Modified mRNA for multicellular transformation

Abstract

Synthetic bacterial messenger mRNA can be used to prepare autologous, allogeneic, or direct nucleic acid cancer vaccines. Cancer cells are transfected in vitro or in vivo with mRNA derived from DNA encoding immunogenic bacterial proteins. An immune response against cancer is generated by direct administration of mRNA in vivo or administration of a vaccine prepared from cancer cells in vitro. Codon modification of mRNA can optimize the expression of immunogenic polypeptides in cancer cells.

Description

Technical Field

[0001] Cross - reference to related applications This application is a continuation of U.S. Patent Application No. 16 / 869,642, filed on March 8, 2020, which is a partial continuation of U.S. Patent Application No. 15 / 583,599, filed on May 1, 2017, and is currently U.S. Patent No. 10,682,401; U.S. Patent Application No. 15 / 114,943, filed on July 28, 2016, and is currently U.S. Patent No. 9,636,388; International Patent Application PCT / US No. 2016 / 033235, filed on May 19, 2016; and claims priority to U.S. Provisional Patent Application No. 62 / 163,446, filed on May 19, 2015. The disclosure is incorporated by reference in its entirety, including all charts, amino acid, and nucleic acid sequences.

[0002] The sequence listing of this application was created on April 12, 2020, and is designated as "Seq - List.txt" with a size of 31 KB. The entire content of the sequence listing is incorporated herein by reference in its entirety.

Background Art

[0003] 1. Field of the Invention The present invention generally relates to vaccines, and more particularly to cancer vaccines prepared by either transfection of cancer cells or direct intratumoral administration with synthetic bacterial messenger ribonucleic acid (mRNA).

[0004] More specifically, the present invention describes synthetic RNAs that efficiently express selected polypeptides in mammalian cells, and the use of RNAs for transforming cells in vivo or in vitro.

[0005] 2. Description of Related Art This invention provides for the development and use of effective mRNA vaccines for cancer treatment. While deoxyribonucleic acid (DNA) vaccines have several drawbacks, including low transfection efficiency and time-consuming delivery methods, the mRNA vaccines of this invention are administered directly to tumor cells and are immediately translated into immunogenic proteins that induce a multi-tumor antigen response. The short in vivo half-life of mRNA is considered safer compared to plasmid DNA, as it reduces the likelihood of integration into the host genome. Unlike DNA, mRNA vaccines do not need to cross the nuclear envelope, often resulting in more rapid and higher levels of protein expression. Furthermore, since the expression of transfected mRNA is cell cycle independent and mRNA levels are not driven by promoters, protein expression and vaccine dose can be regulated by altering the level of transfected mRNA. In contrast to peptides, mRNA vaccines are not restricted by major histocompatibility complex (MHC) haplotypes and are designed to auto-adjuvate by the addition of MHC I transport signals or in combination with protamine. The effectiveness of mRNA vaccines can benefit from complexing agents that protect RNA from degradation and enhance cellular uptake, but cells can also be transfected with mRNA in vivo without other reagents or physical transduction methods. Messenger RNA for use as a vaccine can be produced from plasmid DNA using in vitro transcription.

[0006] Cancer treatment is based on the specific type diagnosed. Common cancers include bladder cancer, breast cancer, colon cancer, lymphoma, melanoma, and prostate cancer. Treatment regimens are not limited to these, but are created by physicians based on an assessment of several factors, including the stage of the disease, etiology, the patient's age, and overall health. For many cancers, treatment regimens include surgery, chemotherapy, radiation, bone marrow / stem cell transplantation, anticancer drugs or immunotherapy, or combinations thereof. The most common treatments include surgery, chemotherapy, radiation, and oral medications. While these treatments are effective, they often have many side effects. Chemotherapy, in particular, targets not only cancer cells but also all newly dividing cells in the body.

[0007] One of the advantages of some immunotherapies is that they can target diseased cells while leaving non-disease cells intact. Because cancer cells arise from the breakdown of normal growth regulatory mechanisms, the body still recognizes many of these cells as self. Cancer immunotherapy allows the body to distinguish these diseased self cells as foreign, exceeding the body's tolerance level. Cancer can also evade immune detection by directly suppressing the body's immune system by reducing the expression of immune activation markers on cells, such as MHC molecules. MHC is one of the components that allows the body to distinguish which cells are self and which are foreign or pathological.

[0008] Treatment for solid tumors typically involves chemotherapy and / or surgery. In recent years, there has been growing interest in developing vaccines to stimulate autoimmune defenses. Patent Document 1 describes in detail a lymphoma vaccine for treating advanced stages of lymphoma using transformed autologous or non-autologous cells isolated from subjects diagnosed with lymphoma. The isolated cells are Streptococcus pyogenes emm55 The cells are transfected with a plasmid vector containing the gene. The bacterial protein is expressed on the cell surface, and when the transfected cells are introduced into a target with cancer, they produce an immunological response against lymphoma cells.

[0009] To date, the FDA has only approved Provenge, a cell carcinoma immunotherapy vaccine for the treatment of prostate cancer. However, several other vaccines are currently being tested in clinical trials. BiovaxId is an autologous tumor-derived immunoglobulin idiotype vaccine currently undergoing Phase III clinical trials for the treatment of painless follicular non-Hodgkin lymphoma.

[0010] In principle, either exogenous DNA or RNA can express proteins in the mammalian body. It is unclear whether similar immune activity can be produced using both dDNA and mRNA-expressed proteins. Conventional knowledge suggests that DNA excels in creating vaccines and gene therapies due to its stability and ease of use. An example of a plasmid DNA vaccine is Merial's Oncept, developed for the treatment of oral canine melanoma.

[0011] Studies on mRNA vaccines have been reported. In one case, an effective mRNA vaccine was delivered using liposomes. This particular vaccine induced cytotoxic T lymphocytes in vivo after administration of mRNA encoding influenza virus protein to mice. Other studies by CureVac GMH have shown that mRNA vaccines induce humoral and cellular immune responses upon intradermal delivery. This vaccine was administered in naked form and also complexed with protamine, a protein that enhances mRNA stability and improves protein expression. This vaccine is currently in clinical trials for castration-resistant prostate cancer.

[0012] Human trials have been conducted using mRNA against liquid and solid tumors. These include acute myeloid lymphoma, metastatic melanoma, prostate cancer, renal cell carcinoma / ovarian carcinoma, neuroblastoma, brain tumors, lung cancer, colon cancer, and renal cell carcinoma. Most clinical trials currently underway involve mRNA transfection into autologous dendritic cells, rather than cancer cells. In addition, no clinical trials using intratumoral administration of mRNA have been attempted. Figure 3 is a table of published clinical trials using mRNA vaccines.

[0013] Delivery vehicles such as liposomes and cationic polymers are considered promising for enhancing transfection. Once the liposome or polymer complex enters the cytoplasm, the mRNA must separate from the delivery vehicle to enable antigen translation. Unfortunately, these vehicles may not properly complex with the mRNA, thus failing to enable proper translation of the encoded protein. Antigen production may occur, but in insufficient amounts to produce the desired effect.

[0014] Many immunotherapies are disease-specific, conceptually complex, and even more complex and expensive to produce. Whether such treatments are commercially viable remains unknown. Direct administration of mRNA to a patient's tumor immediately translates into immunogenic proteins that induce a multi-tumor antigen response, meaning this has broad applicability. For example, a single synthetic mRNA can be used to treat multiple types of cancer in multiple species. mRNA is easy to deliver, cost-effective, easy to transport and store, and easy to administer. Along with an excellent safety profile, these properties of mRNA make it possible to treat cancer patients worldwide, even in developing countries.

[0015] Inducing an immune system that kills cancer cells is the foundation of all cancer immunotherapy. For any type of immunotherapy to be successful, an immune response to tumor-associated antigens must be triggered and amplified. The immune response can include any number of immune cells, including antigen-presenting cells, neutrophils, natural killer cells, T helper cells, T-cytotoxic cells, and B cells. However, triggering and activating an immune response to a single tumor antigen has not been proven sufficient to translate into beneficial clinical efficacy in human cancer vaccine trials, likely due to immune-evading variants and the lack of use of whole tumor cells or tumor cell lysates plus exogenous adjuvants as a source of multiple relevant tumor antigens. This is why it is essential to be able to supply triggers for tumor antigens when they are expressed on the patient's tumor cells. The only way to achieve this is to provide the tumor cells with coding nucleic acids, which then allow the cellular mechanism to express trigger antigens along with the tumor antigens so that all of these antigens are exposed to cells of the immune system. Subsequently, such exposure leads to the diffusion of inter-antigen epitopes, and as a result, the adaptive immune response promotes and activates all tumor cells that possess those antigens, even in the absence of the trigger antigens.

[0016] Using nucleic acids as vaccines offers many other advantages. Nucleic acid vaccines can induce both humoral and cellular immune responses, have low effective doses, are easy to handle, utilize rapid testing, are cost-effective in large-scale production and isolation, are reproducible, can be produced at high frequency, are easily isolated, are more temperature-stable than conventional vaccines, have a long shelf life, are easy to store and transport, and are less likely to require a cold chain.

[0017] DNA has been successfully used in vaccines. DNA is a double-stranded molecule that serves as the blueprint, or genetic instruction, for living organisms. Because DNA is fairly stable, non-reactive, and can be stored for long periods, it is suitable for use as a vaccine. However, DNA is self-replicating and easily damaged by ultraviolet radiation.

[0018] RNA, on the other hand, is single-stranded and functions to execute instructions from DNA; that is, RNA transcribes the genetic code to produce proteins. RNA is more reactive and less stable than DNA, but it is resistant to ultraviolet light. As a result, these properties make RNA more suitable for use as a vaccine. In general, mRNA has zero chance of being incorporated into the host chromosome. mRNA delivery results in faster expression of the target antigen and fewer copies are needed for expression. mRNA expression is transient, which may seem like a disadvantage, but in reality it increases its safety. mRNA is more effective than DNA for protein production in postmittal and non-dividing cells. This is because DNA requires transposition through the nuclear membrane and plasmid membrane, while mRNA requires transposition only through the plasmid membrane. mRNA not only serves as a template for translation but also acts as a ligand for Toll-like receptors and is nuclease-sensitive, so it is less of a concern for horizontal transfer. [Prior art documents] [Patent Documents]

[0019] [Patent Document 1] U.S. Patent No. 7,795,020 [Overview of the project] [Means for solving the problem]

[0020] The present invention is based on the use of ribonucleic acid messages (mRNA) (SEQ ID NO: 1, SEQ ID NO: 13, SEQ ID NO: 15, and SEQ ID NO: 16) encoding immunogenic bacterial proteins. The messages can be delivered into the cytoplasm by any of a number of known techniques. Once the mRNA reaches the cytoplasm, it is translated into the encoded protein using the introduced cellular machinery. The bacterial protein, for example, the M-like protein having the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 14, is then expressed in cells that confer immunogenicity against cancer cells. For example, since the M-like protein is derived from bacterial sources, group A and group G streptococci (GAS and GGS), it is regarded as foreign to the mammalian body. Immunosurveillance cells such as antigen-presenting cells (APCs) are attracted by the heterologous protein. The APCs phagocytose the entire cancer cell and then present all heterologous / mutated proteins, including the M-like protein, to other immune cells.

[0021] The production of bacterial proteins within the cell is achieved by the insertion of the corresponding genetic code. The gene for the M-like protein is called emmL. Once the emmL message is delivered to cancer cells containing abnormal proteins produced by mutations in the cell's DNA, the M-like protein is expressed in the cells, attracting and engulfing immune cells, resulting in the presentation of the previously masked mutated proteins to the immune system. The abnormal proteins may have been present for a long time, but since they are derived from "self" proteins, the body does not necessarily regard them as foreign or threatening. The bacterial protein antigen acts as a primer or trigger for the immune system to deal with cells that were previously indistinguishable as damaged and harmful.

[0022] mRNA is produced as described in the examples. Once obtained, the mRNA containing the immunogenic message is delivered to autologous or syngeneic cells that require the priming action described in the summary of the present invention. The mRNA can also be delivered directly into the tumor or, in the case of some cancers such as lymphoma, into the lymph nodes.

[0023] One M-like protein encoded by the emmL gene has previously been delivered intracellularly via DNA and shown to be expressed intracellularly to produce an immunological effect. Due to concerns regarding DNA delivery, including the potential for chromosomal gene integration, delivery of messages via RNA is a safer alternative as it cannot integrate into host DNA. This ability of DNA to integrate into host DNA is particularly relevant in medical applications where exogenous DNA integration can cause harmful effects. In contrast to DNA expression, mRNA expression persists intracellularly for only a maximum of hours to days. mRNA that is not delivered intracellularly is rapidly degraded by RNase present in the environment, so there is no risk of horizontal transmission. Successful transfection of cancer cells with emmL mRNA can result in the expression of immunogenic bacterial proteins on the surface of the cancer cells, thereby inducing an immunogenic response.

Brief Description of Drawings

[0024] [Figure 1] Shows the plasmid used in the backbone of the recombinant plasmid designed for the production of mRNA of the M-like protein. [Figure 2] Shows the plasmid DNA used as the source of the emmL gene ligated to the linearized vector of Figure 1. [Figure 3-1] Summary of mRNA tests conducted in solid cancers. [Figure 3-2] Summary of mRNA tests conducted in solid cancers. (Continued) [Figure 4] Figure demonstrating the differences in the cellular production pathways between mRNA and DNA. [Figure 5] Shows the production of a recombinant DNA vector for producing mRNA encoding a bacterial antigen. [Figure 6] Shows a Western blot of isolated Emm55 against anti-M-like antibody. [Figure 7] Shows the comparative results of protein expression from DNA and RNA transfection. [Figure 8]This is a photograph of an agarose gel of synthesized emm55 mRNA using the Flashgel system. [Figure 9] This graph shows antibodies reactive to the EmmL protein in mice vaccinated with emmL mRNA or water (control) (C2) at 1, 2, 3, and 4 weeks post-vaccination. [Figure 10] This is a Western blot showing the presence of antibodies in mouse blood that react to EmmL protein before and after vaccination with emmL mRNA. [Figure 11] This is a map of a novel double-stranded DNA molecule used for the production of highly efficient synthetic mRNA in mammalian cells. This DNA molecule includes T7 RNA polymerase (SEQ ID NO: 8), a portion of the 5' untranslated region of the African clawed fern beta-globin gene (SEQ ID NO: 9), a polylinker with restriction endonuclease recognition sites for SacI, NotI, BglII, EcoRV, and SpeI used to insert the coding region of emmL (SEQ ID NO: 7), a portion of the 3' untranslated region of the African clawed fern beta-globin gene (SEQ ID NO: 10), and a polylinker with restriction endonuclease recognition sites for BamHI, EcoRI, and XbaI used to linearize the plasmid before in vitro transcription (SEQ ID NO: 11). The DNA sequence corresponding to Figure 11 is SEQ ID NO: 12. [Figure 12A] The relative adaptability plot of emm55 is shown. The Y-axis represents the adaptability index for each codon in emm55, where 1.0 indicates perfect adaptation to human cell expression. The original emm55 sequence is shown. [Figure 12B] The emm55 after optimization using the JCat algorithm is shown. [Figure 13A]This is a simulated Western blot of Wes® capillary electrophoresis analysis of Emm55 expressed after transient transfection of HEK293T and B16-F10 cells with wild-type uridine (WT) and N1-methylpsoiduridine-containing mRNA. The lysate was 0.5 μg / μL. ERK1 was used as a normalization control. - indicates cells transfected with EGFP mRNA. * indicates Emm55FreqDist transfection 6 hours after incubation of HEK293T cell lysates with rabbit anti-ERK1 alone. emm55Jcat. [Figure 13B] This is emm55MostFreq. [Figure 13C] This is emm55FreqDist. * indicates 6 hours after Emm55FreqDist transfection of HEK293T cell lysates incubated with rabbit anti-ERK1 alone. [Figure 14A] Figure 13 shows the normalized expression of Emm55 from the image. The codon optimization in the JCat algorithm was determined using the codon adaptability index. A value of 1.0 represents complete optimization. Expression in HEK293T cells is shown. [Figure 14B] Expression is shown in B16-F10 cells. [Figure 15A] This shows the time course of Emm55 expression in HEK293T cells. This is an initial assay performed at Wes® maximum signal intensity. [Figure 15B] This is a replica experiment with reduced protein load. Significance was determined by one-way ANOVA using the Bonferroni post-hoc study. *p<0.05, **p<0.01, ***p<0.001, ****P<0.0001 (n=3). ☆Significance between emm55JCat-N1 and pAc / emm55. ★Significance between emm55JCat-WT and pAc / emm55. [Modes for carrying out the invention]

[0025] This invention provides a cancer vaccine that is prepared more efficiently and inexpensively than previously used vaccines, by directly introducing plasmid DNA into the nucleus of cells. The use of emmL (SEQ ID NO: 1, SEQ ID NO: 13, SEQ ID NO: 15, and SEQ ID NO: 16), which encodes mRNA inserted into the cytoplasm, is more effective in transfecting tumor cells.

[0026] The present invention further provides several novel emmL coding RNAs designed to optimize increased expression in transformed cells. Stronger expression of the Emm55 protein was achieved using several codon optimization algorithms designed to adapt the emmm55 nucleotide sequence to mammalian expression.

[0027] mRNA can deliver antigenic protein messages to cancer cells. Because mRNA cannot be incorporated into host DNA, it is not only a safer alternative, but its expression is limited to a few hours to a few days at most. mRNA delivery also provides faster expression in cells because it places the antigenic message further downstream in the cellular protein production process. mRNA only needs to be delivered into the cytoplasm, while DNA must ultimately reach the nucleus to be effective. The use of mRNA is advantageous for protein antigen production because it can induce protein production in both postmittal and non-dividing cells.

[0028] mRNA delivery of antigen proteins is a safer alternative to DNA delivery, but the stability and immunogenicity of mRNA must be addressed. Many of the factors that promote increased stability and immunogenicity have been modified in recombinant vector templates. If the appropriate elements are not present in the vector, they can be added; for example, if the template vector does not contain a poly(A) tail coding sequence, the tail is added during transcription.

[0029] To enhance cytoplasmic stability, mRNA must contain both a 5'-methylguanosine cap and a 3'-poly(A) tail (SEQ ID NO: 3). These elements are involved in attracting and attaching components of the cellular mechanisms involved in mRNA translation into protein. Without these components, the time available for protein translation before degradation is reduced. Therefore, these elements are incorporated into the mRNA as described in the examples.

[0030] Efficient immunogenicity can be increased by utilizing techniques such as viral vectors, nanoparticles, cationic polymers, lipids, and delivery enhancement using electroporation. Viral vectors are widely used for plasmid DNA (pDNA) delivery, but they carry several risks and increase costs. Electroporation using mRNA is a preferred method for mRNA delivery because, due to its less stringent electrical setting, it is less toxic to cells. DNA requires a higher charge to pass through the extracellular and nuclear membranes, while mRNA only needs to pass through the extracellular membrane.

[0031] The production of mRNA for vaccines offers both economic and manufacturing advantages compared to pDNA. mRNA is synthesized in vitro from a linearized pDNA template and requires only a small amount of DNA. On the other hand, the production of large quantities of pDNA is labor-intensive and requires equipment such as large fermentation tanks to grow enough bacteria to produce the large quantities of pDNA needed for vaccine production. Although pDNA isolated from large cultures is pure, due to the circularity of plasmids, the final product arises in three structural forms: relaxed, linear, and superhelical. Each form has the ability to produce an antigen protein once within a cell, but each DNA form has a different ability to enter the cell across the cell membrane. mRNA production produces only one structural form. Furthermore, the manufacturing synthesis method offers high batch-to-batch reproducibility.

[0032] From a manufacturing perspective, mRNA is synthesized from DNA and offers high reproducibility. This is important for use as a vaccine because it does not require large-scale growth, meaning less time and material are needed, and the risk of contamination is lower. These factors contribute to cost reduction. Furthermore, mRNA synthesis requires only one linearized plasmid DNA to produce 100 mRNA molecules, resulting in higher yields. mRNA is produced in vitro, and therefore there is no E. coli contamination (genomic DNA or endotoxin) after isolation. This leads to fewer purification steps and quality control testing. The synthetic nature of in vitro transcription also ensures batch-to-batch reproducibility and better batches of purer products, as the vector sequence containing the selection marker is not part of the final product. Also, in contrast to DNA, mRNA has a single molecular conformation, while plasmid DNA has three. mRNA is also easier to transfect than plasmid DNA and requires a lower voltage, resulting in less cell death during electroporation. Like DNA, mRNA can also be lyophilized. From a regulatory standpoint, mRNA is safer because it is non-replicating and transient, and because mRNA is easily degraded and does not confuse antibiotic resistance, it minimizes or does not pose any environmental problems.

[0033] The following comparison illustrates the advantages of using mRNA instead of DNA for antigen emmL message delivery to cancer cells. The comparison is divided into three parts: upstream production, downstream production, and cell delivery. The majority of the benefits, including reduced production costs, shorter manufacturing times, superior message delivery, and improved safety, are observed in upstream production and cell delivery. Each section highlights the major differences between the DNA and mRNA processes, as well as the similar steps within each process.

[0034] Upstream production The upstream production of both nucleic acid products is nearly identical up to bacterial culture growth. Only a small amount of DNA is required to produce approximately 100 times the amount of mRNA. For example, in in vitro transcription experiments, 25 μg of mRNA was produced from just 0.2 μg of DNA. This is 25 times more mRNA than produced using the same amount of culture. Culture expansion is extremely expensive, time-consuming, and increases the risk of contamination and DNA mutation.

[0035] The advantage of only needing to grow small bacterial cultures is significant. Isolation of small amounts of DNA from these cultures can be done on a small scale. This miniaturization saves time and resources and reduces the risk of contamination. The final mRNA product requires a further step of transcribing mRNA from a DNA template. This is a synthetic process performed in vitro. Due to the synthetic nature of transcription, there is good reproducibility between batches, and the procedure takes only a few hours. Culturing DNA-containing bacteria takes several days.

[0036] A significant drawback of using pDNA instead of mRNA is that the final product may be contaminated with genomic DNA (gDNA). Furthermore, isolated pDNA forms three conformations—linear, superhelical, and circular—which do not transfect cells with the same efficiency. mRNA final products are pure in a single conformation and are not contaminated with gDNA or pDNA.

[0037] Chart 1 compares the steps used in the production of DNA and mRNA. [Table 1]

[0038] Downstream production (homemade herbal remedies) Most of the downstream production is the same for DNA and mRNA. One difference lies in the electroporation step. Unlike DNA, which must pass through both the cell membrane and the nuclear membrane, mRNA only needs to pass through the cell membrane and not the nuclear membrane, so a lower voltage is required. A lower voltage is preferable because it reduces cell death during electroporation. The increased viability of mRNA-transfected cells is translated into vaccine cells that readily express M-like proteins at a sufficient rate.

[0039] Chart 2 compares the treatment of DNA and mRNA in tumor tissue through the process of vaccination in transfected cells versus the process of preparation. [Table 2]

[0040] cell delivery The significant advantages of using mRNA delivery are demonstrated in the following cell delivery flowchart. As shown in the chart, mRNA delivery to cells is skipped prior to immediate translation into antigenic M-like proteins. The transfected DNA must not only pass through the cell membrane but also be transcribed into mRNA for delivery back to the cytosol, which is the starting point for protein synthesis initiated by the mRNA vaccine.

[0041] mRNA vaccines can be conjugated with suitable immunological adjuvants or repressors, depending on the desired effect. Adjuvants such as TriMix, a cocktail of immunostimulatory molecules, can be added to mRNA-based vaccines to induce an increased immune response to the encoded immunogen. Immunosuppressants are useful to counteract the immunosuppressive enzymes of other elements that hinder the body's ability to initiate a full immune response. These immunosuppressive elements are silenced by using silencing RNA (siRNA) that is co-delivered during immunization. A further type of immunosuppressant that can be administered in conjunction with mRNA-based cancer vaccines is checkpoint inhibitors. These generally consist of antibodies such as anti-PD1 and anti-CTLA4 that bind to receptors present on tumor cells or immune-activated cells, and if left unblocked, induce immunosuppression. This process is called "releasing the brakes," and as the name suggests, this release of the "brakes" allows immunotherapies such as mRNA cancer vaccines to enhance the immune system's ability to attack cancer cells.

[0042] The vaccine can be used before or concurrently with the administration of RNA vaccines, in combination with not only checkpoint inhibitor therapy, but also chemotherapy, radiotherapy, whole cell vaccines, other nucleic acid therapies, natural killer cell therapy, or chimeric antigen receptor therapy.

[0043] In other cases, cancer patients are treated with regimens that modify the tumor microenvironment, including, but not limited to, metronomic doses of cytokines, antifusion agents, chemotacticants, and chemicals, either before or concurrently with vaccine administration.

[0044] Chart 3 compares the processing of DNA and mRNA in cells from cell entry to translation. [Table 3]

[0045] In Examples 23-25, the mRNA encoding emmL can be produced using an in vitro transcription reaction. Several modifications can be made to the obtained mRNA in this reaction to improve the stability and translation efficiency of the mRNA and EmmL protein and to reduce mRNA immunogenicity. For example, but are not limited to, modified nucleic acids such as anti-reverse cap analogs [ARCA, P1-(5'-(3'-O-methyl)-7-methyl-guanosyl)P3-(5'-(guanosyl)) triphosphates], N1-methyl-guanosine, 2'-fluoro-guanosine, 7-deaza-guanosine, inosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine can be added to the 5' end of the emmL mRNA.

[0046] In other examples, a poly(A) tail of approximately 50–200 adenosine monophosphates can be attached to the 3' end of emmL mRNA, or both a 5' modified nucleotide cap and the poly(A) tail can be attached to emmL mRNA.

[0047] emmL mRNA can be synthesized using ribonucleotide analogs. Chemical modifications can be performed at this stage to further improve translation efficiency and stability. Examples include 5-methylcytidine-5'-triphosphate, pseudouridine-5'-triphosphate, 2-thiouridine-5'-triphosphate, and N1-methylpsoiduridine-5'-triphosphate.

[0048] Numerous methods exist for delivering mRNA to cells to ensure high levels of EmmL protein production. For example, emmL mRNA produced after in vitro transcription can be directly injected into tissues or tumors.

[0049] By using complexing agents such as lipids or polymers, RNA can be protected from degradation, its uptake by cells can be enhanced, and its delivery to the translational mechanism in the cytoplasm can be improved. In one embodiment, emmL mRNA forms a complex with liposomes prepared from lipophilic materials such as cholesterol and synthetic phospholipids.

[0050] In one embodiment, emmL mRNA forms a complex with liposomes prepared from lipophilic materials such as cholesterol and natural phospholipids.

[0051] In one embodiment, emmL mRNA is N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium methyl sulfate (DOTAP), but is not limited to these, and forms complexes with cationic lipids.

[0052] In one embodiment, emmL mRNA forms a complex with amphoteric lipids such as 3-[(3-chloroamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS), but is not limited to these.

[0053] In one embodiment, emmL mRNA forms a complex with PEGylated lipids such as N-(carbonyl-methoxypolyethylene glycol_2000)-1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE-PEG), but is not limited to these.

[0054] In one embodiment, emmL mRNA forms a complex with a mixture of cationic, zwitterionic, and PEGylated lipids.

[0055] In one embodiment, emmL mRNA forms a complex with protamine.

[0056] In one embodiment, emmL mRNA forms a complex with liposomes prepared from specific materials, such as Japanese hemagglutinating virus, which are used to prepare mRNA vaccines for the treatment of melanoma

[26] .

[0057] In one embodiment, emmL mRNA can form complexes with polymers rationally designed with multiple materials that mimic viral components to efficiently transfect specific cells. These include, but are not limited to, membrane-breaking peptides, nucleic acid-binding components, protective coating layers, and externally targeted ligands.

[0058] In one embodiment, complexing components can be combined and formulated into a single nanoparticle.

[0059] In one embodiment, emmL mRNA or emmL mRNA complexes can be combined with interfering RNA or interfering RNA complexes targeting immune checkpoint molecules such as programmed cell death protein 1 (PD-1), programmed cell death ligand 1 (PD-L1), cytotoxic T lymphocyte-associated protein 4 (CTLA-4), or T cell immune receptors having Ig and ITIM domains (TIGIT). One non-limiting example is an emmL mRNA complex and small interfering RNA (siRNA) complex targeting PD-1.

[0060] In one embodiment, the emmL coding region can be combined with a viral RNA replication gene to form a self-replicating linear RNA molecule. This linear RNA molecule can then be formulated with a lipophilic compound and a lipid to form a liposome that can transfect cells with self-replicating mRNA.

[0061] In one embodiment, emmL mRNA, or emmL mRNA formulated with lipids, protamine, or liposomes, forms a complex with a biodegradable polymer. A not-so-limited example is polycaprolactone, which is approved by the Food and Drug Administration for use as a drug delivery device. The advantage of biodegradable polymer complexing is that, as the polymer degrades, the mRNA or mRNA complex can be delivered over a long period. This sustained delivery can enhance the efficacy of the vaccine.

[0062] In one embodiment, emmL mRNA or emmL mRNA complexes can be formulated in a biodegradable polymer containing tissue-specific or tumor-specific factors that enhance the efficacy of the emmL mRNA vaccine. An example is an emmL mRNA vaccine formulated with a biopolymer containing factors that inhibit angiogenesis or vascular formation, thereby providing a synergistic antitumor effect.

[0063] In one embodiment, emmL mRNA or emmL mRNA complexes can be formulated in a biodegradable polymer containing factors that reduce the expression of immune checkpoint molecules such as PD-1, PD-L1, CTLA-4, or TIGIT. Examples, though not limited to them, include existing or novel pharmaceutical reagents such as small molecules or antibodies that reduce PD-1 expression, thereby providing a synergistic antitumor effect.

[0064] In one embodiment, emmL mRNA or emmL mRNA complexes can be formulated in a biodegradable polymer containing interfering RNA or interfering RNA complexes for factors that reduce the expression of immune checkpoint molecules such as PD-1, PD-L1, CTLA-4, or TIGIT. Examples, though not limited to them, include emmL mRNA complexes and small interfering RNA (siRNA) complexes.

[0065] In one embodiment, emmL mRNA or an emmL mRNA complex can be combined with an adjuvant such as synthetic double-stranded RNA polyriboinosine polyribocytidylic acid [poly(I:C)].

[0066] Analysis of pSFCMVT / emmL design elements Several design elements were able to improve the level of Emml protein production.

[0067] The mRNA vaccines (SEQ ID NOs: 1-3) detailed in Example 1 were cloned into the Oxford Genetics pSF-CMV_T7 plasmid DNA vector to produce pSFCMVT7 / emmL. mRNA expression was detected after transfection in mammalian cells, but only low levels of Emm55 protein were detected by Western blotting. Retrospective analysis of pSFCMVT7 / emmL identified design elements that could improve translation efficiency in mammalian cells.

[0068] There are at least two distinct types of design elements that can improve the level of EmmL protein production. Proximal elements are located near the emmL coding region and are added during polymerase chain reaction (PCR) amplification of emmL from pAc / emm55. Distal elements are located away from the emmL coding region and are generally useful for enhancing protein expression from mRNA.

[0069] The proximal element involves introducing a translation initiation sequence optimized for mammalian cell expression into the N-terminus of the emmL coding region. This sequence has been determined to be RYMRMVATGGC (where R is A or G, Y is C or T, M is A or C, and V is A, C or G) (SEQ ID NO: 4). In one embodiment, the optimal translation initiation sequence, ATAGCCATGGC (SEQ ID NO: 5), substitutes the native start codon of emmL.

[0070] In one embodiment of this proximal design element, oligonucleotide PCR primers are synthesized such that equimolar concentrations of each nucleotide are present at degenerate positions (R, Y, M, and V in SEQ ID NO: 4), and the final oligonucleotide synthesis product contains all possible primer sequences. In this embodiment, the optimal translation initiation sequence is determined empirically by comparing the levels of EmmL protein expression in assays such as Western blotting after the emmL gene has been subcloned into a mammalian expression plasmid DNA vector.

[0071] Another proximal design element that can be used to modify the C-terminus of the emmL coding region is the addition of a stop codon that is appended after the native stop codon. Many eukaryotic expression plasmid vectors contain DNA sequences of all three stop codon variations, TAG, TAA, and TGA, immediately after the last codon of the expressed gene. Since the DNA sequence of the native emmL stop codon is TAG, sequence number 6 can be included as an additional proximal design element.

[0072] Another proximal design element is the addition of restriction endonuclease recognition sites, which can be attached to the N-terminus and C-terminus of the emmL coding region to facilitate its insertion into a plasmid cloning vector. The selection of restriction endonuclease recognition sites is based on the target plasmid. Some examples of restriction endonucleases that can be used are SacI, NotI, BglII, EcoRV, and SpeI. In one preferred embodiment, since the SacI and SpeI sites are not cleaved within the emmL coding region and share reaction conditions, the SacI and SpeI sites can be attached to the N-terminus and C-terminus of the emmL coding region and used simultaneously to prepare emmL coding region PCR amperprimers for insertion into the target plasmid.

[0073] Design elements located distal to the emmL coding region are added to the plasmid cloning vector so that any variation of the emmL coding region, or other genes adapted to the proximal design elements, can be inserted. These distal elements can be manipulated to create mRNA expression vectors capable of driving high levels of emmL or any other mammalian mRNA and protein expression.

[0074] One distal design element is the DNA sequence of the bacteriophage RNA polymerase promoter region. Examples of bacteriophage RNA polymerases are T7, T3, and SP6. In one embodiment, the promoter of T7 RNA polymerase (SEQ ID NO: 8) is the first of several distal elements that are added from the EmmL coding region to ultimately be upstream in relation to the operation of T7 RNA polymerase.

[0075] The 5' and 3' RNA sequences near the transcribed but untranslated eukaryotic gene coding region, known as the untranslated region (UTR), have a strong positive or negative influence on protein translation from transcribed mRNA in vitro. Generally, UTRs supporting high levels of protein expression are unstructured, lack negative regulatory sequences, and contain microRNA binding sites that help further refine gene expression patterns. Both UTRs of genes generally highly expressed in mammalian cells, or UTRs derived from genes with expression patterns matching tissues where mRNA vaccine expression is desired, can be used to optimize the delivery of gene products such as EmmL proteins. UTRs derived from the African clawed frog betaglobin gene have been widely used to mediate high levels of translation in a wide range of eukaryotes, including the design of RNAs used in mammalian immunotherapy. Examples of tissue-specific UTRs include tryptophan hydroxylase (TPH) isoforms that drive differential expression in the pineal gland and brainstem.

[0076] In one embodiment, the 5'UTR of the African clawed fern betaglobin gene is located upstream of the emmL coding region with respect to RNA polymerase activity. Sequence ID 9 is one example, not limited to, of the 5' untranslated region of the African clawed fern betaglobin gene.

[0077] In one embodiment, the 3'UTR of the African clawed fern betaglobin gene can be positioned downstream of the emmL coding region with respect to RNA polymerase activity. Sequence ID 10 is one example, not limited to, of the 3' untranslated region of the African clawed fern betaglobin gene.

[0078] In one embodiment, both the 5' and 3' UTRs of the African clawed fox betaglobin gene can be positioned adjacent to the emmL coding region.

[0079] In one embodiment, the 5'UTR and 3'UTR are selected based on the type of neoplastic cell targeted by the vaccine. In one example of a non-limited set, the 5' and 3'UTRs of genes highly expressed in melanoma cells, such as tyrosinase (TYR), melanogenesis-associated transcription factor (MITF), melanocortin receptor 1 (MC1R), telomerase (TERT), cyclooxygenase 2 (COX2), CXC-motif chemokine receptor 4 (CXCR4), and baculovirus IAP repeat-containing 5 gene (BIRC5), can be used to provide high levels of cell-specific expression in an emmL-based vaccine when used to treat melanoma.

[0080] In one embodiment, to further refine vaccine expression, other genetic elements not located within the primary gene transcript that confer a desired expression level and specificity may be included before, after, or within the 5' and 3' UTRs.

[0081] Other distal design elements are synthetic DNA sequences that provide restriction endonuclease recognition sites that can be used to insert the emmL coding region into other adjacent distal design elements. In one embodiment, the restriction endonuclease recognition sites SacI, NotI, BglII, EcoRV, and SpeI are used (SEQ ID NO: 7).

[0082] Other distal design elements are synthetic DNA sequences that provide restriction endonuclease recognition sites that cleave the target plasmid immediately after the emmL coding region to produce a linear plasmid DNA molecule. Linearization provides a valid termination for RNA polymerase activity, which increases the production of mRNA transcripts of uniform length. An example of a sequence is Sequence ID No. 11, which contains restriction endonuclease recognition sites for BamHI, EcoRI, and XbaI. In one preferred embodiment, BamHI is used to linearize a plasmid containing the emmL coding region because it is not cleaved within the emmL coding region, leaving a 5' nucleotide overhang, thereby enabling transcription with higher efficiency than a 3' nucleotide overhang.

[0083] In one embodiment, a double-stranded DNA molecule containing the distal design element described above is synthesized using overlapping complementary synthetic single-stranded oligonucleotide molecules. These molecules are annealed, and the remaining gaps are filled with a DNA polymerase such as Taq polymerase.

[0084] In one embodiment, two complementary synthetic single-stranded oligonucleotide molecules can be synthesized to encompass all desired distal design elements. These oligonucleotide molecules are then annealed. In any of the above embodiments, the resulting blunt-end synthetic DNA molecule can be inserted into a PCR cloning vector such as the Invitrogen pCR® II-TOPO plasmid by adding template-nonspecific adenosine. This is achieved by incubating the blunt-end synthetic DNA molecule with Taq polymerase and deoxyadenosine triphosphate at a final concentration of approximately 200 μM at 72°C for 10 minutes.

[0085] In one embodiment, the plasmid containing the distal design elements described above is named pT7XLUTR. A map of the synthetic DNA molecule inserted into pCR®II-TOPO is shown in Figure 11, with the nucleotide sequence shown as Sequence ID No. 12. This sequence contains the distal design elements described above, but does not represent the entire or complete range of elements added to support the desired expression level or specificity.

[0086] E. coli can be transformed using pT7XLUTR. Bacteria transformed with pT7XLUTR can be selected on agar plates containing antibiotics matching the PCR cloning vector, such as agar plates containing Luria Bertani broth supplemented with 50-100 μg / mL kanamycin or carbenicillin. Bacterial cultures can be expanded by growth in liquid antibiotic selection medium, such as Luria Bertani broth supplemented with 50-100 μg / mL kanamycin or carbenicillin, and plasmid DNA prepared using methods known to those skilled in the art.

[0087] RNAs incorporating some of the described design elements were found to increase Emm55 expression. The sequences are shown in SEQ ID NOs: 13, 15, and 16.

[0088] Examples The following examples are provided as illustrations of the present invention and are not limiting.

[0089] Example 1: Autologous mRNA vaccine for canine lymphoma A 75-pound male castrated Rhodesian ridgeback is presented to a veterinarian with swollen mandibular and inguinal lymph nodes. Fine-needle aspiration is performed on one of the enlarged nodes. Further examination by a pathologist reveals the animal to have low-grade diffuse lymphoma.

[0090] The owner chooses immunotherapy instead of chemotherapy and steroids because the reported side effects of immunotherapy are minimal. While the animal is under general anesthesia, the veterinarian excises the right mandibular lymph node. The tissue sample is delivered overnight for laboratory processing.

[0091] Upon receiving tissue samples in the laboratory, the following steps are taken: 1) the transport medium is checked for any bacterial contamination; 2) tissue dimensions are measured; 3) intact lymph nodes are repeatedly aspirated using several bolus wash media to release tumor cells; and 4) the aspirated cells are collected and counted.

[0092] Using an appropriate amount of cells, electroporate with emmL, which encodes mRNA. Using a BioRad Gene Pulse instrument, 120 × 10 6 Transfect the cells with 80 μg of mRNA. Freeze a small amount of the transfected cells and culture the rest for approximately 24 hours. After 24 hours, irradiate the cells and freeze-store 10 × 10⁶ cells until needed. 6 Dispense into the specified cell vaccine dose.

[0093] The affected animals will receive a total of eight vaccine doses. Each dose will be delivered overnight from the laboratory to the veterinary clinic and will arrive on the scheduled administration date. The veterinarian will administer each dose intradermally using a syringe equipped with a needle. The eight vaccine doses will be administered every seven days (+ / 1 day) for four weeks, then once a month for four months. A blood sample will be taken before the first administration. Subsequent blood samples will be taken before the fifth and eighth vaccine doses, and eight weeks after the last vaccine dose. The blood samples will be processed for peripheral blood and plasma and stored in the laboratory. They will later be used to evaluate the anti-tumor immune response.

[0094] Throughout the course of treatment, the lymph nodes of the affected animals are monitored along with their overall quality of life. The overall disease state is assessed by the reduction in tumor burden and the anti-tumor immune response. Tumor burden is assessed through measurements performed on each lymph node throughout the course of treatment. The anti-tumor immune response is measured using standard enzyme-linked immunosorbent assay (ELISA) to assess antibody levels and flow cytometry to assess cytotoxic T-cell (CTL) response.

[0095] During the course of treatment, the lymph node size of the affected animals increased and then decreased as the treatment process continued. This observation is likely due to the infiltration of immune cells into the tumor site, in this case the lymph nodes. ELISA and flow cytometry results showed an increase in antibody production and CTLs after the fourth vaccination, and this continued after the completion of the series of vaccinations.

[0096] Example 2: Direct mRNA vaccine against equine melanoma A 15-year-old female Andalusian presented with black lesions on her mane and perianal area. Examination of the fine-needle aspiration led the pathologist to diagnose the animal with melanoma. Due to the complex nature of the procedure, which involves surgical removal of the perianal lesions, the owner opted for immunotherapy.

[0097] Three vaccine doses are prepared, each containing 100 μg of mRNA in 100 μL of sterile nuclease-free H2O. The three doses and three needleless injectors (J-Tip) are sent to the veterinarian. Three of the affected animal's lesions are selected to receive the course of treatment, totaling 300 μg of mRNA per dose. Every two weeks, as previously done, three more doses are sent to the veterinary clinic, each dose administered to the same three lesions using the J-Tip device. The affected animal receives a total of six vaccine doses per lesion.

[0098] Blood samples are taken before the start of a series of vaccinations, before the fifth dose, and two weeks after the completion of the series. The blood samples are processed and stored for peripheral blood and plasma. They are later used to evaluate the anti-tumor immune response.

[0099] The overall disease state is assessed by tumor burden reduction and anti-tumor immune response. Tumor burden is assessed through measurements performed on the lesion before each of the six vaccine doses is administered. The anti-tumor immune response is measured using standard ELISA to assess antibody levels and flow cytometry to assess CTL response.

[0100] As seen in other animals undergoing immunotherapy, melanoma lesions initially increase in size, then decrease as the series of vaccines progresses. ELISA and FACS results show increased antibody production and CTLs after the second vaccine, which are expected to persist after completion of the vaccine series.

[0101] Example 3: Overview of the method for preparing emmL mRNA Method Overview: Restriction enzyme digestion of vectors and inserts To construct appropriate recombinant plasmids for optimal mRNA production, a plasmid backbone containing dual prokaryotic and eukaryotic promoters, untranslated 3' and 5' regions, and a selection marker was used. This type of vector, e.g., pSFCMVT7, has several features that assist in the production and stabilization of mRNA encoding an antigenic M-like protein, e.g., Emm55. Both the vector pSFCMVT7 and the insert containing the plasmid pAc / emmL were cleaved using restriction enzymes SacI and EcoRV. See Figures 1 and 2 for plasmid maps.

[0102] Separation of DNA fragments by gel electrophoresis After restriction digestion using appropriate enzymes, DNA fragments were isolated by gel electrophoresis. To evaluate DNA band lengths, a reference DNA ladder was performed using both digestion reactions to aid in identifying the desired bands. Bands containing DNA were extracted from the gel.

[0103] Gel extraction / DNA isolation Gel slices containing the target DNA were solubilized, the DNA was extracted, and the vector and insert were ligated together to prepare the recombinant plasmid pSFCMVT7 / emmL.

[0104] Vector and insert ligation During restriction digestion of the vector and plasmid-containing insert, "sticky ends" were formed, which were later joined in a ligation reaction. "Sticky ends" refer to unpaired nucleotides available for hydrogen bonding with complementary nucleotides. Since the vector pSFCMVT7 and insert emmL were cleaved with the same restriction enzyme, they contain complementary ends that were joined upon exposure to T4 DNA ligase.

[0105] Bacterial transfection After constructing the mRNA-producing plasmid pSFCMVT7 / emmL, it was transformed, or transfected, into competent bacteria that were isolated and produced sufficient DNA for in vitro mRNA synthesis. Invitrogen's Stbl3 E. coli is an example of a bacterial type that can be used for transfection. Modification was induced by subjecting the bacteria to heat shock to open small openings in the cell membrane, which allow the plasmid to enter the cell and ultimately the nucleus.

[0106] Growth and expansion of bacterial cultures Bacteria transfected with plasmids were placed on a suitable growth medium containing a selective antibiotic. In the case of pSFCMVT7, this was kanamycin. When bacteria are correctly transformed with plasmids, they produce proteins that interfere with the antibacterial properties of kanamycin, allowing kanamycin-resistant bacteria to selectively grow on the medium.

[0107] Plasmid isolation and purification Once a sufficient number of bacteria containing pDNA had grown, the cells were lysed to release the plasmid from within the cells. The pDNA was isolated from gDNA, proteins, and other cellular debris by filtration and anion exchange column.

[0108] Preparation of template DNA: Linearization of plasmid DNA The isolated DNA contains template DNA for mRNA production. For the transcription reaction to occur, the plasmid must be linearized. It is important that the linearization occurs downstream of the target open reading frame gene.

[0109] mRNA transcription reaction After the template is prepared, the message is produced by an in vitro transcription reaction. This reaction simulates mRNA transcription in cells, including 5' end capping and the addition of a poly(A) tail for increased stabilization.

[0110] mRNA purification Once the message is transcribed into mRNA, the residual DNA template is degraded, and as a result, the pure mRNA product can be used to transfect autologous cells, allogeneic cells, or tumor cells. Upon entering the cell, the mRNA produces and presents an M-like protein on the cell surface for immune activation.

[0111] mRNA transfection into cancer cells One method that can deliver mRNA to cancer cells is electroporation. This method uses a weak electric current to create tiny pores in the cell membrane, which then allows mRNA to move through the membrane into the cytoplasm.

[0112] Example 4: Restriction enzyme digestion Table 1 shows the procedure for rapid digestion of pDNA. [Table 4]

[0113] Example 5: Separation of DNA fragments by gel electrophoresis Table 2 shows the procedure for separating DNA fragments. [Table 5]

[0114] Example 6: Gel Extraction / DNA Isolation Table 3 shows the extraction and DNA isolation procedures. [Table 6]

[0115] Example 7: Vector and Insert Ligation Table 4 shows the procedure for vector insertion and ligation. [Table 7]

[0116] Example 8: Transformation of DNA into E. coli Table 5 shows the procedure for transforming E. coli. [Table 8]

[0117] Example 9: Growth and expansion of bacterial culture Table 6 shows the growth of bacterial cultures and the procedure for growth. [Table 9]

[0118] Example 10 Isolation and Purification of Plasmids Table 7 shows the procedure for plasmid isolation and purification. [Table 10]

[0119] Example 11 Preparation of template DNA Table 8 shows the procedure for preparing template DNA and linearizing the plasmid. [Table 11]

[0120] Example 12 mRNA Transcription Table 9 shows the procedure for transcribing mRNA. [Table 12]

[0121] Example 13 mRNA purification Table 10 shows the procedure for purifying mRNA. [Table 13]

[0122] Example 14: Transfection of cancer cells with mRNA Table 11 below shows the procedure for transfecting mammalian cancer cells with emmL mRNA. [Table 14]

[0123] Example 15: Cloning steps of DNA pSFCMVT7 / emmL Figure 5 shows the procedure for preparing a recombinant DNA vector to produce mRNA encoding a bacterial antigen.

[0124] Example 16: Direct binding of antibodies to M-like proteins The Western blot shown in Figure 6 demonstrates the specificity of the anti-M-like protein antibody against isolated M-like proteins, particularly Emm55.

[0125] Proteins were separated by SDS-PAGE (10%) using 130 mM β-ME in loading buffer. The samples were boiled at 100°C for 3 minutes and rotated at 13,000xg for 2 minutes at room temperature. The blot (far left) was probed with the primary antibody (α-M-like protein) in 5% milk at room temperature for 1.5 hours. The primary antibody dilution was 1:500. The secondary antibody (goat α-mouse conjugated HRP) was diluted at 1:5000. The null blot (second from the left) shows nonspecific binding of the secondary antibody.

[0126] Chemiluminescence was used to visualize proteins on nitrocellulose blots (exposure: 10 minutes).

[0127] Example 17: Fluorescence microscope images and charts demonstrating increased expression observed in mRNA compared to DNA. We compared the results of experiments in which RNA and DNA were transfected into mammalian cells and protein expression was assayed. The results showed that the same amount of transfected RNA resulted in a five-fold increase in expression (see Figure 7).

[0128] Example 18 Synthesized emmL mRNA, untailed and tailed. The procedure used to obtain the denatured agarose gel shown in Figure 8 demonstrates the visualization of synthesized emmL mRNA, specifically emm55 mRNA, using the Lonza FlashGel system.

[0129] 20 ng of sample and 100 ng of ladder were prepared by diluting the total volume to 2.5 μL using DEPC-treated water. Equal volumes of formaldehyde sample buffer were added to each sample. The samples were mixed and incubated at 65°C for 15 minutes, followed by incubation on ice for 1 minute. The samples were loaded into 1.2% RNA gel cassettes and run at 225 volts for 8 minutes. The gels were incubated at room temperature for 10 minutes and then visualized using a FlashGel camera. mRNA size was determined using an RNA Millennium Marker.

[0130] Example 19 Chart 4 shows the results of an experiment in which mammalian cells were transfected with RNA (emmL mRNA) and DNA (pSFCMVT17 / emmL), stained with α-M-like protein, and assayed using flow cytometry. The results show that RNA-transfected cells showed a signal equivalent to that of DNA-transfected cells, i.e., 9%. [Table 15]

[0131] Example 20 Blood samples from mice vaccinated with either emmL mRNA (treatment) or sterile water (control) were tested for the presence of antibodies that react with emmL protein. As shown in Figure 9, blood samples from control mice (C2) did not contain α-M-like protein antibodies, while samples from treatment mice (T2) showed a slight increase.

[0132] Example 21 Chart 5 shows the results of an experiment in which melanoma tumor cells were transplanted into mice, followed by injection of either emmL mRNA (treatment) or sterile water (control). The injection regimen was started 10 days after tumor transplantation. The regimen consisted of three injections, either treatment or control, administered every 7 days. All five mice in the experiment survived after the second injection. At this point, two of the three treatment mice had smaller tumors than the control mice. Three of the five mice survived after the third injection, and at that point, the tumors in the remaining two treatment mice were still smaller than those in the remaining control mice. [Table 16]

[0133] Example 22 Figure 10 shows the results of an experiment in which mouse blood samples were tested for the presence of antibodies that react with emmL protein before and after vaccination with emmL mRNA. The Western blot image shows that antibody binding from the pre-vaccination sample increased in blood samples collected after vaccination.

[0134] Example 23 The emmL coding region from the pAc / emm55 plasmid is amplified using PCR with high-fidelity Taq DNA polymerase. In one embodiment, the ampereprimer is designed with a proximal element containing a restriction endonuclease site compatible with the pSF-CMV_T7 vector to minimize potentially inhibitory elements in the 5' and 3' UTR of pSFCMVT7 / emmL.

[0135] The proximal design elements include restriction endonuclease recognition sites for NcoI and XhoI, an optimal translation initiation sequence (SEQ ID NO: 4 or 5), and two additional stop codons downstream of the emmL coding region (SEQ ID NO: 6), with respect to T7 RNA polymerase activity. The resulting ampereprimer can be inserted into a PCR cloning vector such as pCR®II-TOPO. Using the resulting plasmid, E. coli is transformed and selected for positive transformation on an agar plate containing a selective antibiotic matching the PCR cloning vector, such as an agar plate containing Luria Bertani broth supplemented with 50-100 μg / mL kanamycin or carbenicillin in the case of pCR®II-TOPO.

[0136] The bacterial cultures containing the obtained plasmid can be expanded by growth in a liquid antibiotic selective medium, for example, in Luria Bertani broth supplemented with 50-100 μg / mL kanamycin or carbenicillin in the case of pCR®II-TOPO. Plasmid DNA can be prepared from these bacterial cultures using methods known to those skilled in the art. The emmL coding region adjacent to the proximal design element can then be excised from the pCR®II-TOPO plasmid DNA using restriction endonucleases NcoI and XhoI. The emmL coding region adjacent to the proximal design element DNA fragment can then be inserted into a pSF-CMV_T7 vector digested with NcoI and XhoI. Following ligation, bacterial transformation, selection for positive transformation on an agar plate containing 50-100 μg / mL kanamycin, expansion in Luria Bertani broth supplemented with 50-100 μg / mL kanamycin, and plasmid DNA preparation using methods known to those skilled in the art, the resulting plasmid, pSF / emmL, can be used as a template for in vitro mRNA synthesis after linearization with restriction endonuclease XhoI. The obtained mRNA and predicted amino acid sequences are shown as SEQ ID NOs. 13 and 14, respectively.

[0137] Example 24 Using a high-fidelity Taq DNA polymerase, the emmL coding region derived from the pAc / emm55 plasmid is amplified with a proximal design element containing a restriction endonuclease site that matches the polylinker region of pT7XLUTR. In one embodiment, this may also include an optimal translation initiation sequence (SEQ ID NO: 4 or 5) and two additional stop codons (SEQ ID NO: 6). The complete sequence of this embodiment is shown in SEQ ID NO: 15. The resulting amplifier can be inserted into a PCR cloning vector such as pCR®II-TOPO. Following the bacterial transformation, selection, amplification, and plasmid DNA preparation described in Example 23, the resulting plasmid can be digested with restriction endonucleases SacI and SpeI to excise the emmL coding region with the proximal design element from pCR®II-TOPO. The emmL coding region with the proximal design element can then be ligated into a pT7XLUTR plasmid vector digested with SacI and SpeI to produce pT7XLUTR / emmL. The obtained pT7XLUTR / emmL plasmid can be used to transform E. coli.

[0138] Following the selection, expansion, and plasmid DNA preparation described in Example 23, the resulting pT7XLUTR / emmL plasmid can be linearized with the restriction endonuclease BamHI and then used as a template for in vitro mRNA synthesis. The resulting mRNA and predicted amino acid sequences are shown as SEQ ID NOs. 15 and 14, respectively.

[0139] Example 25 Using high-fidelity Taq DNA polymerase, the emmL coding region is amplified from the pAc / emm55 plasmid with minimal 5' and 3' UTR. The T7 RNA polymerase promoter sequence (SEQ ID NO: 8) is added as a proximal design element along with an optimal translation start sequence (SEQ ID NO: 4 or 5), two additional stop codons (SEQ ID NO: 6), and an XhoI restriction endonuclease site.

[0140] The obtained PCR product can be inserted into a PCR cloning vector such as pCR(registered trademark)II-TOPO. Following the bacterial transformation, selection, expansion, and plasmid DNA preparation described in Example 23, the obtained plasmid pT7 / emmL can be used as a template for in vitro mRNA synthesis after linearization with restriction endonuclease XhoI. The obtained mRNA and predicted amino acid sequences are shown as SEQ ID NOs. 16 and 14, respectively.

[0141] In Examples 23-25, the mRNA encoding emmL can be produced using an in vitro transcription reaction. Several modifications can be made to the obtained mRNA in this reaction to improve the stability and translation efficiency of the mRNA and EmmL protein and to reduce mRNA immunogenicity. For example, but not limited to, modified nucleic acids such as anti-reverse cap analogs [ARCA, P1-(5'-(3'-O-methyl)-7-methyl-guanosyl)P3-(5'-(guanosyl)) triphosphates], N1-methyl-guanosine, 2'-fluoro-guanosine, 7-deaza-guanosine, inosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine can be added to the 5' end of the emmL mRNA.

[0142] In other examples, a polyadenylated [poly(A)] tail of adenosine monophosphate approximately 50–200 years in length can be attached to the 3' end of emmL mRNA, or both a 5' modified nucleotide cap and a poly(A) tail can be attached to emmL mRNA.

[0143] emmL mRNA can be synthesized using ribonucleotide analogs. Chemical modifications can be performed at this stage to further improve translation efficiency and stability. Examples include 5-methylcytidine-5'-triphosphate, pseudouridine-5'-triphosphate, 2-thiouridine-5'-triphosphate, and N1-methylpsoiduridine-5'-triphosphate.

[0144] Sequence ID 4 The optimal degenerate DNA sequence for translation initiation. R is A or G, Y is C or T, M is A or C, and V is A, C, or G. RYMRMVATGGC

[0145] Sequence ID 5 The optimal DNA sequence for translation initiation. ATAGCCATGGC

[0146] Sequence ID 6 A DNA sequence containing two stop codons. TAATGA

[0147] Sequence ID 7 DNA sequences of restriction endonuclease recognition sites for SacI, NotI, BglII, EcoRV, and SpeI. GAGCTCGCGGCCGCAGATCTGATATCACTAGT

[0148] Sequence ID 8 DNA sequence of the T7 RNA polymerase promoter. TAATACGACTCACTATAG

[0149] Sequence ID 9 The 50 ribonucleotides in the 5' untranslated region of the African clawed fox betaglobin gene. aagcuucuuguucuuuuugcagaagcucagaauaaacgcucaacuuuggc

[0150] Sequence ID 10 The 74 ribonucleotides in the 3' untranslated region of the African clawed flea betaglobin gene. cuuuuugaugccauugccgacgcccuuggcaaggguuaccacuaaaccagccucaagaacacccgaauggaguc

[0151] Sequence ID 11 DNA sequences of the restriction endonuclease recognition sites of BamHI, EcoRI, and XbaI. GGATCCGAATTCTCTAGA

[0152] Sequence ID 12 DNA sequences of synthetic double-stranded DNA molecules used to prepare pT7XLUTR. Restriction endonuclease recognition sites for T7RNA polymerase, SacI, NotI, BglII, EcoRV, SpeI, as well as BamHI, EcoRI, and XbaI are underlined. JPEG0007836267000017.jpg32164

[0153] Sequence ID 13 (RNA sequence from Example 23) Synthetic mRNA sequence after in vitro mRNA synthesis of emmL from a plasmid template written from 5' to 3' to an mRNA molecule. Anti-reverse cap analog (ARCA) is added to the 5' end of the transcript, and approximately 50-200 adenosine monophosphate (a 50-200 The ) is added to the 3' end of the transcript during in vitro transcription. The 5' lowercase letter is the 5' untranslated region (UTR) derived from the pSF-T7_CMV plasmid vector. The guanine (g) immediately following the ARCA cap is the +1 ribonucleotide produced by T7RNA polymerase. Bold indicates the ribonucleotide added to create the underlined 5'NcoI restriction endonuclease site, and the optimal translation initiation sequence. Uppercase letters indicate the coding sequence of emmL. At the 3' end of the mRNA sequence, bold indicates two further stop codons. The 3'XhoI restriction endonuclease site is underlined. JPEG0007836267000018.jpg226164

[0154] Sequence ID 14 (Predicted protein sequences for Examples 23-25) The amino acid sequences of the emmL transcripts produced in Examples 2-4 were predicted one letter at a time. * indicates a stop codon. *

[0155] Sequence ID 15 (RNA sequence of Example 24) Synthetic mRNA sequences after in vitro mRNA synthesis of emmL from a pT7XLURT plasmid template linearized with restriction endonuclease BamHI, described from 5' to 3' for the mRNA molecule. An anti-reverse cap analog (ARCA) was added to the 5' end of the transcript, and approximately 50-200 adenosine monophosphate (a 50-200) is added to the 3' end of the transcript during in vitro transcription. The guanine (g) immediately following the ARCA cap is a +1 ribonucleotide produced by T7 RNA polymerase. The lowercase 5' letter originates from the 5' untranslated region of the African clawed frog betaglobin gene. Bold indicates the ribonucleotide added to create the optimal translation initiation sequence. The SacI restriction endonuclease site at 5' in the emmL coding region is underlined. Uppercase indicates the coding sequence of emmL. The lowercase 3' in the coding region is the 3' untranslated region of the African clawed frog betaglobin gene. At the 3' end of the mRNA sequence, bold indicates two further stop codons. The SpeI and BamHI restriction endonuclease sites are underlined. JPEG0007836267000019.jpg223164

[0156] Sequence ID 16 (RNA sequence of Example 24) Synthetic mRNA sequence after in vitro mRNA synthesis of emmL from a plasmid template, described from 5' to 3' for the mRNA molecule. An anti-reverse cap analog (ARCA) is added to the 5' end of the transcript, and approximately 50-200 adenosine monophosphate (a) 50-200 ) is added to the 3' end of the transcript during in vitro transcription. The guanine (g) immediately following the ARCA cap is a +1 ribonucleotide produced by T7 RNA polymerase. Bold indicates the ribonucleotide added to create the optimal translation initiation sequence. Uppercase letters indicate the coding sequence of emmL. At the 3' end of the mRNA sequence, bold indicates two further stop codons. The 3'XhoI site is underlined. JPEG0007836267000020.jpg203164

[0157] Example 26 A codon optimization algorithm was also used to synthesize emm55 mRNA. Emm55 expression was measured and compared to determine the relative increase in protein synthesis and stability in mammalian cells. When each mRNA was synthesized in vitro using wild-type uridine (WT), it was shown that N1-methylpsoiduridine (N1) improved protein expression.

[0158] Streptococcus pyogenesemm Three different algorithms were used to optimize the nucleotide sequence of emm55 from expression in the lab to expression in humans. Codon optimization was performed using the JCat algorithm (Grote2005) and two proprietary algorithms performed by the Karolinska Institute (FreqDist and MostFreq). mRNAs designed by the three algorithms were synthesized in vitro by TriLink® Biotechnologies using both wild-type (WT) uridine and chemically modified N1-methylpsoiduridine (N1), and can increase mRNA stability and protein expression levels in vitro (Svitkin2017) and in vivo (Pardi2015). The final nucleotide sequence of each mRNA is shown as SEQ ID NO: 17, SEQ ID NO: 18, and SEQ ID NO: 19. As part of the design, the BbsI and BspQI restriction endonuclease sites were removed by base substitution from emm55JCat and emm55MostFreq to facilitate cloning into the TriLink® plasmid vector used for in vitro mRNA synthesis.

[0159] mRNA was received along with each tube of mRNA supplied by TriLink® Biotechnologies and added as a stock item to allow for independent tracking of each tube. The mRNA was stored at -80°C. Quality control tests were performed to verify purity and integrity using RD3-75.1. However, the mRNA was dispensed by TriLink® Biotechnologies, not according to the SOP (Standard Operating Procedure).

[0160] mRNA was transiently transfected into attachment-enhanced HEK sublines HEK293T-AE and B16-F10 cells using RD3-79.1 (2.5 μg mRNA / well). Cells were transfected with pAc / emm55 using RD3-34.2 (4 μg pDNA / well). 2–48 hours after transfection, cells were lysed in RIPA buffer using RD3-83.1, and the protein concentration of the lysate was determined by a BCA assay using RD3-14.2.

[0161] EGFP mRNA and pDNA were used as transfection-positive and Emm55 expression-negative controls. First, lysates were separated using denatured SDS-PAGE, Western-blotted, stained with chicken anti-Emm55, and detected by chemiluminescence using RD3-74.1. Bands corresponding to the size of Emm55 consistently outperformed the peroxidase detection reaction, resulting in unquantifiable bands. Appropriate dilutions of chicken anti-Emm55 or goat anti-chicken-horseradish peroxidase to increase the upper limit of the detection range were not discernible. For this reason, Emm55 protein detection was performed using the ProteinSimple Wes® capillary electrophoresis system with chicken anti-Emm55. This system degrades proteins and protein / antibody complexes in reduced SDS-PAGE capillary tubes to provide antibody-bound quantification, similar to Western blot data. These assays were performed using the manufacturer's provided protocol.

[0162] The Wes® assay measures the level of Emm55 in cell lysates normalized to the level of ERK1, a serine / threonine kinase regulated by phosphorylation rather than protein levels, thus creating a protein suitable for data normalization within cell or tissue types. This approach has advantages over internal whole protein normalization as it can be multiplexed with Emm55 detection, provides sample loading controls, and cuts the number of sample assays that need to be performed by half. To establish the linearity of this assay, a standard curve was constructed using 10 ng to 30 pg of rEmm55 in 1.5 μg of untransfected HEK293T-AE lysate. Antibody dilutions for the Wes® assay were 1:100 chicken anti-Emm55 and 1:100 goat anti-chicken HRP.

[0163] Instructions for the Wes® assay assembly refer to the input protein concentration, not the mass. Experiments using Wes® were performed with cell lysates of 0.1, 0.25, and 0.5 μg / μL. 0.5 μg / μL yielded results within the Wes® dynamic range using B16-F10 cell lysates, while 0.25 and 0.5 μg / μL HEK293T lysates produced expression levels exceeding detection capabilities at peak onset. The 0.1 μg / μL lysate concentration was found to be optimal at all time points, but lower concentrations can be used to provide a wider dynamic range when high levels of expression are expected. However, these lower input concentrations may miss low but biologically meaningful expression levels, particularly at early and late time points.

[0164] Data normalization was performed by dividing the Wes® numerical output value of Emm55 by the output value of ERK1. In experiments using data replication, normalization was performed for each sample, and then the mean ± standard deviation (n=3) was calculated. At one time point (0.1 μg / μL emm55JCat-WT 12 hours after transfection), an abnormally low ERK1 level resulted in one normalized data point based on the Grubbs limit studentization deviation test. In this case, the mean was calculated from the remaining two replica data points. One-way ANOVA using both Bonferroni post-hoc tests was performed using GraphPad Prism software to determine the significance of the mean difference. Significant findings were confirmed using Tukey post-hoc tests.

[0165] The Codon Adaptability Index (CAI) was calculated for each codon of emm55 using the JCat algorithm. This algorithm returns a score of 1.0 if the mRNA sequence is perfectly optimized for translation in human cells. Figure 12 shows the relative adaptability of emm55 before and after JCat optimization. The relative adaptability plots for emm55 are shown in Figures 12A and 12B.

[0166] The results showed that codon-modified emm55 mRNA drove potent expression of the Emm55 polypeptide in vitro after transient transfection of human HE293T cells and mouse B16-F10 melanoma cells. While a comparison of protein levels to transfection levels using pAc / Emm55(DNA) was not quantitative because a single copy of pDNA produces many copies of mRNA, it showed that WT and N1-modified Emm55JCat expressed significantly higher levels of Emm55 in HEK293 cells between 4 and 12 hours post-transfection. Peak Emm55 expression from Emm55JCat mRNA occurred approximately 12 hours post-transfection and was detected at 48 hours.

Claims

1. A human codon-optimized ribonucleic acid transcribed from a template nucleic acid selected from the group consisting of SEQ ID NOs: 17, SEQ ID NOs: 18, and SEQ ID NOs: 19, which is codon-optimized for polypeptide expression in transfected mammalian cells.

2. The template nucleic acid is the human codon-optimized ribonucleic acid according to claim 1, wherein the template nucleic acid has the sequence of sequence number 19.

3. The human codon-optimized ribonucleic acid according to claim 1, wherein the mammalian cell is a cancer cell.

4. The human codon-optimized ribonucleic acid according to claim 3, wherein the cancer cells are carcinoma, sarcoma, myeloma, lymphoma, or leukemia cells.

5. The polypeptide expressed in the cell has the sequence of Sequence ID No. 14, according to claim 1.

6. The human codon-optimized ribonucleic acid according to claim 1, wherein the amount of polypeptide expressed in mammalian cells transformed with the ribonucleic acid is increased compared to the expression from the corresponding non-codon-optimized ribonucleic acid.

7. The human codon-optimized ribonucleic acid according to claim 1, wherein the template nucleic acid has the sequence of sequence number 17.

8. The human codon-optimized ribonucleic acid according to claim 1, wherein the template nucleic acid has the sequence of sequence number 18.

9. Isolated cancer cells comprising human codon-optimized ribonucleic acid according to any one of claims 1 to 8.

10. A method for manufacturing cancer vaccines, (a) The process of preparing cancer cells, (b) a step of delivering the human codon-optimized ribonucleic acid described in any one of claims 1 to 8 to cancer cells in vitro. method.

11. Human codon-optimized ribonucleic acid according to any one of claims 1 to 8, for use in the treatment of cancer.

Images