RNAi agents that inhibit the expression of beta-ENaC, compositions thereof and methods of use - Patent Application 20070122997

JP7777522B2Active Publication Date: 2025-11-28ARROWHEAD PHARMACEUTICALS INC
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
JP2022525465
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2020-05-14
Filing Date
2020-10-28
Publication Date
2025-11-28
Estimated Expiration
2040-10-28

Smart Images

  • Figure 0007777522000076
    Figure 0007777522000076
  • Figure 0007777522000077
    Figure 0007777522000077
  • Figure 0007777522000078
    Figure 0007777522000078
Patent Text Reader

Abstract

RNAi agents, compositions comprising RNAi agents, and methods for inhibiting the beta ENaC (SCNN1B) gene are described. The beta ENaC RNAi agents and RNAi agent complexes disclosed herein inhibit the expression of the beta ENaC gene. Pharmaceutical compositions comprising one or more beta ENaC RNAi agents and optionally one or more additional therapeutic agents are also described. The delivery of the described beta ENaC RNAi agents to epithelial cells, for example, lung epithelial cells, inhibits beta ENaC gene expression and reduces ENaC activity, thereby providing therapeutic benefits to subjects (including human subjects) for the treatment of various diseases, including chronic obstructive pulmonary disease (COPD).
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] This application claims priority to U.S. Provisional Patent Application No. 63 / 024,722, filed May 14, 2020, and U.S. Provisional Patent Application No. 62 / 927,637, filed October 29, 2019, the contents of each of which are incorporated herein by reference in their entirety.

[0002] Sequence Listing This application contains a Sequence Listing, which has been submitted in ASCII format and is incorporated herein by reference in its entirety. The ASCII copy is named 30678-WO_SEQLIST.txt and is 65 kb in size.

[0003] The present disclosure relates to RNA interference (RNAi) agents, eg, double-stranded RNAi agents, compositions comprising betaENaC RNAi agents, and methods of their use, for inhibiting betaENaC gene expression. [Background technology]

[0004] The vertebrate amiloride-sensitive epithelial sodium channel ("ENaC" or "amiloride-sensitive sodium channel") is a member of the degenerin / ENaC channel superfamily and is characterized by two transmembrane domains, intracellular N- and C-termini, and a large extracellular loop that is a substrate for the Furin protease. This channel is a heterotrimeric complex composed of three homologous subunits (alpha (α), beta (β), and gamma (γ)) encoded by three distinct genes, SCNN1A (alpha), SCNN1B (beta), and SCNN1G (gamma). All three subunits are required for full channel activity. A fourth subunit (delta (δ)), encoded by SCNN1D, is expressed in the testis and ovary and may functionally substitute for the alpha (α) subunit in those tissues.

[0005] ENaC is expressed at the apical membrane of epithelial cells, particularly in the lung, renal distal convoluted tubule, gastrointestinal (GI) tract, reproductive system, and ocular surface epithelium of the eye. In these epithelia, ENaC mediates the influx of extracellular sodium ions, which are then actively transported out of the cell by the basolateral sodium-potassium ATPase, thereby establishing an osmotic concentration gradient and absorbing water from the epithelial lumen into the interstitium. In the kidney, ENaC is involved in electrolyte balance and blood pressure and is the target of systemic small-molecule diuretics such as amiloride. In the lung, airway epithelial ENaC plays an important role in regulating lung hydration and mucociliary clearance.

[0006] Patients with type 1 pseudohypoaldosteronism (PHA) harboring loss-of-function mutations in SCNN1A, SCNN1B, or SCNN1G produce excessive airway surface liquid and have significantly elevated mucociliary clearance rates. Meanwhile, airway epithelial ENaC activity is significantly elevated in patients with cystic fibrosis (CF) of all genotypes. Increased ENaC activity, along with reduced cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel activity, is a major pathogenic mechanism underlying airway dryness and mucociliary stasis in patients with CF lung disease.

[0007] Although inhaled small molecule ENaC inhibitors initially showed promise for the treatment of CF, their clinical development has been limited by their short duration of action in the lung and on-target toxicity (hyperkalemia) associated with inhibition of renal ENaC (see, e.g., O'Riordan et al., 27 J. Aerosol Med. & Pulmonary Drug Dev., 200-208 (2014)).

[0008] Certain RNAi agents capable of inhibiting the expression of the beta-ENaC gene (i.e., SCNN1B) have previously been identified (e.g., those disclosed in U.S. Patent No. 8,344,127). However, other RNAi agent constructs with alternative sequences or specific chemical modifications may have better therapeutic properties that could be used for more effective therapeutics. There remains a need for beta-ENaC RNAi agents with better potency sufficient for the treatment of beta-ENaC-related diseases and disorders. Summary of the Invention

[0009] There remains a need for novel RNA interference (RNAi) agents (referred to as RNAi agents, RNAi triggers, or triggers), such as double-stranded RNAi agents, that can selectively and efficiently inhibit the expression of the beta ENaC (i.e., SCNN1B) gene. There is also a need for novel beta ENaC-specific RNAi agent compositions for treating diseases or disorders associated with increased ENaC activity and / or diseases or disorders that may be at least partially mediated by decreased ENaC activity.

[0010] The nucleotide sequence and chemical modification of the beta ENaC RNAi agent disclosed herein, and the combination of the beta ENaC RNAi agent with a specific targeting ligand suitable for selectively and efficiently delivering in vivo, are different from those previously disclosed or known in the art.The beta ENaC RNAi agent disclosed herein provides highly potent and efficient inhibition of the expression of the beta ENaC gene.

[0011] In general, the disclosure features RNAi agents specific for the beta ENaC gene, compositions comprising the beta ENaC RNAi agents, and methods for inhibiting expression of the beta ENaC gene in vitro and / or in vivo using the beta ENaC RNAi agents or compositions comprising the beta ENaC RNAi agents described herein. The beta ENaC RNAi agents described herein can selectively and efficiently reduce expression of the beta ENaC gene to reduce ENaC levels in a subject (e.g., a human or animal subject), reduce ENaC activity in the subject, or reduce both ENaC levels and ENaC activity in the subject.

[0012] The described beta ENaC RNAi agent can be used for the therapeutic treatment (including preventative treatment or prophylactic treatment) of the symptoms and diseases associated with the increase or elevation of ENaC activity level.Such symptoms and diseases include, but are not limited to, various respiratory diseases, such as cystic fibrosis, chronic bronchitis, chronic obstructive pulmonary disease (COPD), asthma, airway infection, primary ciliary dyskinesia, and lung cancer cystic fibrosis.For example, in subjects suffering from COPD, it is known that acquired CFTR and ENaC dysfunction are associated with the dryness of the mucous membrane in the airway and the reduced ability of the lung to eliminate toxins and infectious pathogens.

[0013] The described beta ENaC RNAi agents can be used, for example, in methods for therapeutic treatment (including prophylactic treatment) of conditions and diseases associated with increased or elevated levels of ENaC activity in the ocular surface epithelium (such as the conjunctival epithelium), such as treating ocular diseases and disorders such as dry eye syndrome.

[0014] In one aspect, the disclosure features an RNAi agent that inhibits expression of the beta ENaC (SCNN1B) gene. The RNAi agent includes a sense strand (also referred to as a passenger strand) and an antisense strand (also referred to as a guide strand). The sense strand and antisense strand may be partially, substantially, or fully complementary to each other. The sense strand and antisense strand of the RNAi agent described herein may each be 16 to 49 nucleotides in length. In some embodiments, the sense strand and antisense strand may independently be 17 to 26 nucleotides in length. The sense strand and antisense strand may be the same length or different lengths. In some embodiments, the sense strand and antisense strand are independently 21 to 26 nucleotides in length. In some embodiments, the sense strand and antisense strand are independently 21 to 24 nucleotides in length. In some embodiments, the sense strand and antisense strand are both 21 nucleotides in length. In some embodiments, the antisense strands are independently 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the sense strands are independently 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides in length. The RNAi agents described herein inhibit expression of one or more beta ENaC genes in vivo and / or in vitro when delivered to cells that express beta ENaC, e.g., lung epithelial cells.

[0015] The beta ENaC RNAi agents disclosed herein target the human beta ENaC gene (see, e.g., SEQ ID NO: 1). In some embodiments, the beta ENaC RNAi agents disclosed herein target a portion of the beta ENaC gene having any of the sequences disclosed in Table 1.

[0016] In another aspect, the present disclosure features a composition (such as a pharmaceutical composition) comprising one or more of the disclosed beta ENaC RNAi agents, which can selectively and efficiently reduce the expression of the beta ENaC gene. The composition comprising one or more of the beta ENaC RNAi agents described herein can be administered to a subject (e.g., a human or animal subject) for the treatment (including prophylaxis or inhibition) of symptoms and diseases associated with increased or elevated ENaC activity (also referred to herein as increased ENaC activity level or elevated ENaC activity level).

[0017] Examples of betaENaC RNAi agent sense and antisense strands that can be used in betaENaC RNAi agents are shown in Tables 3 and 4. Examples of betaENaC RNAi agent duplexes are shown in Tables 5A and 5B. Examples of 19-nucleotide core stretch sequences that may constitute or be included in the sense and antisense strands of certain betaENaC RNAi agents disclosed herein are shown in Table 2.

[0018] In another aspect, the present disclosure features a method for delivering a beta-ENaC RNAi agent to epithelial cells of a subject (e.g., a mammal) in vivo. Compositions used in such methods are also described herein. In some embodiments, the present disclosure provides a method for delivering a beta-ENaC RNAi agent to lung epithelial cells in a subject in vivo. In some embodiments, the subject is a human subject.

[0019] The methods disclosed herein include administering one or more betaENaC RNAi agents to a subject (e.g., a human or animal subject) by any suitable means known in the art. Depending on whether local or systemic treatment is desired, the pharmaceutical compositions disclosed herein comprising one or more betaENaC RNAi agents can be administered in several ways. Administration may be, for example, but is not limited to, intravenous, intraarterial, subcutaneous, intraperitoneal, subcutaneous (e.g., via an implantable device), and intraparenchymal administration. In some embodiments, the pharmaceutical compositions described herein are administered by inhalation (e.g., dry powder inhalation or aerosol inhalation), intranasal administration, intratracheal administration, or oropharyngeal inhalation administration.

[0020] In some embodiments, it is desirable for the beta-ENaC RNAi agents described herein to inhibit expression of the beta-ENaC gene in the pulmonary epithelium, and therefore administration is by inhalation (e.g., via an inhalation device such as a metered dose inhaler, or a nebulizer such as a jet or vibrating mesh nebulizer, or a soft mist inhaler).

[0021] Any oligonucleotide delivery technique known in the art can be used to deliver one or more betaENaC RNAi agents to target cells or tissues. In some embodiments, the betaENaC RNAi agent is delivered to cells or tissues by covalently linking the RNAi agent to a targeting group. In some embodiments, the targeting group can include a cell receptor ligand, such as an integrin targeting ligand. Integrins are a family of transmembrane receptors that promote cell adhesion to the extracellular matrix (ECM). In particular, integrin beta-v-beta-6 (αvβ6) is an epithelial-specific integrin known to be a receptor for ECM proteins and TGF-beta latency-associated peptide (LAP) and is expressed in a variety of cells and tissues. Integrin αvβ6 is known to be highly elevated in damaged lung epithelium. In some embodiments, the betaENaC RNAi agents described herein are conjugated to an integrin targeting ligand with affinity for integrin αvβ6. As referred to herein, an "αvβ6 integrin targeting ligand" is a compound with affinity for integrin αvβ6 that can be used as a ligand to facilitate targeting and delivery of an RNAi agent to a desired cell and / or tissue (i.e., to an integrin αvβ6-expressing cell). In some embodiments, multiple αvβ6 integrin targeting ligands or a cluster of αvβ6 integrin targeting ligands are attached to a beta ENaC RNAi agent. In some embodiments, the beta ENaC RNAi agent-αvβ6 integrin targeting ligand complex is selectively internalized by lung epithelial cells by receptor-mediated endocytosis or other means.

[0022] Examples of targeting groups useful for delivering betaENaC RNAi agents, including αvβ6 integrin targeting ligands, are disclosed, for example, in International Patent Application Publication Nos. WO 2018 / 085415 and WO 2019 / 089765, the contents of each of which are incorporated herein by reference in their entirety.

[0023] The targeting group may be linked to the 3' or 5' end of the sense strand or antisense strand of the betaENaC RNAi agent. In some embodiments, the targeting group is linked to the 3' or 5' end of the sense strand. In some embodiments, the targeting group is linked to the 5' end of the sense strand. In some embodiments, the targeting group is linked to a nucleotide within the sense strand and / or antisense strand of the RNAi agent. In some embodiments, the targeting group is linked to the RNAi agent via a linker.

[0024] In another aspect, the disclosure features a composition that includes one or more BetaENaC RNAi agents having a double-stranded structure disclosed in Tables 5A and 5B.

[0025] The use of beta ENaC RNAi agents provides a method for the therapeutic treatment (including prevention) of diseases or disorders that can be cured by reducing ENaC activity.The beta ENaC RNAi agents disclosed herein can be used to treat various respiratory diseases, such as cystic fibrosis, chronic bronchitis, non-cystic fibrosis bronchiectasis, chronic obstructive pulmonary disease (COPD), asthma, respiratory tract infection, primary ciliary dyskinesia, and lung cancer cystic fibrosis.The beta ENaC RNAi agents can also be used to treat various eye diseases and eye disorders, such as dry eye.Such treatment methods include administering beta ENaC RNAi agents to humans or animals with elevated or increased ENaC activity levels.

[0026] In some embodiments, the beta ENaC RNAi agents disclosed herein comprise: AAGUCGAUGAUGAUCUCCCCA (SEQ ID NO: 194); AGUUGAAGAUGUAACAGUUGC (SEQ ID NO: 195); UUGUUGUAGUCACUGUAGACG (SEQ ID NO: 198); UUGUUGUAGUCACUGUAGAAG (SEQ ID NO: 244); UCGUGUUGUAGUCACUGUAGG (SEQ ID NO: 199); UGUUGUUGCAGUAUUUCUCCC (SEQ ID NO: 201); and UGUUGAAGAUGUAACAGUUGC (SEQ ID NO: 203) The present invention also includes an antisense strand consisting of, consisting essentially of, or comprising a nucleobase sequence that differs by 0 or 1 nucleobase from a nucleotide sequence (5'→3') selected from the group consisting of:

[0027] In some embodiments, the beta ENaC RNAi agents disclosed herein comprise: AAGUCGAUGAUGAUCUCCCCA (SEQ ID NO: 194); AGUUGAAGAUGUAACAGUUGC (SEQ ID NO: 195); UUGUUGUAGUCACUGUAGACG (SEQ ID NO: 198); UUGUUGUAGUCACUGUAGAAG (SEQ ID NO: 244); UCGUGUUGUAGUCACUGUAGG (SEQ ID NO: 199); UGUUGUUGCAGUAUUUCUCCC (SEQ ID NO: 201); and UGUUGAAGAUGUAACAGUUGC (SEQ ID NO: 203) and an antisense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3') selected from the group consisting of:

[0028] In some embodiments, the beta ENaC RNAi agents disclosed herein comprise: AAGUCGAUGAUGAUCUCCCCA (SEQ ID NO: 194); AGUUGAAGAUGUAACAGUUGC (SEQ ID NO: 195); UUGUUGUAGUCACUGUAGACG (SEQ ID NO: 198); UUGUUGUAGUCACUGUAGAAG (SEQ ID NO: 244); UCGUGUUGUAGUCACUGUAGG (SEQ ID NO: 199); UGUUGUUGCAGUAUUUCUCCC (SEQ ID NO: 201); and UGUUGAAGAUGUAACAGUUGC (SEQ ID NO: 203) and an antisense strand consisting of, consisting essentially of, or comprising a nucleobase sequence that differs by 0 or 1 nucleobase from a nucleotide sequence (5'→3') selected from the group consisting of:

[0029] In some embodiments, the beta ENaC RNAi agents disclosed herein comprise: asAfsgsUfcGfaUfgAfuGfaUfcUfcCfcCfsa (SEQ ID NO: 126); asGfsusUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 127); usUfsgsUfuGfuAfgUfcAfcUfgUfaGfaCfsg (SEQ ID NO: 130); usCfsgsUfgUfuGfuAfgUfcAfcUfgUfaGfsg (SEQ ID NO: 131); usGfsusUfgUfuGfcAfgUfaUfuUfcUfcCfsc (SEQ ID NO: 135); cPrpusGfsusUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 138); cPrpuGfuUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 150); cPrpasGfsusUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 153); and cPrpaGfuUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 154) an antisense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3') selected from the group consisting of: In the sequences, a, c, g, and u represent 2'-O-methyl adenosine, 2'-O-methyl cytidine, 2'-O-methyl guanosine, and 2'-O-methyl uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, 2'-fluoro cytidine, 2'-fluoro guanosine, and 2'-fluoro uridine, respectively; cPrpa and cPrpu represent 5'-cyclopropylphosphonate-2'-O-methyl adenosine and 5'-cyclopropylphosphonate-2'-O-methyl uridine, respectively; and s represents a phosphorothioate bond. The sense strand is at least substantially complementary to the antisense strand. Those skilled in the art will appreciate that the inclusion of phosphorothioate linkages, as shown in the modified nucleotide sequences disclosed herein, replaces the phosphodiester linkages typically present in oligonucleotides (see, e.g., Figures 21A-21L, which show all internucleoside linkages).

[0030] In some embodiments, the beta ENaC RNAi agents disclosed herein comprise: (i) an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')usUfsgsUfuGfuAfgUfcAfcUfgUfaGfaCfsg (SEQ ID NO: 130), and a sense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')csgucuacaGfUfGfacuacaacaa (SEQ ID NO: 234); (ii) an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')usCfsgsUfgUfuGfuAfgUfcAfcUfgUfaGfsg (SEQ ID NO: 131), and a sense strand consisting essentially of, or comprising the modified nucleotide sequence (5'→3')cscuacaguGfAfCfuacaacacia (SEQ ID NO: 235); (iii) an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')usGfsusUfgUfuGfcAfgUfaUfuUfcUfcCfsc (SEQ ID NO: 135), and a sense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')gsggagaaaUfAfCfugcaacaaca (SEQ ID NO: 236); (iv) an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3') asGfsusUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 127), and a sense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3') gscaacuguUfAfCfaucuucaacu (SEQ ID NO: 237); (v) an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')asAfsgsUfcGfaUfgAfuGfaUfcUfcCfcCfsa (SEQ ID NO: 126), and a sense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')usggggagaUfCfAfucauciacuu (SEQ ID NO: 238); (vi) an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')cPrpusGfsusUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 138), and a sense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')gscaacuguUfAfCfaucuucaaca (SEQ ID NO: 239); (vii) an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')asGfsusUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 127), and a sense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')gsca_2NacuguUfAfCfaucuucaacu (SEQ ID NO: 240); (viii) an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')cPrpasGfsusUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 153), and a sense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')gscaacuguUfAfCfaucuucaacu (SEQ ID NO: 237); (ix) an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')cPrpuGfuUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 150), and a sense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')gscaacuguUfAfCfaucuucaaca (SEQ ID NO: 239); (x) an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')cPrpaGfuUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 154), and a sense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')gsca_2NacuguUfAfCfaucuucaacu (SEQ ID NO: 240); or (xi) an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')cPrpuGfuUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 150), and a sense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')gsca_2NacuguUfAfCfaucuucaaca (SEQ ID NO: 241); In the sequences, a, c, g, i, and u represent 2'-O-methyladenosine, 2'-O-methylcytidine, 2'-O-methylguanosine, 2'-O-methylinosine, and 2'-O-methyluridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, 2'-fluorocytidine, 2'-fluoroguanosine, and 2'-fluorouridine, respectively; cPrpa and cPrpu represent 5'-cyclopropylphosphonate-2'-O-methyladenosine and 5'-cyclopropylphosphonate-2'-O-methyluridine, respectively; and s represents a phosphorothioate bond.

[0031] In some embodiments, the beta ENaC RNAi agents disclosed herein comprise: (i) an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')usUfsgsUfuGfuAfgUfcAfcUfgUfaGfaCfsg (SEQ ID NO: 130) and a sense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')csgucuacaGfUfGfacuacaacaa (SEQ ID NO: 234); (ii) an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')usCfsgsUfgUfuGfuAfgUfcAfcUfgUfaGfsg (SEQ ID NO: 131) and a sense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')cscuacaguGfAfCfuacaacacia (SEQ ID NO: 235); (iii) an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')usGfsusUfgUfuGfcAfgUfaUfuUfcUfcCfsc (SEQ ID NO: 135) and a sense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')gsggagaaaUfAfCfugcaacaaca (SEQ ID NO: 236); (iv) an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3') asGfsusUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 127) and a sense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3') gscaacuguUfAfCfaucuucaacu (SEQ ID NO: 237); (v) an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')asAfsgsUfcGfaUfgAfuGfaUfcUfcCfcCfsa (SEQ ID NO: 126) and a sense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')usggggagaUfCfAfucauciacuu (SEQ ID NO: 238); (vi) an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')cPrpusGfsusUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 138) and a sense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')gscaacuguUfAfCfaucuucaaca (SEQ ID NO: 239); (vii) an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')asGfsusUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 127) and a sense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')gsca_2NacuguUfAfCfaucuucaacu (SEQ ID NO: 240); (viii) an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')cPrpasGfsusUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 153) and a sense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')gscaacuguUfAfCfaucuucaacu (SEQ ID NO: 237); (ix) an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')cPrpuGfuUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 150) and a sense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')gscaacuguUfAfCfaucuucaaca (SEQ ID NO: 239); (x) an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')cPrpaGfuUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 154) and a sense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')gsca_2NacuguUfAfCfaucuucaacu (SEQ ID NO: 240); or (xi) an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')cPrpuGfuUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 150) and a sense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')gsca_2NacuguUfAfCfaucuucaaca (SEQ ID NO: 241); In the sequences, a, c, g, i, and u represent 2'-O-methyladenosine, 2'-O-methylcytidine, 2'-O-methylguanosine, 2'-O-methylinosine, and 2'-O-methyluridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, 2'-fluorocytidine, 2'-fluoroguanosine, and 2'-fluorouridine, respectively; cPrpa and cPrpu represent 5'-cyclopropylphosphonate-2'-O-methyladenosine and 5'-cyclopropylphosphonate-2'-O-methyluridine, respectively, and s represents a phosphorothioate linkage. Each sense strand further comprises an inverted abasic residue at the 3' end of the nucleotide sequence, and the sense strand also comprises a covalently bound targeting ligand at the 5' end, which comprises an αβ integrin targeting ligand.

[0032] In some embodiments, the beta ENaC RNAi agents disclosed herein comprise: AAGUCGAUGAUGAUCUCCCCA (SEQ ID NO: 194); AGUUGAAGAUGUAACAGUUGC (SEQ ID NO: 195); UUGUUGUAGUCACUGUAGACG (SEQ ID NO: 198); UUGUUGUAGUCACUGUAGAAG (SEQ ID NO: 244); UCGUGUUGUAGUCACUGUAGG (SEQ ID NO: 199); UGUUGUUGCAGUAUUUCUCCC (SEQ ID NO: 201); or UGUUGAAGAUGUAACAGUUGC (SEQ ID NO: 203) and an antisense strand that consists of, consists essentially of, or comprises a nucleotide sequence that differs by 0 or 1 nucleotide from the nucleotide sequence (5'→3') of one of:

[0033] In some embodiments, the beta ENaC RNAi agents disclosed herein comprise: AAGUCGAUGAUGAUCUCCCCA (SEQ ID NO: 194); AGUUGAAGAUGUAACAGUUGC (SEQ ID NO: 195); UUGUUGUAGUCACUGUAGACG (SEQ ID NO: 198); UUGUUGUAGUCACUGUAGAAG (SEQ ID NO: 244); UCGUGUUGUAGUCACUGUAGG (SEQ ID NO: 199); UGUUGUUGCAGUAUUUCUCCC (SEQ ID NO: 201); or UGUUGAAGAUGUAACAGUUGC (SEQ ID NO: 203) an antisense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs by 0 or 1 nucleotide from one of the nucleotide sequences (5'→3') of The beta ENaC RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand, wherein in both the antisense strand and the sense strand, all or substantially all of the nucleotides are modified nucleotides, the sense strand further comprises an inverted abasic residue at the 3' end of the nucleotide sequence, and the sense strand also comprises a targeting ligand covalently attached to its 5' end, wherein the targeting ligand comprises an αvβ6 integrin targeting ligand.

[0034] In some embodiments, the beta ENaC RNAi agents disclosed herein comprise: AAGUCGAUGAUGAUCUCCCCA (SEQ ID NO: 194); AGUUGAAGAUGUAACAGUUGC (SEQ ID NO: 195); UUGUUGUAGUCACUGUAGACG (SEQ ID NO: 198); UUGUUGUAGUCACUGUAGAAG (SEQ ID NO: 244); UCGUGUUGUAGUCACUGUAGG (SEQ ID NO: 199); UGUUGUUGCAGUAUUUCUCCC (SEQ ID NO: 201); or UGUUGAAGAUGUAACAGUUGC (SEQ ID NO: 203) an antisense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs by 0 or 1 nucleotide from one of the nucleotide sequences (5'→3') of The beta ENaC RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand; in both the antisense strand and the sense strand, all or substantially all of the nucleotides are modified nucleotides; the sense strand further comprises an inverted abasic residue at the 3' end of the nucleotide sequence, and the sense strand also comprises a targeting ligand covalently attached to the 5' end, wherein the targeting ligand comprises an αvβ6 integrin targeting ligand; and each antisense strand sequence is located at positions 1-21 of the antisense strand.

[0035] In some embodiments, the BetaENaC RNAi agents disclosed herein comprise an antisense strand and a sense strand, wherein the antisense strand and the sense strand are: UUGUUGUAGUCACUGUAGACG (SEQ ID NO: 198) and CGUCUACAGUGACUACAACAA (SEQ ID NO: 217); or UCGUGUUGUAGUCACUGUAGG (SEQ ID NO: 199) and CCUACAGUGACUACAACACIA (SEQ ID NO: 219) (wherein I represents an inosine (hypoxanthine) nucleotide); or UGUUGUUGCAGUAUUUCUCCC (SEQ ID NO: 201) and GGGAGAAAUACUGCAACAACA (SEQ ID NO: 222); or AGUUGAAGAUGUAACAGUUGC (SEQ ID NO: 195) and GCAACUGUUACAUCUUCAACU (SEQ ID NO: 223); or AAGUCGAUGAUGAUCUCCCCA (SEQ ID NO: 194) and UGGGGAGAUCAUCAUCIACUU (SEQ ID NO: 224) (wherein I represents an inosine (hypoxanthine) nucleotide); or UGUUGAAGAUGUAACAGUUGC (SEQ ID NO: 203) and GCAACUGUUACAUCUUCAACA (SEQ ID NO: 227); or UUGUUGUAGUCACUGUAGAAG (SEQ ID NO: 244) and CUUCUACAGUGACUACAACAA (SEQ ID NO: 245); or AGUUGAAGAUGUAACAGUUGC (SEQ ID NO: 195) and GC(A 2N ) ACUGUUACAUCUUCAACU (SEQ ID NO: 229) (wherein, A 2N represents a 2-aminoadenine-containing nucleotide); or UGUUGAAGAUGUAACAGUUGC (SEQ ID NO: 203) and GC(A 2N ) ACUGUUACAUCUUCAACA (SEQ ID NO: 230) (wherein, A 2N represents a 2-aminoadenine-containing nucleotide) by 0 or 1 nucleotide, and in both the antisense strand and the sense strand, all or substantially all of the nucleotides are modified nucleotides.

[0036] In some embodiments, the BetaENaC RNAi agents disclosed herein comprise an antisense strand and a sense strand, wherein the antisense strand and the sense strand are: UUGUUGUAGUCACUGUAGACG (SEQ ID NO: 198) and CGUCUACAGUGACUACAACAA (SEQ ID NO: 217); or UCGUGUUGUAGUCACUGUAGG (SEQ ID NO: 199) and CCUACAGUGACUACAACACIA (SEQ ID NO: 219) (wherein I represents an inosine (hypoxanthine) nucleotide); or UGUUGUUGCAGUAUUUCUCCC (SEQ ID NO: 201) and GGGAGAAAUACUGCAACAACA (SEQ ID NO: 222); or AGUUGAAGAUGUAACAGUUGC (SEQ ID NO: 195) and GCAACUGUUACAUCUUCAACU (SEQ ID NO: 223); or AAGUCGAUGAUGAUCUCCCCA (SEQ ID NO: 194) and UGGGGAGAUCAUCAUCIACUU (SEQ ID NO: 224); or UGUUGAAGAUGUAACAGUUGC (SEQ ID NO: 203) and GCAACUGUUACAUCUUCAACA (SEQ ID NO: 227); or UUGUUGUAGUCACUGUAGAAG (SEQ ID NO: 244) and CUUCUACAGUGACUACAACAA (SEQ ID NO: 245); or AGUUGAAGAUGUAACAGUUGC (SEQ ID NO: 195) and GC(A 2N ) ACUGUUACAUCUUCAACU (SEQ ID NO: 229) (wherein, A 2N represents a 2-aminoadenine-containing nucleotide); or UGUUGAAGAUGUAACAGUUGC (SEQ ID NO: 203) and GC(A 2N ) ACUGUUACAUCUUCAACA (SEQ ID NO: 230) (wherein, A 2N represents a 2-aminoadenine-containing nucleotide) wherein in both the antisense strand and the sense strand, all or substantially all of the nucleotides are modified nucleotides; the sense strand further comprises an inverted abasic residue at its 3'-terminus; and the sense strand also comprises a targeting ligand covalently attached to its 5'-terminus, wherein the targeting ligand comprises an αvβ6 integrin targeting ligand.

[0037] In some embodiments, the beta ENaC RNAi agents disclosed herein comprise: asAfsgsUfcGfaUfgAfuGfaUfcUfcCfcCfsa (SEQ ID NO: 126); asGfsusUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 127); usUfsgsUfuGfuAfgUfcAfcUfgUfaGfaCfsg (SEQ ID NO: 130); usCfsgsUfgUfuGfuAfgUfcAfcUfgUfaGfsg (SEQ ID NO: 131); usGfsusUfgUfuGfcAfgUfaUfuUfcUfcCfsc (SEQ ID NO: 135); cPrpusGfsusUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 138); cPrpuGfuUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 150); cPrpasGfsusUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 153); and cPrpaGfuUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 154) an antisense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence that differs by 0 or 1 nucleotide from one of the nucleotide sequences (5'→3') of In the sequences, a, c, g, and u represent 2'-O-methyladenosine, 2'-O-methylcytidine, 2'-O-methylguanosine, and 2'-O-methyluridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, 2'-fluorocytidine, 2'-fluoroguanosine, and 2'-fluorouridine, respectively; cPrpa and cPrpu represent 5'-cyclopropylphosphonate-2'-O-methyladenosine and 5'-cyclopropylphosphonate-2'-O-methyluridine, respectively, and s indicates a phosphorothioate linkage; the beta ENaC RNAi agent further includes a sense strand that is at least partially complementary to the antisense strand; and all or substantially all of the nucleotides of the sense strand are modified nucleotides.

[0038] In some embodiments, the beta ENaC RNAi agents disclosed herein comprise: asAfsgsUfcGfaUfgAfuGfaUfcUfcCfcCfsa (SEQ ID NO: 126); asGfsusUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 127); usUfsgsUfuGfuAfgUfcAfcUfgUfaGfaCfsg (SEQ ID NO: 130); usCfsgsUfgUfuGfuAfgUfcAfcUfgUfaGfsg (SEQ ID NO: 131); usGfsusUfgUfuGfcAfgUfaUfuUfcUfcCfsc (SEQ ID NO: 135); cPrpusGfsusUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 138); cPrpuGfuUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 150); cPrpasGfsusUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 153); and cPrpaGfuUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 154) The antisense strand comprises an antisense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence that differs by 0 or 1 nucleotide from one of the nucleotide sequences (5'→3') of the formula (I) in which a, c, g, and u represent 2'-O-methyl adenosine, 2'-O-methyl cytidine, 2'-O-methyl guanosine, and 2'-O-methyl uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, 2'-fluoro cytidine, 2'-fluoro guanosine, and 2'-fluoro uridine, respectively; cPrpa and cPrpu represent 5'-cyclopropylphosphonate-2'-O-methyl adenosine and 5'-cyclopropylphosphonate-2'-O-methyl uridine, respectively, and s represents a phosphorothioate linkage; The RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand; all or substantially all of the nucleotides of the sense strand are modified nucleotides; the sense strand further comprises an inverted abasic residue at the 3' end of the nucleotide sequence, and the sense strand also comprises a targeting ligand covalently attached to the 5' end, wherein the targeting ligand comprises an αvβ6 integrin targeting ligand.

[0039] In some embodiments, the BetaENaC RNAi agents disclosed herein comprise an antisense strand and a sense strand, wherein the antisense strand and the sense strand are: usUfsgsUfuGfuAfgUfcAfcUfgUfaGfaCfsg (SEQ ID NO: 130) and csgucuacaGfUfGfacuacaacaa (SEQ ID NO: 234); usCfsgsUfgUfuGfuAfgUfcAfcUfgUfaGfsg (SEQ ID NO: 131) and cscuacaguGfAfCfuacaacacia (SEQ ID NO: 235); usGfsusUfgUfuGfcAfgUfaUfuUfcUfcCfsc (SEQ ID NO: 135) and gsggagaaaUfAfCfugcaacaaca (SEQ ID NO: 236); asGfsusUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 127) and gscaacuguUfAfCfaucuucaacu (SEQ ID NO: 237); asAfsgsUfcGfaUfgAfuGfaUfcUfcCfcCfsa (SEQ ID NO: 126) and usggggagaUfCfAfucauciacuu (SEQ ID NO: 238); cPrpusGfsusUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 138) and gscaacuguUfAfCfaucuucaaca (SEQ ID NO: 239); asGfsusUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 127) and gsca_2NacuguUfAfCfaucuucaacu (SEQ ID NO: 240); cPrpasGfsusUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 153) and gscaacuguUfAfCfaucuucaacu (SEQ ID NO: 237); cPrpuGfuUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 150) and gscaacuguUfAfCfaucuucaaca (SEQ ID NO: 239); cPrpaGfuUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 154) and gsca_2NacuguUfAfCfaucuucaacu (SEQ ID NO: 240); or cPrpuGfuUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 150) and gsca_2NacuguUfAfCfaucuucaaca (SEQ ID NO: 241) consisting of, consisting essentially of, or comprising a modified nucleotide sequence that differs by zero or one nucleotide from one of the nucleotide sequence (5'→3') pairs of In the sequences, a, c, g, i, and u represent 2'-O-methyladenosine, 2'-O-methylcytidine, 2'-O-methylguanosine, 2'-O-methylinosine, and 2'-O-methyluridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, 2'-fluorocytidine, 2'-fluoroguanosine, and 2'-fluorouridine, respectively; cPrpa and cPrpu represent 5'-cyclopropylphosphonate-2'-O-methyladenosine and 5'-cyclopropylphosphonate-2'-O-methyluridine, respectively, and s indicates a phosphorothioate bond.

[0040] In some embodiments, the BetaENaC RNAi agents disclosed herein comprise an antisense strand and a sense strand, wherein the antisense strand and the sense strand are: usUfsgsUfuGfuAfgUfcAfcUfgUfaGfaCfsg (SEQ ID NO: 130) and csgucuacaGfUfGfacuacaacaa (SEQ ID NO: 234); usCfsgsUfgUfuGfuAfgUfcAfcUfgUfaGfsg (SEQ ID NO: 131) and cscuacaguGfAfCfuacaacacia (SEQ ID NO: 235); usGfsusUfgUfuGfcAfgUfaUfuUfcUfcCfsc (SEQ ID NO: 135) and gsggagaaaUfAfCfugcaacaaca (SEQ ID NO: 236); asGfsusUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 127) and gscaacuguUfAfCfaucuucaacu (SEQ ID NO: 237); asAfsgsUfcGfaUfgAfuGfaUfcUfcCfcCfsa (SEQ ID NO: 126) and usggggagaUfCfAfucauciacuu (SEQ ID NO: 238); cPrpusGfsusUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 138) and gscaacuguUfAfCfaucuucaaca (SEQ ID NO: 239); asGfsusUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 127) and gsca_2NacuguUfAfCfaucuucaacu (SEQ ID NO: 240); cPrpasGfsusUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 153) and gscaacuguUfAfCfaucuucaacu (SEQ ID NO: 237); cPrpuGfuUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 150) and gscaacuguUfAfCfaucuucaaca (SEQ ID NO: 239); cPrpaGfuUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 154) and gsca_2NacuguUfAfCfaucuucaacu (SEQ ID NO: 240); or cPrpuGfuUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 150) and gsca_2NacuguUfAfCfaucuucaaca (SEQ ID NO: 241) consisting of, consisting essentially of, or comprising a nucleotide sequence that differs by 0 or 1 nucleotide from one of the nucleotide sequence (5'→3') pairs of In the sequences, a, c, g, i, and u represent 2'-O-methyladenosine, 2'-O-methylcytidine, 2'-O-methylguanosine, 2'-O-methylinosine, and 2'-O-methyluridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, 2'-fluorocytidine, 2'-fluoroguanosine, and 2'-fluorouridine, respectively; cPrpa and cPrpu represent 5'-cyclopropylphosphonate-2'-O-methyladenosine and 5'-cyclopropylphosphonate-2'-O-methyluridine, respectively; s indicates a phosphorothioate linkage; the sense strand further comprises an inverted abasic residue at the 3' end of the nucleotide sequence; and the sense strand also comprises a targeting ligand covalently bound to the 5' end, wherein the targeting ligand comprises an αβ integrin targeting ligand.

[0041] In some embodiments, the beta ENaC RNAi agents disclosed herein comprise: AAGUCGAUGAUGAUCUCCC (SEQ ID NO: 60); AGUUGAAGAUGUAACAGUU (SEQ ID NO: 15); UUGUUGUAGUCACUGUAGA (SEQ ID NO: 27); UCGUGUUGUAGUCACUGUA (SEQ ID NO: 30); UGUUGUUGCAGUAUUUCUC (SEQ ID NO: 53); or UGUUGAAGAUGUAACAGUU (SEQ ID NO: 16) and an antisense strand comprising a nucleobase sequence that differs by 0 or 1 nucleobase from the nucleotide sequence (5'→3') selected from the group consisting of:

[0042] In some embodiments, the beta ENaC RNAi agents disclosed herein comprise: AAGUCGAUGAUGAUCUCCC (SEQ ID NO: 60); AGUUGAAGAUGUAACAGUU (SEQ ID NO: 15); UUGUUGUAGUCACUGUAGA (SEQ ID NO: 27); UCGUGUUGUAGUCACUGUA (SEQ ID NO: 30); UGUUGUUGCAGUAUUUCUC (SEQ ID NO: 53); or UGUUGAAGAUGUAACAGUU (SEQ ID NO: 16) and an antisense strand comprising a nucleobase sequence that differs by 0 or 1 nucleobase from the nucleotide sequence (5'→3') selected from the group consisting of:

[0043] In some embodiments, the betaENaC RNAi agents disclosed herein comprise: AAGUCGAUGAUGAUCUCCC (SEQ ID NO: 60); AGUUGAAGAUGUAACAGUU (SEQ ID NO: 15); UUGUUGUAGUCACUGUAGA (SEQ ID NO: 27); UCGUGUUGUAGUCACUGUA (SEQ ID NO: 30); UGUUGUUGCAGUAUUUCUC (SEQ ID NO: 53); or UGUUGAAGAUGUAACAGUU (SEQ ID NO: 16) The antisense strand comprises a nucleobase sequence that differs by 0 or 1 nucleobase from a nucleotide sequence (5'→3') selected from the group consisting of: wherein all or substantially all of the nucleotides are modified nucleotides. Each sequence is located at positions 1 to 19 (5'→3') of the antisense strand.

[0044] In some embodiments, the BetaENaC RNAi agents disclosed herein comprise an antisense strand and a sense strand, wherein the antisense strand and the sense strand are each: UUGUUGUAGUCACUGUAGA (SEQ ID NO: 27) and UCUACAGUGACUACAACAA (SEQ ID NO: 80); or UCGUGUUGUAGUCACUGUA (SEQ ID NO: 30) and UACAGUGACUACAACACIA (SEQ ID NO: 86) (wherein I represents an inosine (hypoxanthine) nucleotide); or UGUUGUUGCAGUAUUUCUC (SEQ ID NO: 53) and GAGAAAUACUGCAACAACA (SEQ ID NO: 106); or AGUUGAAGAUGUAACAGUU (SEQ ID NO: 15) and AACUGUUACAUCUUCAACU (SEQ ID NO: 68); or AAGUCGAUGAUGAUCUCCC (SEQ ID NO: 60) and GGGAGAUCAUCAUCIACUU (SEQ ID NO: 115) (wherein I represents an inosine (hypoxanthine) nucleotide); or UGUUGAAGAUGUAACAGUU (SEQ ID NO: 16) and AACUGUUACAUCUUCAACA (SEQ ID NO: 69); or AGUUGAAGAUGUAACAGUU (SEQ ID NO: 15) and (A 2N ) ACUGUUACAUCUUCAACU (SEQ ID NO: 242) (wherein, A 2N represents a 2-aminoadenine-containing nucleotide); or UGUUGAAGAUGUAACAGUU (SEQ ID NO: 16) and (A 2N ) ACUGUUACAUCUUCAACA (SEQ ID NO: 243) (wherein, A 2N represents a 2-aminoadenine-containing nucleotide) The nucleic acid sequence comprises a nucleic acid sequence that differs by 0 or 1 nucleic acid base from a nucleotide sequence (5'→3') pair selected from the group consisting of:

[0045] In some embodiments, the BetaENaC RNAi agents disclosed herein comprise an antisense strand and a sense strand, wherein the antisense strand and the sense strand are each: UUGUUGUAGUCACUGUAGA (SEQ ID NO: 27) and UCUACAGUGACUACAACAA (SEQ ID NO: 80); UCGUGUUGUAGUCACUGUA (SEQ ID NO: 30) and UACAGUGACUACAACACIA (SEQ ID NO: 86) (in the sequences, I represents an inosine (hypoxanthine) nucleotide); UGUUGUUGCAGUAUUUCUC (SEQ ID NO: 53) and GAGAAAUACUGCAACAACA (SEQ ID NO: 106); AGUUGAAGAUGUAACAGUU (SEQ ID NO: 15) and AACUGUUACAUCUUCAACU (SEQ ID NO: 68); AAGUCGAUGAUGAUCUCCC (SEQ ID NO: 60) and GGGAGAUCAUCAUCIACUU (SEQ ID NO: 115) (in the sequences, I represents an inosine (hypoxanthine) nucleotide); UGUUGAAGAUGUAACAGUU (SEQ ID NO: 16) and AACUGUUACAUCUUCAACA (SEQ ID NO: 69); AGUUGAAGAUGUAACAGUU (SEQ ID NO: 15) and (A 2N ) ACUGUUACAUCUUCAACU (SEQ ID NO: 242) (wherein, A 2N represents a 2-aminoadenine-containing nucleotide); and UGUUGAAGAUGUAACAGUU (SEQ ID NO: 16) and (A 2N ) ACUGUUACAUCUUCAACA (SEQ ID NO: 243) (wherein, A 2N represents a 2-aminoadenine-containing nucleotide) The nucleic acid sequence comprises a nucleobase sequence that differs by 0 or 1 nucleobase from a nucleotide sequence (5'→3') pair selected from the group consisting of: wherein all or substantially all of the nucleotides are modified nucleotides.

[0046] As used herein, the terms "oligonucleotide" and "polynucleotide" refer to a polymer of linked nucleosides, each of which may independently be modified or unmodified.

[0047] As used herein, an "RNAi agent" (also referred to as an "RNAi trigger") refers to a composition comprising an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule that can reduce or inhibit (e.g., under appropriate conditions) translation of an mRNA transcript of a target messenger RNA (mRNA) in a sequence-specific manner. As used herein, an RNAi agent may operate via the RNA interference mechanism (i.e., by inducing RNA interference by interacting with the RNA interference pathway machinery (RNA-induced silencing complex, or RISC) in mammalian cells) or any alternative mechanism or pathway. While RNAi agents, as the term is used herein, are considered to operate primarily via the RNA interference mechanism, the disclosed RNAi agents are not constrained or limited to any particular pathway or mechanism of action. The RNAi agents disclosed herein are composed of a sense strand and an antisense strand and include, but are not limited to, small (or small) interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), and Dicer substrates. The antisense strand of the RNAi agent described herein is at least partially complementary to the targeted mRNA (i.e., beta ENaC mRNA). The RNAi agent may contain one or more modified nucleotides and / or one or more non-phosphodiester linkages.

[0048] As used herein, the terms "silence," "reduce," "inhibit," "reduce," or "knock down," when referring to the expression of a given gene, mean that expression of that gene, as measured at the level of RNA transcribed from the gene or at the level of the polypeptide, protein, or protein subunit translated from the mRNA, in a cell, group of cells, tissue, organ, or subject in which the gene is transcribed, is reduced when the cell, group of cells, tissue, organ, or subject is treated with an RNAi agent as described herein, compared to a second cell, group of cells, tissue, organ, or subject that is not so treated.

[0049] As used herein, the terms "sequence" and "nucleotide sequence" mean a sequence or order of nucleic acid bases or nucleotides, written as a sequence of letters using standard nomenclature.

[0050] As used herein, "base," "nucleotide base," or "nucleobase" refers to a heterocyclic pyrimidine or purine compound that is a component of a nucleotide, including the primary purine bases adenine and guanine, and the primary pyrimidine bases cytosine, thymine, and uracil. Nucleobases may be further modified to include, but are not limited to, universal bases, hydrophobic bases, promiscuous bases, extended bases, and fluorinated bases (see, for example, Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008). The synthesis of such modified nucleobases (including phosphoramidite compounds containing modified nucleobases) is known in the art.

[0051] As used herein, unless otherwise specified, the term "complementary" when used to describe a first nucleic acid base or nucleotide sequence (e.g., the sense strand of an RNAi agent or a targeted mRNA) in relation to a second nucleic acid base or nucleotide sequence (e.g., the antisense strand of an RNAi agent or a single-stranded antisense oligonucleotide) refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize (form base-pair hydrogen bonds under mammalian physiological conditions (or other suitable in vivo or in vitro conditions)) with an oligonucleotide comprising the second nucleotide sequence to form a double-stranded or double-helical structure under specific standard conditions. Those skilled in the art can select the optimal set of conditions for hybridization testing. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs and include natural or modified nucleotides or nucleotide mimics, at least to the extent that the above hybridization requirements are met. Sequence identity or complementarity is independent of modifications. For example, a and Af, as defined herein, are complementary to U (or T) and identical to A for purposes of determining identity or complementarity.

[0052] As used herein, "perfectly complementary" or "fully complementary" means that in a hybridized pair of nucleic acid base or nucleotide sequence molecules, all (100%) of the bases in a contiguous sequence of a first oligonucleotide hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence may include all or a portion of the first or second nucleotide sequence.

[0053] As used herein, "partially complementary" means that in a hybridized pair of nucleic acid base or nucleotide sequence molecules, at least 70% (but not all) of the bases in a contiguous sequence of a first oligonucleotide hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence may include all or a portion of the first or second nucleotide sequence.

[0054] As used herein, "substantially complementary" means that in a hybridized pair of nucleic acid base or nucleotide sequence molecules, at least 85% (but not all) of the bases in a contiguous sequence of a first oligonucleotide hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence may include all or a portion of the first or second nucleotide sequence.

[0055] As used herein, the terms "complementary," "fully complementary," "partially complementary," and "substantially complementary" are used to refer to nucleobase or nucleotide matches between the sense and antisense strands of an RNAi agent, or between the antisense strand of an RNAi agent and the sequence of betaENaC mRNA.

[0056] As used herein, the term "substantially identical" or "substantially identical" when applied to nucleic acid sequences means that a nucleotide sequence (or a portion of a nucleotide sequence) has at least about 85% sequence identity or higher (e.g., at least 90%, at least 95%, or at least 99%) identity compared to a reference sequence. The percentage of sequence identity is determined by comparing two optimally aligned sequences over a comparison window. The percentage is calculated by determining the number of positions where the same type of nucleobase occurs in both sequences to determine the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window, and multiplying the result by 100 to determine the percentage of sequence identity. The invention disclosed herein encompasses nucleotide sequences that are substantially identical to those disclosed herein.

[0057] As used herein, the terms "treat," "treatment," and the like refer to methods or steps taken to obtain relief or reduction in the number, severity, and / or frequency of one or more symptoms of a disease in a subject. As used herein, "treat" and "treatment" can encompass prevention, management, prophylactic treatment, and / or inhibition or reduction in the number, severity, and / or frequency of one or more symptoms of a disease in a subject.

[0058] As used herein, the phrase "introducing into a cell" when referring to an RNAi agent means functionally delivering the RNAi agent into the cell. The phrase "functionally delivering" means delivering the RNAi agent into the cell in such a manner that the RNAi agent can have the expected biological activity, for example, sequence-specific inhibition of gene expression.

[0059] Unless otherwise stated, symbols used herein [ka] The use of means that any group may be attached thereto in accordance with the scope of the invention described herein.

[0060] As used herein, the term "isomers" refers to compounds that have identical molecular formulae but differ in the nature or sequence of bonding of their atoms or the arrangement of their atoms in space. Isomers that differ in the arrangement of their atoms in space are called "stereoisomers." Stereoisomers that are not mirror images of one another are called "diastereomers," and stereoisomers that are non-superimposable mirror images are called "enantiomers" or sometimes optical isomers. A carbon atom bonded to four non-identical substituents is called a "chiral center."

[0061] As used herein, unless specifically identified in the structure as having a particular configuration, for each structure in which asymmetric centers exist, giving rise to enantiomers, diastereomers, or other stereoisomeric configurations, each structure disclosed herein is intended to represent all such possible isomers, including their optically pure and racemic forms. For example, the structures disclosed herein are intended to encompass mixtures of diastereomers as well as single stereoisomers.

[0062] As used in the claims herein, the phrase "consisting of" excludes any element, step, or ingredient not specified in the claim. As used in the claims herein, the phrase "consisting essentially of" limits the claim to the specified materials or steps and those that do not materially affect the basic and novel characteristics of the claimed invention.

[0063] Those skilled in the art will readily understand and appreciate that the compounds and compositions disclosed herein may have certain atoms (e.g., N, O, or S atoms) in a protonated or deprotonated state depending on the environment in which the compound or composition is placed. Therefore, as used herein, the structures disclosed herein contemplate that certain functional groups, such as OH, SH, or NH, may be protonated or deprotonated. As those skilled in the art will readily understand, the disclosure herein is intended to encompass the disclosed compounds and compositions regardless of their protonation state based on the environment (e.g., pH). Similarly, compounds described herein that have a labile proton or basic atom also represent salt forms of the corresponding compounds. The compounds described herein may be in the free acid, free base, or salt form. Pharmaceutically acceptable salts of the compounds described herein are within the scope of the present invention.

[0064] As used herein, the terms "linked" or "bonded," when referring to a connection between two compounds or molecules, mean that the two compounds or molecules are covalently linked. Unless otherwise stated, the terms "linked" and "bonded," as used herein, may refer to a connection between a first compound and a second compound with or without any intervening atom or group of atoms.

[0065] As used herein, the term "including" is used herein to mean, and is used interchangeably with, the phrase "including but not limited to." The term "or" is used herein to mean, and is used interchangeably with, "and / or," unless the context clearly indicates otherwise.

[0066] Unless otherwise defined, all scientific and technical terms used herein have the same meaning as commonly understood by those skilled in the art. Although methods and materials similar or equivalent to those described herein can be used to practice or test the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated herein by reference in their entirety. In case of conflict, the present specification, including definitions, will prevail. Additionally, the materials, methods, and examples are illustrative only and are not intended to be limiting.

[0067] Other objects, features, aspects, and advantages of the present invention will become apparent from the following detailed description, the accompanying drawings, and the claims. [Brief explanation of the drawings]

[0068] [Figure 1] FIG. 1 depicts the chemical structure of a tridentate αvβ6 epithelial cell targeting ligand, referred to herein as tri-SM2.

[0069] [Figure 2] FIG. 2 depicts the chemical structure of a tridentate αvβ6 epithelial cell targeting ligand, herein referred to as tri-SM1.

[0070] [Figure 3] FIG. 3 depicts the chemical structure of a tridentate αvβ6 epithelial cell targeting ligand, referred to herein as tri-SM6.1.

[0071] [Figure 4] FIG. 4 depicts the chemical structure of a tridentate αvβ6 epithelial cell targeting ligand, referred to herein as tri-SM9.

[0072] [Figure 5] FIG. 5 depicts the chemical structure of a tridentate αvβ6 epithelial cell targeting ligand, referred to herein as tri-SM6.

[0073] [Figure 6]FIG. 6 depicts the chemical structure of a tridentate αvβ6 epithelial cell targeting ligand, herein referred to as tri-SM8.

[0074] [Figure 7] FIG. 7 depicts the chemical structure of a tridentate αvβ6 epithelial cell targeting ligand, referred to herein as tri-SM10.

[0075] [Figure 8] FIG. 8 depicts the chemical structure of a tridentate αvβ6 epithelial cell targeting ligand, referred to herein as tri-SM11.

[0076] [Figure 9] Figure 9 shows mucociliary clearance levels in sheep administered the beta ENaC RNAi agent AD06598 conjugated at the 5' end of the sense strand to a tridentate small molecule αvβ6 epithelial cell targeting ligand (tri-SM6.1) formulated in isotonic saline (described in further detail in Example 6).

[0077] [Figure 10] Figure 10 shows mucociliary clearance levels in sheep administered the beta ENaC RNAi agent AD07217 conjugated at the 5' end of the sense strand to a tridentate small molecule αvβ6 epithelial cell targeting ligand (tri-SM6.1) (referred to as "APERC-7") formulated in isotonic saline (described in further detail in Examples 8 and 11).

[0078] [Figure 11] Figure 11 shows the mucociliary clearance levels in sheep administered the beta ENaC RNAi agent AD07099 conjugated at the 5' end of the sense strand to a tridentate small molecule αvβ6 epithelial cell targeting ligand (tri-SM6.1) (referred to as "APERC-5") formulated in isotonic saline (described in further detail in Examples 7 and 11).

[0079] [Figure 12]Figure 12 shows mucociliary clearance levels in sheep administered the beta ENaC RNAi agent AD07255 conjugated at the 5' end of the sense strand to a tridentate small molecule αvβ6 epithelial cell targeting ligand (tri-SM6.1) (referred to as "APERC-16") formulated in isotonic saline (described in further detail in Example 10).

[0080] [Figure 13] Figure 13 shows mucociliary clearance levels in sheep administered the beta ENaC RNAi agent AD07253 conjugated at the 5' end of the sense strand to a tridentate small molecule αvβ6 epithelial cell targeting ligand (tri-SM6.1) (referred to as "APERC-14") formulated in isotonic saline (described in further detail in Example 10).

[0081] [Figure 14] Figure 14 shows mucociliary clearance levels in sheep administered the beta ENaC RNAi agent AD07252 conjugated at the 5' end of the sense strand to a tridentate small molecule αvβ6 epithelial cell targeting ligand (tri-SM6.1) (referred to as "APERC-13") formulated in isotonic saline (described in further detail in Example 10).

[0082] [Figure 15] Figure 15 shows mucociliary clearance levels in sheep administered the beta ENaC RNAi agent AD07251 conjugated at the 5' end of the sense strand to a tridentate small molecule αvβ6 epithelial cell targeting ligand (tri-SM6.1) (referred to as "APERC-12") formulated in isotonic saline (described in further detail in Example 9).

[0083] [Figure 16] Figure 16 shows mucociliary clearance levels in sheep administered the beta ENaC RNAi agent AD07250 conjugated at the 5' end of the sense strand to a tridentate small molecule αvβ6 epithelial cell targeting ligand (tri-SM6.1) (referred to as "APERC-11") formulated in isotonic saline (described in further detail in Example 9).

[0084] [Figure 17] Figure 17 shows mucociliary clearance levels in sheep administered the beta ENaC RNAi agent AD07240 conjugated at the 5' end of the sense strand to a tridentate small molecule αvβ6 epithelial cell targeting ligand (tri-SM6.1) (referred to as "APERC-10") formulated in isotonic saline (described in further detail in Example 9).

[0085] [Figure 18] Figure 18 shows mucociliary clearance levels in sheep administered the beta ENaC RNAi agent AD06599 conjugated at the 5' end of the sense strand to a tridentate small molecule αvβ6 epithelial cell targeting ligand (tri-SM6.1) (referred to as "APERC-9") formulated in isotonic saline (described in further detail in Example 8).

[0086] [Figure 19] Figure 19 shows mucociliary clearance levels in sheep administered the beta ENaC RNAi agent AD07217 conjugated at the 5' end of the sense strand to a tridentate small molecule αvβ6 epithelial cell targeting ligand (tri-SM6.1) using a cysteine-maleimide linker (referred to as "APERC-8") formulated in isotonic saline (described in further detail in Example 8).

[0087] [Figure 20] Figure 20 shows mucociliary clearance levels in sheep administered the beta ENaC RNAi agent AD06598 conjugated at the 5' end of the sense strand to a tridentate small molecule αvβ6 epithelial cell targeting ligand (tri-SM6.1) (referred to as "APERC-2") formulated in isotonic saline (described in further detail in Example 7).

[0088] [Figure 21A]Figure 21A is a schematic diagram of modified sense and antisense strands of beta ENaC RNAi agent AD06495 (see Tables 3, 4, 5A, and 5B), with a (TriAlk14) linking group (see Table 6 for chemical structure) located at the 5' end of the sense strand to facilitate linkage to one or more targeting ligands (e.g., those shown in Figures 1-8 herein). The following abbreviations are used in Figures 21A-21L: a, c, g, and u are 2'-O-methyl modified nucleotides; Af, Cf, Gf, and Uf are 2'-fluoro modified nucleotides; o is a phosphodiester bond; s is a phosphorothioate bond; invAb is an inverted abasic residue (see Table 6); and a_2N is a 2'-O-methyl-2-aminoadenosine modified nucleotide (see Table 6). cPrpa is a 5'-cyclopropylphosphonate-2'-O-methyladenosine modified nucleotide (see Table 6). cPrpu is a 5'-cyclopropylphosphonate-2'-O-methyluridine modified nucleotide.

[0089] [Figure 21B] Figure 21B is a schematic diagram of modified sense and antisense strands of beta ENaC RNAi agent AD06497 (see Tables 3, 4, 5A, 5B), with a (TriAlk14) linking group (see Table 6 for chemical structure) located at the 5' end of the sense strand to facilitate linkage to one or more targeting ligands (e.g., those shown in Figures 1-8 herein).

[0090] [Figure 21C] Figure 21C is a schematic diagram of modified sense and antisense strands of the beta ENaC RNAi agent AD06501 (see Tables 3, 4, 5A, 5B), with a (TriAlk14) linking group (see Table 6 for chemical structure) located at the 5' end of the sense strand to facilitate linkage to one or more targeting ligands (e.g., those shown in Figures 1-8 herein).

[0091] [Figure 21D]Figure 21D is a schematic diagram of modified sense and antisense strands of beta ENaC RNAi agent AD06598 (see Tables 3, 4, 5A, 5B), with a (TriAlk14) linking group (see Table 6 for chemical structure) located at the 5' end of the sense strand to facilitate linkage to one or more targeting ligands (e.g., those shown in Figures 1-8 herein).

[0092] [Figure 21E] Figure 21E is a schematic diagram of modified sense and antisense strands of the beta ENaC RNAi agent AD06599 (see Tables 3, 4, 5A, 5B), with a (TriAlk14) linking group (see Table 6 for chemical structure) located at the 5' end of the sense strand to facilitate linkage to one or more targeting ligands (e.g., those shown in Figures 1-8 herein).

[0093] [Figure 21F] Figure 21F is a schematic diagram of modified sense and antisense strands of beta ENaC RNAi agent AD07099 (see Tables 3, 4, 5A, 5B), with a (TriAlk14) linking group (see Table 6 for chemical structure) located at the 5' end of the sense strand to facilitate linkage to one or more targeting ligands (e.g., those shown in Figures 1-8 herein).

[0094] [Figure 21G] Figure 21G is a schematic diagram of modified sense and antisense strands of the beta ENaC RNAi agent AD07217 (see Tables 3, 4, 5A, 5B), with an (NH2-C6) linking group (see Table 6 for chemical structure) located at the 5' end of the sense strand to facilitate linkage to one or more targeting ligands (e.g., those shown in Figures 1-8 herein).

[0095] [Figure 21H]Figure 21H is a schematic diagram of modified sense and antisense strands of beta ENaC RNAi agent AD07482 (see Tables 3, 4, 5A, 5B), with a (TriAlk14) linking group (see Table 6 for chemical structure) located at the 5' end of the sense strand to facilitate linkage to one or more targeting ligands (e.g., those shown in Figures 1-8 herein).

[0096] [Figure 21I] Figure 21I is a schematic diagram of modified sense and antisense strands of beta ENaC RNAi agent AD07250 (see Tables 3, 4, 5A, 5B), with a (TriAlk14) linking group (see Table 6 for chemical structure) located at the 5' end of the sense strand to facilitate linkage to one or more targeting ligands (e.g., those shown in Figures 1-8 herein).

[0097] [Figure 21J] Figure 21J is a schematic diagram of modified sense and antisense strands of beta ENaC RNAi agent AD07240 (see Tables 3, 4, 5A, 5B), with a (TriAlk14) linking group (see Table 6 for chemical structure) located at the 5' end of the sense strand to facilitate linkage to one or more targeting ligands (e.g., those shown in Figures 1-8 herein).

[0098] [Figure 21K] Figure 21K is a schematic diagram of modified sense and antisense strands of beta ENaC RNAi agent AD07453 (see Tables 3, 4, 5A, 5B), with an (NH2-C6) linking group (see Table 6 for chemical structure) located at the 5' end of the sense strand to facilitate linkage to one or more targeting ligands (e.g., those shown in Figures 1-8 herein).

[0099] [Figure 21L]Figure 21L is a schematic diagram of modified sense and antisense strands of beta ENaC RNAi agent AD07255 (see Tables 3, 4, 5A, 5B), with a (TriAlk14) linking group (see Table 6 for chemical structure) located at the 5' end of the sense strand to facilitate linkage to one or more targeting ligands (e.g., those shown in Figures 1-8 herein).

[0100] [Figure 22] 22 depicts the chemical structure in free acid form of a tridentate αvβ6 epithelial cell targeting ligand designated herein as Tri-SM6.1 (referred to herein as (TriSM6.1-avb6-TA14)), linked to a TriAlk14 scaffold linker, wherein: [ka] contains a beta-ENaC RNAi agent.

[0101] [Figure 23] 23 depicts the chemical structure in free acid form of a tridentate αβ epithelial cell targeting ligand herein designated tri-SM6.1, linked to a TriAlk14 scaffold linker further comprising a cysteine-maleimide linker, wherein: [ka] contains a beta-ENaC RNAi agent.

[0102] [Figure 24] FIG. 24 shows the relative mRNA expression of human beta-ENaC (SCNN1B) in cultured primary normal human bronchial epithelial cells transfected with beta-ENaC RNAi agents (described in further detail in Example 12) (error bars not shown).

[0103] [Figures 25A-25D] Figures 25A-25D depict the chemical structure of the beta-ENaC RNAi agent AD07482 (referred to as "APERC-7"), shown in its free acid form, linked to a tridentate small molecule αvβ6 epithelial cell targeting ligand (tri-SM6.1) at the 5' end of the sense strand.

[0104] [Figures 26A-26D] Figures 26A-26D depict the chemical structure of the beta-ENaC RNAi agent AD07482 (referred to as "APERC-7") in its sodium salt form, linked to a tridentate small molecule αvβ6 epithelial cell targeting ligand (tri-SM6.1) at the 5' end of the sense strand.

[0105] [Figures 27A-27D] Figures 27A-27D depict the chemical structure of the beta-ENaC RNAi agent AD07099 (referred to as "APERC-5"), shown in its free acid form, linked to a tridentate small molecule αvβ6 epithelial cell targeting ligand (tri-SM6.1) at the 5' end of the sense strand.

[0106] [Figures 28A-28D] Figures 28A-28D depict the chemical structure of the beta-ENaC RNAi agent AD07099 (referred to as "APERC-5") in its sodium salt form, linked to a tridentate small molecule αvβ6 epithelial cell targeting ligand (tri-SM6.1) at the 5' end of the sense strand.

[0107] [Figures 29A-29D] Figures 29A-29D depict the chemical structure of the beta-ENaC RNAi agent AD06599 (referred to as "APERC-9") shown in its free acid form, linked to a tridentate small molecule αvβ6 epithelial cell targeting ligand (tri-SM6.1) at the 5' end of the sense strand.

[0108] [Figures 30A-30D] Figures 30A-30D depict the chemical structure of the beta-ENaC RNAi agent AD06599 (referred to as "APERC-9") in sodium salt form conjugated to a tridentate small molecule αvβ6 epithelial cell targeting ligand (tri-SM6.1) at the 5' end of the sense strand. DETAILED DESCRIPTION OF THE INVENTION

[0109] RNAi agents Described herein are RNAi agents (referred to herein as betaENaC RNAi agents or betaENaC RNAi triggers) that inhibit expression of the betaENaC (i.e., SCNN1B) gene. Each betaENaC RNAi agent disclosed herein comprises a sense strand and an antisense strand. The sense strand and antisense strand may each be 16-49 nucleotides in length. The sense strand and antisense strand may be the same length or different lengths. In some embodiments, the sense strand and antisense strand are each independently 18-27 nucleotides in length. In some embodiments, both the sense strand and antisense strand are each 21-26 nucleotides in length. In some embodiments, the sense strand and antisense strand are each 21-24 nucleotides in length. In some embodiments, the sense strand and antisense strand are each independently 19-21 nucleotides in length. In some embodiments, the sense strand is approximately 19 nucleotides in length and the antisense strand is approximately 21 nucleotides in length. In some embodiments, the sense strand is approximately 21 nucleotides in length and the antisense strand is approximately 23 nucleotides in length. In some embodiments, the sense strand is 23 nucleotides long, and the antisense strand is 21 nucleotides long.In some embodiments, both the sense strand and the antisense strand are 21 nucleotides long.In some embodiments, the sense strand and the antisense strand of the RNAi agent are each independently 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, or 39 nucleotides long.In some embodiments, the double-stranded RNAi agent has a duplex length of about 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides.

[0110] Exemplary nucleotide sequences used to form betaENaC RNAi agents are shown in Tables 2, 3, and 4. Exemplary RNAi agent duplexes comprising the sense and antisense strand sequences of Tables 2, 3, and 4 are shown in Tables 5A and 5B.

[0111] In some embodiments, the region of complete, substantial, or partial complementarity between the sense strand and the antisense strand is 16 to 26 (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26) nucleotides in length and is located at or near the 5' end of the antisense strand (e.g., the region can be 0, 1, 2, 3, or 4 nucleotides away from the 5' end of the antisense strand that are not complete, substantial, or partial complementarity).

[0112] The sense strand of the beta ENaC RNAi agent described herein comprises at least 16 consecutive nucleotides that are at least 85% identical to the core stretch sequence of the same number of nucleotides in the beta ENaC mRNA (also referred to herein as "core stretch" or "core sequence"). In some embodiments, the sense strand core stretch sequence is 100% (fully) complementary or at least about 85% (substantially) complementary to the core stretch sequence of the antisense strand. Thus, the sense strand core stretch sequence is typically completely identical or at least about 85% identical to the nucleotide sequence of the same length present in the beta ENaC mRNA target (sometimes referred to as, for example, the target sequence). In some embodiments, the sense strand core stretch is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, the sense strand core stretch is 17 nucleotides in length. In some embodiments, the sense strand core stretch is 19 nucleotides in length.

[0113] The antisense strand of the beta ENaC RNAi agent described herein comprises at least 16 consecutive nucleotides that are at least 85% complementary to a core stretch of the same number of nucleotides in the beta ENaC mRNA and a core stretch of the same number of nucleotides in the corresponding sense strand. In some embodiments, the antisense strand core stretch is 100% (fully) complementary or at least about 85% (substantially) complementary to a nucleotide sequence of the same length (e.g., target sequence) present in the beta ENaC mRNA target. In some embodiments, the antisense strand core stretch is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, the antisense strand core stretch is 19 nucleotides in length. In some embodiments, the antisense strand core stretch is 17 nucleotides in length. The sense strand core stretch sequence may be the same length as the corresponding antisense core sequence, or may be a different length.

[0114] The sense and antisense strands of the beta ENaC RNAi agent anneal to form a duplex. The sense and antisense strands of the beta ENaC RNAi agent may be partially complementary, substantially complementary, or fully complementary to each other. Within the complementary duplex region, the sense strand core stretch sequence is at least 85% complementary or 100% complementary to the antisense core stretch sequence. In some embodiments, the sense strand core stretch sequence comprises a sequence of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that is at least 85% or 100% complementary to a corresponding 16, 17, 18, 19, 20, 21, 22, or 23 nucleotide sequence of the antisense strand core stretch sequence (i.e., the sense and antisense core stretch sequences of a BetaENaC RNAi agent have a region of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that are at least 85% paired bases, or 100% paired bases).

[0115] In some embodiments, the antisense strand of a BetaENaC RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2 or Table 3. In some embodiments, the sense strand of a BetaENaC RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 2 or Table 4.

[0116] In some embodiments, the sense strand and / or the antisense strand may independently comprise 1, 2, 3, 4, 5, or 6 additional nucleotides (extensions) at the 3'-end, 5'-end, or both the 3'-end and 5'-end of the core stretch sequence. The additional nucleotides (if present) in the antisense strand may or may not be complementary to the corresponding sequence in the beta ENaC mRNA. The additional nucleotides (if present) in the sense strand may or may not be identical to the corresponding sequence in the beta ENaC mRNA. The additional nucleotides (if present) in the antisense strand may or may not be complementary to the corresponding additional nucleotides (if present) in the sense strand.

[0117] As used herein, an extension comprises 1, 2, 3, 4, 5, or 6 nucleotides at the 5' and / or 3' ends of the sense strand core stretch sequence and / or the antisense strand core stretch sequence. The extension nucleotides of the sense strand may or may not be complementary to the nucleotides (core stretch sequence nucleotides or extension nucleotides) in the corresponding antisense strand. Conversely, the extension nucleotides of the antisense strand may or may not be complementary to the nucleotides (core stretch nucleotides or extension nucleotides) in the corresponding sense strand. In some embodiments, both the sense strand and the antisense strand of an RNAi agent comprise 3'- and 5'-terminal extensions. In some embodiments, one or more of the 3'-terminal extension nucleotides of one strand base pairs with one or more 5'-terminal extension nucleotides of the other strand. In other embodiments, one or more of the 3'-terminal extension nucleotides of one strand do not base pair with one or more 5'-terminal extension nucleotides of the other strand. In some embodiments, the beta ENaC RNAi agent has an antisense strand with a 3'-end extension and a sense strand with a 5'-end extension.In some embodiments, the extension nucleotide is not paired and forms a protrusion.As used herein, " protrusion " refers to a stretch of one or more unpaired nucleotides located at the end of sense strand or antisense strand, which does not form part of the hybridization or double-strand formation part of the RNAi agent disclosed herein.

[0118] In some embodiments, the beta ENaC RNAi agent comprises an antisense strand with a 3'-end extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In other embodiments, the beta ENaC RNAi agent comprises an antisense strand with a 3'-end extension of 1, 2, or 3 nucleotides in length. In some embodiments, one or more of the extended nucleotides of the antisense strand comprise nucleotides that are complementary to the corresponding beta ENaC mRNA sequence. In some embodiments, one or more of the extended nucleotides of the antisense strand comprise nucleotides that are not complementary to the corresponding beta ENaC mRNA sequence.

[0119] In some embodiments, the beta ENaC RNAi agent comprises a sense strand with a 3'-end extension of 1, 2, 3, 4 or 5 nucleotides in length.In some embodiments, one or more of the extension nucleotides of the sense strand comprise adenosine, uracil, or thymidine nucleotide, AT dinucleotide, or the nucleotide corresponding to or identical to the nucleotide in the beta ENaC mRNA sequence.In some embodiments, the 3'-end extension of the sense strand comprises or consists of, but is not limited to, one of the following sequences: T, UT, TT, UU, UUT, TTT, or TTTT (listed from 5' to 3', respectively).

[0120] The sense strand may have a 3'-end extension and / or a 5'-end extension.In some embodiments, the beta ENaC RNAi agent comprises a sense strand with a 5'-end extension of 1, 2, 3, 4, 5, or 6 nucleotides in length.In some embodiments, one or more of the extended nucleotides of the sense strand comprise the nucleotides corresponding to or identical to the nucleotides in the beta ENaC mRNA sequence.

[0121] Exemplary sequences used to form betaENaC RNAi agents are shown in Tables 2, 3, and 4. In some embodiments, the antisense strand of a betaENaC RNAi agent comprises any of the sequences in Table 2 or 3. In certain embodiments, the antisense strand of a betaENaC RNAi agent comprises, or consists of, any one of the modified sequences in Table 3. In some embodiments, the antisense strand of a betaENaC RNAi agent comprises the sequence of nucleotides 1-17, 2-15, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, or 2-21 (5' end to 3' end) of any of the sequences in Table 2 or 3. In some embodiments, the sense strand of a betaENaC RNAi agent comprises any of the sequences in Table 2 or 4. In some embodiments, the sense strand of a betaENaC RNAi agent comprises the sequence of nucleotides 1-18, 1-19, 1-20, 1-21, 2-19, 2-20, 2-21, 3-20, 3-21, or 4-21 (5' end to 3' end) of any of the sequences in Table 2 or 4. In certain embodiments, the sense strand of a betaENaC RNAi agent comprises, or alternatively consists of, a modified sequence of any one of the modified sequences in Table 4.

[0122] In some embodiments, the sense and antisense strands of an RNAi agent described herein comprise the same number of nucleotides. In some embodiments, the sense and antisense strands of an RNAi agent described herein comprise different numbers of nucleotides. In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of an RNAi agent form blunt ends. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of an RNAi agent form blunt ends. In some embodiments, both ends of an RNAi agent form blunt ends. In some embodiments, neither end of an RNAi agent is blunt. As used herein, "blunt end" refers to the ends of a double-stranded RNAi agent in which the terminal nucleotides of the two annealed strands are complementary (form complementary base pairs).

[0123] In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of an RNAi agent form frayed ends. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of an RNAi agent form frayed ends. In some embodiments, both ends of an RNAi agent form frayed ends. In some embodiments, neither end of an RNAi agent forms a frayed end. As used herein, "frayed end" refers to the end of a double-stranded RNAi agent in which the terminal nucleotides of the two annealed strands are paired (i.e., do not form an overhang) but are not complementary (i.e., form a non-complementary pair). In some embodiments, one or more unpaired nucleotides at the end of one strand of a double-stranded RNAi agent form an overhang. The unpaired nucleotides may form a 3' or 5' overhang on the sense strand or the antisense strand. In some embodiments, the RNAi agent comprises a blunt end and a frayed end, a blunt end and a 5' overhang, a blunt end and a 3' overhang, a frayed end and a 5' overhang, a frayed end and a 3' overhang, two 5' overhangs, two 3' overhangs, a 5' overhang and a 3' overhang, two frayed ends, or two blunt ends. Typically, the overhangs (if present) are located at the 3' end of the sense strand, the antisense strand, or both the sense and antisense strands.

[0124] The betaENaC RNAi agent disclosed herein may be composed of one or more modified nucleotides. In some embodiments, substantially all nucleotides of the sense strand and substantially all nucleotides of the antisense strand of the betaENaC RNAi agent are modified nucleotides. The betaENaC RNAi agent disclosed herein may further be composed of one or more modified internucleoside linkages (e.g., one or more phosphorothioate linkages). In some embodiments, the betaENaC RNAi agent comprises one or more modified nucleotides and one or more modified internucleoside linkages. In some embodiments, 2'-modified nucleotides are combined with modified internucleoside linkages.

[0125] In some embodiments, the beta ENaC RNAi agent is prepared or provided as a salt, mixed salt, or free acid. In some embodiments, the beta ENaC RNAi agent is prepared as a sodium salt. Such forms known in the art are within the scope of the invention disclosed herein. Modified Nucleotides

[0126] When used in various oligonucleotide constructs, modified nucleotides can enhance the serum stability of these compounds while preserving their activity within cells, and can also minimize the potential for eliciting interferon activity in humans when the oligonucleotide construct is administered.

[0127] In some embodiments, the betaENaC RNAi agent comprises one or more modified nucleotides. As used herein, a "modified nucleotide" is a nucleotide other than a ribonucleotide (2'-hydroxyl nucleotide). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%) of the nucleotides are modified nucleotides. As used herein, modified nucleotides can include, but are not limited to, deoxyribonucleotides, nucleotide mimics, abasic nucleotides, 2'-modified nucleotides, inverted nucleotides, modified nucleobase-containing nucleotides, bridged nucleotides, peptide nucleic acids (PNAs), 2',3'-seconucleotide mimics (unlocked nucleobase analogues), locked nucleotides, 3'-O-methoxy (2' internucleoside linkage) nucleotides, 2'-F-arabinonucleotides, 5'-Me, 2'-fluoronucleotides, morpholino nucleotides, vinylphosphonate deoxyribonucleotides, vinylphosphonate-containing nucleotides, and cyclopropylphosphonate-containing nucleotides. 2'-modified nucleotides (i.e., nucleotides having a group other than a hydroxyl group at the 2' position of the five-membered sugar ring) include, but are not limited to, 2'-O-methyl nucleotides (also referred to as 2'-methoxy nucleotides), 2'-fluoro nucleotides (also referred to as 2'-deoxy-2'-fluoro nucleotides herein), 2'-deoxy nucleotides, 2'-methoxyethyl (2'-O-2-methoxylethyl) nucleotides (also referred to as 2'-MOE), 2'-amino nucleotides, and 2'-alkyl nucleotides. Not all positions of a given compound need to be uniformly modified. Conversely, two or more modifications may be incorporated into one beta ENaC RNAi agent, or even into one nucleotide thereof.The sense and antisense strands of a betaENaC RNAi agent can be synthesized and / or modified by methods known in the art, and the modification of one nucleotide is independent of the modification of another nucleotide.

[0128] Modified nucleobases include synthetic and natural nucleobases, such as 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines (e.g., 2-aminopropyladenine, 5-propynyluracil, or 5-propynylcytosine), 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, inosine, xanthine, hypoxanthine, 2-aminoadenine, 6-alkyl (e.g., 6-methyl, 6-ethyl, 6-isopropyl, or 6-n-butyl) derivatives of adenine and guanine, 2-alkyl (e.g., 2-methyl, 2-ethyl, 2-isopropyl, or 2-n-butyl) and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-methyl-, 2-methyl-, 2-methyl-, 2-methyl-, 2-methyl-, 2-methyl-, 2-isopropyl-, or 2-n-butyl-, and other alkyl derivatives of adenine and guanine ...methyl-, 2-methyl-, 2-methyl-, 2 uracil, 2-thiothymine, 2-thiocytosine, 5-halouracil, cytosine, 5-propynyluracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-sulfhydryl, 8-thioalkyl, 8-hydroxyl, and other 8-substituted adenines and guanines, 5-halo (e.g., 5-bromo), 5-trifluoromethyl, and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, and 3-deazaadenine.

[0129] In some embodiments, the 5'-end and / or 3'-end of the antisense strand may contain an abasic residue (Ab) (sometimes referred to as an "abasic site" or "abasic nucleotide"). An abasic residue (Ab) is a nucleotide or nucleoside lacking the 1'-position nucleobase of the sugar moiety (see, e.g., U.S. Pat. No. 5,998,203). In some embodiments, the abasic residue may be located within the nucleotide sequence. In some embodiments, Ab or AbAb may be added to the 3'-end of the antisense strand. In some embodiments, the 5'-end of the sense strand may contain one or more additional abasic residues (e.g., (Ab) or (AbAb)). In some embodiments, UUAb, UAb, or Ab is added to the 3'-end of the sense strand. In some embodiments, the abasic (deoxyribose) residue may be replaced with a ribitol (abasic ribose) residue.

[0130] In some embodiments, all or substantially all nucleotides of an RNAi agent are modified nucleotides.As used herein, an RNAi agent in which substantially all nucleotides present are modified nucleotides is an RNAi agent in which four or fewer (i.e., 0, 1, 2, 3, or 4) nucleotides are ribonucleotides (i.e., unmodified) in both the sense strand and the antisense strand.As used herein, a sense strand in which substantially all nucleotides present are modified nucleotides is a sense strand in which two or fewer (i.e., 0, 1, or 2) nucleotides in the sense strand are unmodified ribonucleotides.As used herein, an antisense strand in which substantially all nucleotides present are modified nucleotides is an antisense strand in which two or fewer (i.e., 0, 1, or 2) nucleotides in the sense strand are unmodified ribonucleotides.In some embodiments, one or more nucleotides of an RNAi agent are unmodified ribonucleotides.The chemical structures of certain modified nucleotides are shown in Table 6 herein. Modified internucleoside linkages

[0131] In some embodiments, one or more nucleotides of a BetaENaC RNAi agent are linked by a non-standard bond or backbone (ie, a modified internucleoside bond or a modified backbone). Modified internucleoside linkages or backbones include, but are not limited to, phosphorothioate groups (represented herein as a lowercase "s"), chiral phosphorothioates, thiophosphates, phosphorodithioates, phosphotriesters, aminoalkyl-phosphotriesters, alkylphosphonates (e.g., methylphosphonates or 3'-alkylenephosphonates), chiral phosphonates, phosphinates, phosphoramidates (e.g., 3'-aminophosphoramidate, aminoalkylphosphoramidate, or thionophosphoramidate), thionoalkylphosphonates, thionoalkylphosphotriesters, morpholino linkages, boranophosphates with normal 3'-5' linkages, 2'-5' linked analogs of boranophosphates, and boranophosphates with inverted polarity in which adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. In some embodiments, the modified internucleoside linkage or backbone does not have a phosphorus atom. Modified internucleoside linkages that do not have a phosphorus atom include, but are not limited to, short-chain alkyl or cycloalkyl intersugar linkages, mixed heteroatom and alkyl or cycloalkyl intersugar linkages, or one or more short-chain heteroatom or heterocyclic intersugar linkages. In some embodiments, modified internucleoside backbones include, but are not limited to, siloxane backbones, sulfide backbones, sulfoxide backbones, sulfone backbones, formacetyl and thioformacetyl backbones, methyleneformacetyl and thioformacetyl backbones, alkene-containing backbones, sulfamate backbones, methyleneimino and methylenehydrazino backbones, sulfonate and sulfonamide backbones, amide backbones, and other backbones with mixed N, O, S, and CH moieties.

[0132] In some embodiments, the sense strand of a betaENaC RNAi agent may include 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, the antisense strand of a betaENaC RNAi agent may include 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, or the sense strand and antisense strand may independently include 1, 2, 3, 4, 5, or 6 phosphorothioate linkages. In some embodiments, the sense strand of a betaENaC RNAi agent may include 1, 2, 3, or 4 phosphorothioate linkages, the antisense strand of a betaENaC RNAi agent may include 1, 2, 3, or 4 phosphorothioate linkages, or the sense strand and antisense strand may independently include 1, 2, 3, or 4 phosphorothioate linkages.

[0133] In some embodiments, the sense strand of a betaENaC RNAi agent contains at least two phosphorothioate internucleoside linkages. In some embodiments, the phosphorothioate internucleoside linkages are between nucleotides 1-3 from the 3' end of the sense strand. In some embodiments, one phosphorothioate internucleoside linkage is at the 5' end of the sense strand nucleotide sequence and another phosphorothioate linkage is at the 3' end of the sense strand nucleotide sequence. In some embodiments, two phosphorothioate internucleoside linkages are located at the 5' end of the sense strand and another phosphorothioate linkage is located at the 3' end of the sense strand. In some embodiments, the sense strand does not contain phosphorothioate internucleoside linkages between nucleotides, but does contain one, two, or three phosphorothioate linkages between the terminal nucleotides at both the 5' and 3' ends, and an optional inverted abasic residue end cap. In some embodiments, the targeting ligand is linked to the sense strand by a phosphorothioate linkage.

[0134] In some embodiments, the antisense strand of a betaENaC RNAi agent comprises four phosphorothioate internucleoside linkages. In some embodiments, the four phosphorothioate internucleoside linkages are located between nucleotides 1-3 from the 5' end of the antisense strand and between nucleotides 19-21, 20-22, 21-23, 22-24, 23-25, or 24-26 from the 5' end of the antisense strand. In some embodiments, three phosphorothioate internucleoside linkages are located between positions 1-4 from the 5' end of the antisense strand, and a fourth phosphorothioate internucleoside linkage is located between positions 20-21 from the 5' end of the antisense strand. In some embodiments, the betaENaC RNAi agent comprises at least three or four phosphorothioate internucleoside linkages in the antisense strand. Capping residues or moieties

[0135] In some embodiments, the sense strand may include one or more capping residues or moieties (sometimes referred to in the art as "caps," "terminal caps," or "capping residues"). As used herein, a "capping residue" is a non-nucleotide compound or other moiety that can be incorporated at one or more ends of a nucleotide sequence of an RNAi agent disclosed herein. Capping residues can, in some cases, confer certain beneficial properties to the RNAi agent, such as protection from exonuclease degradation. In some embodiments, an inverted abasic residue (invAb) (also referred to in the art as an "inverted abasic site") is added as a capping residue (see Table A) (see, e.g., F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16). Capping residues are generally known in the art and include, for example, inverted abasic residues, as well as carbon chains, such as terminal C3H7 (propyl), C6H 13 (hexyl), or C 12 H 25(dodecyl) group. In some embodiments, the capping residue may be present at the 5'-end, the 3'-end, or both the 5'-end and the 3'-end of the sense strand. In some embodiments, the 5'-end and / or the 3'-end of the sense strand may contain two or more inverted abasic deoxyribose moieties as capping residues.

[0136] In some embodiments, one or more inverted abasic residues (invAb) are added to the 3'-end of the sense strand. In some embodiments, one or more inverted abasic residues (invAb) are added to the 5'-end of the sense strand. In some embodiments, one or more inverted abasic residues or inverted abasic sites are inserted between the targeting ligand and the nucleotide sequence of the sense strand of the RNAi agent. In some embodiments, including one or more inverted abasic residues or inverted abasic sites at or near one or more terminal ends of the sense strand of the RNAi agent results in greater activity or other desirable properties of the RNAi agent.

[0137] In some embodiments, one or more inverted abasic residues (invAb) are added to the 5' end of the sense strand. In some embodiments, one or more inverted abasic residues may be inserted between the targeting ligand and the nucleotide sequence of the sense strand of the RNAi agent. The inverted abasic residues may be linked by phosphate, phosphorothioate (e.g., referred to herein as (invAb)s), or other internucleoside linkages. In some embodiments, including one or more inverted abasic residues at or near one or both ends of the sense strand of the RNAi agent may result in greater activity or other desirable properties of the RNAi agent. In some embodiments, an inverted abasic (deoxyribose) residue may be replaced with an inverted ribitol (abasic ribose) residue. In some embodiments, the 3' end of the antisense strand core stretch sequence or the 3' end of the antisense strand sequence may contain an inverted abasic residue. The chemical structures of inverted abasic deoxyribose residues are shown in Table 6 below. Beta-ENaC RNAi Agents

[0138] The beta ENaC RNAi agents disclosed herein are designed to target specific positions of the beta ENaC gene (e.g., SEQ ID NO: 1 (GenBank NM_000336.2), SEQ ID NO: 2 (GenBank NM_000336.3)). As defined herein, the antisense strand sequence is designed to target a specific position of the beta ENaC gene when the 5'-terminal nucleobase of the antisense strand aligns with a position 19 nucleotides downstream (towards the 3' end) from the specific position on the gene when base-pairing with the beta ENaC gene. For example, as shown in Tables 1 and 2 herein, an antisense strand sequence designed to target position 987 of the beta ENaC gene must align with position 1005 of the beta ENaC gene when base-pairing with the gene.

[0139] As provided herein, a betaENaC RNAi agent does not require that the nucleobase at position 1 (5'→3') of the antisense strand be complementary to the gene, provided there is at least 85% complementarity (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity) between the antisense strand and the gene over a core stretch sequence of at least 16 contiguous nucleotides. For example, for a betaENaC RNAi agent disclosed herein designed to target position 987 of the betaENaC gene, the 5'-terminal nucleobase of the antisense strand of the betaENaC RNAi agent must align with position 1005 of the gene. However, the 5'-terminal nucleobase of the antisense strand may, but need not, be complementary to position 1005 of the beta ENaC gene, provided there is at least 85% complementarity between the antisense strand and the gene (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity) over a core stretch sequence of at least 16 contiguous nucleotides. As particularly demonstrated by the various examples disclosed herein, the specific site of binding of a gene by the antisense strand of a beta ENaC RNAi agent is an important factor in the level of inhibition achieved by the beta ENaC RNAi agent (e.g., whether the beta ENaC RNAi agent is designed to target position 987, 1296, 1798, or some other position of the beta ENaC gene).

[0140] In some embodiments, the betaENaC RNAi agents disclosed herein target the betaENaC gene at or near the location of a betaENaC sequence shown in Table 1. In some embodiments, the antisense strand of a betaENaC RNAi agent disclosed herein comprises a core stretch sequence that is fully, substantially, or at least partially complementary to the 19-mer sequence of a target betaENaC disclosed in Table 1. [Table 1]

[0141] In some embodiments, a Beta ENaC RNAi agent comprises an antisense strand in which position 19 (5' to 3') of the antisense strand can base pair with position 1 of a 19-base long target sequence disclosed in Table 1. In some embodiments, a Beta ENaC agent comprises an antisense strand in which position 1 (5' to 3') of the antisense strand can base pair with position 19 of a 19-base long target sequence disclosed in Table 1.

[0142] In some embodiments, the beta ENaC agent comprises an antisense strand in which position 2 (5' to 3') of the antisense strand can base pair with position 18 of a 19-base long target sequence disclosed in Table 1. In some embodiments, the beta ENaC agent comprises an antisense strand in which positions 2-18 (5' to 3') of the antisense strand can base pair with each of the complementary bases located at positions 18-2 of a 19-base long target sequence disclosed in Table 1.

[0143] In the RNAi agents disclosed herein, the nucleotide at position 1 (5'->3') of the antisense strand may be perfectly complementary to the beta ENaC gene or may be non-complementary to the beta ENaC gene. In some embodiments, the nucleotide at position 1 (5'->3') of the antisense strand is U, A, or dT. In some embodiments, the nucleotide at position 1 (5'->3') of the antisense strand forms an A:U or U:A base pair with the sense strand.

[0144] In some embodiments, the antisense strand of a betaENaC RNAi agent comprises the sequence of nucleotides 2-18 or 2-19 (5' to 3') of any of the antisense strand sequences in Table 2 or Table 3. In some embodiments, the sense strand of a betaENaC RNAi agent comprises the sequence of nucleotides 1-17, 1-18, or 2-18 (5' to 3') of any of the sense strand sequences in Table 2 or Table 4.

[0145] In some embodiments, the betaENaC RNAi agent is comprised of (i) an antisense strand comprising the sequence of nucleotides 2-18 or 2-19 (5' end to 3' end) of any of the antisense strand sequences in Table 2 or Table 3, and (ii) a sense strand comprising the sequence of nucleotides 1-17 or 1-18 (5' end to 3' end) of any of the sense strand sequences in Table 2 or Table 4.

[0146] In some embodiments, the betaENaC RNAi agent comprises a 19-base core nucleotide sequence shown in Table 2 below. [Table 2-1] [Table 2-2] [Table 2-3]

[0147] A BetaENaC RNAi agent sense and antisense strand comprising or consisting of a nucleotide sequence in Table 2 may be modified or unmodified nucleotides. In some embodiments, a BetaENaC RNAi agent having a sense and antisense strand comprising or consisting of any of the nucleotide sequences in Table 2 is all or substantially all modified nucleotides.

[0148] In some embodiments, the antisense strand of a BetaENaC RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2. In some embodiments, the sense strand of a BetaENaC RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 2.

[0149] As used herein, each N shown in the sequences disclosed in Table 2 may be independently selected from any and all nucleobases (including those found in both modified and unmodified nucleotides). In some embodiments, the N nucleotides shown in the sequences disclosed in Table 2 have a nucleobase that is complementary to the N nucleotides at the corresponding positions in the other strand. In some embodiments, the N nucleotides shown in the sequences disclosed in Table 2 have a nucleobase that is not complementary to the N nucleotides at the corresponding positions in the other strand. In some embodiments, the N shown in the sequences disclosed in Table 2 have the same nucleobase as the N nucleotides at the corresponding positions in the other strand. In some embodiments, the N shown in the sequences disclosed in Table 2 have a different nucleobase than the N nucleotides at the corresponding positions in the other strand.

[0150] Particular modified betaENaC RNAi agent sense and antisense strands are shown in Tables 3 and 4. Modified betaENaC RNAi agent antisense strands and their underlying unmodified nucleobase sequences are shown in Table 3. Modified betaENaC RNAi agent sense strands and their underlying unmodified nucleobase sequences are shown in Table 4. In forming a betaENaC RNAi agent, each of the nucleotides in each of the underlying base sequences shown in Tables 2 and 3 and 4 above may be a modified nucleotide.

[0151] The antisense strand is annealed to the sense strand to form a BetaENaC RNAi agent as described herein. A sense strand containing a sequence shown in Table 2 or Table 4 may hybridize with any antisense strand containing a sequence shown in Table 2 or Table 3, provided that the two sequences have a region of at least 85% complementarity spanning a sequence of 16, 17, 18, 19, 20, or 21 contiguous nucleotides.

[0152] In some embodiments, the antisense strand of the betaENaC RNAi agent comprises the nucleotide sequence of any of the sequences in Table 2 or Table 3.

[0153] In some embodiments, the betaENaC RNAi agent comprises or consists of a duplex having the sense and antisense nucleobase sequences of any of the sequences in Table 2, Table 3, or Table 4.

[0154] Examples of antisense strands containing modified nucleotides are shown in Table 3. Examples of sense strands containing modified nucleotides are shown in Table 4.

[0155] As used in Tables 3 and 4, the following symbols are used to denote modified nucleotides, targeting groups, and linking groups: A = adenosine-3'-phosphate C = cytidine-3'-phosphate G = guanosine-3'-phosphate U = uridine-3'-phosphate I = inosine-3'-phosphate a = 2'-O-methyladenosine-3'-phosphate as = 2'-O-methyladenosine-3'-phosphorothioate c = 2'-O-methylcytidine-3'-phosphate cs = 2'-O-methylcytidine-3'-phosphorothioate g = 2'-O-methylguanosine-3'-phosphate gs = 2'-O-methylguanosine-3'-phosphorothioate i = 2'-O-methylinosine-3'-phosphate is = 2'-O-methylinosine-3'-phosphorothioate t = 2'-O-methyl-5-methyluridine-3'-phosphate ts = 2'-O-methyl-5-methyluridine-3'-phosphorothioate u = 2'-O-methyluridine-3'-phosphate us = 2'-O-methyluridine-3'-phosphorothioate Af = 2'-fluoroadenosine-3'-phosphate Afs = 2'-fluoroadenosine-3'-phosphorothioate Cf = 2'-fluorocytidine-3'-phosphate Cfs = 2'-fluorocytidine-3'-phosphorothioate Gf = 2'-fluoroguanosine-3'-phosphate Gfs = 2'-fluoroguanosine-3'-phosphorothioate Tf = 2'-fluoro-5'-methyluridine-3'-phosphate Tfs = 2'-fluoro-5'-methyluridine-3'-phosphorothioate Uf = 2'-fluorouridine-3'-phosphate Ufs = 2'-fluorouridine-3'-phosphorothioate dT = 2'-deoxythymidine-3'-phosphate A UNA = 2',3'-secoadenosine-3'-phosphate A UNA s = 2',3'-secoadenosine-3'-phosphorothioate C UNA = 2',3'-secocytidine-3'-phosphate C UNA s = 2',3'-secocytidine-3'-phosphorothioate G UNA = 2',3'-secoguanosine-3'-phosphate G UNA s = 2',3'-secoguanosine-3'-phosphorothioate U UNA = 2',3'-secouridine-3'-phosphate U UNA s = 2',3'-secouridine-3'-phosphorothioate a_2N = See Table 6 a_2Ns = See Table 6 (invAb) = inverted abasic deoxyribonucleotide-5'-phosphate (see Table 6) (invAb)s = inverted abasic deoxyribonucleotide-5'-phosphorothioate (see Table 6) s = phosphorothioate bond p = terminal phosphate (synthetic) vpdN = vinylphosphonate deoxyribonucleotide cPrpa = 5'-cyclopropylphosphonate-2'-O-methyladenosine-3'-phosphate (see Table 6) cPrpas = 5'-cyclopropylphosphonate-2'-O-methyladenosine-3'-phosphorothioate (see Table 6) cPrpu = 5'-cyclopropylphosphonate-2'-O-methyluridine-3'-phosphate (see Table 6) cPrpus = 5'-cyclopropylphosphonate-2'-O-methyluridine-3'-phosphorothioate (see Table 6) aAlk = 2'-O-propargyl adenosine-3'-phosphate (see Table 6) aAlks = 2'-O-propargyl adenosine-3'-phosphorothioate (see Table 6) cAlk = 2'-O-propargylcytidine-3'-phosphate (see Table 6) cAlks = 2'-O-propargylcytidine-3'-phosphorothioate (see Table 6) gAlk = 2'-O-propargylguanosine-3'-phosphate (see Table 6) gAlks = 2'-O-propargylguanosine-3'-phosphorothioate (see Table 6) tAlk = 2'-O-propargyl-5-methyluridine-3'-phosphate (see Table 6) tAlks = 2'-O-propargyl-5-methyluridine-3'-phosphorothioate (see Table 6) uAlk = 2'-O-propargyluridine-3'-phosphate (see Table 6) uAlks = 2'-O-propargyluridine-3'-phosphorothioate (see Table 6) (Alk-SS-C6) = See Table 6 (C6-SS-Alk) = See Table 6 (C6-SS-C6) = See Table 6 (6-SS-6) = See Table 6 (C6-SS-Alk-Me) = See Table 6 (NH2-C6) = See Table 6 (TriAlk#) = See Table 6 (TriAlk#)s = See Table 6

[0156] As those skilled in the art will readily understand, unless otherwise indicated by the sequence (e.g., by a phosphorothioate linkage "s"), when present in an oligonucleotide, nucleotide monomers are linked to each other by 5'-3'-phosphodiester bonds. As those skilled in the art will clearly understand, the inclusion of phosphorothioate linkages shown in the modified nucleotide sequences disclosed herein replaces phosphodiester linkages typically present in oligonucleotides. Furthermore, as those skilled in the art will readily understand, the terminal nucleotide at the 3' end of a given oligonucleotide sequence will typically have a hydroxyl (-OH) group at each 3' position of the given monomer ex vivo in place of a phosphate moiety. Also, for the embodiments disclosed herein, when viewing each strand from 5' to 3', inverted abasic residues are inserted such that the 3' position of the deoxyribose is linked at the 3' end of the preceding monomer on each strand (see, e.g., Table 6). Furthermore, as one of ordinary skill in the art will readily understand and appreciate, while the phosphorothioate chemical structures depicted herein typically depict the anion on the sulfur atom, the invention disclosed herein encompasses all phosphorothioate tautomers (e.g., those in which the sulfur atom bears a double bond and the anion is an oxygen atom). Unless otherwise expressly indicated herein, this understanding of the skilled artisan will be used when describing the beta ENaC RNAi agents and compositions of beta ENaC RNAi agents disclosed herein.

[0157] Examples of specific targeting groups and linking groups for use with the BetaENaC RNAi agents disclosed herein are included in the chemical structures shown below in Table 6. Each sense and / or antisense strand may have any of the targeting or linking groups shown herein, as well as other targeting or linking groups attached to the 5' and / or 3' ends of the sequence. [Table 3-1] [Table 3-2] [Table 4-1] [Table 4-2]

[0158] The beta ENaC RNAi agents disclosed herein are formed by annealing an antisense strand with a sense strand. A sense strand containing a sequence shown in Table 2 or Table 4 can be hybridized with any antisense strand containing a sequence shown in Table 2 or Table 3, provided that the two sequences have a region of at least 85% complementarity spanning a sequence of 16, 17, 18, 19, 20, or 21 contiguous nucleotides.

[0159] As shown in Table 4 above, certain exemplary betaENaC RNAi agent nucleotide sequences are shown to further include a reactive linking group at one or both of the 5' and 3' ends of the sense strand. For example, many of the betaENaC RNAi agent sense strand sequences shown in Table 4 above have an (NH2-C6) or (TriAlk14) linking group at the 5' end of the nucleotide sequence. Similarly, some exemplary betaENaC RNAi agent sense strand nucleotide sequences shown in Table 4 above have a (6-SS-6) or (C6-SS-C6) linking group at the 3' end of the nucleotide sequence. Such reactive linking groups are positioned to facilitate the attachment of targeting ligands, targeting groups, and / or PK / PD modulators to the betaENaC RNAi agents disclosed herein. Ligation or conjugation reactions are well known in the art and result in the formation of a covalent bond between two molecules or reactants. Suitable coupling reactions for use within the scope of the invention herein include, but are not limited to, amide coupling reactions, Michael addition reactions, hydrazone formation reactions, inverse electron demand Diels-Alder cycloaddition reactions, oxime ligation, and copper(I)-catalyzed or strain-promoted azide-alkyne cycloaddition reactions.

[0160] In some embodiments, targeting ligands, such as the integrin targeting ligands shown in the examples and figures disclosed herein, may be synthesized as activated esters, such as tetrafluorophenyl (TFP) esters, substituted with a reactive amino group (e.g., NH2-C6) to enable conjugation of the targeting ligand to a betaENaC RNAi agent disclosed herein. In some embodiments, the targeting ligand is synthesized as an azide that can be attached to a propargyl (e.g., TriAlk14) or DBCO group, for example, via copper(I)-catalyzed or strain-promoted azide-alkyne cycloaddition.

[0161] Additionally, certain nucleotide sequences shown in Table 4 above were synthesized with a dT nucleotide at the 3' end of the sense strand followed by a (3'→5') linker (e.g., C6-SS-C6) (see, e.g., AM10033-SS, AM10293-SS, AM10364-SS, and AM10365-SS). The linker can, in some embodiments, facilitate conjugation with additional components (e.g., a PK / PD modulator or one or more targeting ligands). As described herein, the C6-SS-C6 disulfide bond is first reduced to remove the dT from the molecule, which can then facilitate attachment of the desired PK / PD modulator. Thus, the terminal dT nucleotide is not part of the fully conjugated construct.

[0162] In some embodiments, the antisense strand of a BetaENaC RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 3. In some embodiments, the sense strand of a BetaENaC RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 4.

[0163] In some embodiments, the antisense strand of a betaENaC RNAi agent comprises the nucleotide sequence of any of the sequences in Table 2 or Table 3. In some embodiments, the antisense strand of a betaENaC RNAi agent comprises the sequence of nucleotides 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, or 2-24 (5' end to 3' end) of any of the sequences in Table 2 or Table 3. In certain embodiments, the antisense strand of a betaENaC RNAi agent comprises, or alternatively consists of, a modified sequence of any one of the modified sequences in Table 3.

[0164] In some embodiments, the sense strand of a betaENaC RNAi agent comprises the nucleotide sequence of any of the sequences in Table 2 or Table 4. In some embodiments, the sense strand of a betaENaC RNAi agent comprises the sequence of nucleotides 1-17, 2-17, 3-17, 4-17, 1-18, 2-18, 3-18, 4-18, 1-19, 2-19, 3-19, 4-19, 1-20, 2-20, 3-20, 4-20, 1-21, 2-21, 3-21, 4-21, 1-22, 2-22, 3-22, 4-22, 1-23, 2-23, 3-23, 4-23, 1-24, 2-24, 3-24, or 4-24 (5' end to 3' end) of any of the sequences in Table 2 or Table 4. In certain embodiments, the sense strand of a BetaENaC RNAi agent comprises, or alternatively consists of, the modified sequence of any one of the modified sequences in Table 3.

[0165] In the RNAi agents disclosed herein, the nucleotide at position 1 (5' to 3' end) of the antisense strand may be perfectly complementary to the beta ENaC gene or may be non-complementary to the beta ENaC gene. In some embodiments, the nucleotide at position 1 (5' to 3' end) of the antisense strand is U, A, or dT (or a modified form of U, A, or dT). In some embodiments, the nucleotide at position 1 (5' to 3' end) of the antisense strand forms an A:U or U:A base pair with the sense strand.

[0166] In some embodiments, the antisense strand of a betaENaC RNAi agent comprises the sequence of nucleotides 2-18 or 2-19 (5' to 3') of any of the antisense strand sequences in Table 2 or Table 3. In some embodiments, the sense strand of a betaENaC RNAi agent comprises the sequence of nucleotides 1-17 or 1-18 (5' to 3') of any of the sense strand sequences in Table 2 or Table 4.

[0167] In some embodiments, a betaENaC RNAi agent comprises (i) an antisense strand comprising the sequence of nucleotides 2-18 or 2-19 (5' end to 3' end) of any of the antisense strand sequences in Table 2 or Table 3, and (ii) a sense strand comprising the sequence of nucleotides 1-17 or 1-18 (5' end to 3' end) of any of the sense strand sequences in Table 2 or Table 4.

[0168] A sense strand containing a sequence shown in Table 2 or Table 4 may hybridize with any antisense strand containing a sequence shown in Table 2 or Table 3, provided that the two sequences have a region of at least 85% complementarity spanning a sequence of 16, 17, 18, 19, 20, or 21 contiguous nucleotides. In some embodiments, a BetaENaC RNAi agent has a sense strand consisting of a modified sequence of any of the modified sequences in Table 4, and an antisense strand consisting of a modified sequence of any of the modified sequences in Table 3. Certain representative sequence combinations are illustrated by the duplex identification (ID) numbers shown in Tables 5A and 5B.

[0169] In some embodiments, a BetaENaC RNAi agent comprises, consists of, or consists essentially of a duplex represented by any one of the duplex identification numbers set forth herein. In some embodiments, a BetaENaC RNAi agent consists of any of the duplex identification numbers set forth herein. In some embodiments, a BetaENaC RNAi agent comprises the sense and antisense strand nucleotide sequences of any of the duplex identification numbers set forth herein. In some embodiments, a BetaENaC RNAi agent comprises the sense and antisense strand nucleotide sequences of any of the duplex identification numbers set forth herein, and a targeting group, a linking group, and / or other non-nucleotide group, which are covalently linked (i.e., attached) to the sense or antisense strand. In some embodiments, a BetaENaC RNAi agent comprises the sense and antisense strand modified nucleotide sequences of any of the duplex identification numbers set forth herein. In some embodiments, a BetaENaC RNAi agent comprises a sense strand and an antisense strand modified nucleotide sequence of any of the duplex identifier numbers set forth herein, and a targeting group, linking group, and / or other non-nucleotide group, which is covalently attached to the sense strand or the antisense strand.

[0170] In some embodiments, a Beta ENaC RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any of the antisense strand / sense strand duplexes in Table 2 or Tables 5A and 5B, and further comprises a targeting group. In some embodiments, a Beta ENaC RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any of the antisense strand / sense strand duplexes in Table 2 or Tables 5A and 5B, and further comprises one or more αvβ6 integrin targeting ligands.

[0171] In some embodiments, a beta ENaC RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any of the antisense strand / sense strand duplexes in Table 2 or Tables 5A and 5B, and further comprises a targeting group that is an integrin targeting ligand. In some embodiments, a beta ENaC RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any of the antisense strand / sense strand duplexes in Table 2 or Tables 5A and 5B, and further comprises one or more αvβ6 integrin targeting ligands or clusters of αvβ6 integrin targeting ligands (e.g., tridentate αvβ6 integrin targeting ligands).

[0172] In some embodiments, a BetaENaC RNAi agent comprises an antisense strand and a sense strand having a modified nucleotide sequence of any of the antisense strand / sense strand duplexes in Tables 5A and 5B.

[0173] In some embodiments, the BetaENaC RNAi agent comprises an antisense strand and a sense strand having a modified nucleotide sequence of any of the antisense strand / sense strand duplexes in Tables 5A and 5B, and further comprises an integrin targeting ligand.

[0174] In some embodiments, the BetaENaC RNAi agent comprises, consists of, or consists essentially of any of the duplexes in Tables 5A and 5B. [Table 5A] [Table 5B-1] [Table 5B-2]

[0175] In some embodiments, the beta ENaC RNAi agents are formulated or provided as a salt, mixed salt, or free acid. The RNAi agents described herein inhibit or knock down expression of one or more beta ENaC genes in vivo and / or in vitro when delivered to cells expressing the beta ENaC gene. Targeting groups, linking groups, pharmacokinetic / pharmacodynamic (PK / PD) modifiers, and delivery vehicles

[0176] In some embodiments, the betaENaC RNAi agent comprises or is associated with one or more non-nucleotide groups, examples of which include, but are not limited to, targeting groups, linking groups, pharmacokinetic / pharmacodynamic (PK / PD) modifiers, delivery polymers, or delivery vehicles. The non-nucleotide group can enhance targeting, delivery, or binding of the RNAi agent. The non-nucleotide group may be covalently attached to the 3' and / or 5' ends of the sense and / or antisense strands. In some embodiments, the betaENaC RNAi agent comprises a non-nucleotide group linked to the 3' and / or 5' ends of the sense strand. In some embodiments, the non-nucleotide group is linked to the 5' end of the sense strand of the betaENaC RNAi agent. The non-nucleotide group may be linked directly to the RNAi agent or via a linker / linking group. In some embodiments, the non-nucleotide group is linked to the RNAi agent by a labile, cleavable, or reversible bond or linker.

[0177] In some embodiments, the non-nucleotide group enhances the pharmacokinetics or biodistribution properties of the RNAi agent or complex to which it is attached, improving cell- or tissue-specific distribution and cell-specific uptake of the complex. In some embodiments, the non-nucleotide group enhances the endocytosis of the RNAi agent.

[0178] Targeting groups or targeting moieties enhance the pharmacokinetics or biodistribution properties of the conjugate or RNAi agent to which they are attached, improving cell-specific (including, in some cases, organ-specific) distribution and cell-specific (or organ-specific) uptake of the conjugate or RNAi agent. Targeting groups can be monovalent, divalent, trivalent, tetravalent, or higher with respect to the target to which they are directed. Exemplary targeting groups include, but are not limited to, compounds with affinity for cell surface molecules, cell receptor ligands, haptens, antibodies, monoclonal antibodies, antibody fragments, and antibody mimetics with affinity for cell surface molecules. In some embodiments, the targeting group is linked to the RNAi agent using a linker, such as a PEG linker, or one, two, or three abasic and / or ribitol (abasic ribose) residues, which can optionally function as linkers.

[0179] A targeting group may be attached, with or without a linker, to the 5' or 3' end of any of the sense and / or antisense strands disclosed in Tables 2, 3, and 4. A linker may be attached, with or without a targeting group, to the 5' or 3' end of any of the sense and / or antisense strands disclosed in Tables 2, 3, and 4.

[0180] The BetaENaC RNAi agents described herein may be synthesized with reactive groups, such as amino groups (also referred to herein as amines), at the 5' and / or 3' ends, which can then be used to attach targeting moieties using methods typical in the art.

[0181] For example, in some embodiments, a betaENaC RNAi agent disclosed herein is synthesized with an NH2-C6 group at the 5'-end of the sense strand of the RNAi agent. The terminal amino group can then be reacted to form a conjugate with a group comprising, for example, an αββ integrin targeting ligand. In some embodiments, a betaENaC RNAi agent disclosed herein is synthesized with one or more alkyne groups at the 5'-end of the sense strand of the RNAi agent. The terminal alkyne groups can then be reacted to form a conjugate with a group comprising, for example, an αββ integrin targeting ligand.

[0182] In some embodiments, the targeting group comprises an integrin targeting ligand. In some embodiments, the integrin targeting ligand is an αvβ6 integrin targeting ligand. The use of an αvβ6 integrin targeting ligand facilitates cell-specific targeting to cells bearing αvβ6 on their surface, and binding of the integrin targeting ligand can facilitate entry of a therapeutic agent, such as an RNAi agent, linked thereto into cells, such as epithelial cells (e.g., lung epithelial cells and renal epithelial cells). The integrin targeting ligand can be monomeric or monovalent (e.g., having a single integrin targeting moiety) or multimeric or multivalent (e.g., having multiple integrin targeting moieties). The targeting group can be attached to the 3' and / or 5' end of the RNAi oligonucleotide using methods known in the art. Preparation of targeting groups, such as αvβ6 integrin targeting ligands, is described, for example, in International Patent Application Publication Nos. WO 2018 / 085415 and WO 2019 / 089765, the contents of each of which are incorporated herein in their entireties.

[0183] In some embodiments, targeting group is connected to beta ENaC RNAi agent without using additional linker.In some embodiments, targeting group is designed with linker that can be easily present and facilitates connection with beta ENaC RNAi agent.In some embodiments, when two or more kinds of RNAi agent are contained in composition, the two or more kinds of RNAi agent can be connected with their respective targeting group using the same linker.In some embodiments, when two or more kinds of RNAi agent are contained in composition, the two or more kinds of RNAi agent are connected with their respective targeting group using different linkers.

[0184] In some embodiments, a linking group is attached to the RNAi agent. The linking group facilitates covalent attachment of the agent to a targeting group, pharmacokinetic modifier, delivery polymer, or delivery vehicle. The linking group may be attached to the 3'-end and / or 5'-end of the sense or antisense strand of the RNAi agent. In some embodiments, the linking group is attached to the sense strand of the RNAi agent. In some embodiments, the linking group is attached to the 5'-end or 3'-end of the sense strand of the RNAi agent. In some embodiments, the linking group is attached to the 5'-end of the sense strand of the RNAi agent. Examples of linking groups include, but are not limited to, C6-SS-C6, 6-SS-6, reactive groups such as primary amines (e.g., NH2-C6), as well as alkynes, alkyl groups, abasic residues / nucleotides, amino acids, trialkyne functionalized groups, ribitol, and / or PEG groups. Examples of specific linking groups are listed in Table 6.

[0185] A linker or linking group is a connection between two atoms that connects one chemical group or segment of interest (e.g., an RNAi agent) to another chemical group or segment of interest (e.g., a targeting group, a pharmacokinetic modifier, or a delivery polymer) or segment by one or more covalent bonds. A labile linkage includes a labile bond. A linkage may optionally include a spacer to increase the distance between the two linked atoms. A spacer may also add flexibility and / or length to the linkage. Spacers include, but are not limited to, alkyl, alkenyl, alkynyl, aryl, aralkyl, aralkenyl, and aralkynyl groups, each of which may contain one or more heteroatoms, heterocycles, amino acids, nucleotides, and sugars. Spacer groups are well known in the art, and the foregoing list is not intended to limit the scope of the specification. In some embodiments, a betaENaC RNAi agent is attached to a polyethylene glycol (PEG) moiety or a hydrophobic group having 12 or more carbon atoms (e.g., cholesterol or palmitoyl).

[0186] In some embodiments, the betaENaC RNAi agent is linked to one or more pharmacokinetic / pharmacodynamic (PK / PD) modulating agents. PK / PD modulating agents can increase the circulation time of the attached drug and / or enhance the activity of the RNAi agent by improving cell receptor binding, improving cellular uptake, and / or other means. Various PK / PD modulating agents suitable for use with RNAi agents are known in the art. In some embodiments, the PK / PD modulating agent can be a cholesterol or cholesteryl derivative. In some circumstances, the PK / PD modulating agent can be comprised of an alkyl, alkenyl, alkynyl, aryl, aralkyl, aralkenyl, or aralkynyl group, each of which can be linear, branched, or cyclic, and / or substituted or unsubstituted. In some embodiments, the point of attachment for these moieties is at the 5' or 3' end of the sense strand, the 2' position of the ribose ring of any given nucleotide of the sense strand, and / or attached to a phosphate or phosphorothioate backbone anywhere in the sense strand.

[0187] Any of the betaENaC RNAi agent nucleotide sequences shown in Tables 2, 3, and 4 may include a 3'- and / or 5'-terminal targeting group, linking group, and / or PK / PD modifier, whether modified or not. Any of the betaENaC RNAi agent nucleotide sequences shown in Tables 3 and 4 or otherwise described herein that include a 3'- or 5'-terminal targeting group, linking group, and / or PK / PD modifier may alternatively not include a 3'- or 5'-terminal targeting group, linking group, or PK / PD modifier, or may include a different 3'- or 5'-terminal targeting group, linking group, or pharmacokinetic modifier. Pharmacokinetic modifiers include, but are not limited to, those listed in Table 6. Any of the BetaENaC RNAi agent duplexes shown in Tables 5A and 5B, with or without modification, may further comprise a targeting group or linking group (including but not limited to those described in Table 6), which may be attached to the 3' or 5' end of the sense or antisense strand of the BetaENaC RNAi agent duplex.

[0188] Examples of specific modified nucleotides, capping moieties, and linking groups are provided in Table 6. [Table 6-1] [Table 6-2] [Table 6-3] [Table 6-4] [Table 6-5] [Table 6-6] [Table 6-7] [Table 6-8] [Table 6-9] [Table 6-10] [Table 6-11] [Table 6-12] [Table 6-13]

[0189] Alternatively, other linking groups known in the art may be used. Often, the linking groups are commercially available or are incorporated into commercially available nucleotide phosphoramidites (see, e.g., International Patent Application Publication No. WO 2019 / 161213, which is incorporated herein by reference in its entirety).

[0190] In some embodiments, the betaENaC RNAi agent is delivered without being conjugated to a targeting ligand or pharmacokinetic / pharmacodynamic (PK / PD) modifier (referred to as "naked" or "naked RNAi agent").

[0191] In some embodiments, the beta ENaC RNAi agent is conjugated to a targeting group, a linking group, a PK modulator, and / or another non-nucleotide group to facilitate in vivo delivery of the beta ENaC RNAi agent to selected cells or tissues, such as epithelial cells. In some embodiments, the beta ENaC RNAi agent is conjugated to a targeting group that includes an integrin targeting ligand. In some embodiments, the integrin targeting ligand is an αββ integrin targeting ligand. In some embodiments, the targeting group includes one or more αββ integrin targeting ligands.

[0192] In some embodiments, a delivery vehicle may be used to deliver an RNAi agent to a cell or tissue. A delivery vehicle is a compound that improves delivery of an RNAi agent to a cell or tissue. A delivery vehicle may include, or consist of, but is not limited to, a polymer (such as an amphiphilic polymer), a membrane-active polymer, a peptide, a melittin peptide, a melittin-like peptide (MLP), a lipid, a reversibly modified polymer or peptide, or a reversibly modified membrane-active polyamine.

[0193] In some embodiments, RNAi agents may be combined with lipids, nanoparticles, polymers, liposomes, micelles, DPCs, or other delivery systems available in the art for nucleic acid delivery. RNAi agents may also be chemically conjugated to targeting groups, lipids (including, but not limited to, cholesteryl and cholesteryl derivatives), encapsulated in nanoparticles, liposomes, micelles, or conjugated to polymers or DPCs by iontophoresis or other delivery vehicles or systems available in the art, such as hydrogels, cyclodextrins, biodegradable nanocapsules, bioadhesive microspheres, or proteinaceous vectors (see, e.g., WO 2000 / 053722, WO 2008 / 022309, WO 2011 / 104169, and WO 2012 / 083185, WO 2013 / 032829, WO 2013 / 158141, each of which is incorporated herein by reference). In some embodiments, the RNAi agent may be conjugated to an antibody with affinity for pulmonary epithelial cells. In some embodiments, the RNAi agent may be linked to a targeting ligand with affinity for pulmonary epithelial cells or a receptor present on pulmonary epithelial cells. Pharmaceutical Compositions and Formulations

[0194] The betaENaC RNAi agents disclosed herein may be prepared as pharmaceutical compositions or formulations (also referred to herein as "medicines"). In some embodiments, the pharmaceutical compositions comprise at least one betaENaC RNAi agent. These pharmaceutical compositions are particularly useful for inhibiting betaENaC mRNA expression in target cells, cell groups, tissues, or organisms. The pharmaceutical compositions can be used to treat subjects with diseases, disorders, or conditions that would benefit from a reduction in target mRNA levels or inhibition of target gene expression. The pharmaceutical compositions can be used to treat subjects at risk of developing diseases or disorders that would benefit from a reduction in target mRNA levels or inhibition of target gene expression. In one embodiment, the method comprises administering to a subject a betaENaC RNAi agent linked to a targeting ligand described herein. In some embodiments, one or more pharmaceutically acceptable excipients (including vehicles, carriers, diluents, and / or delivery polymers) are added to the pharmaceutical composition comprising the betaENaC RNAi agent to form a pharmaceutical formulation or medicament suitable for in vivo delivery to a subject, including a human.

[0195] Pharmaceutical compositions and methods including the beta ENaC RNAi agents disclosed herein reduce the level of target mRNA in a cell, a group of cells, a tissue, an organ, or a subject, such as by administering a therapeutically effective amount of a beta ENaC RNAi agent described herein to a subject to inhibit expression of beta ENaC mRNA in the subject. In some embodiments, the subject has previously been identified or diagnosed with a disease or disorder mediated, at least in part, by ENaC expression. In some embodiments, the subject has previously been identified or diagnosed with increased ENaC activity in one or more cells or tissues. In some embodiments, the subject has previously been diagnosed with one or more respiratory diseases, such as cystic fibrosis, chronic bronchitis, non-cystic fibrosis bronchiectasis, chronic obstructive pulmonary disease (COPD), asthma, respiratory tract infection, primary ciliary dyskinesia, and lung cancer cystic fibrosis. In some embodiments, the subject has previously been diagnosed with one or more ophthalmic diseases, such as dry eye. In some embodiments, the subject has suffered from one or more respiratory disease-related symptoms associated with or caused by increased ENaC activity.

[0196] Embodiments of the present disclosure include pharmaceutical compositions for delivering beta-ENaC RNAi agents to lung epithelial cells in vivo. Such pharmaceutical compositions can include, for example, beta-ENaC RNAi agents bound to targeting groups comprising integrin targeting ligands. In some embodiments, the integrin targeting ligand is comprised of an αvβ6 integrin ligand.

[0197] In some embodiments, the pharmaceutical compositions described, comprising beta ENaC RNAi agents, are used to treat or manage the clinical symptoms of subjects who benefit from inhibiting the expression of ENaC.In some embodiments, a therapeutically or prophylactically effective amount of one or more pharmaceutical compositions is administered to a subject who needs such treatment.In some embodiments, the administration of any of the disclosed beta ENaC RNAi agents can be used to reduce the number, severity, and / or frequency of disease symptoms in a subject.

[0198] In some embodiments, the beta ENaC RNAi agent described is optionally combined with one or more (i.e., second, third, etc.) therapeutic agents. The second therapeutic agent may be another beta ENaC RNAi agent (e.g., a beta ENaC RNAi agent that targets a different sequence in the beta ENaC gene). In some embodiments, the second therapeutic agent may be an RNAi agent that targets the alpha ENaC gene. The additional therapeutic agent may be a small molecule drug, an antibody, an antibody fragment, and / or an aptamer. The beta ENaC RNAi agent, with or without one or more additional therapeutic agents, may be combined with one or more excipients to form a pharmaceutical composition.

[0199] The pharmaceutical compositions described, comprising beta ENaC RNAi agent, can be used to treat at least one symptom of a subject with a disease or disorder that will benefit from reducing or inhibiting the expression of beta ENaC mRNA.In some embodiments, the symptoms are treated by administering to the subject a therapeutically effective amount of one or more pharmaceutical compositions comprising beta ENaC RNAi agent.In other embodiments, the symptoms are prevented or inhibited by administering to the subject a prophylactically effective amount of one or more beta ENaC RNAi agent.

[0200] In some embodiments, one or more of the described betaENaC RNAi agents are administered to a mammal in a pharmaceutically acceptable carrier or diluent. In some embodiments, the mammal is a human.

[0201] The administration route is the route by which the beta ENaC RNAi agent contacts the body.Generally, the methods of administering drugs, oligonucleotides and nucleic acids for the treatment of mammals are well known in the art and can be applied to the administration of the compositions described herein.In preparations that are appropriately adjusted for specific routes, the beta ENaC RNAi agent disclosed herein can be administered by any suitable route.Therefore, in some embodiments, the pharmaceutical compositions described herein are administered by inhalation, intranasal administration, intratracheal administration, or oropharyngeal inhalation administration.In some embodiments, the pharmaceutical compositions can be administered by injection, for example, intravenously, intramuscularly, intradermally, subcutaneously, intraarticularly, or intraperitoneally, or topically.

[0202] Pharmaceutical compositions comprising the betaENaC RNAi agents described herein can be delivered to cells, cell groups, tissues, or subjects using oligonucleotide delivery techniques known in the art. Generally, any suitable art-recognized method for delivering nucleic acid molecules (in vitro or in vivo) can be adapted for use with the compositions described herein. For example, delivery can be by local administration (e.g., direct injection, implantation, or topical administration), systemic administration, or subcutaneous, intravenous, peritoneal, or parenteral routes (including intracranial (e.g., intraventricular, intraparenchymal, and intrathecal), intramuscular, transdermal, airway (aerosol), nasal, oral, rectal, or topical (including buccal and sublingual) administration). In some embodiments, the compositions are administered by inhalation, intranasal administration, oropharyngeal inhalation, or intratracheal administration. For example, in some embodiments, it is desirable for the beta-ENaC RNAi agents described herein to inhibit expression of the beta-ENaC gene in the pulmonary epithelium, for which reason administration by inhalation (e.g., via an inhalation device such as a metered-dose inhaler, or a nebulizer such as a jet or vibrating mesh nebulizer, or a soft mist inhaler) is particularly suitable and advantageous.

[0203] In some embodiments, the pharmaceutical compositions described herein comprise one or more pharmaceutically acceptable excipients. The pharmaceutical compositions described herein are formulated for administration to a subject.

[0204] As used herein, a pharmaceutical composition or medicament comprises a pharmacologically effective amount of at least one of the therapeutic compounds described and one or more pharmaceutically acceptable excipients. A pharmaceutically acceptable excipient (excipient) is a substance other than the active pharmaceutical ingredient (API, therapeutic product, e.g., a beta-ENaC RNAi agent) that is intentionally included in a drug delivery system. The excipient does not exert, or is not intended to exert, a therapeutic effect at the intended dosage. An excipient can a) aid in the processing of the drug delivery system during manufacturing; b) protect, support, or enhance the stability, bioavailability, or patient tolerance of the API; c) aid in product identification; and / or d) act to enhance any other characteristic of the overall safety or efficacy of the delivery of the API during storage or use. A pharmaceutically acceptable excipient may or may not be an inert substance.

[0205] Excipients include, but are not limited to, absorption enhancers, anti-adherents, anti-foaming agents, antioxidants, binders, buffering agents, carriers, coatings, colors, delivery enhancers, delivery polymers, detergents, dextran, dextrose, diluents, disintegrants, emulsifiers, bulking agents, fillers, flavoring agents, glidants, humectants, lubricants, oils, polymers, preservatives, saline, salts, solvents, sugars, surfactants, suspending agents, sustained release matrices, sweeteners, thickeners, isotonicity agents, solvents, water repellents, and wetting agents.

[0206] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions, and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor® EL™ (BASF, Parsippany, NJ), or phosphate-buffered saline (PBS). It should be stable under the conditions of manufacture and storage and preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerin, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, the maintenance of the required particle size (in the case of dispersions), and the use of surfactants. In many cases, it is preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol or sorbitol, and sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.

[0207] If necessary, the active compound of the amount required can be incorporated into suitable solvent with one or combination of above-listed components, and then sterilized and filtered to prepare sterile injection solution.Generally, the active compound is incorporated into the sterile solvent that contains basic dispersion medium and other components required as listed above to prepare dispersion.For the sterile powder that is used to prepare sterile injection solution, preparation methods include vacuum drying and freeze-drying, thereby obtain the powder of active ingredient and desired additional components from the solution that has been previously sterilized and filtered.

[0208] Formulations suitable for intra-articular administration may be in the form of a sterile aqueous preparation of the drug, which may be in microcrystalline form, for example, in the form of an aqueous microcrystalline suspension. Liposomal formulations or biodegradable polymer systems may also be used to provide drugs for both intra-articular and ocular administration.

[0209] The formulation suitable for inhalation administration can be prepared by incorporating the desired amount of active compound into a suitable solvent, followed by sterile filtration.Generally, the formulation for inhalation administration is a sterile solution at physiological pH and has low viscosity (<5 cP).Salt can be added to the formulation to balance the tonicity.In some cases, surfactants or cosolvents can be added to increase the solubility of the active compound and improve aerosol properties.In some cases, excipients can be added to adjust viscosity and ensure the size and distribution of nebulized droplets.

[0210] In some embodiments, pharmaceutical formulations suitable for inhaled administration comprising a betaENaC RNAi agent disclosed herein may be prepared in an aqueous sodium phosphate buffer solution (e.g., the betaENaC RNAi agent may be formulated in a 0.5 mM monosodium phosphate solution, a 0.5 mM disodium phosphate solution, or an aqueous solution).

[0211] Active compounds may be formulated with carriers that protect the compound from rapid elimination from the body (e.g., sustained-release formulations, such as implants and microencapsulated delivery systems). Biodegradable, biocompatible polymers such as ethylene vinyl acetate, polymeric anhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid can be used. Methods for preparing such formulations are apparent to those skilled in the art. Liposomal suspensions may also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, the methods described in U.S. Pat. No. 4,522,811.

[0212] In order to facilitate administration and ensure uniform dosage, betaENaC RNAi agent can be formulated into unit-dosage composition.Unit-dosage refers to a physically separate unit that is suitable for single administration to treatment subject, and each unit contains a predetermined amount of active compound calculated to achieve desired therapeutic effect together with necessary pharmaceutical carrier.The specification of unit-dosage of the present disclosure is determined by and directly depends on the unique characteristics of active compound and the therapeutic effect that it achieves, and the inherent limitations in the technical field of compounding this active compound for individual treatment.

[0213] The pharmaceutical composition may contain other additional ingredients commonly found in pharmaceutical compositions. Such additional ingredients include, but are not limited to, antipruritics, astringents, local anesthetics, or anti-inflammatory agents (e.g., antihistamines, diphenhydramine, etc.). It is also contemplated that cells, tissues, or isolated organs expressing or containing the RNAi agent defined herein may be used as a "pharmaceutical composition." As used herein, "pharmacologically effective amount," "therapeutically effective amount," or simply "effective amount" refers to the amount of RNAi agent that provides pharmacological, therapeutic, or preventive results.

[0214] In some embodiments, the methods disclosed herein further comprise administering a second therapeutic agent or treatment in addition to administering an RNAi agent disclosed herein. In some embodiments, the second therapeutic agent is another beta-ENaC RNAi agent (e.g., a beta-ENaC RNAi agent that targets a different sequence in the beta-ENaC target). In other embodiments, the second therapeutic agent may be a small molecule drug, an antibody, an antibody fragment, and / or an aptamer.

[0215] In some embodiments, the present invention provides a composition comprising a combination or mixture of at least two kinds of beta ENaC RNAi agents with different sequences.In some embodiments, the two or more beta ENaC RNAi agents are each linked to a targeting group separately and independently.In some embodiments, the two or more beta ENaC RNAi agents are each linked to a targeting group that comprises or consists of an integrin targeting ligand.In some embodiments, the two or more beta ENaC RNAi agents are each linked to a targeting group that comprises or consists of an αvβ6 integrin targeting ligand.

[0216] The present specification describes compositions for delivering beta ENaC RNAi agents to lung epithelial cells.Furthermore, the present specification generally describes compositions for delivering beta ENaC RNAi agents to cells, such as kidney epithelial cells and / or epithelial cells of the gastrointestinal tract or reproductive system, and / or ocular surface epithelial cells in vivo.

[0217] Generally, an effective amount of a beta-ENaC RNAi agent disclosed herein ranges from about 0.0001 to about 20 mg / kg of body weight / deposited dose, e.g., from about 0.001 to about 5 mg / kg of body weight / deposited dose. In some embodiments, an effective amount of a beta-ENaC RNAi agent ranges from about 0.01 mg / kg to about 3.0 mg / kg of body weight / deposited dose. In some embodiments, an effective amount of a beta-ENaC RNAi agent ranges from about 0.03 mg / kg to about 2.0 mg / kg of body weight / deposited dose. In some embodiments, an effective amount of a beta-ENaC RNAi agent ranges from about 0.01 to about 1.0 mg / kg of body weight / deposited dose. In some embodiments, an effective amount of a beta-ENaC RNAi agent ranges from about 0.50 to about 1.0 mg / kg of body weight / deposited dose. The amount administered may depend on factors such as the patient's overall health, the relative biological potency of the compound being delivered, the drug formulation, the presence and type of excipients in the formulation, and the route of administration. It should also be noted that the initial dosage administered may be increased above the upper limit noted above to rapidly achieve a desired blood or tissue concentration, or the initial dosage may be less than the optimal dosage. In some embodiments, administration is once daily. In some embodiments, administration is once weekly. In further embodiments, administration may be once every two weeks, once every three weeks, once a month, or once a quarter (i.e., once every three months).

[0218] The pharmaceutical compositions described herein comprising a BetaENaC RNAi agent may be combined with an excipient or a second therapeutic agent or treatment (including, but not limited to, a second or other RNAi agent, a small molecule drug, an antibody, an antibody fragment, a peptide, and / or an aptamer) for the treatment of a disease or to form a medicament or composition for treating a disease.

[0219] When added to pharmaceutically acceptable excipients or adjuvants, the described beta ENaC RNAi agent can be packaged in a kit, container, pack or dispenser.The pharmaceutical compositions described herein can be packaged in dry powder or aerosol inhalers, other metered dose inhalers, nebulizers, pre-filled syringes or vials. Methods of Treatment and Inhibition of Expression

[0220] The beta ENaC RNAi agents disclosed herein can be used to treat subjects (e.g., humans or other mammals) with diseases or disorders that would benefit from the administration of an RNAi agent. In some embodiments, the RNAi agents disclosed herein can be used to treat subjects (e.g., humans) that would benefit from reducing and / or inhibiting the expression of beta ENaC mRNA.

[0221] In some embodiments, the RNAi agents disclosed herein can be used to treat a subject (e.g., a human) with a disease or disorder in which the subject (e.g., a human) would benefit from reduced ENaC channel activity (e.g., including, but not limited to, cystic fibrosis, chronic bronchitis, non-cystic fibrosis bronchiectasis, chronic obstructive pulmonary disease (COPD), asthma, respiratory tract infection, primary ciliary dyskinesia, and / or lung cancer cystic fibrosis, and / or dry eye). Treatment of a subject can include therapeutic and / or prophylactic treatment. A therapeutically effective amount of any one or more beta-ENaC RNAi agents described herein is administered to the subject. The subject may be a human, a patient, or a human patient. The subject may be an adult, an adolescent, a child, or an infant. The pharmaceutical compositions described herein can be administered to a human or an animal.

[0222] It is known that the increase in ENaC activity promotes the dehydration of airway surface liquid and impairs mucociliary clearance.In some embodiments, the beta ENaC RNAi agent described is used to treat at least one symptom that is at least partially mediated by ENaC activity level in a subject.A therapeutically effective amount of any one or more beta ENaC RNAi agents described is administered to a subject.In some embodiments, a prophylactically effective amount of any one or more RNAi agents described is administered to a subject to prevent or inhibit at least one symptom, thereby treating the subject.

[0223] In certain embodiments, the present disclosure provides a method of treating a disease, disorder, illness, or pathological condition mediated at least in part by betaENaC gene expression in a patient in need of treatment, the method comprising administering to the patient any of the betaENaC RNAi agents described herein.

[0224] In some embodiments, the beta ENaC RNAi agent is used to treat or manage clinical symptoms or pathological conditions in a subject. Wherein the clinical symptoms or pathological conditions are at least partially mediated by ENaC expression. A therapeutically effective amount of one or more of the beta ENaC RNAi agents or compositions comprising the beta ENaC RNAi agent described herein is administered to the subject. In some embodiments, the method comprises administering a composition comprising the beta ENaC RNAi agent described herein to the subject.

[0225] In a further aspect, the disclosure features a method for treating (including prophylactic treatment of) a disease or condition caused by increased or elevated ENaC activity, the method comprising administering to a subject in need thereof a beta ENaC RNAi agent comprising an antisense strand comprising any of the sequences in Table 2 or Table 3. Compositions for use in such methods are also described herein.

[0226] The described betaENaC RNAi agents and / or compositions containing the betaENaC RNAi agents may be used in methods for the therapeutic treatment of diseases or conditions caused by increased or elevated levels of ENaC activity. Such methods include administering a betaENaC RNAi agent described herein to a subject (e.g., a human or animal subject).

[0227] In another aspect, the present disclosure provides a method for treating (including prophylactic treatment of) a pathological condition (such as a disease or disorder) mediated at least in part by beta-ENaC expression, the method comprising administering to a subject a therapeutically effective amount of an RNAi agent comprising an antisense strand comprising any of the sequences in Table 2 or Table 3.

[0228] In some embodiments, disclosed herein are methods of inhibiting expression of the beta ENaC gene, comprising administering to a cell an RNAi agent comprising an antisense strand comprising any of the sequences in Table 2 or Table 3.

[0229] In some embodiments, disclosed herein are methods for treating (including prophylactic treatment of) a pathological condition mediated at least in part by beta-ENaC expression, the method comprising administering to a subject a therapeutically effective amount of an RNAi agent comprising a sense strand comprising any of the sequences in Table 2 or Table 4.

[0230] In some embodiments, disclosed herein are methods of inhibiting expression of the beta ENaC gene, comprising administering to a cell an RNAi agent comprising a sense strand comprising any of the sequences in Table 2 or Table 4.

[0231] In some embodiments, disclosed herein are methods for treating (including prophylactic treatment of) a pathological condition mediated at least in part by beta-ENaC expression, the method comprising administering to a subject a therapeutically effective amount of an RNAi agent comprising a sense strand comprising any of the sequences in Table 4 and an antisense strand comprising any of the sequences in Table 3.

[0232] In some embodiments, disclosed herein are methods of inhibiting expression of the Beta ENaC gene, comprising administering to a cell an RNAi agent comprising a sense strand comprising any of the sequences in Table 4 and an antisense strand comprising any of the sequences in Table 3.

[0233] In some embodiments, disclosed herein are methods of inhibiting expression of the beta ENaC gene, comprising administering to a subject a beta ENaC RNAi agent comprising a sense strand consisting of the nucleobase sequence of any of the sequences in Table 4 and an antisense strand consisting of the nucleobase sequence of any of the sequences in Table 3. In other embodiments, disclosed herein are methods of inhibiting expression of the beta ENaC gene, comprising administering to a subject a beta ENaC RNAi agent comprising a sense strand consisting of a modified sequence of any of the modified sequences in Table 4 and an antisense strand consisting of a modified sequence of any of the modified sequences in Table 3.

[0234] In some embodiments, disclosed herein are methods for inhibiting expression of the beta ENaC gene in a cell, comprising administering one or more beta ENaC RNAi agents comprising one of the duplex structures shown in Tables 5A and 5B.

[0235] In some embodiments, the gene expression level and / or mRNA level of the beta ENaC gene in certain epithelial cells of a subject administered a described beta ENaC RNAi agent is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more than 99% relative to the subject prior to administration of the beta ENaC RNAi agent or a subject not administered the beta ENaC RNAi agent. In some embodiments, the ENaC level or ENaC channel activity level in specific epithelial cells of a subject administered a described beta ENaC RNAi agent is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more than 99% compared to the subject before administration of the beta ENaC RNAi agent or to a subject not administered the beta ENaC RNAi agent. Gene expression levels, protein levels, and / or mRNA levels in a subject may be reduced in cells, cell groups, and / or tissues of the subject. In some embodiments, the beta ENaC mRNA level in specific epithelial cells of a subject administered a described beta ENaC RNAi agent is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98% compared to the subject before or not administered the beta ENaC RNAi agent. In some embodiments, the ENaC heterotrimeric protein complex level in specific epithelial cells of a subject administered a described beta ENaC RNAi agent is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98% compared to the subject before or not administered the beta ENaC RNAi agent.The ENaC level in a subject may be reduced in the subject's cells, cell populations, tissues, blood, and / or other fluids. For example, in some embodiments, the level of beta ENaC mRNA and / or ENaC heterotrimeric protein complex in lung epithelial cells of a subject administered a described beta ENaC RNAi agent is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98% compared to the subject before administration of the beta ENaC RNAi agent or a subject not administered the beta ENaC RNAi agent. In some embodiments, the level of betaENaC mRNA and / or ENaC heterotrimeric protein complex and / or ENaC channel activity in a subset of lung epithelial cells, e.g., airway epithelial cells, of a subject administered a described betaENaC RNAi agent is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98% relative to the subject prior to administration of the betaENaC RNAi agent or a subject not administered the betaENaC RNAi agent.

[0236] The reduction of gene expression, mRNA and protein level can be evaluated by any method known in the art.The reduction or decrease of beta ENaC mRNA level, ENaC channel activity level and / or ENaC heterotrimeric protein complex level is collectively referred to herein as the reduction or decrease of beta ENaC or the inhibition or decrease of the expression of beta ENaC gene.The examples described herein illustrate the known method for evaluating the inhibition of beta ENaC gene expression. Cells, tissues, organs, and non-human organisms

[0237] Contemplated herein is a cell, tissue, organ, or non-human organism that comprises at least one of the betaENaC RNAi agents described herein.The cell, tissue, organ, or non-human organism is produced by delivering the RNAi agent to the cell, tissue, organ, or non-human organism.

[0238] The above-identified embodiments and items will now be illustrated by the following non-limiting examples. [Example]

[0239] Example 1. Synthesis of beta-ENaC RNAi Agents The betaENaC RNAi agent duplexes shown in Tables 5A and 5B were synthesized as follows.

[0240] A. Synthesis. The sense and antisense strands of the betaENaC RNAi agent were synthesized on a solid phase used for oligonucleotide synthesis using phosphoramidite technology. Depending on the scale, a MerMade96E® (Bioautomation), a MerMade12® (Bioautomation), or an OP Pilot 100 (GE Healthcare) was used. Synthesis was performed on a controlled pore glass solid support (CPG, 500 Å or 600 Å, obtained from Prime Synthesis, Aston, PA, USA). All RNAs and 2'-modified RNA phosphoramidites were purchased from Thermo Fisher Scientific (Milwaukee, WI, USA). Specifically, the 2'-O-methyl phosphoramidites used included the following: (5'-O-dimethoxytrityl-N 6 -(benzoyl)-2'-O-methyl-adenosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite, 5'-O-dimethoxy-trityl-N 4 -(acetyl)-2'-O-methyl-cytidine-3'-O-(2-cyanoethyl-N,N-diisopropyl-amino) phosphoramidite, (5'-O-dimethoxytrityl-N 2The protective groups included 5'-(isobutyryl)-2'-O-methyl-guanosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite and 5'-O-dimethoxytrityl-2'-O-methyl-uridine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite. The 2'-deoxy-2'-fluoro-phosphoramidite had the same protecting groups as the 2'-O-methyl RNA amidite. 5'-Dimethoxytrityl-2'-O-methyl-inosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite was purchased from Glen Research (VA). Inverted abasic (3'-O-dimethoxytrityl-2'-deoxyribose-5'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite was purchased from ChemGenes (Wilmington, MA, USA). The following UNA phosphoramidites were used: 5'-(4,4'-dimethoxytrityl)-N 6 -(Benzoyl)-2',3'-secoadenosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytrityl)-N-acetyl-2',3'-secocytosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytrityl)-N-isobutyryl-2',3'-secoguanosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, and 5'-(4,4'-dimethoxytrityl)-2',3'-secouridine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N- [Diisopropyl]-phosphoramidites were used. TFA amino-linked phosphoramidites were also commercially available (ThermoFisher). Cyclopropyl phosphonate phosphoramidites were synthesized according to International Patent Application Publication No. WO 2017 / 214112.

[0241] Trialkine-containing phosphoramidites were dissolved in anhydrous dichloromethane or anhydrous acetonitrile (50 mM), and all other amidites were dissolved in anhydrous acetonitrile (50 mM) with the addition of molecular sieves (3 Å). 5-benzylthio-1H-tetrazole (BTT, 250 mM acetonitrile solution) or 5-ethylthio-1H-tetrazole (ETT, 250 mM acetonitrile solution) was used as the activator solution. Coupling times were 10 min (RNA), 90 s (2'O-Me), and 60 s (2'F). To introduce phosphorothioate bonds, a 100 mM solution of 3-phenyl-1,2,4-dithiazolin-5-one (POS, obtained from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile was used.

[0242] Alternatively, the trialkyne moiety was introduced post-synthetically (see Section E below). For this route, the sense strand was functionalized with 5'- and / or 3'-terminal nucleotides containing primary amines. TFA-amino-linked phosphoramidites were dissolved in anhydrous acetonitrile (50 mM), and molecular sieves (3 Å) were added. 5-benzylthio-1H-tetrazole (BTT, 250 mM acetonitrile solution) or 5-ethylthio-1H-tetrazole (ETT, 250 mM acetonitrile solution) was used as the activator solution. Coupling times were 10 min (RNA), 90 s (2'O-Me), and 60 s (2'F). To introduce phosphorothioate bonds, a 100 mM solution of 3-phenyl-1,2,4-dithiazolin-5-one (POS, obtained from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile was used.

[0243] B. Cleavage and deprotection of the support-bound oligomer. After completion of solid-phase synthesis, the dried solid support was treated with a 1:1 volume solution of 40 wt% aqueous methylamine and 28%-31% ammonium hydroxide solution (Aldrich) at 30°C for 1.5 hours. The solution was evaporated, and the solid residue was reconstituted in water (see below).

[0244] C. Purification. Crude oligomers were purified by anion-exchange high-performance liquid chromatography (HPLC) using a TSKgel SuperQ-5PW 13 μm column and a Shimadzu LC-8 system. Buffer A was 20 mM Tris, 5 mM EDTA (pH 9.0), and 20% acetonitrile. Buffer B was the same as buffer A, but with the addition of 1.5 M sodium chloride. UV traces at 260 nm were recorded. Appropriate fractions were pooled and then run on a GE Healthcare XK 16 / 40 column packed with Sephadex G-25 fine using a running buffer of 100 mM ammonium bicarbonate (pH 6.7) and 20% acetonitrile or filtered water. Alternatively, pooled fractions were desalted and converted to the appropriate buffer or solvent system by tangential flow filtration.

[0245] D. Annealing. Equimolar concentrations of RNA (sense and antisense) were combined in 1x PBS (phosphate-buffered saline, 1x, Corning, Cellgro) to mix the complementary strands and form the RNAi agent. A portion of the RNAi agent was lyophilized and stored at -15 to -25°C. The concentration of the duplex was determined by measuring the absorbance of the solution in 1x PBS using a UV-Vis spectrophotometer. The absorbance of the solution at 260 nm was then multiplied by the conversion factor (0.050 mg / (mL·cm)) and the dilution factor to determine the duplex concentration.

[0246] E. Attachment of Trialkine Linkers. In some embodiments, a trialkyne linker is attached to the sense strand of an RNAi agent on the resin as a phosphoramidite (see Example 1G for the synthesis of an exemplary trialkyne linker phosphoramidite, and Example 1A for the attachment of the phosphoramidite). In other embodiments, the trialkyne linker may be attached to the sense strand after cleavage from the resin, before or after annealing, as described below. In some embodiments, a sense strand amine-functionalized at the 5' or 3' end is attached with a trialkyne linker. Exemplary structures of trialkyne linkers that can be used to form the constructs disclosed herein are as follows: [ka] To attach the trialkyne linker to the annealed duplex, the amine-functionalized duplex was dissolved at approximately 50-70 mg / mL in 90% DMSO / 10% HO. 40 equivalents of triethylamine were added, followed by 3 equivalents of trialkyne-PNP. Once complete, the conjugate was precipitated twice with a solvent system of 1x phosphate-buffered saline / acetonitrile (1:14 ratio) and dried.

[0247] F. Synthesis of Target Ligand SM6.1 ((S)-3-(4-(4-((14-azido-3,6,9,12-tetraoxatetradecyl)oxy)naphthalen-1-yl)phenyl)-3-(2-(4-((4-methylpyridin-2-yl)amino)butanamido)acetamido)propanoic acid) [ka]

[0248] Compound 5 (tert-butyl (4-methylpyridin-2-yl)carbamate) (0.501 g, 2.406 mmol, 1 equiv.) was dissolved in dimethylformamide (DMF) (17 mL). To this mixture was added NaH (0.116 mg, 3.01 mmol, 1.25 equiv., 60% oil dispersion). The mixture was stirred for 10 min, and then compound 20 (ethyl 4-bromobutyrate (0.745 g, 3.82 mmol, 0.547 mL)) (Sigma 167118) was added. After 3 h, the reaction was quenched with ethanol (18 mL) and concentrated. The concentrate was dissolved in DCM (50 mL), washed with saturated aqueous NaCl (1 x 50 mL), dried over NaSO, filtered, and concentrated. The product was purified on a silica column (gradient: 0-5% methanol in DCM). [ka]

[0249] Compound 21 (0.80 g, 2.378 mmol) was dissolved in acetone:0.1 M NaOH [1:1] (100 mL). The reaction was monitored by thin-layer chromatography (TLC) (5% ethyl acetate in hexanes). The organics were concentrated and the residue was acidified to pH 3–4 with 0.3 M citric acid (40 mL). The product was extracted with DCM (3×75 mL). The organics were pooled, dried over Na2SO4, filtered, and concentrated. The product was used without further purification. [ka]

[0250] To a solution of compound 22 (1.1 g, 3.95 mmol, 1 equiv.), compound 45 (595 mg, 4.74 mmol, 1.2 equiv.), and TBTU (1.52 g, 4.74 mmol, 1.2 equiv.) in anhydrous DMF (10 mL) was added diisopropylethylamine (2.06 mL, 11.85 mmol, 3 equiv.) at 0 °C. The reaction mixture was warmed to room temperature and stirred for 3 h. The reaction was quenched with saturated NaHCO3 solution (10 mL). The aqueous phase was extracted with ethyl acetate (3 x 10 mL), and the combined organic phases were dried over anhydrous Na2SO4 and concentrated. The product was separated by CombiFlash® using silica gel as the stationary phase (LC-MS: [M+H]+ calculated 366.20, found 367). [ka]

[0251] To a solution of compound 61 (2 g, 8.96 mmol, 1 eq.) and compound 62 (2.13 mL, 17.93 mmol, 2 eq.) in anhydrous DMF (10 mL) was added K2CO3 (2.48 g, 17.93 mmol, 2 eq.) at 0 °C. The reaction mixture was warmed to room temperature and stirred overnight. The reaction was quenched with water (10 mL). The aqueous phase was extracted with ethyl acetate (3 x 10 mL), and the combined organic phases were dried over anhydrous Na2SO4 and concentrated. The products were separated by CombiFlash® using silica gel as the stationary phase. [ka]

[0252] To a solution of compound 60 (1.77 g, 4.84 mmol, 1 equiv.) in THF (5 mL) HO (5 mL) was added lithium hydroxide monohydrate (0.61 g, 14.53 mmol, 3 equiv.) portionwise at 0 °C. The reaction mixture was warmed to room temperature and stirred for 3 h. After that, the reaction mixture was acidified to pH 3.0 with HCl (6 N). The aqueous phase was extracted with ethyl acetate (3 x 20 mL), and the organic layers were combined, dried over NaSO, and concentrated (LC-MS: [M+H] calculated 352.18, found 352). [ka]

[0253] To a solution of compound 63 (1.88 g, 6.0 mmol, 1.0 equiv.) in anhydrous THF (20 mL) was added dropwise a solution of n-BuLi in hexane (3.6 mL, 9.0 mmol, 1.5 equiv.) at −78°C. The reaction was maintained at −78°C for an additional hour. Triisopropyl borate (2.08 mL, 9.0 mmol, 1.5 equiv.) was then added to the mixture at −78°C. The reaction was then warmed to room temperature and stirred for an additional hour. The reaction was quenched with saturated NH4Cl solution (20 mL), and the pH was adjusted to 3. The aqueous phase was extracted with EtOAc (3×20 mL), and the combined organic phases were dried over Na2SO4 and concentrated. [ka]

[0254] Compound 12 (300 mg, 0.837 mmol, 1.0 equiv.), compound 65 (349 mg, 1.256 mmol, 1.5 equiv.), XPhos Pd G2 (13 mg, 0.0167 mmol, 0.02 equiv.), and K3PO4 (355 mg, 1.675 mmol, 2.0 equiv.) were mixed in a round-bottom flask. The flask was sealed with a septum-equipped screw cap and purged with nitrogen (this process was repeated a total of three times). THF (8 mL) and water (2 mL) were then added via syringe. The mixture was purged with nitrogen over 20 minutes and the reaction was maintained at room temperature overnight. The reaction was quenched with water (10 mL), and the aqueous phase was extracted with ethyl acetate (3 x 10 mL). The organic phase was dried over Na2SO4, concentrated and purified by CombiFlash® using silica gel as the stationary phase and eluted with 15% EtOAc in hexane (LC-MS: [M+H]+ calculated 512.24, found 512.56). [ka]

[0255] Compound 66 (858 mg, 1.677 mmol, 1.0 equiv) was cooled in an ice bath. A solution of HCl in dioxane (8.4 mL, 33.54 mmol, 20 equiv) was added to the flask. The reaction was allowed to warm to room temperature and stirred for an additional hour. The solvent was removed on a rotary evaporator, and the product was used directly without further purification (LC-MS: [M+H]+ calculated 412.18, found 412.46). [ka]

[0256] To a solution of compound 64 (500 mg, 1.423 mmol, 1 equiv.), compound 67 (669 mg, 1.494 mmol, 1.05 equiv.), and TBTU (548 mg, 0.492 mmol, 1.2 equiv.) in anhydrous DMF (15 mL) was added diisopropylethylamine (0.744 mL, 4.268 mmol, 3 equiv.) at 0 °C. The reaction mixture was warmed to room temperature and stirred for an additional 1 h. The reaction was quenched with saturated aqueous NaHCO3 (10 mL), and the product was extracted with ethyl acetate (3 x 20 mL). The organic phases were combined, dried over Na2SO4, and concentrated. The product was purified by CombiFlash® using silica gel as the stationary phase and eluted with 3-4% methanol in DCM. The yield was 96.23% (LC-MS: [M+H]+ calculated 745.35, found 746.08). [ka]

[0257] To a solution of compound 68 (1.02 g, 1.369 mmol, 1 equiv.) in ethyl acetate (10 mL) was added 10% Pd / C (0.15 g, 50% HO) at room temperature. The reaction mixture was warmed to room temperature, and the reaction was monitored by LC-MS. The reaction was maintained at room temperature overnight. The solid was filtered through Celite®, and the solvent was removed on a rotary evaporator. The product was used directly without further purification (LC-MS: [M+H]+ calculated 655.31, found 655.87). [ka]

[0258] To a solution of compound 69 (100 mg, 0.152 mmol, 1 equiv.) and azido-PEG5-OTs (128 mg, 0.305 mmol, 2 equiv.) in anhydrous DMF (2 mL) was added K2CO3 (42 mg, 0.305 mmol, 2 equiv.) at 0 °C. The reaction mixture was stirred at 80 °C for 6 h. The reaction was quenched with saturated NaHCO3 solution, and the aqueous layer was extracted with ethyl acetate (3 x 10 mL). The organic phases were combined, dried over Na2SO4, and concentrated (LC-MS: [M+H]+ calculated 900.40, found 901.46). [ka]

[0259] To a solution of compound 72 (59 mg, 0.0656 mmol, 1.0 equiv.) in THF (2 mL) and water (2 mL) was added lithium hydroxide (5 mg, 0.197 mmol, 3.0 equiv.) at room temperature. The mixture was stirred for an additional 1 h at room temperature. The pH was adjusted to 3.0 with HCl (6N), and the aqueous phase was extracted with ethyl acetate (3 x 10 mL). The combined organic phases were dried over Na2SO4 and concentrated. TFA (0.5 mL) and DCM (0.5 mL) were added to the residue, and the mixture was stirred for an additional 3 h at room temperature. The solvent was removed on a rotary evaporator (LC-MS: [M+H]+ calculated 786.37, found 786.95).

[0260] G. Synthesis of TriAlk 14

[0261] TriAlk14 and (TriAlk14)s shown in Table 6 above may be synthesized using the synthetic routes shown below: Compound 14 may be added to the sense strand as a phosphoramidite using standard oligonucleotide synthesis techniques, or compound 22 may be attached to an amine-containing sense strand using an amide coupling reaction. [ka]

[0262] To a 3 L jacketed reactor was added 500 mL of DCM and 4 (75.0 g, 0.16 mol). The reaction was cooled to an internal temperature of 0 °C, and TBTU (170.0 g, 0.53 mol) was added. The suspension was then treated dropwise with amine 5 (75.5 g, 0.53 mol), maintaining the internal temperature below 5 °C. The reaction was then slowly treated with DIPEA (72.3 g, 0.56 mol), maintaining the internal temperature below 5 °C. Upon completion of the addition, the reaction was allowed to warm to 23 °C over 1 h and stirred for 3 h. A 10% kicker charge of all three reagents was added and stirred for an additional 3 h. The reaction was considered complete when less than 1% of 4 remained. The reaction mixture was washed with saturated ammonium chloride solution (2 x 500 mL) and once with saturated sodium bicarbonate solution (500 mL). The organic layer was then dried over sodium sulfate and concentrated to an oil. The crude oil weighed 188 g and contained 72% 6 by QNMR. The crude oil was carried on to the next step. 46 H 60 N4O 11 Calculated mass = 845.0 m / z, [M+H] found = 846.0. [ka]

[0263] 121.2 g of crude oil containing 72% by weight of compound 6 (86.0 g, 0.10 mol) was dissolved in DMF (344 mL) and treated with TEA (86 mL, 20 v / v%), maintaining the internal temperature below 23 °C. The formation of dibenzofulvene (DBF) relative to the consumption of Fmoc-amine 6 was monitored by HPLC Method 1 (Figure 2), and the reaction was complete within 10 h. Glutaric anhydride (12.8 g, 0.11 mol) was added to this solution, and the intermediate amine 7 was converted to compound 8 within 2 h. Upon completion, the DMF and TEA were removed under reduced pressure at 30 °C, yielding 100 g of crude oil. Due to the high solubility of compound 7 in water, aqueous methods were not feasible, and chromatography was the only method for removing DBF, TMU, and glutaric anhydride. The crude oil (75 g) was purified in three batches on a Teledyne ISCO Combi-flash® purification system. The crude oil (25 g) was loaded onto a 330 g silica column and eluted with 0–20% methanol·DCM over 30 min to give 42 g of compound 8 (54% yield over three steps) (C 36 H 55 N4O 12 Calculated mass = 736.4 m / z, [M+H] found = 737.0). [ka]

[0264] Compound 8 (42.0 g, 0.057 mol) was co-stripped with 10 volumes of acetonitrile to remove any residual methanol from the chromatography solvent prior to use. The oil was redissolved in DMF (210 mL) and cooled to 0°C. This solution was treated with 4-nitrophenol (8.7 g, 0.063 mol) followed by EDC-hydrochloride (12.0 g, 0.063 mol) and was confirmed to be complete within 10 hours. The solution was cooled to 0°C and 10 volumes of ethyl acetate, followed by 10 volumes of saturated ammonium chloride solution, were added, maintaining the internal temperature below 15°C. The layers were separated and the ethyl acetate layer was washed with brine. The combined aqueous layers were extracted twice with 5 volumes of ethyl acetate. The combined organic layers were dried over sodium sulfate and concentrated to an oil. The crude oil (55 g) was purified in three batches on a Teledyne ISCO Combi-Flash® purification system. The crude oil (25 g) was loaded onto a 330 g silica column and eluted with 0–10% methanol·DCM over 30 min to give 22 g of pure 9 (compound 22) (50% yield) (C 42 H 59 N5O 14 Calculated mass = 857.4 m / z, [M+H] found = 858.0). [ka]

[0265] A solution of ester 9 (49.0 g, 57.1 mmol) and 6-amino-1-hexanol (7.36 g, 6.28 mmol) in dichloromethane (3 volumes) was treated dropwise with triethylamine (11.56 g, 111.4 mmol). The reaction was monitored by HPLC method 1 for the disappearance of compound 9 and was found to be complete in 10 min. The crude reaction mixture was diluted with 5 volumes of dichloromethane and washed with saturated ammonium chloride (5 volumes) and brine (5 volumes). The organic layer was dried over sodium sulfate and concentrated to an oil. The crude oil was purified on a Teledyne ISCO Combi-Flash® purification system using a 330 g silica column. 4-Nitrophenol was eluted with 100% ethyl acetate, and 10 was washed off the column with 20% methanol / DCM to give a colorless oil (39 g, 81% yield) (C 42 H 69 N5O 12 Calculated mass = 836.0 m / z, [M+H] found = 837.0). [ka]

[0266] Alcohol 10 was co-stripped twice with 10 volumes of acetonitrile to remove any residual methanol from the chromatography solvent, followed by one additional co-stripping with 5 volumes of dry dichloromethane (KF < 60 ppm) to remove traces of water. Alcohol 10 (2.30 g, 2.8 mmol) was dissolved in 5 volumes of dry dichloromethane (KF < 50 ppm) and treated with diisopropylammonium tetrazolide (188 mg, 1.1 mmol). This solution was cooled to 0 °C and treated dropwise with 2-cyanoethyl N,N,N',N'-tetraisopropylphosphoramidite (1.00 g, 3.3 mmol). The solution was removed from the ice bath and stirred at 20 °C. The reaction was observed to be complete within 3–6 h. The reaction mixture was cooled to 0 °C and treated with 10 volumes of a 1:1 solution of saturated ammonium bicarbonate / brine, then warmed to ambient temperature over 1 min and stirred at 20 °C for an additional 3 min. The biphasic mixture was transferred to a separatory funnel and 10 volumes of dichloromethane were added. The organic layer was separated and washed with 10 volumes of saturated sodium bicarbonate solution to hydrolyze the unreacted bis-phosphite reagent. The organic layer was dried over sodium sulfate and concentrated to an oil to give 94 wt% of compound 14 (3.08 g). 51 H 86 N7O 13 Calculated mass for P = 1035.6 m / z, [M+H] found = 1036.

[0267] H. Conjugation of Target Ligand. Either before or after annealing, a sense strand functionalized with a tridentate alkyne at the 5' or 3' end is conjugated to a target ligand. The following example describes conjugation of a target ligand to an annealed duplex. Stock solutions of 0.5 M tris(3-hydroxypropyltriazolylmethyl)amine (THPTA), 0.5 M Cu(II) sulfate pentahydrate (Cu(II)SO4·5H2O), and 2 M sodium ascorbate solution in deionized water were prepared. A DMSO solution (75 mg / mL) of the target ligand was made. 25 μL of 1 M Hepes buffer (pH 8.5) was added to a 1.5 mL centrifuge tube containing the trialkyne-functionalized duplex (3 mg, 75 μL, 40 mg / mL in deionized water, approximately 15,000 g / mol). After vortexing, 35 μL of DMSO was added and the solution was vortexed. The target ligand was added to the reaction (6 equiv. / duplex, 2 equiv. / alkyne, approximately 15 μL) and the solution was vortexed. The pH was checked using pH paper to confirm it was approximately 8. In a separate 1.5 mL centrifuge tube, 50 μL of 0.5 M THPTA was mixed with 10 μL of 0.5 M Cu(II)SO₄·5H₂O, vortexed, and incubated at room temperature for 5 minutes. After 5 minutes, THPTA / Cu solution (7.2 μL, 6 equiv., THPTA:Cu = 5:1) was added to the reaction vial and vortexed. Immediately thereafter, 2 M ascorbate (5 μL, 50 equiv. / duplex, 16.7 equiv. / alkyne) was added to the reaction vial and vortexed. Upon reaction completion (typically within 0.5–1 h), the reaction was immediately purified by non-denaturing anion exchange chromatography. Example 2. In vivo intratracheal administration of beta-ENaC RNAi agents in rats

[0268] On study day 1, male Sprague-Dawley rats were administered 200 microliters of isotonic saline or 0.5 mg / kg, 1.0 mg / kg, or 2 mg / kg of the beta-ENaC RNAi agent AD06284 or 0.5 mg / kg, 1.0 mg / kg, or 2 mg / kg of the beta-ENaC RNAi agent AD06285 (unlinked to a targeting ligand and formulated in isotonic saline) using a micronebulizer (Penn Century, Philadelphia, PA) suitable for intratracheal (IT) administration. Four rats were administered per group. On study day 8, rats were sacrificed, and total RNA was isolated from both lungs after harvesting and homogenization. Rat beta-ENaC (SCNN1B) mRNA expression was quantified by quantitative PCR using a probe, normalized to rat GAPDH expression, and expressed as a percentage of the vehicle control (geometric mean, + / - 95% confidence interval). [Table 7]

[0269] Example 3. In vivo intratracheal administration of epithelial cell-targeted ligand-binding beta-ENaC RNAi agents in rats On study day 1, male Sprague-Dawley rats were administered 200 microliters of isotonic saline using a micronebulizer (Penn Century, Philadelphia, PA) suitable for intratracheal (IT) administration. They were also administered 0.5 mg / kg, 1.0 mg / kg, or 2 mg / kg of the beta-ENaC RNAi agent AD06284, conjugated to the 5'-end of the sense strand of a tridentate small molecule αvβ6 epithelial cell-targeting ligand (tri-SM6.1, see Figure 3), formulated in isotonic saline. Five rats were administered per group. On study day 8, rats were sacrificed, and total RNA was isolated from both lungs after harvesting and homogenization. Rat beta-ENaC (SCNN1B) mRNA expression was quantified using quantitative PCR using a probe, normalized to rat GAPDH expression, and expressed as a percentage of the vehicle control (geometric mean, + / - 95% confidence interval). [Table 8]

[0270] Example 4. In vivo intratracheal administration of epithelial cell-targeted ligand-binding beta-ENaC RNAi agents in rats On study day 1, male Sprague-Dawley rats were administered 200 microliters of isotonic saline (vehicle, used as a control group) or one of the following beta-ENaC RNAi agents according to the following dosing groups shown in Table 9, via a micronebulizer device (Penn Century, Philadelphia, PA) suitable for intratracheal (IT) administration. [Table 9]

[0271] Five rats were administered per group (n=5). On study day 8, rats were sacrificed, and total RNA was isolated from both lungs after harvesting and homogenization. Rat beta-ENaC (SCNN1B) mRNA expression was quantified by quantitative PCR using a probe, normalized to rat GAPDH expression, and expressed as a percentage of the vehicle control (geometric mean, + / - 95% confidence interval). [Table 10]

[0272] Example 5. In vivo intratracheal administration of epithelial cell-targeted ligand-binding beta-ENaC RNAi agents in rats On study day 1, male Sprague-Dawley rats were administered 200 microliters of isotonic saline (vehicle, used as a control group) or one of the following beta-ENaC RNAi agents according to the following dosing groups shown in Table 11, via a micronebulizer device (Penn Century, Philadelphia, PA) suitable for intratracheal (IT) administration. [Table 11]

[0273] Five rats were administered per group (n=5). Rats were sacrificed on study days 8, 15, or 22 according to the schedule in Table 11 above, and total RNA was isolated from both lungs after harvesting and homogenization. Rat beta-ENaC (SCNN1B) mRNA expression was quantified by quantitative PCR using a probe, normalized to GAPDH expression, and expressed as a percentage of the vehicle control group (geometric mean, + / - 95% confidence interval). [Table 12]

[0274] Example 6. Aerosol administration of epithelial cell-targeted ligand-binding beta-ENaC RNAi agents in sheep Mucociliary clearance (MCC) has been shown to correlate with improved lung function (FEV1) in cystic fibrosis (CF) patients. Initially, MCC was measured in normal sheep by inhaling aerosolized technetium-labeled sulfur colloid followed by gamma imaging for 2 hours to establish baseline values. Starting 3 days after baseline establishment, normal sheep received aerosolized beta-ENaC RNAi agent AD06598 (referred to as APERC-2 in Figures 9 and 20) conjugated to the tridentate small molecule αvβ6 epithelial cell-targeting ligand (tri-SM6.1) at the 5' end of the sense strand and formulated in isotonic saline at a cumulative dose of 0.22 mg / kg or 0.5 mg / kg for 3 consecutive days on study days 1, 2, and 3 (i.e., a total of 3 doses). The beta-ENaC RNAi agent AD06598 was aerosolized at a concentration of 10 mg / mL in a dose volume of 17.5 mL (0.5 mg / kg) or 8.75 mL (0.22 mg / kg) and administered to sheep via nasal intubation. Three sheep per group were studied (n = 3). On day 17 (2 weeks after the final dose), sheep again inhaled aerosolized technetium-labeled sulfur colloid and were then gamma-imaged for 2 hours.

[0275] As shown in Figure 9, administration of the beta-ENaC RNAi agent resulted in a dose-dependent increase in MCC over baseline measurements after two weeks of administration. The observed acceleration of MCC is consistent with improved airway hydration. Example 7. Aerosol administration of epithelial cell-targeted ligand-binding beta-ENaC RNAi agents in sheep

[0276] We evaluated beta-ENaC RNAi agents in a sheep mucociliary clearance (MCC) model. Initially, baseline values ​​were established in normal sheep by inhaling aerosolized technetium-labeled sulfur colloid followed by gamma imaging over a 2-hour period. Starting 3 days after baseline establishment, normal sheep received a single aerosolized dose of 0.5 mg / kg of either 1) the beta-ENaC RNAi agent AD06598 (referred to as APERC-2) conjugated to a tridentate small molecule αvβ6 epithelial cell-targeting ligand (tri-SM6.1) at the 5' end of the sense strand and formulated in isotonic saline, or 2) the beta-ENaC RNAi agent AD07099 (referred to as APERC-5) conjugated to a tridentate small molecule αvβ6 epithelial cell-targeting ligand (tri-SM6.1) at the 5' end of the sense strand and formulated in isotonic saline. Each beta-ENaC RNAi agent was aerosolized at a concentration of 10 mg / mL in a 17.5 mL dose volume and administered to sheep via nasal intubation. One sheep was studied in the APERC-2 group (n = 1), and three sheep were studied in the APERC-5 group (n = 3). On day 14 (2 weeks after the single dose), sheep again inhaled aerosolized technetium-labeled sulfur colloid and were then gamma-imaged for 2 hours.

[0277] For example, when fully bound and annealed, APERC-2 has the following sense and antisense strand structures: Modified sense strand (5'→3'): (TriSM6.1-avb6-TA14)gscaacuguUfAfCfaucuucaacus(invAb) (SEQ ID NO: 246) Modified antisense strand (5'→3'): asGfsusUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 127) (See Figure 22 for the structure of (TriSM6.1-avb6-TA14)) Sense strand base sequence (5'→ 3'): GCAACUGUUACAUCUUCAACU (SEQ ID NO: 223) Antisense strand base sequence (5'→3'): AGUUGAAGAUGUAACAGUUGC (SEQ ID NO: 195)

[0278] Further, for example, when fully bound and annealed, APERC-5 has the following sense and antisense strand structures: Modified sense strand (5'→3'): (TriSM6.1-avb6-TA14)gscaacuguUfAfCfaucuucaacas(invAb) (SEQ ID NO: 187) Modified antisense strand (5'→3'): cPrpusGfsusUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 138) For the structure of (TriSM6.1-avb6-TA14), see Figure 22. For the complete chemical structure of APERC-5, see Figures 27A-27D (free acid) and 28A-28D (sodium salt). Basic base sequence of the sense strand (5'→3') GCAACUGUUACAUCUUCAACA (SEQ ID NO: 227) Antisense strand base sequence (5'→3') UGUUGAAGAUGUAACAGUUGC (SEQ ID NO: 203)

[0279] As shown in Figure 20, administration of the beta-ENaC RNAi agent AD06598 (APERC-2) linked to the tridentate small molecule αvβ6 epithelial cell targeting ligand (tri-SM6.1) resulted in an increase in MCC over baseline measurements two weeks after administration. For example, a single dose of 0.5 mg / kg APERC-2 resulted in a 76% increase over baseline at 2 hours (120 minutes) on day 14 (see Figure 20).

[0280] Administration of the beta-ENaC RNAi agent AD07099 (APERC-5) linked to the tridentate small molecule αvβ6 epithelial cell targeting ligand (tri-SM6.1) also demonstrated an increase in MCC over baseline measurements two weeks after administration, as shown in Figure 11. For example, a single dose of 0.5 mg / kg APERC-5 resulted in a 124% increase over baseline at the 2-hour scan on day 14 (see Figure 11). Example 8. Aerosol administration of epithelial cell-targeted ligand-binding beta-ENaC RNAi agents in sheep

[0281] We evaluated beta-ENaC RNAi agents in a sheep mucociliary clearance (MCC) model. Initially, baseline values ​​were established in normal sheep by inhaling aerosolized technetium-labeled sulfur colloid followed by gamma imaging over a 2-hour period. Starting 3 days after baseline establishment, normal sheep were treated with a cumulative dose of 0.5 mg / kg of either 1) the beta-ENaC RNAi agent AD07217 (referred to as APERC-7) conjugated at the 5' end of the sense strand to a tridentate small molecule αvβ6 epithelial cell-targeting ligand (tri-SM6.1) and formulated in isotonic saline; or 2) beta-ENaC RNAi agent AD07217 (referred to as APERC-7) conjugated at the 5' end of the sense strand to a tridentate small molecule αvβ6 epithelial cell-targeting ligand (tri-SM6.1) and formulated in isotonic saline, but further containing a cysteine-maleimide linker. Sheep received a single inhalation of an aerosol of either the RNAi agent AD07217 (referred to as APERC-8) (see Figure 23 for the chemical structure of the αvβ6 epithelial cell targeting ligand tri-SM6.1 containing a cysteine-maleimide linker) or 3) the beta-ENaC RNAi agent AD06599 (referred to as APERC-9) conjugated to a tridentate small molecule αvβ6 epithelial cell targeting ligand (tri-SM6.1) at the 5' end of the sense strand and formulated in isotonic saline. Each beta-ENaC RNAi agent was aerosolized at a concentration of 10 mg / mL in a 17.5 mL dose volume and administered to sheep via nasal intubation. One sheep per group was studied (n = 1), except for APERC-7, which was administered to three sheep (n = 3). On day 14 (2 weeks after the single dose), the sheep again inhaled aerosolized technetium-labeled sulfur colloid and were then gamma imaged for 2 hours.

[0282] For example, when fully bound and annealed, APERC-7 has the following sense and antisense strand structures: Modified sense strand (5'→3'): (TriSM6.1-avb6-TA14)gsca_2NacuguUfAfCfaucuucaacus(invAb) (SEQ ID NO: 188) Modified antisense strand (5'→3'): asGfsusUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 127) For the structure of (TriSM6.1-avb6-TA14), see Figure 22. For the complete chemical structure of APERC-7, see Figures 25A-25D (free acid) and 26A-26D (sodium salt). Basic base sequence of the sense strand (5'→3') GC(A 2N )ACUGUUACAUCUUCAACU (SEQ ID NO: 229) Antisense strand base sequence (5'→3') AGUUGAAGAUGUAACAGUUGC (SEQ ID NO: 195)

[0283] A functionalized TriAlk14 group at the 5' end of the sense strand (AD07482 in Tables 5A and 5B above) can be used to synthesize the conjugated construct of APERC-7. Alternatively, the NH2-C6 group at the 5' end of the sense strand (AD07217) can be attached to compound 22 (Part E of Example 1 above) to generate an intermediate with identical structure. Either method can be used to obtain the same final construct.

[0284] As shown in Figure 10, administration of the beta-ENaC RNAi agent AD07217 (APERC-7) conjugated to the tridentate small molecule αvβ6 epithelial cell targeting ligand (tri-SM6.1) demonstrated an increase in MCC over baseline measurements 2 weeks after administration, with a 78% increase over baseline at the 14 day, 2-hour post-scan time point.

[0285] Similarly, as shown in Figure 19, administration of the beta-ENaC RNAi agent AD07217 (APERC-8) conjugated to a tridentate small molecule αvβ6 epithelial cell targeting ligand containing a cysteine-maleimide linker (tri-SM6.1) showed a 110% increase over baseline at the 2-hour scan on day 14.

[0286] As shown in Figure 18, administration of the beta-ENaC RNAi agent AD06599 (APERC-9) linked to a tridentate small molecule αvβ6 epithelial cell targeting ligand (tri-SM6.1) demonstrated a 58% increase over baseline at the 2-hour scan time point on day 14. Example 9. Aerosol administration of epithelial cell-targeted ligand-binding beta-ENaC RNAi agents in sheep

[0287] We evaluated beta-ENaC RNAi agents in an ovine mucociliary clearance (MCC) model. First, we measured MCC in normal sheep by gamma imaging over a 2-hour period after inhalation of aerosolized technetium-labeled sulfur colloid to establish baseline values. Starting 3 days after baseline establishment, normal sheep received a single cumulative inhalation dose of 0.5 mg / kg of 1) an aerosol of the beta-ENaC RNAi agent AD07240 (referred to as APERC-10) conjugated at the 5' end of the sense strand to a tridentate small molecule αvβ6 epithelial cell-targeting ligand (tri-SM6.1) and formulated in isotonic saline; 2) an aerosol of the beta-ENaC RNAi agent AD07250 (referred to as APERC-11) conjugated at the 5' end of the sense strand to a tridentate small molecule αvβ6 epithelial cell-targeting ligand (tri-SM6.1) and formulated in isotonic saline; or 3) an aerosol of the beta-ENaC RNAi agent AD07251 (referred to as APERC-12) conjugated at the 5' end of the sense strand to a tridentate small molecule αvβ6 epithelial cell-targeting ligand (tri-SM6.1) and formulated in isotonic saline. Each beta-ENaC RNAi agent was aerosolized at a concentration of 10 mg / mL in a 17.5 mL dose volume and administered to sheep via nasal intubation. One sheep per group was studied (n = 1). On day 14 (2 weeks after the single dose), sheep again inhaled aerosolized technetium-labeled sulfur colloid and were then gamma-imaged for 2 hours.

[0288] As shown in Figure 17, administration of the beta-ENaC RNAi agent AD07240 (APERC-10) conjugated to a tridentate small molecule αvβ6 epithelial cell-targeting ligand (tri-SM6.1) resulted in an 82% increase over baseline at the 2-hour scan on day 14. As shown in Figure 16, administration of the beta-ENaC RNAi agent AD07250 (APERC-11) conjugated to a tridentate small molecule αvβ6 epithelial cell-targeting ligand (tri-SM6.1) resulted in a 134% increase over baseline at the 2-hour scan on day 14. As shown in Figure 15, administration of the beta-ENaC RNAi agent AD07251 (APERC-12) conjugated to a tridentate small molecule αvβ6 epithelial cell-targeting ligand (tri-SM6.1) resulted in a 102% increase over baseline at the 2-hour scan on day 14. Example 10. Aerosol administration of epithelial cell-targeted ligand-binding beta-ENaC RNAi agents in sheep

[0289] We evaluated beta-ENaC RNAi agents in an ovine mucociliary clearance (MCC) model. First, we measured MCC in normal sheep by gamma imaging over a 2-hour period after inhalation of aerosolized technetium-labeled sulfur colloid to establish baseline values. Starting 3 days after baseline establishment, normal sheep received a single cumulative dose of 0.5 mg / kg aerosol of 1) the beta-ENaC RNAi agent AD07252 (referred to as APERC-13) conjugated at the 5' end of the sense strand to a tridentate small molecule αvβ6 epithelial cell-targeting ligand (tri-SM6.1) and formulated in isotonic saline; 2) the beta-ENaC RNAi agent AD07253 (referred to as APERC-14) conjugated at the 5' end of the sense strand to a tridentate small molecule αvβ6 epithelial cell-targeting ligand (tri-SM6.1) and formulated in isotonic saline; or 3) the beta-ENaC RNAi agent AD07255 (referred to as APERC-16) conjugated at the 5' end of the sense strand to a tridentate small molecule αvβ6 epithelial cell-targeting ligand (tri-SM6.1) and formulated in isotonic saline. Each beta-ENaC RNAi agent was aerosolized at a concentration of 10 mg / mL in a 17.5 mL dose volume and administered to sheep via nasal intubation. One sheep per group was studied (n = 1). On day 14 (2 weeks after the single dose), sheep again inhaled aerosolized technetium-labeled sulfur colloid and were then gamma-imaged for 2 hours.

[0290] As shown in Figure 17, administration of the beta-ENaC RNAi agent AD07252 (APERC-13) conjugated to a tridentate small molecule αvβ6 epithelial cell-targeting ligand (tri-SM6.1) resulted in a 62% increase over baseline at the 2-hour scan on day 14. As shown in Figure 16, administration of the beta-ENaC RNAi agent AD07253 (APERC-14) conjugated to a tridentate small molecule αvβ6 epithelial cell-targeting ligand (tri-SM6.1) resulted in a 94% increase over baseline at the 2-hour scan on day 14. As shown in Figure 15, administration of the beta-ENaC RNAi agent AD07255 (APERC-16) conjugated to a tridentate small molecule αvβ6 epithelial cell-targeting ligand (tri-SM6.1) resulted in a 102% increase over baseline at the 2-hour scan on day 14. Example 11. Aerosol administration of epithelial cell-targeted ligand-binding beta-ENaC RNAi agents in sheep

[0291] We evaluated beta-ENaC RNAi agents in a sheep mucociliary clearance (MCC) model. Initially, baseline values ​​were established in normal sheep by inhaling aerosolized technetium-labeled sulfur colloid followed by gamma imaging over a 2-hour period. Starting 3 days after baseline establishment, normal sheep received a single aerosolized dose of 0.5 mg / kg of either 1) the beta-ENaC RNAi agent AD07217 (referred to as APERC-7) conjugated to a tridentate small molecule αvβ6 epithelial cell-targeting ligand (tri-SM6.1) at the 5' end of the sense strand and formulated in isotonic saline, or 2) the beta-ENaC RNAi agent AD07099 (referred to as APERC-5) conjugated to a tridentate small molecule αvβ6 epithelial cell-targeting ligand (tri-SM6.1) at the 5' end of the sense strand and formulated in isotonic saline. Each beta-ENaC RNAi agent was aerosolized at a concentration of 10 mg / mL in a 17.5 mL dose volume and administered to sheep via nasal intubation. Two sheep per group were studied (n = 2). On day 21 (3 weeks after the single dose), sheep again inhaled aerosolized technetium-labeled sulfur colloid and were then gamma-imaged for 2 hours.

[0292] As shown in Figure 10, administration of the beta-ENaC RNAi agent AD07217 (APERC-7) conjugated to a tridentate small molecule αvβ6 epithelial cell targeting ligand (tri-SM6.1) continued to show a 17% increase over baseline at the 2-hour scan time point on Day 21. Also, as shown in Figure 11, administration of the beta-ENaC RNAi agent AD07099 (APERC-5) conjugated to a tridentate small molecule αvβ6 epithelial cell targeting ligand (tri-SM6.1) continued to show a 56% increase over baseline at the 2-hour scan time point on Day 21. Example 12. Relative human beta-ENaC (SCNN1B) mRNA expression in cultured primary normal human bronchial epithelial cells transfected with beta-ENaC RNAi agents

[0293] Normal human primary bronchial epithelial cells were cultured in 96-well tissue culture plates (10,000 cells / well) and transfected with the following RNAiMAX transfection reagents: beta-ENaC RNAi agent AD06598 (designated APERC-2) conjugated to the tridentate small molecule αvβ6 epithelial cell-targeting ligand (tri-SM6.1) at the 5' end of the sense strand; beta-ENaC RNAi agent AD07099 (designated APERC-5) conjugated to the tridentate small molecule αvβ6 epithelial cell-targeting ligand (tri-SM6.1) at the 5' end of the sense strand; or beta-ENaC RNAi agent AD07217 (designated APERC-7) conjugated to the tridentate small molecule αvβ6 epithelial cell-targeting ligand (tri-SM6.1) at the 5' end of the sense strand. 48 hours after transfection, total RNA was isolated, cDNA was generated from the cells by Cells-to-CT extraction, and SCNN1B mRNA expression was quantified by quantitative PCR using a probe, normalized to rat GAPDH expression, and expressed as a percentage of the control group (no transfection) containing lipofectamine alone (geometric mean, + / - 95% confidence interval). As shown in Figure 24, transfection of the disclosed beta ENaC RNAi agent resulted in potent dose-dependent silencing of SCNN1B mRNA expression in cultured normal human bronchial epithelial cells. Other embodiments

[0294] Although the present invention has been described in conjunction with the detailed description thereof, it should be understood that the foregoing description is intended to be illustrative of the invention and not to limit the scope of the invention, which is defined by the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims. Some aspects of the invention are described below. 1. An RNAi agent that inhibits the expression of the beta ENaC gene, an antisense strand comprising at least 17 contiguous nucleotides that differ from any one of the sequences set forth in Table 2 or Table 3 by 0 or 1 nucleotide; and a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand 1. An RNAi agent comprising: 2. The RNAi agent according to item 1, wherein the antisense strand comprises nucleotides 2 to 18 of any one of the sequences shown in Table 2 or Table 3. 3. The RNAi agent of item 1 or 2, wherein the sense strand comprises a nucleotide sequence of at least 17 contiguous nucleotides that differs by 0 or 1 nucleotide from any one of the sequences set forth in Table 2 or Table 4, and the sense strand has a region that is at least 85% complementary to the antisense strand over the 17 contiguous nucleotides. 4. The RNAi agent of any of items 1 to 3, wherein at least one nucleotide of the betaENaC RNAi agent is a modified nucleotide or comprises a modified internucleoside linkage. 5. The RNAi agent according to any one of items 1 to 3, wherein all or substantially all of the nucleotides are modified nucleotides. 6. The RNAi agent according to any of items 4 to 5, wherein the modified nucleotide is selected from the group consisting of 2'-O-methyl nucleotides, 2'-fluoro nucleotides, 2'-deoxy nucleotides, 2',3'-seco-nucleotide mimics, bridged nucleotides, 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted 2'-O-methyl nucleotides, inverted 2'-deoxy nucleotides, 2'-amino-modified nucleotides, 2'-alkyl-modified nucleotides, morpholino nucleotides, vinylphosphonate-containing nucleotides, cyclopropylphosphonate-containing nucleotides, and 3'-O-methyl nucleotides. 7. The RNAi agent of item 5, wherein all or substantially all of the nucleotides are modified with 2'-O-methyl nucleotides, 2'-fluoro nucleotides, or a combination thereof. 8. The RNAi agent according to any one of items 1 to 7, wherein the antisense strand comprises the nucleotide sequence of any one of the modified sequences shown in Table 3. 9. The RNAi agent according to any one of items 1 to 8, wherein the sense strand comprises the nucleotide sequence of any one of the modified sequences shown in Table 4. 10. The RNAi agent of item 1, wherein the antisense strand comprises the nucleotide sequence of any one of the modified sequences shown in Table 3, and the sense strand comprises the nucleotide sequence of any one of the modified sequences shown in Table 4. 11. The RNAi agent according to any one of items 1 to 10, wherein the sense strand is 18 to 30 nucleotides in length and the antisense strand is 18 to 30 nucleotides in length. 12. The RNAi agent according to item 11, wherein the sense strand and the antisense strand are each 18 to 27 nucleotides in length. 13. The RNAi agent according to item 12, wherein the sense strand and the antisense strand are each 18 to 24 nucleotides in length. 14. The RNAi agent according to item 13, wherein the sense strand and the antisense strand are each 21 nucleotides in length. 15. The RNAi agent according to item 14, having two blunt ends. 16. The RNAi agent according to any of items 1 to 15, wherein the sense strand comprises one or two terminal caps. 17. The RNAi agent according to any of items 1 to 16, wherein the sense strand comprises one or two inverted abasic residues. 18. The RNAi agent according to item 1, wherein the RNAi agent is composed of a sense strand and an antisense strand that form a duplex having the structure of any one of the duplexes in Tables 5A and 5B. 19. The RNAi agent according to item 18, wherein all or substantially all of the nucleotides are modified nucleotides. 20. The following sequences, namely: AAGUCGAUGAUGAUCUCCCCA (SEQ ID NO: 194); AGUUGAAGAUGUAACAGUUGC (SEQ ID NO: 195); UUGUUGUAGUCACUGUAGACG (SEQ ID NO: 198); UUGUUGUAGUCACUGUAGAAG (SEQ ID NO: 244); UCGUGUUGUAGUCACUGUAGG (SEQ ID NO: 199); UGUUGUUGCAGUAUUUCUCCC (SEQ ID NO: 201); or UGUUGAAGAUGUAACAGUUGC (SEQ ID NO: 203) 2. The RNAi agent of claim 1, comprising an antisense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs by 0 or 1 nucleotide from the nucleotide sequence (5'→3') of one of: 21. The sense strand has the following sequence: CGUCUACAGUGACUACAACAA (SEQ ID NO: 217); CCUACAGUGACUACAACACIA (SEQ ID NO: 219) (wherein I represents an inosine (hypoxanthine) nucleotide); GGGAGAAAUACUGCAACAACA (SEQ ID NO: 222); GCAACUGUUACAUCUUCAACU (SEQ ID NO: 223); UGGGGAGAUCAUCAUCIACUU (SEQ ID NO: 224) (wherein I represents an inosine (hypoxanthine) nucleotide); GCAACUGUUACAUCUUCAACA (SEQ ID NO: 227); CUUCUACAGUGACUACAACAA (SEQ ID NO: 245); GC(A 2N ) ACUGUUACAUCUUCAACU (SEQ ID NO: 229) (wherein, A 2N represents a 2-aminoadenine-containing nucleotide); or GC(A 2N ) ACUGUUACAUCUUCAACA (SEQ ID NO: 230), (wherein A 2N represents a 2-aminoadenine-containing nucleotide) 21. The RNAi agent of item 20, consisting of, consisting essentially of, or comprising a nucleotide sequence that differs by 0 or 1 nucleotide from the nucleotide sequence (5'→3') of one of 22. The RNAi agent according to item 20 or 21, wherein all or substantially all of the nucleotides are modified nucleotides. 23. The following sequences, namely: asAfsgsUfcGfaUfgAfuGfaUfcUfcCfcCfsa (SEQ ID NO: 126); asGfsusUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 127); usUfsgsUfuGfuAfgUfcAfcUfgUfaGfaCfsg (SEQ ID NO: 130); usCfsgsUfgUfuGfuAfgUfcAfcUfgUfaGfsg (SEQ ID NO: 131); usGfsusUfgUfuGfcAfgUfaUfuUfcUfcCfsc (SEQ ID NO: 135); cPrpusGfsusUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 138); cPrpuGfuUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 150); cPrpasGfsusUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 153); or cPrpaGfuUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 154); and an antisense strand comprising, consisting of, or consisting essentially of a modified nucleotide sequence that differs by 0 or 1 nucleotide from the nucleotide sequence (5'→3') of one of In the sequences, a, c, g, and u represent 2'-O-methyladenosine, 2'-O-methylcytidine, 2'-O-methylguanosine, and 2'-O-methyluridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, 2'-fluorocytidine, 2'-fluoroguanosine, and 2'-fluorouridine, respectively; cPrpa and cPrpu represent 5'-cyclopropylphosphonate-2'-O-methyladenosine and 5'-cyclopropylphosphonate-2'-O-methyluridine, respectively; s represents a phosphorothioate bond; 2. The RNAi agent of item 1, wherein all or substantially all of the nucleotides of the sense strand are modified nucleotides. 24. The sense strand has the following sequence: csgucuacaGfUfGfacuacaacaa (SEQ ID NO: 234); cscuacaguGfAfCfuacaacacia (SEQ ID NO: 235); gsggagaaaUfAfCfugcaacaaca (SEQ ID NO: 236); gscaacuguUfAfCfaucuucaacu (SEQ ID NO: 237); usggggagaUfCfAfucauciacuu (SEQ ID NO: 238); gscaacuguUfAfCfaucuucaaca (SEQ ID NO: 239); gsca_2NacuguUfAfCfaucuucaacu (SEQ ID NO: 240); or gsca_2NacuguUfAfCfaucuucaaca (SEQ ID NO: 241) a modified nucleotide sequence that differs by zero or one nucleotide from the nucleotide sequence (5'→3') of In the sequences, a, c, g, i, and u represent 2'-O-methyladenosine, 2'-O-methylcytidine, 2'-O-methylguanosine, 2'-O-methylinosine, and 2'-O-methyluridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, 2'-fluorocytidine, 2'-fluoroguanosine, and 2'-fluorouridine, respectively; cPrpa and cPrpu represent 5'-cyclopropylphosphonate-2'-O-methyladenosine and 5'-cyclopropylphosphonate-2'-O-methyluridine, respectively; s represents a phosphorothioate bond; 2. The RNAi agent of item 1, wherein all or substantially all of the nucleotides of the antisense strand are modified nucleotides. 25. The RNAi agent according to any one of items 20 to 24, wherein the sense strand further comprises an inverted abasic residue at the 3' end of the nucleotide sequence, the 5' end of the nucleotide sequence, or both. 26. The RNAi agent according to any of items 1 to 25, wherein the RNAi agent is linked to a targeting ligand. 27. The RNAi agent according to item 26, wherein the targeting ligand has affinity for a cell receptor expressed in epithelial cells. 28. The RNAi agent according to item 27, wherein the targeting ligand comprises an integrin targeting ligand. 29. The RNAi agent according to item 28, wherein the integrin targeting ligand is an αvβ6 integrin targeting ligand. 30. The targeting ligand has the following structure: [ka] or a pharmaceutically acceptable salt thereof, [ka] 30. The RNAi agent according to item 29, wherein indicates a point of attachment to the RNAi agent. 31. The targeting ligand has the following structure: [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] having a structure selected from the group consisting of: [ka] 30. The RNAi agent according to any one of items 26 to 29, wherein indicates the point of attachment to the RNAi agent. 32. The RNAi agent according to any one of items 26 to 31, wherein the targeting ligand is bound to the sense strand. 33. The RNAi agent according to item 32, wherein the targeting ligand is attached to the 5' end of the sense strand. 34. A composition comprising the RNAi agent according to any of items 1 to 33, and further comprising a pharmaceutically acceptable excipient. 35. The composition of item 34, further comprising a second RNAi agent capable of inhibiting expression of alpha ENaC (SCNN1A), beta ENaC (SCNN1B), or gamma ENaC (SCNN1G). 36. The composition according to any of items 34-35, further comprising one or more additional therapeutic agents. 37. The composition according to any of items 34 to 36, which is formulated for inhaled administration. 38. The composition of item 37, delivered by a metered dose inhaler, jet nebulizer, vibrating mesh nebulizer, or soft mist inhaler. 39. The composition of any of items 34 to 38, wherein the RNAi agent is a sodium salt. 40. The composition according to any of items 34 to 39, wherein the pharmaceutically acceptable excipient is water for injection. 41. The composition according to any of items 34 to 39, wherein the pharmaceutically acceptable excipient is a buffered saline solution. 42. A method for inhibiting the expression of the beta-ENaC gene in a cell, the method comprising introducing into the cell an effective amount of an RNAi agent according to any one of items 1 to 33 or a composition according to any one of items 34 to 41. 43. The method of item 42, wherein the cell is in a subject. 44. The method of item 43, wherein the subject is a human subject. 45. The method according to any of items 42 to 44, wherein beta-ENaC gene expression is inhibited by at least about 30% after administration of the RNAi agent. 46. ​​A method for treating one or more conditions or diseases associated with increased or elevated ENaC activity levels, comprising administering to a human subject in need of such treatment a therapeutically effective amount of a composition according to any of items 34 to 41. 47. The method according to item 46, wherein the disease is a respiratory disease. 48. The method of item 47, wherein the respiratory disease is cystic fibrosis, chronic bronchitis, non-cystic fibrosis bronchiectasis, chronic obstructive pulmonary disease (COPD), asthma, a respiratory tract infection, primary ciliary dyskinesia, or lung cancer cystic fibrosis. 49. The method according to item 48, wherein the disease is chronic obstructive pulmonary disease (COPD). 50. The method according to item 46, wherein the disease is an eye disease. 51. The method according to item 50, wherein the eye disease is dry eye syndrome. 52. The method of any of items 42 to 51, wherein the RNAi agent is administered at a cumulative dose of about 0.01 mg / kg to about 5.0 mg / kg of body weight of the subject. 53. The method of any of items 42 to 52, wherein the RNAi agent is administered at a cumulative dose of about 0.03 mg / kg to about 2.0 mg / kg of body weight of the subject. 54. The method of any of items 43 to 53, wherein the RNAi agent is administered in two or more doses. 55. Use of the RNAi agent according to any of items 1 to 33 for the treatment of a disease, disorder, or condition mediated at least in part by ENaC activity and / or beta ENaC gene expression. 56. Use of the composition according to any of items 34 to 41 for the treatment of a disease, disorder, or condition mediated at least in part by ENaC activity and / or beta ENaC gene expression. 57. Use of a composition according to any of items 34 to 41 for the manufacture of a medicament for treating a disease, disorder, or condition mediated at least in part by ENaC activity and / or beta ENaC gene expression. 58. The use according to any of items 55 to 57, wherein the disease is chronic obstructive pulmonary disease (COPD). 59. A method for producing an RNAi agent according to any one of items 1 to 33, comprising annealing a sense strand and an antisense strand to form a double-stranded ribonucleic acid molecule. 60. The method of claim 59, wherein the sense strand comprises a target ligand. 61. The method of claim 60, comprising binding a targeting ligand to the sense strand.

Claims

1. An RNAi agent that inhibits the expression of the beta ENaC gene, An antisense strand comprising the nucleotide sequence (5'→3'): cPrpusGfsusUfgAfagaugUfaAfcAfgUfuGfsc (SEQ ID NO: 138); and a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand Including, wherein a represents 2'-O-methyl adenosine, c represents 2'-O-methyl cytidine, g represents 2'-O-methyl guanosine, u represents 2'-O-methyl uridine; A represents 2'-fluoro adenosine, C represents 2'-fluoro cytidine, G represents 2'-fluoro guanosine, U represents 2'-fluoro uridine; cPrpu represents 5'-cyclopropylphosphonate-2'-O-methyl uridine; s represents a phosphorothioate linkage; and all or substantially all of the nucleotides of the sense strand are modified nucleotides.

2. the sense strand comprises the nucleotide sequence (5'→3'): gscaacuguUfAfCfaucuucaaca (SEQ ID NO: 239); 2. The RNAi agent of claim 1, wherein in the sequences, a represents 2'-O-methyl adenosine, c represents 2'-O-methyl cytidine, g represents 2'-O-methyl guanosine, u represents 2'-O-methyl uridine; Af represents 2'-fluoro adenosine, Cf represents 2'-fluoro cytidine, Gf represents 2'-fluoro guanosine, Uf represents 2'-fluoro uridine; and s represents a phosphorothioate bond.

3. The RNAi agent of claim 1 or 2, wherein the sense strand comprises one or two terminal caps.

4. The RNAi agent of any one of claims 1 to 3, wherein the sense strand comprises one or two inverted abasic residues.

5. An RNAi agent described in any one of claims 1 to 4, wherein the sense strand further comprises an inverted abasic residue at the 3' end of the nucleotide sequence, the 5' end of the nucleotide sequence, or both.

6. The RNAi agent of claim 1, wherein the RNAi agent is composed of a sense strand and an antisense strand that form a duplex having the structure of AD07099 (SEQ ID NO: 138 and SEQ ID NO: 177).

7. The RNAi agent of any one of claims 1 to 6, wherein the RNAi agent is linked to a targeting ligand.

8. The RNAi agent of claim 7 , wherein the targeting ligand has affinity for a cellular receptor expressed in epithelial cells.

9. The RNAi agent of claim 8 , wherein the targeting ligand comprises an integrin targeting ligand.

10. The RNAi agent of claim 9, wherein the integrin targeting ligand is an αvβ6 integrin targeting ligand.

11. The targeting ligand has the following structure: 【Chemistry 1】 or a pharmaceutically acceptable salt thereof, 【Chemistry 2】 The RNAi agent of any one of claims 7 to 10, wherein indicates a point of attachment to the RNAi agent.

12. The targeting ligand has the following structure: 【Chemistry 3-1】 【Chemistry 3-2】 【Chemistry 3-3】 [Chemistry 3-4] [Transformation 3-5] 【Chemistry 3-6】 【Chemistry 3-7】 【Transformation 3-8】 【Chemistry 3-9】 having a structure selected from the group consisting of: 【Chemistry 4】 The RNAi agent of any one of claims 7 to 11, wherein indicates a point of attachment to the RNAi agent.

13. The RNAi agent according to any one of claims 7 to 12, wherein the targeting ligand is bound to the sense strand.

14. The RNAi agent of claim 13 , wherein the targeting ligand is attached to the 5′ end of the sense strand.

15. A composition comprising the RNAi agent of any one of claims 1 to 14, and further comprising a pharmaceutically acceptable excipient.

16. 16. The composition of claim 15, further comprising a second RNAi agent capable of inhibiting expression of alpha ENaC (SCNN1A), beta ENaC (SCNN1B), or gamma ENaC (SCNN1G).

17. The composition of any one of claims 15 to 16, further comprising one or more additional therapeutic agents.

18. The composition of any one of claims 15 to 17, which is formulated for inhaled administration.

19. 20. The composition of claim 18, delivered by a metered dose inhaler, a jet nebulizer, a vibrating mesh nebulizer, or a soft mist inhaler.

20. The composition of any one of claims 15 to 19, wherein the RNAi agent is a sodium salt.

21. The composition of any one of claims 15 to 20, wherein the pharmaceutically acceptable excipient is water for injection.

22. The composition of any one of claims 15 to 20, wherein the pharmaceutically acceptable excipient is a buffered saline solution.

23. A composition comprising an RNAi agent described in any one of claims 1 to 14 or a composition described in any one of claims 15 to 22 for use in inhibiting expression of the beta-ENaC gene in a cell, comprising introducing into the cell an effective amount of an RNAi agent described in any one of claims 1 to 14 or a composition described in any one of claims 15 to 22.

24. The composition of claim 23 , wherein the cell is in a subject.

25. 25. The composition of claim 24, wherein the subject is a human subject.

26. 26. The composition of any one of claims 23 to 25, wherein beta ENaC gene expression is inhibited by at least about 30% after administration of the RNAi agent.

27. 23. A composition according to any one of claims 15 to 22 for use in the treatment of one or more symptoms or diseases associated with increased or elevated ENaC activity levels, comprising administering a therapeutically effective amount of the composition according to any one of claims 15 to 22 to a human subject in need of such treatment.

28. 28. The composition of claim 27, wherein the disease is a respiratory disease.

29. 29. The composition of claim 28, wherein the respiratory disease is cystic fibrosis, chronic bronchitis, non-cystic fibrosis bronchiectasis, chronic obstructive pulmonary disease (COPD), asthma, a respiratory tract infection, primary ciliary dyskinesia, or lung cancer cystic fibrosis.

30. 30. The composition of claim 29, wherein the disease is chronic obstructive pulmonary disease (COPD).

31. 28. The composition of claim 27, wherein the disease is an eye disease.

32. 32. The composition of claim 31, wherein the eye disease is dry eye syndrome.

33. 33. The composition of any one of claims 23-32, wherein the RNAi agent is administered at a cumulative dose of about 0.01 mg / kg to about 5.0 mg / kg of body weight of the subject.

34. 34. The composition of any one of claims 23-33, wherein the RNAi agent is administered at a cumulative dose of about 0.03 mg / kg to about 2.0 mg / kg of body weight of the subject.

35. The composition of any one of claims 23 to 34, wherein the RNAi agent is administered in two or more doses.

36. A composition comprising the RNAi agent of any one of claims 1 to 14 for the treatment of a disease, disorder, or condition mediated at least in part by ENaC activity and / or beta ENaC gene expression.

37. The composition of any one of claims 15 to 22 for the treatment of a disease, disorder or condition mediated at least in part by ENaC activity and / or beta ENaC gene expression.

38. Use of a composition according to any one of claims 15 to 22 for the manufacture of a medicament for treating a disease, disorder or condition mediated at least in part by ENaC activity and / or beta ENaC gene expression.

39. 39. The use according to claim 38, wherein the disease is chronic obstructive pulmonary disease (COPD).

40. The composition described in claim 36 or 37, wherein the disease is chronic obstructive pulmonary disease (COPD).

41. A method for producing an RNAi agent according to any one of claims 1 to 14, comprising annealing a sense strand and an antisense strand to form a double-stranded ribonucleic acid molecule.

42. 42. The method of claim 41, wherein the sense strand comprises a target ligand.

43. 43. The method of claim 42, comprising attaching a targeting ligand to the sense strand.

Citation Information

Patent Citations

  • Organic compositions for treating beta-ENaC-related diseases

    JP2013525332A

  • Alpha-v beta-6 integrin ligands and uses thereof

    WO2018085415A1

  • RNAi AGENTS FOR INHIBITING EXPRESSION OF ALPHA-ENaC AND METHODS OF USE

    WO2019010274A1