Probes and methods for enriching target regions using same for high-throughput sequencing

Abstract

The present invention provides a probe and a method for enriching a target region by applying the probe to high-throughput sequencing. [Solution] The present invention discloses a probe suitable for high-throughput sequencing and a method for enriching a target region using the probe. The probe has, from the 5' end, a linker arm, mask sequence 1, UID sequence 1, Illumina Tag1 sequence, a dU region, Illumina Tag2 sequence, UID sequence 2, mask sequence 2, and an extension arm, in this order; mask sequence 1, mask sequence 2, dU region, UID sequence 1, and UID sequence 2 may be 0 bp. When sequencing a library created using the probe of the present invention, there is no need to add a separate sequencing primer. The method of the present invention allows direct capture of the target region using RNA as a template, simplifying the experimental process. [Selected Figure] Figure 1

Description

[Technical field]

[0001] The present invention relates to the field of biotechnology sequencing, and in particular to a probe and a method for enriching a target region for application in high-throughput sequencing. [Background technology]

[0002] With the rapid development of high-throughput sequencing technology, sequencing efficiency has been greatly improved, time has been greatly shortened, and costs have also been greatly reduced, resulting in revolutionary changes in gene detection methods, and the technology is developing toward large-scale industrialization. Although the overall cost of high-throughput sequencing has been greatly reduced, researchers still find the high-depth whole genome sequencing cost and the complexity of deciphering large-scale sequencing data difficult. The emergence of targeted sequencing technology has alleviated the above difficulties to some extent. Targeted sequencing is a research strategy for enriching and sequencing gene regions of interest. The main advantage of targeted region sequencing is that it can perform sequencing on specific regions, effectively reducing sequencing costs and deepening sequencing depth, making it more economical and efficient to study genetic variation information in specific regions.

[0003] At present, there are three main methods to achieve enrichment of target regions: hybrid capture technology, multiplex PCR technology, and molecular inversion probe (MIP). Hybrid capture technology: First, genomic DNA is fragmented by physical or enzymatic cleavage, and adapters are attached to both ends for PCR amplification. Then, it is hybridized with a biotin-labeled probe, and unhybridized DNA is not captured by magnetic beads and is washed away. Finally, the enriched DNA sample is subjected to PCR amplification and sequencing. The characteristics of hybrid capture are excellent scalability and the ability to capture exomes or even larger target regions, but the disadvantages are complex operation procedures, long cycles, high costs, and the need for relatively large amounts of special equipment.

[0004] Multiplex PCR amplification technology designs specific primers based on the target sequence and enriches the target sequence through multiplex amplification. Multiplex PCR technology is easy to operate, flexible to operate, inexpensive, easy to analyze, and has minimal requirements for equipment, and the enrichment of target sequences and library construction can be completed in a few hours. With ultra-deep sequencing, amplicon sequencing can detect ultra-low frequency mutations in complex samples, which is particularly suitable for clinical research on diseases such as cancer. Its disadvantage is that it is only suitable for capturing relatively small target sequences, and problems such as amplification inhibition, cross-amplification of primers, and serious primer dimers need to be solved.

[0005] Molecular inversion probe technology is a new type of multi-target sequencing method, which has the advantages of simple operation procedures, small sample size, low cost, high accuracy, etc. However, the application of molecular inversion probes in the field of high-throughput sequencing is immature, and it has the disadvantages of long hybridization time, high error rate, and complicated operation steps. Summary of the Invention [Problem to be solved by the invention]

[0006] It is an object of the present invention to provide a simple, rapid, highly efficient and accurate method for enriching target regions using improved molecular inversion probe technology. [Means for solving the problem]

[0007] In order to achieve the above object, the present invention provides a probe, the probe comprising from a 5' end thereof a linker arm, a mask sequence 1, a UID sequence 1, an Illumina (Registered Trademark) Tag1 Array (Tag1 sequence) , Illumina (Registered Trademark) Tag2 array ( Tag2 sequence) , mask sequence 2, and extension arm in that order, wherein the UID sequence 1 is composed of 3 to 12 random bases; the mask sequence 1 is composed of 0 to 3 random bases that are not complementary to the sequence upstream of the template corresponding to the linker arm; and the mask sequence 2 is composed of 0 to 3 random bases that are not complementary to the sequence downstream of the template corresponding to the 0 to 3 linker arms.

[0008] In another aspect of the present invention, a probe is provided, the probe comprising from a 5' end a linker arm, a mask sequence 1, an Illumina (Registered Trademark) Tag1 sequence, Illumina (Registered Trademark) The sequence is Tag2 sequence, UID sequence 2, mask sequence 2, and extension arm, with the UID sequence 2 consisting of 3 to 12 random bases; the mask sequence 1 consisting of 0 to 3 random bases that are not complementary to sequences upstream of the template corresponding to the linker arm; and the mask sequence 2 consisting of 0 to 3 random bases that are not complementary to sequences downstream of the template corresponding to the 0 to 3 linker arms.

[0009] In another aspect of the present invention, a probe is also provided, the probe comprising from a 5' end a linker arm, a mask sequence 1, a UID sequence 1, an Illumina (Registered Trademark) Tag1 sequence, Illumina (Registered Trademark)The order is Tag2 sequence, UID sequence 2, mask sequence 2, and extension arm; each of the UID sequence 1 and UID sequence 2 is composed of 3 to 12 random bases; the mask sequence 1 is composed of 0 to 3 random bases that are not complementary to the sequence upstream of the template corresponding to the linker arm; and the mask sequence 2 is composed of 0 to 3 random bases that are not complementary to the sequence downstream of the template corresponding to the 0 to 3 linker arms.

[0010] In another aspect of the present invention, the above-mentioned probe is used as a base for the Illumina (Registered Trademark) Tag1 sequence and Illumina (Registered Trademark) A probe is further provided in which a dU region, which is one to three deoxyuracil bases, is present between the Tag2 sequence.

[0011] Furthermore, the linker arm is a 15-45 bp base sequence that binds complementarily to a nucleic acid template; Illumina (Registered Trademark) Tag1 sequence and Illumina (Registered Trademark) The Tag2 sequence was identified using Illumina (Registered Trademark) Transposon Adapters in any library preparation kit for the platform, any combination of sequences on the adapters or their complements or reverse complements; The extension arm is a 15-45 bp base sequence that binds complementary to a nucleic acid template.

[0012] Additionally, the extension arm is modified; preferably, phosphorothioate modified; More preferably, the Tm value of the linker arm is at least 2° C. higher than the Tm value of the extension arm; Alternatively, the 5' end of the linker arm is modified by phosphorylation; Alternatively, the Illumina (Registered Trademark) Tag1 sequence and Illumina (Registered Trademark) The Tag2 sequence was identified using Illumina (Registered Trademark)The transposon adapters in the library preparation kit for the platform are selected from any combination of sequences on the adapters or their complementary sequences.

[0013] In another aspect of the present invention, there is also provided a method for enriching a target region using said probe and adapted for high throughput sequencing, comprising: a hybridization, extension and ligation reaction step in which the template DNA is hybridized, extended and ligated with the probe to obtain a first product; a second product obtaining step of enzymatically cleaving and digesting the excess probe and template DNA and amplifying the second product by PCR using tagged primers; a purification step for purifying the second product to obtain a library; loading the library into a sequencer for sequencing; Includes.

[0014] Furthermore, the hybridization, extension and ligation reaction steps: the template DNA and the probe are first hybridized, and then polymerase and ligase are added to perform extension and ligation to obtain a first product; Preferably, the reaction system and reaction process are as follows: Purified water 6μL; 2 μL of 50 ng / μL template DNA; 3I10 -3 1 μL of the probe at μM; 10I Amplification Buffer 1μL; The process is to denature at 95°C for 5 minutes and incubate at 60°C for 2 hours; then add the following reagents to the above reaction system to carry out extension and ligation reactions, and the reaction process is to incubate at 60°C for 1 hour; Purified water 1.4μL; 1 μL 1 mM dNTPs; 5U / μL Ampligase DNA ligase 1μL; 10I Amplification Buffer 0.5μL; 50mM NAD + 0.1 μL; Phusion® High-Fidelity DNA Polymerase 1μL; or if the template is RNA, nuclease-free water 5.5 μL; 2 μL of template RNA at 50 ng / μL; 3I10 -3 1 μL of the probe at μM; RNase Inhibitor 0.5 μL; 10I Amplification Buffer 1μL; After denaturation at 70°C for 2 minutes and incubation at 65°C for 2 hours, the following reagents were added and the reaction was carried out at 42°C for 1 hour for extension and ligation reactions: 1 μL of 1 mM dNTPs; 5U / μL Ampligase DNA ligase 1μL; 10I Amplification Buffer 1μL; 50mM NAD + 0.1 μL; 4 μL 5I First-Strand Buffer; 2 μL of 100 mM DTT; SMART MMLV RT 1μL; or adding template DNA, the probe, polymerase and ligase simultaneously, and simultaneously carrying out hybridization, extension and ligation to obtain a first product; Preferably, the reaction system and reaction process are as follows: Purified water 3.4μL; 2 μL of 50 ng / μL template DNA; 3I10 -3 1 μL of the probe at μM; 1 μL 1 mM dNTPs; 5U / μL Ampligase DNA ligase 1μL; 10I Amplification Buffer 1μL; 50mM NAD + 0.1 μL; Phusion® HiFi DNA Polymerase 0.5 μL; The reaction process is 95°C for 5 minutes and 60°C for 3 hours.

[0015] Furthermore, the second product obtaining step includes first digesting the excess probe and template DNA with an exonuclease, then linearizing the first product with a USER enzyme, and then PCR amplifying the first product with a tagged primer to obtain a second product; Preferably, the reaction system and reaction process are as follows: First product Exonuclease I 0.5 μL; Exonuclease III 0.5 μL; Incubate at 37°C for 40 min, then incubate at 95°C for 5 min; Add the following reagents: 2I iProof HF Master Mix 50μL; Purified water 29μL; 2 μL of 20 μM tagged upstream primer; 2 μL of 20 μM tagged downstream primer; USER Enzyme 1 μL; Incubation at 37°C for 15 minutes, pre-denaturation at 98°C for 30 seconds, denaturation at 98°C for 10 seconds, annealing at 58°C for 30 seconds, and extension at 72°C for 30 seconds were performed for 26 cycles; extension at 72°C for 2 minutes, and incubation at 4°C; or exonuclease, tagged upstream primer and tagged downstream primer are added simultaneously, followed by enzymatic cleavage / digestion, linearization and PCR amplification simultaneously to obtain a second product; The 3' ends of the tagged upstream primer and the tagged downstream primer are modified with phosphorothioate and the 5' ends are modified with phosphorothioate, amino or a spacer arm to prevent cleavage by exonuclease; Preferably, the reaction system and reaction process when the template is DNA are as follows: First product 18 μL; Exonuclease Lambda 0.5 μL; Exonuclease III 1 μL; 2I iProof HF Master Mix 50μL; HO 29.5μL; 2 μL of 20 μM tagged upstream primer; 2 μL of 20 μM tagged downstream primer; The reaction process was as follows: incubation at 37°C for 40 minutes, incubation at 95°C for 5 minutes, pre-denaturation at 98°C for 30 seconds, denaturation at 98°C for 10 seconds, annealing at 58°C for 30 seconds, and extension at 72°C for 30 seconds; 26 cycles were performed; extension at 72°C for 2 minutes, and incubation at 4°C; Alternatively, the reaction system and reaction process when the template is RNA are as follows: First product 10.1 μL; Exonuclease I 1 μL; RNase A 0.1 μL; RNase H 0.1 μL; 2I iProof HF Master Mix 50μL; HO 24.8μL; 2 μL of 20 μM tagged upstream primer; 2 μL of 20 μM tagged downstream primer; 27 cycles were performed, each cycle consisting of incubation at 37°C for 60 minutes, incubation at 95°C for 5 minutes, pre-denaturation at 98°C for 30 seconds, denaturation at 98°C for 10 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 30 seconds; extension at 72°C for 2 minutes and incubation at 4°C.

[0016] Further, the upstream primer structure in the tagged primer starts from the 5' end and is (Registered Trademark) Sequence regions, index sequence regions, and Illumina used for cluster generation during sequencing (Registered Trademark) a paired full-length sequence region that is reverse complementary to the Tag1 sequence; The downstream primer structure within the tagged primer begins at the 5' end and is (Registered Trademark) Sequence regions, index sequence regions, and Illumina used for cluster generation during sequencing (Registered Trademark) This is the full-length Tag2 sequence region.

[0017] The implementation process specifically includes the following parts:

[0018] 1. Hybridization of probe and nucleic acid sample Hybridization of a probe with a nucleic acid sample means that the extension arm and linker arm of the probe have a pair sequence complementary to the target region of a single-stranded nucleic acid sample, and hybridization is performed under a suitable hybridization system and temperature. The nucleic acid sample can be DNA, RNA, or cDNA obtained by reverse transcription of RNA, and can be a mixture of DNA and cDNA or DNA and RNA. Figure 1 shows one of the improved MIP probe structures. The origin of the probe can be various synthetic methods or modified by molecular biology techniques after synthesis. The probe is composed of the following eight-part structure, namely, 1) a variable-length linker arm (15-45 nt) that binds complementary to the nucleic acid template; 2) 0-3 random bases that are not complementary to the sequence upstream of the template corresponding to the linker arm, which serves as a mask; 3) 1-2 UID (Unique Identifier) ​​sequences, the UID sequence is composed of 3-12 random bases, and is used to distinguish the labeled sequence of the original template; 4) Illumina (Registered Trademark) Sequencing platform: Tag1 (Illumina) (Registered Trademark)The reverse complement of one sequence segment of the Nextera Transposase Adapters Read 2 in the Nextera Library Prep Kits (5'-CTGTCTCTTATACACATCTCCGAGCCCACGAGAC-3'), the 3' end of which can be reduced by 0 to 16 bases; 5) 0 to 3 deoxyuracil (dU) bases; 6) Illumina (Registered Trademark) Sequencing platform: Tag2 (Illumina) (Registered Trademark) The TruSeq Reagent Kit uses one sequence segment on the 5' end adapter (5'-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3'), the 5' end of the sequence can be reduced by 0 to 19 bases; where the two tag sequences 1 and 2 used for sequencing are Illumina (Registered Trademark) Transposon Adapters in any library preparation kit for the platform, may be any combination of sequences on the adapter or their complementary sequences; 7) 1-3 random bases that are not complementary to the sequence downstream of the template corresponding to the extension arm, serving as a mask; 8) Variable length extension arm (15-45 nt) that binds complementary to the nucleic acid template. The extension arm may be phosphorothioate modified or otherwise modified; during synthesis of the probe, phosphorylation may be modified at the 5' end of the linker arm, or phosphorylation may not be performed during synthesis, and phosphorylation may be modified at the 5' end of the probe through a phosphorylation reaction).

[0019] 2. Extension, ligase ligation reaction After the extension arm and linker arm of the probe are fixed to the target region, the extension arm is extended from the 3' end of the extension arm to the 5' end of the linker arm by utilizing the polymerization function of DNA polymerase. A high fidelity DNA polymerase is preferred. If the template is RNA, it is extended by reverse transcriptase. Then, the nicks are joined by ligase to obtain a circular product. Of course, the hybridization, extension and ligation reactions can be carried out simultaneously in one step.

[0020] 3. Digestion of Linear Probes and Nucleic Acids with Exonucleases To eliminate the effects of the nucleic acid sample and excess probe on the subsequent PCR amplification, the probe and single- and double-stranded nucleic acid samples are digested with single-strand and double-strand exonucleases, leaving only circular products. The exonucleases can be a single enzyme or a mixture of enzymes.

[0021] 4. Linearization of Circular Products and PCR Amplification To improve the efficiency of PCR amplification, the circular products are cleaved into linear form using USER enzyme, and then library amplification is performed using upstream and downstream primers that contain the same or complementary structure as the sequencing tag sequence in the probe structure (CAAGCAGAAGACGGCATACGAGATTTCTGCCTGTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG (non-phosphorothioate modified SEQ ID NO:9) and AATGATACGGCACCACCGAGATCTACACTATAGCCTACACTCTTTCCCTACACGACGCTCTTCCGATCT (non-phosphorothioate modified SEQ ID NO:10). The underlined part is the index sequence, which is used to distinguish the tags of different libraries when sequencing mixed libraries, and its sequence can be changed.

[0022] Of course, it is also possible to mix exonuclease and PCR reagents (not including the USER enzyme) and perform the enzymatic cleavage reaction first, followed by library amplification using phosphorothioate-modified upstream and downstream primers.

[0023] 5. Library Purification To remove impurities such as enzymes, deoxyribonucleoside triphosphates (dNTPs), ions, primers and primer dimers from the library, the library is purified with Beckman Agencourt AMPure XP magnetic beads and may be purified by other methods such as gel excision recovery after electrophoresis or column purification.

[0024] 6. High-throughput Sequencing The prepared library is sequenced on a high-throughput sequencer after passing concentration and fragment quality control. The library sequencing method of the present invention includes, but is not limited to, a reversible termination method, and may also be other sequencing platforms. The sequencing type can be single-end sequencing or double-end sequencing. In an embodiment of the present invention, the sequencing platform is an Illumina (Registered Trademark) and the sequencing type is double-end sequencing. Effect of the Invention

[0025] Compared with conventional MIP methods, the present invention has the following advantageous effects:

[0026] 1. The present invention relates to Illumina (Registered Trademark) Nextera and Illumina (Registered Trademark) The sequence on the TruSeq adapter is used as the backbone sequence of the probe, eliminating the need to add a separate sequencing primer during sequencing, simplifying the experimental process.

[0027] 2. The present invention modifies the PCR tagged primers, and the enzyme cleavage reagent and PCR reagents can be added to the reaction tube simultaneously, thus reducing the operation steps.

[0028] 3. The present invention can directly capture the target region using RNA as a template, without the need for prior reverse transcription, thus simplifying the experimental process.

[0029] 4. The present invention introduces a UID structure to eliminate the repetitive sequences obtained in PCR amplification, significantly reducing the error rate and restoring the true mutation frequency of the sample. The dU base is introduced into the probe structure, and the circular template is linearized by the USER enzyme to increase the PCR amplification efficiency and reduce the PCR amplification error. [Brief description of the drawings]

[0030] [Figure 1] FIG. 1 is a diagram showing the probe structure. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0031] Hereinafter, the embodiments of the present invention will be described in detail, and the embodiments are illustrated in the accompanying drawings, in which the same or similar reference numerals represent the same or similar elements or elements having the same or similar functions. The embodiments depicted in the drawings below are illustrative and are intended to explain the present invention, but should not be construed as limiting the present invention. If specific techniques or conditions are not specified in the examples, they are carried out based on the techniques or conditions described in the literature in this field or the product instructions. If the manufacturer of the reagents or equipment used is not specified, they are conventional products that can be purchased from the market.

[0032] The following primers and probes were all synthesized by Sankyo Biotechnology (Shanghai) Co., Ltd.

[0033] The HCT15 cells used in this example can be purchased from bio-companies such as Punoxi Biotechnology and Shanghai Research Zone Bio-Engineering Co., Ltd., and then their DNA can be extracted by conventional DNA extraction methods.

[0034] The NCI-H3122 cell line can be purchased from companies such as Shanghai Zeye Biological Technology Co., Ltd. and Shanghai Jihe Biological Technology Co., Ltd., and then its RNA can be extracted by conventional RNA extraction methods.

[0035] The probe structure in the embodiment will be described below with reference to the probe structure in FIG.

[0036] [Example 1] Enrichment of target regions with improved MIP probe libraries In this example, four probes targeting human breast cancer susceptibility gene (BRCA) were used. The experiment was divided into two groups, experimental group 1 was the probe without dU structure, experimental group 2 was the probe with dU structure, and other structures and sequences were the same.

[0037] Note: B stands for G, T or C; D stands for G, A or T; H stands for A, T or C; V stands for G, A or C; N stands for A, T, C or G; 5Phos stands for phosphorylation modification; -s- stands for phosphorothioate modification between two bases.

[0038] The probe sequences for experimental group 1 are as follows:

[0039] [ka]

[0040] Here, starting from the 5' end, the underline indicates the linker arm, NNNNNNNNNNNN is the UID sequence 1, and the double underline indicates the Illumina (Registered Trademark) Tag1, dotted underline indicates Illumina (Registered Trademark) Tag2, the wavy underline is the extension arm.

[0041] [ka]

[0042] Here, starting from the 5' end, the underline indicates the linker arm, VV indicates mask sequence 1, and the double underline indicates Illumina (Registered Trademark) Tag1, dotted underline indicates Illumina (Registered Trademark)Tag2, NNNNNNNNNNNN is UID sequence 2, and the wavy underline is the extension arm.

[0043] [ka]

[0044] Here, starting from the 5' end, the underline indicates the linker arm, VBD indicates mask sequence 1, NNN indicates UID sequence 1, and the double underline indicates Illumina (Registered Trademark) Tag1, dotted underline indicates Illumina (Registered Trademark) Tag2, NNN are UID sequence 2, BDB are mask sequence 2, and the wavy underline indicates the extension arm.

[0045] [ka]

[0046] Here, starting from the 5' end, the underline indicates the linker arm, B indicates mask sequence 1, NNNNN indicates UID sequence 1, and the double underline indicates Illumina (Registered Trademark) Tag1, dotted underline indicates Illumina (Registered Trademark) Tag2, NNNNN is UID sequence 2, H is mask sequence 2, and the wavy underline is the extension arm.

[0047] The experimental group 2 probe sequences are as follows:

[0048] [ka]

[0049] Here, starting from the 5' end, the underline indicates the linker arm, NNNNNNNNNNNN is the UID sequence 1, and the double underline indicates the Illumina (Registered Trademark) Tag1, dU is deoxyuracil, dotted underline is Illumina (Registered Trademark) Tag2, the wavy underline is the extension arm.

[0050] [ka]

[0051] Here, starting from the 5' end, the underline indicates the linker arm, VV indicates mask sequence 1, and the double underline indicates Illumina (Registered Trademark) Tag1, dU is deoxyuracil, dotted underline is Illumina (Registered Trademark) Tag2, NNNNNNNNNNNN is UID sequence 2, and the wavy underline is the extension arm.

[0052] [ka]

[0053] Here, starting from the 5' end, the underline indicates the linker arm, VBD indicates mask sequence 1, NNN indicates UID sequence 1, and the double underline indicates Illumina (Registered Trademark) Tag1, dU is deoxyuracil, dotted underline is Illumina (Registered Trademark) Tag2, NNN are UID sequence 2, BDB are mask sequence 2, and the wavy underline indicates the extension arm.

[0054] [ka]

[0055] Here, starting from the 5' end, the underline indicates the linker arm, B indicates mask sequence 1, NNNNN indicates UID sequence 1, and the double underline indicates Illumina (Registered Trademark) Tag1, dU is deoxyuracil, dotted underline is Illumina (Registered Trademark) Tag2, NNNNN is UID sequence 2, DBH is mask sequence 2, and the wavy underline is the extension arm.

[0056] The hybridization reaction system is as follows: Purified water 6μL; 2 μL of 50 ng / μL HCT15 cell line DNA; 3I10 -3 An equal mixture of μM P01-04 or P05-08 probes 1 μL; 10IAmpligase Buffer (Epicentre) 1μL.

[0057] The process is to denature at 95°C for 5 minutes and incubate at 60°C for 2 hours; then add the following reagents to the above hybridization product to carry out extension and ligation reaction, and the reaction process is to incubate at 60°C for 1 hour; Purified water 1.4μL; 1 mM dNTPs (NEB) 1 μL; 5 U / μL Ampligase DNA ligase (Epicentre) 1 μL; 10IAmpligase Buffer (Epicentre) 0.5 μL; 50mM NAD + (NEB) 0.1μL; Phusion® High-Fidelity DNA Polymerase (NEB) 1 μL.

[0058] The excess probe and DNA are digested with exonuclease. The following reagents are then added to the above product: Exonuclease I (NEB) 0.5 μL; Exonuclease III (NEB) 0.5μL.

[0059] Incubation was performed at 37°C for 40 minutes and at 95°C for 5 minutes.

[0060] To cleave the circular products containing dU structures into linear single strands, the USER enzyme was added to the PCR reaction.

[0061] 2I iProof HF Master Mix(Bio-Rad) 50 μL; Purified water 29μL; 2 μL of 20 μM tag1 primer; 2 μL of 20 μM Tag2 primer; USER Enzyme (NEB) 1 μL

[0062] [ka]

[0063] Here, the sequences underlined with wavy lines are Illumina (Registered Trademark) A sequence segment on the 5-terminal adaptor of the TruSeq Reagent Kit, and an Illumina (Registered Trademark) Tag2 is the deletion of 0-19 bases from the 5' end of this sequence segment. Double underlining indicates Illumina (Registered Trademark) The sequence cannot be changed because it is used to generate clusters during sequencing. The underlined part is an even index sequence, and the sequence can be changed. The Illumina (Registered Trademark) One sequence segment of Nextera Transposase Adapters Read 2 is an Illumina (Registered Trademark) It is a reverse complement pair with Tag1.

[0064] The tagged primer sequences were used for PCR amplification of the circularized products, and the Tag1 and Tag2 sequences were identified by Illumina (Registered Trademark) If you replace the transposon adapters in the library preparation kit with other transposon adapter sequences, or other combinations, you will need to change the sequences at the underlined and wavy / dotted positions accordingly.

[0065] 26 cycles were performed, each cycle consisting of incubation at 37°C for 15 minutes, pre-denaturation at 98°C for 30 seconds, denaturation at 98°C for 10 seconds, annealing at 58°C for 30 seconds, and extension at 72°C for 30 seconds; extension at 72°C for 2 minutes and incubation at 4°C.

[0066] After amplification, the libraries were purified using Agencourt AMPure XP magnetic beads. The libraries were then subjected to quality control and purified using Illumina (Registered Trademark) Loaded into sequencer and sequenced.

[0067] [Table 1]

[0068] From Table 1, it can be seen that the template recovery rate of the dU structure-containing probe is almost the same as that of the non-dU structure-containing probe, but the library yield can be significantly improved.

[0069] [Example 2] Enrichment of target regions by MIP probe library with optimized melting temperature (Tm) values ​​of linker and extension arms The probe sequences are as follows:

[0070] P09: Based on P5, a phosphorothioate modification was made between the last three bases at its 3' end.

[0071] P10: Based on P6, a phosphorothioate modification was made between the last three bases at its 3′ end.

[0072] P11: Based on P7, a phosphorothioate modification was made between the last three bases at its 3' end.

[0073] P12: Based on P8, a phosphorothioate modification was made between the last three bases at its 3' end.

[0074] The PCR primer sequences are the same as in Example 1, i.e., the primer sequence with tag1 is the same as the primer sequence with tag1 in Example 1; the primer sequence with tag2 here is the same as the primer sequence with tag2 in Example 1.

[0075] In this example, the Tm value of the linker arm during the design of the probe was more than 2°C higher than that of the extension arm, and the extension arm was modified with phosphorothioate. The experiment was divided into two groups, the control group used the P05-P08 probes, and the optimization group used the optimized P09-P12 probes. The specific steps are as follows:

[0076] 1. The hybridization, extension and ligation reactions are shown in Table 3.

[0077] [Table 2]

[0078] The reaction process was 95°C for 5 minutes and 60°C for 3 hours.

[0079] 2. The following reagents were further added to the above reaction system to carry out the enzymatic cleavage reaction, and the reaction process was incubation at 37°C for 40 minutes and incubation at 95°C for 5 minutes.

[0080] Exonuclease I (NEB) 0.5 μL; Exonuclease III (NEB) 0.5 μL; Exonuclease Lambda (NEB) 0.5μL; 3. The following reagents were added to the above reaction system to linearize the product and amplify it by PCR.

[0081] 2I iProof HF Master Mix (Bio-Rad) 50μL; Purified water 34μL; 2 μL of 20 μM tag1 primer; 2 μL of 20 μM Tag2 primer; USER Enzyme (NEB) 1 μL

[0082] The primer sequence with tag 1 here is the same as the primer sequence with tag 1 in Example 1; the primer sequence with tag 2 here is the same as the primer sequence with tag 2 in Example 1.

[0083] Reaction process: 26 cycles were performed, each cycle consisting of incubation at 37°C for 15 minutes, pre-denaturation at 98°C for 30 seconds, denaturation at 98°C for 10 seconds, annealing at 58°C for 30 seconds, and extension at 72°C for 30 seconds; extension at 72°C for 2 minutes and incubation at 4°C.

[0084] 4. After amplification, the library was purified using Agencourt AMPure XP magnetic beads. The library was then quality controlled and purified using Illumina (Registered Trademark) The DNA was loaded onto a sequencer and sequenced. The analysis results are shown in Table 4.

[0085] [Table 3]

[0086] From Table 4, it can be seen that using the method of this example, the library yield and template recovery rate of the optimized group are significantly higher than that of the control group.

[0087] [Example 3] Improved process for enriching target regions with MIP schemes In this example, the optimization process involved adding the enzyme cleavage reagent and PCR reagent to the reaction tube at the same time. The hybridization reaction system was as follows:

[0088] Purified water 6μL; 2 μL of 50 ng / μL HCT15 cell line DNA; 3I10 -3 1 μL of an equal mixture of μM P05-08 probes; 10IAmpligase Buffer (Epicentre) 1μL.

[0089] The process was denatured at 95° C. for 5 minutes and incubated at 60° C. for 2 hours. The following reagents were then added to the hybridization product to carry out extension and ligation reactions, and the reaction process was incubated at 60° C. for 1 hour.

[0090] Purified water 1.4μL 1 mM dNTPs (NEB) 1 μL; 5U / μL Ampligase DNA ligase (Epicentre) 1 μL; 10IAmpligase Buffer (Epicentre) 0.5 μL; 50mM NAD + (NEB) 0.1μL; Phusion® High-Fidelity DNA Polymerase (NEB) 1 μL.

[0091] Excess probe and DNA were digested with exonuclease before PCR amplification. The following reagents were added to the above product. The reaction process consisted of 26 cycles of incubation at 37°C for 40 minutes, incubation at 95°C for 5 minutes, pre-denaturation at 98°C for 30 seconds, denaturation at 98°C for 10 seconds, annealing at 58°C for 30 seconds, and extension at 72°C for 30 seconds; extension at 72°C for 2 minutes, and incubation at 4°C.

[0092] Exonuclease Lambda 0.5 μL; Exonuclease III 1 μL; 2I iProof HF Master Mix(Bio-Rad) 50 μL; HO 29.5μL; 2 μL of 20 μM Tag3 primer; 2 μL of 20 μM Tag4 primer.

[0093] [ka]

[0094] The primer sequence with tag 3 was modified with phosphorothioate at the 5' end based on the primer with tag 1, and the primer sequence with tag 4 was modified with phosphorothioate at the 5' end based on the primer with tag 2.

[0095] After amplification, the library was purified using Agencourt AMPure XP magnetic beads. The library was then subjected to quality control and purified using Illumina (Registered Trademark) The mixture was loaded onto a sequencer and sequenced. The library yield was 58.5ng, and the template recovery rate was 22.4%, demonstrating that the mixing scheme of enzyme cleavage reagents and PCR reagents is feasible and simplifies the operation process.

[0096] [Example 4] Improved process MIP scheme to enrich target regions against RNA templates The probe sequence in this example is as follows:

[0097] [ka]

[0098] Here, starting from the 5' end, the underlines indicate the linker arm, HVD indicates mask sequence 1, NNNNN indicates UID sequence 1, and the double underlines indicate Illumina (Registered Trademark) Tag1, dU is deoxyuracil, dotted underline is Illumina (Registered Trademark) Tag2, NNNNN is UID sequence 2, HHH is mask sequence 2, and the wavy underline is the extension arm.

[0099] [ka]

[0100] Here, starting from the 5' end, the underlines indicate the linker arm, HVD indicates mask sequence 1, NNNNN indicates UID sequence 1, and the double underlines indicate Illumina (Registered Trademark) Tag1, dU is deoxyuracil, dotted underline is Illumina (Registered Trademark) Tag2, NNNNN is UID sequence 2, BBB is mask sequence 2, and the wavy underline is the extension arm.

[0101] In this example, two probes targeting human EML4-ALK (-echinoderm microtubule-associated protein-like 4-anaplastic lymphoma kinase) fusion gene were used. The hybridization reaction conditions are as follows:

[0102] Nuclease-free water (NEB) 5.5 μL; 2 μL of 50 ng / μL H3122 cell line RNA; 3I10 -3 1 μL of an equal mixture of μM P13-14 probes; RNase Inhibitor (TaKaRa) 0.5μL; 10IAmpligase Buffer (Epicentre) 1μL.

[0103] The process consisted of denaturing at 70° C. for 2 minutes and incubating at 65° C. for 2 hours. The following reagents were then added to the hybridization product, and the reaction process was: extension at 42° C. for 1 hour, followed by ligation reaction.

[0104] 1 mM dNTPs (NEB) 1 μL; 5U / μL Ampligase DNA ligase (Epicentre) 1 μL; 10IAmpligase Buffer (Epicentre) 1 μL; 50mM NAD + (NEB) 0.1μL; 5I First-Strand Buffer(TaKaRa) 4 μL; 100mM DTT (TaKaRa) 2μL; SMART MMLV RT(TaKaRa) 1μL.

[0105] The excess probe, RNA, and RNA on the DNA-RNA hybrid strand were digested with exonucleases and endoribonucleases before PCR amplification.

[0106] The following reagents were added to the above product. The reaction process consisted of 27 cycles of incubation at 37°C for 60 minutes, incubation at 95°C for 5 minutes, pre-denaturation at 98°C for 30 seconds, denaturation at 98°C for 10 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 30 seconds; extension at 72°C for 2 minutes, and incubation at 4°C.

[0107] Exonuclease I 1 μL; RNase A 0.1 μL; RNase H 0.1 μL; 2I iProof HF Master Mix(Bio-Rad) 50 μL; HO 24.8μL; 2 μL of 20 μM tag1 primer; 2 μL of 20 μM Tag2 primer

[0108] The primer sequence with tag 1 here is the same as the primer sequence with tag 1 in Example 1; the primer sequence with tag 2 here is the same as the primer sequence with tag 2 in Example 1.

[0109] After amplification, the library was purified using Agencourt AMPure XP magnetic beads. The library was then subjected to quality control and purified using Illumina (Registered Trademark)The results are shown in Table 5.

[0110] [Table 4]

[0111] Experimental groups 1 to 3 were three replicates. From Table 5, the mapping rate of the library sequencing results was more than 95% and the coverage was 100%, indicating that the improved process MIP scheme can enrich the target region using RNA as the template.

[0112] The above examples are only used to explain the technical means of the present invention, and are not limited to them. The present invention is described in detail with reference to the preferred embodiments, but it should be understood that those skilled in the art can make modifications or substitutions within the equivalent range to the technical means without departing from the spirit and scope of the technical means of the present invention, and all of them should be covered by the claims of the present invention.

Claims

1. The sequence from the 5' end is a linker arm, a mask sequence 1, a UID sequence 1, a Tag1 sequence, a Tag2 sequence, a mask sequence 2, and an extension arm, and the UID sequence 1 is composed of 3 to 12 random bases; the mask sequence 1 is composed of 1 to 3 random bases that are not complementary to a sequence upstream of the template corresponding to the linker arm; and the mask sequence 2 is composed of 1 to 3 random bases that are not complementary to a sequence downstream of the template corresponding to the extension arm, the Tag1 sequence is the sequence 5'-CTGTCTCTTATACACATCTCCGAGCCCACGAGAC-3', where the 3' end of the sequence can be reduced by 0 to 16 bases; the Tag2 sequence is the sequence 5'-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3', where the 5' end of the sequence can be reduced by 0 to 19 bases; the linker arm is a 15-45 bp base sequence that binds complementarily to a nucleic acid template; The extension arm is a 15-45 bp base sequence that complementarily binds to a nucleic acid template, forming a sequencing probe.

2. The sequence from the 5' end is a linker arm, a mask sequence 1, a Tag1 sequence, a Tag2 sequence, a UID sequence 2, a mask sequence 2, and an extension arm, and the UID sequence 2 is composed of 3 to 12 random bases; the mask sequence 1 is composed of 1 to 3 random bases that are not complementary to a sequence upstream of the template corresponding to the linker arm; and the mask sequence 2 is composed of 1 to 3 random bases that are not complementary to a sequence downstream of the template corresponding to the extension arm, the Tag1 sequence is the sequence 5'-CTGTCTCTTATACACATCTCCGAGCCCACGAGAC-3', where the 3' end of the sequence can be reduced by 0 to 16 bases; the Tag2 sequence is the sequence 5'-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3', where the 5' end of the sequence can be reduced by 0 to 19 bases; the linker arm is a 15-45 bp base sequence that binds complementarily to a nucleic acid template; The extension arm is a 15-45 bp base sequence that complementarily binds to a nucleic acid template, forming a sequencing probe.

3. the order being, from the 5' end, a linker arm, mask sequence 1, UID sequence 1, Tag1 sequence, Tag2 sequence, UID sequence 2, mask sequence 2, and extension arm; each of the UID sequence 1 and UID sequence 2 is composed of 3 to 12 random bases; the mask sequence 1 is 1 to 3 random bases that are not complementary to a sequence upstream of the template corresponding to the linker arm; and the mask sequence 2 is 1 to 3 random bases that are not complementary to a sequence downstream of the template corresponding to the extension arm, the Tag1 sequence is the sequence 5'-CTGTCTCTTATACACATCTCCGAGCCCACGAGAC-3', where the 3' end of the sequence can be reduced by 0 to 16 bases; the Tag2 sequence is the sequence 5'-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3', where the 5' end of the sequence can be reduced by 0 to 19 bases; the linker arm is a 15-45 bp base sequence that binds complementarily to a nucleic acid template; The extension arm is a 15-45 bp base sequence that complementarily binds to a nucleic acid template, forming a sequencing probe.

4. A probe described in any one of claims 1 to 3, characterized in that a dU region consisting of 1 to 3 deoxyuracil bases is present between the Tag1 sequence and the Tag2 sequence.

5. the extension arm is modified; Alternatively, the probe according to any one of claims 1 to 4, wherein the 5' end of the linker arm is modified by phosphorylation.

6. The probe according to claim 5 , wherein the extension arm is modified with phosphorothioate.

7. The probe according to claim 6 , wherein the Tm value of the linker arm is at least 2° C. higher than the Tm value of the extension arm.

8. A method for enriching a target region which is applied to high-throughput sequencing, characterized by using a probe according to any one of claims 1 to 4.

9. a hybridization, extension and ligation reaction step in which the template DNA is hybridized, extended and ligated with the probe to obtain a first product; a second product obtaining step of enzymatically cleaving and digesting the excess probe and template DNA and PCR amplifying the second product using tagged primers; a purification step of purifying the second product to obtain a library; loading the library into a sequencer for sequencing; The method for enriching a target region that is applicable to high-throughput sequencing according to claim 8, comprising:

10. The method according to claim 9, characterized in that in the hybridization, extension and ligation reaction steps, the template DNA and the probe according to any one of claims 1 to 4 are hybridized first, and then polymerase and ligase are added to carry out extension and ligation to obtain a first product.

11. The reaction system and reaction process of the hybridization, extension and ligation reactions are as follows when the template is DNA: Purified water 6μL; 2 μL of 50 ng / μL template DNA; 3×10 －３ 1 μL of the probe according to any one of claims 1 to 4; 10×Ampligase Buffer 1μL; The process is to denature at 95°C for 5 minutes and incubate at 60°C for 2 hours; then add the following reagents to the reaction system to carry out the extension and ligation reaction, and the reaction process is to incubate at 60°C for 1 hour; Purified water 1.4μL; 1μL of 1mM dNTPs; 5U / μL Ampligase DNA ligase 1μL; 10x Ampligase Buffer 0.5μL; 50mM NAD+ 0.1μL; Phusion® High-Fidelity DNA Polymerase 1μL; or when the template is RNA, Nuclease-free water 5.5 μL; 2 μL of template RNA at 50 ng / μL; 3×10 －３ 1 μL of the probe at μM; RNase Inhibitor 0.5μL; 10×Ampligase Buffer 1μL; After denaturation at 70°C for 2 minutes and incubation at 65°C for 2 hours, 1 μL of 1 mM dNTPs; 5U / μL Ampligase DNA ligase 1μL; 10×Ampligase Buffer 1μL; 50 mM NAD+ 0.1 μL; 5× First-Strand Buffer 4μL; 2 μL of 100 mM DTT; SMART MMLV RT 1μL; The method according to claim 10, characterized in that the above reagent is added and reacted at 42°C for 1 hour to carry out the extension and ligation reactions.

12. The method according to claim 9, wherein the hybridization, extension and ligation reaction step comprises simultaneously adding a template DNA, the probe according to any one of claims 1 to 4, a polymerase and a ligase, and simultaneously carrying out hybridization, extension and ligation to obtain a first product.

13. The reaction system and reaction process of the hybridization, extension and ligation reactions are as follows: Purified water 3.4μL; 2 μL of 50 ng / μL template DNA; 3×10 －３ 1 μL of the probe at μM; 1μL of 1mM dNTPs; 5U / μL Ampligase DNA ligase 1μL; 10×Ampligase Buffer 1μL; 50mM NAD+ 0.1μL; Phusion® HiFi DNA Polymerase 0.5 μL; The reaction process is 95°C for 5 minutes and 60°C for 3 hours.

13. The method according to claim 12.

14. 10. The method of claim 9, wherein the second product obtaining step comprises first digesting the excess probe and template DNA with an exonuclease, then linearizing the first product with USER Enzyme, and then PCR amplifying the first product with tagged primers to obtain a second product.

15. The reaction system and reaction process for obtaining the second product are as follows: First product Exonuclease I 0.5μL; Exonuclease III 0.5μL; Incubate at 37°C for 40 minutes, then incubate at 95°C for 5 minutes; Add the following reagents: 2× iProof HF Master Mix 50μL; Purified water 29μL; 2 μL of 20 μM tagged upstream primer; 2 μL of 20 μM tagged downstream primer; USER Enzyme 1 μL; The method according to claim 14, characterized in that 26 cycles are performed, each cycle consisting of incubation at 37°C for 15 minutes, pre-denaturation at 98°C for 30 seconds, denaturation at 98°C for 10 seconds, annealing at 58°C for 30 seconds, and extension at 72°C for 30 seconds; extension at 72°C for 2 minutes, and incubation at 4°C.

16. The step of obtaining a second product includes simultaneously adding an exonuclease, a tagged upstream primer and a tagged downstream primer, and simultaneously performing enzymatic cleavage / digestion, linearization and PCR amplification to obtain a second product; The method according to claim 9, characterized in that the 3' ends of the tagged upstream primer and the tagged downstream primer are modified with phosphorothioate and the 5' ends are modified with phosphorothioate, amino or a Spencer arm to prevent cleavage by exonuclease.

17. The reaction system and reaction process for obtaining the second product are as follows: First product 18 μL; Exonuclease Lambda 0.5μL; Exonuclease III 1μL; 2× iProof HF Master Mix 50μL; H ２ O 29.5μL; 2 μL of 20 μM tagged upstream primer; 2 μL of 20 μM tagged downstream primer; The reaction process was as follows: incubation at 37°C for 40 minutes, incubation at 95°C for 5 minutes, pre-denaturation at 98°C for 30 seconds, denaturation at 98°C for 10 seconds, annealing at 58°C for 30 seconds, and extension at 72°C for 30 seconds; 26 cycles were performed; extension at 72°C for 2 minutes, and incubation at 4°C; Alternatively, the reaction system and reaction process when the template is RNA are as follows: First product 10.1 μL; Exonuclease I 1μL; RNase A 0.1μL; RNase H 0.1μL; 2× iProof HF Master Mix 50μL; H ２ O 24.8μL; 2 μL of 20 μM tagged upstream primer; 2 μL of 20 μM tagged downstream primer; Incubation at 37°C for 60 minutes, incubation at 95°C for 5 minutes, pre-denaturation at 98°C for 30 seconds, denaturation at 98°C for 10 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 30 seconds were performed for 27 cycles; extension at 72°C for 2 minutes and incubation at 4°C.

17. The method according to claim 16.

18. The upstream primer structure in the tagged primer starts from the 5' end and includes a sequence region used for cluster generation during sequencing, an index sequence region, and a paired full-length sequence region that is reverse-complementary to the Tag1 sequence; The downstream primer structure in the tagged primer starts from the 5' end and includes a sequence region used for cluster generation during sequencing, an index sequence region, and the Tag2 full-length sequence region.

10. The method according to claim 9.

Images