Cyclic compound library and method for constructing the same

A method for constructing cyclic compound libraries using a photocleavable group and cyclooxygenase ring-closing reaction addresses limitations in existing technologies, offering diverse and stable libraries for high-throughput screening with enhanced accuracy.

JP7832608B2Active Publication Date: 2026-03-18アフィニティ (シャンハイ) バイオファーマシューティカル カンパニー リミテッド
1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Filing Date
2022-02-18
Publication Date
2026-03-18

Smart Images

  • Figure 0007832608000115
    Figure 0007832608000115
  • Figure 0007832608000116
    Figure 0007832608000116
  • Figure 0007832608000117
    Figure 0007832608000117
Patent Text Reader

Abstract

A cyclic compound library and its construction method are provided, which uses a solid support, a molecule containing a photocleavable group, a linker, a building block, a ring-closing A-terminal molecule, and a ring-closing B-terminal molecule at both ends of the reaction synthesis, utilizes the decomposition of the solid support under light irradiation, and completes ring closure of the amino acid residue structures of the ring-closing A-terminal molecule A and the ring-closing B-terminal molecule B by the action of cyclohydrolase. This method, which uses mild ring-closing conditions, is more universal and expands the types of chemical reactions of the encoded compound library and the diversity of the compound library.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] This invention relates to the field of medicinal chemistry, and more particularly to a cyclic compound library and a method for constructing the same. [Background technology]

[0002] Advances in disease characterization and target identification continue to propel drug discovery into uncharted territory. The number of new targets is constantly increasing—attractive from a pathophysiological standpoint, yet challenging to discover established small molecule compounds or biologics that modulate these target functions. One approach to addressing this challenge is to establish compound libraries in which small molecule compounds derived from conventional compound libraries are, in principle, biologically usable, enable cell permeability, and specifically bind to specific proteins (e.g., enzymes).

[0003] Compounds derived from DNA-coding libraries (DELs) are similar to small molecules, offering an opportunity to screen for one or more potential chemicals. The likelihood of discovering new chemical starting points has become very high. However, small molecules typically do not function well for protein-protein interactions. Protein interactions, on the other hand, tend to have expanded binding surfaces, and biologics are well-suited for such applications, often possessing superior selectivity and strong binding affinity.

[0004] Cyclic peptides are attracting attention as promising therapeutic candidates. They offer several key advantages over linear peptides. Typically, macrocyclicization restricts the conformational freedom of cyclic peptides, minimizing entropy during binding, allowing cyclic molecules to bind more strongly and specifically to target proteins. Furthermore, under protease hydrolysis conditions, cyclic peptides are more stable than linear molecules. Additionally, because cyclic peptides have a relatively wide range of structures, they may be effective in covering large, shallow interfaces involving protein-protein interactions that are difficult to target with conventional drug-like small molecules.

[0005] Currently, Reference 1 (Non-Patent Literature 1: Min Hyeon Shin, et al. Bioconjugate Chemistry, 2019, 30, 2931-2938) reports on the construction of a DNA-encoded cyclic mimetic peptide library, and describes a method for constructing such a library. However, the synthesis process relies on chloroacetic acid for the introduction of synthetic blocks at each step, and since the synthetic blocks consist only of low-molecular-weight compounds of primary amines with one reactive group -NH2, the number and type of atoms between each synthetic block are fixed, resulting in a repeating -CO-CH2-N- structural unit and a lack of diversity in the compound library. It has been demonstrated in many drug development studies that the length and type of carbon atoms between drugs significantly affect drug solubility and permeability. Furthermore, as shown in Reference 1, cyclic peptide libraries are mainly used for screening highly protein-protein interaction (PPI) inhibitors that rely on intramolecular or intermolecular hydrogen bonds formed by N atoms and oxygen atoms. The nitrogen atoms formed by the synthetic blocks bound to the cyclic compound library molecules are tertiary amines, exhibiting low or insufficient binding affinity to proteins. This indicates that the types of compound libraries are very limited and do not meet the need for diverse cyclic compound libraries for modern drug discovery. Furthermore, the difficulty in constructing cyclic compound libraries lies in the reaction that forms the ring at the first and last ends of the long chain structure. The cyclization method reported in Reference 1 is limited to chemical cyclization reactions, and since the compound library must be constructed with the DNA sequence supported to complete the cyclization, there are many constraints on chemical cyclization reactions. Moreover, because metal ions are used in the cyclization reaction, there is a possibility of chelation with the DNA molecule, which adversely affects the cyclization reaction. The use of metal ions in the cyclization reaction may adversely affect the stability of the DNA molecule, limiting the stability and accuracy of the screening results.

[0006] Furthermore, Reference 2 (Patent Document 1: CN102471772A) discloses a peptide library containing bicyclic peptides. Bicyclic peptide molecules possess the properties of antibodies, small molecule drugs, and peptides, exhibiting affinity and precise target specificity similar to antibodies. Simultaneously, their small molecular weight allows for rapid and deep penetration into tissues, enabling targeting of lesions from within the tissue. Due to their peptide properties, their pharmacokinetic half-life and renal clearance pathway are "modifiable," thus avoiding hepatic and gastrointestinal toxicity common to other drug forms. However, the technical approach disclosed in this document is a phage screening technique and is limited to natural amino acids, which is a limitation of this compound library.

[0007] Therefore, in this field, in order to obtain a richer cyclic compound library and increase the diversity of the compound library, it is necessary to establish milder and more universal cyclization reaction conditions and cyclization methods for other cyclic molecular structures, which are not limited to peptide-mimicking peptides. Furthermore, in order to directly screen target proteins and enhance the usefulness of the compound library, the establishment of compound library-target protein binding and complexation techniques is required in this field. [Prior art documents] [Patent Documents]

[0008] [Patent Document 1] Chinese Patent Application Publication No. 102471772 [Non-patent literature]

[0009] [Non-Patent Document 1] Min Hyeon Shin, et al. Bioconjugate Chemistry, 2019, 30, 2931-2938 [Overview of the project] [Problems that the invention aims to solve]

[0010] One of the technical problems that this invention aims to solve is to overcome the limitations of conventional ring-closing methods for cyclic compound libraries, to provide a method for constructing cyclic compound libraries that has the advantages of milder ring-closing reaction conditions and high universality, can be used for constructing monocyclic and bicyclic compound libraries, and has fewer side reactions.

[0011] One of the technical problems that this invention aims to solve is to provide a novel library of cyclic compounds having a cyclic molecular structure, thereby increasing the diversity of compound libraries and expanding the range of applications for new drug screening. [Means for solving the problem]

[0012] A method for constructing a cyclic compound library, characterized by comprising the following steps: 1) A solid support G is directly or indirectly bonded to a molecule M containing a photocleavable group to obtain GM; 2) Perform one of the following methods: Method 1, Method 2, or Method 3; Method 1: Perform steps a1 to g1; a1. GM is reactively bonded to the ring-bound A-terminus molecule A to obtain GMA; b1. GMA is reactively bonded to a linker L1 having at least a trifunctional group to obtain GMA-L1; c1. GMA-L1 is sequentially reacted with the starting nucleotide molecule HP and the open primer OP to bind the starting nucleotide molecule HP to the linker L1, thereby obtaining GMA-L1-HP-OP; d1. The product obtained in the previous step is reacted with synthetic block C1 and the DNA tag tag1 corresponding to synthetic block C1, respectively, to bind synthetic block C1 to L1 and DNA tag tag1 to OP to obtain GMA-L1(-HP-OP-tag1)-C1; e1. Define the binding reaction of the corresponding synthetic block and DNA tag set as an extension step, and repeat the extension step so that the synthetic block is sequentially spliced ​​to form a chain, and the DNA tag corresponding to the synthetic block is sequentially spliced ​​to form a chain, GMA-L1(-HP-OP-tag1-······-tag n )-C1-······-C n We obtain the following, where 2 ≤ n ≤ 7 and n is a positive integer; f1. The product obtained in step e1 is reacted with the ring-bound B-terminus molecule B and the closure primer CP to form the ring-bound B-terminus molecule B C n , tag closure primer CP n Combine them here. HP-OP-tag1-······-tag n -CP forms the complete DNA coding sequence, GMA-L1(-DNA)-C1-······-C n -B, i.e., compound library S1'' is obtained. g1. The product obtained in the previous step is subjected to a decomposition reaction under a light source to separate M from A, resulting in A-L1(-DNA)-C1-···-C n -B, i.e., obtain compound library S1'; Method 2: Proceed as in steps a2-g2, but you may swap the order of steps e2 and f2; a2. GM is reactively bonded to a linker L1 having at least a trifunctional group to obtain GM-L1; b2. GM-L1 is sequentially reacted with the starting nucleotide molecule HP and the open primer OP to bind the starting nucleotide molecule HP to the solid support G, thereby obtaining OP-HP-GM-L1; c2. OP-HP-GM-L1 is reacted with synthetic block C1 and DNA tag tag1 corresponding to synthetic block C1, and synthetic block C1 is bound to L1 and DNA tag tag1 is bound to OP to obtain tag1-OP-HP-GM-L1-C1. d2. Define the ligation reaction of the corresponding synthetic block and DNA tag set as an extension step, and repeat the extension step such that the synthetic blocks are sequentially spliced to form a chain and the DNA tags corresponding to the synthetic blocks are sequentially spliced to form a chain, resulting in tag n -······-tag1-OP-HP-G-M-L1-C1······-C n where 0 ≦ n ≦ 7 and n is an integer; e2. React the product obtained in the previous step with a closed-loop A-terminal molecule A and bind the closed-loop A-terminal molecule A to C n ; f2. React the product obtained in the previous step with synthetic blocks C n+1 , ······, C n+m and their corresponding DNA tags tag n+1 , ······, tag n+m sequentially according to the described extension step, binding synthetic block C n+1 to linker L1 and DNA tag tag n+1 to tag n ; after steps e2 and f2, tag n+m -······-tag1-OP-HP-G-M-L1(-C1······C n -A)-C n+1 ······-C n+m is obtained; where 0 ≦ n ≦ 7, 0 ≦ m ≦ 7, n and m are integers, and 2 ≦ n + m ≦ 7. g2. React the product obtained in the previous step with a closed-loop B-terminal molecule B and a closed primer CP, binding the closed-loop B-terminal molecule B to C n+m and the closed primer CP to tag n+m . Here, a complete DNA code sequence is formed by HP-OP-tag1-······-tag n+m -CP, and DNA-G-M-L1(-C1······-C n -A)-C n+1 ······C n+m -B, i.e., compound library S2' is obtained; Method 3: Proceed as in steps a3-g3, but you may swap the order of steps e3 and f3; a3. GM is reactively bonded with a linker L1 having at least tetrafunctional properties to obtain GM-L1; b3. GM-L1 is sequentially reacted with the starting nucleotide molecule HP and the open primer OP to bind the starting nucleotide molecule HP to the linker L1, thereby obtaining GM-L1-HP-OP; c3. GM-L1-HP-OP is reacted with synthetic block C1 and the DNA tag tag1 corresponding to synthetic block C1, respectively, to bind synthetic block C1 to L1 and DNA tag tag1 to OP, thereby obtaining GM-L1(-HP-OP-tag1)-C1; d3. Define the binding reaction of the corresponding synthetic block and DNA tag set as an extension step, and repeat the extension step so that the synthetic block is sequentially spliced ​​to form a chain, and the DNA tag corresponding to the synthetic block is sequentially spliced ​​to form a chain, so that GM-L1(-HP-OP-tag1-······-tag n )-C1-······-C n We obtain the following, where 2 ≤ n ≤ 7 and n is a positive integer; e3. The product obtained in the previous step is reacted with the ring-bound A-terminated molecule A, and the ring-bound A-terminated molecule A is converted to C n To combine; f3. Combine the product obtained in the previous step into synthesis block C n+1 ,······,C n+m and their corresponding DNA tags n+1 ,······,tag n+m The reaction is carried out sequentially according to the extension steps described, and synthesis block C n+1 Linker L1, DNA tag n+1 tag n Combine them; after steps e3 and f3, GM-L1(-HP-OP-tag1······-tag n+m )(-C1······-C n -A)-C n+1 ······-C n+mWe obtain ; where 0 ≤ n ≤ 7, 0 ≤ m ≤ 7, n and m are integers, and 2 ≤ n + m ≤ 7. g3. The product obtained in the previous step is reacted with the ring-bound B-terminus molecule B and the closure primer CP to form the ring-bound B-terminus molecule B C n+m Tag the closure primer CP n+m Combine them here. HP-OP-tag1-······-tag n+m -CP forms the complete DNA coding sequence, GM-L1(-DNA)(-C1······C n -A)-C n+1 ······-C n+m -B, i.e., obtain compound library S3'; 3) Compound libraries S1', S2', or S3' are subjected to a ring-closing reaction in the presence of cyclooxygenase, where the ring-closing A-terminus molecule A reacts with the ring-closing B-terminus molecule B to form a ring, and each [ka] , that is, to obtain a cyclic compound library S1; or [ka] , that is, to obtain the cyclic compound library S2; or [ka] That is, we obtain the cyclic compound library S3. [Brief explanation of the drawing]

[0013] [Figure 1] Graph I shows the agarose gel electrophoresis detection results for Example 29. [Figure 2] Graph II shows the agarose gel electrophoresis detection results for Example 29. [Figure 3] Graph III shows the agarose gel electrophoresis detection results for Example 29. [Figure 4] This is a graph of the agarose gel electrophoresis detection results from Step 5 of Example 31. [Figure 5] This graph shows the statistical results of the abundance of the tag sequence in Example 32. [Figure 6] This is a graph showing the test results for Example 33. [Figure 7] This is a graph of the agarose gel electrophoresis detection results from Step 5 of Example 34. [Figure 8] This graph shows the statistical results of the abundance of the tag sequence in Example 35. [Figure 9] This graph shows the flow cytometry analysis results for Example 36. [Modes for carrying out the invention]

[0014] To solve the above technical problems, the present invention provides a first technical solution: A method for constructing a cyclic compound library, including the following steps: 1) A solid support G is directly or indirectly bonded to a molecule M containing a photocleavable group to obtain GM: 2) Proceed with the following steps: a1. GM is reactively bonded to the ring-bound A-terminus molecule A to obtain GMA; b1. GMA is reactively bonded to a linker L1 having at least a trifunctional group to obtain GMA-L1; c1. GMA-L1 is sequentially reacted with the starting nucleotide molecule HP and the open primer OP to bind the starting nucleotide molecule HP to the linker L1, thereby obtaining GMA-L1-HP-OP; d1. The product obtained in step c1 is reacted with synthetic block C1 and the DNA tag tag1 corresponding to synthetic block C1, respectively, to bind synthetic block C1 to L1 and DNA tag tag1 to OP to obtain GMA-L1(-HP-OP-tag1)-C1; e1. Define the binding reaction of the corresponding synthetic block and DNA tag set as an extension step, and repeat the extension step so that the synthetic block is sequentially spliced ​​to form a chain, and the DNA tag corresponding to the synthetic block is sequentially spliced ​​to form a chain, GMA-L1(-HP-OP-tag1-······-tag n )-C1-······-C n We obtain the following, where 2 ≤ n ≤ 7 and n is a positive integer; f1. The product obtained in step e1 is reacted with the ring-bound B-terminus molecule B and the closure primer CP to form the ring-bound B-terminus molecule B C n , tag closure primer CP n Combine them here. HP-OP-tag1-······-tag n -CP forms the complete DNA coding sequence, GMA-L1(-DNA)-C1-······-C n -B, i.e., compound library S1'' is obtained. g1. The product obtained in step f1 is subjected to a decomposition reaction under a light source to cleave from A to M, resulting in A-L1(DNA)-C1-······-C n -B, i.e., obtain compound library S1'; 3) The compound library S1' is subjected to a ring-closing reaction in the presence of cyclooxygenase, and the ring-closed A-terminus molecule A reacts with the ring-closed B-terminus molecule. [ka] That is, we obtain the cyclic compound library S1.

[0015] In the first technical solution provided by the present invention, the resulting cyclic compound is removed from the solid support and DNA is encoded on the compound. The compound library obtained in this manner is suitable for conventional DEL screening modes, and the screened compounds need to be subjected to high-throughput sequencing.

[0016] To solve the above technical problems, the present invention also provides a second technical solution: A method for constructing a cyclic compound library, including the following steps: 1) A solid support G is directly or indirectly bonded to a molecule M containing a photocleavable group to obtain GM; 2) Proceed with the following steps: a2. GM is reactively bonded to a linker L1 having at least a trifunctional group to obtain GM-L1; b2. GM-L1 is sequentially reacted with the starting nucleotide molecule HP and the open primer OP to bind the starting nucleotide molecule HP to the solid support G, thereby obtaining OP-HP-GM-L1; c2. OP-HP-GM-L1 is reacted with synthetic block C1 and the DNA tag tag1 corresponding to synthetic block C1, and synthetic block C1 is bound to L1 and DNA tag tag1 is bound to OP to obtain tag1-OP-HP-GM-L1-C1; d2. Define the binding reaction of the corresponding synthetic block and DNA tag set as an extension step, and repeat the extension step so that the synthetic block is sequentially spliced ​​to form a chain, and the DNA tag corresponding to the synthetic block is sequentially spliced ​​to form a chain, tag n -·····tag1-OP-HP-GM-L1-C1-········-C n We obtain the following, where 2 ≤ n ≤ 7 and n is a positive integer; e2. The product obtained in the previous step is reacted with the ring-bound A-termined molecule A, and the ring-bound A-termined molecule A is converted to C n To combine; f2. The product obtained in the previous step is combined in synthesis block C. n+1 , ...., C n+m and their corresponding DNA tags n+1 , ...., tag n+m The reaction is carried out sequentially according to the extension steps described, and synthesis block C n+1 Linker L1, DNA tag n+1 tag n Combine them; after steps e2 and f2, tag n+m-············tag1-OP-HP-GM-L1(-C1·························································−tag1-OP-HP-GM-L1(-C1··································−C n -A)-C n+1 Da·····C n+m We obtain ; where 0 ≤ n ≤ 7, 0 ≤ m ≤ 7, n and m are integers, and 2 ≤ n + m ≤ 7. g2. The product obtained in the previous step is reacted with the ring-closed B-terminus molecule B and the closure primer CP to form the B-terminus molecule B C n+m Tag the closure primer CP n+m Combine them here. HP-OP-tag1-······-tag n+m -CP forms the complete DNA coding sequence, DNA-GM-L1(1(-C1······-C n -A)-C n+1 Da·····C n+m -B, i.e., compound library S2', is obtained; 3) The compound library S2' is subjected to a ring-closing reaction in the presence of cyclooxygenase, and the ring-closed A-terminus molecule A reacts with the ring-closed B-terminus molecule. [ka] That is, we obtain the cyclic compound library S2.

[0017] In the second technical solution, in step 2), the order of e2 and f2 can be swapped, i.e.: In one embodiment, the product tag obtained in step d2 n -···········tag1-OP-HP-GM-L1-C1-············································································································································ is n The ring-bound A-terminated molecule A is reacted with C n Combine them and tag n -···········tag1-OP-HP-GM-L1-C1-············································································································································ is n -A is obtained. Next tag n -······-tag1-OP-HP-GM-L1-C l -······-C n -A, composite block C n+1 ,······,C n+mand their corresponding DNA tag n+1 , ······, tag n+m and react them sequentially according to the described extension steps to obtain synthetic block C n+1 to linker L1, and DNA tag n+1 to tag n and bind tag n+m - ······ - tag1 - OP - HP - G - M - L1(-C[-······-C n -A)-C n+1 - ······ - C n+m ; Alternatively, the product tag n - ······ - tag1 - OP - HP - G - M - L1 - C1 - ······ - C n from step d2 is reacted with synthetic blocks C n+1 , ······, C n+m and their corresponding DNA tag n+1 , ······, tag n+m and react them sequentially according to the described extension steps to obtain synthetic block C n+1 bind to linker L1, bind DNA tag n+1 to tag n and bind tag n+m - ······ - tag1 - OP - HP - G - M - L1(-C1 - ······ - C n )-C n+1 - ······ - C n+m ; Then tag n+m - ······ - tag1 - OP - HP - G - M - L1(-C1 - ······ - C n )-C n+1 - ······ - C n+m is reacted with the closed - loop A - terminal molecule A to bind the closed - loop A - terminal molecule A to C n and bind tag n+m - ······ - tag1 - OP - HP - G - M - L1(-C1 - ······ - C n -A)-C n+1 - ······ - C n+m ;

[0018] In the second technical solution provided by the present invention, the final compound is located on a solid support, and the DNA code is also located on the solid support. Therefore, all synthesis steps are performed on the solid support, and the quality of the compound library is better guaranteed. The compound library obtained with this solution can be applied to fluorescence-activated cell sorting (FACS) screening. The screened cyclic compounds do not require high-throughput sequencing, and the screened cyclic compounds can be directly removed from the solid support using a degradation reaction under light irradiation, resulting in a shorter screening period and high efficiency.

[0019] To solve the above technical problems, the present invention further provides a third technical solution: A method for constructing a cyclic compound library, including the following steps: 1) A solid support G is directly or indirectly bonded to a molecule M containing a photocleavable group to obtain GM: 2) Proceed with the following steps: a3. GM is reactively bonded to a linker L1 having at least four functional groups to obtain GM-L1; b3. GM-L1 is sequentially reacted with the starting nucleotide molecule HP and the open primer OP to bind the starting nucleotide molecule HP to the linker L1, thereby obtaining GM-L1-HP-OP; c3. GM-L1-HP-OP is reacted with synthetic block C1 and the DNA tag tag1 corresponding to synthetic block C1, and synthetic block C1 is bound to L1 and DNA tag tag1 to OP to obtain GM-L1(-HP-OP-tag1)-C1; d3. Define the binding reaction of the corresponding synthetic block and DNA tag set as an extension step, and repeat the extension step so that the synthetic block is sequentially spliced ​​to form a chain, and the DNA tag corresponding to the synthetic block is sequentially spliced ​​to form a chain, so that GM-L1(-HP-OP-tag1-······-tag n )-C1-······-C n We obtain the following, where 2 ≤ n ≤ 7 and n is a positive integer; e3. The product obtained in the previous step is reacted with the ring-bound A-terminated molecule A, and the ring-bound A-terminated molecule A is converted to C n To combine; f3. Combine the product obtained in the previous step into synthesis block C n+1 ,······,C n+m and their corresponding DNA tags n+1 ,······,tag n+m The reaction is carried out sequentially according to the extension steps described, and synthesis block C n+1 Linker L1, DNA tag n+1 tag n Combine them; after steps e3 and f3, GM-L1(-HP-OP-tag1······-tag n+m )(-C1······-C n -A)-C n+1 ······-C n+m We obtain ; where 0 ≤ n ≤ 7, 0 ≤ m ≤ 7, n and m are integers, and 2 ≤ n + m ≤ 7. g3. The product obtained in the previous step is reacted with the ring-closed B-terminus molecule B and the closure primer CP to form the B-terminus molecule B C n+m Tag the closure primer CP n+m Combine them here. HP-OP-tag1-······-tag n+m -CP forms the complete DNA coding sequence, GM-L1(-DNA)(-C1······-C n -A)-C n+1 Da·····C n+m -B, i.e., obtain compound library S3'; 3) The compound library S3' is subjected to a ring-closing reaction in the presence of cyclooxygenase, and the ring-closed A-terminus molecule A reacts with the ring-closed B-terminus molecule. [ka] That is, we obtain the cyclic compound library S3.

[0020] In the third technical solution, in step 2), the order of e3 and f3 can be swapped, i.e.: In one embodiment, the product obtained in step d3 is GM-L1(-HP-OP-tag1-······-tag n )-C1······-C n The ring-bound A-terminated molecule A is reacted with C n Combined with GM-L1(-HP-OP-tag1-······-tag n )-C1······-C n -A is obtained. Next, GM-L1(-HP-OP-tag1-······-tag n )-C1······-C n -A, composite block C n+1 ,······,C n+m and their corresponding DNA tags n+1 ,······,tag n+m The reaction is carried out sequentially according to the extension steps described, and synthesis block C n+1 Linker L1, DNA tag n+1 tag n Combine them into GM-L1(-HP-OP-tag1······-tag n+m )(-C1······-C n -A)-C n+1 ······-C n+m To obtain; Alternatively, the product obtained in step d3, GM-L1(-HP-OP-tag1-······-tag n )-C1-······-Cn, composite block C n+1 ,······,C n+m and their corresponding DNA tags n+1 ,······,tag n+m The reaction is carried out sequentially according to the extension steps described, and synthesis block C n+1 Linker L1, DNA tag n+1 tag n Combine them into GM-L1(-HP-OP-tag1······-tag n+m )(-C1······-Cn)-C n+1 ······-C n+mNext, obtain GM-L1(-HP-OP-tag1······-tag n+m )(-C1······-Cn)-C n+1 ······-C n+m The ring-bound A-terminated molecule A is reacted with C n Combine them into GM-L1(-HP-OP-tag1······-tag n+m )(-C1······-C n -A)-C n+1 ······-C n+m To obtain.

[0021] In the third technical solution provided by the present invention, the quality of the compound library is better guaranteed because the final compound is on a solid support, the DNA encoding is also on the compound, and all synthesis steps are performed on the solid support. The library obtained by this method can be subjected to secondary screening by cleaving molecule M containing a photocleavable group. Secondary screening follows primary screening on the solid support, where the compound is removed from the solid support by cleaving molecule M containing a photocleavable group, the DNA is encoded into the library compound at this point, and the resulting compound library is subjected to secondary screening. Secondary screening can be a combination of different screening techniques, such as fluorescence-activated cell sorting (FACS) screening, conventional targeted protein affinity screening, AS-MS screening, and any combination thereof, in order to improve the accuracy of the screening results.

[0022] In the third technical solution, the GM-L1(-DNA)(-C1······-C obtained in step g3 is used. n -A)-C n+1 ······-C n+m -B is decomposed under a light source to separate M from A, and DNA-L1(-C1-C n -A)-C n+1 ······-C n+m-B, i.e., compound library S4' can be obtained. Compound library S4' is subjected to a ring-closing reaction in the presence of cyclooxygenase, in which the ring-closing A-terminus molecule A reacts with the ring-closing B-terminus molecule B to form a ring. [ka] That is, a cyclic compound library S4 is obtained. Alternatively, the compound library S3 is subjected to a decomposition reaction under a light source to cleave M from L1, [ka] That is, compound S4 is obtained.

[0023] In the three technical solutions provided by the present invention, the solid support G is selected from one or more of PEG resin, PEGA resin, TentaGel resin, and solid support CPG.

[0024] In the first and third technical solutions, the solid support G contains one active functional group R1. The solid support G can be represented by the general formula G0-R1, where R1 represents the active functional group of the solid support G, and G0 represents the solid support structure of the solid support G other than the active functional group. The solid support G is directly or indirectly bonded to a molecule M containing a photocleavable group by this active functional group R1. R1 can be selected from: an amino group, a carboxyl group, or a hydroxyl group. In a preferred embodiment, the solid support G is selected from solid supports having an aminoactive functional group; that is, preferably, the active functional group R1 is selected from amino groups such as a primary amino group or a secondary amino group. More preferably, the active functional group R1 is selected from primary amino groups. More preferably, the solid support is selected from PEGA.

[0025] In the second technical solution, the solid support G contains two activating functional groups R1 and R1'. The solid support G can be represented by the general formula R1'-G0-R1, where R1 represents an activating functional group for binding to linker L1, and R1' represents an activating functional group for binding to the DNA coding sequence. In a preferred embodiment, R1 is an amino group and R1' is a carboxyl group.

[0026] In the three technical solutions provided by the present invention, the molecule M containing a photocleavable group contains at least two activating functional groups, each represented by R2 and R3. The molecule M containing a photocleavable group can be represented by the general formula R2-M0-R3, where R2 and R3 represent two independent activating functional groups. R2 is an activating functional group responsible for bonding to the solid support G, and R3 is an activating functional group responsible for bonding to the ring-closing A-terminus molecule A or to the linker L1 bond. R2 and R3 exist independently in a protected or unprotected form, and R2 and R3 do not interfere with each other's bonding reactions. In particular, R3 primarily does not interfere with the reaction process of R2 in relation to the solid support G, or R3 is in a protected form when R2 reacts in relation to the solid support G.

[0027] In a preferred embodiment, R2 exists in an unprotected form and R3 exists in a protected form. After R2 binds to the solid support G to obtain GM, the protecting group of R3 needs to be removed before the next reaction.

[0028] The solid support G can be bonded to a molecule M containing a photocleavable group in two ways. One method is to obtain GM by a direct complementary pair-forming reaction of R2 with R1. A complementary pair-forming reaction is a reaction in which two activated functional groups react such that the chemical structures in which the two activated functional groups are located are covalently bonded, for example, by covalently bonding two molecules to form one molecule. Based on different reaction principles, R1 can have all or part of its fragment removed when it reacts with R2. For example, R1 can remove a water molecule when it bonds with R2; or, for example, when an addition reaction occurs, R1 reacts with R2 without removing its fragment. When R1 reacts with R2 by direct complementary pair-forming, the following combinations can be selected: amino group and carboxyl group, amino group and hydroxyl group, amino group and phosphate group, amino group and alkyl or aryl halogenated group, etc.

[0029] Alternatively, R2 may indirectly bond with R1 via another linker having two functional groups to obtain GM. For example, a linker having two functional groups may have two activating groups, the first of which can react by complementary pair formation with the activating group R1 of the solid support G, and the second of which can react by complementary pair formation with the activating group R2 of molecule M containing a photocleavable group. The reaction process can take two forms: in the first, the first activating group is reactively bonded to the activating functional group R1 of the solid support G, and then the second activating group is reactively bonded to the activating functional group R2 of molecule M containing a photocleavable group; in the second, the second activating group is reactively bonded to the activating functional group R2 of molecule M containing a photocleavable group, and then the first activating group is reactively bonded to the activating functional group R1 of the solid support G to obtain the indirectly bonded GM. In the indirect connection method, it is no longer required that R2 and R1 have a complementary pair relationship.

[0030] In the molecule M containing a photocleavable group, the photocleavable group is preferably: [ka] Here, R3 is located on the C atom directly bonded to the benzene ring of the side chain adjacent to the nitro group; R2 is [ka] R2 is located at the position and bonded to a C atom on the benzene ring, and R2 is spaced apart by one or more covalent bonds, or R2 is spaced apart by one or more covalent bonds to the C atom to which R3 is bonded; the benzene ring may contain zero, one or more side chains or substituents that do not interfere with the bonding reaction of R2 and R3.

[0031] Molecule M, containing this photocleavable group, can cleave the chemical bond between R3 and the C atom to which R3 is bonded under appropriate light conditions. Molecule M, containing the photocleavable group, can be decomposed at 365 nm.

[0032] In some preferred embodiments, the molecule M containing the photocleavable group can be selected from the following structures: [ka] In the above structure, R3 can be selected from -OH, -NH2, -NHNH2, -N3, Cl, Br, etc. In the above structure, R2 is represented by a carboxyl group.

[0033] In some specific embodiments, the solid support G and the molecule M containing the photocleavable group can be indirectly bonded by a low-molecular-weight compound having a difunctional group.

[0034] In some specific embodiments, the solid support G has an active functional group amino group, and the low molecular weight compound having the difunctional group has an active functional group carboxyl and is an amino group protected by a protecting group. The reaction solvent is an organic solvent such as dichloromethane or N,N-dimethylformamide; the reaction temperature is 15-30°C, preferably 20-25°C; and the reaction time is 1-12 hours, preferably 2-6 hours. Next, the amino group protected by the protecting group of the low molecular weight compound having the difunctional group is deprotected and reacted with a molecule M containing a photocleavable group to bond it; the protecting group of the amino group is preferably an Fmoc protecting group; the reaction solvent for deprotection is an organic solvent such as dichloromethane or N,N-dimethylformamide, and piperidine is added to the reaction solvent; the reaction temperature is 15-30°C, preferably 20-25°C; and the reaction time is 1-12 hours, preferably 1-6 hours. Next, after deprotection, it bonds with molecule M containing a photocleavable group; after deprotection, the difunctional low molecular weight compound provides an activated functional amino group, and molecule M containing the photocleavable group provides an activated functional carboxyl group, resulting in the formation of an amide bond through the reaction; the reaction solvent is an organic solvent, for example, N,N'-diisopropylcarbodiimide (DIC), 1-hydroxybenzotriazole (HOBt), or 4-dimethylaminopyridine (DMAP) are added to the reaction solvent; the reaction temperature is 15-30°C, preferably 20-25°C; and the reaction time is 1-12 hours, preferably 1-6 hours.

[0035] In some specific embodiments, a solid support G and a molecule M containing a photocleavable group can be directly bonded. The solid support G has an activated functional amino group, and the molecule M containing the photocleavable group provides an activated functional carboxyl group, and an amide bond is formed by the reaction; the reaction solvent is an organic solvent such as dichloromethane or N,N-dimethylformamide; one or more of N,N'-diisopropylcarbodiimide (DIC), 1-hydroxybenzotriazole (HOBt), and 4-dimethylaminopyridine (DMAP) are added to the reaction solvent; the reaction temperature is 15-30°C, preferably 20-25°C, and the reaction time is 1-12 hours, preferably 1-6 hours.

[0036] In the three technical solutions provided by the present invention, the ring-closed A-termined molecule A and the ring-closed B-termined molecule B are formed by a cyclooxygenase ring-closing reaction, in which part or all of the molecular fragment of the A-termined molecule A is removed; the ring-closed A-termined molecule A has two activating functional groups R4 and R5; R4 is an activating functional group involved in the cyclooxygenase ring-closing reaction and is removed during the ring-closing reaction; R5 is an activating functional group responsible for binding to the linker L1 or synthetic block, and after the ring-closing reaction, R5 is retained in the ring structure of the cyclic compound molecule; R4 and R5 exist independently of each other in protected or unprotected forms, and R4 and R5 do not interfere with each other's binding reactions. The molecular structure of the ring-closed A-termined molecule A mainly consists of two parts: a molecular fragment A1 that is removed during the cyclooxygenase ring-closing reaction and a molecular fragment A0 that is retained in the ring during the ring-closing reaction. The ring-closed A-termined molecule A can be represented by the general formula R4-A1-A0-R5. R4 is located on molecular fragment A1, which is removed during the cyclooxygenase cyclization reaction, and A1 is also eliminated during the cyclization reaction. R5 is located on molecular fragment A0, which is maintained in the ring structure during the cyclization reaction. In the reaction with R3, R4 is the first to be spliced, so it is mainly required that R5 does not interfere with the reaction process in which R4 binds to R3 of molecule M containing a photocleavable group, or that R5 is in a protected form with a protecting group in the reaction in which R4 binds to molecule M containing a photocleavable group.

[0037] Molecular fragment A0 has a site-blocking group in its structure, which is directly bonded to R5. The site-blocking group is part or all of the structure of molecular fragment A0. The site-blocking group is a group that increases spatial site blocking between M and A, and the site-blocking group can be selected from: a group having a carboxyl group, an aliphatic chain, a polyethylene glycol chain, or a rigid ring. In a preferred embodiment, the site-blocking group is an amino acid residue consisting of one or more amino acids. Preferably, the site-blocking group is an amino acid residue consisting of 1 to 10 amino acids. Since the site-blocking group is held on a ring, the site-blocking group is preferably an amino acid residue consisting of 2 to 5 amino acids, taking into account the size of the ring as well as the site-blocking effect.

[0038] In a preferred embodiment, R4 exists in an unprotected form and R5 exists in a protected form. If R4 is bonded to R3 of molecule M containing a photocleavable group to obtain GMA, the protecting group of R5 is removed before the next reaction. If R4 is bonded to the synthetic block, the protecting group of R5 is removed before the next reaction.

[0039] In the first technical solution, R4 is an activating functional group that forms a complementary pair with R3 of molecule M, which contains photocleavage. The reaction of R4 and R3 splices the photocleavable molecule M with the ring-closed A-termined molecule A, which is then separated and purified to obtain GMA. R4 and R3 are reactive groups for complementary pair formation, and in some preferred embodiments, R4 and R3 can be selected from the following combinations: amino group and carboxyl group, hydroxyl group and carboxyl group, phosphate group and hydroxyl group, amino group and alkyl or aryl halogenated group, etc.

[0040] In the second and third technical solutions, R4 is an activating functional group that forms a complementary pair with one of the activating functional groups of the synthetic block, and the ring-closed A-terminus molecule A is spliced ​​into the synthetic block by the reaction of R4 with the activating functional group of the synthetic block. In some preferred embodiments, R4 and one of the activating functional groups of the synthetic block may be selected from the following combinations: an amino group and a carboxyl group, a hydroxyl group and a carboxyl group, a phosphate group and a hydroxyl group, an amino group and an alkyl or aryl halogenated group, etc.

[0041] In preferred embodiments, the structure of the ring-bound A-termined molecule A, from which a portion of A1 has been removed from the molecular structure, is an amino acid residue consisting of one or more amino acids. This amino acid residue is bonded to A0 in the molecular structure of the ring-bound A-termined molecule A by a peptide bond. For example, in some preferred embodiments, the amino acid sequence of the removed portion A1 in the molecular structure of the ring-bound A-termined molecule A is as follows: FAGDDAE(-Phe-Ala-Gly-Asp-Asp-Ala-Glu), AYDGE(-Ala-Tyr-Asp-Gly-Glu), -OCam-L, FL(-Phe-Leu), AL(-Ala-Leu), GL(-Gly-Leu), HL(-His-Leu) or HV(-His-Val) or SL(Ser-Leu).

[0042] In a preferred embodiment, the ring-bound A-terminal molecule A is a peptide chain consisting of at least 3 amino acids. More preferably, the ring-bound A-terminal molecule A is a peptide chain consisting of 3 to 20 amino acids.

[0043] In the first technical solution, in some specific embodiments, a molecule M containing a photocleavable group can directly react with and bond to a ring-bound A-terminated molecule A. The photocleavable molecule M provides an activated functional group, either an amino group or a hydroxyl group, and the ring-bound A-terminated molecule A provides an activated functional group, either a carboxyl group, which react to form an ester bond or an amide bond. The reaction solvent is an organic solvent such as dichloromethane or N,N-dimethylformamide, to which one or more of N,N'-diisopropylcarbodiimide (DIC), 1-hydroxybenzotriazole (HOBt), or 4-dimethylaminopyridine (DMAP) are added; the reaction temperature is 15-30°C, preferably 20-25°C, and the reaction time is 1-24 hours, preferably 12-18 hours. The other activated functional group of the ring-bound A-terminated molecule A is a protecting amino group; preferably, the ring-bound A-terminated molecule A is a tetrapeptide protected by an Fmoc-protected amino group. The amino group is used as an activating functional group in the reaction between the ring-closed A-terminus molecule A and linker L1, and must undergo a deprotection reaction before reacting with linker L1; the reaction solvent for the deprotection is an organic solvent such as dichloromethane or N,N-dimethylformamide, to which piperidine is added; the reaction temperature is 15-30°C, preferably 20-25°C; and the reaction time is 1-24 hours, preferably 12-18 hours.

[0044] In the first and third technical solutions, the ring-closed A-terminus molecule A is bonded to synthetic block 3 by a direct reaction. The reaction between the two forms an ester or amide bond for connection. The reaction solvent is an organic solvent such as dichloromethane or N,N-dimethylformamide, to which one or more of N,N'-diisopropylcarbodiimide (DIC), 1-hydroxybenzotriazole (HOBt), or 4-dimethylaminopyridine (DMAP) are added; the reaction temperature is 15-30°C, preferably 20-25°C, and the reaction time is 1-24 hours, preferably 12-18 hours. The other activating functional group of the ring-closed A-terminus molecule A is a carboxyl group protected by a protecting group; preferably, the ring-closed A-terminus molecule A is a tetrapeptide protected by an allylhydroxyl group (AllO-). During the ring-forming reaction, the ring-closed A-terminus molecule A needs to have the protecting group of the carboxyl group removed and then be cyclized by cyclooxygenase.

[0045] In the three technical solutions provided by the present invention, linker L1 is a linker having at least three activating functional groups, and optionally at least four activating functional groups.

[0046] In the first technical solution, linker L1 has at least three activating functional groups R6, R7, and R8. Linker L1 can be represented by the following general formula: [ka] Here, R6, R7, and R8 are three activating functional groups. R6, R7, and R8 each exist independently in a protected or unprotected form, and they do not interfere with each other's bonding reactions. In the first technical solution, R6 is an activating functional group that forms a complementary pair with the activating functional group R5 on the ring-closed A-terminus molecule A, R7 is an activating functional group reactively spliced ​​onto the starting nucleotide molecule HP, and R8 is an activating functional group reactively spliced ​​onto the synthetic block C1. The reaction sequence of the three activating functional groups is such that, first, R6 reacts with R5 and is spliced, so it is required that R7 and R8 do not interfere with the splicing reaction of R6 and R5; second, R7 reacts with the starting nucleotide molecule HP and is spliced, so it is required that R8 does not interfere with the splicing reaction of R7 with the starting nucleotide molecule HP; and finally, R8 reacts with the synthetic block C1 and is spliced. In a preferred embodiment, R6 exists in an unprotected form, while R7 and R8 exist in a protected form using protecting groups with different deprotection reaction mechanisms. For example, R6 is an unprotected carboxyl group, R7 is a carboxyl group protected by a protecting group, and R8 is an amino group protected by a protecting group; after R6 is bonded to R5 of the ring-closed A-terminus molecule A to obtain GMA-L1, the protecting group of R7 is first removed using a deprotection reaction mechanism, and R7 is reactively spliced ​​to the starting nucleotide molecule HP, while the open primer OP can continue splicing at the same time; then the protecting group of R8 is removed using another deprotection reaction mechanism, and R8 is spliced ​​to the synthetic block C1, and the subsequent reaction is carried out.

[0047] In the second technical solution, linker L1 has at least three activating functional groups R6, R7, and R8, and linker L1 can be represented by the following general formula: [ka] Here, R6, R7, and R8 are three activating functional groups. R6, R7, and R8 each exist independently in a protected or unprotected form, and R6, R7, and R8 do not interfere with each other's bonding reactions. In the second technical solution, R6 is an activating functional group that forms a complementary pair with the activating functional group R3 of molecule M containing a photocleavable group, R7 is an activating functional group that is reaction spliced ​​with synthetic block C1, and R8 is a synthetic block C n+1 These are activated functional groups that react and splice. The reaction sequence of the three activated functional groups is as follows: First, R6 reacts with molecule M containing a photocleavable group and is spliced, so it is required that R7 and R8 do not interfere with the splicing reaction process of R6; next, R7 reacts with synthetic block C1 and is spliced, so it is required that R8 does not interfere with the splicing reaction process of R7; and finally, R8 reacts with synthetic block C n+1 It reacts with and is spliced. In a preferred embodiment, R6 exists in an unprotected form, while R7 and R8 exist in a protected form using protecting groups with different deprotection reaction mechanisms.

[0048] In the third technical solution, linker L1 has at least four active functional groups R6, R6', R7, and R8. Linker L1 can be represented by the following general formula: [ka] Here, R6, R6', R7, and R8 are four active functional groups. R6, R6', R7, and R8 each exist independently in a protected or unprotected form, and R6, R6', R7, and R8 do not interfere with each other's binding reactions. R6 is an active functional group that forms a complementary pair with the active functional group R3 of molecule M, which contains a photocleavable group; R6' is an active functional group spliced ​​in reaction with the starting nucleotide molecule HP; R7 is an active functional group spliced ​​in reaction with synthetic block C1; and R8 is an active functional group spliced ​​in reaction with synthetic block C n+1 It is an active functional group that has been spliced ​​in response to a reaction.

[0049] In the third technical solution, a preferred embodiment is that linker L1 is composed of two trifunctional linkers L1' and L1'' spliced ​​together, and can be represented by the following general formula: L1'-L1''; where L1' has three activating functional groups R6, R6' and R6'', L1'' has three activating functional groups R7, R8 and R8', and R6'' is bonded to R8' in a complementary pair-forming reaction.

[0050] In the third technical solution, a preferred embodiment is that the linker L1 has a decomposable functional group R L This includes the functional group R L When decomposed, linker L1 splits into two molecular fragments: one consisting of R6 and R6', and the other consisting of R7 and R8.

[0051] In the above preferred embodiment of the third technical solution provided by the present invention, the compound library obtained after secondary screening can be subjected to secondary segment cleavage of the library compounds by a degradable functional group R in linker L1 to directly obtain the screened compounds, achieving short time and high efficiency.

[0052] In some specific embodiments, linker molecule L1 may consist of two trifunctional linker molecules L1' and L1'', and linker molecule L0 bonded between L1' and L1''. Degradable functional group R L L1 is either the functional group L1' of linker molecule L0, which is located within the structure of linker molecule L0 and bonded to linker molecule L1, or the functional group L1'' of linker molecule L0, which is bonded to linker molecule L1. Linker L1 can be represented by the following general formula: L1'-L0-L1''. Here, L1' has three activating functional groups R6, R6' and R6'', L1'' has three activating functional groups R7, R8 and R8', and L0 has two activating functional groups R7 and R7', where R7 is bonded to R6'' in the complementary pair formation reaction, and R7' is bonded to R8' in the complementary pair formation reaction. That is, the degradable functional group R LThis may be a functional group formed after a complementary pair formation reaction between R7 and R6'', or a functional group formed after a complementary pair formation reaction between R7 and R8, or a degradable functional group independently located within the structure of linker L0.

[0053] In some specific embodiments, the method involves a decomposable functional group R L This refers to an acid-cleaving group, or a photocleaving group having a different cleavage wavelength than molecule M containing the aforementioned photocleaving group. Examples of acid-cleaving groups include ester bonds and amide bonds.

[0054] In particular, linker L0 is selected from the following structures: [ka] (Formula 1), [ka] (Formula 2), [ka] (Equation 3), [ka] (Equation 4), [ka] (Equation 5), [ka] (Equation 6), [ka] (Equation 7), [ka] (Equation 8), [ka] (Equation 9), Here, in the molecular structure of the degradable linker molecule L0 shown in Equations 1 to 7, the hydroxyl group and aldehyde group are used to react and bond with the activating functional group of linker molecules L1 and L1'', forming the degradable functional group R L It is possible to form R L These can be cleaved under acidic conditions or in the presence of light. For example, a hydroxyl group can react with a carboxyl group to form an ester bond, which can be cleaved into two molecular fragments under acidic conditions; an aldehyde group can react with an amine group to form an amide bond; in the molecular structure of the degradable linker L0 shown in formulas 8-9, the hydroxyl group and the amine group react with the carboxyl group of L1'' to form an ester bond and an amide bond, respectively, which can be cleaved by light, with an irradiation wavelength of 290 nm for photocleavage.

[0055] In some preferred embodiments, the activating functional groups that form a complementary pair with any of the activating functional groups bonded to molecule L1 can be selected from the following combinations: an amino group and a carboxyl group, a hydroxyl group and a carboxyl group, a phosphate group and a hydroxyl group, an amino group and an alkyl or aryl halogenated group, etc.

[0056] In the first technical solution, in some specific embodiments, the ring-bound A-terminus molecule A can directly react with and bond to linker L1. The activating functional group R6 of linker L1 is a carboxyl group, and the ring-bound A-terminus molecule A provides the activating functional group amino group, and the two react to form an amide bond; the reaction solvent is an organic solvent, such as dichloromethane or N,N-dimethylformamide; the reaction solvent is N,N'-diisopropylcarbodiimide (DIC), 1-hydroxybenzotriazole (HOBt), or 4-dimethylaminopyridine (DMAP); the reaction temperature is 15-35°C, preferably 20-30°C; and the reaction time is 1-12 hours, preferably 1-6 hours.

[0057] In the second and third technical solutions, in some specific embodiments, a molecule M containing a photocleavable group can directly react with and bond to linker L1. The activated functional group R6 of linker L1 is a carboxyl group, and the molecule M containing the photocleavable group provides an activated functional hydroxyl group, and the two react to form an ester bond; the reaction solvent is an organic solvent such as dichloromethane or N,N-dimethylformamide; the reaction solvent is N,N'-diisopropylcarbodiimide (DIC), 1-hydroxybenzotriazole (HOBt), or 4-dimethylaminopyridine (DMAP); the reaction temperature is 15-35°C, preferably 20-30°C; and the reaction time is 1-12 hours, preferably 1-6 hours.

[0058] In the three technical solutions provided by the present invention, the starting nucleotide molecule HP has the activating functional groups R9,R9 and reacts with the activating functional group of linker L1 or the activating functional group of solid support G by complementary pair formation.

[0059] In the first technical solution, the activating functional group R7 of linker L1 reacts with R9 to bind the starting nucleotide molecule HP to linker L1. Furthermore, the starting nucleotide molecule HP is bound to the open primer OP reaction under the action of DNA ligase to obtain GMA-L1-HP-OP. In addition, the action of DNA ligase also achieves the objective of lengthening the DNA coding sequence. The starting nucleotide molecule HP is the starting point of the DNA strand in DNA splicing technology. The open primer OP refers to the DNA strand that can be extended in DNA splicing technology.

[0060] In the second technical solution, the solid support G contains two activating functional groups R1 and R1', with R1' being R1' of the solid support G. The starting nucleotide molecule HP is spliced ​​onto the solid support G through a reaction with R9. Furthermore, the starting nucleotide molecule HP is bound to the open primer OP reaction under the action of a DNA ligase, and the goal of lengthening the DNA coding sequence is also achieved through the action of the DNA ligase.

[0061] In the third technical solution, the activating functional group R6' of linker L1 reacts with R9 to bind the starting nucleotide molecule HP to linker L1. Furthermore, the starting nucleotide molecule HP is bound to the open primer OP reaction under the action of DNA ligase, and the goal of lengthening the DNA coding sequence is also achieved through the action of DNA ligase.

[0062] In some specific embodiments, the active functional group R9 of the starting nucleotide molecule HP is selected from an amino group, and the active functional group of the linker L1 or solid support G that reacts with R9 in complementary pair formation is a carboxyl group. The carboxyl group reacts with R9 (amino group) to form an amide bond, completing the splicing of the linker L1 or solid support G with the starting nucleotide molecule HP. The carboxyl group may be a carboxyl group that forms tert-butyl ester protection; the condition for the deprotection reaction of the carboxyl tert-butyl group is 95% trifluoroacetic acid deprotection. The activated carboxyl group obtained after deprotection reacts with the activated R9 amino group of the starting nucleotide molecule HP (HDNA) to form an amide bond; this is first reacted with N,N'-diisopropylcarbodiimide (DIC) and N-hydroxysuccinimide (NHS) in an organic solvent such as dichloromethane or N,N-dimethylformamide for 1 to 12 hours, preferably 1 to 6 hours; then reacted with the starting nucleotide molecule HP under the following conditions. The reaction with the starting nucleotide molecule HP (HDNA) can be carried out in HEPES buffer at a reaction temperature of 15 to 30°C, preferably 20 to 25°C, for 1 to 48 hours, preferably 12 to 24 hours.

[0063] In some specific embodiments, the starting nucleotide molecule HP binds to an open primer OP in the presence of T4 DNA ligase and extends the DNA sequence in preparation for binding to the DNA tag.

[0064] In the first technical solution, in some specific embodiments, the active functional group R8 of the ligand molecule L1 is an amino group protected by an Fmoc protecting group. The Fmoc protecting group can be removed using the aforementioned organic solvent conditions containing piperidine, and then prepared for bonding of the synthetic block.

[0065] In the second and third technical solutions, the activating functional groups R7 and R8 of linker L1 have different protecting groups for the deprotection reaction mechanism. In some specific embodiments, R1 is a carboxyl group protected by employing an allyl hydroxyl group (AllO-), and R8 is an amino group protected by employing a fluorenyl methoxycarbonyl group (Fmoc).

[0066] In the three technical solutions provided by the present invention, the completion of splicing synthetic blocks and their corresponding DNA tags is referred to as going through an extension step. By repeating this extension step, the synthetic blocks and DNA tags are joined, and the number of compounds in the compound library is expanded. Each block has a different and unique DNA tag, and the blocks and their corresponding DNA tags form a list. Further synthetic blocks and their corresponding DNA tags are arbitrarily selected from the list, and the extension step is repeated so that each synthetic block is sequentially joined to the synthetic block from the previous extension step, and each DNA tag is sequentially joined to the DNA tag from the previous extension step, i.e., the chains of synthetic blocks and DNA tags are extended, respectively.

[0067] In the first technical solution, by repeating the extension step, GMA-L1(-HP-OP-tag1-······-tag n )-C1-······-C n The number of synthetic blocks to be joined and the number of corresponding DNA tags n are determined according to the desired ring size. In principle, n takes values ​​in the range of 2 ≤ n ≤ 7, and n is a positive integer.

[0068] In the second technical solution, by repeating the extension step, tag n -······-tag1-OP-HP-GM-L1-C1-C n Japanese tag n+m -············tag1-OP-HP-GM-L1(-C1·························································−tag1-OP-HP-GM-L1(-C1··································−C n -A)-C n+1 ······-C n+m We obtain ; where 0 ≤ n ≤ 7, 0 ≤ m ≤ 7, n and m are integers, and 2 ≤ n + m ≤ 7.

[0069] In the third technical solution, by repeating the above extension step, GM-L1(-HP-OP-tag1······-tag n )-C1······-C n and GM-L1(-HP-OP-tag1······-tag n+m )(-C1······-C n -A)-C n+1 ······-C n+m We obtain the following: where 0 ≤ n ≤ 7, 0 ≤ m ≤ 7, n and m are integers, and 2 ≤ n + m ≤ 7.

[0070] The synthetic block is a low molecular weight compound having a dual-activating functional group. The first and second activating functional groups of the synthetic block do not exist simultaneously in a form protected by an unprotected group, and the first and second activating functional groups do not interfere with each other. The synthetic block may also contain a backbone structure (e.g., a backbone unit), which may be bonded within a ring or in the form of a side chain of the ring. The activating functional groups of two adjacent synthetic blocks are complementary; that is, the two activating functional groups are bonded by reacting together to form a covalent bond. The dual-activating functional groups of the synthetic block are each independently selected from one of the following: an amino group, a carboxyl group, an aldehyde group, an alkenyl group, an alkynyl group, a halogen group, an azide group, a hydroxyl group, and a hydrophobic group.

[0071] In a preferred embodiment, the first activating functional group exists in a form protected by a protecting group or in a form not protected by a protecting group, and the second activating functional group exists in a form protected by a protecting group. When the first activating functional group is in a form protected by a protecting group, the mechanism for deprotecting the first activating functional group is different from the mechanism for deprotecting the second activating functional group.

[0072] In a preferred embodiment, the first activating functional group exists in an unprotected form, and the second activating functional group exists in a protected form. In the splicing reaction of the synthetic block, first, a splicing reaction is directly carried out using the first activating functional group not protected by a protecting group, and then it is necessary to remove the protecting agent for the second activating functional group before the next step of the splicing reaction of the synthetic block.

[0073] By repeating this extension step, the synthetic blocks are sequentially spliced. In the first technical solution, each synthetic block is sequentially spliced, the first activating functional group of synthetic block C1 is responsible for splicing with linker L1, and the first activating functional group of each subsequent synthetic block is sequentially spliced with the second activating functional group of the previous synthetic block, and the second activating functional group of synthetic block C n is responsible for splicing with the closed-ring B-terminal molecule B; the first activating functional group and the second reactive functional group do not exist in a form where they are not protected simultaneously, and the first activating functional group and the second activating functional group do not interfere with each other. In the second and third technical solutions, the first activating functional group of synthetic block C1 is responsible for splicing with one activating functional group of linker L1, the first activating functional group of each synthetic block between C1 and C n and the first activating functional group of synthetic block C n are sequentially spliced with the second activating functional group of the previous synthetic block, and the second activating functional group of synthetic block C n is responsible for splicing with the closed-ring A-terminal molecule A; the first activating functional group of synthetic block C n+1 is responsible for splicing with the other activating functional group of linker L1, and C n+1 and Cn+m between each synthetic block and synthetic block C n+m The first activating functional group of is sequentially spliced with the second activating functional group of the previous synthetic block to form synthetic block C n+m The second activating functional group of synthetic block C is responsible for splicing with the closed-ring B-terminal molecule B; the first activating functional group and the second reactive functional group do not exist in a form where they are simultaneously protected, and the first activating functional group and the second activating functional group do not interfere with each other.

[0074] In a preferred embodiment, adjacent synthetic blocks are bonded by the following chemical bonds: amide bond, ester bond.

[0075] In a preferred embodiment, the first activating functional group of each synthetic block is the same activating functional group, for example, all are carboxyl groups; the second activating functional group of each synthetic block is also the same reactive functional group, for example, all are amino groups; furthermore, the first activating functional group is different from the second activating functional group.

[0076] In a preferred embodiment, the double activating functional groups of the synthetic block are carboxyl groups and amino groups, and the carboxyl groups and amino groups exist independently in a protected form or an unprotected form.

[0077] In a preferred embodiment, the synthetic block is a double activating functional group compound having both an amino group and a carboxyl group. In some embodiments, the amino group and the carboxyl group in the synthetic block are bonded to the same carbon atom, such as in an α-amino acid. In other embodiments, the amino group and the carboxyl group in the synthetic block are bonded to different atoms, and it may be a non-amino acid compound having both an amino group and a carboxyl group, or an N-substituted amino acid. In other embodiments, the synthetic block is selected from substituted or unsubstituted dicarboxylic acids, substituted or unsubstituted diamines, substituted or unsubstituted diols, substituted or unsubstituted alkenes, substituted or unsubstituted alkynes, substituted or unsubstituted aldehydes.

[0078] In a preferred embodiment, the first activating functional group is a carboxyl group, and the carboxyl group exists in an unprotected form.

[0079] In a preferred embodiment, the first activating functional group is an amino group, which is protected by a protecting group, which is an Fmoc protecting group.

[0080] In a preferred embodiment, the synthesis block is an Fmoc-amino acid.

[0081] In a preferred embodiment, at least one of the synthesis blocks includes a backbone structure having an E3 ligase substrate structure capable of binding to an E3 ligase. A library of compounds having an E3 ligase substrate structure applicable to PROTAC enables versatile screening of the library.

[0082] In some specific embodiments, the backbone structure is selected from the following: [ka]

[0083] In a preferred embodiment, each of the synthesis blocks comprises at least one cyclic outer chain in total. The cyclic outer chain expands the diversity of the compound library and provides a wider variety of library compounds.

[0084] In a preferred embodiment, each of the synthetic blocks comprises at least two ring-closing side chains in total, and at least two cyclic outer chains are joined by a chemical reaction to form a bicyclic structure. The ring-closing reaction of the two cyclic outer chains may occur before or after the enzymatic ring-closing reaction. The formation of a bicyclic structure consisting of two cyclic outer chains can be carried out in all three technical solutions provided by the present invention.

[0085] The DNA tags are sequentially joined to each other by DNA ligase. In the extension step, the splicing reaction of the DNA tag and the corresponding synthetic block is completed so that the strand of the synthetic block and the strand of the DNA tag are extended, respectively. In the extension step, the splicing reaction of the DNA tag may be performed to extend the strand of the DNA tag, followed by the splicing reaction of the corresponding synthetic block to extend the strand of the synthetic block, or the splicing reaction of the synthetic block may be performed to extend the strand of the synthetic block, followed by the splicing reaction of the corresponding DNA tag to extend the strand of the DNA tag.

[0086] In the three technical solutions provided by the present invention, when a DNA tag is spliced, a closure primer CP is bound by DNA ligase to form a complete DNA coding sequence. The closure primer CP is the terminal strand at which DNA elongation stops in DNA splicing technology.

[0087] In the three technical solutions provided by the present invention, the ring-bound B-terminus molecule B is a compound having a double activating functional group. The ring-bound B-terminus molecule B can be represented by the general formula R10-B0-R11. R10 is the activating functional group used for reactive splicing with the second activating functional group of the final synthetic block, and R11 is the activating functional group used for the cyclic reaction. R10 and R11 exist independently in a protected or unprotected form, and R10 and R11 do not interfere with each other's bonding reaction. Since R10 is the first to react with the second activating functional group of the final synthetic block to be spliced, the main requirement is that R11 does not interfere with the reaction process of bonding R10 to the second activating functional group of the final synthetic block, or that R10 is in a protected form during the reaction process of bonding R10 to the second activating functional group of the final synthetic block.

[0088] In a preferred embodiment, R10 exists in an unprotected form and R11 exists in a protected form. R10 reacts first with the second activating functional group of the final synthetic block to perform splicing. If R11 is used in the ring-closing reaction, the protecting group of R11 is removed first before the ring-closing reaction.

[0089] R10 and the second activating functional group of the final synthesis block are reactive groups that form complementary pairs, and in some preferred embodiments, the second activating functional group of R10 and the final synthesis block can be selected from the following combinations: amino group and carboxyl group, hydroxyl group and carboxyl group, phosphate group and hydroxyl group, amino group and alkyl or aryl halogenated group, etc.

[0090] In a novel preferred embodiment, compounds R10 and R11 have two activating functional groups of the ring-bound B-terminal molecule B, one of which is an amino group and the other is a carboxyl group.

[0091] In the first technical solution, the closed primer OP and the ring-closed B-terminus molecule B are spliced ​​and separated and purified to obtain GMA-L1(-DNA)-C1-······-C n -B is obtained. This can constitute the compound library S1''. Compound library S1'' contains a solid support G and has not yet formed the desired ring structure. R10 is C n It reacts with the second activating functional group and is spliced, while the other activating functional group R11 is at the free end of the ring-closed B-terminus molecule B.

[0092] In the second technical solution, the closed primer OP and the ring-closed B-terminus molecule B are spliced ​​and separated and purified to obtain DNA-GM-L1(-C1······-C n -A)-C n+1 ······-C n+m -B is obtained. This can constitute the compound library S2'. R10 is C nIt reacts with the second activating functional group and is spliced. Another activating functional group, R11, is at the free end of the closed-ring B terminus of molecule B.

[0093] In the third technical solution, the closed-loop primer OP and the closed-ring B-terminal molecule B are spliced and separated and purified, so that -G-M-L1(-DNA)(-C1······-C n -A)-C n+1 ······-C n+m -B, that is, the compound library S3' is obtained. R10 reacts with the second activating functional group of C n and is spliced. Another activating functional group R11 is at the free end of the closed-ring B-terminal molecule B.

[0094] In a preferred embodiment, R11 is located at the free end of the closed-ring B-terminal molecule B, and R11 is an amino group. Preferably, the active functional group R11 at the free end of the closed-ring B-terminal molecule B is a primary amino group.

[0095] In a preferred embodiment, the closed-ring B-terminal molecule B is a peptide chain consisting of 2 to 10 amino acids.

[0096] In some specific embodiments, the closed-ring B-terminal molecule B is a Fmoc-protected dipeptide.

[0097] In some specific embodiments, the molecular structure of the closed-ring B-terminal molecule B has amino acid residues GL (Gly-Leu-), LL (Leu-Leu-), QL (Gln-Leu-), KL (Lys-Leu-), GF (Gly-Phe-), GI (Gly-Ile-), FSA, VGAG, GV, GF, GM.

[0098] In the technical solution provided by the present invention, in the first technical solution, the bond between M and A in G-M-A-L1(-DNA)-C1-······-Cn-B is cleaved by photo-cleavage, and A-L1(-DNA)-C1-······-C n-B is obtained, and this compound itself constitutes compound library S1'. Compound library S1' does not contain the solid support G and has not yet formed the desired ring structure.

[0099] In the technical solution provided by the present invention, compound libraries S1', S2', or S3' are subjected to a ring-closing reaction in the presence of cyclooxygenase, thereby the ring-closing A-terminus molecule A reacts with the ring-closing B-terminus molecule B to form a peptide bond and a ring. In the ring-forming reaction, the free terminal activated functional group of the ring-closing B-terminus molecule B reacts with the ring-closing A-terminus molecule A, removing some or all of the molecular fragment of the ring-closing A-terminus molecule, and the free terminal activated functional group of the ring-closing B-terminus molecule B binds to the remaining portion from which the fragment was removed to form a ring structure.

[0100] The cyclooxygenase described in the present invention refers to an enzyme that reacts two terminal amino acid residues in a molecule to form a peptide bond connecting them. Preferably, the cyclic synthase is a cyclic peptide synthase, which is an enzyme that catalyzes the dehydration reaction between the N-terminal amino group of one terminal amino acid residue and the C-terminal α-carboxyl group of the other terminal amino acid residue in the molecule to form a cyclic polypeptide.

[0101] The cyclooxygenase is selected from ligases VyPAL2, Butelase1, PatG, PagG, ominiligase-1, PCY1, or OaAEP1B&3-5.

[0102] In particular, Butelase 1 is a specific aspartic acid / aminyl ligase that efficiently catalyzes intramolecular or intermolecular cyclization of linear polypeptides having an Asx(Asp / Asn)-His-Val tripeptide sequence at the carboxyl terminus. Butelase 1 cleaves the His-Vai dipeptide from the carboxyl terminus of the linear polypeptide and then attaches it to the amino terminus to form a cyclic structure.

[0103] In some specific embodiments, the temperature of the enzymatic cyclization reaction is 25 to 45°C; preferably, the temperature of the enzymatic cyclization reaction is 30 to 45°C; more preferably, the temperature of the enzymatic cyclization reaction is 35 to 40°C.

[0104] In some specific embodiments, the pH range of the enzymatic cyclization reaction is 4.5 to 6.0; preferably, the pH range of the enzymatic cyclization reaction is 4.8 to 5.5; and more preferably, the pH range of the enzymatic cyclization reaction is 4.9 to 5.3.

[0105] In some specific embodiments, the reaction time for the enzymatic cyclization reaction is 12 to 48 hours; preferably, the reaction time for the enzymatic cyclization reaction is 18 to 36 hours; more preferably, the reaction time for the enzymatic cyclization reaction is 20 to 24 hours.

[0106] In some specific embodiments, the pH is adjusted using sodium acetate buffer during the enzymatic ring-closing reaction.

[0107] In some specific embodiments, disodium ethylenediaminetetraacetate or a solution thereof (0.05 M) is added to the enzymatic ring-closing reaction.

[0108] In some specific embodiments, sodium chloride or a solution thereof (0.25 M) is added to the enzyme cyclization reaction.

[0109] In some specific embodiments, TCEP is added to the enzymatic cyclization reaction as a reducing agent.

[0110] In this invention, linker L1 is used to provide at least three activating functional groups that link 1) a DNA coding sequence, 2) an A-terminal molecule A, and 3) a synthetic block and a B-terminal molecule B. The amino acid residue structures of A-terminal molecule A and B-terminal molecule B are used to complete cyclization in the presence of cyclooxygenase, resulting in milder cyclization conditions and greater universality, expanding the chemical reaction types and diversity of the encoded compound library.

[0111] The present invention provides a method for constructing a library of cyclic compounds, where the number and types of atoms provided by each synthetic block in the cyclic structure are highly adjustable, and each synthetic block can be spliced ​​using an amide bond (-CO-NH-), providing more hydrogen bonding possibilities for the cyclic structure. This can contribute to improving the binding of the cyclic structure to proteins.

[0112] The present invention provides a method using photocleavage under mild reaction conditions, which effectively avoids the detrimental effects on DNA coding sequence stability that occur due to removal of solid-phase synthesis under other harsh conditions.

[0113] The present invention provides a method for synthesizing DNA-coding compounds using solid-phase support-borne DNA-coding compounds. The post-processing and purification steps of the reaction are simple, usually requiring only a few simple filtration and washing operations. As a result, the post-processing and separation / purification steps of each reaction step are simplified, significantly shortening the synthesis period (cycle time) of the DNA-coding compound library and enabling substantial cost reductions.

[0114] In the compound library synthesis method of the present invention, a DNA coding sequence is bound to a linker attached to the compound library, and then the DNA coding sequence is bound. The synthesis ratio of the starting nucleotide molecule HP to the docking compound is approximately 1:250, which significantly reduces the DNA administration ratio and saves costs.

[0115] In the compound library synthesis method of the present invention, each step corresponding to DNA tag splicing requires the removal of the remaining 249 copies of unspliced ​​DNA, followed by the binding of the synthetic block to its corresponding DNA tag by alternately reacting one of the dual-activating functional groups of the synthetic block having a protecting group with the synthetic block. The deprotecting group can simultaneously close the reaction sites of the compound library of unspliced ​​DNA, facilitating the removal of excess DNA, reducing interference, exhibiting a purification effect, and improving the efficiency and uniqueness of DNA coding and the purity of the final product.

[0116] The present invention also provides a method for constructing a library of bicyclic compounds by using linker L1 of the three technical solutions described above as a linker having at least five functional groups. Here, one functional group of linker L1 is used to directly or indirectly link the DNA coding sequence, and the other four functional groups of linker L1 are used to allow or prevent dry linkage with the synthetic block before linking two ring-closed A-termined molecules A, A and two ring-closed B-termined molecules B, B', respectively. Finally, two ring-closing reactions are carried out in the presence of cyclooxygenase 1 and cyclooxygenase 2 to ring-close two pairs of ring-closed A-termined molecule A and ring-closed B-termined molecule B, A-termined molecule A' and ring-closed B-termined molecule B', to obtain a library of bicyclic compounds.

[0117] The relationship between cyclooxygenase and its ring-closing A-terminus and B-terminus is as follows: If cyclooxygenase is OaAEP1B&3-5, the A-terminus can be selected from: NFL, NAL, NGL, NHL, DFL, DAL, DGL, DHL; the B-terminus can be selected from: GL (Gly-Leu-), LL (Leu-Leu-), QL (Gln-Leu-), KL (Lys-Leu-), GF (Gly-Phe); if cyclooxygenase is VyPAL2, the A-terminus is selected from NSL and the B-terminus is GI Selected from; if cyclooxygenase is Butelase1, the A-terminus is selected from NHV and the B-terminus is GIThe following are selected from: if the cyclooxygenase is PatG, the A-terminus is selected from FAGDDAE; if the cyclooxygenase is ominiligase-1, the A-terminus is selected from OCam-Leu, OCam-; if the cyclooxygenase is PCY1, the A-terminus is selected from FQA, IQT and the B-terminus is selected from FSA, VGAG. Specifically, in the three technical solutions described above, step f2 or f3 is performed two more times to ligate the ring-closed A-terminus molecule A and the ring-closed B-terminus molecule B, respectively, before reacting with the closure primer CP.

[0118] Taking the first technical solution described above as an example, the method for constructing a bicyclic compound library is structured as follows: The linker L1 is at least a pentafunctional linker; After step e1, perform the following steps: e1-1. The product obtained in step e1 is reacted with the ring-bound B-terminus molecule B, and the ring-bound B-terminus molecule B is converted to C n tag B tag n To combine; e1-2. The product obtained in the previous step is used in synthesis block C. n+1 ,······,C n+m and their corresponding DNA tags n+1 ,······,tag n+m Then, the reaction is carried out sequentially according to the described extension steps, and synthesis block C n+1 Set to L1, DNA tag n+1 tag B Combine them into GMA-L1(-HP-OP-tag1-······-tag n+m )(-C1-······-C n -B)-C n+1 ······-C n+m To obtain; e1-3. The product obtained in the previous step is reacted with the ring-bound A-termined molecule A', and the ring-bound A-termined molecule A' is converted to C n+m tag A' Combine it with tagn+m; e1-4. The product obtained in the previous step is used in synthesis block C. n+m+1 ,······,C n+m+x and their corresponding DNA tags n+m+1 ,······,tag n+m+x Then, the reaction is carried out sequentially according to the described extension steps, and synthesis block C n+1 Set to L1, DNA tag n+m+1 tag A' Combine them into GM-A1-L1(-HP-OP-tag1-······-tag n+m+x )(-C1-······-C n -B)-(C n+1 ······-C n+m -A')-C n+m+1 -······-C n+m+x To obtain; e1-5. The product obtained in the previous step is reacted with the ring-bound B-terminus molecule B' and tag B', and the ring-bound B-terminus molecule B' is converted to C n+m+x tag B' tag n+m+x To combine; e1-6. The product obtained in the previous step is reacted with the closure primer CP to bind the closure primer CP to tagB', where HP-OP-tag1-···-tag n -tag B -tag n+1 -······-sky n+m -tag A' -tag n+m+1 -···-tag n+m+x -tag B' -CP forms the complete DNA coding sequence, GMA-L1(-DNA)(-C1······-C n -B)(-C n+1 -······-C n+m -A')-C n+m+1 ······-C n+m+x --Obtain B'; e1-7. The product obtained in the previous step is decomposed under a light source to cleave A through M, and A-L1(-DNA)(-C1······Cn-B)(-C n+1 Da·····C n+m -A')-Cn+m+1 ······-C n+m+x We obtain -B'; where 0 ≤ n ≤ 7, 0 ≤ m ≤ 7, n, m, x are integers, and 2 ≤ n + m + x ≤ 7; e1-8. The product obtained in the previous step is subjected to a ring-closing reaction in the presence of cyclooxygenase 1, where the ring-closing A-terminus molecule A reacts with the ring-closing B-terminus molecule B to form a ring. [ka] To obtain. e1-9. The product obtained in the previous step is subjected to a ring-closing reaction in the presence of cyclooxygenase 2, where two pairs of ring-closing A-terminus molecules A' and ring-closing B-terminus molecules B' react to form a ring. [ka] In other words, a library of bicyclic compounds is obtained.

[0119] Taking the second technical solution described above as an example, the method for constructing a bicyclic compound library is structured as follows: The linker L1 is at least a pentafunctional linker; After step e2, perform the following steps: e2-2. The product obtained in step e2 is tagged with a DNA tag corresponding to the A-terminus of the ring-closing molecule. A Combine it with the tagn; e2-2. The product obtained in step e2-1 is reacted with the ring-bound B-terminus molecule B, so that the ring-bound B-terminus molecule B becomes C n+m Then, the corresponding DNA tag tag is attached to tagB at the tag position, B -tag n+m -············tag1-OP-HP-GM-L1(-C1·························································−tag1-OP-HP-GM-L1(-C1··································−C n -A)-C n+1 ······-C n+m -B is obtained. e2-3. The product obtained in the previous step is used in synthesis block C. n+m+1 ,······,C n+m+x and corresponding DNA tagn+m+1 ,······,tag n+m+x Then, the reaction is carried out sequentially according to the described extension steps, and synthesis block C n+m+1 Set to L1, DNA tag n+m+1 Combine it with tagB, tag n+m+x -············tag1-OP-HP-GM-L1(-C1·························································−tag1-OP-HP-GM-L1(-C1··································−C n -A)(-C n+1 ······-C n+m -B)-C n+m+1 ······-C n+m+x To obtain; e2-4. The product obtained in the previous step is reacted with the ring-bound A-termined molecule A', and the ring-bound A-termined molecule A' is converted to C n+m+x The tag is placed at the corresponding DNA tag position. A' To combine; e2-5. The product obtained in the previous step is used in synthesis block C n+m+x+1 ,······,C n+m+x+y and their corresponding DNA tags n+m+x+1 ,······,tag n+m+x+y Then, the reaction is carried out sequentially according to the described extension steps, and synthesis block C n+m+x+1 Set to L1, DNA tag n+m+x+1 tag A' Combine them and tag n+m+x+y -············tag1-OP-HP-GM-L1(-C1·························································−tag1-OP-HP-GM-L1(-C1··································−C n -A)(-C n+1 ······-C n+m -B)(-C n+m+1 ······-C n+m+x -A')-C n+m+x+1 Da·····C n+m+x+y To obtain; e2-6. The product obtained in the previous step is divided into a ring-closed B-terminus molecule B and a DNA tag. B' It reacts with C to form the ring-closed B-terminal molecule B'. n+m+x+y tagB' n+m+x+y To combine; e1-7. The product obtained in the previous step is reacted with the closure primer CP to bind the closure primer CP to tagB', where HP-OP-tag1-······-tag n+m+x+y -tagB'-CP forms the complete DNA coding sequence, DNA-GM-L1(-C1······-C n -A)(-C n+1 ······-C n+m -B)(-C n+m+1 ······-C n+m+x -A')-C n+m+x+1 ······-C n+m+x+y We obtain -B', where 0≦n≦7, 0≦m≦7, 0≦x≦7, 0≦y≦7, n, m, x, y are integers, and 2≦n+m+x+y≦7; e2-8. The product obtained in the previous step is subjected to a ring-closing reaction in the presence of cyclooxygenase 1, where the ring-closing A-terminus molecule A reacts with the ring-closing B-terminus molecule B to form a ring. [ka] To obtain; e2-9. The product obtained in the previous step is subjected to a ring-closing reaction in the presence of cyclooxygenase 2, where the ring-closed A-terminus molecule A' reacts with the ring-closed B-terminus molecule B' to form a ring. [ka] In other words, a library of bicyclic compounds is obtained.

[0120] Taking the third technical solution described above as an example, the method for constructing a bicyclic compound library is structured as follows: The linker L1 is at least a hexafunctional linker; After step e3, perform the following steps: e3-1. The product obtained in step e3 is tagged with a DNA tag corresponding to the A-terminus of the ring-closing molecule. A Combine it with the tagn; e3-2. The product obtained in step e3-1 is reacted with the ring-bound B-terminus molecule B, and the ring-bound B-terminus molecule B is converted to C n+mTag B is then bound to the corresponding DNA tag position, GM-L1(-HP-OP-tag1······-tag n+m -tag B )(-C1······-C n -A)-C n+1 ······-C n+m -B is obtained. e3-3. The product obtained in the previous step is used in synthesis block C n+m+1 ,······,C n+m+x and their corresponding DNA tags n+m+1 ,······,tag n+m+x Then, the reaction is carried out sequentially according to the described extension steps, and synthesis block C n+m+1 Set to L1, DNA tag n+m+1 tag B Combine them into GM-L1(-HP-OP-tag1······-tag n+m+x )(-C1······-C n -A)(-C n+1 Da·····C n+m -B)-C n+m+1 ······-C n+m+x To obtain; e3-4. The product obtained in the previous step is reacted with the ring-bound A-termined molecule A', and the ring-bound A-termined molecule A' is converted to C n+m+x Then, tagA' is attached to the corresponding DNA tag position; e3-5. The product obtained in the previous step is used in synthesis block C n+m+x+1 ,······,C n+m+x+y and their corresponding DNA tags n+m+x+1 ,······,tag n+m+x+y Then, the reaction is carried out sequentially according to the described extension steps, and synthesis block C n+m+x+1 Set to L1, DNA tag n+m+x+1 Combine this with tagA', and GM-L1(-HP-OP-tag1······-tag n+m+x+y )(-C1······-C n -A)(-C n+1 ······-C n+m -B)(-C n+m+1 ······-C n+m+x -A')-Cn+m+x+1 ······-C n+m+x+y To obtain; e3-6. The product obtained in the previous step is converted into a closed B-terminal molecule B' and a DNA tag. B' In contrast, the closed B-terminal molecule B' is C n+m+x+y DNA tag B' tag n+m+x+y To combine; e3-7. The product obtained in the previous step is reacted with the closure primer CP to tag the closure primer CP. B' Combine them, and here, HP-OP-tag1······-tag n+m+x+y -tag B' -CP forms the complete DNA coding sequence, GM-L1(-DNA)(-C1······-C n -A)(-C n+1 ······-C n+m -B)(-C n+m+1 ······-C n+m+x -A')-C n+m+x+1 ······-C n+m+x+y We obtain -B', where 0≦n≦7, 0≦m≦7, 0≦x≦7, 0≦y≦7, n, m, x, y are integers, and 2≦n+m+x+y≦7; e3-8. The product obtained in the previous step is subjected to a ring-closing reaction in the presence of cyclooxygenase 1, where the ring-closing A-terminal molecule A1 reacts with the ring-closing B-terminal molecule B1 to form a ring. [ka] To obtain. e3-9. The product obtained in the previous step is subjected to a ring-closing reaction in the presence of cyclooxygenase 2, where the ring-closing A-terminal molecule A2 reacts with the ring-closing B-terminal molecule B2 to form a ring. [ka] In other words, a library of bicyclic compounds is obtained.

[0121] In a preferred embodiment, at least a pentafunctional linker L1 is obtained by splicing three trifunctional linkers.

[0122] In a preferred embodiment, at least a pentafunctional linker L1 is obtained by splicing one tetrafunctional linker and one trifunctional linker.

[0123] The present invention also provides a library of cyclic compounds having the following structural formulas, obtained by constructing the methods described above: [ka] Here, 2 ≤ n ≤ 7, where n is a positive integer; L1 is at least a trifunctional linker, the DNA coding sequence is bound to L1, and L1 and the DNA coding sequence are linked by an amide bond; C1 to Cn are a synthetic block having a double-activating functional group linked in order; A represents a ring-closed A-terminus molecule and is an amino acid residue; B represents a ring-closed B-terminus molecule and is an amino acid residue; L1 and A are linked by an amide bond or an ester bond; synthetic block C n A is bonded to B by an amide or ester bond; A and B form a peptide bond and a ring in the presence of cyclooxygenase.

[0124] The present invention also provides a second library of cyclic compounds obtained by constructing the aforementioned method, having the following structural formula: [ka] Here, 0 ≤ n ≤ 7, 0 ≤ m ≤ 7, n and m are integers, and 2 ≤ n + m ≤ 7; L1 is at least a trifunctional linker molecule having a DNA coding sequence bound to a solid support G, where G and the DNA coding sequence are linked by an amide bond; C1~C n This is a synthetic block having a double-activated functional group in the order of first and last, C n+1 ~C n+mThis is a synthetic block having a double-activating functional group in the order of first and last; G represents a solid support, M represents a molecule with a photocleavable group; A represents a ring-closed A-terminus molecule, showing amino acid residues; B represents a ring-closed B-terminus molecule, showing amino acid residues; synthetic block C n A and C are linked by an amide or ester bond; synthesis block C n+m A is linked to B by an amide or ester bond; in the presence of cyclooxygenase, A and B form a peptide bond and a ring.

[0125] The present invention also provides a third cyclic compound library obtained by the method described above, having the following structural formula: [ka] Here, 0 ≤ n ≤ 7, 0 ≤ m ≤ 7, n and m are integers, and 2 ≤ n + m ≤ 7; L1 is at least a tetrafunctional linker, the DNA coding sequence is bound to L1, and L1 is bound to the DNA coding sequence by an amide bond; C1~C n This is a synthetic block having double-activated functional groups that are bonded in order, C n+1 ~C n+m This is a synthetic block having a double-activated functional group that is bonded in order; G represents a solid support, and M represents a molecule containing a photocleavable group; A represents a ring-closed A-terminus molecule consisting of an amino acid residue; B represents a ring-closed B-terminus molecule consisting of an amino acid residue; synthetic block C n It is bonded to A by an amide bond or ester bond; synthesis block C n+m A is bonded to B by an amide or ester bond; in the presence of cyclooxygenase, A and B form a peptide bond and a ring.

[0126] The present invention also provides a fourth cyclic compound library obtained by the method described above, having the following structural formula: [ka] Here, 0 ≤ n ≤ 7, 0 ≤ m ≤ 7, n and m are integers, and 2 ≤ n + m ≤ 7; L1 is at least a tetrafunctional linker, the DNA coding sequence is bound to L1, and L1 is bound to the DNA coding sequence by an amide bond; C1~C n This is a synthetic block having double-activated functional groups that are bonded in order, C n+1 ~C n+m This is a synthetic block having a double-activating functional group that is bonded in order; G represents a solid support, and M represents a molecule containing a photocleavable group; A represents a ring-closed A-terminus molecule that is an amino acid residue; B represents a B-terminus molecule of a ring that is an amino acid residue; synthetic block C n It is bonded to A by an amide bond or ester bond; synthesis block C n+m A is bonded to B by an amide or ester bond; in the presence of cyclooxygenase, A and B form a peptide bond and a ring.

[0127] The present invention also provides a first library of bicyclic compounds having the following structural formulas, obtained by constructing the methods described above: [ka] Here, 0 ≤ n ≤ 7, 0 ≤ m ≤ 7, 0 ≤ x ≤ 7, n, m, and x are integers, and 2 ≤ n + m + x ≤ 7; L1 is at least a pentafunctional linker, the DNA coding sequence is bound to L1, and L1 is bound to the DNA coding sequence by an amide bond; C1~C n This is a synthetic block having double-activated functional groups that are bonded in order, C n+1 ~C n+m This is a synthetic block having double-activated functional groups that are bonded in order, C n+m+1 ~C n+m+xThis is a synthetic block having a double-activating functional group that is linked in order; A and B represent a ring-closed A-termined molecule and a B-termined molecule that undergo ring closure in the presence of one type of cyclooxygenase, respectively, and A' and B' represent a ring-closed A-termined molecule and a B-termined molecule that undergo ring closure in the presence of a different type of cyclooxygenase, respectively, and A, B, A', and B' are all amino acid residues; synthetic block C n It is bonded to B by an amide bond or ester bond; synthesis block C n+m A is bonded to B by an amide or ester bond; A and B, and A' and B', respectively, form peptide bonds in the presence of cyclooxygenase, forming a bicyclic structure.

[0128] The present invention also provides a second library of bicyclic compounds having the following structural formulas, obtained by constructing the methods described above: [ka] Here, 0 ≤ n ≤ 7, 0 ≤ m ≤ 7, 0 ≤ x ≤ 7, 0 ≤ y ≤ 7, n, m, x, and y are integers, and 2 ≤ n + m + x + y ≤ 7; L1 is at least a pentafunctional linker, the DNA coding sequence is bound to solid support G, and G is bound to the DNA coding sequence by an amide bond; C1~C n This is a synthetic block having double-activated functional groups that are bonded in order, C n+1 ~C n+m This is a synthetic block having double-activated functional groups that are bonded in order, C n+m+1 ~C n+m+x This is a synthetic block having double-activated functional groups that are bonded in order, C n+m+x+1 ~C n+m+x+yThis is a synthetic block having a double-activating functional group that is linked in order; A and B represent a ring-closed A-termined molecule and a B-termined molecule that undergo ring closure in the presence of one type of cyclooxygenase, respectively, and A' and B' represent a ring-closed A-termined molecule and a B-termined molecule that undergo ring closure in the presence of a different type of cyclooxygenase, respectively, and A, B, A', and B' are all amino acid residues; synthetic block C n It is bonded to A by an amide bond or ester bond; synthesis block C n+m It is bonded to B by an amide bond or ester bond; synthesis block C n+m+x A' is bonded to A' by an amide or ester bond; synthesis block C n+m+x+y A and B are linked by B' via an amide or ester bond; A and B and A' and B' form peptide bonds, respectively, in the presence of cyclooxygenase, forming a bicyclic structure.

[0129] The present invention also provides a third library of bicyclic compounds having the following structural formulas, obtained by constructing the methods described above: [ka] Here, 0 ≤ n ≤ 7, 0 ≤ m ≤ 7, 0 ≤ x ≤ 7, 0 ≤ y ≤ 7, n, m, x, and y are integers, and 2 ≤ n + m + x + y ≤ 7; L1 is at least a hexafunctional linker, the DNA coding sequence is bound to L1, and L1 is bound to the DNA coding sequence by an amide bond; C1~C n This is a synthetic block having double-activated functional groups that are bonded in order, C n+1 ~C n+m This is a synthetic block having double-activated functional groups that are bonded in order, C n+m+1 ~C n+m+x This is a synthetic block having double-activated functional groups that are bonded in order, C n+m+x+1 ~C n+m+x+yA is a synthetic block having a double-activating functional group that is linked in order; G represents a solid support, and M represents a molecule containing a photocleavable group; A and B represent a ring-closed A-termined and B-termined molecule that undergoes ring closure in the presence of one type of cyclooxygenase, respectively, and A' and B' represent a ring-closed A-termined and B-termined molecule that undergoes ring closure in the presence of different types of cyclooxygenase, respectively, and A, B, A', and B' are all amino acid residues; synthetic block C n It is bonded to A by an amide bond or ester bond; synthesis block C n+m It is bonded to B by an amide bond or ester bond; synthesis block C n+m+x A' is bonded to A' by an amide or ester bond; synthesis block C n+m+x+y A and B are linked by B' via an amide or ester bond; A and B and A' and B' form peptide bonds, respectively, in the presence of cyclooxygenase, forming a bicyclic structure.

[0130] The present invention also provides a fourth library of bicyclic compounds having the following structural formulas, obtained by constructing the methods described above: [ka] Here, 0 ≤ n ≤ 7, 0 ≤ m ≤ 7, 0 ≤ x ≤ 7, 0 ≤ y ≤ 7, n, m, x, and y are integers, and 2 ≤ n + m + x + y ≤ 7; L1 is at least a hexafunctional linker, the DNA coding sequence is bound to L1, and L1 is bound to the DNA coding sequence by an amide bond; C1~C n This is a synthetic block having double-activated functional groups that are bonded in order, C n+1 ~C n+m This is a synthetic block having double-activated functional groups that are bonded in order, C n+m+1 ~C n+m+x This is a synthetic block having double-activated functional groups that are bonded in order, C n+m+x+1 ~C n+m+x+yThis is a synthetic block having a double-activating functional group that is linked in order; A and B represent a ring-closed A-termined molecule and a B-termined molecule that undergo ring closure in the presence of one type of cyclooxygenase, respectively, and A' and B' represent a ring-closed A-termined molecule and a B-termined molecule that undergo ring closure in the presence of a different type of cyclooxygenase, respectively, and A, B, A', and B' are all amino acid residues; synthetic block C n It is bonded to A by an amide bond or ester bond; synthesis block C n+m It is bonded to B by an amide bond or ester bond; synthesis block C n+m+x A' is bonded to A' by an amide or ester bond; synthesis block C n+m+x+y A is linked by B' by an amide or ester bond; A and B and A' and B' each form peptide bonds in the presence of cyclooxygenase, forming a bicyclic structure. A fourth library of bicyclic compounds can be obtained from the third library of bicyclic compounds by cleaving a molecule M containing a photocleavable group under a light source.

[0131] Specifically, each of the aforementioned composite blocks (C1, ..., C n , C n+1 , ...., C n+m , C n+m+1 , ...., C n+m+x , C n+m+x+1 , ...., C n+m+x+y Each of the following is independently selected from substituted or unsubstituted amino acids, substituted or unsubstituted dicarboxylic acids, substituted or unsubstituted diamines, substituted or unsubstituted diols, α,β-unsaturated aldehydes, α,β-unsaturated ketones, α,β-unsaturated acids, natural amino acids, or unnatural amino acids.

[0132] Specifically, of each of the aforementioned synthetic blocks, at least one synthetic block includes a backbone structure, and the backbone structure has an E3 ligase substrate structure that binds to an E3 ligase. The backbone structure is bound either within the ring or in the form of a side chain of the ring.

[0133] The specific backbone structure is selected from the following: [ka]

[0134] Specifically, each of the aforementioned synthetic construction blocks contains at least one ring-closed side chain in total. The cyclic outer chain provides a wider variety of library compounds and simultaneously allows for several functional modifications similar to lipidization to be performed on the branched chain. Furthermore, it is possible to further enhance the membrane permeability and osmotic properties of the molecule based on the membrane permeability of the molecule itself, leading to an expansion of the diversity of the compound library.

[0135] Specifically, in each of the aforementioned synthetic blocks, each synthetic block contains a total of at least two cyclic outer chains, and at least two cyclic outer chains are linked by a chemical reaction to form a bicyclic structure. Bicyclic or polycyclic structures can stabilize the conformation of macrocyclic molecules, increase the rigidity of the cyclic structure, enhance the stability of cyclic structural molecules, and extend the half-life of cyclic structural molecular pharmaceuticals.

[0136] The compound library of the present invention provides a cyclic compound library, increasing the diversity of compound libraries and expanding their application to new drug screening.

[0137] The compound library of the present invention allows for diverse adjustments of the number and types of atoms in the ring structure using different synthesis blocks, thereby expanding the diversity of the compound library.

[0138] In the compound library of the present invention, the amide bond (-CO-NH-) can be used for splicing adjacent synthetic blocks, offering more possibilities for hydrogen bonding in the ring structure and contributing to improved binding affinity of the ring structure to proteins.

[0139] The cyclic synthetic blocks of the cyclic compound library of the present invention can include backbone structures such as E3 ligase substrate structures, increasing the application of compound libraries in PROTAC. [Examples]

[0140] The technical solutions of the present invention will be described clearly and completely below, but it is clear that the embodiments described are only a part of the embodiments of the present invention, and not all embodiments. All other embodiments that can be obtained by those skilled in the art without any creative work based on the embodiments of the present invention are within the scope of the protection of the present invention.

[0141] In the reaction roadmaps of each embodiment below, [ka] This indicates a solid-phase support (PEGA resin), and other [ka] This indicates a composite block. [ka] The letters L, N, A, I, E, P, etc. within the text are abbreviations for single-letter amino acids. For example, L represents leucine (Leu), N represents aspartic acid (Asn), A represents alanine (Ala), I represents isoleucine (Ile), E represents glutamic acid (Glu), and P represents proline (Pro). [ka] The symbol indicates that the synthetic block is leucine, and other single-letter abbreviations are interpreted as the usual single-letter amino acid abbreviations in this field. [ka] The letters AA1, ..., and AA4 within each character indicate that the synthesis block is an amino acid, and are distinguished only by their sequential numbers, such as 1...4. [ka] The letters C1, ..., C n , C n+1 , ...., C n+m All of these indicate that the synthetic block is one of the types of synthetic blocks covered by this application, and are distinguished only by the serial numbers 1······n, n+1······n+m. Photo linker indicates a photocleavable group. Ahx indicates 6-aminohexanoic acid.

[0142] <Example 1: Synthesis of a cyclic compound library> [ka] [ka] [ka]

[0143] Step 1. Dissolve the amino-modified PEGA resin (1 g, 0.5 mmol / g) in N,N-dimethylformamide for 1 hour, then wash with 10% N,N-diisopropylethylamine in N,N-dimethylformamide and N,N-dimethylformamide separately, and drain. Add 10 mL of N,N-dimethylformamide, acetic anhydride (26 mg, 0.25 mmol), and N,N-diisopropylethylamine (129 mg, 1 mmol) to the resin and stir at room temperature for 30 minutes. Wash the resin with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), and drain. The resin was dissolved in N,N-dimethylformamide (5 mL), and Fmoc-ε-Amx-OH (397 mg, 4.5 eq), HOAt (153 mg, 4.5 eq), HATU (428 mg, 4.5 eq), and DIEA (323 mg, 10 equiv.) were added. The mixture was stirred at room temperature for 2 hours. The resin was washed with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), respectively, drained, and 1 g of resin was obtained. Step 2. 10 mL of a 20% piperidine N,N-dimethylformamide solution was added to 1 g of resin and stirred at room temperature for 1 hour. The resin was washed with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), respectively, and drained to obtain 980 mg of resin. Step 3. DIC (126 mg, 4 eq), HOBt (135 mg, 4 eq), and photocleavable group molecule M (225 mg, 3 eq) were stirred in N,N-dimethylformamide (5 mL) for 3 minutes. Then, 980 mg of well-dissolved resin was added, and the mixture was stirred at room temperature for 2 hours. The mixture was washed with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), drained, and 1 g of resin was obtained. Step 4. DIC (126 mg, 4 eq), HOBt (135 mg, 4 eq), DMAP (15 mg, 0.5 eq), and Fmoc-protected tetrapeptide (225 mg, 3 eq) were stirred in 10 mL of N,N-dimethylformamide for 10 minutes. Then, 1 g of the well-dissolved resin was added, and the mixture was stirred at room temperature for 16 hours. The mixture was washed with N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), and drained to obtain 1 g of resin. Step 5. Referring to the method for removing Fmoc in Step 2, compound 18 was used according to the condensation conditions in Step 3 to obtain 950 mg of resin. Step 6. 950 mg of resin was added to 25 ml of 95% trifluoroacetic acid aqueous solution and reacted at room temperature for 2 hours. The resin was washed with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), drained, and the resulting resin was added to 25 mL of 20% DIEA solution in N,N-dimethylformamide and stirred at room temperature for 2 hours. The resin was washed with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), drained, and 900 mg of resin was obtained. Step 7. Dissolve DIC (40 mg, 5 eq) and NHS (36 mg, 5 eq) in 5 mL of N,N-dimethylformamide, add to 250 mg of resin, and react at room temperature for 2 hours. Wash the resin with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), and drain. Dissolve the resin in 4 mL of pH 8.0 HEPES (100 mM) buffer, add HDNA (250 nmol, lm M), and react overnight at room temperature to obtain 240 mg of resin. Step 8. Add 10 mL of 20% piperidine N,N-dimethylformamide solution to 240 mg of resin and stir at room temperature for 1 hour. Wash the resin with N,N-dimethylformamide (3 × 5 mL) and water (3 × 5 mL), respectively, and drain. Add 3400 μL of water, 400 μL of 10 × T4 DNA ligase buffer, 8 μL of T4 DNA ligase (40 U / μL), and 175 μL of OP (AAATCGATGTG) (300 nm, 1.74 nm / μL) to the resin and react overnight at room temperature. Then wash the resin with water (3 × 10 mL) and T4 DNA ligase buffer (3 × 3 mL), respectively, and drain to obtain 230 mg of resin. 230 mg of resin was mixed with 3300 μL of water, 400 μL of 10 × T4 DNA ligase buffer, 8 μL of T4 DNA ligase (40 U / μL), and 294 μL of DNAtag1 (ATCTGACA) (300 nm, 1.7 nm / μL). The mixture was allowed to react overnight at room temperature. The resin was then washed with T4 DNA ligase buffer (3 × 3 mL), water (3 × 10 mL), and N,N-dimethylformamide (3 × 10 mL), and drained. DIC (40 mg, 5 eq), HOBt (42 mg, 5 eq), and amino acid AA1 (110 mg, 5 eq) were stirred in N,N-dimethylformamide (5 mL) for 10 minutes. After stirring, 230 mg of the well-dissolved resin was added, and the mixture was stirred at room temperature for 1 hour. The resin was washed with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), and drained. 5 mL of a 20% piperidine solution in N,N-dimethylformamide was added to the resin and stirred at room temperature for 1 hour. The resin was then washed again with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), and drained to obtain 220 mg of resin. GTTACACGT Step 9. DNA tag 2 (GTTACACGT) and amino acid AA2 were added according to the procedure in Step 9 to obtain 210 mg of resin. Step 10. DNA tag 3 (CTGTAACGA) and amino acid AA3 were added according to the procedure in Step 9 to obtain 200 mg of resin. Step 11. DNA tag 4 (TTCGAACTT) and amino acid AA4 were added according to the procedure in Step 9 to obtain 190 mg of resin. Step 12. DIC (40 mg, 5 eq), HOBt (42 mg, 5 eq), and Fmoc-protected dipeptide (128 mg, 5 eq) were stirred in 5 ml of N,N-dimethylformamide for 10 minutes. 190 mg of the well-dissolved resin was added, and the mixture was stirred at room temperature for 2 hours. The resin was washed with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), respectively, and after draining, 5 mL of a 20% piperidine solution in N,N-dimethylformamide was added to the resin, and the mixture was stirred at room temperature for 1 hour. The resin was washed with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), respectively, and after draining, 185 mg of resin was obtained. Step 13. Add 3400 μL of water, 400 μL of 10×T4 DNA ligase buffer, 8 μL of T4 DNA ligase (40 U / μL), and 175 μL of CP (TAGCCTATTGTCAGACAAGCTTCACCTGC) (300 nm, 1.74 nm / μL) to 185 mg of resin. React overnight at room temperature, then wash the resin with water (3 × 10 mL) and T4 DNA ligase buffer (3 × 3 mL), drain, and obtain 180 mg of resin. Step 14. 1 mL of N-methylpyrrolidone was added to 180 mg of resin, irradiated with 365 nm ultraviolet light for 5 hours, then the resin was filtered and freeze-dried by solvent dialysis to obtain 5 mg of compound 16. Step 15. Dissolve 2 mg of compound 16 in 800 μl of water, add 100 μl of sodium acetate (pH=5.0, 0.5 M), 2 μl of sodium chloride solution (0.25 M), 20 μl of disodium ethylenediaminetetraacetate solution (0.05 M), 10 μl of TCEP solution (0.05 M), and 60 μl of cyclase OaAEP3 (1.34 mg / mL), respectively, and react the mixture overnight at 37°C to obtain 1.2 mg of the product.

[0144] In this embodiment, the linker compound 18 was synthesized as follows. [ka] Step 1. Compound Fmoc-Asp(Alloc)-OH (750 mg, 1.83 mmol), NH2-PEG4CH2CH2COO t Bu (588 mg, 1.83 mmol) and DIPEA (472 mg, 3.66 mmol) were dissolved in 10 ml of N,N-dimethylformamide. HATU (836 mg, 2.2 mmol) was added at 0°C, and the mixture was stirred at room temperature for 2 hours. The mixture was then quenched with water, and 10 ml of ethyl acetate was added. The aqueous phase was extracted three times with ethyl acetate. The organic phases were combined, dried over anhydrous sodium sulfate, filtered, and spin-dried to obtain the crude product. The crude product was passed through a column with ethyl acetate as the eluent to obtain a colorless oil (1.2 g, 92.3%). Step 2. Compound 2 (1.2 g, 1.68 mmol) and Pd(PPh3)4 (97 mg, 0.084 mmol) were dissolved in 20 ml of tetrahydrobilin solution, and phenylsilane (363 mg, 3.36 mmol) was added at 0°C under a nitrogen atmosphere. The mixture was stirred at room temperature for 1 hour. The mixture was spin-dried and purified by passing it through a column (6% methanol dichloromethane solution as the eluent) to obtain a white solid (1 g, 88.5%). LC-MS: 673.7 (M+H) + .

[0145] <Example 2: Verification of the Enzymatic Cyclization Method> [ka] [ka]

[0146] Step 1. Dissolve DIC (40 mg, 5 eq) and NHS (36 mg, 5 eq) in 5 mL of N,N-dimethylformamide, add to 250 mg of resin, and react at room temperature for 2 hours. Wash the resin with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), respectively, and drain. Add 5 mL of 20% piperidine N,N-dimethylformamide solution to the resin, stir at room temperature for 1 hour, then wash with N,N-dimethylformamide (3 × 5 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), drain, and obtain 240 mg of resin. Step 2: DIC (40 mg, 5 eq), HOBt (42 mg, 5 eq), and amino acid AA1 (110 mg, 5 eq) were stirred in N,N-dimethylformamide (5 mL) for 10 minutes. Then, 230 mg of well-dissolved resin was added, and the mixture was stirred at room temperature for 1 hour. The resin was washed with N,N-dimethylformamide (3 × 3 mL), methylene chloride (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), respectively, and drained to obtain 240 mg of resin. Step 3. Using 5 mL of a 20% piperidine N,N-dimethylformamide solution, DIC (40 mg, 5 eq), HOBt (42 mg, 5 eq), and amino acid AA2 (142 mg, 5 eq), 235 mg of resin was obtained, following the steps of Fmoc removal in Step 1 and condensation in Step 2. Step 4. Using 5 mL of a 20% piperidine N,N-dimethylformamide solution, DIC (40 mg, 5 eq), HOBt (42 mg, 5 eq), and amino acid AA3 (119 mg, 5 eq), 230 mg of resin was obtained, referring to the removal of Fmoc in Step 1 and the condensation procedure in Step 2. Step 5. Using 5 mL of a 20% piperidine N,N-dimethylformamide solution, DIC (40 mg, 5 eq), HOBt (42 mg, 5 eq), and amino acid AA4 (105 mg, 5 eq), 220 mg of resin was obtained, referring to the removal of Fmoc in Step 1 and the condensation procedure in Step 2. Step 6. Using 5 mL of 20% piperidine N,N-dicarboxamide solution, DIC (40 mg, 5 eq), HOBt (42 mg, 5 eq), and dipeptide (128 mg, 5 eq), 215 mg of resin was obtained, following the de-Fmoc procedure in Step 1 and the condensation procedure in Step 2. Step 7. 215 mg of resin was mixed with 1 mL of N-methylpyrrolidone, irradiated with 365 nm ultraviolet light for 5 hours, filtered, and freeze-dried by solvent dialysis to obtain 25 mg of compound 8. Step 8. Dissolve 0.3 mg of compound 8 in 800 μl of water, add 100 μl of sodium acetate buffer (pH=5.0, 0.5 M), 2 μl of sodium chloride solution (0.25 M), 20 μl of disodium ethylenediaminetetraacetate solution (0.05 M), 10 μl of TCEP solution (0.05 M), and 30 μl of OaAEP3 (1.34 mg / mL), respectively, and react the mixture overnight at 37°C to obtain cyclic compound 9. LCMS: 1154.72 (M+H) + .

[0147] <Example 3: Verification of Library Construction Method 3> [ka] [ka]

[0148] Synthesis method: 1. PEGA resin (100 mg, 25 μmol) was dissolved in 3 ml of N,N-dimethylformamide for 2 hours. 95 mg of resin was obtained according to a standard solid-phase peptide synthesis method. 2. 95 mg of resin was stirred with 95% trifluoroacetic acid, 2.5% water, and 2.5% triisopropylsilane at room temperature for 2 hours. 3 mL of N,N-dimethylformamide solution containing 10% N,N-diisopropylethylamine was added to the resin and stirred at room temperature for 2 hours. The resin was washed with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), respectively, and drained. DIC (32 mg, 10 eq) and NHS (28 mg, 10 eq) were dissolved in 3 mL of N,N-dimethylformamide and added to the resin with stirring for 1 minute, and the mixture was reacted at 37°C for 4 hours. The resin was washed with N,N-dimethylformamide (3 × 2 mL), dichloromethane (3 × 2 mL), and N,N-dimethylformamide (3 × 2 mL), drained, and 3 mL of 100 mM HEPES buffer pH 8.0 HDNA (100 nmol) was added to the resin. The mixture was reacted at 37°C for 16 hours. 5 mL of a 20% piperidine solution in N,N-dimethylformamide was added to the resin, and the mixture was stirred at room temperature for 1 hour. Then, it was washed with N,N-dimethylformamide (3 × 5 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), drained, and 85 mg of resin was obtained. 3. To 85 mg of resin, 2095 μL of water, 250 μL of 10×T4 DNA ligase buffer, 25 μL of T4 DNA ligase (10000 U / μL), and 58 μL of OP (AAATCGATGTG) (100 nm, 1.74 nm / μL) were added and reacted overnight at room temperature. After that, the resin was washed with water (3×5 mL) and T4 DNA ligase buffer (3×3 mL), drained, and 75 mg of resin was obtained. 75 mg of resin was mixed with 2095 μL of water, 250 μL of 10×T4 DNA ligase buffer, and 25 μL of T4 DNA ligase (10000 U / μL). The mixture was divided into 96 wells, and DNA tags (1.35 nm, 1 nm / μ) were added to each well. The mixture was allowed to react overnight at room temperature. The resin was then washed with T4 DNA ligase buffer (3×3 mL), water (3×3 mL), and N,N-dimethylformamide (3×3 mL), and drained. DIC (16 mg, 5 eq) and HOBt (17 mg, 5 eq) were dissolved in N,N-dimethylformamide (5 mL) and divided into 96 portions. The amino acids (5 eq) were added to the resin in each well, and the mixture was stirred at room temperature for 1 hour. The resin was then washed with N,N-dimethylformamide (3×3 mL), dichloromethane (3×3 mL), and N,N-dimethylformamide (3×5 mL), and drained. The resin was added to 5 mL of N,N-dimethylformamide solution containing 20% ​​piperidine, and the mixture was stirred at room temperature for 1 hour. The resin was washed with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), and drained to obtain 70 mg of resin. All condensation reactions and DNA binding reactions were repeated a total of four times. After the fourth amino acid and DNA tagging, the resins were combined and washed with N,N-dimethylformamide (3 × 5 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), and drained to obtain 70 mg of resin. 4. DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), and Fmoc-Gly-Leu-OH (51 mg, 5 eq) were stirred in 5 mL of N,N-dimethylformamide for 2 minutes, then 70 mg of resin was added, and the mixture was stirred at room temperature for 2 hours. The resin was washed with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), respectively, and drained. The resin, palladium tetrakis (2.89 mg, 0.2 eq), and phenylsilane (54.12 mg, 20 eq) were stirred in 5 mL of dichloromethane under nitrogen protection at room temperature for 1 hour. The resin was washed with dichloromethane (3 × 3 mL) and N,N-dimethylformamide (3 × 3 mL), respectively, drained, and subjected to standard solid-phase synthesis to obtain 65 mg of resin. 5. 65 mg of resin, palladium tetrakis (2.89 mg, 0.2 eq), and phenylsilane (54.12 mg, 20 eq) were stirred in 5 mL of dichloromethane under nitrogen protection at room temperature for 1 hour. The resin was washed with dichloromethane (3 × 3 mL) and N,N-dimethylformamide (3 × 3 mL), drained, and added to 5 mL of a 20% piperidine solution in N,N-dimethylformamide, and stirred at room temperature for 1 hour. The resin was washed with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), drained, and 60 mg of resin was obtained. 6. 60 mg of resin was mixed with 2095 μL of water, 250 μL of 10×T4 DNA ligase buffer, 25 μL of T4 DNA ligase (10000 U / μL), and 57 μL of CP (100 nm, 1.74 nm / μL). The mixture was allowed to react overnight at room temperature. After washing with T4 DNA ligase buffer (3 × 3 mL) and water (3 × 5 mL), the mixture was drained. Next, 50 mg of resin was dissolved in 830 μL of water. 100 μL of sodium acetate buffer (pH=5.0, 0.5 M), 2 μL of sodium chloride aqueous solution (0.25 M), 20 μL of disodium EDTA aqueous solution (0.05 M), 10 μL of TCEP aqueous solution (0.05 M), and 30 μL of OaAEP3 (1.34 mg / mL) were added. The mixture was allowed to react overnight at 37°C to obtain a DNA-coding cyclic peptide library.

[0149] <Example 4: Construction of different A-terminal ring-closed libraries> [ka] [ka]

[0150] Synthesis method: 1. 100 mg of resin 1 was used to obtain 90 mg of resin according to a standard solid-phase synthesis method, referencing the synthesis method described above. 2. 90 mg of resin was added to 5 mL of 95% trifluoroacetic acid aqueous solution and reacted at room temperature for 2 hours. The resin was washed with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), and after draining, the obtained resin was added to 5 mL of N,N-dimethylformamide solution containing 20% ​​DIEA and stirred at room temperature for 2 hours. The resin was washed with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), and after draining, 85 mg of resin was obtained. 3. Dissolve DIC (16 mg, 5 eq) and NHS (15 mg, 5 eq) in 5 mL of N,N-dimethylformamide, add to 85 mg of resin, and react at room temperature for 2 hours. Wash the resin with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), respectively, and drain. Dissolve the resin in 2 mL of pH 8.0 HEPES (100 mM) buffer, add HDNA (100 nmol, 1 mM), and react overnight at room temperature to obtain 80 mg of resin. Add 5 mL of 20% piperidine solution in N,N-dimethylformamide to the resin, stir at room temperature for 1 hour, then wash with N,N-dimethylformamide (3 × 5 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), drain, and obtain 75 mg of resin. 4. 75 mg of resin was mixed with 2095 μL of water, 250 μL of 10×T4 DNA ligase buffer, 25 μL of T4 DNA ligase (10000 U / μL), and 58 μL of OP (AAATCGATGTG) (100 nm, 1.74 nm / μL). The mixture was allowed to react overnight at room temperature. After that, the resin was washed with water (3×5 mL) and T4 DNA ligase buffer (3×3 mL), drained, and 75 mg of resin was obtained. 75 mg of resin was mixed with 2095 μL of water, 250 μL of 10×T4 DNA ligase buffer, and 25 μL of T4 DNA ligase (10000 U / μL). The mixture was divided into 96 wells, and DNA tags (1.35 nm, 1 nm / μ) were added to each well. The mixture was allowed to react overnight at room temperature. The resin was then washed with T4 DNA ligase buffer (3×3 mL), water (3×3 mL), and N,N-dimethylformamide (3×3 mL), and drained. DIC (16 mg, 5 eq) and HOBt (17 mg, 5 eq) were dissolved in N,N-dimethylformamide (5 mL) and divided into 96 portions. Fmoc-amino acids (5 eq) were added to the resin in each well, and the mixture was stirred at room temperature for 1 hour. The resin was then washed with N,N-dimethylformamide (3×3 mL), dichloromethane (3×3 mL), and N,N-dimethylformamide (3×5 mL), and drained. The resin was added to 5 mL of N,N-dimethylformamide solution containing 20% ​​piperidine, and the mixture was stirred at room temperature for 1 hour. The resin was washed with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), respectively, and drained to obtain 70 mg of resin. After completing the fourth amino acid and DNA tagging, the resin was combined to obtain 65 mg of resin. 5. DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), and Fmoc-Gly-Leu-OH (51 mg, 5 eq) were stirred in 5 mL of N,N-dimethylformamide for 2 minutes, and 65 mg of resin was added. The mixture was stirred at room temperature for 2 hours. The resin was washed with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), respectively, and drained. The resin was washed with dichloromethane (3 × 3 mL) and N,N-dimethylformamide (3 × 3 mL), respectively, and drained. 5 mL of 20% piperidine solution in N,N-dimethylformamide was added to the resin, and the mixture was stirred at room temperature for 1 hour. The resin was washed with N,N-dimethylformamide (3 × 3 mL) and water (3 × 5 mL), respectively, and drained to obtain 60 mg of resin. 6. Add 2095 μL of water, 250 μL of 10×T4 DNA ligase buffer, 25 μL of T4 DNA ligase (10000 U / μL), and 57 μL of CP (100 nm, 1.74 nm / μL) to 60 mg of resin. React overnight at room temperature, then wash the resin with T4 DNA ligase buffer (3 × 3 mL) and water (3 × 5 mL), and drain. 7. 55 mg of resin was mixed with 1 mL of N-methylpyrrolidone, irradiated with 365 nm ultraviolet light for 5 hours, filtered, and freeze-dried by solvent dialysis to obtain 5 mg of compound 8. 8. 5 mg of compound 8 was dissolved in 800 μl of water, and 100 μl of sodium acetate buffer (pH=5.0, 0.5 M), 2 μl of sodium chloride solution (0.25 M), 20 μl of disodium ethylenediaminetetraacetate solution (0.05 M), 10 μl of TCEP solution (0.05 M), and 60 μl of cyclase enzyme OaAEP3 (1.34 mg / mL) were added. The mixture was reacted overnight at 37°C, and lyophilized in the aqueous phase to obtain a 3 mg library of DNA-coding cyclic peptides. Here, during the cyclization reaction, the A-terminus molecule is detached from the fragment-GL.

[0151] <Example 5: Construction of different A-terminal ring-closed libraries> [ka] [ka]

[0152] Synthesis method: 1. 100 mg of resin was used to obtain 90 mg of resin according to a standard solid-phase synthesis method, referencing the synthesis method described above. 2. 90 mg of resin was added to 5 ml of 95% trifluoroacetic acid aqueous solution and reacted at room temperature for 2 hours. The resin was washed with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), drained, and the resulting resin was added to 20% DIEA N,N-dimethylformamide solution (5 mL) and stirred at room temperature for 2 hours. The resin was washed with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), drained, and 85 mg of resin was obtained. 3. Dissolve DIC (16 mg, 5 eq) and NHS (15 mg, 5 eq) in 5 mL of N,N-dimethylformamide, add to 85 mg of resin, and react at room temperature for 2 hours. Wash the resin with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), and drain. Dissolve the resin in 2 mL of pH 8.0 HEPES (100 mM) buffer, add HDNA (100 nmol, lm M), and react overnight at room temperature to obtain 80 mg of resin. Add 5 mL of a 20% piperidine solution in N,N-dimethylformamide to the resin, stir at room temperature for 1 hour, then wash with N,N-dimethylformamide (3 × 5 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), drain, and obtain 75 mg of resin. 4. 75 mg of resin was mixed with 2095 μL of water, 250 μL of 10×T4 DNA ligase buffer, 25 μL of T4 DNA ligase (10000 U / μL), and 58 μL of OP (AAATCGATGTG) (100 nm, 1.74 nm / μL). The mixture was allowed to react overnight at room temperature. After that, the resin was washed with water (3×5 mL) and T4 DNA ligase buffer (3×3 mL), drained, and 75 mg of resin was obtained. 75 mg of resin was mixed with 2095 μL of water, 250 μL of 10×T4 DNA ligase buffer, and 25 μL of T4 DNA ligase (10000 U / μL). The mixture was divided into 96 wells, and DNA tags (1.35 nm, 1 nm / μ) were added to each well. The mixture was allowed to react overnight at room temperature. The resin was then washed with T4 DNA ligase buffer (3×3 mL), water (3×3 mL), and N,N-dimethylformamide (3×3 mL), and drained. DIC (16 mg, 5 eq) and HOBt (17 mg, 5 eq) were dissolved in N,N-dimethylformamide (5 mL) and divided into 96 portions. Fmoc-amino acids (5 eq) were added to the resin in each well, and the mixture was stirred at room temperature for 1 hour. The resin was then washed with N,N-dimethylformamide (3×3 mL), dichloromethane (3×3 mL), and N,N-dimethylformamide (3×5 mL), and drained. The resin was added to 5 mL of N,N-dimethylformamide solution containing 20% ​​piperidine, and the mixture was stirred at room temperature for 1 hour. The resin was washed with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), respectively, and drained to obtain 70 mg of resin. After completing the fourth amino acid and DNA tagging, the resin was combined to obtain 65 mg of resin. 5. DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), and Fmoc-Gly-Leu-OH (51 mg, 5 eq) were stirred in 5 mL of N,N-dimethylformamide for 2 minutes, and 65 mg of resin was added. The mixture was stirred at room temperature for 2 hours. The resin was washed with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), respectively, and drained. The resin was washed with dichloromethane (3 × 3 mL) and N,N-dimethylformamide (3 × 3 mL), respectively, and drained. 5 mL of 20% piperidine solution in N,N-dimethylformamide was added to the resin, and the mixture was stirred at room temperature for 1 hour. The resin was washed with N,N-dimethylformamide (3 × 3 mL) and water (3 × 5 mL), respectively, and drained to obtain 60 mg of resin. 6. Add 2095 μL of water, 250 μL of 10×T4 DNA ligase buffer, 25 μL of T4 DNA ligase (10000 U / μL), and 57 μL of CP (100 nm, 1.74 nm / μL) to 60 mg of resin. React overnight at room temperature, then wash the resin with T4 DNA ligase buffer (3 × 3 mL) and water (3 × 5 mL), and drain. 7. 55 mg of resin was mixed with 1 mL of N-methylpyrrolidone, irradiated with 365 nm ultraviolet light for 5 hours, filtered, and freeze-dried by solvent dialysis to obtain 5 mg of compound 8. 8. 5 mg of compound 8 was dissolved in 800 μl of water, and 100 μl of sodium acetate buffer (pH=5.0, 0.5 M), 2 μl of sodium chloride solution (0.25 M), 20 μl of disodium ethylenediaminetetraacetate solution (0.05 M), 10 μl of TCEP solution (0.05 M), and 60 μl of cyclase enzyme OaAEP3 (1.34 mg / mL) were added. The mixture was reacted overnight at 37°C, and lyophilized in the aqueous phase to obtain a 3 mg library of DNA-coding cyclic peptides. Here, during the cyclization reaction, the A-terminus molecule is detached from the fragment-FL.

[0153] <Example 6: Construction of different A-terminal ring-closed libraries> [ka] [ka]

[0154] Synthesis method: Referring to the library construction method of Example 4, a 3 mg DNA-coding cyclic peptide library was obtained from 100 mg of starting resin. During the ring-closing reaction, the ring-closing A-terminus molecule was detached from fragment-AL.

[0155] <Example 7: Construction of different A-terminal ring-closed libraries> [ka] [ka]

[0156] Synthesis method: 1. PEGA resin (100 mg, 25 μmol) was dissolved in 3 ml of N,N-dimethylformamide over 2 hours. Fmoc-Amx-OH (4.77 equiv), mono-tert-butyl succinate (0.23 equiv), HOBt (5 equiv), HBTU (5 equiv), and DIPEA (10 equiv) were added, and the mixture was stirred at room temperature for 2 hours. The resin was washed with N,N-dimethylformamide (3 × 2 mL), dichloromethane (3 × 2 mL), and N,N-dimethylformamide (3 × 2 mL), and drained. 4 mL of a 20% piperidine solution in N,N-dimethylformamide was added to the resin, stirred at room temperature for 1 hour, then washed with N,N-dimethylformamide (3 × 2 mL), dichloromethane (3 × 2 mL), and N,N-dimethylformamide (3 × 2 mL), and drained. DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), and 4-(4-(1-hydroxyethyl)-2-methoxy-5-nitrophenoxy)butyric acid (38 mg, 5 eq) were stirred in N,N-dimethylformamide (3 mL) for 5 minutes, then added to the drained resin, and the mixture was stirred at room temperature for 2 hours. The resin was washed with N,N-dimethylformamide (3 × 2 mL), dichloromethane (3 × 2 mL), and N,N-dimethylformamide (3 × 2 mL), respectively, and then drained. DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), DMAP (2 mg, 0.5 eq), and Fmoc-Glu-OAll (51 mg, 5 eq) were stirred in N,N-dimethylformamide (3 mL) for 5 minutes, then added to the drained resin, and the mixture was stirred at room temperature for 2 hours. The resin was washed with N,N-dimethylformamide (3 × 2 mL), dichloromethane (3 × 2 mL), and N,N-dimethylformamide (3 × 2 mL), and then drained to obtain 95 mg of resin. 2. 90 mg of resin, palladium tetrakis (2.89 mg, 0.2 eq), and phenylsilane (54.12 mg, 20 eq) were stirred in 5 mL of dichloromethane under nitrogen protection at room temperature for 1 hour. The resin was washed with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), respectively, and drained to obtain 85 mg of resin. 3. Using DIC (16 mg, 5 eq) and HOBt (17 mg, 5 eq) as coupling agents and aryl-protected amino acids as raw materials, 80 mg of resin was obtained following a standard solid-phase synthesis procedure. 4. Add 95% TFA, 2.5% H2O, and 2.5% triisopropylsilane to 80 mg of resin and stir at room temperature for 2 hours. Add 3 mL of N,N-dimethylformamide solution containing 10% DIPEA to the resin and stir at room temperature for 2 hours. Wash the resin with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), respectively, and drain. Dissolve DIC (32 mg, 10 eq) and NHS (28 mg, 10 eq) in 3 mL of N,N-dimethylformamide, add to the resin with stirring for 1 minute, and react at 37°C for 4 hours. The resin was washed with N,N-dimethylformamide (3 × 2 mL), dichloromethane (3 × 2 mL), and N,N-dimethylformamide (3 × 2 mL), drained, and 3 mL of HDNA (100 nmol) dissolved in 100 mM HEPES buffer pH 8.0 was added to the resin. The mixture was reacted at 37°C for 16 hours. 5 mL of a 20% piperidine solution in N,N-dimethylformamide was added to the resin, and the mixture was stirred at room temperature for 1 hour. Then, it was washed with N,N-dimethylformamide (3 × 5 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), drained, and 75 mg of resin was obtained. 5. To 75 mg of resin, 2095 μL of water, 250 μL of 10×T4 DNA ligase buffer, 25 μL of T4 DNA ligase (10000 U / μL), and 58 μL of OP (AAATCGATGTG) (100 nm, 1.74 nm / μL) were added and reacted overnight at room temperature. After that, the resin was washed with water (3×5 mL) and T4 DNA ligase buffer (3×3 mL), drained, and 75 mg of resin was obtained. 75 mg of resin was mixed with 2095 μL of water, 250 μL of 10×T4 DNA ligase buffer, and 25 μL of T4 DNA ligase (10000 U / μL). The mixture was divided into 96 wells, and DNA tags (1.35 nm, 1 nm / μ) were added to each well. The mixture was allowed to react overnight at room temperature. The resin was then washed with T4 DNA ligase buffer (3×3 mL), water (3×3 mL), and N,N-dimethylformamide (3×3 mL), and drained. DIC (16 mg, 5 eq) and HOBt (17 mg, 5 eq) were dissolved in N,N-dimethylformamide (5 mL) and divided into 96 portions. The amino acids (5 eq) were added to the resin in each well, and the mixture was stirred at room temperature for 1 hour. The resin was then washed with N,N-dimethylformamide (3×3 mL), dichloromethane (3×3 mL), and N,N-dimethylformamide (3×5 mL), and drained. The resin was added to 5 mL of N,N-dimethylformamide solution containing 20% ​​piperidine, and the mixture was stirred at room temperature for 1 hour. The resin was washed with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), respectively, and drained to obtain 70 mg of resin. All condensation reactions and DNA binding reactions were repeated a total of four times, and after the fourth amino acid and DNA tag, the resin was added. DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), and Fmoc-Gly-Leu-OH (51 mg, 5 eq) were stirred in 5 mL of N,N-dimethylformamide for 2 minutes, then 70 mg of resin was added, and the mixture was stirred at room temperature for 2 hours. The resin was washed with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), respectively, and drained. The resin, palladium tetrakis (2.89 mg, 0.2 eq), and phenylsilane (54.12 mg, 20 eq) were stirred in 5 ml of dichloromethane at room temperature for 1 hour under nitrogen protection.The resin was washed with dichloromethane (3 × 3 mL) and N,N-dimethylformamide (3 × 3 mL), drained, and then added to the resin with 5 mL of N,N-dimethylformamide solution containing 20% ​​piperidine. The mixture was stirred at room temperature for 1 hour. The resin was then washed with N,N-dimethylformamide (3 × 3 mL) and water (3 × 5 mL), drained, and 65 mg of resin was obtained. 6. Add 2095 μL of water, 250 μL of 10×T4 DNA ligase buffer, 25 μL of T4 DNA ligase (10000 U / μL), and 57 μL of CP (100 nm, 1.74 nm / μL) to 65 mg of resin and allow to react overnight at room temperature. Then wash with T4 DNA ligase buffer (3 × 3 mL) and water (3 × 5 mL) and drain. Next, dissolve 10 mg of resin in 830 μL of water, add 100 μL of sodium acetate buffer (pH=5.0, 0.5 M), 2 μL of sodium chloride aqueous solution (0.25 M), 20 μL of disodium EDTA aqueous solution (0.05 M), 10 μL of TCEP aqueous solution (0.05 M), and 30 μL of OaAEP3 (1.34 mg / mL) to perform a ring-closing reaction, and allow the mixture to react overnight at 37°C to obtain a DNA-coding cyclic peptide library. During the ring-closing reaction, the ring-closing A-terminus molecule is detached from the fragment-GL.

[0157] <Example 8: Construction of different A-terminal closed-ring libraries> [ka] [ka]

[0158] Synthesis method: Referring to the resin synthesis and database construction method of Example 7, a 55 mg solid-phase DNA-coding cyclic peptide library was obtained from 100 mg of starting resin. Here, during the ring-closing reaction, the ring-closing A-terminus molecule is detached from fragment-FL.

[0159] <Example 9: Construction of different A-terminal closed-ring libraries> [ka]

[0160] Synthesis method: Referring to the resin synthesis and database construction method of Example 7, a 50 mg solid-phase DNA-coding cyclic peptide library was obtained from 100 mg of starting resin. Here, during the ring-closing reaction, the ring-closing A-terminus molecule is detached from fragment-AL.

[0161] <Example 10: Use of ONB-protected peptide in the synthesis of the DEL library of the present invention> [ka]

[0162] Step 1. ONB-protected Fmoc-Asn-OH was synthesized. The protecting group can be completely removed under 365 nm UV irradiation. (1) The compounds (2-nitrophenyl)methanamine hydrochloride (1.9 g, 10 mmol), Fmoc-Asp-OtBu (5 g, 12 mmol), and DIPEA (3.9 g, 15 mmol) were dissolved in 20 ml of N,N-dimethylformamide. HATU (5.8 g, 15 mmol) was added at 0°C, and the mixture was stirred at room temperature for 2 hours. The mixture was then quenched with water, 10 ml of ethyl acetate was added, and the aqueous phase was extracted three times with ethyl acetate. The organic phases were combined, dried on anhydrous sodium sulfate, filtered, and spin-dried to obtain the crude product. The crude product was passed through a column with ethyl acetate as the eluent to obtain a white solid (4.5 g, 82.6%). (2) The compound obtained in the previous step (4.5 g, 8.25 mmol) was added to 50 ml of 25% trifluoroacetic acid in dichloromethane solution and reacted at room temperature for 2 hours. The mixture was spin-dried and purified by column chromatography (using 6% methanol in dichloromethane solution as the eluent) to obtain a white solid (3.5 g, 86.7%). ¹H NMR (400 MHz, DMSO) δ 8.50 (t, J=5.7 Hz, 1 H), 8.03 (d, J=8.1 Hz, 1 H), 7.90 (d, J=7.4 Hz, 2 H), 7.71 (d, J=7.3 Hz, 2 H), 7.67-7.59 (m, 2 H), 7.59-7.48 (m, 2 H), 7.42 (t, J=7.4 Hz, 2 H) H),7.33(dd,J=6.9,4.5Hz,2H),4.56(d,J=4.2Hz,2H),4.47-4.36(m,1H),4.26(dt,J =137,7.2Hz,3H),2.74(dd,J=15.1,5.6Hz,1H),2.65-2.58(m,1H).LCMS:490.2(M+H) + . Step 2: Application of ONB-protected peptides to DEL library synthesis and investigation of the effect of removing ONB protecting groups under 365 nm UV irradiation. Following the synthesis of the DEL library in Example 1, compound 15 was removed from the resin simultaneously with the removal of the ONB protecting group, and compound 16 was obtained under 365 nm UV irradiation. The preparation method is as follows. [ka] [ka] [ka] [ka]

[0163] <Example 11: Verification of a ring-closing method for compounds containing one side chain on the ring> [ka]

[0164] Step 1. DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), and Fmoc-Lys(Alloc)-OH (57 mg, 5 eq) were stirred in N,N-dimethylformamide (3 mL) for 10 minutes. Then, 100 mg of the well-dissolved resin was added, and the mixture was stirred at room temperature for 1 hour. The resin was washed with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), respectively, and drained to obtain 100 mg of resin. Step 2. Add 5 mL of 20% piperidine N,N-dimethylformamide solution to the resin and stir at room temperature for 1 hour. Then wash with N,N-dimethylformamide (3 × 5 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), drain, and obtain 100 mg of resin. DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), and synthetic block Al (49 mg, 5 eq) were used to obtain 95 mg of resin, referring to the condensation procedure in Step 1. Step 3. Using 5 mL of a 20% piperidine N,N-dimethylformamide solution, DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), and Fmoc-L-citrulline (synthesis block A2) (50 mg, 5 eq), 95 mg of resin was obtained, following the Fmoc removal and condensation procedure in Step 1. Step 4. Using 5 mL of a 20% piperidine N,N-dimethylformamide solution, DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), and synthesis block A3 (52 mg, 5 eq), 90 mg of resin was obtained, following the de-Fmoc and condensation steps in Step 1. Step 5. 90 mg of resin, palladium tetrakis (2.89 mg, 0.2 eq), and phenylsilane (54.12 mg, 20 eq) were stirred in 5 mL of dichloromethane under nitrogen protection at room temperature for 1 hour. The resin was washed with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), respectively, and drained to obtain 85 mg of resin. Step 6. 5 mL of a solution of DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), Fmoc-Gly-Leu-OH (50 mg, 5 eq), and 20% piperidine in N,N-dimethylformamide was mixed to obtain 85 mg of resin. The 85 mg of resin was added to a mixed solution of 0.5 mL of acetonitrile and 0.5 mL of water, irradiated with 365 nm ultraviolet light for 5 hours, filtered, and freeze-dried by solvent dialysis to obtain 5 mg of compound 7. Step 7. Dissolve 0.25 mg of compound 7 in 800 μl of water, add 100 μl of sodium acetate buffer (pH=5.0, 0.5 M), 2 μl of sodium chloride solution (0.25 M), 20 μl of disodium ethylenediaminetetraacetate solution (0.05 M), 10 μl of TCEP solution (0.05 M), and 30 μl of OaAEP3 (1.34 mg / mL), respectively, and react the mixture overnight at 37°C to obtain cyclic compound 8. LCMS: 1437.06 (M+H) + .

[0165] <Example 12: Verification of a ring-closing method for compounds containing one side chain on the ring> [ka]

[0166] Step 1. DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), and synthetic block Al(S)-2-((((9H-fluoren-9-yl)methoxy)carbonyl)amino)3-(pyridine-3-yl)propanoic acid (50 mg, 5 eq) were stirred in N,N-dimethylformamide (3 mL) for 10 minutes. Then, 100 mg of well-dissolved resin was added, and the mixture was stirred at room temperature for 1 hour. The resin was washed with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), drained, and 100 mg of resin was obtained. 5 mL of a 20% piperidine-containing N,N-dimethylformamide solution was added to the resin and stirred at room temperature for 1 hour. The mixture was then washed with N,N-dimethylformamide (3 × 5 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), dried, and 100 mg of resin was obtained. Step 2. Using DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), and synthesis block A2 (50 mg, 5 eq), 95 mg of resin was obtained by referring to the condensation procedure in Step 1. 5 mL of a 20% piperidine-containing N,N-dimethylformamide solution was added to the resin, and after stirring at room temperature for 1 hour, it was washed with N,N-dimethylformamide (3 × 5 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), dried, and 95 mg of resin was obtained. Step 3. Using DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), and Fmoc-Lys(Alloc)-OH (57 mg, 5 eq), refer to the Fmoc removal and condensation procedure in Step 1 to obtain 95 mg of resin. Step 4. Using DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), and synthesis block A3 (52 mg, 5 eq), refer to the condensation and de-Fmoc procedure in Step 1 to obtain 90 mg of resin. Step 5. Using 5 mL of a solution of DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), Fmoc-Gly-Leu-OH (52 mg, 5 eq), and 20% piperidine in N,N-dimethylformamide, 85 mg of resin was obtained by referring to the condensation and Fmoc removal procedure in Step 1. The 85 mg of resin was added to a mixed solution of 0.5 mL of acetonitrile and 0.5 mL of water, and irradiated with 365 nm ultraviolet light for 5 hours. The resin was filtered and freeze-dried by solvent dialysis to obtain 5 mg of compound 6. Step 6. Dissolve 0.25 mg of compound 6 in 800 μL of water, and subject the mixture to a ring-closing reaction with 100 μL of sodium acetate buffer (pH=5.0, 0.5 M), 2 μL of sodium chloride solution (0.25 M), 20 μL of disodium ethylenediaminetetraacetate solution (0.05 M), 10 μL of TCEP solution (0.05 M), and 30 μL of OaAEP3 (1.34 mg / mL). The mixture was reacted overnight at 37°C to obtain cyclic molecular compound 7. LCMS: 1436.11(M+H) + .

[0167] <Example 13: Application of the cyclic molecular compound library of the present invention to protac> [ka] [ka] [ka]

[0168] Synthesis method: Referring to the above synthesis process for synthesizing a DEL cyclic molecular library from a bifunctional resin, a POI is added to the compound library as a specific synthetic block to synthesize a DEL cyclic molecular library with specific functions and structures.

[0169] <Example 14: DEL cyclic molecular library using PROTAC technology: (Target protein substrate in side chain)> [ka] [ka] [ka]

[0170] Steps: Step 1. DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), and Fmoc-AA1-OH (100 mg, 5 eq) were stirred in 3 mL of N,N-dimethylformamide for 10 minutes. Then, 100 mg of the prepared resin was added, and the mixture was stirred at room temperature for 1 hour. The resin was washed with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), respectively, and drained. 5 mL of a 20% piperidine solution in N,N-dimethylformamide was added to the resin, stirred at room temperature for 1 hour, then washed with N,N-dimethylformamide (3 × 5 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), and drained to obtain 100 mg of resin. Step 2. The amino acids were sequentially linked according to the standard solid-phase synthesis method of Step 1 to obtain 85 mg of compound 8. Step 3. 85 mg of resin was stirred with 95% trifluoroacetic acid, 2.5% water, and 2.5% triisopropylsilane at room temperature for 2 hours. 3 mL of N,N-dimethylformamide solution containing 10% DIPEA was added to the resin and stirred at room temperature for 2 hours. The resin was washed with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), respectively, and drained. 50 mg of resin was added to 3 mL of NMP solution and irradiated with 365 nm ultraviolet light for 5 hours. The resin was filtered and freeze-dried by solvent dialysis to obtain 8 mg of compound 9. Step 4. Dissolve 0.6 mg of compound 9 in 800 μL of water, and subject the mixture to a ring-closing reaction with 100 μL of sodium acetate buffer (pH=5.0, 0.5 M), 2 μL of sodium chloride solution (0.25 M), 20 μL of disodium ethylenediaminetetraacetate solution (0.05 M), 10 μL of TCEP solution (0.05 M), and 30 μL of OaAEP3 (1.34 mg / mL). The mixture was reacted overnight at 37°C to obtain cyclic molecular compound 10. LCMS: 1740.04 (M+H) + .

[0171] <Example 15: DEL of a cyclic molecular library in PROTAC: (Target protein substrate within the ring)> [ka] [ka]

[0172] Step 1. DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), and Fmoc-AA1-OH (100 mg, 5 eq) were stirred in 3 mL of N,N-dimethylformamide for 10 minutes, then 100 mg of the prepared resin was added, and the mixture was stirred at room temperature for 1 hour. The resin was washed with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), respectively, and drained. 5 mL of a 20% piperidine solution in N,N-dimethylformamide was added to the resin, stirred at room temperature for 1 hour, then washed with N,N-dimethylformamide (3 × 5 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), and drained to obtain 100 mg of resin. Step 2. The amino acids were sequentially linked according to the standard solid-phase synthesis method of Step 1 to obtain 80 mg of compound 7. Step 3. 80 mg of resin was stirred with 95% trifluoroacetic acid, 2.5% water, and 2.5% triisopropylsilane at room temperature for 2 hours. 3 mL of N,N-dimethylformamide solution containing 10% DIPEA was added to the resin and stirred at room temperature for 2 hours. The resin was washed with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), respectively, and drained. 50 mg of resin was added to 3 mL of NMP solution and irradiated with 365 nm ultraviolet light for 5 hours. The resin was filtered and freeze-dried by solvent dialysis to obtain 8 mg of compound 8. Step 4. Dissolve 0.5 mg of compound 8 in 800 μL of water, and subject the mixture to a ring-closing reaction with 100 μL of sodium acetate buffer (pH=5.0, 0.5 M), 2 μL of sodium chloride solution (0.25 M), 20 μL of disodium ethylenediaminetetraacetate solution (0.05 M), 10 μL of TCEP solution (0.05 M), and 30 μL of OaAEP3 (1.34 mg / mL). The mixture was reacted overnight at 37°C to obtain cyclic molecular compound 9. LCMS: 1490.8 (M+H) + .

[0173] <Example 16: Verification of a biring-type ring-closing method> [ka]

[0174] Synthesis method: Step 1. DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), and Fmoc-NH-PEG3CH2COOH (55 mg, 5 eq) were stirred in 3 mL of N,N-dimethylformamide for 10 minutes. Then, 100 mg of the well-dissolved resin was added, and the mixture was stirred at room temperature for 1 hour. The resin was washed with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), N,N-dimethylformamide (3 × 5 mL), and H2O (3 × 3 mL), respectively, and drained to obtain 100 mg of resin. Step 2. Add 2 mL of 95% trifluoroacetic acid aqueous solution to the resin and stir at room temperature for 2 days. Then, wash the resin with H2O (3 × 3 mL), N,N-dimethylformamide (3 × 5 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), dry, wash again, and drain to obtain 100 mg of resin. Add a 50% DIPEA N,N-dimethylformamide solution to the resin and stir at room temperature for 1 hour. Then, wash with N,N-dimethylformamide (3 × 5 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), dry each to obtain 95 mg of resin. This resin was then processed according to standard solid-phase peptide synthesis procedures to obtain 92 mg of resin. Of this, DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), and Fmoc-protected amino acids (60 mg, 5 eq) were obtained. Step 3. 5 mL of a 50% trifluoroacetic acid-dichloromethane solution was added to the resin and stirred at room temperature for 1 hour. The resin was washed with N,N-dimethylformamide (3 × 5 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), respectively, and drained to obtain 87 mg of resin. PyBop (27 mg, 2 eq) and DIPEA (17 mg, 5 eq) were stirred in 3 mL of N,N-dimethylformamide for 1 minute, then added to the resin, and the mixture was stirred at room temperature for 1 hour. The resin was washed with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), and drained to obtain 85 mg of resin. In this reaction, the side chain of glutamic acid (E) in the synthesis block reacts with the side chain of methionine (K) in the synthesis block to form a ring structure. Step 4. 5 mL of a 20% piperidine N,N-dimethylformamide solution was added to 85 mg of resin and stirred at room temperature for 1 hour. The resin was washed with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), respectively, and drained to obtain 80 mg of resin. The 80 mg of resin was added to a mixed solution of 0.5 mL of acetonitrile and 0.5 mL of water, irradiated with 365 nm ultraviolet light for 5 hours, filtered, and freeze-dried by solvent dialysis to obtain 4 mg of compound 5. Step 5. Dissolve 0.25 mg of compound 6 in 800 μL of water, and subject the mixture to a ring-closing reaction with 100 μL of sodium acetate buffer (pH=5.0, 0.5 M), 2 μL of sodium chloride solution (0.25 M), 20 μL of disodium ethylenediaminetetraacetate solution (0.05 M), 10 μL of TCEP solution (0.05 M), and 30 μL of OaAEP3 (1.34 mg / mL). The mixture was reacted overnight at 37°C to obtain the bicyclic molecular compound 6. LCMS: 1172. (M+H) + That was the case.

[0175] From the above verification results, it can be seen that a library of bicyclic compounds can be constructed by the construction method of the present invention. Synthesis block E and synthesis block K each provide a cyclic outer chain, and the two cyclic outer chains are bonded by a chemical reaction to form a ring structure. The bicyclic ring structure of the library compound obtained in this embodiment is a bridging ring in which one or more synthesis blocks are shared between the two rings.

[0176] <Example 17: Verification test of ring closure of a biring structure> [ka] [ka] [ka]

[0177] Synthesis method: 1. PEGA resin (100 mg, 25 μmol) was dissolved in 3 ml of N,N-dimethylformamide for 2 hours. Following standard solid-phase peptide synthesis procedures, it was first spliced ​​with the ring-closed A-terminus molecule (LFNL tetrapeptide), followed by splicing with Fmoc-O-tert-butyl-1-glutamic acid (i.e., trifunctional linker L1') to obtain 95 mg of resin (compound 2). 2. The 95 mg resin obtained in the previous step was stirred with 95% TFA, 2.5% H2O, and 2.5% triisopropylsilane at room temperature for 2 hours. A 10% DIPEA solution of N,N-dimethylformamide (3 mL) was added to the resin and stirred at room temperature for 2 hours. The resin was washed with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), respectively, and drained. 3 mL of N,N-dimethylformamide containing DIC (32 mg, 10 eq), HOBt (35 mg, 10 eq), and Boc-Lys-OAll (76 mg, 10 eq, i.e., trifunctional linker L1'') was added to the resin with stirring for 1 minute, and the mixture was allowed to react for 1 hour to splice the trifunctional linker L1' and synthesize the tetrafunctional linker L1. The resin was washed with N,N-dimethylformamide (3 × 2 mL), dichloromethane (3 × 2 mL), and N,N-dimethylformamide (3 × 2 mL), respectively, and drained to obtain 85 mg of resin (compound 3). 3. 85 mg of resin, palladium tetrakis (3 mg, 0.2 eq), and phenylsilane (60.12 mg, 20 eq) were stirred in 5 mL of dichloromethane under nitrogen protection at room temperature for 1 hour. The resin was washed with dichloromethane (3 × 3 mL) and N,N-dimethylformamide (3 × 3 mL), respectively, and drained to obtain 80 mg of resin (compound 4). 4. This allyl ester-protected amino acid was subjected to standard solid-phase peptide synthesis to obtain 70 mg of resin (Compound 5). 5. 70 mg of resin was mixed with 95% TFA, 2.5% H2O, and 2.5% triisopropylsilane, and stirred at room temperature for 2 hours. 3 mL of N,N-dimethylformamide solution containing 10% DIPEA was added to the resin, and stirred at room temperature for 2 hours. The resins were washed with N,N-dimethylformamide (3 × 3 mL) and drained. The tert-butyloxycarbonyl protected amino acids were subjected to standard solid-phase peptide synthesis procedures to obtain 60 mg of resin (compound 6). 6. 5 mL of a 20% piperidine N,N-dimethylformamide solution was added to 60 mg of resin and stirred at room temperature for 1 hour. The resin was washed with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), respectively, and drained to obtain 55 mg of resin (compound 7) according to the standard solid-phase peptide synthesis of Fmoc-protected amino acids. 7. This resin was deprotected sequentially from allyl, tert-butoxycarbonyl, and 9-fluorenylmethoxycarbonyl according to the deprotection method described above to obtain 45 mg of resin (compound 8). 8. 45 mg of resin was added to 1 ml of NMP solution and irradiated with 365 nm ultraviolet light for 5 hours. The resin was filtered and freeze-dried by solvent dialysis to obtain 5 mg of compound 9. 9. Peptide compound 9 in 20% DMSO, 100 μM, and 20 μM PagG were added to 10 mM, pH=7.0 MES buffer. The mixture was reacted at 25°C for 16 hours. The reaction was quenched by steaming for 5 minutes, and the mixture was freeze-dried to obtain compound 10. 10. Compound 10 was dissolved in 800 μL of water, and the mixture was subjected to a ring-closing reaction with 100 μL of sodium acetate buffer (pH=5.0, 0.5 M), 2 μL of sodium chloride solution (0.25 M), 20 μL of disodium ethylenediaminetetraacetate solution (0.05 M), 10 μL of TCEP solution (0.05 M), and 30 μL of OaAEP3 (1.34 mg / mL). The mixture was reacted overnight at 37°C to simultaneously cyclize the two rings and obtain bicyclic molecular compound 6. LCMS: 1746.1 (M+H) + .

[0178] From the above verification results, it can be seen that the construction method of the present invention can construct a bicyclic compound library and is particularly applicable to the screening of bicyclic peptide molecules. Bicyclic or polycyclic structures stabilize the conformation of macrocyclic molecules, increase the rigidity of the cyclic structure, improve the stability of cyclic peptide molecules, extend the half-life of cyclic peptide drugs, and have better application prospects.

[0179] <Example 18: Verification test of ring closure> [ka]

[0180] 0.25 mg of peptide was dissolved in 800 μl of water, and the peptide was subjected to a ring-closing reaction with 100 μl of sodium acetate buffer (pH=5.0, 0.5 M), 2 μl of sodium chloride solution (0.25 M), 20 μl of disodium ethylenediaminetetraacetate solution (0.05 M), 10 μl of TCEP solution (0.05 M), and 60 μl of OaAEP3 (1.34 mg / mL). The mixture was reacted overnight at 37°C to obtain the product. The molecular weight of the product was confirmed to be 554(M+H)+ by LC-MS, and it was ring-closable.

[0181] <Example 19: Verification test of ring closure> [ka]

[0182] Dissolve 0.5 mg of peptide in 800 μl of water, then add 100 μl of sodium acetate buffer (pH=5.0, 0.5 M), 2 μl of sodium chloride solution (0.25 M), 20 μl of disodium ethylenediaminetetraacetate solution (0.05 M), 10 μl of TCEP solution (0.05 M), and 60 μl of OaAEP3 (1.34 mg / mL). React the mixture overnight at 37°C. The molecular weight of the product was 1306.5 (M+H) by LC-MS. + This was confirmed, and it was possible to close the ring.

[0183] <Example 20: Verification test of ring closure> [ka]

[0184] 0.5 mg of peptide was dissolved in 800 μl of water. 100 μl of sodium acetate buffer (pH=5.0, 0.5 M), 2 μl of sodium chloride solution (0.25 M), 20 μl of disodium ethylenediaminetetraacetate solution (0.05 M), 10 μl of TCEP solution (0.05 M), and 60 μl of OaAEP3 (1.34 mg / mL) were added. The mixture was reacted overnight at 37°C to obtain the product. LC-MS: 984.98 (M+H) + .

[0185] <Example 21: Verification test of ring closure> [ka]

[0186] 0.5 mg of peptide was dissolved in 800 μl of water. 100 μl of sodium acetate buffer (pH=5.0, 0.5 M), 2 μl of sodium chloride solution (0.25 M), 20 μl of disodium ethylenediaminetetraacetate solution (0.05 M), 10 μl of TCEP solution (0.05 M), and 60 μl of OaAEP3 (1.34 mg / mL) were added. The mixture was reacted overnight at 37°C to obtain the product. LC-MS: 984.71 (M+H) + .

[0187] <Example 22: Verification of a ring-closing method for aromatic rings contained within cyclic molecules> [ka]

[0188] Step 1. Stir DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), and Fmoc-benzylaminobenzoic acid (40 mg, 5 eq) in N,N-dimethylformamide (3 mL) for 10 minutes. Then add 100 mg of the well-swollen resin and stir the mixture at room temperature for 1 hour. Wash the resin with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), drain, and obtain 100 mg of resin. Step 2. Add 5 mL of 20% piperidine N,N-dimethylformamide solution to the resin and stir at room temperature for 1 hour. Wash the resin with N,N-dimethylformamide (3 × 5 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), dry it, drain the water, and obtain 100 mg of resin. Refer to the condensation procedure in Step 1 and obtain 95 mg of resin using DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), and Fmoc-Gly-Leu-OH (52 mg, 5 eq). Step 3. Using 5 mL of a 20% piperidine N,N-dimethylformamide solution, 85 mg of resin was obtained, following the Fmoc removal procedure in Step 2. 85 mg of resin was added to a mixed solution of 0.5 mL of acetonitrile and 0.5 mL of water, and irradiated with 365 nm ultraviolet light for 5 hours. The resin was then filtered, and the solvent was freeze-dried to obtain 5 mg of compound 4. Step 4. Dissolve 0.25 mg of compound 5 in 800 μl of water, add 100 μl of sodium acetate buffer (pH=5.0, 0.5 M), 2 μl of sodium chloride solution (0.25 M), 20 μl of disodium ethylenediaminetetraacetate solution (0.05 M), 10 μl of TCEP solution (0.05 M), and 30 μl of OaAEP3 (1.34 mg / mL), respectively, and react the mixture overnight at 37°C to obtain cyclic peptide compound 5. LCMS: 962.53 (M+H) + .

[0189] <Example 23: Verification of a ring-closing method for aromatic rings contained within cyclic molecules> [ka]

[0190] Step 1. DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), and 4-(((((9H-fluoren-9-yl)methoxy)carbonyl)amino)methyl 2-(((allyloxy)carbonyl)amino)benzoic acid (45 mg, 5 eq) were stirred in 3 mL of N,N-dimethylformamide for 10 minutes, and then 100 mg of well-swollen resin was added. Washed with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dichloromethane (3 × 5 mL), and drained to obtain 100 mg of resin. Step 2. Add 5 mL of a 20% piperidine solution to the resin and stir at room temperature for 1 hour. Then wash with N,N-dimethylformamide (3 × 5 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), dry, and obtain 100 mg of resin. Referring to the condensation procedure in Step 1, DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), and Fmoc-Gly-Leu-OH (52 mg, 5 eq) were obtained as 95 mg of resin. Step 3. 5 mL of a 20% N,N-dimethylformamide solution of piperidine is subjected to the de-Fmoc procedure in Step 2 to obtain 85 mg of resin. 85 mg of resin is added to a mixture of 0.5 mL of acetonitrile and 0.5 mL of water, irradiated with 365 nm ultraviolet light for 5 hours, the resin is filtered, and the solvent is freeze-dried to obtain 5 mg of compound 4. Step 4. Dissolve 0.25 mg of compound 5 in 800 μl of water, add 100 μl of sodium acetate buffer (pH=5.0, 0.5 M), 2 μl of sodium chloride solution (0.25 M), 20 μl of disodium ethylenediaminetetraacetate solution (0.05 M), 10 μl of TCEP solution (0.05 M), and 30 μl of OaAEP3 (1.34 mg / mL), respectively, and react the mixture overnight at 37°C to obtain cyclic compound 5. LCMS: 1061.56 (M+H) + .

[0191] <Example 24: Compound library with improved membrane permeability and its construction> [ka] [ka] [ka]

[0192] 1. Following a standard solid-phase synthesis procedure based on the synthesis method described above, 100 mg of PEGA resin 1 was obtained as 95 mg of resin. Product 2 has a molecular structure containing two proline constituent molecular fragments. 2. 90 mg of resin was obtained by a standard Fmoc deprotection and amino acid condensation method, based on solid-phase synthesis. 3. 90 mg of resin was added to 5 ml of 95% trifluoroacetic acid aqueous solution and reacted at room temperature for 2 hours. The resin was washed with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), drained, and the resulting resin was added to 5 mL of N,N-dimethylformamide solution containing 20% ​​DIEA and stirred at room temperature for 2 hours. The resin was washed with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), drained, and 85 mg of resin was obtained. 4. Dissolve DIC (16 mg, 5 eq) and NHS (15 mg, 5 eq) in N,N-dimethylformamide (5 mL), add to 85 mg of resin, and react at room temperature for 2 hours. Wash the resin with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), and drain. Dissolve the resin in 2 mL of pH 8.0 HEPES (100 mM) buffer, add HDNA (100 nmol, lm M), and react overnight at room temperature to obtain 80 mg of resin. Add 5 mL of 20% piperidine N,N-dimethylformamide solution to the resin, stir at room temperature for 1 hour, then wash the resin with N,N-dimethylformamide (3 × 5 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), drain, and obtain 75 mg of resin. 5. To 75 mg of resin, 2095 μL of water, 250 μL of 10×T4 DNA ligase buffer, 25 μL of T4 DNA ligase (10000 U / μL), and 58 μL of OP (AAATCGATGTG) (100 nm, 1.74 nm / μL) were added and reacted overnight at room temperature. After that, the resin was washed with water (3×5 mL) and T4 DNA ligase buffer (3×3 mL), drained, and 75 mg of resin was obtained. 75 mg of resin was mixed with 2095 μL of water, 250 μL of 10×T4 DNA ligase buffer, and 25 μL of T4 DNA ligase (10000 U / μL). The mixture was divided into 96 wells, and DNA tags (1.35 nm, 1 nm / μ) were added to each well. The mixture was allowed to react overnight at room temperature. The resin was then washed with T4 DNA ligase buffer (3×3 mL), water (3×3 mL), and N,N-dimethylformamide (3×3 mL), and drained. DIC (16 mg, 5 eq) and HOBt (17 mg, 5 eq) were dissolved in N,N-dimethylformamide (5 mL), and the mixture was divided into 96 wells. Fmoc-N-methylamino acid (5 eq) was added to the resin in each well, and the mixture was stirred at room temperature for 1 hour. The resin was washed and drained with N,N-dimethylformamide (3×3 mL), dichloromethane (3×3 mL), N,N-dimethylformamide (3×3 mL), and N,N-dimethylformamide (3×5 mL). 5 mL of 20% piperidine N,N-dimethylformamide solution was added to the resin and stirred at room temperature for 1 hour. The resin was washed and drained with N,N-dimethylformamide (3×3 mL), dichloromethane (3×3 mL), and N,N-dimethylformamide (3×5 mL) to obtain 70 mg of resin. The condensation reaction and DNA binding reaction were repeated a total of four times. Fmoc amino acids were picked up in the second round, and Fmoc-N-methyl amino acids were picked up in the first, third, and fourth rounds. After amino acid pick-up and DNA labeling in the fourth round, the resin was combined to obtain 65 mg of resin. 6. DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), and Fmoc-Gly-Leu-OH (51 mg, 5 eq) were stirred in N,N-dimethylformamide (5 mL) for 2 minutes, then 65 mg of resin was added, and the mixture was stirred at room temperature for 2 hours. The resin was washed and dried with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 3 mL), respectively. 5 mL of N,N-dimethylformamide solution containing 20% ​​piperidine was added to the resin, and the resin was stirred at room temperature for 1 hour. The resin was washed and dried with N,N-dimethylformamide (3 × 3 mL) and water (3 × 5 mL), respectively, to obtain 60 mg of resin. 7. 60 mg of resin was mixed with 2095 μL of water, 250 μL of 10×T4 DNA ligase buffer, 25 μL of T4 DNA ligase (10000 U / μL), and 57 μL of CP (100 nm, 1.74 nm / μL). The mixture was allowed to react overnight at room temperature. After that, the resin was washed with T4 DNA ligase buffer (3 × 3 mL) and water (3 × 5 mL), and drained. 8. 60 mg of resin was mixed with 1 mL of N-methylpyrrolidone, irradiated with 365 nm ultraviolet light for 5 hours, filtered, and freeze-dried by solvent dialysis to obtain 5 mg of compound 9. 9. 5 mg of compound 16 was dissolved in 800 μL of water, and 100 μL of sodium acetate buffer (pH=5.0, 0.5 M), 2 μL of aqueous sodium chloride solution (0.25 M), 20 μL of aqueous disodium ethylenediaminetetraacetate solution (0.05 M), 10 μL of TCEP solution (0.05 M), and 60 μL of OaAEP3 (1.34 mg / mL) were added. The mixture was reacted overnight at 37°C to carry out the ring-closing reaction, and 3 mg of product 10 was obtained after preparation.

[0193] <Example 25: Compound library with improved membrane permeability and its construction> [ka] [ka]

[0194] Synthesis method: 1. WDIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), and Fmoc-Glu (O t Bu)-OH (100 mg, 5 eq) was stirred in N,N-dimethylformamide (3 mL) for 10 minutes, then 100 mg of the prepared resin was added and stirred at room temperature for 1 hour. 5 mL of a 20% piperidine solution in N,N-dimethylformamide was added to the resin and stirred at room temperature for 1 hour. The mixture was then washed with N,N-dimethylformamide (3 × 5 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), drained, and 95 mg of resin was obtained. 2. By sequentially adding amino acids according to the standard solid-phase synthesis procedure of Step 1, 80 mg of resin 7 was obtained. 3. 80 mg of this resin was added to 2 ml of NMP solution and irradiated with 365 nm ultraviolet light for 5 hours. The resin was filtered and freeze-dried by solvent dialysis to obtain 10 mg of compound 8. 4. Dissolve 0.5 mg of compound 8 in 800 μL of water, add 100 μL of sodium acetate buffer (pH=5.0, 0.5 M), 2 μL of sodium chloride solution (0.25 M), 20 μL of disodium ethylenediaminetetraacetate solution (0.05 M), 10 μL of TCEP solution (0.05 M), and 30 μL of OaAEP3 (1.34 mg / mL), and react overnight at 37°C to obtain cyclic peptide compound 9. LCMS: 1238.70 (M+H) + .

[0195] Compounds 10, 11, and 12 were synthesized according to the method of the above examples. The structures of the compounds according to the LC-MS validation table are as follows:

[0196] [Table 1]

[0197] <Example 26: Evaluation of membrane permeability> For the cyclic peptide compounds 9-12 obtained in the above examples, an MDCK model was established to measure their membrane permeability. The MDCK cell line is derived from the Martins D'Arby canine epithelial cell line, and the MDCK cell monolayer is the most suitable cytological model for investigating the process of drug absorption and reabsorption in the renal tubules in vivo. The MDCK cells were digested and dispersed in a culture flask, and 5 × 10⁶ cells were added to Millicell CPI. 4 cells / cm 2 The cells were inoculated, and 400 μL of MEM culture medium containing 10% FBS was added to side A (luminal side, apical side) and 800 μL to side B (basal side). The cells were then cultured at 37°C in an incubator containing 5% CO2. The culture medium was changed daily, and care was taken to avoid contact between the pipette gun and the cell membrane to prevent damage to the cell layer. To detect the integrity of the cell monolayer, the transepithelial electrical resistance (TEER) was measured periodically using Millicell2ERS.

[0198] A→B translocation from the apical (A) to the basolateral (B) end of an MDCK cell monolayer membrane. In the A→B assay, 450 μL of drug or positive control HEPES solution was added to the apical end of the membrane as the supply pool, and 1300 μL of blank HEPES solution was added to the basolateral end as the recipient pool. The Transwell plate was placed on a 37°C incubator and shaken. After 90 minutes, the supply and recipient cell sample solutions were removed, and proteins were precipitated by adding ethyl i-wet. After vortexing, the solution was centrifuged and transferred, and the permeability was measured by LC / MS. The membrane permeability coefficient (Papp) was calculated based on this permeability. Papp (Apparent permeability) is a specific evaluation parameter, and is 1 × 10⁻⁶ -6 If the rate is 10 cm / s or higher, more than 60% of the drug can be absorbed. -6 If the current is above cm / s, more than 80% of drug molecules can be absorbed.

[0199] [Table 2]

[0200] From the data above, the Papp value of the synthesized compound is 10 -6 That concludes the explanation. The Papp values ​​for compound 9 and compound 11 are 10 × 10 -6 In summary, it can be seen that it exhibits superior cell permeability.

[0201] <Example 27: Verification test of ring closure of synthetic cut blocks present in cyclic molecules linked by ether bonds> [ka]

[0202] 1. D1C (16 mg, 5 eq), HOBt (17 mg, 5 eq), and FmocNHPEG4CH2CH2COOH (104 mg, 5 eq) were stirred in N,N-dimethylformamide (3 mL) for 10 minutes. Then, 100 mg of the well-dissolved resin was added, and the mixture was stirred at room temperature for 1 hour. The resin was washed with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), respectively, and drained. 5 mL of a 20% piperidine solution in N,N-dimethylformamide was added to the resin, and after stirring at room temperature for 1 hour, it was washed with N,N-dimethylformamide (3 × 5 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), drained, and 95 mg of resin was obtained. 2. DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), and Fmoc-p-benzylamine benzoic acid (40 mg, 5 eq) were stirred in 3 mL of N,N-dimethylformamide for 10 minutes. Next, 95 mg of the well-dissolved resin was added, and the mixture was stirred at room temperature for 1 hour. The resin was washed with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), respectively, and drained. 5 mL of a 20% piperidine solution in N,N-dimethylformamide was added to the resin, and the mixture was stirred at room temperature for 1 hour. The resin was washed with N,N-dimethylformamide (3 × 5 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), respectively, and drained to obtain 90 mg of resin. 3. DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), and Fmoc-Gly-Leu-OH (52 mg, 5 eq) were used. Refer to the condensation procedure in Step 1. Next, 5 mL of a 20% piperidine solution in N,N-dimethylformamide was added to the resin and stirred at room temperature for 1 hour. The resin was washed with N,N-dimethylformamide (3 × 5 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), drained, and 80 mg of resin was obtained. 4. 80 mg of resin was added to a mixture of 0.5 ml of acetonitrile and 0.5 ml of water, irradiated with 365 nm ultraviolet light for 5 hours, filtered, and 5 mg of compound 5 was obtained by freeze-drying the solvent. 5. Dissolve 0.25 mg of compound 5 in 800 μL of water, add 100 μL of sodium acetate buffer (pH=5.0, 0.5 M), 2 μL of sodium chloride solution (0.25 M), 20 μL of disodium ethylenediaminetetraacetate solution (0.05 M), 10 μL of TCEP solution (0.05 M), and 30 μL of OaAEP3 (1.34 mg / mL), and react overnight at 37°C to obtain cyclic peptide compound 6. LCMS: 1210.92 (M+H) + .

[0203] <Example 28: Verification of cleavage and acid cleavage in the presence of L0> [ka]

[0204] Synthesis method: 1. DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), and 3-((((9H-fluoren-9-yl)methoxy)carbonyl)amino)-3-(2-nitrophenyl)propanoic acid (54 mg, 5 eq) were stirred in DMF (3 mL) for 10 minutes, then 100 mg of well-dissolved resin was added, and the mixture was stirred at room temperature for 1 hour. The mixture was washed with DMF (3 × 3 mL), DCM (3 × 3 mL), and DMF (3 × 5 mL), respectively, and drained. 5 mL of 20% piperidine DMF solution was added to the resin, and the mixture was stirred at room temperature for 1 hour. The resin was washed with DMF (3 × 5 mL), DCM (3 × 3 mL), and DMF (3 × 5 mL), and drained to obtain 95 mg of resin. 2. Using DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), and Fmoc-Glu-OAll (52 mg, 5 eq), 92 mg of resin was obtained, referring to the condensation and de-Fmoc procedure in Step 1. 3. Using DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), and 2-(4-(((((((9H-fluoren-9-yl)methoxy)carbonyl)amino)(3,5-dimethoxyphenyl)methyl)phenoxy)acetic acid (68 mg, 5 eq), 90 mg of resin was obtained, referring to the condensation and Fmoc removal procedure in Step 1. 4. Using DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), and Fmoc-Glu-OAll (52 mg, 5 eq), 90 mg of resin was obtained, referring to the condensation procedure in Step 1. 5. Add 2 mL of 50% trifluoroacetic acid in dichloromethane solution to the resin and stir at room temperature for 1 hour. Wash the resin with DCM (3 × 3 mL), and spin-dry the filtrate to obtain 4 mg of compound 6. LCMS: 409.12(M+H) + .

[0205] The segment cut was verified as follows: [ka]

[0206] Synthesis method: 1. 100 mg of resin was added to a mixture of 0.5 ml of acetonitrile and 0.5 ml of water, irradiated with 365 nm ultraviolet light for 2 hours, filtered, and lyophilized to obtain 4 mg of compound 5. LC-MS: 877.96 (M+H) + .

[0207] <Example 29: Verification of DNA primer stability during multiple rounds of extension steps> The synthetic blocks are sequentially spliced ​​to form extended chains according to the extension steps described in this specification, and the DNA tags corresponding to the synthetic blocks are sequentially spliced ​​to form extended chains. Multiple rounds of synthesis were performed according to the resin synthesis method and library construction method described in the preceding paragraph of this application. The library compounds synthesized in rounds 4, 5, and 7 were subjected to PCR, and the PCR products were detected by agarose gel electrophoresis.

[0208] Here, PCR was performed using four rounds of DNA-containing resin-based primers (TGACTCCCAAATCGATGTG,GCAGGTGAAGCTTGTCTGACAATAGGCTAAA), 2×taq master mix, and distilled water. The obtained PCR products were detected by agarose gel electrophoresis (PCR product band size: 85 bp).

[0209] PCR was performed using primers synthesized from 5 rounds of DNA-containing resin (TGACTCCCAAATCGATGTG,GCAGGTGAAGCTTGTCTGACAATAGGCTATC), 2× taq master mix, and distilled water. The obtained PCR products were detected by agarose gel electrophoresis (PCR product band size: 94 bp).

[0210] PCR was performed using primers synthesized from 7 rounds of DNA-containing resin (TGACTCCCAAATCGATGTG,GCAGGTGAAGCTTGTCTGACAATAGGCTATC), 2× taq master mix, and distilled water. The obtained PCR products were detected by agarose gel electrophoresis (PCR product band size: 94 bp).

[0211] The detection results by agarose gel electrophoresis are shown in Figures 1-3. Figures 1-3 show that the purity of PCR in synthesis rounds 4, 5, and 7 is high, which indicates that the mild reaction conditions in the synthesis method of the present invention, particularly the ring-closing reaction conditions, contribute to maintaining the stability of the DNA molecule, and therefore the stability and accuracy of the screening results of the compound library constructed in the present invention are better.

[0212] <Example 30> Following the method described in Example 5, four rounds of synthesis were performed to obtain a corresponding monocyclic compound library (approximately 100 million units).

[0213] <Example 31: Screening of compounds targeting the KRAS protein using a synthesized DEL library> Experimental Objective: Screening of target compounds targeting KRAS from the Example 30 compound library. Experimental steps: 1. Incubation of compound libraries and target proteins PBST, 0.25 mg / mL of KRAS (dissolved in PBS), Yeast tRNA, 10.2 mg / mL of DEL compound library, and 0.1 mg / mL of BSA were added to PCR tubes in the following volumes and incubated at room temperature for 60 minutes; PBST, PBS, Yeast tRNA, a 10.2 mg / mL DEL compound library, and 0.1 mg / mL BSA were added to PCR tubes according to the volumes shown in Table 1, and the BSA groups were incubated at room temperature for 60 minutes.

[0214] [Table 3]

[0215] 2. Beads pretreatment for the experimental group and the BSA group. Place 160 μL of Beads into a PCR tube, place the tube in a magnetic rack, wait until the Beads adhere to the tube wall, and discard the supernatant; remove the PCR tube, add 160 μL of PBST to resuspend the Beads, place it in a magnetic rack, and discard the supernatant; repeat the above steps three times; leave the Beads resuspended in 160 μL of PBST at 4°C as a reserve.

[0216] 3. Capture / Release 20 μL of pre-treated beads were added and incubated at room temperature for 30 minutes. The incubation system was placed in a magnetic rack and the supernatant was discarded; the PCR tube was removed, 20 μL was resuspended in 100 μL of PBST, placed in the magnetic rack, and the supernatant was discarded; this procedure was repeated 5 times. 20 μL was resuspended in 40 μL of PBST, transferred to a new PCR tube, and placed in a water bath at 72°C for 5 minutes. The PCR tube was placed in a magnetic rack and the supernatant was transferred to a new PCR tube; 10 μL of pre-treated beads were added to the supernatant and incubated at room temperature for 10 minutes; the supernatant was used for subsequent screening.

[0217] 4. Conduct a 2 / 3 round screening. Round 2: Add the appropriate reagents to the supernatant obtained in Step 3 according to Table 2, note that PBS should be added to the BSA group and the target protein to the experimental group; incubate at room temperature for 30 minutes and repeat Step 3.

[0218] [Table 4]

[0219] Round 3: Step 3 was repeated, the samples were placed in a magnetic rack, and the supernatant (approximately 40 μL) was used for subsequent PCR analysis.

[0220] 5. Use PCR (Bio-Rad T100 PCR instrument) / NGS. A PCR 50uL system was used, following the conditions in Table 3:

[0221] [Table 5]

[0222] Figure 4 shows the results of analyzing a 4% agarose gel after applying 10 μL of PCR sample to the gel.

[0223] <Example 32: NGS analysis of PCR samples> The NGS analysis of the PCR sample described in Example 31 was performed as follows. 1. Library Construction: Library construction was performed using a kit. The specific procedure is as follows: Library construction was performed directly using more than 50 ng of PCR-purified product (stock solution needs to be gel-cut or purified with magnetic beads). End repair (including phosphorylation of the 5' end and A' addition of the 3' end) was performed using End Prep Enzyme Mix, and adapters were added to both ends. Subsequently, the fragments were purified using DNA Clean Beads, and finally amplified using P5 and P7 primers. Library quality was examined using a Qseq 100 Bioanalyzer (Bioptic, Taiwan, China), and library concentration was examined using Qubit3.0. 2. Sequencing: The DNA library was mixed, and sequencing information was read according to Illumina Novaseq (Illumina, San Diego, CA, USA) using NovaSeq Control Software (NCS) + OLB + GAPipeline-1.6, which is included with NovaSeq. 3. Data Analysis - Sequencing Data Quality Analysis: Raw data from downstream instruments was subjected to preliminary statistical analysis. Next, the raw data was optimized using Cutadapt[l] (version 1.9.1) software to remove primer and junction sequences, bases with quality values ​​less than 20 at both ends, and sequences with an N base ratio greater than 10%, and the clean data after QC was statistically analyzed. Qean reads were merged using Pandaseq[2] (version 2.7) based on the overlap region of Read1 and Read2 to create a complete sequence, and the length distribution of the merged sequence was statistically analyzed.

[0224] Data splitting: The data was split according to the barcode sequence, and the splitting results were statistically analyzed.

[0225] Tag Sequence Abundance Statistics: Tag sequences were obtained by anchoring them according to the constant region sequences upstream and downstream of the tag sequence. The tag sequences were divided into sequence units corresponding to different building blocks, and each sequence unit was analyzed to determine whether it belonged to a collection of DNA sequences corresponding to the building block. If it did, the sequence was extracted, and abundance statistics were performed.

[0226] As can be seen from the attached Figure 5, there was a significant difference in abundance values, and sequences with a higher number of repeats were selected for subsequent validation.

[0227] <Example 33: SPR analysis of screened compounds> 1. Protein fixation: An NTA microarray was used to immobilize the protein. Before immobilization, the microarray was activated by regenerating it with 0.5 M EDTA (pH 8.0) and 100 mM NaOH for 120 seconds each. The KRAS protein was diluted to 5 μg / mL in analysis buffer, and the flow rate was set to 10 μL / min. The KRAS protein was captured by injecting the sample into the test channel for 360 seconds, and the test channel was washed with PBS buffer for 90 seconds until the protein capture was stable.

[0228] 2. Sample test conditions: A PBS buffer pH 7.4 containing 0.05% Tween-20 and 5% DMSO was used as the running buffer. This running buffer was used as the control sample, and sequential concentrations were set (0.1953 μM, 0.3906 μM, 0.7812 μM, 1.5625 μM, 3.125 μM, 6.25 μM, 12.5 μM, 25 μM, 50 μM, 100 μM). The flow rate was 30 μL / min, the binding time was 90 seconds, and the dissociation time was 300 seconds. In addition, eight gradient concentrations of DMSO-containing buffer were prepared for solvent correction.

[0229] 3. Parameter fitting: The experiment involved plotting the response signal on the x-axis with analysis time and the y-axis with the response value, and was performed over multiple cycles. After solvent correction, the obtained data were subjected to a two-parameter deduction and fitted using BIAcore T200 analysis software. The fitted model used a 1:1 Langmuir binding model to determine the binding-dissociation constant and other affinity indices. The dissociation constant indices are shown in Table 4.

[0230] [Table 6]

[0231] Conclusion: The graph of the test results is shown in Figure 6. From the data in the table, it was found that the compounds screened from the library had a certain binding ability to the target protein, proving that the target compounds were captured.

[0232] <Example 34: Screening of compounds targeting the DLL3 protein using a synthesized DEL library> Experimental Objective: Screening of target compounds targeting KRAS from the Example 30 compound library. Experimental steps: 1. Incubation of compound libraries and target proteins PBST, 40.2 mg / mL of DLL3 (dissolved in PBS), Yeast tRNA, 10.2 mg / mL of DEL compound library, and 0.1 mg / mL of BSA were added to PCR tubes in the volumes corresponding to Table 1, and incubated at room temperature for 60 minutes. PBST, PBS, Yeast tRNA, 10.2 mg / mL of DEL Compound Library, and 0.1 mg / mL of BSA were added to PCR tubes in the volumes corresponding to Table 1, and incubated as a BSA group at room temperature for 60 minutes.

[0233] [Table 7]

[0234] 2. Beads pretreatment for the experimental group and the BSA group. Place 160 μL of Beads into a PCR tube, place the tube in a magnetic rack, wait until the Beads adhere to the tube wall, and discard the supernatant; remove the PCR tube, add 160 μL of PBST to resuspend the Beads, place it in a magnetic rack, and discard the supernatant; repeat the above steps three times; leave the Beads resuspended in 160 μL of PBST at 4°C as a reserve.

[0235] 3. Capture / Release 20 μL of pre-treated beads were added and incubated at room temperature for 30 minutes. The incubation system was placed in a magnetic rack and the supernatant was discarded; the PCR tube was removed, 20 μL was resuspended in 100 μL of PBST, placed in the magnetic rack, and the supernatant was discarded; this procedure was repeated 5 times. 20 μL was resuspended in 40 μL of PBST, transferred to a new PCR tube, and placed in a water bath at 72°C for 5 minutes. The PCR tube was placed in a magnetic rack and the supernatant was transferred to a new PCR tube; 10 μL of pre-treated beads were added to the supernatant and incubated at room temperature for 10 minutes; the supernatant was used for subsequent screening.

[0236] 4. Conduct a 2 / 3 round screening. Round 2: Add the appropriate reagents to the supernatant obtained in Step 3 according to Table 2, note that PBS should be added to the BSA group and the target protein to the experimental group; incubate at room temperature for 30 minutes and repeat Step 3;

[0237] [Table 8]

[0238] Round 3: Step 3 was repeated, the sample was placed in a magnetic rack, and the supernatant (≒40uL) was used for subsequent PC analysis.

[0239] 5. PCR (Bio-Rad T100 PCR instrument) / NGS A PCR 50uL system was used, following the conditions in Table 3.

[0240] [Table 9]

[0241] A 4% agarose gel was prepared, and 10 μL of PCR sample was added to the gel for analysis. The results are shown in Figure 7. Conclusion: After three rounds of screening and enrichment, a 500 nM DLL3 protein can be screened for interacting fragments from a 2.5 nM DEL library.

[0242] <Example 35: NGS analysis of PCR samples> The NGS analysis of the PCR sample described in Example 34 was performed as follows: 1. Library Construction: Library construction was performed using a kit. The specific procedure is as follows: Library construction was performed directly using more than 50 ng of PCR-purified product (stock solution needs to be gel-cut or purified with magnetic beads). End repair (including phosphorylation of the 5' end and A' addition of the 3' end) was performed using End Prep Enzyme Mix, and adapters were added to both ends. Subsequently, the fragments were purified using DNA Clean Beads, and finally amplified using P5 and P7 primers. Library quality was examined using a Qseq 100 Bioanalyzer (Bioptic, Taiwan, China), and library concentration was examined using Qubit3.0.

[0243] 2. Sequencing: The DNA library was mixed, and sequencing information was read according to Illumina Novaseq (Illumina, San Diego, CA, USA) using NovaSeq Control Software (NCS) + OLB + GAPipeline-1.6, which is included with NovaSeq.

[0244] 3. Data Analysis - Sequencing Data Quality Analysis: Raw data from downstream instruments was subjected to preliminary statistical analysis. Next, the raw data was optimized using Cutadapt[l] (version 1.9.1) software to remove primer and junction sequences, bases with quality values ​​less than 20 at both ends, and sequences with an N base ratio greater than 10%, and the clean data after QC was statistically analyzed. Qean reads were merged using Pandaseq[2] (version 2.7) based on the overlap region of Read1 and Read2 to create a complete sequence, and the length distribution of the merged sequence was statistically analyzed.

[0245] Data splitting: The data was split according to the barcode sequence, and the splitting results were statistically analyzed.

[0246] Tag Sequence Abundance Statistics: Tag sequences were obtained by anchoring them according to the constant region sequences upstream and downstream of the tag sequence. The tag sequences were divided into sequence units corresponding to different Building Blocks, and each sequence unit was analyzed to determine whether it belonged to a collection of DNA sequences corresponding to the Building Block. If it did, the sequence was extracted, and abundance statistics were performed. As can be seen from the attached Figure 8, there was a significant difference in abundance values, and sequences with a high number of repeats were selected for subsequent validation.

[0247] <Example 36: FACS analysis of screened compounds> The compounds obtained in Example 35 were incubated with DLL3-overexpressing CT-26 cells labeled with FITC, and then subjected to flow cytometry analysis, yielding the following results: 1. Digest CT-26 cells and 25 cm 3 Resuspend from the culture flask, count, and transfer 1 × 10⁶ units to a 96-well plate. 5 Planted one per well; 2. The compounds were added to the culture medium at different concentrations, thoroughly mixed, and added to a 96-well plate, then incubated in a 37°C incubator for 6 hours. 3. Centrifuge the 96-well plate at 1000 rpm for 5 minutes and discard the supernatant. Digest 100 μL / well of 0.25% trypsin for 2 minutes, centrifuge, and discard the supernatant. Resuspend the cells in PBS + 2% FBS, 200 μL / well. 4. The cells were analyzed by flow cytometry, and the green fluorescence channel was selected. The specific results are shown in Figure 9.

[0248] Conclusion: The data in attached Figure 9 (from top to bottom: DMSO, 2.5uM compound, 5uM compound, 10uM compound) shows that the compounds screened from the library bind to DLL-overexpressing CT-26 cells in a concentration-dependent manner.

[0249] In summary, the embodiments described above are merely better embodiments of the present invention and are not intended to limit the scope of protection of the present invention. Modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention are included within the scope of protection of the present invention.

Claims

1. A method for constructing a cyclic compound library, characterized by comprising the following steps: 1) A solid support G is directly or indirectly bonded to a molecule M containing a photocleavable group to obtain GM; 2) Perform one of the following methods: Method 1, Method 2, or Method 3; Method 1: Perform steps a1 to g1; a1. GM is reactively bonded to the ring-bound A-terminus molecule A to obtain GMA; b1. GMA is reactively bonded to a linker L1 having at least a trifunctional group to obtain GMA-L1; c1. GMA-L1 is sequentially reacted with the starting nucleotide molecule HP and the open primer OP to bind the starting nucleotide molecule HP to the linker L1, thereby obtaining GMA-L1-HP-OP; d1. The product obtained in the previous step is used in synthesis block C. 1 and composite block C 1 Corresponding DNA tag 1 They are reacted with each other, and then the composite block C 1 to L 1 DNA tag 1 Combine it with OP, GMA-L1(-HP-OP-tag 1 )-C 1 To obtain; Define the binding reaction of the corresponding synthetic block and the DNA tag set as an extension step, and repeat the extension step so that the synthetic blocks are sequentially spliced to form a chain, and the DNA tags corresponding to the synthetic blocks are sequentially spliced to form a chain, resulting in G-M-A-L1(-HP-OP-tag 1 -∙∙∙∙∙∙-tag n )-C 1 -∙∙∙∙∙∙-C n is obtained. Here, 2 ≤ n ≤ 7, and n is a positive integer; f1. The product obtained in step e1 is reacted with the ring-bound B-terminus molecule B and the closure primer CP to form the ring-bound B-terminus molecule B C n , tag closure primer CP n It is then combined with HP-OP-tag. 1 -・・・・・・-tag n -CP forms the complete DNA coding sequence, GMA-L1(-DNA)-C 1 -・・・・・・-C n -B, i.e., compound library S1'' is obtained. g1. The product obtained in the previous step is subjected to a decomposition reaction under a light source to separate M from A, and A-L1(-DNA)-C 1 -・・・-C n -B, i.e., obtain compound library S1'; Method 2: Proceed as in steps a2-g2, but you may swap the order of steps e2 and f2; a2. GM is reactively bonded to a linker L1 having at least a trifunctional group to obtain GM-L1; b2. GM-L1 is sequentially reacted with the starting nucleotide molecule HP and the open primer OP to bind the starting nucleotide molecule HP to the solid support G, thereby obtaining OP-HP-GM-L1; c2. Combine OP-HP-GM-L1 into block C 1 and composite block C 1 Corresponding DNA tag 1 It reacts with and synthesizes block C 1 Set to L1, DNA tag 1 Combine it with OP and tag 1 -OP-HP-GM-L1-C 1 To obtain. d2. Define the binding reaction of the corresponding synthetic block and DNA tag set as an extension step, and repeat the extension step so that the synthetic block is sequentially spliced ​​to form a chain, and the DNA tag corresponding to the synthetic block is sequentially spliced ​​to form a chain, tag n -・・・・・・-tag 1 -OP-HP-GM-L1-C 1 ......-C n We obtain the following, where 2 ≤ n ≤ 7 and n is an integer; e2. The product obtained in the previous step is reacted with the ring-bound A-termined molecule A, and the ring-bound A-termined molecule A is converted to C n To combine; f2. The product obtained in the previous step is used in synthesis block C. n+1 , ......, C n+m and their corresponding DNA tags n+1 , ......, tag n+m The reaction is carried out sequentially according to the extension steps described, and synthesis block C n+1 Linker L1, DNA tag n+1 tag n Combine them; after steps e2 and f2, tag n+m -・・・・・・-tag 1 -OP-HP-GM-L1(-C 1 ......C n -A)-C n+1 ......-C n+m We obtain the following equation: where 2 ≤ n ≤ 4, 0 ≤ m ≤ 3, n and m are integers, and 2 ≤ n + m ≤ 7. g2. The product obtained in the previous step is reacted with the ring-bound B-terminus molecule B and the closure primer CP to form the ring-bound B-terminus molecule B C n+m Tag the closure primer CP n+m It is then combined with HP-OP-tag. 1 -・・・・・・-tag n+m -CP forms the complete DNA coding sequence, DNA-GM-L1(-C 1 ......-C n -A)-C n+1 ......C n+m -B, i.e., compound library S2' is obtained; Method 3: Proceed as in steps a3-g3, but you may swap the order of steps e3 and f3; a3. GM is reactively bonded with a linker L1 having at least tetrafunctional properties to obtain GM-L1; b3. GM-L1 is sequentially reacted with the starting nucleotide molecule HP and the open primer OP to bind the starting nucleotide molecule HP to the linker L1, thereby obtaining GM-L1-HP-OP; c3. GM-L1-HP-OP is used with synthetic block C1 and the DNA tag corresponding to synthetic block C1. 1 They are reacted with each other, and then the composite block C 1 Set to L1, DNA tag 1 Combine it with OP, GM-L1(-HP-OP-tag 1 )-C 1 To obtain; d3. Define the binding reaction of the corresponding synthetic block and DNA tag set as an extension step, and repeat the extension step so that the synthetic block is sequentially spliced ​​to form a chain, and the DNA tag corresponding to the synthetic block is sequentially spliced ​​to form a chain, thereby creating GM-L1(-HP-OP-tag 1 -・・・・・・-tag n )-C 1 -・・・・・・-C n We obtain the following, where 2 ≤ n ≤ 7 and n is a positive integer; e3. The product obtained in the previous step is reacted with the ring-bound A-terminated molecule A, and the ring-bound A-terminated molecule A is converted to C n To combine; f3. Combine the product obtained in the previous step into synthesis block C n+1 ,・・・・・・,C n+m and their corresponding DNA tags n+1 ,・・・・・・,tag n+m The reaction is carried out sequentially according to the extension steps described, and synthesis block C n+1 Linker L1, DNA tag n+1 tag n Combine them; after steps e3 and f3, GM-L1(-HP-OP-tag 1 ......-tag n+m )(-C 1 ......-C n -A)-C n+1 ......-C n+m We obtain the following equation: where 2 ≤ n ≤ 4, 0 ≤ m ≤ 3, n and m are integers, and 2 ≤ n + m ≤ 7. g3. The product obtained in the previous step is reacted with the ring-bound B-terminus molecule B and the closure primer CP to form the ring-bound B-terminus molecule B C n+m Tag the closure primer CP n+m It is then combined with HP-OP-tag. 1 -・・・・・・-tag n+m -CP forms the complete DNA coding sequence, GM-L1(-DNA)(-C1...C n -A)-C n+1 ......-C n+m -B, i.e., compound library S3' is obtained; 3) The compound libraries S1', S2', or S3' are subjected to a ring-closing reaction in the presence of cyclooxygenase, and the ring-closed A-termined molecule A reacts with the ring-closed B-termined molecule B to form a ring, and each 【Chemistry 1】 That is, we obtain a cyclic compound library S1; or 【Chemistry 2】 That is, we obtain the cyclic compound library S2; or 【Transformation 3】 That is, we obtain the cyclic compound library S3; Here, the ring-closed A-terminal molecule A is a peptide chain consisting of at least three amino acids. The ring-closed B-terminal molecule B is a compound having two reactive functional groups, the two reactive functional groups being denoted as R10 and R11, respectively; R10 is an activating functional group used for splicing by reacting with the second activating functional group of the final synthetic block, and R11 is an activating functional group responsible for the ring-closing reaction; R10 and R11 may each exist independently in the form of protecting groups, where R10 and R11 do not interfere with each other's bonding reactions, and the protecting group is an Fmoc protecting group. The two activating functional groups R10 and R11 of the ring-bound B-terminal molecule B are, one being an amino group and the other a carboxyl group.

2. The method according to claim 1, characterized in that the solid support G is selected from one or more of PEG resin, PEGA resin, TentaGel resin, and solid support CPG.

3. The method according to 2, characterized in that the solid support G has one active functional group R1, where R1 is amino; or the solid support G has two active functional groups R1 and R1', where R1 is amino and R1' is carboxyl.

4. The method according to claim 1, characterized in that the molecule M containing a photocleavable group has at least two activating functional groups represented by R2 and R3; R2 is an activating functional group responsible for bonding to the solid support G, and R3 is an activating functional group responsible for bonding to the ring-closing A-termined molecule A or to the linker L1.

5. The method according to claim 4, characterized in that R3 exists in a protected form, wherein the protecting group is an Fmoc protecting group.

6. The method according to claim 4, characterized in that the molecule M containing the photocleavable group is selected from the following structures: 【Chemistry 4】 Here, R3 is selected from -OH, -NH2, -NHNH2, -N3, Cl, and Br; R2 is represented by a carboxyl group.

7. The ring-closed A-termined molecule A and the ring-closed B-termined molecule B are subjected to a cyclooxygenase ring-closing reaction, during which the ring-closed A-termined molecule A has some or all of its molecular fragment A1 removed; the ring-closed A-termined molecule A has two activating functional groups R4 and R5; R4 is an activating functional group involved in the cyclooxygenase ring-closing reaction and is removed during the ring-closing reaction; R5 is an activating functional group responsible for binding to linker L1 or the synthetic block, and after the ring-closing reaction, R5 is retained in the ring structure of the cyclic compound molecule; R4 and R5 exist independently of each other in protected or unprotected forms, and R4 and R5 do not interfere with each other's binding reactions, the protecting group being an Fmoc protecting group, and R4 and R5 are activating functional groups on the peptide chain containing an amino group or a carboxyl group. The method according to claim 4, characterized in that the amino acid sequence of the molecular fragment A1 is FAGDDAE, AYDGE, OCam-Leu, FL, AL, GL, HL, or HV.

8. The method according to claim 7, characterized in that R5 exists in a form protected by an Fmoc protecting group.

9. The method according to claim 7, characterized in that R4 is an activated functional group that is complementary to R3 of molecule M containing a photocleavable group by an amide bond, ester bond, ether bond, amine bond, or imine bond.

10. The method according to claim 7, characterized in that, in method 1, the linker L1 has at least three activating functional groups R6, R7, and R8, and R6, R7, and R8 can exist independently of each other in a protected or unprotected form, the protecting group being an Fmoc protecting group, and R6, R7, and R8 do not interfere with each other's bonding reactions; R6 is an activating functional group complementary to the activating functional group R5 on the ring-bound A-terminus molecule A by an amide bond, ester bond, ether bond, amine bond, or imine bond, and R7 is an activating functional group complementary to the activating functional group R5 on the ring-bound A-terminus molecule A by an amide bond, ester bond, ether bond, amine bond, or imine bond.

11. In method 2, linker L1 has at least three activating functional groups R6, R7, and R8; R6, R7, and R8 can exist independently of each other in a protected or unprotected form, the protecting group being an Fmoc protecting group, and R6, R7, and R8 do not interfere with each other's bonding reactions; R6 is an activating functional group complementary to the activating functional group R3 of molecule M containing a photocleavable group by an amide bond, ester bond, ether bond, amine bond, or imine bond, and R7 is in synthetic block C 1 It is an activated functional group that reacts and splices, and R8 is in synthetic block C n+1 The method according to claim 4, wherein the activated functional group is spliced ​​by reacting with the activated functional group.

12. In method 3 described above, linker L1 has at least four activating functional groups R6, R6', R7, and R8; R6, R6', R7, and R8 can exist independently of each other in a protected or unprotected form, the protecting group being an Fmoc protecting group, and R6, R6', R7, and R8 do not interfere with each other's bonding reactions; R6 is an activating functional group complementary to the activating functional group R3 of molecule M containing a photocleavable group, bonded by an amide, ester, ether, amine, or imine bond; R6' is an activating functional group spliced ​​in reaction to the starting nucleotide molecule HP; and R7 is in synthetic block C 1 It is an activated functional group that reacts and splices, and R8 is in synthetic block C n+1 The method according to claim 4, wherein the activated functional group is spliced ​​by reacting with the activated functional group.

13. The linker L1 has a decomposable functional group R L Includes R L The method according to claim 12, characterized in that, by decomposition, the linker L1 splits into two molecular fragments, and the two molecular fragments are a molecular fragment consisting of R6 and R6' and a molecular fragment consisting of R7 and R8, respectively.

14. The decomposable functional group R L The method according to claim 13, characterized in that it is an acid-cleavable group or a photo-cleavable group having a cleavage wavelength different from that of the molecule M containing the photo-cleavable group.

15. The linker L1 is composed of two trifunctional linkers L1' and L1'', and a linker L0 bonded between L1' and L1'', and the decomposable functional group R L The method according to claim 13, wherein L1' has three activating functional groups R6, R6', and R6'', L1'' has three activating functional groups R7, R8, and R8', and L0 has two activating functional groups R7 and R7', where R7 is complementaryly connected to R6'' by an amide bond, ester bond, ether bond, amine bond, or imine bond, and R7' is complementaryly connected to R8' in the pair reaction by an amide bond, ester bond, ether bond, amine bond, or imine bond.

16. The method according to claim 15, characterized in that the linker L0 is selected from the following structures: 【Transformation 5】

17. The starting nucleotide molecule HP has an activated functional group R9 that reacts with the activated functional group of linker L1 or the activated functional group of solid support G in a complementary pair formation. The method according to claim 1, characterized in that the activated functional group R9 is an amino group, and the activated functional group of linker L1, which is complementary to R9 by an amide bond, ester bond, ether bond, amine bond, or imine bond, or the activated functional group of solid support G is a carboxyl group.

18. The method according to claim 1, characterized in that the synthesis block is selected from dicarboxylic acids, diamines, diols, α,β-unsaturated aldehydes, α,β-unsaturated ketones, α,β-unsaturated acids, carbon-carbon double or carbon-carbon triple bonds containing reactive groups (hydroxyl groups, amine groups, aldehyde groups, carboxyl groups, sulfonic acid esters, or halogens), natural amino acids, or unnatural amino acids.

19. In the above method 1, each composite block is sequentially spliced, and composite block C 1 The first activating functional group of is responsible for splicing with linker L1, and the first activating functional group of each subsequent synthesis block is sequentially spliced ​​with the second activating functional group of the previous synthesis block, resulting in synthesis block C n The method according to claim 18, characterized in that the second activating functional group is responsible for splicing with the ring-closed B-terminal molecule B; the first and second activating functional groups do not exist simultaneously in an unprotected form, and the first and second activating functional groups do not interfere with each other.

20. In the method 2 or method 3 described above, synthetic block C 1 The first activating functional group of is responsible for splicing with one activating functional group of linker L1, and C 1 and C n The first activating functional group of each synthetic block between and synthetic block C n The first activating functional group of is sequentially spliced with the second activating functional group of the previous synthetic block, and synthetic block C n The second activating functional group of is responsible for splicing with the ring-closed A-terminal molecule A; the first activating functional group of synthetic block C n+1 The first activating functional group of is responsible for splicing with the other activating functional group of linker L1, and C n+1 and C n+m The first activating functional group of each synthetic block between and synthetic block C n+m is sequentially spliced with the second activating functional group of the previous synthetic block, and synthetic block C n+m The second activating functional group of is responsible for splicing with the ring-closed B-terminal molecule B; the first activating functional group and the second activating functional group do not exist in a form where they are simultaneously protected, and the first activating functional group and the second activating functional group do not interfere with each other. The method according to claim 18, characterized in that.

21. The method according to claim 19 or 20, characterized in that adjacent synthetic blocks are linked by the following chemical bonds: amide bonds, ester bonds, ether bonds, amine bonds, or imine bonds.

22. The method according to claim 18, characterized in that the synthesis block is a compound having both an amino group and a carboxyl group as two active functional groups.

23. The method according to claim 18, characterized in that the composite block further includes a backbone structure, the backbone structure being bonded within a ring or bonded to a ring in the form of a side chain of the ring.

24. The method according to claim 23, characterized in that at least one of the synthetic blocks includes a backbone structure, and the backbone structure has an E3 ligase substrate structure that can bind to an E3 ligase.

25. The method according to claim 23, characterized in that the backbone structure is selected from the following; 【Transformation 6】

26. The method according to claim 23, characterized in that each of the aforementioned synthetic blocks comprises at least one cyclic outer chain in total.

27. The method according to claim 23, characterized in that each of the aforementioned synthetic blocks comprises a total of at least two cyclic outer chains, and at least two of the cyclic outer chains are chemically bonded to form a bicyclic structure.

28. The method according to claim 23, characterized in that the DNA tags are sequentially bound by a DNA ligase; in the extension step, the splicing reaction between the DNA tags and the synthetic block corresponding to the DNA tags is completed such that the strands of the synthetic block and the strands of the DNA tags are extended, respectively.

29. The method according to claim 1, characterized in that R11 exists in a form protected by an Fmoc protecting group.

30. The method according to claim 1, characterized in that the ring-bound B-terminal molecule B is a peptide chain consisting of 2 to 10 amino acids.

31. The method according to claim 1, characterized in that the ring-bound B-terminal molecule B is an Fmoc-protected dipeptide.

32. The method according to claim 1, characterized in that the molecular structure of the ring-bound B-terminal molecule B has amino acid residues GL, LL, QL, KL, GF, or GI.

33. In step 3) above, compound library S1', S2', or S3' is subjected to a ring-closing reaction in the presence of cyclooxygenase, in which ring-closing A-termined molecule A reacts with ring-closing B-termined molecule B to form an amide bond and a ring is formed; in this ring-forming reaction, the terminal activating functional group of ring-closing B-termined molecule B reacts with ring-closing A-termined molecule A, removing part or all of ring-closing A-termined molecule A, and further the terminal activating functional group of ring-closing B-termined molecule B binds to the remaining portion to form a ring structure, wherein the cyclooxygenase is selected from the group consisting of ligases VyPAL2, Butelase1, PatG, PagG, ominiligase-1, PCY1, or OaAEP1B&3-5, as described in claim 1.

34. The method according to claim 33, characterized in that the formed ring structure is a single ring, a double ring, or a ring structure having side chains.

35. The method according to claim 33, characterized in that the temperature of the enzyme cyclization reaction is 25 to 45°C.

36. The method according to claim 33, characterized in that the pH of the enzyme cyclization reaction is 4.5 to 6.

0.

37. The method according to claim 33, characterized in that the reaction time of the enzyme cyclization reaction is 12 to 48 hours.

38. The method according to claim 33, characterized in that the pH is adjusted using a sodium acetate buffer in the enzyme cyclization reaction.

39. The method according to claim 33, characterized by adding disodium ethylenediaminetetraacetate, sodium chloride, and TCEP to the enzyme cyclization reaction system.

40. The aforementioned compound library S3' is first subjected to a decomposition reaction under a light source to cleave from L1 to M, and DNA-L1(-C) is obtained. 1 ......-C n -A)-C n+1 ......-C n+m -B, i.e., compound library S4' is obtained; next, the compound library S4' is subjected to a ring-closing reaction in the presence of cyclooxygenase, so that the ring-closing A-terminus molecule A and the ring-closing B-terminus molecule B react to form a ring, 【Transformation 7】 That is, we obtain the cyclic compound library S4; Alternatively, the compound library S3 may be subjected to a decomposition reaction under a light source to cleave M from L1, 【Transformation 8】 The method according to claim 1, characterized in that, a compound library S4 is obtained.

Citation Information

Patent Citations

  • Peptide libraries

    CN102471772A