 to 6, wherein the silyl group represented by the formula (ii-3) is a silyl group represented by the following formula (ii-3-1): 【Chemistry 6】 [In formula (ii-3-1), P1 represents a bond to an inorganic porous substrate; K2 each independently represents an alkyl group having 1 to 6 carbon atoms, a phenyl group, or a phenyl group having one or more substituents (the substituents are selected from the group consisting of a fluoro group, a chloro group, a bromo group, a cyano group, an alkoxy group having 1 to 6 carbon atoms, an aryloxy group having 6 to 10 carbon atoms, an acyloxy group having 1 to 10 carbon atoms, an acyl group having 1 to 10 carbon atoms, an alkylcarbamoyl group having 1 to 6 carbon atoms, and an arylcarbamoyl group having 6 to 10 carbon atoms); M2 represents an alkylene group having 1 to 4 carbon atoms, and N2 represents an alkyl group having 2 to 6 carbon atoms, a phenyl group, or a phenyl group having one or more substituents (the substituents are selected from the group consisting of a fluoro group, a chloro group, a bromo group, a cyano group, an alkoxy group having 1 to 6 carbon atoms, an aryloxy group having 6 to 10 carbon atoms, an acyloxy group having 1 to 10 carbon atoms, an acyl group having 1 to 10 carbon atoms, an alkylcarbamoyl group having 1 to 6 carbon atoms, and an arylcarbamoyl group having 6 to 10 carbon atoms).

8. The inorganic porous substrate according to any one of claims 1 to 7, characterized in that A1 in the above formula (i-1) is an alkylene group having 1 to 20 carbon atoms which may contain one or more of an imino group, an oxy group, or a thio group.

9. (i) The inorganic porous substrate according to any one of claims 1 to 8, characterized in that the silyl group (A) is represented by the following formula (i-1-1): 【Chemistry 7】 [In formula (i-1-1), X1 represents a bond to an inorganic porous substrate; Z1's each independently represent an alkyl group having 1 to 6 carbon atoms (the alkyl group is a linear or branched alkyl group or a cycloalkyl group), a phenyl group, or a phenyl group having one or more substituents (the substituents are selected from the group consisting of alkyl groups having 1 to 6 carbon atoms and alkoxy groups having 1 to 6 carbon atoms); A2 represents an alkylene group having 1 to 15 carbon atoms which may contain at least one of an imino group, an oxy group, and a thio group, and B2 represents a hydrogen atom or an alkyl group having 1 to 2 carbon atoms.

10. An inorganic porous carrier having the following (vi) a silyl group (C) and (vii) a silyl group (D), and having the following characteristic (viii): (vi) Silyl group (C): a silyl group represented by the following formula (vi-1): (vii) Silyl group (D): at least one silyl group selected from the group consisting of silyl groups represented by the following formulas (vii-1), (vii-2), and (vii-3): (viii) the pore size is 20 nm or more; 【Chemistry 8】 [In formula (vi-1), X01 represents a bond to an inorganic porous carrier; Y01 each independently represents any one selected from the group consisting of a bond to an inorganic porous carrier, a hydroxyl group, an amino group, an alkoxy group having 1 to 6 carbon atoms, and an alkylamino group having 1 to 12 carbon atoms (the alkylamino group represents a monoalkylamino group or a dialkylamino group); Z1's each independently represent an alkyl group having 1 to 6 carbon atoms (the alkyl group is a linear or branched alkyl group or a cycloalkyl group), a phenyl group, or a phenyl group having one or more substituents (the substituents are selected from the group consisting of alkyl groups having 1 to 6 carbon atoms and alkoxy groups having 1 to 6 carbon atoms); a represents an integer represented by 2-b; b represents an integer of 0 to 2; A01 represents an alkylene group having 1 to 20 carbon atoms which may contain one or more of an acylimino group, an oxy group, or a thio group; or an arylene group having 1 to 20 carbon atoms which may contain one or more of an acylimino group, an oxy group, or a thio group, B1 represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms (the alkyl group represents a linear or branched alkyl group or a cycloalkyl group), a phenyl group, or a phenyl group having one or more substituents (the substituents are selected from the group consisting of alkyl groups having 1 to 6 carbon atoms and alkoxy groups having 1 to 6 carbon atoms), C1 represents a group having a nucleoside or nucleotide structure in which a reactive group is protected or deprotected. 【Chemistry 9】 、 【Chemistry 10】 、 【Chemistry 11】 、 [In the formula (vii-1), (vii-2), or (vii-3), P01 represents a bond to an inorganic porous carrier; Q01 and R01 each independently represent any one selected from the group consisting of a bond to an inorganic porous carrier, a hydroxyl group, an amino group, an alkoxy group having 1 to 6 carbon atoms, and an alkylamino group having 1 to 12 carbon atoms (the alkylamino group represents a monoalkylamino group or a dialkylamino group); J1 represents an alkyl group having 2 to 20 carbon atoms which may have one or more substituents (the substituents are selected from the group consisting of a fluoro group, a chloro group, a bromo group, a cyano group, an aryl group having 6 to 10 carbon atoms, an alkoxy group having 1 to 6 carbon atoms, an aryloxy group having 6 to 10 carbon atoms, an acyloxy group having 1 to 10 carbon atoms, an acyl group having 1 to 10 carbon atoms, an alkylcarbamoyl group having 1 to 6 carbon atoms, and an arylcarbamoyl group having 6 to 10 carbon atoms), or a phenyl group having at least one alkyl group having 1 to 6 carbon atoms (the phenyl group may have one or more substituents selected from the group consisting of a fluoro group, a chloro group, a bromo group, a cyano group, an alkoxy group having 1 to 6 carbon atoms, an aryloxy group having 6 to 10 carbon atoms, an acyloxy group having 1 to 10 carbon atoms, an acyl group having 1 to 10 carbon atoms, an alkylcarbamoyl group having 1 to 6 carbon atoms, and an arylcarbamoyl group having 6 to 10 carbon atoms); K1 each independently represents an alkyl group having 1 to 20 carbon atoms which may have one or more substituents (the substituents are selected from the group consisting of a fluoro group, a chloro group, a bromo group, a cyano group, an aryl group having 6 to 10 carbon atoms, an alkoxy group having 1 to 6 carbon atoms, an aryloxy group having 6 to 10 carbon atoms, an acyloxy group having 1 to 10 carbon atoms, an acyl group having 1 to 10 carbon atoms, an alkylcarbamoyl group having 1 to 6 carbon atoms, and an arylcarbamoyl group having 6 to 10 carbon atoms), a phenyl group, or a phenyl group having one or more substituents (the substituents are selected from the group consisting of a fluoro group, a chloro group, a bromo group, a cyano group, an alkoxy group having 1 to 6 carbon atoms, an aryloxy group having 6 to 10 carbon atoms, an acyloxy group having 1 to 10 carbon atoms, an acyl group having 1 to 10 carbon atoms, an alkylcarbamoyl group having 1 to 6 carbon atoms, and an arylcarbamoyl group having 6 to 10 carbon atoms); M1 represents an alkylene group having 1 to 6 carbon atoms; and N1 represents an alkyl group having 2 to 20 carbon atoms which may have one or more substituents (the substituents are selected from the group consisting of a fluoro group, a chloro group, a bromo group, a cyano group, an aryl group having 6 to 10 carbon atoms, an alkoxy group having 1 to 6 carbon atoms, an aryloxy group having 6 to 10 carbon atoms, an acyloxy group having 1 to 10 carbon atoms, an acyl group having 1 to 10 carbon atoms, an alkylcarbamoyl group having 1 to 6 carbon atoms, and an arylcarbamoyl group having 6 to 10 carbon atoms), a phenyl group, or a phenyl group having one or more substituents (the substituents are selected from the group consisting of a fluoro group, a chloro group, a bromo group, a cyano group, an alkoxy group having 1 to 6 carbon atoms, an aryloxy group having 6 to 10 carbon atoms, an acyloxy group having 1 to 10 carbon atoms, an acyl group having 1 to 10 carbon atoms, an alkylcarbamoyl group having 1 to 6 carbon atoms, and an arylcarbamoyl group having 6 to 10 carbon atoms).

11. The inorganic porous carrier according to claim 10, wherein the pore diameter of the inorganic porous carrier is 40 nm or more and 500 nm or less.

12. The inorganic porous carrier according to any one of claims 10 to 11, characterized in that the cumulative pore volume in the pore diameter range of 40 nm to 1000 nm of the inorganic porous carrier is greater than 0.32 mL / g and less than or equal to 4 mL / g.

13. The specific surface area of ​​the inorganic porous carrier is 0.1 m ２ / g or more, 200m ２ The inorganic porous carrier according to any one of claims 10 to 12, wherein the molecular weight is 100% or less.

14. The inorganic porous carrier according to any one of claims 10 to 13, wherein the inorganic porous body is composed of silica, silica gel, zeolite, or glass.

15. The amount of a group containing a nucleoside or nucleotide structure in which a reactive group is protected or deprotected satisfies the following formula (Nu #1). The inorganic porous carrier according to any one of claims 10 to 14. [0025] I01: The amount (μmol / g) of a group having a nucleoside or nucleotide structure in which a reactive group is protected or deprotected in an inorganic porous carrier; S01: The specific surface area (m ) of the inorganic porous carrier obtained by nitrogen adsorption / desorption isotherm measurement ２ / g)

16. The inorganic porous carrier according to any one of claims 10 to 15, characterized in that C1 in the formula (vi-1) contains a succinyl linker.

17. The inorganic porous carrier according to any one of claims 10 to 16, having a silyl group represented by the above formula (vii-3) as the silyl group (D).

18. The inorganic porous carrier according to any one of claims 10 to 17, wherein the silyl group represented by the formula (vii-3) is a silyl group represented by the following formula (vii-3-1): 【Chemistry 12】 [In formula (ii-3-1), P01 represents a bond to an inorganic porous carrier; K2 each independently represents an alkyl group having 1 to 6 carbon atoms, a phenyl group, or a phenyl group having one or more substituents (the substituents are selected from the group consisting of a fluoro group, a chloro group, a bromo group, a cyano group, an alkoxy group having 1 to 6 carbon atoms, an aryloxy group having 6 to 10 carbon atoms, an acyloxy group having 1 to 10 carbon atoms, an acyl group having 1 to 10 carbon atoms, an alkylcarbamoyl group having 1 to 6 carbon atoms, and an arylcarbamoyl group having 6 to 10 carbon atoms); M2 represents an alkylene group having 1 to 4 carbon atoms, and N2 represents an alkyl group having 2 to 6 carbon atoms, a phenyl group, or a phenyl group having one or more substituents (the substituents are selected from the group consisting of a fluoro group, a chloro group, a bromo group, a cyano group, an alkoxy group having 1 to 6 carbon atoms, an aryloxy group having 6 to 10 carbon atoms, an acyloxy group having 1 to 10 carbon atoms, an acyl group having 1 to 10 carbon atoms, an alkylcarbamoyl group having 1 to 6 carbon atoms, and an arylcarbamoyl group having 6 to 10 carbon atoms).

19. The inorganic porous carrier according to any one of claims 10 to 18, characterized in that A01 in the above formula (vi-1) is an alkylene group having 1 to 20 carbon atoms which may contain one or more of an acylimino group, an oxy group, or a thio group.

20. (vi) The inorganic porous carrier according to any one of claims 10 to 19, characterized in that the silyl group (C) is represented by the following formula (vi-1-1): 【Chemistry 13】 [In formula (vi-1-1), X01 represents a bond to an inorganic porous carrier; Z1's each independently represent an alkyl group having 1 to 6 carbon atoms (the alkyl group is a linear or branched alkyl group or a cycloalkyl group), a phenyl group, or a phenyl group having one or more substituents (the substituents are selected from the group consisting of alkyl groups having 1 to 6 carbon atoms and alkoxy groups having 1 to 6 carbon atoms); A02 represents an alkylene group having 1 to 15 carbon atoms which may contain at least one of an acylimino group, an oxy group, and a thio group; B2 represents a hydrogen atom or an alkyl group having 1 to 2 carbon atoms, and C2 represents a group having a nucleoside or nucleotide structure containing a succinyl linker and a reactive group that is protected or deprotected.

21. The inorganic porous carrier according to any one of claims 10 to 20, wherein C1 in the above formula (vi-1) has a group having a nucleoside or nucleotide structure in which a hydroxyl group as a reactive group is protected, (A) removing the protecting group of the hydroxyl group at the 5' position of the nucleoside; a step (B) of producing a phosphite by condensing the hydroxyl group at the 5' position of the nucleoside produced in the step (A) with an amidite compound having a second nucleoside base; A step (C) of oxidizing the phosphite produced in the step (B) to produce a nucleotide; and A step (D) of deprotecting the protecting group of the hydroxyl group at the 5' position of the nucleotide produced in the step (C). A method for producing a nucleic acid, comprising:

22. a step (B') of further condensing the product produced in the step (D) with an amidite compound having a nucleoside base to be subsequently introduced to produce a phosphite; A step (C') of oxidizing the phosphite produced in the step (B') to produce an oligonucleotide; and A step (D') of deprotecting the protecting group of the hydroxyl group at the 5'-position of the oligonucleotide chain end formed in the step (C') The method for producing a nucleic acid according to claim 21 , comprising:

23. The method for producing a nucleic acid according to claim 22, further comprising a step (E) of repeating a series of steps consisting of the steps (B'), (C') and (D') m times (m represents an integer of 1 or more) to react m amidite compounds and then excising the extended nucleic acid.

24. Use of the inorganic porous carrier according to any one of claims 10 to 20 in the production of nucleic acid by the phosphoramidite method.

Images