Composition for promoting olfactory receptor expression

Abstract

To provide a composition for promoting olfactory receptor expression.SOLUTION: A composition for promoting olfactory receptor expression has one or more amino acid selected from gamma-aminobutyric acid (GABA), L-citrulline, L(-)-phenylalanine, L-arginine, L-alanine, L- asparagine, L-aspartic acid and L-cysteine as an active ingredient.SELECTED DRAWING: Figure 1

Description

[Technical field]

[0001] The present invention relates to a composition for promoting olfactory receptor expression. [Background technology]

[0002] Olfactory receptors have been discovered as G protein-coupled receptors in olfactory cells (olfactory receptor neurons). In vertebrates, these proteins are located in the olfactory epithelium, and in insects, they are known to be important receptors for detecting odors. In recent years, it has been confirmed that olfactory receptors are also present in various tissue cells, such as skin and sperm. It is now believed that olfactory receptors are present throughout the body, expressed as a variety of different cell-type receptors (OR family), and regulate physiological cell functions other than olfaction. However, the complete picture has yet to be elucidated. OR2AT4, a member of the olfactory receptor family, is known to stimulate the proliferation of keratinocytes in the skin. In particular, it has been shown that the epithelium of human hair follicles, especially the outer root sheath, expresses OR2AT4, and that coadministration of the specific OR2AT4 antagonist Phenirat® with OR2AT4 inhibits hair growth (Non-Patent Document 1).

[0003] In addition, olfactory receptors present throughout the body are also involved in immune activation. Patent Document 1 describes that the synthetic substances Sandalore (registered trademark) and Brahmanol (registered trademark), which are known compounds, promote wound healing by promoting the expression and secretion of interleukin IL-1α through activation of the OR2AT4 receptor. Patent Document 2 discloses an invention in which a compound that selectively binds to or selectively changes the expression of multiple olfactory receptors, such as olfactory receptor family 1, 2, or 51, is used as a therapeutic agent for cancer, autoimmune disease, infectious disease, graft-versus-host disease, etc. The compound of the invention disclosed in Patent Document 2 binds to olfactory receptors or controls the expression of olfactory receptors, thereby regulating pathological cellular cytotoxic T cell (CTL) responses and activating or normally controlling immunity.

[0004] Patent Document 3 describes a skin immune function regulator containing a fragrance as an active ingredient. It is shown that the fragrance contained in this skin immune function regulator has an effect of stimulating skin olfactory receptors. In this way, it is thought that an olfactory receptor expression promoter can be used as a treatment or improvement agent for cancer, autoimmune disease, infectious disease, organ transplantation, etc. On the other hand, amino acids are known to be the smallest units that make up proteins and have various physiological activities, but it was not known that amino acids promote the expression of olfactory receptors. [Prior art documents] [Patent documents]

[0005] [Patent Document 1] Special Publication No. 2017-518324 [Patent Document 2] Special Publication No. 2016-535060 [Patent Document 3] JP 2003-206237 A [Non-patent literature]

[0006] [Non-Patent Document 1] NATURE COMMUNICATIONS (2018)9:3624 DOI:10.1038 / s41467-018-05973-0 www.nature.com / naturecommunications Summary of the Invention [Problem to be solved by the invention]

[0007] The present invention aims to provide a composition for promoting the expression of olfactory receptors, which contains as an active ingredient one or more amino acids selected from gamma-aminobutyric acid (GABA), L-citrulline, L(-)-phenylalanine, L-arginine, L-alanine, L-asparagine, L-aspartic acid, and cysteine. [Means for solving the problem]

[0008] The present invention has the following configuration. (1) A composition for promoting olfactory receptor expression, comprising as an active ingredient one or more amino acids selected from gamma aminobutyric acid (GABA), L-citrulline, L(-)-phenylalanine, L-arginine, L-alanine, L-asparagine, L-aspartic acid, and L-cysteine. (2) A composition for promoting olfactory receptor expression described in (1), wherein the olfactory receptor is OR2AT4 and / or OR51B5. Effect of the Invention

[0009] The present invention provides a composition for promoting olfactory receptor expression, which contains as an active ingredient one or more amino acids selected from gamma aminobutyric acid (hereinafter referred to as "GABA"), L-citrulline, L(-)-phenylalanine, L-arginine, L-alanine, L-asparagine, L-aspartic acid, and L-cysteine. [Brief description of the drawings]

[0010] [Figure 1] 1 is a graph showing the results of testing the olfactory receptor expression promoting effect of GABA in Test Example 2. [Diagram 2] 1 is a graph showing the results of a test on the olfactory receptor expression promoting effect of L-citrulline in Test Example 2. [Diagram 3] 1 is a graph showing the results of a test on the olfactory receptor expression promoting effect of L-(-)phenylalanine in Test Example 2. [Figure 4]1 is a graph showing the results of a test on the olfactory receptor expression promoting effect of L-arginine in Test Example 2. [Diagram 5] 1 is a graph showing the results of testing the olfactory receptor expression promoting effect of L-alanine in Test Example 2. [Figure 6] 1 is a graph showing the results of a test on the olfactory receptor expression promoting effect of L-asparagine in Test Example 2. [Figure 7] 1 is a graph showing the results of a test on the olfactory receptor expression promoting effect of L-aspartic acid in Test Example 2. [Figure 8] 1 is a graph showing the results of a test on the olfactory receptor expression promoting effect of L-cysteine ​​in Test Example 2. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0011] The composition of the present invention refers to one or more amino acids selected from GABA, L-citrulline, L(-)-phenylalanine, L-arginine, L-alanine, L-asparagine, L-aspartic acid, and L-cysteine. The composition of the present invention also includes those containing optional ingredients.

[0012] The above amino acids may be in the form of their salts. The salts may be any pharma- ceutically acceptable salts. Examples of the salts include alkali metal salts such as potassium salts and sodium salts; alkaline earth metal salts such as calcium salts, barium salts and magnesium salts; ammonium salts such as ammonium salts and tricyclohexylammonium salts; and alkanolamine salts such as monoethanolamine salts, diethanolamine salts, triethanolamine salts, monoisopropyl alcoholamine salts, diisopropyl alcoholamine salts and triisopropyl alcoholamine salts.

[0013] The method for producing amino acids is not particularly limited. For example, synthesis, extraction, enzymatic and fermentation methods can be used. In addition, a method for optically resolving a racemic mixture of D,L-amino acids can also be used. The optical resolution method is not particularly limited.

[0014] The composition of the present invention refers to one that contains at least one of the above amino acids. The lower limit of the suitable content of one or more amino acids selected from GABA, L-citrulline, L(-)-phenylalanine, L-arginine, L-alanine, L-asparagine, L-aspartic acid and L-cysteine, calculated as the total amount, is usually 0.001% by mass or more, preferably 0.01% by mass or more. The upper limit is usually 30% by mass or less, preferably 10% by mass or less. EXAMPLES

[0015] The present invention will be specifically described below with reference to test examples. <<Test Example 1>> <Primary screening of amino acids that promote olfactory receptor gene expression> We screened for amino acids that have the effect of promoting the expression of OR2AT4 and / or OR51B5. 1. Test Method (1) Cells for testing and culture methods Normal human epidermal keratinocytes (Neo) (Thermo Fisher Scientific) (NHEK) were cultured in EpiLife (registered trademark) Medium with 60 μM Calcium (Life Technologies Japan) solution supplemented with Humedia-KG2 growth additive (Kurabo). When the cells became 80-90% confluent, they were detached with 0.017% Trypsin / 0.007% EDTA (0.05% Trypsin / 0.02% EDTA (Sigma) diluted 3-fold with PBS), resuspended, and the cell number was counted. 1×10 in a 12-well plate 5 The cells were reseeded at 37°C / well and cultured overnight in a 5% CO2 incubator, and the test sample (amino acid) was added the next day.

[0016] (2) RNA extraction method and RT-PCR method The supernatant of the cells (after 24 hours) to which amino acids of each concentration had been added was removed and washed with PBS(-). 300 μl / well of RNAiso (Takara) was added, and the cells were disrupted by thorough pipetting. This cell homogenized solution was collected in a 1.5 ml tube. 60 μl of chloroform was added, and the cells were shaken well and left to stand at room temperature for 5 minutes. The mixture was then centrifuged at 12,000×g for 15 minutes at 4° C., and the upper layer of the separated aqueous phase (RNA portion) was transferred to a new test tube. An additional 300 μl of isopropanol was added, mixed thoroughly, and allowed to stand at room temperature for 10 minutes. Next, RNA was precipitated by centrifugation at 12,000×g for 10 minutes at 4° C. The supernatant was discarded, and 300 μl of 75% cold ethanol was added, stirred with a vortex mixer, and centrifuged at 7,500×g for 5 minutes at 4° C. The supernatant was discarded, the mixture was dried at room temperature for several minutes, and then dissolved in 15 μl of RNase-free water to recover total RNA. Using NanoDrop 2000C (Thermo Scientific), RNA was quantified and the concentration was adjusted, reverse transcription was performed according to the protocol of PrimeScript (registered trademark) RT reagent Kit (Takara Bio), and real-time PCR was performed using LightCycler (registered trademark) 480 (Roche) after adjustment using SYBR (registered trademark) Premix Ex Taq (trademark) II (Tli RNaseH Plus) (Takara Bio). The Cp value of each gene was compared relative to the Cp value of the GAPDH gene.

[0017] Primer for Hs_OR2AT4_mRNA (TAKARA) Reverse: GTAGTAGGTGCCCACGACCAGAA (SEQ ID NO: 1), Forward: CTATGTCCACATCCTGGCCTCA (SEQ ID NO: 2);

[0018] Primer for Hs_OR51B5_mRNA (Invitrogen) Reverse: TTTGCCTATGGCCTGCTACCTAA (SEQ ID NO: 3), Forward: GCCCAGTTGTCTGGCATCTC (SEQ ID NO: 4);

[0019] Primer for Hs_GAPDH_mRNA (Invitrogen) Reverse: TGGTGAAGAGACGCCAGTGGA (SEQ ID NO: 5), Forward: GCACCGTCAAGGCTGAGAAC (SEQ ID NO: 6) were used, respectively.

[0020] (3) Amino acids to be tested The amino acids in Table 1 below were subjected to the experiment.

[0021] [Table 1]

[0022] The effects of the 22 types of amino acids listed in Table 1 above on olfactory receptors were evaluated under the following conditions, and a primary screening was performed. Each amino acid was dissolved in cell culture medium at 0.01% or 0.1% to prepare a test solution, which was then added to the well at 1 ml per well. After culturing for 24 hours in a 37°C, 5% CO2 incubator, the expression changes of olfactory receptor (OR2AT4, OR51B5) mRNA were measured to evaluate the effect of promoting the expression of olfactory receptor genes.

[0023] 2. Test Results When the amino acid concentration was set to 0.01% and 0.1%, changes in mRNA were detected. Table 2 below shows the results of mRNA measurement at an amino acid concentration of 0.01% arranged in order of increasing expression, and Table 3 shows the results of mRNA measurement at an amino acid concentration of 0.1% arranged in order of increasing expression. Amino acids that showed a measured value of 2 or more relative to the measured value (relative value) when no additives were added were marked with an *.

[0024] [Table 2]

[0025] [Table 3]

[0026] We focused on amino acids that showed olfactory receptor OR2AT4 or OR51B5 values ​​of 2 or more at a concentration of 0.01% compared to the value when no amino acids were added. These were eight amino acids: GABA, L-citrulline, L(-)-phenylalanine, L-arginine, L-alanine, L-asparagine, L-aspartic acid, and L-cysteine.

[0027] <<Test Example 2>> <Effective concentration of amino acids> Based on the results of Test Example 1, eight amino acids, namely GABA, L-aspartic acid, L-citrulline, L(-)-phenylalanine, L-asparagine, L-cysteine, L-arginine, and L-alanine, which have a high effect of increasing the mRNA expression of the olfactory receptors OR2AT4 or OR51B5, were tested in more detail and the effective concentration of each amino acid was confirmed using the increased production of mRNA and olfactory receptor protein amounts as indicators. The test concentrations of each amino acid were 0.001%, 0.01%, and 0.1%. The mRNA and protein levels of OR2AT4 and OR51B5 were measured.

[0028] 1. Test Method (1) mRNA measurement After adding amino acids under the same conditions as in Test Example 1, the cells were cultured for 24 hours and the mRNA of olfactory receptors OR2AT4 and OR51B5 was measured. The average and standard deviation were obtained from the measurement results of 3 wells for each concentration. All data were subjected to a significance test against the measurement values ​​of cells without amino acids (t-test, significance level: *p<0.05, **p<0.01, ***p<0.001).

[0029] (2) Measurement of expressed protein amount The amount of expressed olfactory receptor OR2AT4 or OR51B5 protein was measured by Western blotting. The procedure for Western blotting was as follows.

[0030] 1) After adding the amino acids at the above concentrations and culturing for 48 hours, the cells were harvested, washed with PBS(-), and proteins were extracted using cell lysis buffer. 2) The SDS concentration in the extraction solution was adjusted to 2% based on the extracted protein concentration using 0.5 M Tris-HCl buffer (pH 6.8). 3) Protein bands were separated by SDS-PAGE (5-20% gel) (DRC) and transferred to a 0.2 μm PVDF Trans-Blot Turbo Transfer Pack. 4) Blocking was performed at room temperature for 20 minutes using StartingBlock T20 (PBS) and Blocking Buffer (Thermo Scientific). 5) After removing the blocking solution, the sections were replaced with a 1000-fold diluted primary antibody and incubated overnight at 4°C with shaking. The primary antibodies used were anti-rabbit-human OR2AT4 antibody (Abcam), anti-rabbit OR51B5 antibody (Abcam), and anti-mouse β-actin antibody (Santacruz). 6) After the antibody reaction was completed, the plate was washed three times with 0.05% Tween 20-PBS solution, and HRP-Rabbit-IgG (Cell signaling) and HRP-Mouse-IgG (Invitrogen) were diluted 1:10,000 with blocking buffer and reacted at room temperature for 1 hour. 7) After reacting with ECL prime Western blotting detection reagent (GE Healthcare) for 5 minutes, the antibodies were detected using a luminometer image analyzer LAS-4000 mini series (GE Healthcare) and the relative values ​​to β-actin were calculated. 8) The average and standard deviation were obtained from the measurement results of three wells for each concentration. All data were subjected to a significance test against the measurement values ​​of cells without amino acids (t-test, significance level: *p<0.05, **p<0.01, ***p<0.001).

[0031] 2. Test Results The test results are explained below for each added amino acid. (1) GABA The upper part of Figure 1 shows the results of measuring the amount of OR2AT4 mRNA (left graph) and OR51B5 mRNA (right graph) after addition of GABA. The lower part shows the results of measuring the amount of OR2AT4 protein (left graph) and OR51B5 protein (right graph). The addition of GABA promoted gene expression of olfactory receptors, and the expression level of each receptor increased statistically significantly. In other words, GABA promoted gene expression and protein expression of olfactory receptors in a concentration-dependent manner.

[0032] (2) L-Citrulline The upper part of Figure 2 shows the results of measuring the amount of OR2AT4 mRNA (left graph) and OR51B5 mRNA (right graph) after the addition of L-citrulline. The lower part shows the results of measuring the amount of OR2AT4 protein (left graph) and OR51B5 protein (right graph). The addition of L-citrulline promoted gene expression of olfactory receptors, and the expression level of each receptor increased statistically significantly. In other words, L-citrulline promoted gene expression and protein expression of olfactory receptors in a concentration-dependent manner.

[0033] (3) L-(-)-Phenylalanine The upper part of Figure 3 shows the results of measuring the amount of OR2AT4 mRNA (left graph) and OR51B5 mRNA (right graph) after addition of L-(-)-phenylalanine. The lower part shows the results of measuring the amount of OR2AT4 protein (left graph) and OR51B5 protein (right graph). The addition of L-(-)-phenylalanine promoted gene expression of olfactory receptors, and the expression level of each receptor increased statistically significantly. In other words, L-(-)-phenylalanine promoted gene expression and protein expression of olfactory receptors in a concentration-dependent manner.

[0034] (4) L-Arginine The upper part of Figure 4 shows the results of measuring the amount of OR2AT4 mRNA (left graph) and OR51B5 mRNA (right graph) with the addition of L-arginine. The lower part shows the results of measuring the amount of OR2AT4 protein (left graph) and OR51B5 protein (right graph). The addition of L-arginine promoted gene expression of olfactory receptors, and the expression level of each receptor increased statistically significantly. In other words, L-arginine promoted gene expression and protein expression of olfactory receptors in a concentration-dependent manner.

[0035] (5) L-Alanine The upper part of Figure 5 shows the results of measuring the amount of OR2AT4 mRNA (left graph) and OR51B5 mRNA (right graph) with the addition of L-alanine. The lower part shows the results of measuring the amount of OR2AT4 protein (left graph) and OR51B5 protein (right graph). The addition of L-alanine promoted gene expression of olfactory receptors, and the expression level of each receptor increased statistically significantly. In other words, L-alanine promoted gene expression and protein expression of olfactory receptors in a concentration-dependent manner.

[0036] (6) L-Asparagine The upper part of Figure 6 shows the results of measuring the amount of OR2AT4 mRNA (left graph) and OR51B5 mRNA (right graph) by adding L-asparagine. The lower part shows the results of measuring the amount of OR2AT4 protein (left graph) and OR51B5 protein (right graph). The addition of L-asparagine promoted gene expression of olfactory receptors, and the expression level of each receptor increased statistically significantly, but the optimum concentration was 0.01%. In other words, it is thought that L-asparagine has an optimal range for mRNA expression. However, unlike mRNA, olfactory receptor protein expression was promoted in a concentration-dependent manner.

[0037] (7) L-Aspartic Acid The upper part of Figure 7 shows the results of measuring the amount of OR2AT4 mRNA (left graph) and OR51B5 mRNA (right graph) after addition of L-aspartic acid. The lower part shows the results of measuring the amount of OR2AT4 protein (left graph) and OR51B5 protein (right graph). The addition of L-aspartic acid promoted gene expression of olfactory receptors, and the expression level of each receptor increased statistically significantly, with the optimum addition being 0.01%. In other words, it is thought that there is an optimal range for L-aspartic acid in the expression of olfactory receptor mRNA. However, unlike mRNA, the protein expression of olfactory receptors was promoted in a concentration-dependent manner.

[0038] (8) L-Cysteine The upper part of Figure 8 shows the results of measuring the amount of OR2AT4 mRNA (left graph) and OR51B5 mRNA (right graph) with the addition of L-cysteine. The lower part shows the results of measuring the protein ratio of OR2AT4 (left graph) and OR51B5 protein (right graph). The addition of L-cysteine ​​promoted gene expression of olfactory receptors, and the expression level of each receptor increased statistically significantly. In other words, it is considered that there is a concentration-dependent promoting effect on mRNA expression. On the other hand, L-cysteine ​​promoted the protein expression of OR2AT4, but no statistically significant effect was observed on the protein expression of OR51B5.

[0039] From the above test results, it was revealed that the eight amino acids GABA, L-citrulline, L(-)-phenylalanine, L-arginine, L-alanine, L-asparagine, L-aspartic acid, and L-cysteine ​​promote the expression of olfactory receptor genes and olfactory receptor protein in a concentration-dependent manner at concentrations of 0.001% or more. It was also revealed that the optimal concentration is preferably 0.01% or more.

Claims

[Claim 1] A composition for promoting the expression of olfactory receptors OR2AT4 and / or OR51B5, which comprises as an active ingredient one or more amino acids selected from gamma aminobutyric acid (GABA), L-citrulline, L(-)-phenylalanine, L-arginine, L-alanine, L-asparagine, L-aspartic acid, and L-cysteine.

Images