Method for detecting rotavirus genotype and primer set for amplifying genes used therein

Abstract

The present invention aims to provide new gene detection primers that can more accurately detect the genotype of rotavirus A, and a detection means using the same.The present invention provides: (A) a method for detecting the genotype of rotavirus A, using as basic gene amplification sense primers sense primers that match one to four base sequence regions selected from: (1) bases 802-834 (corresponding to G3 type), (2) bases 747-789 (corresponding to equine G3 type), (3) bases 603-636 (corresponding to G9 type), and (4) bases 666-711 (corresponding to G12 type), with bases 174-834 in the base sequence of the VP7 gene segment of the reference strain of rotavirus A G1 type as the base sequence counting standard; and (B) a method for detecting the genotype of rotavirus A, using as common gene amplification antisense primers those that match each of the base sequence regions with bases 883-1062 as the counting standard.The present invention also provides a gene amplification primer set and a genotype detection kit for use in the method.

Description

[Technical field]

[0001] The present invention relates to a means for detecting the genotype of a virus, and more specifically, to a method for detecting the genotype of a rotavirus, in particular rotavirus A, a primer set for gene amplification used therein, and a genotype detection kit containing the primer set. [Background technology]

[0002] Rotaviruses are viruses that cause acute gastroenteritis in various mammals and birds, and belong to the Reoviriade family. There are nine groups (AI) of rotaviruses that do not show serological cross-reactivity for the capsid protein VP6. Of these, the rotavirus that is most frequently detected is rotavirus A (RVA).

[0003] RVA is the leading cause of gastroenteritis in infants and young children worldwide. In 2016, the global death toll from RVA in children under 5 years of age was 128,500 (Troeger JAMA Pediatr. 2018 Aug 13. doi: 10.1001 / jamapediatrics.2018.1960.). RVA is also a major problem in developed countries, including Japan (Nakagomi et al., Jpn J InfectDis 2013, 66(4), 269-275).

[0004] Since RVA is present in sufficient quantities in the feces of patients, a simple immunochromatographic test kit is sufficient for clinical diagnosis, but genotype diagnosis is necessary for molecular epidemiological studies and to investigate changes in genotype prevalence after vaccination.

[0005] Two live attenuated RVA vaccines have already been introduced in Japan (Rotarix: November 2011 and RotaTeq: July 2012). Although the RVA vaccines are effective (Non-Patent Documents 1-4), selective pressure of the vaccine may induce a shift in epidemic strains. Therefore, surveillance of changes in the genotype distribution of RVA is becoming increasingly important. [Prior art documents] [Non-patent literature]

[0006] [Non-Patent Document 1] Lambert et al., Med J Aust 2009, 191(3), 157-160. [Non-Patent Document 2] Leshem et al., Pediatrics 2014, 134(1), 15-23. [Non-Patent Document 3] Karafillakis et al., Vaccine 2015, 33(18), 2097-2107. [Non-Patent Document 4] Fujii et al., BMC Pediatr 2017, 17(1), 156. [Non-Patent Document 5] Gouvea et al., J Clin Microbiol 1990, 28(2), 276-282. [Non-Patent Document 6] Mitui et al., Virol J 2012, 9, 144 DISCLOSURE OF THEINVENTION [Problem to be solved by the invention]

[0007] As a means of surveillance of the genotype distribution of rotavirus A (RVA), a genotype-specific detection method based on the analysis of gene amplification products obtained by gene amplification methods such as PCR is used. In particular, a nested PCR method is used in which the gene amplification products of RVA in a sample obtained by the first stage RT-PCR are further subjected to a second stage PCR using RVA genotype-specific primers to amplify the RVA genotype-specific genes. As gene amplification primers used in this second stage PCR, the VP7 primer set reported by Gouvea et al. in 1990 is still used worldwide (Non-Patent Document 5). However, since the primer sequence has hardly been improved to date, it has been reported that there are genotypes for which the RVA strain is misidentified by this primer set (Mitui et al., Virol J 2012, 9, 144). As mentioned above, the epidemic strain is changing due to the vaccination of RVA vaccines, and it is necessary to provide new gene detection primers that can more accurately detect the RVA genotype. [Means for solving the problem]

[0008] As a result of investigations aimed at solving the above-mentioned problems, the inventors have discovered small regions of the RVA gene, together with their corresponding RVA genotypes, for which it is possible to design gene amplification primers that are highly specific for each RVA genotype, i.e., that can accurately detect the RVA genotype in a sample without cross-reacting with genotypes other than the desired genotype and without causing erroneous judgment, when detecting the RVA genotype using a gene amplification method such as PCR, and have succeeded in providing a method for detecting the RVA genotype using the gene amplification primers, and a primer set for detecting the gene.

[0009] The present invention includes (1) an RVA genotype detection method (also referred to as the detection method of the present invention), (2) a gene amplification primer set for use in the detection method (also referred to as the primer set of the present invention), and (3) an RVA genotype detection kit comprising the primer set (also referred to as the kit of the present invention).

[0010] <Detection method of the present invention> The detection method of the present invention is a method for detecting the genotype of rotavirus using the following "sense primer (A)" and "common antisense primer (B)".

[0011] The sense primer (A) is (A) The base sequence count is based on the 174th to 834th bases of the plus strand of the double-stranded RNA or its complementary DNA of the VP7 gene segment (segment 9) of the reference strain (Wa strain / K02033) of the G1 type of rotavirus A. (1) one or more sense primers that hybridize to the minus strand of the double-stranded RNA of the VP7 gene segment of the reference strain (AU-1 / D86271) of rotavirus A G3 type (human rotavirus) or its complementary DNA base sequence from base 802 to 834 (number of the plus strand); (2) one or more sense primers that hybridize to the minus strand of the double-stranded RNA of the VP7 gene segment of the reference strain (S13-30 / KJ639017) of rotavirus A equine G3 type (equine rotavirus) or its complementary DNA base sequence from base 747 to 789 (plus strand numbering); (3) one or more sense primers that hybridize to the minus strand of the 603rd to 636th bases (plus strand numbering) of the double-stranded RNA or its complementary DNA of the VP7 gene segment of the G9 type strain of rotavirus A (B3458 / EF990708); (4) one or more sense primers that hybridize to the minus strand of the 666th to 711th bases (plus strand numbering) of the double-stranded RNA or its complementary DNA of the VP7 gene segment of the G12 type strain of rotavirus A (Dhaka25 / DQ146654); and The common antisense primer (B) is (B) One or more common antisense primers selected from the group consisting of primers that hybridize to the positive strand of the reference strain of rotavirus A described in (1)-(4) above, each of which matches the region of the base sequence from base 883 to base 1062 of the positive strand of the reference strain of the G1 type as the counting standard.

[0012] The detection method of the present invention is a detection method for detecting the genotype of rotavirus using a gene amplification product obtained by applying a gene amplification means using the above-mentioned sense primer (A) and common antisense primer (B) as gene amplification primers to a gene obtained from a sample.

[0013] In the detection method of the present invention, in addition to the above (1)-(4), 1 to 4 types selected from the following (5)-(8) can be additionally used as sense primer (A) (hereinafter, these are also referred to as "additional sense primers"). (5) one or more sense primers that hybridize to the minus strand of the double-stranded RNA of the VP7 gene segment of the reference strain (Wa strain / K02033) of rotavirus A G1 type or its complementary DNA base sequence from base 297 to base 338 (number of the plus strand); (6) one or more sense primers that hybridize to the minus strand of the double-stranded RNA of the VP7 gene segment of the reference strain (KUN / D50124) of rotavirus A G2 type or its complementary DNA base sequence from base 399 to 438 (number of the plus strand); (7) one or more sense primers that hybridize to the minus strand of the double-stranded RNA of the VP7 gene segment of the reference strain (BrB-9 / GU565090) of rotavirus A G4 type or its complementary DNA base sequence from base 468 to 507 (plus strand numbering); (8) One or more sense primers that hybridize to the minus strand of the double-stranded RNA or its complementary DNA base sequence from base 174 to 210 (plus strand numbering) of the VP7 gene segment of the type strain of rotavirus A G8 type (NP-130 / LC169923).

[0014] The G1 type reference strain of RVA is defined by the above "Wa strain / K02033". "Wa strain" is the name of the strain, and "K02033" is the GenBank accession number of the VP7 gene of the RVA of the strain. The RVA reference strains of other genotypes in this specification are also disclosed in a similar format. The base sequence in GenBank is genomic RNA (plus strand) for all genotypes, and the base U (uracil) is written as T (thymine) for convenience. For example, by searching for the above "K02033" (half-width) on the website "https: / / www.ncbi.nlm.nih.gov / nucleotide / ", the base sequence of the VP7 gene of the Wa strain is found, and the base sequence can be identified.

[0015] The "baseline sequence counting standard" refers to the standard for counting the base sequence numbers, including RVA type strains of other genotypes, and the base sequence of the RVA type strain other than the G1 type selected as the detection target is specified in a state of being aligned with the base sequence of the VP7 gene of the G1 type type strain. If there is a deletion or insertion of a base in the base sequence of the VP7 gene of the G1 type type strain, the base sequence number is counted including the deletion or insertion. For example, the G9 type RVA type type strain (B3458 / EF990708) has a deletion of a base corresponding to the 1028th base of the G1 type, and the base sequence region of the G9 type corresponding to the 883-1062nd base sequence region of the G1 type with which the base sequence is aligned is specified as 883-1061. In this case, the bases in the 883-1027th region of the G9 type are directly aligned with the 883-1027th bases of the G1 type. However, the base (deletion) of the G9 type corresponding to the 1028th base of the G1 type is skipped, and the 1028th base of the G9 type is matched to the 1029th base of the G1 type, and thereafter, the 1028th to 1061st bases of the G9 type are matched to the 1029th to 1062nd bases of the G1 type. Note that this "base sequence counting standard" is a relative method of counting, and it is possible to use a strain other than the G1 type as the standard strain for counting, and even in that case, the substantial content of the present invention is exactly the same.

[0016] Hybridization to the double-stranded RNA of a given reference strain or its complementary DNA means that the target primer hybridizes to the target nucleic acid serving as a template so as to function as a gene amplification primer in a gene amplification method such as PCR. Perfect complementarity is of course included, but non-complementary bases of approximately 15% or less (for example, within 3 bases for a gene amplification primer of 20 bases long) are also acceptable. The reason why the target nucleic acid includes RNA is that the target nucleic acid serving as the initial template is the double-stranded RNA of RVA regardless of which gene amplification method is used, and for example, when a gene amplification method based on PCR is used, the initial gene amplification method is the RT-PCR method.

[0017] In addition, the hybridizing region of the gene amplification primer may be the entirety or a part of the primer. For example, the gene amplification primer may be modified with a tag sequence or the like suitable for the selected gene amplification means.

[0018] In the above eight base sequence regions defined for the sense primer (A) with the additional sense primer added, the sense primer corresponding to the reference strain of the RVA genotype is one or more kinds, and it is also possible to use two or more kinds of sense primers corresponding to the same region. For example, a specific base in the sense primer is diversified (for example, the specific base is A or G), and multiple kinds of sense primers corresponding to the same reference strain can be used as mixed primers corresponding to the same base sequence region.

[0019] The "gene amplification means" used in the detection method of the present invention is not limited, and examples thereof include the PCR method, the NASBA method, the LAMP method, the LCR method, and methods based on these gene amplification methods. The "gene amplification means" of the present invention is not limited to gene amplification methods currently provided, and also includes gene amplification methods provided in the future to which the present invention can be applied. The detection method of the present invention can be carried out under specific conditions according to the specific gene amplification means to which the present invention is applied.

[0020] In the present invention, a gene amplification means based on the PCR method is one of the preferred embodiments. Specifically, the PCR method and the RT-PCR method can be used, and further, the nested PCR method and the semi-nested PCR method can be preferably used, but are not limited to these. In addition, the detection method of the present invention has very high specificity for the corresponding RVA genotype, and even if it is carried out as a multiplex PCR method in which sense primer (A) and common antisense primer (B), which may include two or more additional sense primers corresponding to multiple RVA genotypes, are reacted together in a thermal cycler, the RVA genotype can be detected with high sensitivity.

[0021] In general, the more types of gene amplification primers used in multiplex PCR, the more difficult it is to accurately detect genotypes because the risk of erroneous detection increases synergistically. The gene amplification primers used in the detection method of the present invention have high specificity for the respective genotypes of RVA, and even if a multiplex PCR method is performed using sense primers corresponding to multiple, for example, 3-8 different RVA genotypes, the risk of erroneous detection can be reduced. In particular, in the second amplification step of the nested PCR method (including semi-nested PCR method), when a sense primer (A) that may contain an additional sense primer is used as a nested sense primer and a common antisense primer (B) is used as a common nested antisense primer, the detection method of the present invention can be suitably performed.

[0022] When a gene amplification method is performed directly on the RVA gene (double-stranded RNA) without using nested-PCR (including semi-nested PCR) as the gene amplification method, the detection method of the present invention can be carried out by carrying out an RT-PCR method using the set of the above-mentioned "sense primer (A) which may contain an additional sense primer" and "common antisense primer (B)."

[0023] The case where nested-PCR (including semi-nested PCR) is used as the gene amplification method will be described in more detail below. In this case, the set of the above-mentioned "sense primer (A) which may contain an additional sense primer" and the "common antisense primer (B)" is used in the second amplification step of nested PCR (including semi-nested PCR), and the sense primer (A) is used as the nested sense primer and the common antisense primer (B) is used as the common nested antisense primer, as described above.

[0024] In the first amplification step by RT-PCR, (1) a common outer sense primer that hybridizes to a minus strand corresponding to a base sequence of a plus strand of a genotype-different rotavirus A reference strain to be detected, the minus strand matching each of the whole or part of the base sequence of the plus strand of the VP7 gene segment (segment 9) of the G1 type reference strain of rotavirus A (Wa strain / K02033) based on the base sequence counting standard of the base sequence 1-72 of the base sequence of the plus strand of the double-stranded RNA or its complementary DNA, and (2) a common outer antisense primer that hybridizes to a base sequence of a plus strand of a genotype-different rotavirus A reference strain to be detected, the minus strand matching each of the whole or part of the base sequence of the plus strand of the G1 type reference strain based on the base sequence counting standard of the base sequence 883-1062 of the base sequence of the plus strand of the G1 type reference strain, the minus strand matching each of the whole or part of the base sequence of the plus strand of the genotype-different rotavirus A reference strain, are used as a template in the second amplification step, thereby obtaining a nested The PCR method (including the semi-nested PCR method) can be applied to the detection method of the present invention.

[0025] In the detection method of the present invention, the type of RVA type strain to be selected for hybridization confirmation is not particularly limited, and examples thereof include the type strain of G3 type (human rotavirus) (AU-1 / D86271), the type strain of equine G3 type (equine rotavirus) (S13-30 / KJ639017), the type strain of G9 type (B3458 / EF990708), and the type strain of G12 type (Dhaka25 / DQ146654). Further examples thereof include the type strain of G1 type (Wa strain / K02033), the type strain of G2 type (KUN / D50124), the type strain of G4 type (BrB-9 / GU565090), and the type strain of G8 type (NP-130 / LC169923).

[0026] Among these, at least "G3 type (human rotavirus), equine-like G3 type (equine rotavirus), G9 type, and G12 type", or if further narrowed down, "G3 type (human rotavirus), equine-like G3 type (equine rotavirus), and G9 type" are used as the basis for selecting the type strain of RVA to be detected, which is a preferred basic embodiment of the detection method of the present invention. In addition, it is also a preferred embodiment to select "G1 type, G2 type, G4 type, and G8 type" as the type strain of RVA by adding "G1 type, G2 type, and G8 type" to these, or if further narrowed down, "G1 type, G2 type, and G8 type". From the viewpoint of detecting RVA genotypes as widely and efficiently as possible, it is also a preferred embodiment to select type strains of all genotypes, "G3 type (human rotavirus), equine-like G3 type (equine rotavirus), G9 type, G12 type, G1 type, G2 type, G4 type, and G8 type", as disclosed in the examples.

[0027] The reference strain of RVA to be confirmed for common hybridization in the creation of the common antisense primer corresponds to the reference strain selected in the above sense primer.

[0028] When the gene amplification means is a method based on the PCR method, all of the gene amplification primers described above are preferably 10-40 bases long, more preferably 15-30 bases long. When a gene amplification method other than the PCR method is used, the base length of the gene amplification primers can be selected to be suitable for the other gene amplification method.

[0029] Specimens to which the detection method of the present invention should be applied include samples isolated from living organisms in which rotavirus may be present, research media containing the virus amplified and maintained in cultured cells, etc., and specific examples include samples from feces, vomit, blood, cerebrospinal fluid, breast milk, research media, and the environment (food, tableware, clothing, diapers, sewage, river water, etc.), etc. All of these samples are separated from living organisms.

[0030] <Primer set of the present invention> The primer set of the present invention is a gene amplification primer set for carrying out the above-mentioned detection method of the present invention. Specifically, there are the following embodiments, each of which can be used as a gene amplification primer used in the above-mentioned detection method of the present invention.

[0031] (I)-1: Basic sense primer set This is a primer set for gene amplification intended for detecting the genotype of rotavirus, and includes a sense primer selected from 1 to 4 of the following (A)(1)-(4).

[0032] The base sequence count was based on the 174th to 834th bases of the plus strand of the double-stranded RNA or its complementary DNA of the VP7 gene segment (segment 9) of the reference strain (Wa strain / K02033) of the G1 type of rotavirus A. (A)(1) one or more sense primers that hybridize to the minus strand of the 802-834 bases (numbering of the plus strand) of the double-stranded RNA or its complementary DNA of the VP7 gene segment of the reference strain (AU-1 / D86271) of rotavirus A G3 type (human rotavirus); (A)(2) one or more sense primers that hybridize to the minus strand of the double-stranded RNA of the VP7 gene segment of the reference strain (S13-30 / KJ639017) of rotavirus A equine G3 type (equine rotavirus) or its complementary DNA base sequence from base 747 to 789 (number of the plus strand); (A)(3) one or more sense primers that hybridize to the minus strand of the 603-636 bases (plus strand numbering) of the double-stranded RNA or its complementary DNA of the VP7 gene segment of the G9 type strain of rotavirus A (B3458 / EF990708); (A)(4) One or more sense primers that hybridize to the minus strand of the 666-711th base sequence (plus strand numbering) of the double-stranded RNA or its complementary DNA of the VP7 gene segment of the G12 type strain of rotavirus A (Dhaka25 / DQ146654).

[0033] (I)-2: Sense primer set that may include additional sense primers This is a primer set for gene amplification, which further comprises the above basic sense primer set and 1 to 4 kinds of sense primers (additional sense primers) selected from the following (A)(5) to (8).

[0034] (A)(5) one or more sense primers that hybridize to the minus strand of the double-stranded RNA of the VP7 gene segment of the reference strain (Wa strain / K02033) of the G1 type of rotavirus A or its complementary DNA base sequence from base 297 to base 338 (number of the plus strand); (A)(6) one or more sense primers that hybridize to the minus strand of the double-stranded RNA or its complementary DNA base sequence from base 399 to 438 (plus strand numbering) of the VP7 gene segment of the reference strain (KUN / D50124) of the G2 type of rotavirus A; (A)(7) one or more sense primers that hybridize to the minus strand of the double-stranded RNA of the VP7 gene segment of the reference strain (BrB-9 / GU565090) of rotavirus A G4 type or its complementary DNA base sequence from base 468 to base 507 (number of the plus strand); (A)(8) One or more sense primers that hybridize to the minus strand of the double-stranded RNA of the VP7 gene segment of the reference strain of rotavirus A G8 type (NP-130 / LC169923) or its complementary DNA base sequence from base 174 to 210 (the numbering of the plus strand).

[0035] The sense primers corresponding to the reference strain of the RVA genotype in the above eight base sequence regions defined for the sense primer (A) to which the above additional sense primers have been added are one or more types, and it is also possible to use a sense primer set in which two or more types of sense primers correspond to the same region. For example, a sense primer set in which a specific base in the sense primer is diversified (for example, the specific base is A or G) and multiple types of sense primers corresponding to the same reference strain are arranged to correspond to the same base sequence region as mixed primers can be used.

[0036] Among the above, at least "G3 type (human rotavirus), equine G3 type (equine rotavirus), G9 type, and G12 type," or if further narrowed down, "G3 type (human rotavirus), equine G3 type (equine rotavirus), and G9 type," are preferred basic embodiments of the sense primer set as the basis for selecting the reference strain of RVA to be detected. It is also preferred to add "G1 type, G2 type, G4 type, and G8 type" to these, or if further narrowed down, "G1 type, G2 type, and G8 type," to select the sense primer set as the reference strain of RVA. From the viewpoint of detecting RVA genotypes as broadly and efficiently as possible, as disclosed in the examples, a sense primer set that is compatible with reference strains of all genotypes, including "G3 type (human rotavirus), equine G3 type (equine rotavirus), G9 type, G12 type, G1 type, G2 type, G4 type, and G8 type," is also preferred.

[0037] The above sense primer sets (I)-1 and (I)-2 can be used in combination with an appropriate antisense primer to carry out the detection method of the present invention.

[0038] (II) A set of sense and antisense primers This primer set is a combination of the above-mentioned "basic sense primer set" (I)-1 or the "sense primer set which may contain an additional sense primer" (I)-2, and an antisense primer (B).

[0039] Specifically, the primer set for gene amplification includes a combination of the sense primer set (I)-1 or (I)-2 described above, and one or more common antisense primers (B) that hybridize to the positive strand of the above-mentioned reference strain of rotavirus A that are matched to the region of the base sequence from 883 to 1062 of the positive strand of the double-stranded RNA or its complementary DNA of the VP7 gene segment (segment 9) of the reference strain of G1 type rotavirus A (Wa strain / K02033) as the counting standard.

[0040] The above-mentioned set of sense primer and antisense primer (II) can be used to carry out the detection method of the present invention.

[0041] (III) Primer set used in nested-PCR This is a primer set used when performing nested PCR as a means of detecting the RVA genotype.

[0042] Specifically, the above-mentioned (I)-1, (I)-2, or (II) gene amplification primer set is included as a primer set used in the second amplification step of the nested-PCR method, and (1) a primer set for gene amplification of a rotavirus A type strain having a different genotype to be detected, which matches all or a part of the base sequence of the plus strand of the double-stranded RNA or its complementary DNA in the VP7 gene segment (segment 9) of the G1 type rotavirus A type strain (Wa strain / K02033) using the 1st to 72nd bases of the base sequence of the plus strand of the double-stranded RNA or its complementary DNA as the base for base sequence counting. The primer set for gene amplification includes, as a primer set used in the first amplification step of a nested-PCR method using an RT-PCR method, (1) a common outer sense primer that hybridizes to a minus strand corresponding to the base sequence, and (2) a common outer antisense primer that hybridizes to a plus strand base sequence of a reference strain of rotavirus A having a different genotype to be detected, the plus strand base sequence matching all or part of the base sequence, using positions 883-1062 of the base sequence of the plus strand of the G1 type reference strain as the base for base sequence counting.

[0043] The above primer set (III) of the present invention can be used to carry out the detection method of the present invention using nested-PCR.

[0044] All of the gene amplification primers in the primer set of the present invention (I)-1, (I)-2, (II), or (III) above are preferably 10-40 bases long, more preferably 15-30 bases long, when the gene amplification means is a method based on the PCR method. When a gene amplification method other than the PCR method is used, the base length of the gene amplification primers can be selected to be suitable for the other gene amplification method.

[0045] <Kit of the Present Invention> The kit of the present invention is a detection kit containing the primer set of the present invention as a component thereof for carrying out the detection method of the present invention using the primer set of the present invention. Other components can be incorporated into the kit of the present invention depending on the specific embodiment of the detection method of the present invention. Specifically, for example, when the gene amplification means is a method based on the PCR method, it is possible to incorporate an enzyme for PCR (DNA polymerase), reverse transcriptase, a buffer (buffer solution), a metal ion (magnesium ion, etc.) that serves as a cofactor for the enzyme, deoxyribonucleotide triphosphate (dNTP (a mixture of dATP, dCTP, dGTP, TTP)) that serves as a substrate for DNA amplification, water for dilution, etc. as other components. Effect of the Invention

[0046] According to the present invention, means for detecting the genotype of RVA (rotavirus A) with high accuracy based on a gene amplification method such as PCR is provided in the form of a detection method, a primer set for gene amplification, and a detection kit. [Brief description of the drawings]

[0047] [Figure 1A] 1 is a diagram showing the migration patterns for each genotype of Rotavirus A when the primer set of Comparative Example (Test System 1) was used. [Figure 1B] 1 is a diagram showing the migration patterns of each genotype of Rotavirus A when the primer set of an Example (Test system 1) is used. [Diagram 2] 1 is a diagram showing the migration patterns of each genotype of Rotavirus A when the primer set of an Example (Test System 2) is used. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0048] An example of an embodiment of the present invention will be described below, but this example is merely one aspect of the above-described concept of the present invention.

[0049] <Sense primer (A)> Examples of the sense primer (A) include the sense primers (1)-(8) below that hybridize to the minus strand. Among the symbols representing bases, "R" represents guanine or adenine.

[0050] (A)(1) A sense primer that hybridizes to the minus strand of double-stranded RNA of the VP7 gene segment of the reference strain (AU-1 / D86271) of rotavirus A G3 type (human rotavirus) or its complementary DNA base sequence at positions 802-834 (plus strand numbering). An example of this is a sense primer that contains a part or all of CAAGGGAAAACGTRGCAGTTA (SEQ ID NO: 3).

[0051] (A)(2) A sense primer that hybridizes to the minus strand of double-stranded RNA of the VP7 gene segment of the type strain (S13-30 / KJ639017) of equine type G3 (equine rotavirus) of rotavirus A or its complementary DNA base sequence at positions 747-789 (numbering of the plus strand). An example of this is a sense primer that contains a part or all of CTAGATGTTACTACGGCTAC (SEQ ID NO: 4).

[0052] (A)(3) A sense primer that hybridizes to the minus strand of the 603rd to 636th bases (plus strand numbering) of the double-stranded RNA or its complementary DNA sequence of the VP7 gene segment of the reference strain (B3458 / EF990708) of the G9 type of rotavirus A. An example of this is a sense primer that contains a part or all of GATGGGACARTCTTGTACCATA (SEQ ID NO: 7).

[0053] (A)(4) A sense primer that hybridizes to the minus strand of the 666th to 711th base sequences (plus strand numbers) of the double-stranded RNA or its complementary DNA sequence of the VP7 gene segment of the reference strain (Dhaka25 / DQ146654) of the G12 type of rotavirus A. An example of this is a sense primer that contains a part or all of TACRACAACCGACGTCACA (SEQ ID NO: 8).

[0054] (A)(5) A sense primer that hybridizes to the minus strand of the 297th to 338th bases (plus strand numbering) of the double-stranded RNA or its complementary DNA sequence of the VP7 gene segment of the reference strain (Wa strain / K02033) of the G1 type of rotavirus A. An example of this is a sense primer that contains a part or all of GTATTATCCAACTGAAGCAAGTAC (SEQ ID NO: 1).

[0055] (A)(6) A sense primer that hybridizes to the minus strand of the 399th to 438th bases (plus strand numbering) of the double-stranded RNA or its complementary DNA sequence of the VP7 gene segment of the reference strain (KUN / D50124) of the G2 type of rotavirus A. An example of this is a sense primer that contains a part or all of TTAAAGACTACAATGATATTACTACATT (SEQ ID NO: 2).

[0056] (A)(7) A sense primer that hybridizes to the minus strand of the 468th to 507th bases (plus strand numbering) of the double-stranded RNA or its complementary DNA base sequence of the VP7 gene segment of the reference strain (BrB-9 / GU565090) of the G4 type of rotavirus A. An example of this is a sense primer that contains a part or all of TTCGCTTCTGGTGTGAGGAGTTG (SEQ ID NO: 5).

[0057] (A)(8) A sense primer that hybridizes to the minus strand of the 174th to 210th bases (plus strand numbering) of the double-stranded RNA or its complementary DNA base sequence of the VP7 gene segment of the reference strain (NP-130 / LC169923) of the G8 type of rotavirus A. An example of this is a sense primer that contains a part or all of TTACRCCATTTGTAAATTCACAG (SEQ ID NO: 6).

[0058] <Common antisense primer (B)> The above common antisense primer (B) is preferably a common antisense primer containing a part or all of ACTTGCCACCATTTTTTCCA (SEQ ID NO: 9).

[0059] <Mode of application to nested PCR method> The primer set of the present invention described above is used as a nested sense primer and a common nested antisense primer in the second amplification step of the nested-PCR method (including the semi-nested PCR method). And as the common outer sense primer in the first amplification step by the RT-PCR method, a common outer sense primer containing a part or all of CTCCTTTTAATGTATGGTATTGAATATACC (SEQ ID NO: 10) can be mentioned, and as the common outer antisense primer, a common outer antisense primer containing a part or all of GTATAAAANACTTGCCACCATTTTTTCCA (SEQ ID NO: 11) can be mentioned.

[0060] In addition, it is also possible to incorporate and use known primers for RVA detection, for example, the primers described in Non-Patent Document 5 (specifically, primers having the base sequences of SEQ ID NOs: 12-20 below) into the primer set of the present invention as needed, and this mode is also an embodiment of the present invention.

Example

[0061] Hereinafter, examples of the present invention will be described.

[0062] [Construction of test system 1] (1) Preparation of samples For the evaluation of the multiplex PCR method, 11 representative strains were selected from RVA strains whose genotypes had been determined in advance by sequence analysis, and specimens known to contain these RVA strains were selected and used.

[0063] Human-wt / JPN-Hokkaido / SP15-09 / 2015 / G1 lineage 1 (Wa-like) Human-wt / JPN-Kyoto / NT036 / 2013 / G1 lineage 2 (Wa) Human-wt / JPN-Hokkaido / SP15-06 / 2015 / G1 lineage 1 (DS-1) Human-wt / JPN-Hokkaido / To16-04 / 2016 / G2 Human-wt / JPN-Aichi / KN105 / 2013 / G3 (Mr. Wa) Human-wt / JPN-Hokkaido / To16-01 / 2016 / G3 (equine-like, DS-1) Human-wt / JPN-Okayama / OH279 / 2002 / G4 Human-wt / JPN-Hokkaido / TA15-07 / 2015 / G8 Human-wt / JPN-Hokkaido / To14-25 / 2014 / G9 lineage 3 Human-wt / JPN-Hokkaido / To16-02 / 2016 / G9 lineage 6 Human-wt / JPN-Hokkaido / NS17-5 / 2017 / G12

[0064] The specimens containing the RVA strains were prepared as 10% stool suspensions in PBS (10 mM, pH 7.2) from feces collected from patients hospitalized with acute gastroenteritis. Viral RNA was extracted using the Direct-zol RNA MiniPrep kit (Zymo Research, Irvine, CA) according to the manufacturer's instructions. Briefly, 80 μL of the stool suspension was added to 240 μL of TRIzol® LS reagent and mixed by vortexing. After incubation at room temperature for 5 minutes, 320 μL of ethanol was added and the mixture was directly loaded onto the spin column of the kit. The column was centrifuged at 12,000 × g for 1 minute and washed. The purified RNA was eluted with 40 μL of DNase / RNase-free water.

[0065] (2) Genotyping by semi-nested multiplex PCR The following Gouvea primer sets (comparison examples): 1st Beg 9: GGCTTTAAAAGAGAGAATTTCCGTCTGG (SEQ ID NO: 19) End 9: GGTCACATCATACAATTCTAATCTAAG (SEQ ID NO: 20) 2nd RVG 9: GGTCACATCATACAATTCT (SEQ ID NO: 18) aAT8 (G8): GTCACACCATTTGTAAATTCG (SEQ ID NO: 12) aBT1(G1): CAAGTACTCAAATCAATGATGG (SEQ ID NO: 13) aCT2 (G2): CAATGATATTAACACATTTTCTGTG (SEQ ID NO: 14) aDT4(G4): CGTTTCTGGTGAGGAGTTG (SEQ ID NO: 15) aET3 (G3): CGTTTGAAGAAGTTGCAACAG (SEQ ID NO: 16) aFT9 (G9): CTAGATGTAACTACAACTAC (SEQ ID NO: 17) and the following example primer sets: 1st VP7 C-040F: CTCCTTTTAATGTATGGTATTGAATATACC (SEQ ID NO: 10) VP7 C-941R: GTATAAAANACTTGCCACCATTTTTTCCA (SEQ ID NO: 11) 2nd VP7 C-932R: ACTTGCCACCATTTTTTCCA (SEQ ID NO: 9) G1-297F: GTATTATCCAACTGAAGCAAGTAC (SEQ ID NO: 1) G2-401F: TTAAAGACTACAATGATATTACTACATT (SEQ ID NO: 2) G3-809F: CAAGGGAAAACGTRGCAGTTA (SEQ ID NO: 3) G3e-757F: CTAGATGTTACTACGGCTAC (SEQ ID NO: 4) G4-478F: TTCGCTTCTGGTGAGGAGTTG (SEQ ID NO: 5) G8-179F: TTACRCCATTTGTAAATTCACAG (SEQ ID NO: 6) G9-606F: GATGGGACARTCTTGTACCATA (SEQ ID NO: 7) G12-669F: TACRACAACCGACGTCACA (SEQ ID NO: 8) RT-PCR (primary PCR) was performed using the outer primers indicated as "1st" above, and multiplex PCR (secondary PCR) was performed using the nested primers indicated as "2nd". "G3e" indicates that it is equine-like, and indicates the primers related to equine G3.

[0066] RT-PCR was performed using 1 μL of RNA sample with the TaKaRa One Step RNA PCR kit (AMV) (Takara, Kyoto, Japan). Before the reaction, the RNA sample was mixed with the primary primer (outer primer) (10 pmol each) and incubated at 65°C for 5 min. Then, using a GenAmp PCR System 2700 thermal cycler (Applied Biosystems, Foster, CA, USA), the reaction was performed at 50°C for 30 min (reverse transcription reaction), followed by 94°C for 2 min, followed by 40 cycles of amplification reaction (94°C for 30 s, 50°C for 30 s, 72°C for 90 s), and finally extension reaction at 72°C for 5 min. The primary PCR product thus obtained was diluted 50-fold with DNase / RNase-free water, and 2 μL of the diluted solution was used for the secondary PCR.

[0067] Secondary PCR was performed using the second primer (nested primer) (5 pmol each) and Premix Ex Taq® Hot Start Version (Takara). Denaturation was performed at 94°C for 30 seconds, followed by 20 cycles of amplification (94°C for 30 seconds, 50°C for 30 seconds, 72°C for 60 seconds), and finally extension at 72°C for 5 minutes.

[0068] The sizes of the PCR products were analyzed by 1.5% agarose gel electrophoresis and ethidium bromide staining, and a 100 bp DNA ladder (New England BioLabs, Ipswich, MA, USA) was used as a DNA size marker.

[0069] As an alternative reagent kit for the first PCR, PrimeScript TM The reaction conditions were as follows: RT-PCR was performed at 45°C for 10 minutes, followed by a 98°C reaction for 10 seconds, followed by 40 cycles of amplification (98°C for 10 seconds, 50°C for 15 seconds, and 68°C for 20 seconds), followed by a 68°C extension reaction for 3 minutes.

[0070] The size of the PCR amplification product was analyzed in the same manner as for the PCR amplification product obtained by the above-mentioned basic amplification reaction system.

[0071] (3) Comparison of virus strains and primer sequences The VP7 nucleotide sequences of the RVA reference strains were obtained from GenBank and aligned using the CLUSTAL W and MAFFT multiple sequence alignment software programs version 7.0 (Katoh et al., 2009) included in the MEGA software package version 7.0.18. Final editing was performed with Microsoft Excel 2010 software (Microsoft, Redmond, WA, USA).

[0072] [Results of Test System 1] (1) Evaluation of Gouvea primer sets (comparative examples) The multiplex PCR method using the above Gouvea primer set was evaluated in the basic amplification reaction system using 10 RVA strains collected in Japan (G1 lineage 1 (Wa-like), G1 lineage 2 (Wa-like), G1 lineage 1 (DS-1-like), G2, G3 (Wa-like), equine-like G3 (DS-1-like), G4, G8, G9 lineage 3, and G9 lineage 6).

[0073] As a result, the genotypes of Wa-like G1 lineage 1, Wa-like G1 lineage 2, DS-1-like G1, G2, Wa-like G3, and G4 could be determined without any problems, but the following three types of viruses were misidentified or difficult to determine (Figure 1A). Figure 1A shows the results in the basic reaction system, and the difficult-to-determine areas are indicated by ↑. First, a band close to the size of G1 (749 bp) was obtained in the horse-like G3 sample. In addition, a band was obtained at the position of G3 (374 bp) in G8. G9 type viruses that are prevalent in Japan are broadly divided into lineage 3 and lineage 6 by phylogenetic analysis, but in lineage 3, no band was detected or the band was very faint, making it difficult to determine. Furthermore, in G9 lineage 6, a weak nonspecific band was observed between G1 (749 bp) and G8 (885 bp). This result was similar when five or more samples were used.

[0074] (2) Evaluation of the primer set of the embodiment In contrast to the comparative example (1) above, when the primer set of the example (above; including the primer for G12) was used, it was confirmed that the genotypes of all strains, including G1, G2, human G3, equine G3, G4, G8 and G9, plus G12, could be accurately determined in the basic amplification reaction system (Figure 1B). That is, the bands of equine G3 and G1 were clearly different, and the bands of G8 and G3 were also clearly different. In addition, the band of G9 lineage 3 was clearly detected. Furthermore, the non-specific bands observed in G9 lineage 6 were not observed. Thus, the parts that were difficult to detect in the comparative example were clearly detected, and the newly added band of G12 was also clearly recognized in a distinguishable form. This result was the same when two or more samples were used, and further, the same was true when the above basic amplification reaction system was used for each sample, and when the amplification reaction system attached to the alternative reagent kit was used.

[0075] [Construction of test system 2] (1) Details of Test System 2 In test system 2, the detection performance of the genotypes near both ends of the gene-corresponding regions assigned to the RVA strains, human G3, equine G3, G9, and G12, was examined using a semi-nested multiplex PCR similar to that used in test system 1.

[0076] (2) Sample preparation The samples used were the same fecal samples used in Test System 1 for each of G1, G2, human G3, equine G3, G4, G8, G9, and G12.

[0077] (3) Genotyping by semi-nested multiplex PCR The following primer sets: 1st VP7 C-040F: CTCCTTTTAATGTATGGTATTGAATATACC (SEQ ID NO: 10) VP7 C-941R: GTATAAAANACTTGCCACCATTTTTTCCA (SEQ ID NO: 11) 2nd VP7 C-932R: ACTTGCCACCATTTTTTCCA (SEQ ID NO: 9) G1-297F: GTATTATCCAACTGAAGCAAGTAC (SEQ ID NO: 1) G2-401F: TTAAAGACTACAATGATATTACTACATT (SEQ ID NO: 2) G3-beg-802F(19): TTAGGACCAAGGGAAAACG (SEQ ID NO: 21) G3-end-812F(23): GGGAAAACGTAGCAGTTATACAG (SEQ ID NO: 22) G3e-beg-747F(21): CAATCATAAACTAGATGTTAC (SEQ ID NO: 23) G3e-end-771F(19): GGCTACTTGTACGATCAGA (SEQ ID NO: 24) G4-478F: TTCGCTTCTGGTGAGGAGTTG (SEQ ID NO: 5) G8-179F: TTACRCCATTTGTAAATTCACAG (SEQ ID NO: 6) G9-beg-603F(23): ATCGATGGGACARTCTTGTACCA (SEQ ID NO: 25) G9-end-613F(24): CAATCTTGTACCATAAAAGTGTGC (SEQ ID NO: 26) G12-beg-666F(19): ATGTACGACAACCGACGTC (SEQ ID NO: 27) G12-end-689F(23): CATTTGAAGAGGTAGCAAATGCG (SEQ ID NO: 28) RT-PCR (primary PCR) was performed using the outer primers indicated as "1st" above, and multiplex PCR (secondary PCR) was performed using the nested primers indicated as "2nd". Note that "G3e" indicates equine-like, and as with test system 1, it indicates primers related to equine-like G3.

[0078] RT-PCR was performed using 1 μL of RNA sample with the TaKaRa One Step RNA PCR kit (AMV) (Takara, Kyoto, Japan). Before the reaction, the RNA sample was mixed with the primary primer (outer primer) (10 pmol each) and incubated at 65°C for 5 min. Then, using a GenAmp PCR System 2700 thermal cycler (Applied Biosystems, Foster, CA, USA), the reaction was performed at 50°C for 30 min (reverse transcription reaction), followed by 94°C for 2 min, followed by 40 cycles of amplification reaction (94°C for 30 s, 50°C for 30 s, 72°C for 90 s), and finally extension reaction at 72°C for 5 min. The primary PCR product thus obtained was diluted 50-fold with DNase / RNase-free water, and 2 μL of the diluted solution was used for the secondary PCR.

[0079] Secondary PCR was performed using the second primer (nested primer) (5 pmol each) and Premix Ex Taq® Hot Start Version (Takara). Denaturation was performed at 94°C for 30 seconds, followed by 20 cycles of amplification (94°C for 30 seconds, 50°C for 30 seconds, 72°C for 60 seconds), and finally extension at 72°C for 5 minutes.

[0080] The sizes of the PCR products were analyzed by 1.5% agarose gel electrophoresis and ethidium bromide staining, and a 100 bp DNA ladder (New England BioLabs, Ipswich, MA, USA) was used as a DNA size marker.

[0081] As an alternative reagent kit for the first PCR, PrimeScript TMThe reaction conditions were as follows: RT-PCR was performed at 45°C for 10 minutes, followed by a 98°C reaction for 10 seconds, followed by 40 cycles of amplification (98°C for 10 seconds, 50°C for 15 seconds, and 68°C for 20 seconds), followed by a 68°C extension reaction for 3 minutes.

[0082] The size of the PCR amplification product was analyzed in the same manner as for the PCR amplification product obtained by the above-mentioned basic amplification reaction system.

[0083] (4) Comparison of virus strains and primer sequences The VP7 nucleotide sequences of the RVA reference strains were obtained from GenBank and aligned using the CLUSTAL W and MAFFT multiple sequence alignment software programs version 7.0 (Katoh et al., 2009) included in the MEGA software package version 7.0.18. Final editing was performed with Microsoft Excel 2010 software (Microsoft, Redmond, WA, USA).

[0084] [Results of Test System 2] Primers corresponding to both ends of gene regions corresponding to the reference strains of human G3, equine G3, G9, and G12, which are more fundamental elements in the detection method of the present invention, i.e., for human G3, G3-beg-802F (5' side: corresponding to G3h-beg in FIG. 2) and G3-end-812F (5' side: corresponding to G3h-end in FIG. 2); for equine G3, G3e-beg-747F (5' side: corresponding to G3e-beg in FIG. 2) and G3e-end-771F (5' side: corresponding to G3e-end in FIG. 2); For G9, G9-beg-603F (5' side: corresponding to G9-beg in FIG. 2) and G9-end-613F (5' side: corresponding to G9-end in FIG. 2); for G12, G12-beg-666F (5' side: corresponding to G12-beg in FIG. 2) and G12-end-689F (5' side: corresponding to G12-end in FIG. 2); for each, multiplex PCR was performed with primers corresponding to the standard strains G1, G2, G4, and G8 that can be added in the present invention. As a result, although differences in the shade of the bands were observed, clear bands that could be clearly distinguished from others were observed for the sets of primers at both ends of the gene region corresponding to each basic standard strain. Therefore, it was revealed that the detection method of the present invention can be performed for the entire gene region defined for each standard strain in the present invention. In addition, from this result, it is considered that the detection method of the present invention can be applied to the entire gene region defined for the additional primers as well. [Industrial Applicability]

[0085] Rapid and accurate determination of the genotype (G type) of the VP7 gene segment of rotavirus A (RVA) is industrially important for the following reasons.

[0086] (1) The VP7 protein of rotavirus is the most important viral protein in the host defense. In other words, since the VP7 protein is the protein that constitutes the outermost part of the rotavirus particle, the body is more likely to recognize VP7 among the rotavirus proteins, and during rotavirus infection, antibodies against the VP7 protein are preferentially produced. On the other hand, if the VP7 genotype is different, antibodies previously produced will be ineffective or less effective. Therefore, understanding the prevalence status of rotavirus VP7 genotype units is the key to predicting the immune status of people in areas where that rotavirus is prevalent, and is also important for predicting future epidemics and evaluating the effectiveness of vaccines.

[0087] (2) The rotavirus genome is composed of 11 gene segments, and since there are many types of each gene, it is thought that the number of combinations of genotypes is simply enormous. However, in reality, the pattern of genotype composition for each rotavirus strain is roughly fixed, and once the genotype (G type) of the VP7 gene segment is determined, the other genotypes can be roughly predicted. Therefore, in normal clinical testing, there is little need to determine the genotypes of other gene segments in addition to determining the genotype of rotavirus VP7.

[0088] (3) At present, rotaviruses other than RVA that can infect humans include rotavirus B (RVB) and rotavirus C (RVC). However, the detection frequency of RVA is extremely high, and the types of epidemic strains of RVB and RVC are limited, so there is little need to take the trouble to determine the genotype of RVB and RVC. Therefore, determining only the genotype (G type) of the VP7 gene segment of RVA is sufficient to grasp the current status of rotavirus in normal clinical testing sites.

[0089] As described above in (1)-(3), determining the genotype (G type) of the VP7 gene segment of RVA is an essential task for rotavirus, and the present invention, which can perform this task quickly and accurately, can be said to be of great industrial importance.

Claims

1. (A) The base sequence count is based on the 174th to 834th bases of the plus strand base sequence in the double-stranded RNA or its complementary DNA of the VP7 gene segment (segment 9) of the reference strain (Wa strain / K02033) of the G1 type of rotavirus A: (1) a sense primer consisting of the base sequence represented by SEQ ID NO: 3, which hybridizes to the minus strand of the 802-834 bases (plus strand numbering) of the double-stranded RNA or its complementary DNA base sequence of the VP7 gene segment of the type strain (AU-1 / D86271) of rotavirus A G3 type (human rotavirus); (2) a sense primer consisting of the base sequence represented by SEQ ID NO: 4, which hybridizes to the minus strand of the 747th to 789th bases (plus strand numbering) of the double-stranded RNA or its complementary DNA of the VP7 gene segment of the type strain (S13-30 / KJ639017) of the equine G3 type (equine rotavirus) of rotavirus A; (3) a sense primer consisting of the base sequence represented by SEQ ID NO: 7, which hybridizes to the minus strand of the 603rd to 636th bases (the number of the plus strand) of the double-stranded RNA or its complementary DNA of the VP7 gene segment of the G9 type strain (B3458 / EF990708) of rotavirus A; (4) a sense primer consisting of the base sequence represented by SEQ ID NO: 8, which hybridizes to the minus strand of the 666th to 711th base sequences (plus strand numbers) of the double-stranded RNA or its complementary DNA of the VP7 gene segment of the G12 type strain of rotavirus A (Dhaka25 / DQ146654); a sense primer selected from 1 to 4 of (1) to (4) above; and (B) a common antisense primer that hybridizes to the plus strand of the type strain of rotavirus A described in (1) to (4) above, which matches each region of the base sequence of the plus strand of the type strain of the G1 type, using bases 883 to 1062 of the base sequence as the counting standard; A detection method in which a gene amplification means using the above-mentioned sense primer (A) and common antisense primer (B) as gene amplification primers is applied to a gene obtained from a sample, and the genotype of a rotavirus is detected using the gene amplification product obtained.

2. The sense primer in (A)(1) hybridizing to the minus strand of the 802-834th base (plus strand numbering) of the double-stranded RNA or its complementary DNA base sequence of the VP7 gene segment of the type strain (AU-1 / D86271) of rotavirus A G3 type (human rotavirus) is a sense primer consisting of the base sequence represented by SEQ ID NO: 3, The sense primer (A)(2) hybridizing to the minus strand of the 747th to 789th bases (plus strand numbering) of the double-stranded RNA or its complementary DNA base sequence of the VP7 gene segment of the type strain (S13-30 / KJ639017) of the equine G3 type (equine rotavirus) of rotavirus A is a sense primer consisting of the base sequence represented by SEQ ID NO: 4, The sense primer (A)(3) hybridizing to the minus strand of the 603rd to 636th bases (the numbering of the plus strand) of the double-stranded RNA or the complementary DNA of the VP7 gene segment of the G9 type strain (B3458 / EF990708) of rotavirus A is a sense primer consisting of the base sequence represented by SEQ ID NO: 7, The sense primer (A)(4) hybridizing to the minus strand of the 666th to 711th base sequences (plus strand numbers) of the double-stranded RNA or its complementary DNA of the VP7 gene segment of the G12 type strain (Dhaka25 / DQ146654) of rotavirus A is a sense primer consisting of the base sequence represented by SEQ ID NO: 8, The detection method according to claim 1, wherein the sense primers (A) include the four sense primers (1) to (4).

3. The method according to claim 1 or 2, further comprising using, as the sense primer (A), 1 to 4 types selected from the following (5) to (8): (5) a sense primer that hybridizes to a minus strand of the 297th to 338th bases (plus strand numbering) of the double-stranded RNA or its complementary DNA of the VP7 gene segment of the type strain (Wa strain / K02033) of the G1 type of rotavirus A; (6) a sense primer that hybridizes to a minus strand of the base sequence 399-438 (plus strand numbering) of double-stranded RNA or its complementary DNA of the VP7 gene segment of the type strain (KUN / D50124) of rotavirus A G2 type; (7) a sense primer that hybridizes to a minus strand of the 468th to 507th bases (plus strand numbering) of the double-stranded RNA or its complementary DNA base sequence of the VP7 gene segment of the G4 type strain (BrB-9 / GU565090) of rotavirus A; (8) A sense primer that hybridizes to the minus strand of the double-stranded RNA of the VP7 gene segment of the type strain of rotavirus A G8 type (NP-130 / LC169923) or its complementary DNA base sequence from base 174 to base 210 (plus strand numbering).

4. The sense primer (A)(5) hybridizing to the minus strand of the 297th to 338th bases (plus strand numbering) of the double-stranded RNA or its complementary DNA base sequence of the VP7 gene segment of the type strain (Wa strain / K02033) of the G1 type of rotavirus A is a sense primer consisting of the base sequence represented by SEQ ID NO: 1, The sense primer (A)(6) hybridizing to the minus strand of the 399th to 438th bases (numbering of the plus strand) of the double-stranded RNA or its complementary DNA base sequence of the VP7 gene segment of the G2 type strain (KUN / D50124) of rotavirus A is a sense primer consisting of the base sequence represented by SEQ ID NO: 2, The sense primer (A)(7) hybridizing to the minus strand of the 468th to 507th bases (plus strand numbering) of the double-stranded RNA or its complementary DNA base sequence of the VP7 gene segment of the G4 type strain (BrB-9 / GU565090) of rotavirus A is a sense primer consisting of the base sequence represented by SEQ ID NO:5, The detection method according to claim 3, wherein the sense primer (A)(8) that hybridizes to the minus strand of bases 174 to 210 (plus strand numbering) of the double-stranded RNA or its complementary DNA base sequence of the VP7 gene segment of the type strain (NP-130 / LC169923) of rotavirus A G8 type is a sense primer consisting of the base sequence represented by SEQ ID NO:

6.

5. The detection method according to any one of claims 1 to 4, wherein the common antisense primer (B) is a common antisense primer consisting of the base sequence represented by SEQ ID NO:

9.

6. The gene amplification means is a second amplification step of the nested PCR method, and in a first amplification step of the RT-PCR method, (1) hybridizing to a minus strand corresponding to a base sequence of the plus strand of a type strain of rotavirus A having a different genotype to be detected, which matches all or a part of the base sequence of the double-stranded RNA of the VP7 gene segment (segment 9) of the type strain of rotavirus A G1 type (Wa strain / K02033) or its complementary DNA, using the 1st to 72nd bases of the base sequence of the plus strand in the base sequence of the double-stranded RNA of the VP7 gene segment (segment 9) of the type strain of rotavirus A G1 type or its complementary DNA as a base for base sequence counting. The detection method according to any one of claims 1 to 5, further comprising the step of using as a gene amplification primer a common outer sense primer which hybridizes to the base sequence of the plus strand of a reference strain of rotavirus A having a different genotype to be detected, and (2) a common outer antisense primer which hybridizes to the base sequence of the plus strand of a reference strain of rotavirus A having a different genotype to be detected, the common outer sense primer being used as a gene amplification primer, and ...

7. A primer set for gene amplification, comprising a sense primer selected from 1 to 4 of the following (1) to (4), for the purpose of detecting the genotype of rotavirus: The base sequence count is based on the 174th to 834th bases of the plus strand of the double-stranded RNA or its complementary DNA of the VP7 gene segment (segment 9) of the reference strain (Wa strain / K02033) of the G1 type of rotavirus A: (1) a sense primer consisting of the base sequence represented by SEQ ID NO: 3, which hybridizes to the minus strand of the 802-834 bases (plus strand numbering) of the double-stranded RNA or its complementary DNA base sequence of the VP7 gene segment of the type strain (AU-1 / D86271) of rotavirus A G3 type (human rotavirus); (2) a sense primer consisting of the base sequence represented by SEQ ID NO: 4, which hybridizes to the minus strand of the 747th to 789th bases (plus strand numbering) of the double-stranded RNA or its complementary DNA of the VP7 gene segment of the type strain (S13-30 / KJ639017) of the equine G3 type (equine rotavirus) of rotavirus A; (3) a sense primer consisting of the base sequence represented by SEQ ID NO: 7, which hybridizes to the minus strand of the 603rd to 636th bases (the number of the plus strand) of the double-stranded RNA or its complementary DNA of the VP7 gene segment of the G9 type strain (B3458 / EF990708) of rotavirus A; (4) A sense primer consisting of the base sequence represented by SEQ ID NO: 8, which hybridizes to the minus strand of the 666th to 711th base sequences (plus strand numbering) of the double-stranded RNA or its complementary DNA of the VP7 gene segment of the G12 type strain of rotavirus A (Dhaka25 / DQ146654).

8. The sense primer (1) hybridizing to the minus strand of the 802-834th base (plus strand numbering) of the double-stranded RNA or its complementary DNA base sequence of the VP7 gene segment of the type strain (AU-1 / D86271) of rotavirus A G3 type (human rotavirus) is a sense primer consisting of the base sequence represented by SEQ ID NO: 3, The sense primer (2) hybridizing to the minus strand of the 747th to 789th bases (plus strand numbering) of the double-stranded RNA or its complementary DNA base sequence of the VP7 gene segment of the type strain (S13-30 / KJ639017) of the equine G3 type (equine rotavirus) of rotavirus A is a sense primer consisting of the base sequence represented by SEQ ID NO: 4, The sense primer (3) hybridizing to the minus strand of the 603rd to 636th bases (plus strand numbering) of the double-stranded RNA or its complementary DNA base sequence of the VP7 gene segment of the G9 type strain (B3458 / EF990708) of rotavirus A is a sense primer consisting of the base sequence represented by SEQ ID NO: 7, The sense primer (4) hybridizing to the minus strand of the 666th to 711th base sequences (plus strand numbers) of the double-stranded RNA or its complementary DNA of the VP7 gene segment of the G12 type strain (Dhaka25 / DQ146654) of rotavirus A is a sense primer consisting of the base sequence represented by SEQ ID NO: 8, The primer set for gene amplification according to claim 7, comprising the four sense primers (1) to (4) as the sense primers.

9. The primer set for gene amplification according to claim 7 or 8, further comprising 1 to 4 primers selected from the following (5) to (8) as the sense primers: (5) a sense primer that hybridizes to a minus strand of the 297th to 338th bases (plus strand numbering) of the double-stranded RNA or its complementary DNA of the VP7 gene segment of the type strain (Wa strain / K02033) of the G1 type of rotavirus A; (6) a sense primer that hybridizes to a minus strand of the base sequence 399-438 (plus strand numbering) of double-stranded RNA or its complementary DNA of the VP7 gene segment of the type strain (KUN / D50124) of rotavirus A G2 type; (7) a sense primer that hybridizes to a minus strand of the 468th to 507th bases (plus strand numbering) of the double-stranded RNA or its complementary DNA base sequence of the VP7 gene segment of the G4 type strain (BrB-9 / GU565090) of rotavirus A; (8) A sense primer that hybridizes to the minus strand of the double-stranded RNA of the VP7 gene segment of the type strain of rotavirus A G8 type (NP-130 / LC169923) or its complementary DNA base sequence from base 174 to base 210 (plus strand numbering).

10. The sense primer (5) hybridizing to the minus strand of the 297th to 338th bases (plus strand numbering) of the double-stranded RNA or its complementary DNA base sequence of the VP7 gene segment of the type strain (Wa strain / K02033) of the G1 type of rotavirus A is a sense primer consisting of the base sequence represented by SEQ ID NO: 1, The sense primer (6) hybridizing to the minus strand of the 399th to 438th bases (plus strand numbering) of the double-stranded RNA or its complementary DNA base sequence of the VP7 gene segment of the G2 type strain (KUN / D50124) of rotavirus A is a sense primer consisting of the base sequence represented by SEQ ID NO: 2, The sense primer (7) hybridizing to the minus strand of the 468th to 507th bases (plus strand numbering) of the double-stranded RNA or its complementary DNA base sequence of the VP7 gene segment of the G4 type strain (BrB-9 / GU565090) of rotavirus A is a sense primer consisting of the base sequence represented by SEQ ID NO:5, The primer set for gene amplification according to claim 9, wherein the sense primer hybridizing to the minus strand of the 174th to 210th bases (plus strand numbering) of the double-stranded RNA or its complementary DNA base sequence of the VP7 gene segment of the G8 type strain (NP-130 / LC169923) of rotavirus A in (8) above is a sense primer consisting of the base sequence represented by SEQ ID NO:

6.

11. The primer set for gene amplification according to any one of claims 7 to 10, comprising all of (1) to (4) and one or more of (5) to (8) relating to the sense primer.

12. The gene amplification primer set according to any one of claims 7 to 11, comprising, together with the sense primer, a common antisense primer that hybridizes to the plus strand of the reference strain of rotavirus A that matches the region of the base sequence from 883rd to 1062nd bases of the plus strand base sequence in the double-stranded RNA of the VP7 gene segment (segment 9) of the reference strain of G1 type rotavirus A (Wa strain / K02033) or its complementary DNA as the counting standard.

13. The primer set for gene amplification according to claim 12 , wherein the common antisense primer is a common antisense primer consisting of the base sequence represented by SEQ ID NO:

9.

14. The gene amplification primer set is included as a primer set used in a second amplification step of a nested PCR method, and (1) hybridizes to a minus strand corresponding to a base sequence of a plus strand of a type strain of rotavirus A having a different genotype to be detected, the ... double-stranded RNA of a VP7 gene segment (segment 9) of a type strain of rotavirus A G1 type (Wa strain / K02033) having a different genotype to be detected, the minus strand corresponding to a base sequence of a plus strand of a double-stranded RNA of a VP7 gene segment (segment 9) of a type strain of rotavirus A G1 type or a complementary DNA thereof being determined as a base for base sequence counting from bases 1 to 72 of the base sequence. The primer set for gene amplification according to any one of claims 7 to 13, comprising: (1) a common outer sense primer that hybridizes to a base sequence of the positive strand of a reference strain of rotavirus A having a different genotype to be detected, the common outer antisense primer hybridizing to the base sequence of the positive strand of a reference strain of rotavirus A having a different genotype to be detected, the common outer sense primer hybridizing to a base sequence of the positive strand of a reference strain of rotavirus A having a different genotype to be detected, the common outer antisense primer being a primer set used in a first amplification step of a nested PCR method using an RT-PCR method, the common outer sense primer hybridizing to a base sequence of the positive strand of a reference strain of rotavirus A having a different genotype to be detected, the common outer antisense primer hybridizing to the base sequence of the positive strand of a reference strain of rotavirus A having a different genotype to be detected, the common outer antisense primer being matched to all or a part of the base sequence of the positive strand of the reference strain of the G1 type, using base sequence counting bases 883 to 1062 of the base sequence of the positive strand of the reference strain of the G1 type.

15. The primer set for gene amplification according to claim 14, wherein the common outer sense primer (1) is a common sense primer consisting of the base sequence represented by SEQ ID NO:

10.

16. The primer set for gene amplification according to claim 14 or 15, wherein the common outer antisense primer (2) is a common antisense primer consisting of the base sequence represented by SEQ ID NO:

11.

17. The primer set for gene amplification according to any one of claims 7 to 16, wherein all of the primers for gene amplification are 10 to 40 bases in length.

18. A kit for detecting a rotavirus genotype, comprising the gene amplification primer set according to any one of claims 7 to 17.

Images