Methods and compositions relating to GLP1R variants

Abstract

Provided herein are methods and compositions for a glucagon-like peptide-1 receptor (GLP1R) library that contains nucleic acids encoding immunoglobulins that bind to GLP1R.The libraries described herein include diversified libraries, each containing nucleic acids that encode predetermined variants of at least one predetermined reference nucleic acid sequence.The protein library that is generated when the nucleic acid library is translated is further described herein.The library of cells that expresses the diversified nucleic acid library described herein is further described herein.

Description

[Technical Field]

[0001] cross reference This application claims the interests of U.S. Provisional Patent Application No. 63 / 070,734, filed on 26 August 2020, and U.S. Provisional Patent Application No. 63 / 081,801, filed on 22 September 2020, each of which is incorporated herein by reference in whole. [Background technology]

[0002] G protein-coupled receptors (GPCRs) are involved in a wide variety of diseases. Because GPCRs are often expressed at low levels within cells and are highly unstable during purification, developing antibodies against them has been difficult due to problems in obtaining appropriate antigens. Therefore, improved drugs for therapeutic interventions targeting GPCRs are needed.

[0003] Embedding by reference All publications, patents, and patent applications referenced herein are incorporated by reference to the same extent as each individual publication, patent, or patent application is specifically and individually indicated as being incorporated by reference. [Overview of the project]

[0004] Antibodies or antibody fragments that bind to GLP1R, comprising an immunoglobulin heavy chain and an immunoglobulin light chain, are provided herein, wherein (a) the immunoglobulin heavy chain has an amino acid sequence that is at least about 90% identical to that shown in Table 9, and (b) the immunoglobulin light chain has an amino acid sequence that is at least about 90% identical to that shown in Table 10. Further antibodies or antibody fragments are provided herein, wherein the antibody is a monoclonal antibody, a polyclonal antibody, a bispecific antibody, a multispecific antibody, a transplant antibody, a human antibody, a humanized antibody, a synthetic antibody, a chimeric antibody, a camelized antibody, a single-chain Fv(scFv), a single-chain antibody, a Fab fragment, a F(ab')2 fragment, a Fd fragment, a Fv fragment, a single-domain antibody, an isolated complementarity-determining region (CDR), a diabody, a fragment consisting only of a single monomeric variable domain, a disulfide-linked Fv(sdFv), an intrabody, an anti-idiotype (anti-Id) antibody, or an ab antigen-binding fragment thereof. Further details herein are provided of antibodies or antibody fragments that are chimeric or humanized. Further details herein are provided of antibodies or antibody fragments having an EC50 of less than about 25 nanomoles in a cAMP assay. Further details herein are provided of antibodies or antibody fragments having an EC50 of less than about 20 nanomoles in a cAMP assay. Further details herein are provided of antibodies or antibody fragments having an EC50 of less than about 10 nanomoles in a cAMP assay. Further details herein are provided of antibodies or antibody fragments that are agonists of GLP1R. Further details herein are provided of antibodies or antibody fragments that are antagonists of GLP1R. Further details herein are provided of antibodies or antibody fragments that are allosteric modulators of GLP1R. An antibody or antibody fragment, further provided herein, is a GLP1R allosteric modulator that is negative.

[0005] Methods for treating metabolic diseases or disorders comprising administering an antibody or antibody fragment conjugated to GLP1R are further provided herein, wherein the antibody or antibody fragment comprises the sequences shown in Tables 7-13. Methods are further provided herein, wherein the antibody is a monoclonal antibody, polyclonal antibody, bispecific antibody, multispecific antibody, transplant antibody, human antibody, humanized antibody, synthetic antibody, chimeric antibody, camelized antibody, single-chain Fv(scFv), single-chain antibody, Fab fragment, F(ab')2 fragment, Fd fragment, Fv fragment, single-domain antibody, isolated complementarity-determining region (CDR), diabody, fragment consisting only of a single monomeric variable domain, disulfide-bound Fv(sdFv), intrabody, anti-idiotype (anti-Id) antibody, or their ab antigen-binding fragments. Methods in which the antibody or antibody fragment is chimeric or humanized are further provided herein. Methods are further provided herein, wherein the antibody or antibody fragment has an EC50 of less than about 25 nanomoles in a cAMP assay. A method is further provided herein, wherein the antibody or antibody fragment has an EC50 of less than about 20 nanomoles in a cAMP assay. A method is further provided herein, wherein the antibody or antibody fragment has an EC50 of less than about 10 nanomoles in a cAMP assay. A method is further provided herein, wherein the antibody or antibody fragment is a GLP1R agonist. A method is further provided herein, wherein the antibody or antibody fragment is a GLP1R antagonist. A method is further provided herein, wherein the antibody or antibody fragment is an allosteric modulator of GLP1R. A method is further provided herein, wherein the allosteric modulator of GLP1R is a negative allosteric modulator. A method is further provided herein, wherein the antibody or antibody fragment is an allosteric modulator. A method is further provided herein, wherein the antibody or antibody fragment is a negative allosteric modulator. A method is further provided herein, wherein the metabolic disorder or impairment is type II diabetes or obesity.

[0006] An antibody or antibody fragment comprising a variable domain (heavy chain region, VH) and a variable domain (light chain region, VL) is provided herein, wherein VH comprises complementarity-determining regions CDRH1, CDRH2, and CDRH3, and VL comprises complementarity-determining regions CDRL1, CDRL2, and CDRL3, and (a) the amino acid sequence of CDRH1 is as shown in any one of SEQ ID NOs. 441 to 619, (b) the amino acid sequence of CDRH2 is as shown in any one of SEQ ID NOs. 620 to 798, (c) the amino acid sequence of CDRH3 is as shown in any one of SEQ ID NOs. 799 to 977, (d) the amino acid sequence of CDRL1 is as shown in any one of SEQ ID NOs. 978 to 1156, and (e) the amino acid sequence of CDRL2 is as shown in SEQ ID NOs. 1157 to 1156 1335 As shown in one of the following, (f) the amino acid sequence of CDRL3 is: 1336 ~1347 and 1353-1519The antibodies or antibody fragments are provided herein, which are monoclonal antibodies, polyclonal antibodies, bispecific antibodies, multispecific antibodies, transplant antibodies, human antibodies, humanized antibodies, synthetic antibodies, chimeric antibodies, camelized antibodies, single-chain Fv(scFv), single-chain antibodies, Fab fragments, F(ab')2 fragments, Fd fragments, Fv fragments, single-domain antibodies, isolated complementarity-determining regions (CDRs), diabodies, fragments consisting only of a single monomeric variable domain, disulfide-bonded Fv(sdFv), intrabodies, anti-idiotype (anti-Id) antibodies, or ab antigen-binding fragments thereof. The antibodies or antibody fragments are provided herein, which are chimeric or humanized. The antibodies or antibody fragments are provided herein, which have an EC50 of less than about 25 nanomoles in a cAMP assay. An antibody or antibody fragment is further provided herein, the antibody or antibody fragment having an EC50 of less than about 20 nanomoles in a cAMP assay. An antibody or antibody fragment is further provided herein, the antibody or antibody fragment having an EC50 of less than about 10 nanomoles in a cAMP assay. An antibody or antibody fragment is further provided herein, the antibody or antibody fragment is an agonist of GLP1R. An antibody or antibody fragment is further provided herein, the antibody or antibody fragment is an antagonist of GLP1R. An antibody or antibody fragment is further provided herein, the antibody or antibody fragment is an allosteric modulator of GLP1R. An antibody or antibody fragment is further provided herein, the allosteric modulator of GLP1R is a negative allosteric modulator. An antibody or antibody fragment is further provided herein, VH contains a sequence that is at least about 90% identical to any one of SEQ ID NOs. 58-77. An antibody or antibody fragment is further provided herein, wherein VH contains the sequence of any one of SEQ ID NOs. 58-77. An antibody or antibody fragment is further provided herein, wherein VL contains the sequence of any one of SEQ ID NOs. 92-111 that is at least about 90% identical.An antibody or antibody fragment is further provided herein, wherein VL comprises one of the sequences of sequence numbers 92 to 111.

[0007] A method for treating a metabolic disease or disorder is provided herein, comprising administering an antibody or antibody fragment that binds to GLP1R, comprising a heavy chain variable domain region (VH) and a light chain variable domain region (VL), wherein VH comprises complementarity-determining regions CDRH1, CDRH2 and CDRH3, and VL comprises complementarity-determining regions CDRL1, CDRL2 and CDRL3, wherein (a) the amino acid sequence of CDRH1 is as shown in any one of SEQ ID NOs: 441-619, (b) the amino acid sequence of CDRH2 is as shown in any one of SEQ ID NOs: 620-798, (c) the amino acid sequence of CDRH3 is as shown in any one of SEQ ID NOs: 799-977, (d) the amino acid sequence of CDRL1 is as shown in any one of SEQ ID NOs: 978-1156, and (e) the amino acid sequence of CDRL2 is as shown in SEQ ID NOs: 1157- 1335 As shown in one of the following, (f) the amino acid sequence of CDRL3 is: 1336 ~1347 and 1353-1519As shown in any one of the following: Methods are further provided herein, in which the antibody is a monoclonal antibody, polyclonal antibody, bispecific antibody, multispecific antibody, transplant antibody, human antibody, humanized antibody, synthetic antibody, chimeric antibody, camelized antibody, single-chain Fv(scFv), single-chain antibody, Fab fragment, F(ab')2 fragment, Fd fragment, Fv fragment, single-domain antibody, isolated complementarity-determining region (CDR), diabody, fragment consisting only of a single monomeric variable domain, disulfide-bonded Fv(sdFv), intrabody, anti-idiotype (anti-Id) antibody, or ab antigen-binding fragment thereof. Methods in which the antibody or antibody fragment is chimeric or humanized are further provided herein. Methods are further provided herein, in which the antibody or antibody fragment has an EC50 of less than about 25 nanomoles in a cAMP assay. Methods are further provided herein, in which the antibody or antibody fragment has an EC50 of less than about 20 nanomoles in a cAMP assay. A method is further provided herein, wherein the antibody or antibody fragment has an EC50 of less than about 10 nanomoles in a cAMP assay. A method is further provided herein, wherein the antibody or antibody fragment is an agonist of GLP1R. A method is further provided herein, wherein the antibody or antibody fragment is an antagonist of GLP1R. A method is further provided herein, wherein the antibody or antibody fragment is an allosteric modulator of GLP1R. A method is further provided herein, wherein the allosteric modulator of GLP1R is a negative allosteric modulator. A method is further provided herein, wherein the antibody or antibody fragment is an allosteric modulator. A method is further provided herein, wherein the antibody or antibody fragment is a negative allosteric modulator. A method is further provided herein, wherein VH contains a sequence that is at least about 90% identical to any one of SEQ ID NOs. 58-77. A method is further provided herein, wherein VH contains a sequence that is at least about 90% identical to any one of SEQ ID NOs. 58-77. A method is further provided herein, wherein VL contains a sequence that is at least about 90% identical to any one of sequence numbers 92-111.A method is further provided herein, wherein VL comprises one of the sequences of sequence numbers 92 to 111. A method is further provided herein, wherein the metabolic disorder or impairment is type II diabetes or obesity.

[0008] Nucleic acid compositions provided herein include: a) a first nucleic acid encoding a heavy chain variable domain region (VH) comprising complementarity-determining regions CDRH1, CDRH2, and CDRH3, wherein (i) the amino acid sequence of CDRH1 is as shown in any one of SEQ ID NOs. 441 to 619, (ii) the amino acid sequence of CDRH2 is as shown in any one of SEQ ID NOs. 620 to 798, and (iii) the amino acid sequence of CDRH3 is as shown in any one of SEQ ID NOs. 799 to 977; and b) a second nucleic acid encoding a light chain variable domain region (VL) comprising complementarity-determining regions CDRL1, CDRL2, and CDRL3, wherein (i) the amino acid sequence of CDRL1 is as shown in any one of SEQ ID NOs. 978 to 1156, and (ii) the amino acid sequence of CDRL2 is as shown in SEQ ID NOs. 1157 to 977. 1335 (iii) The amino acid sequence of CDRL3 is as shown in one of the following: 1336 ~1347 and 1353-1519 It contains a second nucleic acid, as shown in any one of the following:

[0009] A nucleic acid composition provided herein comprises: a) a first nucleic acid encoding a heavy chain variable domain region (VH) having an amino acid sequence that is at least about 90% identical to the sequence shown in any one of SEQ ID NOs. 58 to 77; b) a second nucleic acid encoding a light chain variable domain region (VL) having at least about 90% identical to the sequence shown in any one of SEQ ID NOs. 92 to 111; and an excipient. A nucleic acid composition is further provided herein, wherein the VH comprises the amino acid sequence shown in any one of SEQ ID NOs. 58 to 77. A nucleic acid composition is further provided herein, wherein the VL comprises the amino acid sequence shown in any one of SEQ ID NOs. 92 to 111. A nucleic acid composition is further provided herein, wherein the VH comprises the amino acid sequence shown in any one of SEQ ID NOs. 58 to 77, and the VL comprises the amino acid sequence shown in any one of SEQ ID NOs. 92 to 111. [Brief explanation of the drawing]

[0010] [Figure 1A] A schematic diagram of immunoglobulins is shown below. [Figure 1B] A second schematic diagram of immunoglobulins is shown. [Figure 2] A schematic diagram of the motif for placement on immunoglobulins is shown. [Figure 3] A step-by-step diagram illustrating an exemplary process workflow for gene synthesis disclosed herein is shown. [Figure 4] An example of a computer system is shown. [Figure 5] This is a block diagram showing the architecture of a computer system. [Figure 6] This diagram shows a network configured to incorporate multiple computer systems, multiple mobile phones and personal digital assistants, and network-attached storage (NAS). [Figure 7] This is a block diagram of a multiprocessor computer system that uses a shared virtual address memory space. [Figure 8A]A schematic diagram of an immunoglobulin containing a VH domain bound to a VL domain using a linker is shown. [Figure 8B] A schematic diagram of the complete domain structure of immunoglobulin, including the VH domain bound to the VL domain using a linker, leader sequence, and pIII sequence, is shown. [Figure 8C] This diagram shows a schematic representation of the four framework elements (FW1, FW2, FW3, FW4) and the variable 3CDR (L1, L2, L3) elements for the VL or VH domain. [Figure 9A] The structure of glucagon-like peptide 1 (GLP-1, cyan), PDB entry 5VAI, which forms a complex with the GLP-1 receptor (GLP-1R, gray), is shown. [Figure 9B] The crystal structure of the CXCR4 chemokine receptor (gray), PDB entry 3OR0, is shown, complexed with the cyclic peptide antagonist CVX15 (blue). [Figure 9C] The crystal structure of the human smoothund receptor, PDB entry 5L7D, which has a gray transmembrane domain and an orange extracellular domain (ECD), is shown. The ECD contacts the TMD via extracellular loop 3 (ECL3). [Figure 9D] The structure of GLP-1R (gray) formed in complex with Fab (magenta), PDB entry 6LN2, is shown. [Figure 9E] The crystal structure of CXCR4 (gray), PDB entry 4RWS, is shown, which forms a complex with the viral chemokine antagonist viral macrophage inflammatory protein 2 (vMIP-II, green). [Figure 10] A schematic diagram of the library design focusing on GPCRs is shown. It includes two germline heavy chains VH1-69 and VH3-30, four germline light chains IGKV1-39 and IGKV3-15, and IGLV1-51 and IGLV2-14. [Figure 11]This graph shows the length distribution of HCDR3 in a GPCR-focused library compared to the length distribution in a B cell population derived from three healthy adult donors. In total, 2,444,718 unique VH sequences from the GPCR library and 2,481,511 unique VH sequences from the human B cell repertoire were analyzed to generate the length distribution plots. [Figure 12A] We present the design of overexpression GLP-1R CHO cells for phage antibody library selection. GLP-1R expression was confirmed by dual detection gating of GFP green fluorescence and surface expression with a Flag tag on the cell surface. [Figure 12B] This demonstrates a cell-based panning process. [Figure 13] This graph shows the proportion of unique HCDR3 in the output pool for five GLP-1R panning cycles. [Figure 14] The graph shows binding plots for 13 unique GLP-1R hits compared to binding in parental CHO cells. [Figure 15] The HCDR3 loop sequences of 13 unique GLP1R binders are shown. Six clones possess a GLP-1 motif, four clones possess a GLP-2 motif, and three clones lack either a GLP-1 or GLP-2 motif. In clones possessing a GLP-1 or GLP-2 motif, residues similar to the GLP-1 or GLP-2 sequence are colored black, and different residues are colored red. Functional antagonists in the cAMP assay are highlighted in yellow. [Figure 16A] The graphs show orthosteric inhibition of GLP1R-3 binding in the absence and presence of GLP-1(7-36). [Figure 16B] This graph shows the effect of GLP1R-3 on GLP-1 activation in the cAMP assay. [Figure 16C] This graph shows the effect of GLP1R-3 on GLP-1-induced β-arrestin recruitment. [Figure 17]The design of GLP1R-59-2 is shown. The GLP1(7-36) peptide was ligated to the N-terminus of the light chain of the functionally inactive GLP-1R-binding antibody GLP1R-2. [Figure 18A] The graph shows GLP1R-59-2, which specifically binds to GLP-1R having an EC50 of 15.5 nM. [Figure 18B] The graph shows the GLP1R-59-2 levels in a cAMP assay using EC50 similar to that of the GLP-1 7-36 peptide. [Figure 18C] The graph shows the GLP1R-59-2 activity when β-arrestin recruitment was induced in GLP-1R-expressing cells. [Figure 19A] This report shows the in vivo pharmacokinetic (PK) and pharmacological (PD) effects of GLP1R-3 and GLP1R-59-2. Based on β-phase calculations, GLP1R-3 has a half-life of 1 week in rats. [Figure 19B] This study shows the in vivo pharmacokinetic (PK) and pharmacological (PD) effects of GLP1R-3 and GLP1R-59-2. GLP1R-59-2 has a half-life of 2 days in rats. [Figure 20A] The graph shows the GLP1R-59-2 response to glucose after glucose loading. [Figure 20B] This graph shows the area under the curve (AUC) for a glucose tolerance test (GTT). [Figure 21A] The graph shows the results of a 19+2 hour drug regimen involving GLP1R-3 and GLP-1 peptide exendin 9-39. [Figure 21B] The graph shows the area under the curve (AUC) in an insulin loading test (ITT). [Figure 22A] The graph shows the comparison of a single 6-hour administration regimen of GLP1R-3 treatment after insulin loading with GLP-1 peptide exendin 9-39 (1.0 or 0.23 mg / kg dose) or a control. [Figure 22B] The graph shows the area under the curve (AUC) for GLP-1R-3 (20 mg / kg) treatment at 6 hours in ITT. [Figure 23A] The graph shows the effects of a single 6-hour dose regimen of GLP1R-3 treatment after insulin loading compared to GLP1R-226-1, GLP1R-226-2, or a control. [Figure 23B] The area under the curve (AUC) of the graphs for GLP1R-3 treatment after insulin loading, single 6-hour administration regimens, compared to GLP1R-226-1, GLP1R-226-2, or control, is shown. [Figure 24A] This is a schematic diagram of the panning strategies of GLP1R-221 and GLP1R-222 variants. [Figure 24B] This is a schematic diagram of the panning strategies of GLP1R-221 and GLP1R-222 variants. [Figure 25A] This graph shows the competitive data for GLP1R-221 and GLP1R-222 variants. [Figure 25B] This graph shows the competitive data for GLP1R-221 and GLP1R-222 variants. [Figure 26] This is a graph of GLP1R-221 and GLP1R-222 mutants in the cAMP assay. [Modes for carrying out the invention]

[0011] This disclosure uses prior molecular biology techniques within the scope of the art, unless otherwise noted. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art.

[0012] definition

[0013] Throughout this disclosure, various embodiments are presented in the form of scopes. It should be understood that the scope descriptions are for convenience and brevity only and should not be interpreted as inflexible limitations on the scope of any embodiment. Therefore, unless otherwise explicitly stated in the context, the scope descriptions should be considered to disclose all possible partial scopes and the individual numerical values ​​within those scopes specifically to a tenth of a unit. For example, a scope description of 1–6 should be considered to specifically disclose partial scopes such as 1–3, 1–4, 1–5, 2–4, 2–6, 3–6, and the individual values ​​within those scopes, e.g., 1.1, 2, 2.3, 5, and 5.9. This applies regardless of the width of the scope. The upper and lower limits of the scopes between these may independently fall within smaller scopes and are included in this disclosure, subject to any specifically excluded limits of any of the described scopes. If the described scope includes one or both of the limits, the scope excluding one or both of those limits is also included in this disclosure, unless otherwise clearly indicated in the context.

[0014] The terms used herein are for the purpose of describing specific embodiments only and are not intended to limit any embodiments. Where used herein, the singular forms “a,” “an,” and “the” are intended to include the plural form unless the context clearly indicates otherwise. The terms “comprises” and / or “comprising,” where used herein, indicate the presence of the described features, integers, steps, actions, elements, components, and / or groups, but are not intended to exclude the presence or addition of one or more other features, integers, steps, actions, elements, components, and / or groups thereof. Where used herein, the terms “and / or” include any combination of one or more of the related enumerated items.

[0015] Where used herein, unless otherwise specified or the context makes clear, the term “about” with respect to a number or range of numbers is understood to mean the number and its range plus or minus 10%, or, for any range, 10% below the stated lower limit and 10% above the stated upper limit for the stated value.

[0016] Unless otherwise specified, the term “nucleic acid” as used herein includes double-stranded or triple-stranded nucleic acids, as well as single-stranded molecules. In double-stranded or triple-stranded nucleic acids, the nucleic acid strands do not need to have the same extent (i.e., a double-stranded nucleic acid does not need to be double-stranded along the entire length of both strands). When provided, nucleic acid sequences are listed in the 5' to 3' direction unless otherwise specified. The methods described herein result in the production of isolated nucleic acids. The methods described herein further result in the production of isolated and purified nucleic acids. As used herein, “nucleic acids” may include base lengths of at least 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, or more. Furthermore, this specification provides methods for synthesizing any number of polypeptide segments encoding nucleotide sequences, e.g., sequences encoding non-ribosomal peptides (NRPs), sequences encoding non-ribosomal peptide synthase (NRPS) modules and synthetic variants, polypeptide segments of other module proteins, e.g., antibodies, polypeptide segments from other protein families, e.g., non-coding DNA or RNA, e.g., regulatory sequences, e.g., promoters, transcription factors, enhancers, nucleotides, shRNA, RNAi, miRNA, microRNAs, small nucleolar RNAs, or any functional or structural DNA or RNA unit of interest. The following are non-limiting examples of polynucleotides.Specifically, these include coding or non-coding regions of genes or gene fragments, intergenetic DNA, loci determined by linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, short interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), nucleolar small RNA, ribozymes, complementary DNA (cDNA), which is the DNA presentation of mRNA and is usually obtained by reverse transcription or amplification of messenger RNA (mRNA), synthesized or amplified DNA molecules, genomic DNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. The cDNA encoding a gene or gene fragment referred to herein may include at least one region encoding an exon sequence that does not contain intervening intron sequences in the genomic equivalent sequence.

[0017] GPCR Library for GLP1 Receptors

[0018] Methods and compositions relating to G protein-coupled receptor (GPCR) binding libraries for a glucagon-like peptide-1 receptor (GLP1R) containing nucleic acids encoding immunoglobulins containing a GPCR-binding domain are provided herein. The immunoglobulins described herein can stably support the GPCR-binding domain. The GPCR-binding domain may be designed based on the GLP1R ligand and the surface interaction of GLP1R. The libraries described herein may be further diversified to provide mutant libraries, each containing nucleic acids encoding a predetermined variant of at least one given reference nucleic acid sequence. Protein libraries that may be produced when the nucleic acid libraries are translated are further described herein. In some examples, the nucleic acid libraries described herein are transferred into cells to produce cellular libraries. Downstream applications of libraries synthesized using the methods described herein are also provided herein. Downstream applications include biologically relevant functions, such as the identification of mutant nucleic acids or protein sequences with improved stability, affinity, binding, and functional activity, and the treatment or prevention of disease conditions related to GPCR signaling.

[0019] Libraries containing nucleic acids encoding immunoglobulins are provided herein. In some examples, immunoglobulins are antibodies. As used herein, the term antibody is understood to include one or more fragments of an antibody that possess the characteristic Y-shaped two arms of a typical antibody molecule, as well as the ability to specifically bind to an antigen. Exemplary antibodies include monoclonal antibodies, polyclonal antibodies, bispecific antibodies, multispecific antibodies, transplant antibodies, human antibodies, humanized antibodies, synthetic antibodies, chimeric antibodies, camelized antibodies, single-chain Fv(scFv) (including fragments linked using synthetic or natural linker recombination methods, allowing the VL and VH regions to be produced as a single protein chain forming monovalent molecules containing single-chain Fab and scFab), single-chain antibodies, Fab fragments (including monovalent fragments containing VL, VH, CL and CH1 domains), and F(ab')2 fragments (including two Fab fragments linked by disulfide crosslinking at the hinge region). These include, but are not limited to, bivalent fragments, Fd fragments (including fragments containing VH and CH1 fragments), Fv fragments (including fragments containing the VL and VH domains of a single arm of the antibody), single-domain antibodies (dAb or sdAb) (including fragments containing the VH domain), isolated complementarity-determining regions (CDRs), diabodies (including fragments containing a bivalent dimer such as two VL and VH domains bound to each other, recognizing two different antigens), fragments consisting of only a single monomeric variable domain, disulfide-linked Fv (sdFv), intrabodies, anti-idiotype (anti-Id) antibodies, or their ab antigen-binding fragments. In some examples, the libraries disclosed herein include nucleic acids encoding immunoglobulins, where the immunoglobulins are Fv antibodies, including Fv antibodies composed of minimal antibody fragments containing complete antigen recognition and antigen-binding sites. In some embodiments, the Fv antibody consists of a dimer in which one heavy chain variable domain and one light chain variable domain are closely associated noncovalently, and three hypervariable regions of each variable domain interact to define an antigen-binding site on the surface of the VH-VL dimer. In some embodiments, six hypervariable regions confer antigen-binding specificity to the antibody.In some embodiments, a single variable domain (or half of an Fv containing only three antigen-specific hypervariable regions, including a single-domain antibody isolated from a camelid animal containing one heavy-chain variable domain such as a VHH antibody or a nanobody) has the ability to recognize and bind to an antigen. In some examples, the libraries disclosed herein contain nucleic acids encoding immunoglobulins, where the immunoglobulins are single-chain Fv or scFv containing antibody fragments containing VH, VL, or both VH and VL domains, both domains residing in a single polypeptide chain. In some embodiments, the Fv polypeptide further includes a polypeptide linker between the VH and VL domains, enabling the scFv to form a desired structure for antigen binding. In some examples, the scFv is linked to an Fc fragment, or VHH is linked to an Fc fragment (including a minibody). In some examples, the antibodies include immunoglobulin molecules and immunologically active fragments of immunoglobulin molecules, e.g., molecules containing an antigen-binding site. Immunoglobulin molecules are of any type (e.g., IgG, IgE, IgM, IgD, IgA, and IgY), a class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2), or a subclass.

[0020] In some embodiments, the library contains immunoglobulins adapted to the species of the intended therapeutic target. Generally, these methods include “mammalization” and methods for transferring donor antigen-binding information to less immunogenic mammalian antibody acceptors to produce useful therapeutic treatments. In some examples, the mammals are mice, rats, horses, sheep, cattle, primates (e.g., chimpanzees, baboons, gorillas, orangutans, monkeys), dogs, cats, pigs, donkeys, rabbits, or humans. In some examples, libraries and methods for feline and canine antibody felineization are provided herein.

[0021] The "humanization" of a non-human antibody can take the form of a chimeric antibody containing the minimal sequence derived from the non-human antibody. A humanized antibody is generally a human antibody (recipient antibody) in which one or more residues from a CDR (Chronic Distribution Range) are replaced by residues from one or more CDRs of a non-human antibody (donor antibody). The donor antibody can be any suitable non-human antibody, such as an antibody from a mouse, rat, rabbit, chicken, or non-human primate, possessing the desired specificity, affinity, or biological effect. In some examples, residues in a selected framework region of the recipient antibody are replaced by residues in a corresponding framework region derived from the donor antibody. The humanized antibody may also contain residues not found in either the recipient or donor antibody. In some examples, these modifications are made to further refine the antibody's capabilities.

[0022] "Canine transformation" may include methods for transferring non-canine antigen-binding information from a donor antibody to a less immunogenic canine antibody acceptor in order to produce a therapeutic agent useful for dogs. In some examples, the canine-transformed non-canine antibodies provided herein are chimeric antibodies containing minimal sequences derived from the non-canine antibody. In some examples, the canine-transformed antibody is a canine antibody sequence ("acceptor" or "recipient" antibody) in which the hypervariable region residues of the recipient are replaced with hypervariable region residues ("donor" antibody) derived from a non-canine species such as mouse, rat, rabbit, cat, dog, goat, chicken, cattle, horse, llama, camel, dromedary, shark, non-human primate, human, humanized, recombinant, or engineered sequence having desired properties. In some examples, framework region (FR) residues of the canine antibody are replaced with corresponding non-canine FR residues. In some examples, the canine-transformed antibody contains residues not found in the recipient or donor antibody. In some cases, these modifications are made to further refine the antibody's capabilities. Canine antibodies may also contain at least a portion of the immunoglobulin constant region (Fc) of the canine antibody.

[0023] "Felineization" may include methods for transferring non-feline antigen-binding information from a donor antibody to a less immunogenic feline antibody acceptor in order to produce a therapeutic agent useful for cats. In some examples, the felineized forms of non-feline antibodies provided herein are chimeric antibodies containing minimal sequences derived from non-feline antibodies. In some examples, the felineized antibody is a feline antibody sequence ("acceptor" or "recipient" antibody) in which the hypervariable region residues of the recipient are replaced with hypervariable region residues ("donor" antibody) derived from a non-feline species such as mouse, rat, rabbit, cat, dog, goat, chicken, cattle, horse, llama, camel, dromedary, shark, non-human primate, human, humanized, recombinant sequence, or engineered sequence having desired properties. In some examples, the framework region (FR) residues of the feline antibody are replaced with corresponding non-feline FR residues. In some examples, the felineized antibody contains residues not found in the recipient antibody or donor antibody. In some cases, these modifications are made to further refine the antibody's capabilities. Feline antibodies may also contain at least a portion of the immunoglobulin constant region (Fc) of a feline antibody.

[0024] Libraries containing nucleic acids encoding non-immunoglobulins are provided herein. For example, non-immunoglobulins are antibody mimetics. Exemplary antibody mimetics include, but are not limited to, antikalin, affilin, affibody molecules, affimers, affitins, alphabodies, avimers, atrimers, DARPin, finomers, Knitz domain-based proteins, monobodies, antikalin, Notchin, armadillo repeat protein-based proteins, and bicyclic peptides.

[0025] The libraries described herein include nucleic acids encoding immunoglobulins, which contain variants of at least one region of the immunoglobulin. Exemplary regions of antibodies for mutation include, but are not limited to, complementarity-determining regions (CDRs), variable domains, or constant domains. In some examples, the CDR is CDR1, CDR2, or CDR3. In some examples, the CDR is a heavy chain domain, including, but not limited to, CDRH1, CDRH2, and CDRH3. In some examples, the CDR is a light chain domain, including, but not limited to, CDRL1, CDRL2, and CDRL3. In some examples, the variable domain is a light chain variable domain (VL) or a heavy chain variable domain (VH). In some examples, the VL domain includes a kappa chain or a lambda chain. In some examples, the constant domain is a constant domain, light chain (CL) or a constant domain, heavy chain (CH).

[0026] The methods described herein provide the synthesis of a library containing nucleic acids encoding immunoglobulins, each nucleic acid encoding a predetermined variant of at least one given reference nucleic acid sequence. In some cases, the given reference sequence is a nucleic acid sequence encoding a protein, and the variant library includes sequences encoding mutations at at least one codon so that multiple different single-residue variants of the subsequent protein encoded by the synthesized nucleic acid are generated by a standard translation process. In some examples, the variant library includes a variety of nucleic acids that collectively encode variants at multiple positions. In some examples, the variant library includes sequences encoding mutations at at least one codon in the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3, VL, or VH domains. In some examples, the variant library includes sequences encoding mutations at multiple codons in the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3, VL, or VH domains. In some examples, the variant library includes sequences encoding variations in multiple codons of framework element 1 (FW1), framework element 2 (FW2), framework element 3 (FW3), or framework element 4 (FW4). Exemplary numbers of codons for variation include, but are not limited to, at least 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 225, 250, 275, 300, or more than 300 codons.

[0027] In some cases, at least one region of the immunoglobulin for the mutation originates from the heavy chain V gene family, the heavy chain D gene family, the heavy chain J gene family, the light chain V gene family, or the light chain J gene family. In some cases, the light chain V gene family includes the immunoglobulin kappa (IGK) gene or the immunoglobulin lambda (IGL) gene. Exemplary genes include, but are not limited to, IGHV1-18, IGHV1-69, IGHV1-8, IGHV3-21, IGHV3-23, IGHV3-30 / 33rn, IGHV3-28, IGHV1-69, IGHV3-74, IGHV4-39, IGHV4-59 / 61, IGKV1-39, IGKV1-9, IGKV2-28, IGKV3-11, IGKV3-15, IGKV3-20, IGKV4-1, IGLV1-51, IGLV2-14, IGLV1-40, and IGLV3-1. In some cases, the genes are IGHV1-69, IGHV3-30, IGHV3-23, IGHV3, IGHV1-46, IGHV3-7, IGHV1, or IGHV1-8. In some cases, the genes are IGHV1-69 and IGHV3-30. In some cases, the genes are IGHJ3, IGHJ6, IGHJ, IGHJ4, IGHJ5, IGHJ2, or IGH1. In some cases, the genes are IGHJ3, IGHJ6, IGHJ, or IGHJ4.

[0028] Libraries containing nucleic acids encoding immunoglobulins are provided herein, and the libraries are synthesized using a variety of fragments. In some examples, the fragments include CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3, VL, or VH domains. In some examples, the fragments include framework element 1 (FW1), framework element 2 (FW2), framework element 3 (FW3), or framework element 4 (FW4). In some examples, the immunoglobulin library is synthesized with at least or about two, three, four, five, or more than five fragments. The length of each nucleic acid fragment or the average length of a synthesized nucleic acid can be at least or approximately 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, 600, or greater than 600 base pairs. In some examples, the lengths are approximately 50–600, 75–575, 100–550, 125–525, 150–500, 175–475, 200–450, 225–425, 250–400, 275–375, or 300–350 base pairs.

[0029] The libraries containing nucleic acids encoding immunoglobulins described herein, when translated, contain amino acids of varying lengths. In some examples, the length of each amino acid fragment or the average length of the synthesized amino acids may be at least or about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, or greater than 150 amino acids. In some examples, the length of the amino acids may be about 15–150, 20–145, 25–140, 30–135, 35–130, 40–125, 45–120, 50–115, 55–110, 60–110, 65–105, 70–100, or 75–95 amino acids. In some cases, the length of an amino acid is approximately 22 to 75 amino acids. In some cases, immunoglobulins contain at least or approximately 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, or more than 5000 amino acids.

[0030] Several mutant sequences for at least one region of immunoglobulins for mutation are synthesized de novo using the methods described herein. In some examples, several mutant sequences are synthesized de novo for CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3, VL, VH, or combinations thereof. In some examples, several mutant sequences are synthesized de novo for framework element 1 (FW1), framework element 2 (FW2), framework element 3 (FW3), or framework element 4 (FW4). The number of variant sequences may be at least or approximately 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, or more than 500. In some examples, the number of variant sequences is at least or approximately 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, or more than 8000. In some examples, the number of mutant sequences is approximately 10–500, 25–475, 50–450, 75–425, 100–400, 125–375, 150–350, 175–325, 200–300, 225–375, 250–350, or 275–325.

[0031] In some examples, the variant sequences for at least one region of an immunoglobulin differ in length or sequence. In some examples, at least one region synthesized de novo is for CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3, VL, VH, or a combination thereof. In some instances, at least one region synthesized de novo is for framework element 1 (FW1), framework element 2 (FW2), framework element 3 (FW3) or framework element 4 (FW4). In some examples, the variant sequence contains at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, or more variant nucleotides or amino acids compared to the wild type. In some examples, the variant sequence contains at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 additional nucleotides or amino acids compared to the wild type. In some examples, the variant sequence contains at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 fewer nucleotides or amino acids compared to the wild type. In some examples, the library contains at least or about 10 1 10 2 10 3 10 4 10 5 10 6 10 7 10 8 10 9 10 10 or 10 10 or more variants.

[0032] Following synthesis of the libraries described herein, they can be used for screening and analysis. For example, the libraries can be assayed for their visibility and panning. In some examples, visibility is assayed using selectable tags. Exemplary tags include, but are not limited to, radioactive labels, fluorescent labels, enzymes, chemiluminescent tags, colorimetric tags, affinity tags, or other labels or tags known in the art. In some examples, the tags are histidine, polyhistidine, myc, hemagglutinin (HA), or FLAG. In some examples, the libraries can be assayed by sequencing using a variety of methods, including, but not limited to, single-molecule real-time (SMRT) sequencing, Polony sequencing, ligation sequencing, reversible terminator sequencing, proton detection sequencing, ion semiconductor sequencing, nanopore sequencing, electronic sequencing, pyrosequencing, Maxam-Gilbert sequencing, chain arrest (e.g., Sanger) sequencing, +S sequencing, or synthesis sequencing.

[0033] In some cases, libraries are assayed for functional activity, structural stability (e.g., thermal or pH stability), expression, specificity, or a combination thereof. In some cases, libraries are assayed for foldable immunoglobulins (e.g., antibodies). In some cases, regions of antibodies are assayed for functional activity, structural stability, expression, specificity, folding, or a combination thereof. For example, the VH or VL region is assayed for functional activity, structural stability, expression, specificity, folding, or a combination thereof.

[0034] GLP1R Library

[0035] This specification provides GLP1R-binding libraries containing nucleic acids encoding immunoglobulins (e.g., antibodies) that bind to GLP1R. In some examples, the immunoglobulin sequence of the GLP1R-binding domain is determined by the interaction between the GLP1R-binding domain and GLP1R.

[0036] A library containing nucleic acids encoding immunoglobulins with a GLP1R-binding domain is provided herein, the GLP1R-binding domain being designed based on interactions with the surface of GLP1R. In some examples, GLP1R includes the sequence defined by Sequence ID No. 1. In some examples, the GLP1R-binding domain interacts with the amino or carboxyl terminus of GLP1R. In some examples, the GLP1R-binding domain interacts with at least one transmembrane domain, including but not limited to transmembrane domain 1 (TM1), transmembrane domain 2 (TM2), transmembrane domain 3 (TM3), transmembrane domain 4 (TM4), transmembrane domain 5 (TM5), transmembrane domain 6 (TM6), and transmembrane domain 7 (TM7). In some examples, the GLP1R-binding domain interacts with the intracellular surface of GLP1R. For example, the GLP1R-binding domain interacts with at least one intracellular loop, including but not limited to intracellular loop 1 (ICL1), intracellular loop 2 (ICL2), and intracellular loop 3 (ICL3). In some cases, the GLP1R-binding domain interacts with the extracellular surface of GLP1R. For example, the GLP1R-binding domain interacts with at least one extracellular domain (ECD) or extracellular loop (ECL) of GLP1R. Extracellular loops include, but are not limited to, extracellular loop 1 (ECL1), extracellular loop 2 (ECL2), and extracellular loop 3 (ECL3).

[0037] GLP1R-binding domains are described herein and are designed based on surface interactions between a GLP1R ligand and GLP1R. In some examples, the ligand is a peptide. In some examples, the ligand is glucagon, glucagon-like peptide 1-(7-36)amide, glucagon-like peptide 1-(7-37), liraglutide, exendin-4, lixisenatide, T-0632, GLP1R0017, or BETP. In some examples, the ligand is a GLP1R agonist. In some examples, the ligand is a GLP1R antagonist. In some examples, the ligand is a GLP1R allosteric modulator. In some examples, the allosteric modulator is a negative allosteric modulator. In some examples, the allosteric modulator is a positive allosteric modulator.

[0038] The sequence of the GLP1R-binding domain, based on the surface interaction between the GLP1R ligand and GLP1R, is analyzed using various methods. For example, various computational analyses are performed. In some cases, structural analysis is performed. In some cases, sequence analysis is performed. Sequence analysis can be performed using databases known in the art. Non-exclusive examples of databases include, but are not limited to, NCBI BLAST (blast.ncbi.nlm.nih.gov / Blast.cgi), UCSC Genome Browser (genome.ucsc.edu / ), UniProt (www.uniprot.org / ), and IUPHAR / BPS Guide to PHARMACOLOGY (guidetopharmacology.org / ).

[0039] GLP1R-binding domains designed based on sequence analysis across various organisms are described herein. For example, sequence analysis is performed to identify homologous sequences in different organisms. Exemplary organisms include, but are not limited to, mice, rats, horses, sheep, cattle, primates (e.g., chimpanzees, baboons, gorillas, orangutans, monkeys), dogs, cats, pigs, donkeys, rabbits, fish, flies, and humans.

[0040] After identifying the GLP1R-binding domain, a library containing nucleic acids encoding the GLP1R-binding domain can be generated. In some examples, the GLP1R-binding domain library may include sequences of the GLP1R-binding domain designed based on conformational ligand interactions, peptide ligand interactions, small molecule ligand interactions, the extracellular domain of GLP1R, or antibodies targeting GLP1R. In some examples, the GLP1R-binding domain library may include sequences of the GLP1R-binding domain designed based on peptide ligand interactions. The GLP1R-binding domain library may be translated to generate a protein library. In some examples, the GLP1R-binding domain library is translated to generate a peptide library, an immunoglobulin library, their derivatives, or a combination thereof. In some examples, the GLP1R-binding domain library is translated to generate a protein library that has been further modified to generate a peptide-mimicking library. In some examples, the GLP1R-binding domain library is translated to generate a protein library used to generate small molecules.

[0041] The methods described herein result in the synthesis of a library of GLP1R-binding domains, each containing nucleic acids that encode a predetermined variant of at least one predetermined reference nucleic acid sequence. In some cases, the predetermined reference sequence is a nucleic acid sequence that encodes a protein, and the variant library contains sequences that encode mutations at least one codon, such that multiple different single-residue variants of the subsequent protein encoded by the synthesized nucleic acids are generated by a standard translation process. In some examples, the library of GLP1R-binding domains contains a variety of nucleic acids that collectively encode mutations at multiple positions. In some examples, the variant library contains sequences that encode mutations at at least one codon of the GLP1R-binding domain. In some examples, the variant library contains sequences that encode mutations at multiple codons of the GLP1R-binding domain. Exemplary numbers of codons for mutation include, but are not limited to, at least 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 225, 250, 275, 300, or more than 300 codons.

[0042] The methods described herein provide for the synthesis of a library comprising nucleic acids encoding a GLP1R-binding domain, wherein the library comprises sequences encoding variations in the length of the GLP1R-binding domain. In some examples, the library comprises sequences encoding variations in the length of at least 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 225, 250, 275, 300, or more than 300 fewer codons compared to a given reference sequence. In some examples, the library contains sequences that encode at least 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 275, 300, or more than 300 variations in codon length compared to a given reference sequence.

[0043] After identifying the GLP1R-binding domain, it can be positioned in the immunoglobulins described herein. In some examples, the GLP1R-binding domain is positioned in the CDRH3 region. The GPCR-binding domain that can be positioned in an immunoglobulin may also be called a motif. Immunoglobulins containing the GLP1R-binding domain may be designed based on binding, specificity, stability, expression, folding, or downstream activity. In some examples, immunoglobulins containing the GLP1R-binding domain enable contact with GLP1R. In some examples, immunoglobulins containing the GLP1R-binding domain enable high-affinity binding to GLP1R. Exemplary amino acid sequences of the GLP1R-binding domain are shown in Table 1.

[0044] [Table 1]

[0045] Immunoglobulins containing a GLP1R-binding domain are provided herein, and the sequence of the GLP1R-binding domain facilitates interaction with GLP1R. The sequence may be homologous or identical to the sequence of a GLP1R ligand. In some examples, the GLP1R-binding domain sequence has at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 1. In some examples, the GLP1R-binding domain sequence has at least or about 95% homology with SEQ ID NO: 1. In some examples, the GLP1R-binding domain sequence has at least or about 97% homology with SEQ ID NO: 1. In some examples, the GLP1R-binding domain sequence has at least or about 99% homology with SEQ ID NO: 1. In some examples, the GLP1R-binding domain sequence has at least or about 100% homology with SEQ ID NO: 1. In some examples, the GLP1R binding domain sequence contains at least a portion of the sequence having at least or about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, or more than 400 amino acids of Sequence ID No. 1.

[0046] The term "sequence identity" means that two polynucleotide sequences are identical within a comparison framework (i.e., nucleotide-wise). The term "percentage of sequence identity" is calculated by comparing two optimally aligned sequences within a comparison framework, determining the number of positions in both sequences where identical nucleic acid bases (e.g., A, T, C, G, U, or I) occur, obtaining the number of corresponding positions, dividing the number of corresponding positions by the total number of positions in the comparison framework (i.e., the framework size), and multiplying the result by 100 to obtain the percentage of sequence identity. Alignment for determining the percentage of amino acid sequence identity can be achieved in various ways within the scope of the art, using publicly available computer software such as EMBOSS MATCHER, EMBOSS WATER, EMBOSS STRETCHER, EMBOSS NEEDLE, EMBOSS LALIGN, BLAST, BLAST-2, ALIGN, or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithm necessary to achieve the maximum alignment over the entire length of the sequences being compared.

[0047] In situations where ALIGN-2 is used to compare amino acid sequences, the percentage of amino acid sequence identity of a given amino acid sequence A to a given amino acid sequence B (or, to paraphrase, that a given amino acid sequence A has or contains a particular percentage of amino acid sequence identity to a given amino acid sequence B) is calculated as follows: 100 times fraction X / Y, where X is the number of amino acid residues scored as identical matches by the sequence alignment program ALIGN-2 in the program alignment of A and B, and where Y is the total number of amino acid residues in B. It will be understood that if the length of amino acid sequence A is not equal to the length of amino acid sequence B, the percentage of amino acid sequence identity of A to B will not be equal to the percentage of amino acid sequence identity of B to A. Unless otherwise specified, all amino acid sequence identity percentage values ​​used herein are obtained using the ALIGN-2 computer program as described in the preceding paragraph.

[0048] The term "homology" or "similarity" between two proteins is determined by comparing the amino acid sequence of one protein sequence and its conserved amino acid substitutions with that of the second protein sequence. Similarity can be determined using procedures well known in the art, such as the BLAST program (Basic Local Alignment Search Tool from the National Center for Biological Information).

[0049] The terms "complementarity-determining region" and "CDR," which are synonymous with "hypervariable region" or "HVR," are known in the art to refer to discontinuous sequences of amino acids within the antibody variable region that confer antigen specificity and / or binding affinity. Generally, there are three CDRs in each heavy chain variable region (CDRH1, CDRH2, CDRH3) and three CDRs in each light chain variable region (CDRL1, CDRL2, CDRL3). The terms "framework region" and "FR" are known in the art to refer to non-CDR portions of the heavy and light chain variable regions. Generally, there are four FRs in each full-length heavy chain variable region (FR-H1, FR-H2, FR-H3, FR-H4) and four FRs in each full-length light chain variable region (FR-L1, FR-L2, FR-L3, FR-L4).The precise amino acid sequence boundaries of a given CDR or FR are as follows: Kabat et al. (1991), “Sequences of Proteins of Immunological Interest,” 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD (“Kabat” numbering scheme); Al-Lazikani et al., (1997) JMB 273, 927-948 (“Chothia” numbering scheme); MacCallum et al., J.Mol.Biol.262:732-745 (1996), “Antibody-antigen interactions: Contact analysis and binding site topography,” J.Mol.Biol.262, 732-745.” (“Contact” numbering scheme); Lefranc MP et al., “IMGT unique numbering for immunoglobulin and T cell receptor variable domains and Ig superfamily V-like domains,” Dev Comp Immunol, 2003. Jan;27(1):55-77 ("IMGT" numbering scheme); Honegger A and Pluckthun A, "Yet another numbering scheme for immunoglobulin variable domains: an automatic modeling and analysis tool," J Mol Biol, 2001 Jun 8;309(3):657-70, ("Aho" numbering scheme); and Whitelegg NR and Rees AR, "WAM: an improved algorithm for modeling antibodies on the WEB," Protein Eng. 2000 Dec;13(12):819-24 ("AbM" numbering scheme). It can be easily determined using one of several well-known schemes, including those described therein.In certain embodiments, the CDR of the antibodies described herein may be defined by a method selected from Kabat, Chothia, IMGT, Aho, AbM, or a combination thereof.

[0050] The boundaries of a given CDR or FR can differ depending on the scheme used for identification. For example, Kabat's scheme is based on structural alignment, while Chothia's scheme is based on structural information. Numbering for both Kabat's and Chothia's schemes is based on the length of the most common antibody region sequences, with insertions corresponding by insertion letters, e.g., "30a", and deletions appearing in some antibodies. The two schemes estimate specific insertions and deletions ("indels") at various positions, leading to different numbering. The contact scheme is based on the analysis of complex crystal structures and is similar in many ways to Chothia's numbering scheme.

[0051] GLP1R-binding libraries are provided herein that include nucleic acids encoding immunoglobulins containing a GLP1R-binding domain, including variations in domain type, domain length, or residue mutations. In some examples, the domain is a region of immunoglobulin containing the GLP1R-binding domain. For example, the region is a VH, CDRH3, or VL domain. In some examples, the domain is a GLP1R-binding domain.

[0052] The methods described herein result in the synthesis of a GLP1R-binding library of nucleic acids, each encoding a predetermined variant of at least one given reference nucleic acid sequence. In some cases, the given reference sequence is a nucleic acid sequence encoding a protein, and the variant library includes sequences encoding mutations of at least one codon so that multiple different variants of a single residue of the subsequent protein encoded by the synthesized nucleic acid are generated by a standard translation process. In some examples, the GLP1R-binding library includes a variety of nucleic acids that collectively encode mutations at multiple positions. In some examples, the variant library includes sequences encoding mutations of at least one codon in the VH, CDRH3, or VL domain. In some examples, the variant library includes sequences encoding mutations of at least one codon in the GLP1R-binding domain. For example, altering at least one single codon in the GLP1R-binding domain as listed in Table 1. In some examples, the variant library includes sequences encoding mutations of multiple codons in the VH, CDRH3, or VL domain. In some examples, the variant library includes sequences encoding mutations of multiple codons in the GLP1R-binding domain. Exemplary numbers of codons for mutation include, but are not limited to, at least 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 225, 250, 275, 300, or more than 300 codons.

[0053] The methods described herein result in the synthesis of a GLP1R-binding library of nucleic acids, each encoding a predetermined variant of at least one given reference nucleic acid sequence, wherein the GLP1R-binding library includes a sequence encoding a domain length variation. In some examples, the domain is a VH, CDRH3, or VL domain. In some examples, the domain is a GLP1R-binding domain. In some examples, the library includes a sequence encoding at least or about 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 225, 250, 275, 300, or more than 300 fewer codon length variations compared to the given reference sequence. In some examples, the library contains sequences that encode at least 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 275, 300, or more than 300 variations in codon length compared to a given reference sequence.

[0054] GLP1R-binding libraries containing nucleic acids encoding immunoglobulins with GLP1R-binding domains are provided herein, and these GLP1R-binding libraries are synthesized using a variety of fragments. In some examples, the fragments contain VH, CDRH3, or VL domains. In some examples, GLP1R-binding libraries are synthesized with at least or about two fragments, three fragments, four fragments, five fragments, or more than five fragments. The length of each nucleic acid fragment or the average length of the synthesized nucleic acid may be at least or about 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, 600, or more than 600 base pairs. In some examples, the lengths are approximately 50–600, 75–575, 100–550, 125–525, 150–500, 175–475, 200–450, 225–425, 250–400, 275–375, or 300–350 base pairs.

[0055] GLP1R-binding libraries containing nucleic acids encoding immunoglobulins with GLP1R-binding domains as described herein, when translated, contain amino acids of varying lengths. In some examples, the length of each amino acid fragment or the average length of the synthesized amino acids may be at least or about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, or more than 150 amino acids. In some cases, the length of an amino acid is approximately 15–150, 20–145, 25–140, 30–135, 35–130, 40–125, 45–120, 50–115, 55–110, 60–110, 65–105, 70–100, or 75–95 amino acids. In some cases, the length of an amino acid is approximately 22–75 amino acids.

[0056] A GLP1R-binding library containing de novo-synthesized variant sequences encoding immunoglobulins with GLP1R-binding domains includes several variant sequences. In some examples, several variant sequences are synthesized de novo for CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3, VL, VH, or combinations thereof. In some examples, several variant sequences are synthesized de novo for framework element 1 (FW1), framework element 2 (FW2), framework element 3 (FW3), or framework element 4 (FW4). In some examples, several variant sequences are synthesized de novo for the GPCR-binding domain. For example, the number of variant sequences is approximately 1 to 10 for the VH domain and approximately 10 for the GLP1R-binding domain. 8For the VK domain, there are approximately 1 to 44 variant sequences. The number of variant sequences can be at least or approximately 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, or more than 500. In some examples, the number of variant sequences is approximately 10–300, 25–275, 50–250, 75–225, 100–200, or 125–150.

[0057] Antibodies or antibody fragments that bind to GLP1R are described herein. In some embodiments, the antibody or antibody fragment comprises the sequences shown in Tables 7-13. In some embodiments, the antibody or antibody fragment comprises sequences that have at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with the sequences shown in Tables 7-13.

[0058] In some examples, the antibodies or antibody fragments described herein contain one of the CDRH1 sequences from SEQ ID NOs. 441 to 619. In some examples, the antibodies or antibody fragments described herein contain a sequence that is at least 80% identical to one of the CDRH1 sequences from SEQ ID NOs. 441 to 619. In some examples, the antibodies or antibody fragments described herein contain a sequence that is at least 85% identical to one of the CDRH1 sequences from SEQ ID NOs. 441 to 619. In some examples, the antibodies or antibody fragments described herein contain a sequence that is at least 90% identical to one of the CDRH1 sequences from SEQ ID NOs. 441 to 619. In some examples, the antibodies or antibody fragments described herein contain a sequence that is at least 95% identical to one of the CDRH1 sequences from SEQ ID NOs. 441 to 619. In some examples, the antibodies or antibody fragments described herein contain one of the CDRH2 sequences from SEQ ID NOs. 620 to 798. In some examples, the antibodies or antibody fragments described herein contain a sequence that is at least 80% identical to one of the CDRH2 sequences of SEQ ID NOs. 620-798. In some examples, the antibodies or antibody fragments described herein contain a sequence that is at least 85% identical to one of the CDRH2 sequences of SEQ ID NOs. 620-798. In some examples, the antibodies or antibody fragments described herein contain a sequence that is at least 90% identical to one of the CDRH2 sequences of SEQ ID NOs. 620-798. In some examples, the antibodies or antibody fragments described herein contain a sequence that is at least 95% identical to one of the CDRH2 sequences of SEQ ID NOs. 620-798. In some examples, the antibodies or antibody fragments described herein contain a CDRH3 sequence of one of the CDRH3 sequences of SEQ ID NOs. 799-977. In some examples, the antibodies or antibody fragments described herein contain a sequence that is at least 80% identical to one of the CDRH3 sequences of SEQ ID NOs. 799-977. In some cases, the antibodies or antibody fragments described herein contain a sequence that is at least 85% identical to one of the CDRH3 sequences of sequence numbers 799-977.In some cases, the antibodies or antibody fragments described herein contain a sequence that is at least 90% identical to one of the CDRH3 sequences of sequence numbers 799-977. In some cases, the antibodies or antibody fragments described herein contain a sequence that is at least 95% identical to one of the CDRH3 sequences of sequence numbers 799-977.

[0059] In some examples, the antibodies or antibody fragments described herein contain one of the CDRL1 sequences from SEQ ID NOs. 978 to 1156. In some examples, the antibodies or antibody fragments described herein contain a sequence that is at least 80% identical to one of the CDRL1 sequences from SEQ ID NOs. 978 to 1156. In some examples, the antibodies or antibody fragments described herein contain a sequence that is at least 85% identical to one of the CDRL1 sequences from SEQ ID NOs. 978 to 1156. In some examples, the antibodies or antibody fragments described herein contain a sequence that is at least 90% identical to one of the CDRL1 sequences from SEQ ID NOs. 978 to 1156. In some examples, the antibodies or antibody fragments described herein contain a sequence that is at least 95% identical to one of the CDRL1 sequences from SEQ ID NOs. 978 to 1156. In some examples, the antibodies or antibody fragments described herein contain a sequence that is at least 95% identical to one of the CDRL1 sequences from SEQ ID NOs. 1157 to 1156. 1335 It contains one of the following CDRL2 sequences. In some examples, the antibodies or antibody fragments described herein are sequence numbers 1157~ 1335 It contains a sequence that is at least 80% identical to any one of the CDRL2 sequences. In some examples, the antibodies or antibody fragments described herein are sequence numbers 1157~ 1335 It contains a sequence that is at least 85% identical to any one of the CDRL2 sequences. In some examples, the antibodies or antibody fragments described herein are sequence numbers 1157~ 1335 It contains a sequence that is at least 90% identical to any one of the CDRL2 sequences. In some examples, the antibodies or antibody fragments described herein are sequence numbers 1157~ 1335It contains a sequence that is at least 95% identical to any one of the CDRL2 sequences. In some examples, the antibodies or antibody fragments described herein are sequence numbers. 1336 ~1347 and 1353-1519 It contains one of the following CDRL3 sequences. In some examples, the antibodies or antibody fragments described herein are sequence numbers. 1336 ~1347 and 1353-1519 It contains a sequence that is at least 80% identical to any one of the CDRL3 sequences. In some examples, the antibodies or antibody fragments described herein are sequence numbers. 1336 ~1347 and 1353-1519 It contains a sequence that is at least 85% identical to any one of the CDRL3 sequences. In some examples, the antibodies or antibody fragments described herein are sequence numbers. 1336 ~1347 and 1353-1519 It contains a sequence that is at least 90% identical to any one of the CDRL3 sequences. In some examples, the antibodies or antibody fragments described herein are sequence numbers. 1336 ~1347 and 1353-1519 It contains a sequence that is at least 95% identical to one of the CDRL3 sequences.

[0060] In some embodiments, the antibody or antibody fragment comprises a heavy chain variable domain region (VH) and a light chain variable domain region (VL), where VH comprises complementarity-determining regions CDRH1, CDRH2, and CDRH3, and VL comprises complementarity-determining regions CDRL1, CDRL2, and CDRL3, where (a) the amino acid sequence of CDRH1 is as shown in any one of SEQ ID NOs: 441-619, (b) the amino acid sequence of CDRH2 is as shown in any one of SEQ ID NOs: 620-798, (c) the amino acid sequence of CDRH3 is as shown in any one of SEQ ID NOs: 799-977, (d) the amino acid sequence of CDRL1 is as shown in any one of SEQ ID NOs: 978-1156, and (e) the amino acid sequence of CDRL2 is as shown in SEQ ID NOs: 1157- 1335 As shown in one of the following, (f) the amino acid sequence of CDRL3 is: 1336 ~1347 and 1353-1519As shown in one of the following embodiments, an antibody or antibody fragment comprising a heavy chain variable domain region (VH) and a light chain variable domain region (VL), wherein the VH comprises complementarity-determining regions CDRH1, CDRH2 and CDRH3, and the VL comprises complementarity-determining regions CDRL1, CDRL2 and CDRL3, and (a) the amino acid sequence of CDRH1 is at least or about 80%, 85%, 90%, or 95% identical to any one of sequence numbers 441-619, and (b) the amino acid sequence of CDRH2 is sequence (c) The amino acid sequence of CDRH3 is at least 80%, 85%, 90%, or 95% identical to any one of sequence numbers 620-798, (d) The amino acid sequence of CDRL1 is at least 80%, 85%, 90%, or 95% identical to any one of sequence numbers 799-977, (e) The amino acid sequence of CDRL2 is at least 80%, 85%, 90%, or 95% identical to any one of sequence numbers 978-1156, 1335 (f) The amino acid sequence of CDRL3 is at least or approximately 80%, 85%, 90%, or 95% identical to any one of the following: 1336 ~1347 and 1353-1519 It is at least or approximately 80%, 85%, 90%, or 95% identical to any one of the following.

[0061] In some embodiments, antibodies or antibody fragments comprising a heavy chain variable domain region (VH) and a light chain variable domain region (VL) are described herein, wherein the VH comprises an amino acid sequence that is at least about 90% identical to the sequence shown in any one of SEQ ID NOs. 58 to 77, and the VL comprises an amino acid sequence that is at least about 90% identical to the sequence shown in any one of SEQ ID NOs. 92 to 111. In some examples, the antibody or antibody fragment includes a VH containing at least or approximately 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with one of sequence numbers 58–77, and a VL containing at least or approximately 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with one of sequence numbers 92–111.

[0062] The term "sequence identity" means that two polynucleotide sequences are identical within a comparison framework (i.e., nucleotide-wise). The term "percentage of sequence identity" is calculated by comparing two optimally aligned sequences within a comparison framework, determining the number of positions in both sequences where identical nucleic acid bases (e.g., A, T, C, G, U, or I) occur, obtaining the number of corresponding positions, dividing the number of corresponding positions by the total number of positions in the comparison framework (i.e., the framework size), and multiplying the result by 100 to obtain the percentage of sequence identity. Typically, techniques for determining sequence identity involve comparing two nucleotide or amino acid sequences and determining their percentage of identity. Sequence comparisons for purposes such as evaluating identity can be performed by any suitable alignment algorithm, including but not limited to the Needleman-Wunsch algorithm (see, for example, the EMBOSS Needle aligner available at www.ebi.ac.uk / Tools / psa / emboss_needle / , optional and with default settings), the BLAST algorithm (see, for example, the BLAST alignment tool available at blast.ncbi.nlm.nih.gov / Blast.cgi, optional and with default settings), and the Smith-Waterman algorithm (see, for example, the EMBOSS Water aligner available at www.ebi.ac.uk / Tools / psa / emboss_water / , optional and with default settings). Optimal alignment can be evaluated using any suitable parameters of the selected algorithm, including default parameters. The "proportion of identity," also known as the "proportion of homology" between two sequences, can be calculated by dividing the number of perfect matches between two optimally aligned sequences by the length of the reference sequence and multiplying by 100. The proportion of identity can also be determined by comparing sequence information using an advanced BLAST computer program, such as version 2.2.9, available from the National Institutes of Health.The BLAST program is based on the alignment methods described in Karlin and Altschul, Proc. Natl. Acad. Sci. USA 87:2264-2268 (1990), and Altschul, et al., J. Mol. Biol. 215:403-410 (1990); Karlin and Altschul, Proc. Natl. Acad. Sci. USA 90:5873-5877 (1993); and Altschul et al., Nucleic Acids Res. 25:3389-3402 (1997). In short, the BLAST program defines identity as the number of identically aligned symbols (i.e., nucleotides or amino acids) divided by the total number of symbols in the shorter of the two sequences. The program can be used to determine the percentage of identity across the entire length of sequences being compared. The default parameters are provided to optimize the search using a short query sequence, for example, with the blastp program. This program also allows masking off segments of the query sequence using a SEG filter, as determined by the SEG program in Wootton and Federhen, Computers and Chemistry 17:149-163 (1993). High sequence identity generally includes integer values ​​in the range of approximately 80% to 100% sequence identity.

[0063] GLP1R-binding libraries containing de novo-synthesized mutant sequences encoding immunoglobulins with GLP1R-binding domains offer improved diversity. For example, mutants are generated by placing GLP1R-binding domain mutants into immunoglobulins containing N-terminal CDRH3 mutants and C-terminal CDRH3 mutants. In some examples, the mutants include affinity-mature mutants. Alternatively, or in combination, the mutants include mutants of other regions of immunoglobulins, including but not limited to CDRH1, CDRH2, CDRL1, CDRL2, and CDRL3. In some examples, the number of mutants in a GLP1R-binding library is at least or about 104 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , 10 18 , 10 19 , 10 20 , or 10 20 These are non-identical sequences exceeding 10. For example, a library containing approximately 10 variant sequences in the VH region, approximately 237 variant sequences in the CDRH3 region, and approximately 43 variant sequences in the VL and CDRL3 regions is 10 5 This includes non-identical sequences (10 × 237 × 43).

[0064] In some cases, at least one region of the antibody for the mutation originates from the heavy chain V gene family, the heavy chain D gene family, the heavy chain J gene family, the light chain V gene family, or the light chain J gene family. In some cases, the light chain V gene family includes the immunoglobulin kappa (IGK) gene or the immunoglobulin lambda (IGL) gene. Exemplary regions for antibodies used for mutations include, but are not limited to, IGHV1-18, IGHV1-69, IGHV1-8, IGHV3-21, IGHV3-23, IGHV3-30 / 33rn, IGHV3-28, IGHV1-69, IGHV3-74, IGHV4-39, IGHV4-59 / 61, IGKV1-39, IGKV1-9, IGKV2-28, IGKV3-11, IGKV3-15, IGKV3-20, IGKV4-1, IGLV1-51, IGLV2-14, IGLV1-40, and IGLV3-1. In some cases, the genes are IGHV1-69, IGHV3-30, IGHV3-23, IGHV3, IGHV1-46, IGHV3-7, IGHV1, or IGHV1-8. In some cases, the genes are IGHV1-69 and IGHV3-30. In some cases, the antibody region for mutation is IGHJ3, IGHJ6, IGHJ, IGHJ4, IGHJ5, IGHJ2, or IGH1. In some cases, the antibody region for mutation is IGHJ3, IGHJ6, IGHJ, or IGHJ4. In some cases, at least one region of the antibody for mutation is IGHV1-69, IGHV3-23, IGKV3-20, IGKV1-39, or a combination thereof. In some cases, at least one region of the antibody for mutation is IGHV1-69 and IGKV3-20; in some cases, at least one region of the antibody for mutation is IGHV1-69 and IGKV1-39; in some cases, at least one region of the antibody for mutation is IGHV3-23 and IGKV3-20; in some cases, at least one region of the antibody for mutation is IGHV3-23 and IGKV1-39.

[0065] A library is provided herein comprising nucleic acids encoding a GLP1R antibody containing a mutation in at least one region of the antibody, where the region is a CDR region. In some examples, the GLP1R antibody is a monodomain antibody containing one heavy chain variable domain, such as a VHH antibody. In some examples, the VHH antibody contains mutations in one or more CDR regions. In some examples, the library described herein contains at least or about 1, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1200, 1400, 1600, 1800, 2000, 2400, 2600, 2800, 3000, or more than 3000 sequences of CDR1, CDR2, or CDR3. In some examples, the libraries described herein include at least or about 10 CDR1, CDR2, or CDR3. 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , 10 18 , 10 19 , 10 20 , or 10 20 It includes sequences exceeding a certain number. For example, the library includes at least 2000 sequences in CDR1, at least 1200 sequences in CDR2, and at least 1600 sequences in CDR3. In some examples, each sequence is not identical.

[0066] In some examples, CDR1, CDR2, or CDR3 are of the light chain variable domain (VL). The CDR1, CDR2, or CDR3 of the light chain variable domain (VL) may be referred to as CDRL1, CDRL2, or CDRL3, respectively. In some examples, the libraries described herein contain at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1200, 1400, 1600, 1800, 2000, 2400, 2600, 2800, 3000, or more than 3000 sequences of the CDR1, CDR2, or CDR3 of the VL. In some examples, the libraries described herein include at least or about 10 VL CDR1, CDR2, or CDR3. 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , 10 18 , 10 19 , 10 20 , or 10 20 It includes sequences exceeding a certain number. For example, the library includes at least 20 sequences of VL's CDR1, at least 4 sequences of VL's CDR2, and at least 140 sequences of VL's CDR3. In some examples, the library includes at least 2 sequences of VL's CDR1, at least 1 sequence of VL's CDR2, and at least 3000 sequences of VL's CDR3. In some examples, VL is IGKV1-39, IGKV1-9, IGKV2-28, IGKV3-11, IGKV3-15, IGKV3-20, IGKV4-1, IGLV1-51, IGLV2-14, IGLV1-40, or IGLV3-1. In some examples, VL is IGKV2-28. In some examples, VL is IGLV1-51.

[0067] In some examples, CDR1, CDR2, or CDR3 are heavy chains of variable domains (VH). CDR1, CDR2, or CDR3 of heavy chain variable domains (VH) may be referred to as CDRH1, CDRH2, or CDRH3, respectively. In some examples, the libraries described herein contain at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1200, 1400, 1600, 1800, 2000, 2400, 2600, 2800, 3000, or more than 3000 sequences of CDR1, CDR2, or CDR3 of VH. In some examples, the libraries described herein include at least or about 10 VH CDR1, CDR2, or CDR3. 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , 10 18 , 10 19 , 10 20 , or 10 20 Includes sequences exceeding a certain number. For example, the library includes at least 30 sequences of VH's CDR1, at least 570 sequences of VH's CDR2, and at least 10 sequences of VH's CDR3. 8 The array includes at least 30 arrays of VH's CDR1, at least 860 arrays of VH's CDR2, and at least 10 arrays of VH's CDR3. 7It contains a sequence of [number] elements. In some examples, VH is IGHV1-18, IGHV1-69, IGHV1-8, IGHV3-21, IGHV3-23, IGHV3-30 / 33rn, IGHV3-28, IGHV3-74, IGHV4-39, or IGHV4-59 / 61. In some examples, VH is IGHV1-69, IGHV3-30, IGHV3-23, IGHV3, IGHV1-46, IGHV3-7, IGHV1, or IGHV1-8. In some examples, VH is IGHV1-69 or IGHV3-30. In some examples, VH is IGHV3-23.

[0068] The libraries described herein include, in some embodiments, CDRL1, CDRL2, CDRL3, CDRH1, CDRH2, or CDRH3 of varying lengths. In some examples, the lengths of CDRL1, CDRL2, CDRL3, CDRH1, CDRH2, or CDRH3 include at least or about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, or more than 90 amino acid lengths. For example, CDRH3 includes at least or about 12, 15, 16, 17, 20, 21, or 23 amino acid lengths. In some examples, CDRL1, CDRL2, CDRL3, CDRH1, CDRH2, or CDRH3 contain amino acid lengths of approximately 1 to 10, 5 to 15, 10 to 20, or 15 to 30.

[0069] Libraries containing nucleic acids encoding antibodies having the variant CDR sequences described herein include a variety of amino acid lengths at translation. In some examples, the length of each amino acid fragment or the average length of the synthesized amino acids may be at least or about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, or greater than 150 amino acids. In some examples, the amino acid lengths are about 15–150, 20–145, 25–140, 30–135, 35–130, 40–125, 45–120, 50–115, 55–110, 60–110, 65–105, 70–100, or 75–95 amino acids. In some cases, the length of an amino acid is approximately 22 to 75 amino acids. In some cases, antibodies contain at least or approximately 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, or more than 5000 amino acids.

[0070] The ratio of the lengths of CDRL1, CDRL2, CDRL3, CDRH1, CDRH2, or CDRH3 can vary in the libraries described herein. In some examples, CDRL1, CDRL2, CDRL3, CDRH1, CDRH2 or CDRH3, including at least or about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, or more than 90 amino acids in length, comprise about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more than 90% of the library. For example, CDRH3 comprising a length of about 23 amino acids is present in 40% of the library, CDRH3 comprising a length of about 21 amino acids is present in 30% of the library, CDRH3 comprising a length of about 17 amino acids is present in 20% of the library, and CDRH3 comprising a length of about 12 amino acids is present in 10% of the library. In some examples, CDRH3 comprising a length of about 20 amino acids is present in 40% of the library, CDRH3 comprising a length of about 16 amino acids is present in 30% of the library, CDRH3 comprising a length of about 15 amino acids is present in 20% of the library, and CDRH3 comprising a length of about 12 amino acids is present in 10% of the library.

[0071] The libraries described herein encoding VHH antibodies comprise shuffled variant CDR sequences to generate libraries having a theoretical diversity of at least or about 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , 10 18 , 10 19 , 10 20 , or 10 20 or more. In some examples, the library comprises at least or about 10 7 , 10 8, 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , 10 18 , 10 19 , 10 20 , or 10 20 It has the diversity of a final library of arrays exceeding [a certain value].

[0072] GLP1R-binding libraries encoding immunoglobulins are provided herein. In some examples, the GLP1R immunoglobulin is an antibody. In some examples, the GLP1R immunoglobulin is a VHH antibody. In some examples, the GLP1R immunoglobulin has a binding affinity (e.g., kD) to GLP1R of less than 1 nM, less than 1.2 nM, less than 2 nM, less than 5 nM, less than 10 nM, less than 11 nM, less than 13.5 nM, less than 15 nM, less than 20 nM, less than 25 nM, or less than 30 nM. In some examples, the GLP1R immunoglobulin has a kD of less than 1 nM. In some examples, the GLP1R immunoglobulin has a kD of less than 1.2 nM. In some examples, the GLP1R immunoglobulin has a kD of less than 2 nM. In some examples, the GLP1R immunoglobulin has a kD of less than 5 nM. In some cases, GLP1R immunoglobulin contains less than 10 nM kD. In some cases, GLP1R immunoglobulin contains less than 13.5 nM kD. In some cases, GLP1R immunoglobulin contains less than 15 nM kD. In some cases, GLP1R immunoglobulin contains less than 20 nM kD. In some cases, GLP1R immunoglobulin contains less than 25 nM kD. In some cases, GLP1R immunoglobulin contains less than 30 nM kD.

[0073] In some cases, GLP1R immunoglobulin is a GLP1R agonist. In some cases, GLP1R immunoglobulin is a GLP1R antagonist. In some cases, GLP1R immunoglobulin is a GLP1R allosteric modulator. In some cases, the allosteric modulator is a negative allosteric modulator. In some cases, the allosteric modulator is a positive allosteric modulator. In some cases, GLP1R immunoglobulins exert agonist, antagonist, or allosteric effects at concentrations of at least or approximately 1 nM, 2 nM, 4 nM, 6 nM, 8 nM, 10 nM, 20 nM, 30 nM, 40 nM, 50 nM, 60 nM, 70 nM, 80 nM, 90 nM, 100 nM, 120 nM, 140 nM, 160 nM, 180 nM, 200 nM, 300 nM, 400 nM, 500 nM, 600 nM, 700 nM, 800 nM, 900 nM, 1000 nM, or above 1000 nM. In some cases, GLP1R immunoglobulins are negative allosteric modulators. In some cases, GLP1R immunoglobulin is a negative allosteric modulator at concentrations of at least or about 0.001, 0.005, 0.01, 0.05, 0.1, 0.5, 1 nM, 2 nM, 4 nM, 6 nM, 8 nM, 10 nM, 20 nM, 30 nM, 40 nM, 50 nM, 60 nM, 70 nM, 80 nM, 90 nM, 100 nM, or greater than 100 nM. In some cases, GLP1R immunoglobulin is a negative allosteric modulator at concentrations ranging from about 0.001 to about 100, 0.01 to about 90, about 0.1 to about 80, 1 to about 50, about 10 to about 40 nM, or about 1 to about 10 nM. In some cases, GLP1R immunoglobulins contain an EC50 or IC50 of at least or about 0.001 nM, 0.0025 nM, 0.005 nM, 0.01 nM, 0.025 nM, 0.05 nM, 0.06 nM, 0.07 nM, 0.08 nM, 0.9 nM, 0.1 nM, 0.5 nM, 1 nM, 2 nM, 3 nM, 4 nM, 5 nM, 6 nM, or greater than 6 nM.In some cases, GLP1R immunoglobulins contain an EC50 or IC50 of at least or about 1 nM, 2 nM, 4 nM, 6 nM, 8 nM, 10 nM, 20 nM, 30 nM, 40 nM, 50 nM, 60 nM, 70 nM, 80 nM, 90 nM, 100 nM, or greater than 100 nM.

[0074] GLP1R-binding libraries encoding immunoglobulins are provided herein, the immunoglobulins having long half-lives. In some examples, the half-lives of GLP1R immunoglobulins are at least or about 12 hours, 24 hours, 36 hours, 48 ​​hours, 60 hours, 72 hours, 84 hours, 96 hours, 108 hours, 120 hours, 140 hours, 160 hours, 180 hours, 200 hours, or more than 200 hours. In some examples, the half-lives of GLP1R immunoglobulins are in the range of about 12 hours to about 300 hours, about 20 hours to about 280 hours, about 40 hours to about 240 hours, or about 60 hours to about 200 hours.

[0075] The GLP1R immunoglobulins described herein may have improved properties. In some cases, the GLP1R immunoglobulin is monomeric. In some cases, the GLP1R immunoglobulin is less prone to aggregation. In some cases, at least or about 70%, 75%, 80%, 85%, 90%, 95%, or 99% of the GLP1R immunoglobulin is monomeric. In some cases, the GLP1R immunoglobulin is thermally stable. In some cases, the GLP1R immunoglobulin results in reduced nonspecific binding.

[0076] After the synthesis of a GLP1R-binding library containing nucleic acids encoding immunoglobulins with GLP1R-binding domains, the library can be used for screening and analysis. For example, the library can be assayed for its visibility and panning. In some examples, visibility is assayed using selectable tags. Exemplary tags include, but are not limited to, radioactive labels, fluorescent labels, enzymes, chemiluminescent tags, colorimetric tags, affinity tags, or other labels or tags known in the art. In some examples, the tags are histidine, polyhistidine, myc, hemagglutinin (HA), or FLAG. In some examples, the GLP1R-binding library contains nucleic acids encoding immunoglobulins with multiple tags such as GFP, FLAG, and Lucy, as well as a DNA barcode. In some examples, libraries are assayed by sequencing using a variety of methods, including but not limited to single-molecule real-time (SMRT) sequencing, Polony sequencing, ligation sequencing, reversible terminator sequencing, proton detection sequencing, ion semiconductor sequencing, nanopore sequencing, electron sequencing, pyrosequencing, Maxam-Gilbert sequencing, chain termination (e.g., Sanger) sequencing, +S sequencing, or synthesis sequencing.

[0077] Expression system

[0078] Libraries containing nucleic acids encoding immunoglobulins with GLP1R-binding domains are provided herein, and these libraries exhibit improved specificity, stability, expression, folding, or downstream activity. In some examples, the libraries described herein are used for screening and analysis.

[0079] Libraries containing nucleic acids encoding immunoglobulins with GLP1R-binding domains are provided herein for use in screening and analysis. In some examples, screening and analysis include in vitro, in vivo, or ex vivo assays. Cells for screening include primary cells taken from living subjects or cell lines. Cells may originate from prokaryotes (e.g., bacteria and fungi) or eukaryotes (e.g., animals and plants). Exemplary animal cells include, but are not limited to, those derived from mice, rabbits, primates, and insects. In some examples, cells for screening include, but are not limited to, Chinese hamster ovary (CHO) cell lines, human fetal kidney (HEK) cell lines, or baby hamster kidney (BHK) cell lines. In some examples, the nucleic acid libraries described herein may also be delivered to multicellular organisms. Exemplary multicellular organisms include, but are not limited to, plants, mice, rabbits, primates, and insects.

[0080] The nucleic acid libraries described herein or the protein libraries encoding them may be screened for a variety of pharmacological or pharmacokinetic properties. In some examples, the libraries are screened using in vitro, in vivo, or ex vivo assays. For example, in vitro pharmacological or pharmacokinetic properties to be screened include, but are not limited to, binding affinity, binding specificity, and binding activity. Exemplary in vivo pharmacological or pharmacokinetic properties of the libraries described herein to be screened include, but are not limited to, therapeutic efficacy, activity, preclinical toxicity properties, clinical efficacy properties, clinical toxicity properties, immunogenicity, potency, and clinical safety properties.

[0081] Pharmacological or pharmacokinetic properties that can be screened include, but are not limited to, cell binding affinity and cell activity. For example, cell binding affinity assays or cell activity assays may be performed to determine the agonist, antagonist, or allosteric effects of the libraries described herein. In some examples, the cell activity assay is a cAMP assay. In some examples, the libraries described herein are compared to the cell binding or cell activity of GLP1R ligands.

[0082] The libraries described herein can be screened using cell-based or non-cell-based assays. Examples of non-cell-based assays include, but are not limited to, the use of viral particles, in vitro translation proteins, and protealiposomes containing GLP1R.

[0083] The nucleic acid libraries described herein may be screened by sequencing. In some examples, next-generation sequences are used to determine the enrichment of GLP1R-binding mutant sequences. In some examples, V gene distribution, J gene distribution, V gene family, CDR3 count by length, or combinations thereof are determined. In some examples, clone frequency, clone accumulation, lineage accumulation, or combinations thereof are determined. In some examples, the number of sequences, VH clones, clones, more than one clone, clonal type, more than one clonal type, lineage, Simpson, or combinations thereof are determined. In some examples, the proportion of non-identical CDR3s is determined. For example, the proportion of non-identical CDR3s is calculated by dividing the number of non-identical CDR3s in the sample by the total number of sequences in the sample that contain CDR3s.

[0084] This specification provides nucleic acid libraries that can be expressed in vectors. Expression vectors for inserting the nucleic acid libraries disclosed herein may include eukaryotic or prokaryotic expression vectors. Exemplary expression vectors, but not limited to, mammalian expression vectors: pSF-CMV-NEO-NH2-PPT-3XFLAG, pSF-CMV-NEO-COOH-3XFLAG, pSF-CMV-PURO-NH2-GST-TEV, pSF-OXB20-COOH-TEV-FLAG(R)-6His, pCEP4 pDEST27, pSF-CMV-Ub-KrYFP, pSF-CMV-FMDV-daGFP, pEF1a-mCherry-N1 Vector, pEF1a-tdTomato Examples of vectors include pSF-CMV-FMDV-Hygro, pSF-CMV-PGK-Puro, pMCP-tag(m), and pSF-CMV-PURO-NH2-CMYC; bacterial expression vectors: pSF-OXB20-BetaGal, pSF-OXB20-Fluc, pSF-OXB20, and pSF-Tac; plant expression vectors: pRI 101-AN DNA and pCambia2301; yeast expression vectors: pTYB21 and pKLAC2; and insect vectors: pAc5.1 / V5-His A and pDEST8. In some examples, the vector is pcDNA3 or pcDNA3.1.

[0085] Nucleic acid libraries expressed in vectors to generate constructs containing immunoglobulins with a GLP1R binding domain sequence are described herein. In some examples, the size of the constructs varies. In some examples, the constructs contain at least or about 500, 600, 700, 800, 900, 1000, 1100, 1300, 1400, 1500, 1600, 1700, 1800, 2000, 2400, 2600, 2800, 3000, 3200, 3400, 3600, 3800, 4000, 4200, 4400, 4600, 4800, 5000, 6000, 7000, 8000, 9000, 10000, or more than 10000 bases. For example, the structures are approximately 300-1,000, 300-2,000, 300-3,000, 300-4,000, 300-5,000, 300-6,000, 300-7,000, 300-8,000, 300-9,000, 300-10,000, 1,000-2,000, 1,000-3,000, 1,000-4,000, 1,000-5,000, 1,000- 6,000, 1,000-7,000, 1,000-8,000, 1,000-9,000, 1,000-10,000, 2,000-3,000, 2,000-4,000, 2,000-5,000, 2,000-6,000, 2,000-7,000, 2,000-8,000, 2,000-9,000, 2,000-10,000, 3,000-4,000, 3,000 ~5,000, 3,000~6,000, 3,000~7,000, 3,000~8,000, 3,000~9,000, 3,000~10,000, 4,000~5,000, 4,000~6,000, 4,000~7,000, 4,000~8,000, 4,000~9,000, 4,000~10,000, 5,000~6,000, 5,000~7,000, 5,000 This includes the ranges of bases 0-8,000, 5,000-9,000, 5,000-10,000, 6,000-7,000, 6,000-8,000, 6,000-9,000, 6,000-10,000, 7,000-8,000, 7,000-9,000, 7,000-10,000, 8,000-9,000, 8,000-10,000, or 9,000-10,000.

[0086] Libraries containing nucleic acids encoding immunoglobulins with GPCR-binding domains are provided herein, and the nucleic acid libraries are expressed in cells. In some examples, the libraries are synthesized to express reporter genes. Exemplary reporter genes include, but are not limited to, acetohydroxy acid synthase (AHAS), alkaline phosphatase (AP), beta-galactosidase (LacZ), beta-glucolonidase (GUS), chloramphenicol acetyltransferase (CAT), green fluorescent protein (GFP), red fluorescent protein (RFP), yellow fluorescent protein (YFP), cyan fluorescent protein (CFP), cellulan fluorescent protein, citrin fluorescent protein, orange fluorescent protein, cherry fluorescent protein, turquoise fluorescent protein, blue fluorescent protein, horseradish peroxidase (HRP), luciferase (Luc), nopalin synthase (NOS), octopine synthase (OCS), luciferase, and their derivatives. Methods for determining the regulation of reporter genes are well known in the art and include, but are not limited to, fluorescence measurements (e.g., fluorescence spectroscopy, fluorescence-activated cell sorting (FACS), fluorescence microscopy) and antibiotic resistance assessment.

[0087] Diseases and Disabilities

[0088] GLP1R-binding libraries are provided herein, comprising nucleic acids encoding immunoglobulins (e.g., antibodies) containing a GLP1R-binding domain that may have therapeutic effects. In some examples, the GLP1R-binding library yields, at translation, a protein used to treat a disease or disorder. In some examples, the protein is an immunoglobulin. In some examples, the protein is a peptide mimetic.

[0089] The GLP1R libraries described herein may include GLP1R modulators. In some examples, the GLP1R modulator is an inhibitor. In some examples, the GLP1R modulator is an activator. In some examples, the GLP1R inhibitor is a GLP1R antagonist. In some examples, the GLP1R antagonist is GLP1R-3. In some examples, GLP1R modulators are used to treat a variety of diseases or disorders.

[0090] Illustrative conditions include, but are not limited to, cancer, inflammatory diseases or disorders, metabolic diseases or disorders, cardiovascular diseases or disorders, respiratory diseases or disorders, pain, digestive diseases or disorders, reproductive diseases or disorders, endocrine diseases or disorders, or neurological diseases or disorders. In some examples, cancer may be a solid tumor or a hematological cancer. In some examples, GLP1R modulators as described herein are used for the treatment of weight gain (or induction of weight loss), obesity, or type 2 diabetes. In some examples, GLP1R modulators are used to treat hypoglycemia. In some examples, GLP1R modulators are used to treat post-obesity hypoglycemia. In some examples, GLP1R modulators are used to treat severe hypoglycemia. In some examples, GLP1R modulators are used to treat hyperinsulinemia. In some examples, GLP1R modulators are used to treat congenital hyperinsulinemia.

[0091] In some cases, the subject is a mammal. In some cases, the subject is a mouse, rabbit, dog, or human. The subject treated by the methods described herein may be an infant, an adult, or a child. Pharmaceutical compositions comprising the antibodies or antibody fragments described herein may be administered intravenously or subcutaneously.

[0092] This specification describes pharmaceutical compositions comprising an antibody or antibody fragment that binds to GLP1R. In some embodiments, the antibody or antibody fragment comprises the sequences shown in Tables 7-13. In some embodiments, the antibody or antibody fragment comprises a sequence that has at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with the sequences shown in Tables 7-13.

[0093] In some examples, the pharmaceutical composition includes an antibody or antibody fragment described herein that contains one of the CDRH1 sequences from SEQ ID NOs. 441 to 619. In some examples, the pharmaceutical composition includes an antibody or antibody fragment described herein that contains a sequence at least 80% identical to one of the CDRH1 sequences from SEQ ID NOs. 441 to 619. In some examples, the pharmaceutical composition includes an antibody or antibody fragment described herein that contains a sequence at least 85% identical to one of the CDRH1 sequences from SEQ ID NOs. 441 to 619. In some examples, the pharmaceutical composition includes an antibody or antibody fragment described herein that contains a sequence at least 90% identical to one of the CDRH1 sequences from SEQ ID NOs. 441 to 619. In some examples, the pharmaceutical composition includes an antibody or antibody fragment described herein that contains a sequence at least 95% identical to one of the CDRH1 sequences from SEQ ID NOs. 441 to 619. In some examples, the pharmaceutical composition includes an antibody or antibody fragment described herein that contains one of the CDRH2 sequences from SEQ ID NOs. 620 to 798. In some examples, the pharmaceutical composition includes an antibody or antibody fragment described herein that contains a sequence at least 80% identical to one of the CDRH2 sequences from SEQ ID NOs. 620 to 798. In some examples, the pharmaceutical composition includes an antibody or antibody fragment described herein that contains a sequence at least 85% identical to one of the CDRH2 sequences of SEQ ID NOs. 620-798. In some examples, the pharmaceutical composition includes an antibody or antibody fragment described herein that contains a sequence at least 90% identical to one of the CDRH2 sequences of SEQ ID NOs. 620-798. In some examples, the pharmaceutical composition includes an antibody or antibody fragment described herein that contains a sequence at least 95% identical to one of the CDRH2 sequences of SEQ ID NOs. 620-798. In some examples, the pharmaceutical composition includes an antibody or antibody fragment described herein that contains a sequence at least 80% identical to one of the CDRH3 sequences of SEQ ID NOs. 799-977. In some examples, the pharmaceutical composition includes an antibody or antibody fragment described herein that contains a sequence at least 85% identical to one of the CDRH3 sequences of SEQ ID NOs. 799-977.In some examples, the pharmaceutical composition comprises an antibody or antibody fragment described herein that contains a sequence at least 90% identical to one of the CDRH3 sequences of SEQ ID NOs.799 to 977. In some examples, the pharmaceutical composition comprises an antibody or antibody fragment described herein that contains a sequence at least 95% identical to one of the CDRH3 sequences of SEQ ID NOs.799 to 977.

[0094] In some examples, the pharmaceutical composition includes an antibody or antibody fragment described herein that contains one of the CDRL1 sequences from SEQ ID NOs. 978 to 1156. In some examples, the pharmaceutical composition includes an antibody or antibody fragment described herein that contains a sequence at least 80% identical to one of the CDRL1 sequences from SEQ ID NOs. 978 to 1156. In some examples, the pharmaceutical composition includes an antibody or antibody fragment described herein that contains a sequence at least 85% identical to one of the CDRL1 sequences from SEQ ID NOs. 978 to 1156. In some examples, the pharmaceutical composition includes an antibody or antibody fragment described herein that contains a sequence at least 90% identical to one of the CDRL1 sequences from SEQ ID NOs. 978 to 1156. In some examples, the pharmaceutical composition includes an antibody or antibody fragment described herein that contains a sequence at least 951157 to 1156. 1335 The present invention comprises an antibody or antibody fragment containing any one of the CDRL2 sequences described herein. In some examples, the pharmaceutical composition contains SEQ ID NO: 1157~ 1335 The antibody or antibody fragment described herein contains a sequence that is at least 80% identical to any one of the CDRL2 sequences. In some examples, the pharmaceutical composition contains SEQ ID NO: 1157~ 1335 The present invention comprises an antibody or antibody fragment containing at least 85% identical sequences to any one of the CDRL2 sequences. In some examples, the pharmaceutical composition contains SEQ ID NO: 1157~ 1335 The present invention comprises an antibody or antibody fragment containing at least 90% identical sequences to any one of the CDRL2 sequences. In some examples, the pharmaceutical composition contains Sequence ID No. 1157~ 1335The antibody or antibody fragment described herein contains a sequence that is at least 95% identical to any one of the CDRL2 sequences. In some examples, the pharmaceutical composition contains an SEQ ID NO: 1336 ~1347 and 1353-1519 The antibody or antibody fragment described herein contains any one of the CDRL3 sequences. In some examples, the pharmaceutical composition is SEQ ID NO: 1336 ~1347 and 1353-1519 The present invention comprises an antibody or antibody fragment containing at least 80% identical sequences to any one of the CDRL3 sequences. In some examples, the pharmaceutical composition includes the sequence number 1336 ~1347 and 1353-1519 The antibody or antibody fragment described herein contains a sequence that is at least 85% identical to any one of the CDRL3 sequences. In some examples, the pharmaceutical composition contains an SEQ ID NO: 1336 ~1347 and 1353-1519 The present invention comprises an antibody or antibody fragment containing at least 90% identical sequences to any one of the CDRL3 sequences. In some examples, the pharmaceutical composition includes the sequence number 1336 ~1347 and 1353-1519 This invention comprises an antibody or antibody fragment described herein that contains a sequence that is at least 95% identical to any one of the CDRL3 sequences.

[0095] In some embodiments, the antibody or antibody fragment comprises a heavy chain variable domain region (VH) and a light chain variable domain region (VL), where VH comprises complementarity-determining regions CDRH1, CDRH2, and CDRH3, and VL comprises complementarity-determining regions CDRL1, CDRL2, and CDRL3, where (a) the amino acid sequence of CDRH1 is as shown in any one of SEQ ID NOs: 441-619, (b) the amino acid sequence of CDRH2 is as shown in any one of SEQ ID NOs: 620-798, (c) the amino acid sequence of CDRH3 is as shown in any one of SEQ ID NOs: 799-977, (d) the amino acid sequence of CDRL1 is as shown in any one of SEQ ID NOs: 978-1156, and (e) the amino acid sequence of CDRL2 is as shown in SEQ ID NOs: 1157- 1335 As shown in one of the following, (f) the amino acid sequence of CDRL3 is: 1336~1347 and 1353-1519 As shown in one of the following embodiments, an antibody or antibody fragment comprising a heavy chain variable domain region (VH) and a light chain variable domain region (VL), wherein the VH comprises complementarity-determining regions CDRH1, CDRH2 and CDRH3, and the VL comprises complementarity-determining regions CDRL1, CDRL2 and CDRL3, and (a) the amino acid sequence of CDRH1 is at least or about 80%, 85%, 90%, or 95% identical to any one of sequence numbers 441-619, and (b) the amino acid sequence of CDRH2 is sequence (c) The amino acid sequence of CDRH3 is at least 80%, 85%, 90%, or 95% identical to any one of sequence numbers 620-798, (d) The amino acid sequence of CDRL1 is at least 80%, 85%, 90%, or 95% identical to any one of sequence numbers 799-977, (e) The amino acid sequence of CDRL2 is at least 80%, 85%, 90%, or 95% identical to any one of sequence numbers 978-1156, 1335 (f) The amino acid sequence of CDRL3 is at least or approximately 80%, 85%, 90%, or 95% identical to any one of the following: 1336 ~1347 and 1353-1519 It is at least or approximately 80%, 85%, 90%, or 95% identical to any one of the following. In some embodiments, antibodies or antibody fragments comprising a heavy chain variable domain region (VH) and a light chain variable domain region (VL) are described herein, wherein the VH comprises an amino acid sequence that is at least about 90% identical to the sequence shown in any one of SEQ ID NOs. 58 to 77, and the VL comprises an amino acid sequence that is at least about 90% identical to the sequence shown in any one of SEQ ID NOs. 92 to 111. In some examples, the antibody or antibody fragment includes a VH containing at least or approximately 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with one of sequence numbers 58–77, and a VL containing at least or approximately 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with one of sequence numbers 92–111.

[0096] This specification describes pharmaceutical compositions comprising antibodies or antibody fragments that bind to GLP1R, including antibodies or antibody fragments in various dosages. In some examples, the dosages range from about 1 mg / kg to 80 mg / kg, about 1 mg / kg to about 100 mg / kg, about 5 mg / kg to about 100 mg / kg, about 5 mg / kg to about 80 mg / kg, about 5 mg / kg to about 60 mg / kg, about 5 mg / kg to about 50 mg / kg, or about 5 mg / kg to about 500 mg / kg, and may be administered as a single dose or in multiple doses. In some cases, the dosages were approximately 0.01 mg / kg, 0.05 mg / kg, 0.10 mg / kg, 0.25 mg / kg, 0.5 mg / kg, 1 mg / kg, 5 mg / kg, 10 mg / kg, 15 mg / kg, 20 mg / kg, 25 mg / kg, 30 mg / kg, 35 mg / kg, 40 mg / kg, and 45 mg / kg. , about 50mg / kg, about 55mg / kg, about 60mg / kg, about 65mg / kg, about 70mg / kg, about 75mg / kg, about 80mg / kg, about 85mg / kg, about 90mg / kg, about 95mg / kg, about 100mg / kg, about 105mg / kg, about 110mg / kg, about 115mg / kg, about 120, about 125, about 130, about 135, about 140, about 145, approximately 150, approximately 155, approximately 160, approximately 165, approximately 170, approximately 175, approximately 180, approximately 185, approximately 190, approximately 195, approximately 200, approximately 205, approximately 210, approximately 215, approximately 220, approximately 225, approximately 230, approximately 240, approximately 250, approximately 260, approximately 270, approximately 275, approximately 280, approximately 290, approximately 300, approximately 310, approximately 320, approximately 330, approximately 340, approximately 350, approximately 36 It is administered in doses of 0 mg / kg, approximately 370 mg / kg, approximately 380 mg / kg, approximately 390 mg / kg, approximately 400 mg / kg, 410 mg / kg, approximately 420 mg / kg, approximately 430 mg / kg, approximately 440 mg / kg, approximately 450 mg / kg, approximately 460 mg / kg, approximately 470 mg / kg, approximately 480 mg / kg, approximately 490 mg / kg, or approximately 500 mg / kg.

[0097] Mutant library

[0098] Codon variation

[0099] The variant nucleic acid libraries described herein may contain multiple nucleic acids, each nucleic acid encoding a variant codon sequence compared to a reference nucleic acid sequence. In some examples, each nucleic acid in the first nucleic acid population contains a variant at a single variant site. In some examples, the first nucleic acid population contains multiple variants at a single variant site, such that the first nucleic acid population contains two or more variants at the same variant site. The first nucleic acid population may contain nucleic acids that collectively encode multiple codon variants at the same variant site. The first nucleic acid population may contain nucleic acids that collectively encode up to 19 or more codons at the same location. The first nucleic acid population may contain nucleic acids that collectively encode up to 60 variant triplets at the same location, or the first nucleic acid population may contain nucleic acids that collectively encode up to 61 different triplet codons at the same location. Each variant may encode a codon that results in a different amino acid during translation. Table 2 presents a list of possible codons (and representative amino acids) for each variant site.

[0100] [Table 2]

[0101] A nucleic acid population may contain a variety of nucleic acids that collectively encode up to 20 codon mutations at multiple positions. In such cases, each nucleic acid in the population contains codon mutations at two or more positions of the same nucleic acid. In some examples, each nucleic acid in the population contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more codon mutations of a single nucleic acid. In some examples, the long nucleic acid of each variant contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more codon mutations of a single long nucleic acid. In some examples, a mutant nucleic acid population includes codon mutations at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more codons of a single nucleic acid. In some examples, a mutant nucleic acid population includes codon mutations at at least approximately 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more codons of a single long nucleic acid.

[0102] Highly parallel nucleic acid synthesis

[0103] This specification provides a platform approach that leverages miniaturization, parallelization, and vertical integration of end-to-end processes from polynucleotide synthesis to gene assembly within silicon nanocells to create innovative synthesis platforms. The apparatus described herein provides a silicon synthesis platform that can increase throughput by up to 1,000 times or more compared to conventional synthesis methods, with the same footprint as a 96-well plate, and can generate up to approximately 1,000,000 or more polynucleotides, or 10,000 or more genes, in a single, particularly parallelized run.

[0104] With the advent of next-generation sequencing, high-resolution genomic data has become a crucial factor in research exploring the biological roles of various genes in both normal biology and disease pathogenesis. At the heart of this research lies the central theory of molecular biology and the concept of "residue-by-residue transmission of sequence-related information." Genomic information encoded in DNA is transcribed into a message, which is then translated into proteins—active products within a given biological pathway.

[0105] Another interesting area of ​​research concerns the discovery, development, and manufacture of therapeutic molecules, particularly those focused on specific cellular targets. High-diversity DNA sequence libraries are central to the targeted therapy development pipeline. Gene variants are used to express proteins in the genetic engineering cycle of designing, building, and testing proteins, ideally reaching genes optimized for highly expressing proteins with high affinity to therapeutic targets. Consider the receptor binding pocket as an example. The ability to simultaneously test all sequence substitutions of all residues within the binding pocket allows for thorough exploration and increases the likelihood of success. Saturated mutagenesis, in which researchers attempt to generate all possible mutations at specific sites within the receptor, represents one approach to this development challenge. Although expensive, time- and labor-intensive, it allows each variant to be introduced at its respective location. In contrast, combinatorial mutagenesis, where several selected sites or short DNA extensions can be extensively modified, produces an incomplete repertoire of variants with biased expressions.

[0106] To accelerate the drug development pipeline, a library containing desired variants available at the intended frequency and in the correct location available for testing—in other words, a precision library—enables reduced screening costs and overall time savings. A method for synthesizing nucleic acid synthetic variant libraries resulting in the precise introduction of each intended variant at the desired frequency is provided herein. For end-users, this translates to the ability to query these hypotheses in an efficient manner, as well as completely sample the sequence space, potentially reducing costs and screening time. Genome-wide editing can elucidate libraries where critical pathways, each variant, and sequence substitution can be tested for optimal functionality, and thousands of genes can be used to reconstruct pathways and entire genomes to redesign biological systems for drug discovery.

[0107] In the first example, the drug itself can be optimized using the methods described herein. For example, to improve a specific function of an antibody, a mutant polynucleotide library encoding a portion of the antibody is designed and synthesized. The mutant nucleic acid library of the antibody can then be produced by the processes described herein (e.g., PCR mutagenesis followed by insertion into a vector). The antibody is then expressed in a producing cell line and screened for enhancement of activity. Exemplary screening includes examining binding affinity to an antigen, stability, or modulation of effector function (e.g., ADCC, complement, or apoptosis). Exemplary regions for antibody optimization include, but are not limited to, the Fc region, the Fab region, the variable region of the Fab region, the constant region of the Fab region, and the variable domains (V) of the heavy or light chain. H or V L ), and V H or V L Examples include the specific complementarity-determining region (CDR).

[0108] Nucleic acid libraries synthesized by the methods described herein can be expressed in a variety of cells associated with disease conditions. These disease-associated cells include cell lines, tissue samples, primary cells obtained from a subject, cultured cells grown from a subject, or cells from model systems. Exemplary model systems include, but are not limited to, plant and animal models of disease conditions.

[0109] To identify mutant molecules associated with the prevention, mitigation, or treatment of disease conditions, the mutant nucleic acid libraries described herein are expressed in cells associated with the disease condition, or in cells capable of inducing the disease condition. In some examples, the active agents are used to induce the disease condition in cells. Exemplary tools for inducing disease conditions include, but are not limited to, Cre / Lox recombinant systems, LPS inflammation induction, and streptozotocin for inducing hypoglycemia. Cells associated with the disease condition may be cells obtained from model systems or cultured cells, as well as cells obtained from subjects having a particular disease condition. Exemplary disease conditions include bacterial, fungal, viral, autoimmune, or proliferative disorders (e.g., cancer). In some examples, the mutant nucleic acid libraries are expressed in model systems, cell lines, or primary cells derived from the subject and screened for changes in at least one cellular activity. Exemplary cellular activities include, but are not limited to, proliferation, cycle progression, cell death, adhesion, migration, regeneration, cellular signaling, energy production, oxygen utilization, metabolic activity and aging, response to free radical damage, or any combination thereof.

[0110] substrate

[0111] Apparatus used as a surface for synthesizing polynucleotides may, but are not limited to, be in the form of a substrate including a homogeneous array surface, a patterned array surface, channels, beads, a gel, etc. Substrates comprising multiple clusters are provided herein, each cluster comprising multiple loci that assist in the attachment and synthesis of polynucleotides. In some examples, the substrate comprises a homogeneous array surface. For example, a homogeneous array surface is a homogeneous plate. As used herein, the term “locus” refers to a distinct region of structure that assists in the encoding of a single, predetermined sequence of polynucleotides extending from the surface. In some examples, the locus is on a two-dimensional surface, e.g., a substantially flat surface. In some examples, the locus is on a three-dimensional surface, e.g., a well, a microwell, a channel, or a post. In some examples, the surface of the locus comprises a material actively functionalized to bind to at least one nucleotide for the synthesis of polynucleotides, or preferably a population of identical nucleotides for the synthesis of a population of polynucleotides. In some examples, polynucleotides refer to a population of polynucleotides encoding the same nucleic acid sequence. In some cases, the surface of the substrate comprises one or more surfaces of the substrate. The average error rate of polynucleotides synthesized in the libraries described herein using the provided systems and methods is often less than 1 in 1000, less than approximately 1 in 2000, less than approximately 1 in 3000, or less than that, without error correction.

[0112] This specification provides a surface that facilitates the parallel synthesis of multiple polynucleotides having different predetermined sequences at addressable positions on a common support. In some examples, the substrate is 50, 100, 200, 400, 600, 800, 1000, 1200, 1400, 1600, 1800, 2,000, 5,000, 10,000, 20,000, 50,000, 100,000, 200,000, 300,000, 400,000, 500,000, 600,000, 700,000, 800,000, 900,000 This provides a support for synthesizing non-identical polynucleotides of 1,000,000, 1,200,000, 1,400,000, 1,600,000, 1,800,000, 2,000,000, 2,500,000, 3,000,000, 3,500,000, 4,000,000, 4,500,000, 5,000,000, 10,000,000 or more. In some cases, the surface may have 50, 100, 200, 400, 600, 800, 1000, 1200, 1400, 1600, 1800, 2,000, 5,000, 10,000, 20,000, 50,000, 100,000, 200,000, 300,000, 400,000, 500,000, 600,000, 700,000, 800,000, 900,000, and 1,000. This provides a support for synthesizing polynucleotides encoding different sequences of 1,000, 1,200,000, 1,400,000, 1,600,000, 1,800,000, 2,000,000, 2,500,000, 3,000,000, 3,500,000, 4,000,000, 4,500,000, 5,000,000, 10,000,000 or more. In some examples, at least a portion of the polynucleotides have the same sequence or are configured to be synthesized with the same sequence. In some examples, the substrate provides a surface environment for the growth of polynucleotides having at least 80, 90, 100, 120, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500 bases or more.

[0113] Methods for polynucleotide synthesis at different loci on a substrate are provided herein, in which each locus supports the synthesis of a population of polynucleotides. In some cases, each locus supports the synthesis of a population of polynucleotides having a different sequence from the population of polynucleotides amplified at another locus. In some examples, the sequence of each polynucleotide is synthesized with 1, 2, 3, 4, 5, 6, 7, 8, 9 or more duplicates across different loci within the same cluster of surface loci for polynucleotide synthesis. In some examples, the loci on the substrate are located within multiple clusters. In some examples, the substrate contains at least 10, 500, 1,000, 2,000, 3,000, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000, 10,000, 11,000, 12,000, 13,000, 14,000, 15,000, 20,000, 30,000, 40,000, 50,000 or more clusters. In some examples, the substrates are 2,000, 5,000, 10,000, 100,000, 200,000, 300,000, 400,000, 500,000, 600,000, 700,000, 800,000, 900,000, 1,000,000, 1,100,000, 1,200,000, 1,300,000, 1,400,000, 1,500,000, 1,600,000, 1,700,000, 1,800,000, 1,900,000, 2,000,0 It includes 00, 300,000, 400,000, 500,000, 600,000, 700,000, 800,000, 900,000, 1,000,000, 1,200,000, 1,400,000, 1,600,000, 1,800,000, 2,000,000, 2,500,000, 3,000,000, 3,500,000, 4,000,000, 4,500,000, 5,000,000, or 10,000,000 or more different loci. In some examples, the substrate contains approximately 10,000 different loci. The number of loci within a single cluster varies in various cases.Depending on the case, each cluster may contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 130, 150, 200, 300, 400, 500 or more loci. In some examples, each cluster may contain approximately 50–500 loci. In some examples, each cluster may contain approximately 100–200 loci. In some examples, each cluster may contain approximately 100–150 loci. In some examples, each cluster may contain approximately 109, 121, 130, or 137 loci. In some examples, each cluster may contain approximately 19, 20, 61, 64 or more loci. Alternatively, or in combination, polynucleotide synthesis may occur on a homogeneous array surface.

[0114] In some cases, the number of distinct polynucleotides synthesized on a substrate depends on the number of distinct loci available on that substrate. In some cases, the density of loci in a substrate cluster or within its surface is at least or about 1, 10, 25, 50, 65, 75, 100, 130, 150, 175, 200, 300, 400, 500, 1,000 or more per 1 mm 2 These are the gene loci around this area. In some cases, the substrate is 10-500, 25-400, 50-500, 100-500, 150-500, 10-250, 50-250, 10-200, or 50-200 mm. 2This includes: In some examples, the distance between the centers of two adjacent loci within a cluster or surface is approximately 10–500, approximately 10–200, or approximately 10–100 μm. In some examples, the distance between the centers of two adjacent loci is greater than approximately 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 μm. In some examples, the distance between the centers of two adjacent loci is less than approximately 200, 150, 100, 80, 70, 60, 50, 40, 30, 20, or 10 μm. In some examples, each locus has a width of approximately 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 μm. In some cases, each locus has a width of approximately 0.5–100, 0.5–50, 10–75, or 0.5–50 μm.

[0115] In some examples, the cluster density inside the substrate is at least or approximately 100 mm². 2 1 cluster per 10mm 2 1 cluster per 5mm 2 1 cluster per 4mm 2 1 cluster per 3mm 2 1 cluster per 2 mm 2 1 cluster per 1 mm 2 1 cluster per 1 mm 2 2 clusters per 1 mm 2 3 clusters per 1 mm 2 4 clusters per 1 mm 2 5 clusters per 1 mm 2 10 clusters per 1 mm 2 There are 50 clusters or more per unit. In some examples, the substrate is 10mm 2 Approximately 1 cluster per 1 mm 2Each cluster contains approximately 10 clusters. In some examples, the distance between the centers of two adjacent clusters is at least or approximately 50, 100, 200, 500, 1000, 2000, or 5000 μm. In some cases, the distance between the centers of two adjacent clusters is approximately 50–100, 50–200, 50–300, 50–500, and 100–2000 μm. In some cases, the distance between the centers of two adjacent clusters is approximately 0.05–50, 0.05–10, 0.05–5, 0.05–4, 0.05–3, 0.05–2, 0.1–10, 0.2–10, 0.3–10, 0.4–10, 0.5–10, 0.5–5, or 0.5–2 mm. In some cases, each cluster has a cross-section of approximately 0.5 to 2 mm, approximately 0.5 to 1 mm, or approximately 1 to 2 mm. In some cases, each cluster has a cross-section of approximately 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, or 2 mm. In some cases, each cluster has an interior cross-section of approximately 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.15, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, or 2 mm.

[0116] In some examples, the substrate is roughly the size of a standard 96-well plate, for example, approximately 100 to 200 mm on a standard basis of approximately 50 to 150 mm. In some examples, the substrate has a diameter of approximately 1000, 500, 450, 400, 300, 250, 200, 150, 100, or 50 mm or less. In some examples, the substrate diameter is approximately 25 to 1000, 25 to 800, 25 to 600, 25 to 500, 25 to 400, 25 to 300, or 25 to 200 mm. In some examples, the substrate is at least approximately 100, 200, 500, 1,000, 2,000, 5,000, 10,000, 12,000, 15,000, 20,000, 30,000, 40,000, or 50,000 mm. 2 The substrate has the surface area of ​​the plane described above. In some examples, the thickness of the substrate is approximately 50-2000, 50-1000, 100-1000, 200-1000, or 250-1000 mm.

[0117] Surface material

[0118] The substrates, apparatus, and reactors provided herein are manufactured from any variety of materials suitable for the methods, compositions, and systems described herein. In certain examples, the substrate material is fabricated to exhibit low levels of nucleotide bonding. In some examples, the substrate material is modified to produce distinct surfaces exhibiting high levels of nucleotide bonding. In some examples, the substrate material is transparent to visible and / or UV light. In some examples, the substrate material is sufficiently conductive to form a uniform electric field across all or part of the substrate, for example. In some examples, the conductive material is connected to an electrical ground. In some examples, the substrate is thermally conductive or insulating. In some examples, the material is chemically and heat-resistant to support chemical or biochemical reactions, such as polynucleotide synthesis reaction processes. In some examples, the substrate includes flexible materials. In the case of flexible materials, the material may include, but is not limited to, nylon, nitrocellulose, polypropylene, etc., both modified and unmodified. In some examples, the substrate includes rigid materials. For rigid materials, the materials may include, but are not limited to, glass, fused silica, silicon, plastics (e.g., polytetrafluoroethylene, polypropylene, polystyrene, polycarbonate, and blends thereof), and metals (e.g., gold, platinum). Substrates, solid supports, or reactors can be manufactured from materials selected from the group consisting of silicon, polystyrene, agarose, dextran, cellulosic polymers, polyacrylamide, polydimethylsiloxane (PDMS), and glass. Substrates / solid supports or microstructures / reactors within them can be manufactured in combination of the materials listed herein or any other suitable materials known in the art.

[0119] Surface structure

[0120] Substrates for the methods, compositions, and systems described herein are provided herein, the substrates having a surface structure suitable for the methods, compositions, and systems described herein. In some examples, the substrate includes raised and / or recessed features. One advantage of having such features is an increased surface area to assist polynucleotide synthesis. In some examples, a substrate having raised and / or recessed features is called a three-dimensional substrate. In some cases, a three-dimensional substrate includes one or more channels. In some cases, one or more loci include channels. In some cases, the channels are available for the deposition of reagents via a deposition apparatus such as a material deposition apparatus. In some cases, reagents and / or fluids accumulate in a larger well that is fluidly connected to one or more channels. For example, a substrate includes multiple channels corresponding to multiple loci having a cluster, and the multiple channels are fluidly connected to one well of the cluster. In some methods, a library of polynucleotides is synthesized at multiple loci of the cluster.

[0121] This specification provides substrates for the methods, compositions, and systems described herein, which are configured for the synthesis of polynucleotides. In some examples, the structure is configured to enable controlled flow and mass transfer pathways for the synthesis of polynucleotides on the surface. In some examples, the substrate configuration allows for a controlled and uniform distribution of mass transfer pathways, chemical exposure time, and / or cleaning effect during polynucleotide synthesis. In some examples, the substrate configuration allows for increased sweep efficiency by providing sufficient volume for the growing polynucleotide, for example, so that the volume excluded by the growing polynucleotide does not occupy more than 50, 45, 40, 35, 30, 25, 20, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1% or less of the initially available volume available or suitable for growing the polynucleotide. In some examples, the three-dimensional structure allows for controlled fluid flow to enable rapid replacement of chemical exposures.

[0122] Provided herein are substrates for the methods, compositions, and systems described herein, the substrates comprising structures suitable for the methods, compositions, and systems described herein. In some examples, separation is achieved by physical structure. In some examples, separation is achieved by differential functionalization of surface-generated active and inactive regions for polynucleotide synthesis. In some examples, differential functionalization is achieved by alternating hydrophobicity across the entire substrate surface, thereby creating a water contact angle effect that causes beading or wetting of the deposited reagent. By using larger structures, splashing and cross-contamination between reagents in adjacent spots and different polynucleotide synthesis locations can be reduced. In some cases, equipment such as material deposition apparatus is used to deposit reagents at different polynucleotide synthesis locations. Substrates having three-dimensional features are configured to enable the synthesis of a large number of polynucleotides (e.g., more than about 10,000) with a low error rate (e.g., less than about 1:500, 1:1000, 1:1500, 1:2,000, 1:3,000, 1:5,000, or 1:10,000). In some cases, the circuit board is 1 mm 2 Each includes features having a feature density of approximately 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 300, 400, or 500 or more.

[0123] Wells in the substrate may have the same or different width, height, and / or volume as other wells in the substrate. Channels in the substrate may have the same or different width, height, and / or volume as other channels in the substrate. In some examples, the diameter of a cluster or the diameter of a well containing a cluster, or both, are approximately 0.05–50, 0.05–10, 0.05–5, 0.05–4, 0.05–3, 0.05–2, 0.05–1, 0.05–0.5, 0.05–0.1, 0.1–10, 0.2–10, 0.3–10, 0.4–10, 0.5–10, 0.5–5, or 0.5–2 mm. In some examples, the diameter of a cluster or well, or both, is less than 5, 4, 3, 2, 1, 0.5, 0.1, 0.09, 0.08, 0.07, 0.06, or 0.05 mm, or approximately 5, 4, 3, 2, 1, 0.5, 0.1, 0.09, 0.08, 0.07, 0.06, or 0.05 mm. In some examples, the diameter of a cluster or well, or both, is approximately 1.0–1.3 mm. In some examples, the diameter of a cluster or well, or both, is approximately 1.150 mm. In some examples, the diameter of a cluster or well, or both, is approximately 0.08 mm. The cluster diameter refers to a cluster within a two-dimensional or three-dimensional substrate.

[0124] In some examples, well heights are approximately 20–1000, 50–1000, 100–1000, 200–1000, 300–1000, 400–1000, or 500–1000 μm. In some cases, well heights are approximately 1000, 900, 800, 700, or less than 600 μm.

[0125] In some examples, the substrate contains multiple channels corresponding to multiple gene loci within the cluster, with channel heights or depths of 5–500, 5–400, 5–300, 5–200, 5–100, 5–50, or 10–50 μm. In some cases, channel heights are less than 100, 80, 60, 40, or 20 μm.

[0126] In some examples, the diameters of both channels, loci (e.g., on a substantially flat substrate), or both channels and loci (e.g., on a three-dimensional substrate where the locus corresponds to a channel) are approximately 1–1000, 1–500, 1–200, 1–100, 5–100, or 10–100 μm, e.g., approximately 90, 80, 70, 60, 50, 40, 30, 20, or 10 μm. In some examples, the diameters of channels, loci, or both channels and loci are less than approximately 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 μm. In some examples, the distance between the centers of two adjacent channels, loci, or both channels and loci is approximately 1–500, 1–200, 1–100, 5–200, 5–100, 5–50, or 5–30 μm, e.g., approximately 20 μm.

[0127] Surface modification

[0128] Methods for polynucleotide synthesis on surfaces are provided herein, and the surfaces include various surface modifications. In some examples, surface modification is used for chemical and / or physical changes of a surface by additive or subtractive processes to alter one or more chemical and / or physical properties of the surface of a substrate or selected parts or regions of the surface of a substrate. For example, surface modification includes, but is not limited to, (1) altering the wetting properties of the surface; (2) functionalizing the surface, i.e., introducing, modifying, or substituting surface functional groups; (3) defunctionalizing the surface, i.e., removing surface functional groups; (4) otherwise altering the chemical composition of the surface, for example by etching; (5) increasing or decreasing the surface roughness; (6) introducing a coating that exhibits different wetting properties from the surface, for example; and / or (7) depositing fine particles on the surface.

[0129] In some cases, adding a chemical layer (called an adhesion promoter) to the top of the surface facilitates the formation of structured patterns of loci on the substrate surface. Exemplary surfaces to which adhesion promoters should be applied include, but are not limited to, glass, silicon, silicon dioxide, and silicon nitride. In some cases, the adhesion promoter is a chemical with high surface energy. In some examples, a second chemical layer is deposited on the substrate surface. In some cases, the second chemical layer has low surface energy. In some cases, the surface energy of the chemical layer coated on the surface assists in the localization of droplets on the surface. Depending on the arrangement of the selected patterning, the proximity of loci and / or the fluid contact area of ​​the loci can be modified.

[0130] In some examples, for instance, for the synthesis of polynucleotides, the surface of the substrate on which nucleic acids or other parts are deposited, or the degraded gene loci, may be smooth or substantially planar (e.g., two-dimensional) or have irregularities such as raised or recessed features (e.g., three-dimensional features). In some examples, the surface of the substrate is modified with one or more different compound layers. Such modification layers for this purpose may include, but are not limited to, inorganic and organic layers such as metals, metal oxides, polymers, and small organic molecules.

[0131] In some cases, the degraded loci of a substrate are functionalized with one or more moieties that increase and / or decrease the surface energy. In some cases, the moieties are chemically inert. In some cases, the moieties are configured to support one or more processes in a desired chemical reaction, e.g., polynucleotide synthesis. The surface energy or hydrophobicity of the surface is a factor for determining the affinity of nucleotides to adhere to the surface. In some cases, methods for functionalizing a substrate include (a) resulting in a substrate having a surface containing silicon dioxide, and (b) silanizing the surface using a suitable silanizing agent described herein or otherwise known in the art, e.g., an organofunctionalized alkoxysilane molecule. The methods and functionalizing agents are described in U.S. Patent No. 5,474,796, which is incorporated herein in whole by reference.

[0132] In some cases, the surface of a substrate is functionalized by contact with a derivatization composition containing a mixture of silanes, typically via reactive hydrophilic moieties present on the substrate surface, under reaction conditions effective for bonding silanes to the substrate surface. Silanation generally involves coating the surface by self-assembly with organofunctionalized alkoxysilane molecules. For example, various siloxane functionalization reagents, as currently known in the art, can be used to lower or increase the surface energy. Organofunctionalized alkoxysilanes are classified according to their organofunctionality.

[0133] Polynucleotide synthesis

[0134] The methods of this disclosure for the synthesis of polynucleotides may include processes involving phosphoramidite chemistry. In some examples, the synthesis of polynucleotides includes coupling a base with a phosphoramidite. The synthesis of polynucleotides may also include coupling a base by depositing a phosphoramidite under coupling conditions, where the base is optionally deposited two or more times with the phosphoramidite, i.e., double coupling. The synthesis of polynucleotides may include capping of unreacted sites. In some examples, capping is optional. The synthesis of polynucleotides may also include oxidation or one or more oxidation steps. The synthesis of polynucleotides may include deblocking, detritylation, and sulfidation. In some examples, the synthesis of polynucleotides includes either oxidation or sulfidation. In some examples, the apparatus is cleaned with, for example, tetrazole or acetonitrile during one step or between each step of the polynucleotide synthesis reaction. The time frame for any one step in the phosphoramidite synthesis method may be approximately 2 minutes, 1 minute, 50 seconds, 40 seconds, 30 seconds, 20 seconds, and less than 10 seconds.

[0135] The synthesis of polynucleotides using the phosphoramidite method may involve subsequently adding phosphoramidite components (e.g., nucleoside phosphoramidites) to a growing polynucleotide chain to form a phosphyte triester bond. The synthesis of phosphoramidite polynucleotides proceeds in the 3' to 5' direction. The synthesis of phosphoramidite polynucleotides allows for the controlled addition of one nucleotide to a growing nucleic acid chain in each synthetic cycle. In some examples, each synthetic cycle includes a coupling step. The coupling of phosphoramidites involves the formation of a phosphyte triester bond between an activated nucleoside phosphoramidite and a nucleoside bound to a substrate, for example, via a linker. In some examples, the nucleoside phosphoramidite is provided in an activated apparatus. In some examples, the nucleoside phosphoramidite is provided in the apparatus together with an activator. In some examples, the nucleoside phosphoramidite is provided in the apparatus in an excess of 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100 times or more compared to the nucleoside bound to the substrate. In some examples, the addition of the nucleoside phosphoramidite is carried out in an anhydrous environment, for example, anhydrous acetonitrile. After adding the nucleoside phosphoramidite, the apparatus is optionally washed. In some examples, the coupling step is optionally repeated one or more further times, accompanied by a washing step between the addition of the nucleoside phosphoramidite to the substrate. In some examples, the method of synthesizing polynucleotides used herein comprises one, two, three or more consecutive coupling steps. In many cases, before coupling, the nucleoside bonded to the apparatus is deprotected by the removal of a protecting group, which functions to prevent polymerization. A common protecting group is 4,4'-dimethoxytrityl (DMT).

[0136] After coupling, the synthesis method for phosphoramidite polynucleotides optionally includes a capping step. In the capping step, the growing polynucleotide is treated with a capping agent. The capping step is useful in blocking the 5'-OH group bound to the unreacted substrate after coupling from further chain elongation and preventing the formation of polynucleotides with internal base deletions. Furthermore, phosphoramidites activated with 1H-tetrazole may react slightly with the O6 position of guanosine. Although not bound by theory, upon oxidation with I2 / water, this byproduct may undergo depurination, possibly via O6-N7 migration. The aprine site may be cleaved during the final deprotection of the polynucleotide, thus reducing the yield of the full-length product. The O6 modification can be removed by treatment with a capping reagent before oxidation with I2 / water. In some examples, including a capping step during polynucleotide synthesis reduces the error rate compared to synthesis without capping. For example, the capping step involves treating the substrate-bound polynucleotide with a mixture of acetic anhydride and 1-methylimidazole. After the capping step, the apparatus is optionally cleaned.

[0137] In some cases, the growing nucleic acids bound to the apparatus are oxidized after the addition of nucleoside phosphoramidite and optionally after capping and one or more washing steps. The oxidation step involves triester phosphate, which is oxidized to tetracoordinate triester phosphate, a protected precursor of the naturally occurring phosphate diester nucleoside bond. In some cases, oxidation of the growing polynucleotides is achieved by treatment with iodine and water in the presence of a weak base (e.g., pyridine, lutidine, colidine) in the presence of an optional weak base. Oxidation may be carried out under anhydrous conditions using, for example, tert-butyl hydroperoxide or (1S)-(+)-(10-camphorsulfonyl)-oxaziridine (CSO). In some methods, a capping step is performed after oxidation. The second capping step allows the apparatus to dry, as residual water from persistent oxidation may inhibit subsequent coupling. After oxidation, the apparatus and the growing polynucleotides are optionally washed. In some examples, the oxidation step is replaced by a sulfidation step to obtain a polynucleotide phosphorothioate, after which an optional capping step can be performed. Many reagents allow for efficient sulfur transfer and include, but are not limited to, 3-(dimethylaminomethylidene)amino)-3H-1,2,4-dithiazole-3-thion, DDTT, 3H-1,2-benzodithiol-3-one 1,1-dioxide, and N,N,N'N'-tetraethylthiuram disulfide (TETD), also known as Beaucage reagents.

[0138] For the subsequent cycle of nucleoside incorporation resulting from coupling, the protected 5' end of the growing polynucleotide bound to the apparatus is removed to allow the primary hydroxyl group to react with the next nucleoside phosphoramidite. In some examples, the protecting group is DMT, and deblocking occurs with dichloromethane trichloroacetic acid. Detritylation for extended periods or with stronger acid solutions than recommended can increase depurination of the solid support-bound polynucleotide, and thus reduce the yield of the desired full-length product. The methods and compositions disclosed herein result in controlled deblocking conditions that limit undesirable depurination reactions. In some examples, the polynucleotide bound to the apparatus is washed after deblocking. In some examples, efficient washing after deblocking contributes to synthetic polynucleotides with a low error rate.

[0139] Methods for synthesizing polynucleotides typically involve a repeating chain of the following steps: applying a protected monomer to an active functionalized surface (e.g., a locus) for linking with either an activated surface, a linker, or a pre-deprotected monomer; deprotecting the applied monomer to make it reactive with the subsequently applied protected monomer; and applying another protected monomer for linking. One or more intermediate steps include oxidation or sulfurization. In some examples, one or more washing steps precede or follow one or all of the steps.

[0140] Methods for synthesizing phosphoramidite-based polynucleotides involve a series of chemical steps. In some examples, one or more steps of the synthesis method include a reagent cycle, and one or more steps of the method include the application of reagents useful for that step to an apparatus. For example, reagents are circulated by a series of liquid deposition and vacuum drying steps. In the case of a substrate having three-dimensional features such as wells, microwells, and channels, the reagents optionally pass through one or more areas of the apparatus via the wells and / or channels.

[0141] The methods and systems described herein relate to polynucleotide synthesizers for synthesizing polynucleotides. Synthesis may be carried out in parallel. For example, at least or approximately at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 1000, 10000, 50000, 75000, 100000 or more polynucleotides can be synthesized in parallel. The total number of polynucleotides that can be synthesized in parallel may be 2-100,000, 3-50,000, 4-10,000, 5-1,000, 6-900, 7-850, 8-800, 9-750, 10-700, 11-650, 12-600, 13-550, 14-500, 15-450, 16-400, 17-350, 18-300, 19-250, 20-200, 21-150, 22-100, 23-50, 24-45, 25-40, and 30-35. Those skilled in the art will understand that the total number of polynucleotides synthesized in parallel may be any range constrained by any of these values, for example, 25-100. The total number of polynucleotides synthesized in parallel may be any range defined by any value that acts as an endpoint to that range. The total molar mass of polynucleotides synthesized inside the apparatus, or the molar mass of each individual polynucleotide, may be at least or at least about 10, 20, 30, 40, 50, 100, 250, 500, 750, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 25000, 50000, 75000, 100000 picomoles or more. The length of each polynucleotide inside the apparatus, or the average length of polynucleotides, may be at least or at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 150, 200, 300, 400, 500 nucleotides or more.The length of each polynucleotide or the average length of polynucleotides inside the device may be at most or at most about 500, 400, 300, 200, 150, 100, 50, 45, 35, 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10 nucleotides or less. The length of each polynucleotide or the average length of polynucleotides inside the device may be 10-500, 9-400, 11-300, 12-200, 13-150, 14-100, 15-50, 16-45, 17-40, 18-35, 19-25. Those skilled in the art will understand that the length of each polynucleotide or the average length of polynucleotides inside the device may be within any range constrained by any of these values, for example, within the range of 100-300. The length of each polynucleotide within the device, or the average length of the polynucleotides, can be within any range defined by any of the values ​​that serve as the range endpoints.

[0142] The methods for surface synthesis of polynucleotides provided herein enable rapid synthesis. For example, at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 125, 150, 175, 200 nucleotides / hour or more are synthesized. The nucleotides include adenine, guanine, thymine, cytosine, uridine components, or their analogs / modified versions. In some examples, libraries of polynucleotides are synthesized in parallel on the substrate. For example, approximately or at least approximately 100, 1,000, 10,000, 30,000, 75,000, 100,000, 1,000,000, 2,000,000, 3,000,000, 4,000,000, or 5,000,000 degraded loci can support the synthesis of at least the same number of different polynucleotides, and polynucleotides encoding different sequences are synthesized at the degraded loci. In some cases, a library of polynucleotides is synthesized in an instrument with a low error rate as described herein, in a time of less than approximately 3 months, less than 2 months, less than 1 month, less than 3 weeks, less than 15 hours, less than 14 hours, less than 13 hours, less than 12 hours, less than 11 hours, less than 10 hours, less than 9 hours, less than 8 hours, less than 7 hours, less than 6 hours, less than 5 hours, less than 4 hours, less than 3 hours, less than 2 days, less than 24 hours, or less. In some examples, larger nucleic acids prepared from polynucleotide libraries synthesized with low error rates using the substrates and methods described herein can be prepared in approximately 3 months, 2 months, 1 month, 3 weeks, 15 days, 14 days, 13 days, 12 days, 11 days, 10 days, 9 days, 8 days, 7 days, 6 days, 5 days, 4 days, 3 days, 2 days, 24 hours, or less.

[0143] In some examples, the methods described herein result in the generation of a library of nucleic acids containing nucleic acids of different variants at multiple codon sites. In some examples, the nucleic acids may have one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, thirty, forty, fifty, or more variant codon sites.

[0144] In some cases, one or more codon sites in the mutant may be adjacent. In some cases, one or more codon sites in the mutant may not be adjacent, but are separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more codons.

[0145] In some cases, the nucleic acid may contain multiple sites of the mutant codon, all of which are adjacent to each other and form an extension of the mutant codon. In some cases, the nucleic acid may contain multiple sites of the mutant codon, but which are not adjacent to each other. In some cases, the nucleic acid may contain multiple sites of the mutant codon, some of which are adjacent to each other and form an extension of the mutant codon, while some of which are not adjacent to each other.

[0146] Referring to the figure, Figure 3 shows an exemplary workflow for synthesizing nucleic acids (e.g., genes) from shorter nucleic acids. The workflow is generally divided into five stages: (1) de novo synthesis of a single-stranded nucleic acid library, (2) joining of nucleic acids to form a larger fragment, (3) error correction, (4) quality control, and (5) shipping. Prior to de novo synthesis, the intended nucleic acid sequence or group of nucleic acid sequences is pre-selected. For example, a group of genes is pre-selected for production.

[0147] Once a large nucleic acid for synthesis is selected, a predetermined library of nucleic acids is designed for de novo synthesis. Various preferred methods are known for generating high-density polynucleotide arrays. In the example workflow, a surface layer is provided for the apparatus. In this example, the surface chemistry is modified to improve the polynucleotide synthesis process. Low surface energy regions are generated to repel liquids, while high surface energy regions are generated to attract liquids. The surface itself may be in the form of a flat surface or may include morphological changes such as protrusions or microwells that increase the surface area. In the example workflow, the selected high surface energy molecules perform a dual function to support DNA chemistry, as disclosed in International Patent Application Publication No. 2015 / 021080, which is incorporated herein in its entirety by reference.

[0148] The in-situ preparation of polynucleotide arrays involves generation on a solid support, utilizing the single-nucleotide elongation process to elongate multiple oligomers in parallel. Deposition devices, such as material deposition systems, are designed to release reagents stepwise so that multiple polynucleotides are elongated one residue at a time in parallel to produce oligomers having a predetermined nucleic acid sequence 302. In some examples, the polynucleotides are cleaved from the surface at this stage. Cleavage includes gas cleavage with ammonia or methylamine, for example.

[0149] The generated polynucleotide library is placed in a reaction chamber. In this exemplary workflow, the reaction chamber (also called a "nanoractor") is a silicon-coated well 303 containing PCR reagents and lowered into the polynucleotide library. Before or after the encapsulation of the polynucleotides 304, reagents are added to release the polynucleotides from the substrate. In this exemplary workflow, the polynucleotides are released after encapsulation 305 of the nanoreactor. Once released, the single-stranded polynucleotide fragments hybridize to span the entire long-range sequence of DNA. Partial hybridization 305 is possible because each synthesized polynucleotide is designed to have a small portion that overlaps with at least one other polynucleotide in the pool.

[0150] Following hybridization, the PCA reaction is initiated. During the polymerase cycle, polynucleotides anneal to complementary fragments, and gaps are filled by the polymerase. Each cycle randomly increases the length of various fragments depending on which polynucleotides are found together. The complementarity between fragments allows for the formation of a complete, large span of double-stranded DNA306.

[0151] After PCA is complete, the nanoreactor is separated from the instrument 307 and positioned for interaction with the instrument having primers for PCR 308. After sealing, the nanoreactor is subjected to PCR 309 to amplify larger nucleic acids. After PCR 310, the nanochamber is opened 311, error correction reagent is added 312, the chamber is sealed 313 to allow the error correction reaction to occur and remove mismatched base pairs and / or less complementary strands from the double-stranded PCR amplification product 314. The nanoreactor is opened and separated 315. The error-corrected product then undergoes additional processing steps such as PCR and molecular barcoding, then packaged 322 and shipped 323.

[0152] In some cases, quality control measures are taken. After error correction, the quality control step includes, for example, interaction with a wafer having sequencing primers for amplification 316 of the error-corrected product, sealing the wafer into a chamber containing the error-corrected amplified product 317, and performing an additional amplification round 318. The nanoreactor is opened 319, the product is pooled 320, and sequenced 321. After an acceptable quality control determination is made, the packaged product 322 is approved for shipment 323.

[0153] In some cases, nucleic acids generated by workflows such as the one shown in Figure 3 are subjected to mutagenesis using duplicate primers disclosed herein. In some cases, the primer library is generated by preparing in situs on a solid support and elongating multiple oligomers in parallel using a single-nucleotide elongation process. Deposition devices, such as material deposition devices, are designed to release reagents stepwise so that multiple polynucleotides are elongated one residue at a time in parallel to produce oligomers having a predetermined nucleic acid sequence 302.

[0154] Computer system

[0155] Any of the systems described herein may be operablely linked to a computer and may be automated via a computer, either locally or remotely. In various cases, the methods and systems of this disclosure may further include software programs for a computer system and the use thereof. Thus, computer control for the synchronization of distribution / vacuum / refilling functions, such as the adjustment and synchronization of the movement, distribution, and vacuuming operations of the material deposition apparatus, is within the scope of this disclosure. The computer system may be programmed to interface between a user-specified base sequence and the position of the material deposition apparatus in order to deliver the correct reagent to a designated area of ​​the substrate.

[0156] The computer system 400 shown in Figure 4 may be understood as a logical device capable of reading instructions from a medium 411 and / or a network port 405, which can optionally be connected to a server 409 having a fixed medium 412. A system like the one shown in Figure 4 may include a CPU 401, a disk drive 403, optional input devices such as a keyboard 415 and / or a mouse 416, and an optional monitor 407. Data communication can be achieved via a designated communication medium to a server at a local or remote location. The communication medium may include any means for transmitting and / or receiving data. For example, the communication medium may be a network connection, a wireless connection, or an Internet connection. Such a connection may result in communication over the World Wide Web. It is assumed that data relating to this disclosure can be transmitted over such a network or connection for reception and / or review by party 422, as shown in Figure 4.

[0157] Figure 5 is a block diagram showing a first exemplary architecture of a computer system 500 that can be used in connection with the exemplary examples of the present disclosure. As shown in Figure 5, the exemplary computer system may include a processor 502 for processing instructions. Non-limiting examples of processors include Intel Xeon® processors, AMD Opteron® processors, Samsung 32-bit RISC ARM 1176JZ(F)-S v1.0® processors, ARM Cortex-A8 Samsung S5PC100® processors, ARM Cortex-A8 Apple A4® processors, Marvell PXA 930® processors, or functionally equivalent processors. Multiple execution threads can be used for parallel processing. In some examples, multiple processors or processors with multiple cores can also be used, whether it is a single computer system, a cluster, or distributed across a network system including multiple computers, mobile phones, and / or personal digital assistants.

[0158] As shown in Figure 5, the high-speed cache 504 may be connected to or incorporated into the processor 502 to provide high-speed memory for instructions or data recently or frequently used by the processor 502. The processor 502 is connected to the northbridge 506 by the processor bus 508. The northbridge 506 is connected to the random access memory (RAM) 510 by the memory bus 512, which manages the processor 502's access to the RAM 510. The northbridge 506 is also connected to the southbridge 514 by the chipset bus 516. Similarly, the southbridge 514 is connected to the peripheral bus 518. The peripheral bus may be, for example, PCI, PCI-X, PCI Express, or other peripheral buses. The northbridge and southbridge are often referred to as the processor chipset and manage data transfer between the processor, RAM, and peripheral components of the peripheral bus 518. In some alternative architectures, instead of using a separate northbridge chip, the functions of the northbridge can be incorporated into the processor. In some examples, system 500 may include an accelerator card 522 attached to the peripheral bus 518. Accelerators can include field-programmable gate arrays (FPGAs) or other hardware to accelerate specific processes. For example, accelerators can be used for adaptive data reconstruction or to evaluate algebraic expressions used in extended set processing.

[0159] Software and data are stored in external storage device 524 and can be loaded into RAM 510 and / or cache 504 for use by the processor. System 500 includes an operating system for managing system resources. Non-limiting examples of operating systems include Linux®, Windows®, MACOS®, Blackberry OS®, iOS®, and other functionally equivalent operating systems, as well as application software that runs on top of the operating system for managing data storage and optimization as illustrated in the exemplary examples of this disclosure. In this example, system 500 also includes network interface cards (NICs) 520 and 521 connected to a peripheral bus to provide a network interface to external storage such as network-attached storage (NAS) and other computer systems that can be used for distributed parallel processing.

[0160] Figure 6 shows a network 600 having multiple computer systems 602a, 602b, multiple mobile phones and personal digital assistants 602c, and network-attached storage (NAS) 604a and 604b. In an exemplary example, systems 602a, 602b, and 602c can manage data storage and optimize data access to data stored in network-attached storage (NAS) 604a and 604b. Mathematical models can be used with data and evaluated using distributed parallel processing across computer systems 602a, 602b, and mobile phone and personal digital assistant systems 602c. Computer systems 602a and 602b, as well as mobile phone and personal digital assistant systems 602c, can also provide parallel processing for adaptive data reconstruction of data stored in network-attached storage (NAS) 604a and 604b. Figure 6 is just one example, and a wide variety of other computer architectures and systems can be used in conjunction with the various examples of this disclosure. For example, blade servers can be used to provide parallel processing. Processor blades can be connected via a backplane to enable parallel processing. Storage can also be connected to the backplane via a separate network interface or as network-attached storage (NAS). In some exemplary cases, processors can maintain a separate memory space and send data via a network interface, backplane, or other connector for parallel processing by other processors. In other examples, some or all of the processors can use a shared virtual address memory space.

[0161] Figure 7 is a block diagram of a multiprocessor computer system 700 using a shared virtual address memory space, in an exemplary example. The system includes multiple processors 702a-f that can access a shared memory subsystem 704. The system incorporates multiple programmable hardware memory algorithm processors (MAPs) 706a-f into the memory subsystem 704. Each MAP 706a-f may include memory 708a-f and one or more field-programmable gate arrays (FPGAs) 710a-f. The MAPs provide configurable functional units, and specific algorithms or parts of algorithms can be provided in the FPGAs 710a-f for processing in close cooperation with their respective processors. For example, MAPs can be used to evaluate algebraic expressions relating to a data model and perform adaptive data reconstruction in the exemplary example. In this example, each MAP is globally available to all processors for these purposes. In one configuration, each MAP can access its associated memory 708a-f using direct memory access (DMA), enabling it to perform tasks independently and asynchronously from its respective microprocessors 702a-f. In this configuration, one MAP can directly feed its results to another MAP for pipelined and parallel execution of algorithms.

[0162] The computer architectures and systems described above are merely examples, and a wide variety of other computer, mobile phone, and personal digital assistant architectures and systems, including those using general-purpose processors, coprocessors, FPGAs and other programmable logic devices, systems on a chip (SOC), application-specific integrated circuits (ASICs), and any combination of other processing and logic elements, can be used in connection with the exemplary examples. In some examples, all or part of a computer system can be implemented in software or hardware. Any variety of data storage media, including random-access memory, hard drives, flash memory, tape drives, disk arrays, network-attached storage (NAS), and other local or distributed data storage devices and systems, can be used in connection with the exemplary examples.

[0163] In exemplary examples, a computer system can be implemented using software modules that run on any of the above or other computer architectures and systems. In other examples, the functionality of the system may be partially or completely implemented with firmware, programmable logic devices such as field-programmable gate arrays (FPGAs) referenced in Figure 5, systems-on-chip (SOCs), application-specific integrated circuits (ASICs), or other processing and logic elements. For example, a set processor and optimizer can be implemented with hardware acceleration using a hardware accelerator card such as the accelerator card 522 shown in Figure 5.

[0164] The following examples are provided to illustrate to those skilled in the art the principles and practices of the embodiments disclosed herein and should not be construed as limiting the scope of any claimed embodiment. Unless otherwise specified, all parts and proportions are by weight. [Examples]

[0165] The following embodiments are provided for illustrative purposes to illustrate various embodiments of the Disclosure and are not intended to limit the Disclosure in any way. These embodiments, together with the methods described herein, represent and are illustrative of currently preferred embodiments and are not intended to limit the scope of the Disclosure. Modifications and other uses that fall within the scope of the spirit of the Disclosure as defined by the claims will be recalled by those skilled in the art.

[0166] Example 1: Functionalization of the surface of the device

[0167] The apparatus was functionalized to assist in the attachment and synthesis of polynucleotide libraries. First, the surface of the apparatus was wet-washed for 20 minutes with a piranha solution containing 90% H2SO4 and 10% H2O2. The apparatus was rinsed in several beakers with DI water, held under a gooseneck tap of DI water for 5 minutes, and dried with N2. Then, the apparatus was immersed in NH4OH (1:100; 3 mL:300 mL) for 5 minutes, rinsed with DI water using a hand gun, immersed in three consecutive beakers containing DI water for 1 minute each, and then rinsed again with DI water using a hand gun. The apparatus was then plasma-cleaned by exposing the surface of the apparatus to O2. Using a SAMCO PC-300 instrument, O2 was plasma-etched for 1 minute in downstream mode at 250 watts.

[0168] The cleaned surface of the apparatus was actively functionalized with a solution containing N-(3-triethoxysilylpropyl)-4-hydroxybutylamide using a YES-1224P vapor deposition oven system with the following parameters: 0.5–1 Tor, 60 minutes, 70°C, and 135°C vaporizer. The surface of the apparatus was resist-coated using a Brewer Science 200X spin coater. SPR(trademark) 3612 photoresist was spin-coated onto the apparatus at 2500 rpm for 40 seconds. The apparatus was pre-baked on a Brewer hot plate at 90°C for 30 minutes. The apparatus was subjected to photolithography using a Karl Suss MA6 mask aligner instrument. The apparatus was exposed for 2.2 seconds and developed with MSF 26A for 1 minute. The remaining developer was rinsed off with a hand gun, and the apparatus was immersed in water for 5 minutes. After baking the apparatus in an oven at 100°C for 30 minutes, lithography defects were visually inspected using a Nikon L200. Using the DESCAM process, residual resist was removed using a SAMCO PC-300 instrument, followed by O2 plasma etching at 250 watts for 1 minute.

[0169] The surface of the apparatus was passively functionalized with a 100 μL solution of perfluorooctyltrichlorosilane mixed with 10 μL of light mineral oil. The apparatus was placed in a chamber and pumped for 10 minutes, then the valve was closed to the pump and left for 10 minutes. The chamber was vented to air. The resist was stripped from the apparatus by immersing it twice in 500 mL of NMP at 70°C for 5 minutes while sonicating at maximum power (9 in the Crest system). The apparatus was then immersed in 500 mL of isopropanol at room temperature for 5 minutes and sonicated at maximum power. The apparatus was immersed in 300 mL of 200 proof ethanol and dried by blow-drying with N2. The functionalized surface was activated to function as a support for polynucleotide synthesis.

[0170] Example 2: Synthesis of a 50-mer sequence using an oligonucleotide synthesizer

[0171] A two-dimensional oligonucleotide synthesizer was incorporated into a flow cell and connected to a flow cell (Applied Biosystems (ABI394 DNA Synthesizer)). The two-dimensional oligonucleotide synthesizer was homogenized with N-(3-TRIETHOXYSILYLPROPYL)-4-HYDROXYBUTYRAMIDE (Gelest), and a 50 bp exemplary polynucleotide ("50mer polynucleotide") was synthesized using the polynucleotide synthesis method described herein.

[0172] The 50mer sequence was as described in SEQ ID NO: 1348: 5'AGACAATCAACCATTTGGGGTGGACAGCCTTGACCTCTAGACTTCGGCAT##TTTTTTTTTT3' (SEQ ID NO: 1348), where # represents thymidine-succinyl hexamide CED phosphoramidite (CLP-2244 from ChemGenes), which is a cleavable linker that allows for the release of oligos from the surface during deprotection.

[0173] Synthesis was performed using standard DNA synthesis chemistry (coupling, capping, oxidation, and deblocking) and an ABI synthesizer, following the protocols in Table 3.

[0174] [Table 3-1]

[0175] [Table 3-2]

[0176] [Table 3-3]

[0177] The phosphoramidite / activator combination was delivered in the same manner as the bulk reagents were delivered through the flow cell. Since the environment was "moist" by the reagents throughout the entire process, no drying step was performed.

[0178] To enable faster flow, the flow limiter was removed from the ABI 394 synthesizer. Without a flow limiter, the flow rates for amidite (0.1 M in ACN), activator (0.25 M benzoylthiotetrazole ("BTT"; Glen Research 30-3070-xx) in ACN), and Ox (0.02 M I2 in 20% pyridine, 10% water, and 70% THF) were roughly 100 uL / second for acetonitrile ("ACN") and capping reagent (a 1:1 mixture of CapA and CapB, where CapA is acetic anhydride in THF / pyridine and CapB is 16% 1-methylimidiso in THF), roughly 200 uL / second for deblocking (3% dichloroacetic acid in toluene), and roughly 300 uL / second (compared to roughly 50 uL / second for all reagents with a flow limiter). The time required to completely push out the oxidizer was observed, and the timing of the chemical flow was adjusted accordingly, with additional ACN washing introduced between different chemicals. After polynucleotide synthesis, the tip was deprotected in gaseous ammonia at 75 psi overnight. Five drops of water were applied to the surface to recover the polynucleotides. The recovered polynucleotides were then analyzed using a BioAnalyzer mini RNA tip.

[0179] Example 3: Synthesis of a 100-mer sequence using an oligonucleotide synthesizer.

[0180] The same process described in Example 2 for the synthesis of a 50-mer sequence was used to synthesize a 100-mer polynucleotide ("100-mer polynucleotide"; 5'CGGGATCCTTATCGTCATCGTCGTACAGATCCCGACCCATTTGCTGTCCACCAGTCATGCTAGCCATACCATGATGATGATGATGATGAGAACCCCGCAT##TTTTTTTTTT3', where # is thymidine succinyl Hexamide CED phosphoramidite (CLP-2244, manufactured by ChemGenes; SEQ ID NO: 1349) was used for the synthesis of the first type, which was homogeneously functionalized with N-(3-TRIETHOXYSILYLPROPYL)-4-HYDROXYBUTYRAMIDE, and the second type, which was functionalized with a 5 / 95 mixture of 11-acetoxyundecyltriethoxysilane and n-decyltriethoxysilane. Polynucleotides extracted from the surface were analyzed using a BioAnalyzer instrument.

[0181] All 10 samples from the two chips were further PCR-amplified using the following thermal cycling program in 50 μL of PCR mix (25 μL of NEB Q5 master mix, 2.5 μL of 10 μM forward primer, 2.5 μL of 10 μM reverse primer, 1 μL of polynucleotide extracted from the surface, and up to 50 μL of water) with forward primer (5'ATGCGGGGTTCTCATCATC3'; SEQ ID NO: 1350) and reverse primer (5'CGGGATCCTTATCGTCATCG3'; SEQ ID NO: 1351): 98℃, 30 seconds 98°C, 10 seconds; 63°C, 10 seconds; 72°C, 10 seconds; repeat for 12 cycles. 72℃, 2 minutes

[0182] When the PCR product was also run on a BioAnalyzer, a sharp peak was shown at the position of 100mer. Next, the PCR-amplified sample was cloned and subjected to Sanger sequencing. Table 4 summarizes the results of Sanger sequencing of samples collected from spots 1-5 obtained from chip 1 and samples collected from spots 6-10 obtained from chip 2.

[0183]

Table 4

[0184] Therefore, the high quality and homogeneity of the synthesized polynucleotides were repeated on two chips with different surface chemistries. Overall, 89% of the sequenced 100mers were complete error-free sequences, corresponding to 233 out of 262.

[0185] Table 5 summarizes the error characteristics of the sequences obtained from the polynucleotide samples from spots 1-10.

[0186]

Table 5

[0187] Example 4: Functional GLP-1R antibodies identified from a library focused on synthetic GPCRs demonstrate potent blood glucose control

[0188] This example describes the identification of antagonist and agonist GLP-1R antibodies with functional activity in vitro and in vivo.

[0189] Materials and methods

[0190] Generation of stable cell lines and phage libraries

[0191] A full-length human GLP-1R gene (UniProt-P43220) with an N-terminal FLAG tag and a C-terminal GFP tag, cloned into a pCDNA3.1(+) vector (ThermoFisher), was transfected into Chinese hamster ovary (CHO) cells in suspension to generate a stable cell line expressing GLP-1R. Target expression was confirmed by FACS. Subsequently, cells expressing more than 80% GLP-1R via GFP were directly used for cell-based selection.

[0192] Combinations of germline heavy chain IGHV1-69, IGHV3-30 and germline light chain IGKV1-39, IGKV3-15, IGLV1-51, IGLV2-14 frameworks were used in a GPCR-focused phage display library, and the diversity of all six CDRs was encoded by a pool of oligos synthesized as in Examples 1-3 above. The CDRs were also screened to ensure they did not contain manufacturability responsibilities, potential splice sites, or commonly used nucleotide restriction sites. The heavy chain variable regions (VH) and light chain variable regions (VL) were ligated by a (G4S)3 linker. The resulting scFv(VH-linker-VL) gene library was cloned into the pADL 22-2c (Antibody Design Labs) phage display vector by NotI restriction digestion and electroporated into TG1 electrocompetent E. coli cells (Lucigen). The final library was 1.1 × 10⁶ 10 This exhibits a wide range of sizes, which has been verified by NGS.

[0193] Panning and screening strategies used to isolate scFv clones of the agonist GLP-1R

[0194] Before panning with GLP-1R-expressing CHO cells, phage particles were blocked with 5% BSA / PBS to deplete the nonspecific binding agents of the CHO parent cells. To deplete the CHO parent cells, the introduced phage aliquots were 1 × 10⁶ 8The CHO parent cells were rotated at 14 rpm / min for 1 hour at room temperature (RT). Then, the cells were pelleted by centrifugation at 1,200 rpm for 10 minutes in a benchtop Eppendorf 5920RS / 4×1000 rotor to deplete the nonspecific CHO cell binding agent. The supernatant of the phages from which the CHO cell binding agent had been depleted was then processed into 1×10⁶ phosphate groups. 8 The phage was transferred to GLP-1R-expressing CHO cells. The phage supernatant and GLP-1R-expressing CHO cells were selected for GLP-1R binding by rotating them at 14 rpm / min for 1 hour at room temperature. After incubation, the cells were washed several times with 1×PBS / 0.5% Tween to remove unbound clones. To elute the phages bound to GLP-1R cells, the cells were incubated with trypsin in PBS buffer at 37°C for 30 minutes. The cells were pelleted by centrifugation at 1,200 rpm for 10 minutes. The efflux supernatant enriched with GLP-1R-bound clones was amplified in TG1 E. coli cells and used as input phages for the next selection. This selection strategy was repeated five times. Each time was depleted against the CHO parent background. The amplified efflux phage obtained from one selection was used as the input phage for the next selection, and the stringency of washing was increased in each subsequent round of selection, with more washings performed. After five selections, 500 clones from each of the four and five selections were Sanger-sequenced to identify unique clones.

[0195] Next-generation sequencing analysis

[0196] Phagemid DNA was miniprepped from the stock of output bacteria from all panning rounds. Forward primer ACAGAATTCATTAAAGAGGAGAAATTAACC (SEQ ID NO:1521) and reverse primer TGAACCGCCTCCACCGCTAG (SEQ ID NO:1522)Variable heavy chains (VH) were amplified from phagemid DNA using PCR. The PCR products were used directly for library preparation using the KAPA HyperPlus Library Preparation Kit (Kapa Biosystems, product number KK8514). To add diversity to the library, 15% PhiX Control (product number FC-110-3001), purchased from Illumina, Inc., was added to the samples. The library was then loaded into an Illumina 600-cycle MiSeq Reagent Kit v3 (Illumina, product number MS-102-3003) and run on a MiSeq instrument.

[0197] Reformatting and high-throughput (HT) IgG purification

[0198] Expi293 cells were transfected with heavy-chain and light-chain DNA in a 2:1 ratio using Expifectamine (ThermoFisher, A14524). After collecting the supernatant 4 days after transfection, cell viability decreased to less than 80%. Purification was performed using either King Fisher (ThermoFisher) or Phynexus Protein A column tips (Hamilton) containing Protein A magnetic beads. For large-scale production of IgG clones evaluated in in vivo mouse studies, the Akta HPLC purification system (GE) was used.

[0199] IgG characterization and quality control. Purified IgG from positive GLP-1R binders (hits) was characterized for purity using the LabChip GXII Touch HT Protein Express high-sensitivity assay. IgG was reduced to VH and VL using dithiothreitol (DTT). IgG concentration was measured using Lunatic (UnChain). IgG for in vivo mouse testing was further characterized by HPLC and tested for endotoxin levels at doses of less than 5 EU / kg (Endosafe® nexgen-PTS® endotoxin test, Charles River).

[0200] Binding assays and flow cytometry

[0201] GLP-1R IgG clones were tested in a binding assay combined with flow cytometry analysis as follows: FLAG-GLP-1R-GFP expressing CHO cells (CHO-GLP-1R) and CHO parent cells were incubated with 100 nM IgG on ice for 1 hour, washed three times, incubated with Alexa 647 conjugate goat anti-human antibody (1:200) (Jackson ImmunoResearch Laboratories, 109-605-044) on ice for 30 minutes, washed three times, and cells were pelleted and tested between each washing step by centrifugation. All incubation and washing were performed in a buffer containing PBS + 1% BSA. For titration, IgG was serially diluted 1:3 from 100 nM to 0.046 nM. Cells were analyzed by flow cytometry to identify hits (hits are IgG that specifically binds to CHO-GLP-1R) by measuring the GFP signal against the Alexa 647 signal. The flow cytometry data from the binding assay using 100 nM IgG is shown as a dot plot. The analysis of the binding assay by IgG titration is shown as a binding curve plotted against MFI (mean fluorescence intensity) with IgG concentration.

[0202] Ligand competition assay

[0203] Ligand competition assays involved incubating primary IgG with 1 μM GLP-1 (7-36). For each data point, IgG (600 nM) was prepared in Flow buffer (PBS + 1% BSA) and diluted 1:3 at 8 titration points. Peptide GLP-1 7-36 (2 μM) was similarly prepared in Flow buffer (PBS + 1% BSA). Each well contained 100,000 cells and was treated with 50 μL of IgG and 50 μL of peptide (= plus) or peptide-free buffer only (= minus). Cells and IgG / peptide mixtures were incubated on ice for 1 hour, washed, and then a secondary antibody (goat anti-human APC, Jackson ImmunoResearch Laboratories, product no. 109-605-044) diluted 1:200 in PBS + 1% BSA was added. This was incubated on ice for 30 minutes (50 μL / well), then washed and resuspended in 60 μL of buffer. Finally, assay readings were measured at a rate of 4 seconds per well using an Intellicyt® IQue3 Screener.

[0204] Cell-based functional assays

[0205] cAMP assay. GLP-1R IgG clones were tested for their potential effects on GLP-1R signaling by performing a cAMP assay obtained from Eurofins DiscoverX. The technique involved in detecting cAMP levels is not a signal-gain competitive immunoassay based on enzyme fragment complementation techniques. Experiments were designed to test either the agonist or antagonist activity of the IgG clones. To test the agonist activity of IgG, cells were stimulated with IgG incubated at 37°C for 30 minutes (titration 1:3, starting at 100 nM and diluted down to 0.046 nM with PBS), or stimulated with the known agonist GLP-1 7-36 peptide (MedChemExpress, catalog number: HY-P005), starting at 12.5 nM and diluted down to 0.003 nM with PBS and titrated at 1:6. To test antagonist activity, cells were incubated with a fixed concentration of 100 nM IgG at room temperature for 1 hour to bind, followed by stimulation with GLP1 7-36 peptide (1:6 titration starting at 12.5 nM in PBS and decreasing to 0.003 nM) at 37°C for 30 minutes. Intracellular cAMP levels were detected according to the assay kit instructions.

[0206] Assay for β-arrestin recruitment. The assay for β-arrestin recruitment was obtained from Eurofins DiscoverX (catalog no. 93-0300E2) using untagged GLP-1R overexpressing CHO-K1 cells. This experiment was intended to test whether GLP1R-3 has an effect on GLP-1R activation on GLP-1 7-36 agonist-induced β-arrestin recruitment. Proliferated cells were seeded at 5,000 cells / well in 96-well plates, and the experiment was performed 48 hours after seeding. 100 nM IgG was pre-incubated with seeded cells in a volume of 50 μl at RT for 1 hour, followed by the addition of 5 μl of ligand GLP-1 7-36 and further incubation at 37°C for 30 minutes. 22.5 μL of detection solution was added to each well, gently tapped, and briefly spun down. The plates were then incubated at room temperature in the dark for 1 hour. Next, the plates were read using a chemiluminescent plate reader, Molecular Devices SpectraMax M5, and the output relative light unit (RLU) data was analyzed using GraphPad Prism.

[0207] In vivo testing

[0208] Animals. All animal procedures were approved by the Institutional Animal Care and Use Committee (IACUC) of the University of California, San Francisco, and carried out in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals. Male littermates of C57BL / 6NHsd (Envigo RMS, LLC), 8-10 weeks old and weighing approximately 20-28 grams, were used in all described studies. Mice were housed in temperature (22-25°C) and light-controlled rooms (12-hour light / dark cycles starting at 7:00 AM). Mice were fed a solid diet containing 9% fat (PicoLab mouse Diet 20 (#5058), Lab Supply, Fortworth, Texas, USA) for the duration of their stay at the UCSF animal care facility.

[0209] Monoclonal antibodies and reagents. Anti-GLP-1 monoclonal antibodies (mAbs) in PBS buffer were tested in these studies: an agonist mAb, GLP1R-59-2, and one antagonist mAb, GLP1R-3. Mice were administered before a glucose tolerance test (GTT) or insulin tolerance test (ITT) using the following regimens: Specifically, the agonist GLP1R-59-2 mAb was administered at 5 or 10 mg / kg in three different dosing regimen groups before the GTT and in four different dosing regimen groups during the insulin tolerance test (ITT). 1. The mAb was administered as a single dose 15 hours before the GTT and 21 hours before the ITT. 2. The mAb was administered as a dual dose 15 hours before the GTT and 21 hours before the ITT, with a second dose of the mAb added 2 hours before the GTT and ITT. 3. A single mAb dose was administered 2 hours before the GTT and ITT. 4. A single mAb dose was administered only 6 hours before the ITT.

[0210] The antagonist GLP1R-3 mAb was administered at 20 mg / kg to four different dosing regimen groups. 1. The mAb was administered as a single dose 15 hours before GTT and 21 hours before ITT. 2. The mAb was administered as a double dose 15 hours before GTT and 21 hours before ITT, and a second mAb dose was added 2 hours before GTT and ITT. 3. The mAb was administered as a single dose 6 hours before GTT and ITT. 4. The mAb single dose was administered 2 hours before GTT and ITT.

[0211] The exendin 9-39 peptide (MedChemExpress, catalog number: HY-P0264) was administered at 1.0 or 0.23 mg / kg to three different dosing regimen groups. 1. Exendin was administered as a single dose 21 hours before ITT. 2. Exendin was administered as a double dose by adding a second exendin dose 2 hours before ITT, 21 hours before ITT. 3. The mAb was administered as a single dose 6 hours before ITT.

[0212] Glucose tolerance test

[0213] The glucose tolerance test (GTT) was used to evaluate the effects of two different anti-GLP1 mAbs (agonist and antagonist) on glucose load after acute glucose administration. The intraperitoneal glucose tolerance test (IP-GTT) was performed in male mice at 8 or 10 weeks of age, glucose processing after glucose injection was evaluated, and blood glucose levels were measured after the mice were fasted overnight (14 - 16 hours). To avoid diurnal variations in blood glucose levels of the mice, this test was performed at a fixed time. After overnight fasting, the body weight of the mice was measured and the baseline blood glucose level (before glucose injection; time 0 min) was measured. The mice were intraperitoneally injected i.p. with a 30% dextrose solution (Hospira, Illinois) as a single bolus (10 ul / gram body weight), and blood glucose levels were measured 15, 30, 60, 120, and 180 minutes after glucose administration. Blood samples were obtained by tail nick and blood glucose levels were monitored using a OneTouch Ultra 2 glucose monitor (LifeScan, Inc).

[0214] Insulin resistance test

[0215] An insulin tolerance test (ITT) was performed to evaluate the effects of two different anti-GLP1 mAbs (agonist and antagonist) on insulin sensitivity after acute insulin administration. Eight or ten-week-old male mice were fasted for six hours, and their body weight was recorded before and after fasting. To avoid circadian fluctuations in the mice's blood glucose levels, the test was performed at a constant time. Blood samples were collected by tail nicks, and baseline glucose was measured before insulin injection. Mice were injected with a single bolus of human insulin (Novolin, Novo Nordisk) at 0.75 U / kg body weight, and blood glucose levels were measured 15, 30, 45, 60, and 120 minutes after insulin injection. Blood glucose levels were monitored using a OneTouch Ultra 2 glucose monitor (LifeScan, Inc.).

[0216] ELISA for pharmacokinetic (PK) studies.

[0217] Rat PK studies were conducted at Charles River Laboratories, One Innovation Dr, 3 Biotech, Worcester, MA 01605. Five male Sprague-Dawley rats were received at the laboratory for a minimum of three days prior to administration and then adapted. GLP1R-3 and GLP1R59-2 were administered intravenously at a dose of 10 mg / kg in a vehicle containing 100 mM Hepes, 100 mM NaCl, 50 mM NaAc, and pH 6.0. Continuous blood samples of approximately 250 μl were collected via jugular vein cannula before administration and at 0.0833, 0.25, 0.5, 1, 2, 4, 8, 24, 48, 72, 96, 168, 240, and 336 hours after administration. Blood samples were collected in K2EDTA tubes and stored on moist ice until processed into plasma by centrifugation (10 minutes at 5°C, 3500 rpm) within 30 minutes of collection. The plasma samples were then transferred to appropriate tubes containing DPP-4 (3.3 μL per 100 μL of plasma) and frozen on dry ice. To measure human IgG in rat plasma samples, sheep anti-human IgG (1 mg / mL) was used as the coating reagent (binding site, lot number AU003.M), and goat anti-human IgG, HRP (H&L) (1 mg / mL) was used as the detection reagent (Bethyl, catalog number A80-319P) in the ELISA assay. Stock solutions of human IgG standards and QCs were prepared by adding human IgG to rat plasma. Each test sample, QC, standard, and blank were analyzed using at least two wells. A sigmoid calibration curve was fitted using a 4-parameter logistic (4PL) model. A semi-logarithmic sigmoid calibration curve was obtained by plotting the absorbance response to concentration. The concentration of the analyte in the test sample was determined by computer interpolation from the plotted calibration curve.

[0218] result

[0219] The design of antibody libraries focused on GPCRs is based on GPCR-binding motifs and GPCR antibodies.

[0220] We analyzed all known GPCR interactions, including interactions between GPCRs and ligands, peptides, antibodies, endogenous extracellular loops, and small molecules, to map GPCR-binding molecular determinants. Using the crystal structures of approximately 150 peptides, ligands, or antibodies bound to the ECD of approximately 50 GPCRs (http: / / www.gpcrdb.org), we identified GPCR-binding motifs. Over 1000 GPCR-binding motifs were extracted from this analysis. Furthermore, analysis of all elucidated GPCR structures (zhanglab.ccmb.med.umich.edu / GPCR-EXP / ) identified over 2000 binding motifs from the endogenous extracellular loops of GPCRs. Finally, analysis of the structures of over 100 small molecule ligands bound to GPCRs identified a reduced amino acid library of five amino acids (Tyr, Phe, His, Pro, and Gly) that may be able to reproduce many of the structural contacts of these ligands. This sublibrary with diversity of reduced amino acids was placed inside the CxxxxxC motif. A total of over 5000 GPCR binding motifs were identified (Figures 9A-9E). These binding motifs are located in five different stem regions, namely CARDLRELECEEWTxxxxxSRGPCVDPRGVAGSFDVW. (SEQ ID NO:1523) ,CARDMYYDFxxxxxEVVPADDAFDIW (SEQ ID NO:1524) ,CARDGRGSLPRPKGGPxxxxxYDSSEDSGGAFDIW (SEQ ID NO:1525) CARANQHFxxxxxGYHYYGMDVW (SEQ ID NO:1526) CAKHMSMQxxxxxRADLVGDAFDVW (SEQ ID NO:1527) It was placed in one of the locations.

[0221] These stem regions were selected from structural antibodies containing transcendentally long HCDR3s. Antibody germlines were specifically selected to be resistant to these transcendentally long HCDR3s. Structural and sequence analysis of human antibodies with longer than 21 amino acids revealed a bias in the V gene in antibodies with long HCDR3s. Finally, germline IGHV (IGHV1-69 and IGHV3-30), IGKV (IGKV1-39 and IGKV3-15), and IGLV (IGLV1-51 and IGLV2-14) genes were selected based on this analysis.

[0222] In addition to the diversity of HCDR3, limited diversity was also introduced into the other five CDRs. There were 416 HCDR1 and 258 HCDR2 variants in the IGHV1-69 domain; 535 HCDR1 and 416 HCDR2 variants in the IGHV3-30 domain; 490 LCDR1, 420 LCDR2, and 824 LCDR3 variants in the IGKV1-39 domain; 490 LCDR1, 265 LCDR2, and 907 LCDR3 variants in the IGKV3-15 domain; 184 LCDR1, 151 LCDR2, and 824 LCDR3 variants in the IGLV1-51 domain; and 967 LCDR1, 535 LCDR2, and 922 LCDR3 variants in the IGLV2-14 domain (Figure 10). These CDR variants were selected by comparing germline CDRs with the germline space of single, double, and triple mutations observed in CDRs from at least two of the V gene repertoires of 12 human donors. All CDRs were pre-screened to remove manufacturability responsibilities, potential splice sites, or nucleotide restriction sites. The CDRs were synthesized as a pool of oligos and incorporated into scaffolds of selected antibodies. The heavy chain (VH) and light chain (VL) genes were ligated with a (G4S)3 linker. The resulting scFv(VH-linker-VL) gene pool was cloned into a phagemide display vector at the N-terminus of the M13 gene-3 minor coat protein. The final size of the GPCR library was 1 × 10⁶ in scFv format. 10Next-generation sequencing (NGS) was performed on the final phage library to analyze the distribution of HCDR3 lengths in the library for comparison with the distribution of HCDR3 lengths in B cell populations derived from three healthy adult donors. The HCDR3 sequences from the three healthy donors used were obtained from publicly available databases of over 37,000,000 B cell receptor sequences. 31 The length of HCDR3 in GPCR libraries is much longer than the length of HCDR3 observed in B cell repertoire sequences. On average, the median length of HCDR3 in GPCR libraries (showing a biphasic distribution pattern) is two or three times longer (33 to 44 amino acids) than the median length observed in native B cell repertoire sequences (15 to 17 amino acids) (Figure 11). The biphasic length distribution of HCDR3 in GPCR libraries is mainly caused by two groups of stems used to present motifs within HCDR3: (8aa, 9aaxxxxx10aa, 12aa) and (14aa, 16aaxxxxx18aa, 14aa).

[0223] Phage panning of GLP-1R overexpressing cell lines resulted in clonal enrichment.

[0224] To detect cell surface expression, a FLAG tag was displayed at the N-terminus of the receptor, and to track total receptor expression, an EGFP tag was displayed at the C-terminus, creating a stable CHO cell line overexpressing GLP-1R. Flow cytometry analysis of these cells confirmed that the majority (>80%) of the receptor was expressed on the cell surface (Figure 12A). These GLP-1R-expressing CHO cells were used for five phage pannings against a GPCR-focused library. An overview of the selection scheme is shown in Figure 12B. Variable heavy chains (VH) from the output of each panning were PCR amplified and sequenced by MiSeq. A significant clonal enrichment was observed from the first to the fifth panning as the proportion of unique HCDR3 decreased in the pooled NGS sequencing output from each panning (Figure 13), indicating target-specific clonal selection in the panning process. A total of approximately 1000 clones (from the 4th and 5th trials) were sorted for single-clone NGS sequencing, and approximately 100 unique VH-VL pairs were selected, reformatted, and expressed as full-length human IgG2 on a 1 ml scale.

[0225] The IgG conjugate for GLP-1R contains either GLP-1, GLP-2, or an identified, unique HCDR3 motif.

[0226] Purified IgG clones were tested for specific binding to GLP-1R-expressing CHO cells. Single-point flow cytometry analysis using a 100 nM IgG concentration revealed that 13 of the 100 IgG-specific clones tested specifically bound to GLP-1R-positive cells (GFP+) rather than parental CHO cells (GFP-). The binding of these 13 hits was then further evaluated by 8-point titrations of each IgG clone starting at 200 nM (30 μg / mL), and the cell binding affinity was determined to be in the double-digit nM range. The average background binding to parental CHO cells by all 13 IgG clones is shown as a black line and is negligible compared to the specific binding to GLP-1R-expressing cells (Figure 14). No complete saturation was observed, and the plateau in the binding curve at the highest concentration of 200 nM was used in the experiment. Figure 15 shows the amino acid sequences of HCDR3 for these 13 IgG clones. Of these, six were found to contain the GLP-1 motif, four contained the GLP-2 motif, and three had an unknown motif.

[0227] Eight of the thirteen binders, IgG, are negative antagonists in GLP-1R-mediated cAMP signaling.

[0228] Next, thirteen IgG conjugates were evaluated for their functional activity in the cAMP signaling pathway by using GLP-1R overexpressing CHO-K1 cells purchased from DiscoverX, which were designed and validated to assess GLP-1R-induced cAMP signaling. In the first example, IgG clones were tested for agonist activity compared to the peptide agonist GLP-17-36 in dose escalation. Stimulation with GLP-17-36 resulted in cAMP signaling, which was not observed for the IgG clones, indicating that they were not activated. Subsequently, a panel of IgG clones was tested for antagonist activity by pre-incubating GLP-1R-expressing cells with fixed concentrations of IgG to induce binding, and then stimulating the cells with GLP-17-36 in a dose-dependent manner. This allowed us to investigate the effect of IgG presence on GLP-17-36-induced GLP-1R cAMP signaling, thereby potentially revealing any potential competitive effects of any of the IgGs. The dose-response curve for GLP-1 7-36 was observed to shift to the right in the presence of 8 of the 13 IgG clones, suggesting that they act as negative antagonists to the GLP-1 7-36 response (data not shown). Similar observations were made regarding the effect of the 13 IgG clones on the exendin-4-induced GLP-1R cAMP signaling response (data not shown). The remaining 5 IgG clones did not appear to have a significant effect on GLP-1R cAMP signaling (data not shown).

[0229] Characterization of the mechanism of action of the antagonist IgG GLP1R-3

[0230] To determine the mechanism of action of these functional hits, subsequent studies focused on GLP1R-3, one of the GLP-1 motif-containing IgG clones that exhibited high binding affinity and functionality. Ligand competitive binding assays, the effect of IgG on the GLP-1 dose response in cAMP signaling, and β-arrestin recruitment assays were performed, leading to the following characterization of GLP1R-3:

[0231] Competition with endogenous ligands in GLP-1R binding assays. To determine whether GLP1R-3 binds to the orthosteric site of the receptor, N-terminal FLAG-tagged and C-terminal GFP-tagged GLP-1R-overexpressing CHO cells were incubated with a dose escalation of GLP1R-3 at 100 nM, either in or out of a constant concentration of the peptide agonist GLP-1 7-36 (1 μM). Flow cytometry analysis revealed a significant decrease in GLP1R-3 binding to GLP-1R(GFP+) in the presence of GLP-1 7-36. While the presence of the GLP-1 7-36 peptide did not completely eliminate GLP1R-3 binding, this observation suggests that the antibody may be able to bind to a duplicate epitope, or that GLP1R-3 has a stronger binding affinity to GLP-1 7-36 and competes for binding (Figure 16A).

[0232] GLP1R-3 antagonizes GLP-1-activated cAMP signaling. The next step was to determine whether GLP1R-3 exhibits dose-dependent competitive antagonism against GLP-1R. GLP-1 7-36-induced cAMP signaling was investigated by 3-fold titration with dose escalation of GLP-1 7-36 starting at 20 nM in the presence of a constant concentration (100 nM) of GLP1R-3. Clear dose-dependent inhibition of the cAMP signal was observed. The EC50 of the GLP-1 7-36 peptide was 0.025 nM in the absence of GLP1R-3 and 0.11 nM in the presence of 100 nM GLP1R-3 (Figure 16B), supporting the competitive antagonist status of GLP1R-3.

[0233] GLP1R-3 reduces the recruitment of β-arrestin upon GLP-1R activation. When a GPCR is activated by an agonist, β-arrestin is recruited from the cytosol to the GPCR, thereby excluding the receptor from further G protein interactions, resulting in signal termination, hence the name "arrestin." To determine whether GLP1R-3 has any effect on β-arrestin recruitment by activated GLP-1R, GLP-1R overexpressing CHO-K1 cells (DiscoverX), specifically designed and validated for evaluating GLP-1R β-arrestin recruitment, were used in the following manner: Cells were pre-incubated with a fixed concentration of GLP1R-3 (100 nM) at room temperature for 1 hour to induce binding, and then stimulated with GLP-1 7-36. GLP1R-3 inhibited the recruitment of GLP-17-36 peptide-induced β-arrestin to GLP-1R, as evidenced by a rightward shift in the GLP-17-36 dose-response curve for β-arrestin recruitment (Figure 16C). This indicates that GLP1R-3 reduces β-arrestin recruitment to GLP-1R, which is consistent with the observed decrease in receptor activation. Thus, these cell-based assays demonstrate that GLP1R-3 is a competitive antagonist of GLP-1R to GLP-17-36.

[0234] Design and characterization of the GLP-1R agonist IgG GLP1R-59-2

[0235] Since none of the 13 IgG hits showed any agonist activity, a GLP-1R agonist antibody (GLP1R-59-2) was genetically engineered by ligating the natural GLP-17-36 peptide to the N-terminus of the light chain of the functionally inactive but GLP-1R-specific conjugate GLP1R-2 (Figure 17). GLP-1R binding assays, cAMP assays, and β-arrestin recruitment assays were performed to obtain the characterization of GLP1R-59-2 as described herein:

[0236] GLP1R-59-2 specifically binds to GLP-1R-expressing CHO cells. Flow cytometry analysis revealed that GLP1R-59-2 specifically binds to GLP-1R-positive cells (GFP+) and not to parental CHO cells (GFP-). This specific binding was also confirmed by dose escalation of GLP1R-59-2, with an apparent binding EC of 15.5 nM. 50 This resulted in (Figure 18A).

[0237] GLP1R-59-2 induces a similar GLP-1R cAMP response to GLP-1 7-36. Agonist activity of GLP1R-59-2 was tested to compare with GLP-1 7-36 to stimulate GLP-1R-overexpressing CHO-K1 cells (DiscoverX), and separate dose-escalation analyses were performed for both the ligand and antibody. Both the induced similar cAMP signaling profiles and their dose-response curves showed nearly overlapping EC values ​​of 0.042 nM for GLP1R-59-2 and 0.085 nM for GLP-1 7-36. 50 It was found to have the value (Figure 18B), supporting the hypothesis that GLP1R-59-2 can act as an effective agonist of GLP-1R.

[0238] GLP1R-59-2 is less effective than GLP-17-36 in recruiting β-arrestin to GLP-1R. To determine whether GLP1R-59-2 could induce a similar level of β-arrestin recruitment to GLP-1R as GLP-17-36, GLP-1R overexpressing CHO-K1 cells (DiscoverX) were stimulated with dose escalations for each. It was found that β-arrestin recruitment was less with GLP1R-59-2 stimulation than with GLP-17-36 stimulation (Figure 18C). Although GLP1R-59-2 was less effective than GLP-17-36 for maximum β-arrestin recruitment, both induced EC of 0.042 nM. 50 And at 0.085 nM of GLP-1 7-36, the agonist IgG appears to be slightly more potent.

[0239] In vivo PK and PD trials of GLP1R-3 and GLP1R-59-2

[0240] While endogenous GLP-1 peptides have a very short serum half-life of only a few minutes, GLP-1R antibodies can have a significantly longer half-life. This could be considerably more advantageous than current GLP-1 peptide analog therapies. In vivo PK rat studies were conducted to evaluate the half-lives of the IgG-form antagonist GLP1R-3 and agonist GLP1R-59-2. In a two-week PK study, GLP1R-3 showed an antibody-like in vivo half-life of approximately one week in rats, while the agonist GLP-1 peptide-antibody fusion GLP1R-59-2 showed a half-life of >2 days in rats (Figures 19A-19B). Liraglutide, an approved GLP-1R agonist for the treatment of type II diabetes, has a half-life of 13 hours.

[0241] The agonist GLP1R-59-2 was tested for its in vivo pharmacodynamic (PD) effects in glucose tolerance tests (GTT) using a wild-type C57BL / 6NHsd mouse model compared to a vehicle control. Treatment with the agonist mAb GLP1R-59-2 at any dose (5 mg / kg and 10 mg / kg) or in any of the following regimens (2 hours, 13+2 hours, and 15 hours before glucose loading) significantly stabilized blood glucose even after glucose loading (Figure 20A). Compared to control mice, GLP1R-59-2 treatment was significant in all cases (p<0.001) in reducing the area under the curve (AUC) in GTT (Figure 20B). However, there were no significant differences between each individual treatment timing or dose.

[0242] Treatment with the antagonist GLP1R-3 mAb and GLP-1 peptide exendin 9-39 significantly stabilized higher blood glucose levels in wild-type C57BL / 6NHsd mice in a 19+2 hour pre-insulin loading regimen (Figure 21A). Compared to control mice, both GLP1R-3 mAb (20 mg / kg) and exendin (1 mg / kg) treatments were significant (p<0.0001) in area under the stabilization curve (AUC) in ITT (Figure 21B). However, there was no significant difference between GLP1R-3 and control versus exendin (0.23 mg / kg) for the 19+2 hour treatment.

[0243] Another experiment using a single 6-hour drug regimen, antagonist, GLP1R-3mAb treatment, also significantly stabilized higher blood glucose after insulin loading compared to GLP-1 peptide exendin 9-39 (1.0 or 0.23 mg / kg dose) or control (Figure 22A). Compared to control mice, treatment with GLP1R-3mAb (20 mg / kg) at 6 hours significantly stabilized the area under the curve (AUC) in ITT (p<0.05). However, there was no significant difference between control and exendin (1.0 and 0.23 mg / kg) with respect to a single 6-hour treatment (Figure 22B).

[0244] Treatment with GLP1R-3mAb was also compared to the comparative antibodies GLP1R-226-1 and GLP1R-226-2. Treatment with GLP1R-3mAb in a single 6-hour dosing regimen significantly stabilized higher post-insulin loading (time 0) blood glucose compared to GLP1R-226-1 (20 mg / kg) or control (Figures 23A-23B). Compared to control mice, treatment with GLP1R-3mAb (20 mg / kg) over 6 hours significantly stabilized the area under the curve (AUC) in ITT (p<0.05). There was no significant difference between control and GLP1R-226-1 or GLP1R-226-2 with a single 6-hour treatment (p<0.05).

[0245] Example 5: GLP1R variant

[0246] We optimized GLP1R-3 to generate further GLP1R mutants.

[0247] The panning strategies for the GLP1R-221 and GLP1R-222 mutants are shown in Figures 24A-24B. 768 clones obtained from the 4th and 5th trials were selected and sequenced using Miseq. 95 unique clones were reformatted. Data for the GLP1R-221 and GLP1R-222 mutants are shown in Tables 6A-6H. The sequences of the GLP1R-221 and GLP1R-222 mutants are shown in Tables 9-13.

[0248] [Table 6]

[0249] [Table 7]

[0250] [Table 8-1]

[0251] [Table 8-2]

[0252] [Table 8-3]

[0253] [Table 8-4]

[0254] [Table 9-1]

[0255] [Table 9-2]

[0256] [Table 9-3]

[0257] [Table 9-4]

[0258] [Table 10]

[0259] [Table 11]

[0260] [Table 12]

[0261] [Table 13]

[0262] GLP1R-221 and GLP1R-222 variants were assayed using competitive assays. The data are shown in Figures 25A–25B. The variants were also assayed using a cAMP assay. Briefly, cells were pre-incubated with 100 nM anti-GLP1R antibody, followed by agonist stimulation three times starting from 12.5 nM. The data are shown in Figure 26, with improved variants highlighted in green.

[0263] Example 6: Array

[0264] [Table 14]

[0265] Table 15-1

[0266] Table 15-2

[0267] Table 16-1

[0268] Table 16-2

[0269] Table 16-3

[0270] Table 16-4

[0271] Table 16-5

[0272] Table 16-6

[0273] Table 16-7

[0274] Table 16-8

[0275] Table 17-1

[0276] Table 17-2

[0277] Table 17-3

[0278] Table 17-4

[0279] Table 17-5

[0280] Table 18-1

[0281] Table 18-2

[0282] Table 18-3

[0283] Table 18-4

[0284] Table 18-5

[0285] Table 18-6

[0286] Table 18-7

[0287] Table 18-8

[0288] Table 18-9

[0289] Table 18-10

[0290] Table 18-11

[0291] Table 18-12

[0292] Table 18-13

[0293] Table 18-14

[0294] Table 18-15

[0295] Table 18-16

[0296] Table 18-17

[0297] Table 18-18

[0298] Table 18-19

[0299] Table 18-20

[0300] Table 18-21

[0301] Table 18-22

[0302] Table 18-23

[0303] Table 18-24

[0304] Table 18-25

[0305] Table 18-26

[0306] Table 18-27

[0307] Table 18-28

[0308] Table 18-29

[0309] Table 18-30

[0310] Table 18-31

[0311] Table 18-32

[0312] Table 18-33

[0313] Table 19-1

[0314] Table 19-2

[0315] Table 19-3

[0316] Table 19-4

[0317] Table 19-5

[0318] Table 19-6

[0319] Table 19-7

[0320] Table 19-8

[0321] Table 19-9

[0322] Table 19-10

[0323] Table 19-11

[0324] Table 19-12

[0325] Table 19-13

[0326] Table 19-14

[0327] Table 19-15

[0328] Table 19-16

[0329] Table 19-17

[0330] Table 19-18

[0331] Table 20-1

[0332] Table 20-2

[0333] Table 20-3

[0334] Table 20-4

[0335] Table 20-5

[0336] [Table 20-6]

[0337] [Table 20-7]

[0338] [Table 20-8]

[0339] While preferred embodiments of the Disclosure have been shown and described herein, it will be apparent to those skilled in the art that such embodiments are provided only as examples. Numerous variations, modifications, and substitutions will now come to mind to those skilled in the art without departing from the Disclosure. It should be understood that various alternative forms to the embodiments of the Disclosure described herein may be used when carrying out the Disclosure. The following claims define the scope of the Disclosure, and the methods and structures of these claims, as well as their equivalents, are intended to be encompassed thereby.

Claims

1. An antibody or antibody fragment comprising a heavy chain and a light chain that binds to a glucagon-like peptide 1 receptor (GLP1R), wherein the heavy chain comprises a heavy chain variable region (VH) and the light chain comprises a light chain variable region (VL), (a) The VH includes CDR-H1 containing the amino acid sequence of SEQ ID NO: 441, CDR-H2 containing the amino acid sequence of SEQ ID NO: 620, and CDR-H3 containing the amino acid sequence of SEQ ID NO: 799, and the VL includes CDR-L1 containing the amino acid sequence of SEQ ID NO: 978, CDR-L2 containing the amino acid sequence of SEQ ID NO: 1157, and CDR-L3 containing the amino acid sequence of SEQ ID NO: 1336, (b) The VH includes CDR-H1 containing the amino acid sequence of SEQ ID NO: 534, CDR-H2 containing the amino acid sequence of SEQ ID NO: 713, and CDR-H3 containing the amino acid sequence of SEQ ID NO: 892, and the VL includes CDR-L1 containing the amino acid sequence of SEQ ID NO: 1071, CDR-L2 containing the amino acid sequence of SEQ ID NO: 1250, and CDR-L3 containing the amino acid sequence of SEQ ID NO: 1429, (c) The VH includes CDR-H1 containing the amino acid sequence of SEQ ID NO: 445, CDR-H2 containing the amino acid sequence of SEQ ID NO: 624, and CDR-H3 containing the amino acid sequence of SEQ ID NO: 803, and the VL includes CDR-L1 containing the amino acid sequence of SEQ ID NO: 982, CDR-L2 containing the amino acid sequence of SEQ ID NO: 1161, and CDR-L3 containing the amino acid sequence of SEQ ID NO: 1340, (d) The VH includes CDR-H1 containing the amino acid sequence of SEQ ID NO: 444, CDR-H2 containing the amino acid sequence of SEQ ID NO: 623, and CDR-H3 containing the amino acid sequence of SEQ ID NO: 802, and the VL includes CDR-L1 containing the amino acid sequence of SEQ ID NO: 981, CDR-L2 containing the amino acid sequence of SEQ ID NO: 1160, and CDR-L3 containing the amino acid sequence of SEQ ID NO: 1339, (e) The VH includes CDR-H1 containing the amino acid sequence of SEQ ID NO: 451, CDR-H2 containing the amino acid sequence of SEQ ID NO: 630, and CDR-H3 containing the amino acid sequence of SEQ ID NO: 809, and the VL includes CDR-L1 containing the amino acid sequence of SEQ ID NO: 988, CDR-L2 containing the amino acid sequence of SEQ ID NO: 1167, and CDR-L3 containing the amino acid sequence of SEQ ID NO: 1346, (f) The VH includes CDR-H1 containing the amino acid sequence of SEQ ID NO: 442, CDR-H2 containing the amino acid sequence of SEQ ID NO: 621, and CDR-H3 containing the amino acid sequence of SEQ ID NO: 800, and the VL includes CDR-L1 containing the amino acid sequence of SEQ ID NO: 979, CDR-L2 containing the amino acid sequence of SEQ ID NO: 1158, and CDR-L3 containing the amino acid sequence of SEQ ID NO: 1337, or (g) The VH comprises CDR-H1 containing the amino acid sequence of SEQ ID NO: 533, CDR-H2 containing the amino acid sequence of SEQ ID NO: 712, and CDR-H3 containing the amino acid sequence of SEQ ID NO: 891, and the VL comprises CDR-L1 containing the amino acid sequence of SEQ ID NO: 1070, CDR-L2 containing the amino acid sequence of SEQ ID NO: 1249, and CDR-L3 containing the amino acid sequence of SEQ ID NO: 1428. The antibody or a fragment of that antibody.

2. (a) The VH includes CDR-H1 containing the amino acid sequence of SEQ ID NO: 441, CDR-H2 containing the amino acid sequence of SEQ ID NO: 620, and CDR-H3 containing the amino acid sequence of SEQ ID NO: 799, and the VH includes an amino acid sequence that is at least 90% identical to the amino acid sequence of residues 1 to 148 of SEQ ID NO: 54, and the VL includes CDR-L1 containing the amino acid sequence of SEQ ID NO: 978, CDR-L2 containing the amino acid sequence of SEQ ID NO: 1157, and CDR-L3 containing the amino acid sequence of SEQ ID NO: 1336, and the VL includes an amino acid sequence that is at least 90% identical to the amino acid sequence of residues 1 to 110 of SEQ ID NO: 89, or (b) The antibody or antibody fragment according to claim 1, wherein VH comprises CDR-H1 containing the amino acid sequence of SEQ ID NO: 534, CDR-H2 containing the amino acid sequence of SEQ ID NO: 713, and CDR-H3 containing the amino acid sequence of SEQ ID NO: 892, and VH comprises an amino acid sequence that is at least 90% identical to the amino acid sequence of SEQ ID NO: 70, and VL comprises CDR-L1 containing the amino acid sequence of SEQ ID NO: 1071, CDR-L2 containing the amino acid sequence of SEQ ID NO: 1250, and CDR-L3 containing the amino acid sequence of SEQ ID NO: 1429, and VL comprises an amino acid sequence that is at least 90% identical to the amino acid sequence of SEQ ID NO:

104.

3. (a) The VH comprises the amino acid sequence of residues 1 to 148 of SEQ ID NO: 54, and the VL comprises the amino acid sequence of residues 1 to 110 of SEQ ID NO: 89, or (b) The antibody or antibody fragment according to claim 1 or 2, wherein VH comprises the amino acid sequence of SEQ ID NO: 70 and VL comprises the amino acid sequence of SEQ ID NO:

104.

4. The antibody or antibody fragment according to any one of claims 1 to 3, wherein the heavy chain comprises an amino acid sequence that is at least 90% identical to the amino acid sequence of SEQ ID NO: 54, and the light chain comprises an amino acid sequence that is at least 90% identical to the amino acid sequence of SEQ ID NO:

89.

5. The antibody or antibody fragment according to any one of claims 1 to 4, wherein the heavy chain comprises the amino acid sequence of SEQ ID NO: 54, and the light chain comprises the amino acid sequence of SEQ ID NO:

89.

6. (a) The VH comprises the amino acid sequence of residues 1 to 148 of SEQ ID NO: 54, and the VL comprises the amino acid sequence of residues 1 to 110 of SEQ ID NO: 89, (b) The VH comprises the amino acid sequence of SEQ ID NO: 70, and the VL comprises the amino acid sequence of SEQ ID NO: 104, (c) The VH contains the amino acid sequence of SEQ ID NO: 67, and the VL contains the amino acid sequence of SEQ ID NO: 101, (d) The VH contains the amino acid sequence of SEQ ID NO: 60, and the VL contains the amino acid sequence of SEQ ID NO: 94, (e) The VH contains the amino acid sequence of SEQ ID NO: 61, and the VL contains the amino acid sequence of SEQ ID NO: 95, (f) The VH contains the amino acid sequence of SEQ ID NO: 58, and the VL contains the amino acid sequence of SEQ ID NO: 92, or (g) The VH comprises the amino acid sequence of SEQ ID NO: 69, and the VL comprises the amino acid sequence of SEQ ID NO:

103. The antibody or antibody fragment according to claim 1.

7. The antibody or antibody fragment according to any one of claims 1 to 6, wherein the antibody or antibody fragment is a monoclonal antibody, a bispecific antibody, a multispecific antibody, a transplant antibody, a humanized antibody, a chimeric antibody, a single-chain Fv (scFv), or a single-chain antibody.

8. The antibody or antibody fragment according to any one of claims 1 to 7, wherein the antibody or antibody fragment is a chimeric or humanized antibody.

9. The antibody or antibody fragment according to any one of claims 1 to 8, wherein the antibody or antibody fragment has an EC50 of about 25 nanomoles, 20 nanomoles, or less than 10 nanomoles in a cAMP assay.

10. The antibody or antibody fragment according to any one of claims 1 to 9, wherein the antibody or antibody fragment is a GLP1R1 antagonist.

11. A pharmaceutical composition comprising the antibody or antibody fragment according to any one of claims 1 to 10 and a pharmaceutically acceptable carrier.

12. An isolated nucleic acid encoding the antibody or a fragment of the antibody according to any one of claims 1 to 10.

13. A vector comprising the nucleic acid described in claim 12.

14. A host cell comprising the nucleic acid according to claim 12, or the vector according to claim 13.

15. A host cell expressing the antibody or antibody fragment described in any one of claims 1 to 10.

16. A method for producing the antibody or antibody fragment described in any one of claims 1 to 10, comprising incubating the host cell described in claim 14 or claim 15 under conditions suitable for expressing the antibody or antibody fragment.

17. The method according to claim 16, further comprising isolating the antibody or a fragment of that antibody.

18. A pharmaceutical composition for use in a method for treating a metabolic disease or disorder, wherein the method comprises administering the antibody or antibody fragment described in any one of claims 1 to 10.

19. The pharmaceutical composition according to claim 18, wherein the metabolic disease or disorder is hyperinsulinism or hypoglycemia.

20. An antibody or antibody fragment that binds to a glucagon-like peptide 1 receptor (GLP1R), comprising a heavy chain and a light chain, wherein the heavy chain comprises a heavy chain variable region (VH) and the light chain comprises a light chain variable region (VL), (a) The VH includes CDR-H1 containing the amino acid sequence of SEQ ID NO: 561, CDR-H2 containing the amino acid sequence of SEQ ID NO: 740, and CDR-H3 containing the amino acid sequence of SEQ ID NO: 919, and the VL includes CDR-L1 containing the amino acid sequence of SEQ ID NO: 1098, CDR-L2 containing the amino acid sequence of SEQ ID NO: 1277, and CDR-L3 containing the amino acid sequence of SEQ ID NO: 1456, or (b) The antibody or antibody fragment thereof, wherein VH comprises CDR-H1 containing the amino acid sequence of SEQ ID NO: 592, CDR-H2 containing the amino acid sequence of SEQ ID NO: 771, and CDR-H3 containing the amino acid sequence of SEQ ID NO: 950, and VL comprises CDR-L1 containing the amino acid sequence of SEQ ID NO: 1129, CDR-L2 containing the amino acid sequence of SEQ ID NO: 1308, and CDR-L3 containing the amino acid sequence of SEQ ID NO: 1487.

21. The antibody or antibody fragment according to claim 20, wherein the antibody or antibody fragment is a partial agonist of GLP1R.

22. A pharmaceutical composition comprising the antibody or antibody fragment according to claim 20 or claim 21, and a pharmaceutically acceptable carrier.

23. An isolated nucleic acid encoding the antibody or a fragment of the antibody according to claim 20 or claim 21.

24. A vector comprising the nucleic acid described in claim 23.

25. A host cell comprising the nucleic acid according to claim 23 or the vector according to claim 24.

26. A host cell expressing the antibody or antibody fragment described in claim 20 or claim 21.

27. ​​A method for producing the antibody or antibody fragment according to claim 20 or claim 21, comprising incubating the host cell according to claim 25 or claim 26 under conditions suitable for the expression of the antibody or antibody fragment.

28. The method according to claim 27, further comprising isolating the antibody or a fragment of that antibody.

29. The pharmaceutical composition according to claim 22, for use in the treatment of obesity or type II diabetes.

Images