Pharmaceutical composition and screening method for inhibiting the production of hepatitis B virus protein

JP7863836B2Active Publication Date: 2026-05-22FUJIFILM CORP +1
View PDF 7 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
FUJIFILM CORP
Filing Date
2024-03-05
Publication Date
2026-05-22

AI Technical Summary

Technical Problem

Current treatments for hepatitis B virus (HBV) infection, such as nucleoside analogs, are ineffective in reducing HBs antigen levels, and RNA interference methods face challenges due to genetic variability among HBV genotypes, necessitating a new mechanism to inhibit HBV protein production.

Method used

A pharmaceutical composition that targets human RNA-binding proteins binding to enhancer I and II regions of HBV genomic DNA, inhibiting HBV protein production by reducing the expression or function of these proteins, and a screening method to identify substances that inhibit the production of HBV proteins, particularly HBs antigen, and a method for screening substances that inhibit the production of HBV proteins by targeting RNA-binding proteins that bind to specific sequences in HBV RNA.

Benefits of technology

The composition effectively reduces HBV protein production, particularly HBs antigen, and suppresses HBV replication, offering a novel approach to HBV treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007863836000007
    Figure 0007863836000007
  • Figure 0007863836000008
    Figure 0007863836000008
  • Figure 0007863836000009
    Figure 0007863836000009
Patent Text Reader

Abstract

To provide a pharmaceutical composition useful as a novel anti-hepatitis B virus agent and a screening method.SOLUTION: According to the present invention, there is provided a pharmaceutical composition that inhibits production of a hepatitis B virus protein, in which the pharmaceutical composition inhibits expression or a function of an RNA-binding protein that binds to at least one sequence selected from a hepatitis B virus RNA sequence corresponding to an enhancer I region sequence on hepatitis B virus genome DNA or a hepatitis B virus RNA sequence corresponding to an enhancer II region sequence on the hepatitis B virus genome DNA.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a pharmaceutical composition having anti-hepatitis B virus activity and a method for screening substances that inhibit the production of hepatitis B virus proteins.

Background Art

[0002] Hepatitis B virus (HBV) is a virus belonging to the genus Hepadnavirus and is a spherical DNA virus with a diameter of about 42 nm. The virus itself is a DNA virus composed of a core (core) with a diameter of 27 nm, including an outer coat (envelope), incomplete double-stranded DNA, DNA polymerase, reverse transcriptase, etc., and is called a Dane particle. It forms a double structure, with the outer side consisting of HBs antigen (hepatitis B surface antigen, HBsAg) and the inner side consisting of HBc antigen (hepatitis B core antigen, HBcAg) and genomic DNA (Non-Patent Document 1). In addition to Dane particles, HBs antigen exists as hollow particles, small spherical particles or rod-shaped particles. The genomic DNA of HBV has four types of transcription open reading frames (ORFs), namely pre-S / S gene region, P gene region, X gene region, pre-C / C gene region, three promoters, and two enhancer (Enhancer, Enh) regions. The core promoter in the X gene region and the precore region in the C gene region are involved in the production of the HBe antigen (hepatitis B envelope antigen, HBeAg) constituent protein. A point mutation in this region results in the non-production of the HBe antigen constituent protein and the HBe antigen-negative state. Also, the two enhancer regions are called Enhancer I (EnhI) and Enhancer II (EnhII), and both can increase the activity of all three promoters (Patent Document 1). When HBV invades liver cells, incomplete circular double-stranded DNA is taken up into the nucleus of the liver cell and converted into fully closed double-stranded DNA (covalently closed circular DNA, cccDNA). In a chronic HBV infection, cccDNA exists as minichromosomes, with 5 to 50 cccDNA molecules per liver cell. Four types of RNA are transcribed from the cccDNA in the liver cell nucleus, and these are translated into structural proteins: HBs antigen, HBc antigen, HBe antigen, X protein, and polymerase containing reverse transcriptase. One of the RNA molecules is incorporated into the core particle as pregenomic RNA, and reverse transcriptase synthesizes a minus-strand DNA, followed by a plus-strand DNA, resulting in incomplete circular double-stranded DNA. Furthermore, it is enveloped in an envelope formed from the HBs antigen, becoming a viral particle (Dane particle) and released into the bloodstream. Hollow particles (particles without a DNA nucleus) containing RNA-translated HBs antigen, HBc antigen, and p22cr antigen, as well as HBe antigen which can pass through the hepatocyte membrane, are released and secreted into the bloodstream in large quantities, separate from the release route of Dane particles into the blood. This action is thought to be a mechanism for escaping attack by the host immune system in HBV infection. HBe antigen, HBc antigen, and p22cr antigen can be measured as HBcr antigen (hepatitis B core-related antigen, HBcrAg) and are used as markers of viral replication (Non-patent Literature 1).

[0003] Hepatitis B is a type of viral hepatitis caused by infection with HBV, and it is estimated that there are approximately 240 million infected people worldwide. As mentioned earlier, when infected with HBV, Dane particles are released into the bloodstream, and a large amount of viral proteins are secreted into the bloodstream separately from the Dane particle release route. Among the viral proteins, HBs antigen in particular has been suggested to interfere with the elimination of infected cells by the host human immune system (Non-Patent Literature 2, 3). Therefore, it is considered important for the treatment of hepatitis B to reduce Dane particles, that is, to suppress viral replication, as well as to reduce viral proteins, including HBs antigen. Nucleoside analogs such as entecavir and tenofobi are used as first-line treatments for hepatitis B. Nucleoside analogs inhibit the activity of HBV polymerase protein and inhibit the formation of incomplete circular double-stranded DNA, thereby reducing the amount of Dane particles in the blood and suppressing viral replication. However, since nucleoside analogs cannot reduce HBs antigen, it is difficult to achieve elimination of infected cells by the host immune system. Therefore, the development of drugs that can reduce HBs antigen is desired. In recent years, research and development of double-stranded RNA (dsRNA) that binds to and degrades HBV RNA using the principle of RNA interference (RNAi) has been progressing. These double-stranded RNAs have been reported to reduce HBs antigen in HBV-infected cells, etc. (Non-Patent Literature 4). Due to their properties, double-stranded RNA needs to have a high degree of sequence identity with HBV RNA in order to bind to HBV RNA and exert its effect. However, because there are eight genotypes of HBV and the RNA sequence changes due to gene mutations, there are concerns that the effect of double-stranded RNA that binds to HBV RNA may not be expected in some cases. In fact, analysis of HBV collected from hepatitis B patients has reported that multiple clones with different gene sequences exist in the same patient, and that there are clones in which the effect of double-stranded RNA on HBV RNA is attenuated (Non-Patent Literature 5). Therefore, it is necessary to develop pharmaceuticals that can achieve a reduction in HBs antigen through a new mechanism of action.

[0004] HBV lacks the molecules necessary to transcribe RNA from its own genes, and the molecules necessary to produce viral proteins from RNA. Therefore, HBV must utilize molecules present in infected human liver cells for replication and viral protein production. Consequently, a new approach that targets the human proteins utilized by HBV to inhibit HBV replication and viral protein production has begun to attract attention. For example, attempts have been made to regulate HBV replication by controlling the transcription from HBV genomic DNA to HBV RNA using nucleic acid molecules that bind to enhancer I in HBV genomic DNA (Patent Document 2). In addition, attempts have been made to suppress HBV proliferation by controlling the transcription to HBV RNA by controlling the expression of transcription factors that act on the enhancer region in HBV genomic DNA (Patent Documents 3-5). However, it is not yet fully understood which factors in the human host are necessary for HBV replication and viral protein production, or what kind of anti-HBV effects can be achieved by controlling them. [Prior art documents] [Patent Documents]

[0005] [Patent Document 1] International Publication No. 2005-059138 [Patent Document 2] U.S. Patent Application Publication No. 2003 / 0148985A1 [Patent Document 3] Special Publication No. 2018-526332 [Patent Document 4] Special Publication No. 2007-520461 [Patent Document 5] Special Publication No. 2005-532052 [Non-patent literature]

[0006] [Non-Patent Document 1] Tanaka et al., Modern Media, Vol. 54, No. 12, pp. 347-352, 2008. [Non-Patent Document 2] Brouw et al., Immunology, Vol. 126, pp. 280-289, 2008. [Non-Patent Document 3] Vanlandschoot et al., Journal of General Virology, Vol. 83, pp. 1281-1289, 2002. [Non-Patent Document 4] Wooddell et al., Molecular Therapy, Vol. 21, No. 5, pp. 973-985, 2013. [Non-Patent Document 5] Wu et al., Gastroenterology, Vol. 128, pp. 708-716, 2005. [Overview of the project] [Problems that the invention aims to solve]

[0007] The object of the present invention is to provide a novel pharmaceutical composition that targets a human protein, which is a host factor, and has anti-hepatitis B virus (HBV) activity. Another object of the present invention is to provide a pharmaceutical composition that targets a human protein and suppresses the production of HBV protein. Furthermore, another object of the present invention is to provide a method for screening substances that target a host factor and suppress the production of HBV protein. [Means for solving the problem]

[0008] As a result of diligent research into the above-mentioned problems, the present inventors have discovered that a pharmaceutical composition that inhibits a human protein that binds to at least one region of the hepatitis B virus RNA (HBV RNA) sequence corresponding to the enhancer I (EnhI) region sequence and the enhancer II (EnhII) region sequence on the hepatitis B virus genomic DNA (HBV genomic DNA) has the ability to inhibit the production of HBV protein, and has thus completed the present invention.

[0009] In other words, the present invention provides the following: <1> A pharmaceutical composition that inhibits the production of hepatitis B virus protein (HBV protein), characterized in that it inhibits the expression or function of an RNA-binding protein that binds to at least one sequence selected from an HBV RNA sequence corresponding to the enhancer (Enh) I region sequence on HBV genomic DNA and an HBV RNA sequence corresponding to the enhancer (Enh) II region sequence on HBV genomic DNA. <2> The pharmaceutical composition according to <1>, wherein the HBV RNA sequence corresponding to the enhancer (Enh) I region sequence on the HBV genomic DNA is a sequence having a sequence identity of 80% or more with SEQ ID NO: 1, and the HBV RNA sequence corresponding to the enhancer (Enh) II region sequence on the HBV genomic DNA is a sequence having a sequence identity of 80% or more with SEQ ID NO: 2. <3> The pharmaceutical composition according to <1> or <2>, wherein the HBV RNA sequence corresponding to the enhancer (Enh) I region sequence on the HBV genomic DNA is a sequence having a sequence identity of 90% or more with SEQ ID NO: 1, and the HBV RNA sequence corresponding to the enhancer (Enh) II region sequence on the HBV genomic DNA is a sequence having a sequence identity of 90% or more with SEQ ID NO: 2. <4> The pharmaceutical composition according to any one of <1> to <3>, wherein the HBV protein is the HBs antigen protein. <5> Furthermore, the pharmaceutical composition according to any one of <1> to <4>, which is characterized by reducing the expression level of HBV genomic DNA. <6> Furthermore, the pharmaceutical composition according to any one of <1> to <5>, which is characterized by reducing the expression level of fully double-stranded DNA (cccDNA). <7> The pharmaceutical composition according to any one of <1> to <6>, wherein the RNA-binding protein is at least one protein selected from RBFOX1, ELAVL2, MBNL1, RBMX, SRSF9, SRSF10, SNRPA, ELAVL1, PUM2, YTHDC1, SRSF1, KHDRBS3 and EIF4B. <8> A method for screening a substance that inhibits the production of HBV protein, comprising A screening method characterized by identifying a substance that inhibits the expression or function of an RNA-binding protein with respect to at least one sequence selected from an HBV RNA sequence corresponding to the enhancer (Enh) I region sequence on the HBV genomic DNA and an HBV RNA sequence corresponding to the enhancer (Enh) II region sequence on the HBV genomic DNA. <9> The screening method according to <8>, wherein the HBV RNA sequence corresponding to the enhancer (Enh) I region sequence on the HBV genomic DNA is a sequence having 80% or more sequence identity with SEQ ID NO: 1, and the HBV RNA sequence corresponding to the enhancer (Enh) II region sequence on the HBV genomic DNA is a sequence having 80% or more sequence identity with SEQ ID NO: 2. <10> The screening method according to <8> or <9>, wherein the HBV protein is the HBs antigen protein. <11> A method for screening a substance that inhibits the production of hepatitis B virus (HBV) protein, comprising: (a) Identifying an RNA-binding protein that binds to at least one sequence selected from an HBV RNA sequence corresponding to the enhancer (Enh) I region sequence on the HBV genomic DNA and an HBV RNA sequence corresponding to the enhancer (Enh) II region sequence on the HBV genomic DNA; (b) Contacting a test substance that inhibits the function or activity of the identified RNA-binding protein or reduces the expression level of the same protein with a cell infected with HBV or a cell expressing HBV; (c) Measuring the ability to produce HBV protein in a cell infected with HBV or a cell expressing HBV; and (d) Selecting a substance having an activity of inhibiting the production of the HBV protein in (c). A method comprising the above steps. <12> The method according to <11>, wherein (a) includes the step of using an RNA-binding protein sequence database. <13> (b) The test substance is an antibody, peptide, protein, non-peptide compound, synthetic compound, antisense nucleic acid, double-stranded RNA, adeno-associated virus vector, or CRISPR-Cas vector system. <11> Methods used. <14> (c) includes a step of measuring the HBV protein in the culture supernatant of cells infected with HBV or cells expressing HBV, <11> Methods used. <15> (d) The substance is an antibody, peptide, protein, non-peptide compound, synthetic compound, antisense nucleic acid, double-stranded RNA, adeno-associated virus vector, or CRISPR-Cas vector system. <11> Methods used.

[0010] Furthermore, the present invention provides the following: <1> ~ <7> A method of treatment comprising administering a pharmaceutical composition described in any one of the above to a subject who is infected with HBV or suffering from a disease associated with HBV infection. Diseases associated with HBV infection include hepatitis B, cirrhosis caused by them, or liver cancer caused by them. The treatment method described above. <c> <1> ~ <7> A pharmaceutical composition described in any one of the following; and Instructions describing how to treat diseases associated with HBV infection. A treatment kit for diseases associated with HBV infection, including [mention specific product / method]. <d> The method for treating a disease associated with HBV infection includes administering the pharmaceutical composition to a subject who is infected with HBV or suffering from a disease associated with HBV infection. <c>A treatment kit for diseases associated with HBV infection, as described above. <e> A substance for use in treatments that inhibit the production of hepatitis B virus protein (HBV protein) that inhibits the expression or function of RNA-binding proteins that bind to at least one sequence selected from an HBV RNA sequence corresponding to the enhancer (Enh) I region sequence on the HBV genomic DNA and an HBV RNA sequence corresponding to the enhancer (Enh) II region sequence on the HBV genomic DNA. <f> The use of a substance that inhibits the expression or function of an RNA-binding protein that binds to at least one sequence selected from an HBV RNA sequence corresponding to the enhancer (Enh) I region sequence on HBV genomic DNA and an HBV RNA sequence corresponding to the enhancer (Enh) II region sequence on HBV genomic DNA, for the manufacture of a pharmaceutical composition that inhibits the production of hepatitis B virus protein (HBV protein). [Effects of the Invention]

[0011] The pharmaceutical composition of the present invention has excellent anti-HBV activity and is useful as an anti-HBV agent. Furthermore, the screening method of the present invention is useful for screening substances that inhibit the production of HBV protein. [Brief explanation of the drawing]

[0012] < / f> < / e> < / c> < / d> < / c> [Figure 1] Figure 1 shows the relative luminescence (%) of firefly luciferase in a reporter assay using an EnhI / EnhII region-deficient construct derived from genotype C. [Figure 2] Figure 2 shows the relative expression level (%) of firefly luciferase RNA in a reporter assay using an EnhI / EnhII region-deficient construct derived from genotype C. [Figure 3] Figure 3 shows the relative values ​​(%) of each dsRNA-added well relative to the negative control dsRNA-added well for each concentration of HBs antigen (HBsAg). [Figure 4] Figure 4 shows the relative values ​​(%) of cell viability for each dsRNA-treated well compared to the negative control dsRNA-treated well at each concentration. [Figure 5] Figure 5 shows the relative expression level (%) of firefly luciferase RNA and the relative luminescence level (%) of firefly luciferase in reporter assays using EnhI / EnhII region-deficient constructs derived from various genotypes. [Modes for carrying out the invention]

[0013] The present invention will be described in detail below. In this specification, unless otherwise specified, each term has the following meaning:

[0014] Prevention means inhibiting the onset of the disease, reducing the risk of developing it, or delaying its onset. Treatment refers to the improvement or slowing of the progression of the disease or condition in question. Treatment refers to the prevention or treatment of various diseases. The term "effective dose" refers to a therapeutically effective dose or a preventive effective dose, etc. A therapeutically effective dose is the amount sufficient to stabilize, reduce, or eradicate HBV infection in an infected subject. A preventive dose is the amount sufficient to prevent HBV infection in a subject at risk of infection. The subject means mammals including humans.

[0015] <Hepatitis B virus (HBV)> Hepatitis B virus (HBV) means a virus having the ability to cause hepatitis B. HBV is currently classified into eight genotypes (genotype) from type A to type H due to differences in base sequences derived from genetic mutations. The HBV to be targeted for prevention or treatment in the pharmaceutical composition of the present invention includes all genotypes. In the present invention, diseases associated with HBV infection include hepatitis B, including acute hepatitis, chronic hepatitis, and fulminant hepatitis. Also, any disease caused by the infection of HBV into a living body including humans, such as liver cirrhosis, liver fibrosis, and liver cancer such as hepatocellular carcinoma, is included.

[0016] <Hepatitis B virus protein (HBV protein)> Hepatitis B virus protein (HBV protein) is a protein constituting HBV, and examples include HBs antigen, HBc antigen, HBe antigen, etc. In the present invention, the HBV protein is not particularly limited, but is preferably the HBs antigen.

[0017] <HBV RNA sequence corresponding to the EnhI region sequence and the EnhII region sequence on the HBV genomic DNA> The HBV genomic DNA has two enhancer regions (EnhI and EnhII), and EnhI and EnhII are known to promote transcription from HBV genomic DNA to HBV RNA. In the present invention, the HBV RNA sequence corresponding to the EnhI region sequence and the EnhII region sequence on the HBV genomic DNA means the base sequence of the region corresponding to EnhI on the HBV genomic DNA within the 3' untranslated region (hereinafter also referred to as 3'UTR) of the RNA encoding the HBV protein, or the base sequence of the region corresponding to EnhII on the HBV genomic DNA within the 3'UTR of the RNA encoding the HBV protein. In the present invention, the HBV RNA sequence corresponding to the EnhI region sequence and the EnhII region sequence on the HBV genomic DNA is preferably the nucleotide sequence of the region corresponding to EnhI on the HBV genomic DNA, which is located within the 3'UTR of the RNA encoding the HBs antigen, or the nucleotide sequence of the region corresponding to EnhII on the HBV genomic DNA, which is located within the 3'UTR of the RNA encoding the HBs antigen.

[0018] In the present invention, the HBV RNA sequence corresponding to the EnhI region sequence on the HBV genomic DNA is a sequence having 80% or more sequence identity with SEQ ID NO: 1, and the HBV RNA sequence corresponding to the EnhII region sequence on the HBV genomic DNA is a sequence having 80% or more sequence identity with SEQ ID NO: 2. The above HBV RNA is preferably an RNA encoding the HBV protein and an RNA encoding the HBs antigen. The HBV RNA sequence mentioned above is, for example, the sequence of SEQ ID NO: 1 or SEQ ID NO: 2. The sequence is preferably 80% or more identical to the sequence of SEQ ID NO: 1 or SEQ ID NO: 2, more preferably 85%, even more preferably 90%, even more preferably 95%, even more preferably 98%, and particularly preferably 100% identical.

[0019] Sequence ID 1: uuaauugcauguauacaaucuaagcaggcuuucacuuucucgccaacuuacaaggccuuucuguguaaacaauaucugaaccuuuaccccguugcccggcaacggucaggucucugccaaguguuugcugacgcaacccccacuggauggggcuuggcuaucggccaucgccgcaugcguggaaccuuuguggcuccgcug Sequence ID 2: uugcccaaggucuuauauaagaggacucuuggacucucagcgaugucaacgaccgaccuugaggcauacuucaaagacuguuuguuuaaggacugggaggaguugggggaggagauuagguuaaagauuuuugu

[0020] <RNA-binding protein> RNA-binding proteins are known to specifically bind to specific target RNAs and control various cellular functions in post-transcriptional and post-translational protein expression, such as RNA splicing, polyadenylation, capping, modification, transport, localization, translation, and metabolic turnover (Ray et al., Nature, Vol. 499, No. 11, 2013). In the present invention, it is presumed that the RNA-binding protein controls the expression (production) of HBV proteins by binding to a specific sequence on HBV RNA. The above HBV RNA is preferably RNA encoding the HBs antigen. Examples of the specific sequence on the above HBV RNA include the sequences of SEQ ID NO: 1 or SEQ ID NO: 2. The above sequence preferably has a sequence identity of 80% or more, more preferably 85%, further preferably 90%, even more preferably 95%, even more preferably 98%, and particularly preferably 100% with respect to the sequences of SEQ ID NO: 1 or SEQ ID NO: 2.

[0021] In the present invention, the RNA-binding protein is preferably one that recognizes and binds to 4 to 9 bases on the above sequence, for example, RFBOX1 (RNA binding protein, fox-1 homolog), ELAVL2 (ELAV-like RNA binding protein 2), MBNL1 (muscleblind-like Protein 1), RBMX (RNA-binding motif protein, X chromosome), SRSF9 (serine and arginine rich splicing factor 9), SRSF10 (serine and arginine rich splicing factor 10), SNRPA (small nuclear ribonucleoprotein polypeptide A), ELAVL1 (ELAV-like RNA binding protein 1), PUM2 (pumilio homolog 2), YTHDC1 (YTH domain containing 1), SRSF1 (serine and arginine rich splicing factor 1), KHDRBS3 (KH RNA binding domain containing, signal transduction associated 3), or EIF4B (eukaryotic translation initiation factor Examples include 4B). The RNA-binding protein of the present invention is preferably at least one protein selected from RBFOX1, ELAVL2, MBNL1, RBMX, SRSF9, SRSF10, SNRPA, ELAVL1, PUM2, YTHDC1, SRSF1, KHDRBS3, and EIF4B.

[0022] <Pharmaceutical composition> The pharmaceutical composition of the present invention is a pharmaceutical composition comprising a "substance," specifically a "substance that inhibits the production of HBV protein," and a pharmaceutically acceptable carrier. The pharmaceutical composition of the present invention includes a substance that inhibits the expression or function of an RNA-binding protein that binds to at least one sequence selected from an HBV RNA sequence corresponding to the enhancer (Enh) I region sequence on the HBV genomic DNA and an HBV RNA sequence corresponding to the enhancer (Enh) II region sequence on the HBV genomic DNA, as a substance that inhibits the production of HBV protein.

[0023] The pharmaceutical composition of the present invention preferably contains a substance that inhibits the production of HBV protein, and more preferably a substance that inhibits the production of HBs antigen.

[0024] Examples of "substances" include antibodies, peptides, proteins, non-peptide compounds, synthetic compounds, antisense nucleic acids, double-stranded RNA, adeno-associated virus vectors, and CRISPR-Cas vector systems.

[0025] An "antisense nucleic acid" is a nucleic acid that contains a base sequence or a portion thereof that is complementary or substantially complementary to the base sequence of a "sense" nucleic acid that codes for a certain protein, such as the coding strand of a double-stranded cDNA molecule, an mRNA sequence, or the coding strand of a gene, and has the function of suppressing protein synthesis by forming a specific and stable double helix and binding to the target base sequence. "RNAi nucleic acids" include, but are not limited to, nucleic acids that interfere with or inhibit the expression of target genes by short-chain interfering RNA (siRNA), small hairpin RNA (shRNA), or RNA interference (RNAi). "Double-stranded RNA" includes, but is not limited to, nucleic acids that interfere with or inhibit the expression of target genes by short interfering RNA (siRNA), small hairpin RNA (shRNA), or RNA interference (RNAi). An "RNA interference agent" is a nucleic acid that interferes with or inhibits the expression of a target gene through RNA interference. RNA interference is a post-transcriptional targeted gene silencing technique that uses double-stranded RNA (dsRNA) to degrade mRNA containing the same sequence as the dsRNA (Sharp et al., Science, Vol. 287, pp. 2431-2432, 2000; Zamore et al., Cell, Vol. 101, pp. 25-33, 2000; Tuschl et al., Genes & Development, Vol. 13, pp. 3191-3197, 1999). It occurs when endogenous ribonucleases cleave long dsRNAs, producing shorter RNAs called short-chain interfering RNAs (siRNAs) of 21 or 22 nucleotides in length. These siRNAs mediate the degradation of target mRNA. Kits for RNAi synthesis are commercially available, for example, from New England Biolabs and Ambion. In one embodiment, one or more of the above chemistry for use with antisense RNA can be used. The substances included in the pharmaceutical composition of the present invention are preferably antisense nucleic acids or double-stranded RNA, and more preferably double-stranded RNA. Furthermore, in the case of double-stranded RNA, it is particularly preferable that it be an RNA interference agent.

[0026] Adeno-associated viruses are single-stranded DNA viruses belonging to the Parvoviridae family, consisting of approximately 4700 base pairs. They lack an envelope and possess an icosahedral capsid with a diameter of 20-30 nm. Because they recognize heparan sulfate proteoglycans, a common component of cell membranes, and infect cells through this mechanism, they have a broad host range. The genome of adeno-associated viruses (ADVs) can be used to insert any gene or nucleic acid. Therefore, by infecting target cells with genetically modified ADVs, the desired gene or nucleic acid can be introduced, making ADVs usable as vectors for gene transfer. Furthermore, "adeno-associated virus vectors" are non-pathogenic and can introduce genes into terminally differentiated, non-dividing cells, so they are expected to have applications in gene therapy. Adeno-associated viruses are known to exhibit different infectivity to tissues and cells depending on their serotype (Ozawa et al., Drug Delivery System, Vol. 22, No. 6, pp. 643-650, 2007). The substances included in the pharmaceutical composition of the present invention are preferably adeno-associated virus type 5, adeno-associated virus type 7, adeno-associated virus type 8, or adeno-associated virus type 9, with adeno-associated virus type 8 being more preferred.

[0027] The "CRISPR-Cas system" is a system that repurposes the Clustered Regulatory Interspaced Short Palindromic Repeats / CRISPR-associated Protein (CRISPR / Cas) system, which was discovered as an acquired immunity possessed by eubacteria and archaea, for genome editing (Jinek et al., Science, Vol. 337, pp. 816-821, 2012). Specifically, the genomic region called the CRISPR region of the above-mentioned bacteria contains multiple repeats of cassettes that incorporate fragmented foreign DNA (20 bp), and each cassette incorporates different foreign DNA. Each cassette is thought to be generated when DNA from an alien organism (such as a phage) is taken into a cell, fragmented, and incorporated into the CRISPR region. Each cassette encodes CRISPR RNA (crRNA). The crRNA has a protospacer sequence and a sequence complementary to the trans-crRNA (tracrRNA), described later. The protospacer sequence is 20 nucleotides long and has a sequence complementary to the target DNA sequence. The protospacer sequence does not need to be 100% complementary to the target sequence; a mismatch is acceptable in the 6-nucleotide region from the 5' end. The crRNA forms a complex with trans-crRNA (tracrRNA), which is transcribed separately via the complementary region. The crRNA-tracrRNA complex then forms a further complex with Cas9 endonuclease. The protospacer portion of the crRNA hybridizes complementaryly with the foreign DNA, thereby leading the Cas9 endonuclease to the target sequence of the foreign DNA. The foreign DNA is cleaved by the Cas9 endonuclease at the target sequence, and the CRISPR-Cas9 system protects the host from the foreign DNA. Thus, the CRISPR-Cas9 system was discovered because it functions as an acquired immunity against new foreign DNA in eubacteria and archaea. By designing protospacers made of foreign DNA, it is possible to sequence-dependently cleave the mammalian genome, and thereby edit the mammalian genome. A "CRISPR-Cas vector system" is a vector system comprising a crRNA, a tracrRNA sequence or a guide RNA (gRNA) that combines the functions of both crRNA and tracrRNA, and a Cas gene sequence. The system currently in primary use is the second type of CRISPR-Cas9 system derived from Streptococcus pyogenes, but it is not limited to this system.

[0028] Pharmaceutically acceptable carriers include excipients, diluents, bulking agents, disintegrants, stabilizers, preservatives, buffers, emulsifiers, fragrances, colorants, sweeteners, viscosity enhancers, flavoring agents, solubilizers, and other additives. By using one or more such carriers, pharmaceutical compositions in the form of tablets, capsules, powders, syrups, granules, pills, suspensions, emulsions, powder formulations, suppositories, eye drops, nasal drops, ear drops, patches, ointments, injections, solutions, lozenges, or elixirs can be prepared. These pharmaceutical compositions can be administered orally or parenterally. Other forms for parenteral administration include topical solutions containing one or more active substances, prescribed according to standard laws, and suppositories for enteric-coated intravenous administration. Furthermore, the dosage and frequency of administration of the pharmaceutical composition of the present invention can be appropriately selected according to the patient's sex, weight, age, severity, and symptoms. Typically, for adults, 0.01 to 1000 mg / kg per day should be administered orally or parenterally (e.g., by injection, intravenous drip, or rectal administration) in one to several divided doses.

[0029] The pharmaceutical composition of the present invention preferably further reduces the expression level of HBV DNA.

[0030] The pharmaceutical composition of the present invention preferably further reduces the expression level of full double-stranded DNA (cccDNA).

[0031] The pharmaceutical composition of the present invention is useful as a pharmaceutical for inhibiting the expression or function of an RNA-binding protein that binds to at least one sequence of an HBV RNA sequence corresponding to the EnhI region sequence on the HBV genomic DNA and an HBV RNA sequence corresponding to the EnhII region sequence on the HBV genomic DNA, or as a pharmaceutical for suppressing or inhibiting the onset or progression of a disease involving the RNA-binding protein, and for treating or preventing the disease.

[0032] <Screening Method> The screening method of the present invention is useful as a method for screening substances that inhibit the production of HBV protein.

[0033] The present invention provides a screening method for substances that inhibit the production of HBV protein, characterized by identifying a substance that inhibits the expression or function of an RNA-binding protein that binds to at least one sequence selected from an HBV RNA sequence corresponding to the enhancer I region sequence on HBV genomic DNA and an HBV RNA sequence corresponding to the enhancer II region sequence on HBV genomic DNA. In the screening method of the present invention, it is preferable that the HBV RNA sequence corresponding to the enhancer I region sequence on the hepatitis B virus genomic DNA is a sequence that has 80% or more sequence identity with SEQ ID NO: 1, and the HBV RNA sequence corresponding to the enhancer II region sequence on the hepatitis B virus genomic DNA is a sequence that has 80% or more sequence identity with SEQ ID NO: 2. The screening method of the present invention also preferably identifies substances that inhibit the production of HBs antigen as hepatitis B virus proteins.

[0034] The screening method of the present invention includes, (a) A step of identifying an RNA-binding protein that binds to at least one sequence selected from an HBV RNA sequence corresponding to the EnhI region sequence on HBV genomic DNA and an HBV RNA sequence corresponding to the EnhII region sequence on HBV genomic DNA. (b) A step of contacting cells infected with HBV or cells expressing HBV with a test substance that inhibits the function or activity of an identified RNA-binding protein, or a test substance that reduces the expression level of the said protein. (c) A step of measuring the ability of cells infected with HBV or cells expressing HBV to produce HBV protein, and (d) A step of selecting a substance that has the activity to inhibit the production of the HBV protein of (c), Methods including the following are mentioned.

[0035] (a) A step of identifying an RNA-binding protein that binds to at least one sequence selected from an HBV RNA sequence corresponding to the EnhI region sequence on HBV genomic DNA and an HBV RNA sequence corresponding to the EnhII region sequence on HBV genomic DNA. For example, one could utilize a public RNA-binding protein sequence database such as the RNA-Binding Protein Database (RBPDB). The public RNA-binding protein sequence database used is not particularly limited. By inputting HBV RNA sequences corresponding to the EnhI or EnhII regions on the HBV genomic DNA into RBPDB or a similar database, RNA-binding proteins that bind to these regions can be extracted. Another method involves performing a pull-down assay using a cell extract derived from HepG2.2.15 cells and RNA having a sequence corresponding to the EnhI or EnhII region sequence on HBV genomic DNA transcribed in vitro, and then identifying the resulting binding protein using a mass spectrometer, or a similar method.

[0036] The screening method of the present invention preferably includes a step of using an RNA-binding protein sequence database in (a). In another embodiment, it is preferable that (a) is a method that includes the step of performing a pull-down assay using RNA having a sequence corresponding to the EnhI or EnhII region sequence on HBV genomic DNA.

[0037] (b) A step of contacting cells infected with HBV or cells expressing HBV with a test substance that inhibits the function or activity of the identified RNA-binding protein, or a test substance that reduces the expression level of the said protein. Examples of cells infected with HBV include primary human hepatocytes infected with HBV clone C_JPNAT (GenBank:AB246345.1), or HepG2 cells that forcibly express sodium taurocholate cotransporting polypeptide (NTCP) and are infected with HBV clone C_JPNAT (GenBank:AB246345.1). The combination of HBV clone and cells mentioned above is not particularly limited. Examples of cells expressing HBV include HepG2.2.15 cells, or HepG2 cells, Huh-7 cells, HepaRG cells, or primary human hepatocytes that are forcibly expressed using a plasmid containing a sequence that is 1.24 times longer than the genome sequence of HBV clone C_JPNAT (GenBank: AB246345.1). The HBV clones mentioned above are not particularly limited. Furthermore, the length of the HBV genome-derived sequence inserted into the plasmid containing the genome sequence of the HBV clone is not particularly limited, as long as it is at least 1.24 times longer than the genome sequence of the HBV clone.

[0038] Examples of test substances include antibodies, peptides, proteins, non-peptide compounds, synthetic compounds, antisense nucleic acids, double-stranded RNA, adeno-associated virus vectors, and CRISPR-Cas vector systems. The test substance used in the screening method of the present invention is preferably antisense nucleic acid or double-stranded RNA, and more preferably double-stranded RNA. Furthermore, in the case of double-stranded RNA, it is particularly preferable that it be an RNA interference agent.

[0039] Contact between HBV-infected cells or cells expressing HBV and the test substance can be performed, for example, by adding the test substance to a culture medium and culturing it for a certain period of time. The concentration of the added test substance varies depending on the type of substance (solubility, toxicity, etc.), but can be appropriately selected within the range of approximately 0.1 nmol / L to approximately 100 nmol / L. The culturing time can range from approximately 24 hours to approximately 120 hours.

[0040] (c) A process for measuring the ability of HBV-infected cells or cells expressing HBV to produce HBV protein. One method for measuring the ability to produce HBV protein is to measure the HBV protein in the culture supernatant of cells infected with HBV or cells expressing HBV. For example, the HBV protein can be measured using methods such as chemiluminescent enzyme immunoassay (CLEIA) or enzyme immunosorbent assay (ELISA) or similar methods, using the recovered culture supernatant.

[0041] (d) A step of selecting a substance that has the activity to inhibit the production of the HBV protein of (c). For example, by applying the test substance in (c), it is possible to select a substance that suppresses HBV protein production by 30% or more, preferably 50% or more, more preferably 70% or more, and even more preferably 90% or more, compared to the negative control.

[0042] <Uses of pharmaceutical compositions> The pharmaceutical composition of the present invention is useful in the treatment or prevention of HBV infection.

[0043] The pharmaceutical composition of the present invention can inhibit the production of HBV protein, particularly the production of HBs antigen. It can also inhibit HBV gene expression (HBV DNA production). Therefore, the pharmaceutical composition of the present invention is useful for the treatment or prevention of HBV infection.

[0044] This invention relates to the use of the pharmaceutical composition of the present invention for inhibiting the production of HBs antigen. This invention relates to the use of the pharmaceutical composition of the present invention for inhibiting HBV DNA production. This invention relates to the use of the pharmaceutical composition of the present invention for inhibiting the gene expression of HBV.

[0045] The present invention relates to the use of the pharmaceutical composition of the present invention for the treatment or prevention of HBV infection. Diseases associated with HBV infection include progressive liver fibrosis, inflammation, and necrosis, which can progress to cirrhosis, end-stage liver disease, and hepatocellular carcinoma.

[0046] Next, the present invention will be explained with reference to test examples, but the present invention is not limited to these. [Examples]

[0047] [Test Example 1] (Reporter assay using an EnhI / EnhII region-deficient construct) PCR reactions were performed using 1xPrimeSTAR Max DNA Polymerase (Takara Corporation) in a reaction mixture containing 0.2 μmol / L primers. Using HBV genomic DNA (GenBank: AB246345.1; hereinafter also referred to as "genotype C") as a template, a 410 bp region containing the PreS2 / S promoter was subjected to PCR using a combination of primers consisting of the nucleotide sequence of SEQ ID NO: 3 and SEQ ID NO: 4, under the conditions of 98°C for 10 seconds, 58°C for 5 seconds, and 72°C for 15 seconds, repeated 35 times, to obtain amplified fragments into which KpnI and HindIII restriction enzyme sites were introduced. Similarly, a 1086 bp region containing the sequence of the 3' untranslated region (hereinafter also referred to as "3'UTR") of the gene encoding the HBs antigen was subjected to PCR using a combination of primers consisting of the nucleotide sequence of SEQ ID NO: 5 and SEQ ID NO: 6, under the conditions of 98°C for 10 seconds, 58°C for 5 seconds, and 72°C for 15 seconds, repeated 35 times, to obtain amplified fragments into which XbaI and SalI restriction enzyme sites were introduced. Each fragment was treated with either a combination of KpnI (Takara) and HindIII (Takara), or a combination of XbaI (Takara) and SalI (Takara), and these were inserted into the KpnI and HindIII sites or the XbaI and SalI sites of pGL3 (Promega) to obtain a plasmid. Hereafter, this plasmid will also be referred to as "PreS2 / S-Luc-3'UTR". In the example test 4 described later, it will also be referred to as "PreS2 / S-Luc-3'UTR (genotype C)" to clarify the difference in genotypes. Using the PreS2 / S-Luc-3'UTR plasmid as a template, PCR was performed using primer combinations consisting of the nucleotide sequence of SEQ ID NO: 7 and SEQ ID NO: 8, and primer combinations consisting of the nucleotide sequence of SEQ ID NO: 9 and SEQ ID NO: 10, under conditions of 98°C for 10 seconds, 58°C for 5 seconds, and 72°C for 30 seconds repeated 35 times, to obtain amplified fragments for constructing plasmids lacking the EnhI region.These fragments were ligated using the In-Fusion HD Cloning Kit (Takara Corporation) to obtain a plasmid lacking the EnhI region from the PreS2 / S-Luc-3'UTR plasmid. Hereafter, this plasmid will also be referred to as "PreS2 / S-Luc-3'UTR dEnhI". Using the PreS2 / S-Luc-3'UTR plasmid as a template, PCR was performed using primer combinations consisting of the nucleotide sequence of SEQ ID NO: 7 and the nucleotide sequence of SEQ ID NO: 11, and primer combinations consisting of the nucleotide sequence of SEQ ID NO: 10 and the nucleotide sequence of SEQ ID NO: 12, under the conditions of 98°C for 10 seconds, 58°C for 5 seconds, and 72°C for 30 seconds repeated 35 times to obtain amplified fragments for creating a plasmid lacking the EnhII region. These fragments were ligated using the In-Fusion HD Cloning Kit (Takara Corporation) to obtain a plasmid lacking the EnhII region from the PreS2 / S-Luc-3'UTR plasmid. Hereafter, this plasmid will also be referred to as "PreS2 / S-Luc-3'UTR dEnhII".

[0048] [Table 1]

[0049] Using HepG2.2.15 cells (Proc Natl Acad Sci USA, Vol. 84, pp. 1005-1009, 1987), which are hepatoblastoma cell lines HepG2 into which the HBV genome has been introduced to produce the virus continuously, a reporter assay was performed according to the following procedure. The following were used as the cell culture medium. DMEM / F-12, GlutaMAX (Invitrogen) + 5 μg / mL insulin (Wako) + 1% penicillin / streptomycin (Sigma) + 10 mmol / L HEPES (Sigma) + 50 μmol / L hydrocortisone (Sigma) + 10% FBS (Equitech-Bio)

[0050] Suspend HepG2.2.15 cells in the above medium, 1 × 10⁶ cells per well. 4 Cells were seeded in 96-well microtiter plates at a cell / 100μL density and incubated in a 5% CO2 incubator at 37°C for 24 hours. 0.062 μg of either PreS2 / S-Luc-3'UTR plasmid, PreS2 / S-Luc-3'UTR dEnhI plasmid, or PreS2 / S-Luc-3'UTR dEnhII plasmid, along with 0.25 ng of pRL-SV40 plasmid (Promega), and 0.23 μL of TransIT-X2 Transfection Reagent (Mirus) were diluted in 7.8 μL of serum-free medium (ThermoFisher Scientific) and incubated at room temperature for 20 minutes. 8 μL of this plasmid-TransIT-X2 Transfection Reagent mixture was added to the wells seeded with the aforementioned HepG2.2.15 and incubated for 24 hours. Next, the culture medium was changed to 100 μL / well of the aforementioned cell culture medium, and the cells were incubated for a further 48 hours at 37°C in a 5% CO2 incubator. After incubation, luminescence from firefly luciferase and sea urchin luciferase was detected using a Dual-Luciferase Reporter Assay System (Promega). The luminescence of firefly luciferase, corrected for the luminescence of sea urchin luciferase, was calculated for each well, and the results are shown in Figure 1. The relative values ​​(%) of the luminescence of luciferase in each deletion plasmid-added well compared to the luminescence of firefly luciferase in the PreS2 / S-Luc-3'UTR plasmid-added well are also shown in Figure 1.

[0051] Suspend HepG2.2.15 cells in the above medium, 2 × 10⁶ cells per well. 5 Cells were seeded in 12-well microtiter plates at a cell / 1000μL ratio and incubated in a 5% CO2 incubator at 37°C for 24 hours. 1 μg of either PreS2 / S-Luc-3'UTR plasmid, PreS2 / S-Luc-3'UTR dEnhI plasmid, or PreS2 / S-Luc-3'UTR dEnhII plasmid, along with 3 μL of TransIT-X2 Transfection Reagent (Mirus), was diluted in 97 μL of serum-free medium (ThermoFisher Scientific) and incubated at room temperature for 20 minutes. 100 μL of this plasmid-TransIT-X2 Transfection Reagent mixture was added to the wells seeded with the aforementioned HepG2.2.15 and incubated for 24 hours. Next, the culture medium was changed to 1000 μL / well and incubated again in a 5% CO2 incubator at 37°C for another 24 hours. The culture supernatant was then discarded, and the cells were washed with phosphate-buffered saline (1000 μL / well, Fujifilm Wako Pure Chemical Industries, Ltd.). Total RNA was extracted using the RNeasy Mini Kit (Qiagen). 1 μg of the extracted total RNA was reverse transcribed using the PrimeScript RT Reagent Kit with gDNA Eraser (Takara Corporation) to produce cDNA. Based on the produced cDNA, the expression level of firefly luciferase RNA was quantified, and the relative value (%) of the expression level of firefly luciferase RNA in each plasmid-added well compared to the expression level of firefly luciferase RNA in the well transfected with the PreS2 / S-Luc-3'UTR plasmid is calculated and shown in Figure 2.

[0052] Deletion of the EnhI or EnhII region resulted in a 70% to 80% reduction in the relative luminescence derived from the firefly luciferase protein (Figure 1). Therefore, it was considered possible that this phenomenon was due to a decrease in transcriptional activity (decrease in firefly luciferase RNA expression) due to the deletion of the EnhI or EnhII region in the DNA sequence, or due to a change in RNA function due to the deletion of the region corresponding to EnhI or EnhII in the RNA sequence. Analysis of the relative expression level of firefly luciferase RNA revealed that deletion of the EnhI or EnhII region hardly changed the relative expression level of firefly luciferase RNA (Figure 2). This indicates that the decrease in relative luminescence due to deletion of the EnhI or EnhII region is due to a change in RNA function due to the deletion of the region corresponding to EnhI or EnhII in the RNA sequence. In other words, it was revealed that the region corresponding to EnhI or EnhII on the HBV genomic DNA functions on RNA and regulates protein expression.

[0053] [Test Example 2] (In silico identification of RNA-binding proteins) Since the EnhI and EnhII regions function on RNA, we attempted to identify RNA-binding proteins that bind to these regions. The putative RNA-binding proteins were identified by inputting the EnhI region within the 3'UTR of the HBs antigen-encoding RNA (GenBank: AB246345, RNA sequence corresponding to the EnhI region consisting of base pairs 1060-1260, SEQ ID NO: 1) or the EnhII region within the 3'UTR of the HBs antigen-encoding RNA (GenBank: AB246345, RNA sequence corresponding to the EnhII region consisting of base pairs 1638-1771, SEQ ID NO: 2) into the public RNA-Binding Protein Database (RBPDB) and running a binding protein prediction program. RBPDB is a database that stores information on RNA-binding proteins and their binding sequences obtained from in vitro and in vivo experiments using humans, mice, flies, etc. By inputting the base sequence of an RNA, it is possible to extract RNA-binding proteins that are presumed to bind to RNA with that sequence (Nucleic Acids Res, Vol. 39, pp. D301-D308, 2011).

[0054] [Table 2]

[0055] It was expected that multiple RNA-binding proteins would bind to at least one region of the EnhI-equivalent and EnhII-equivalent regions on the RNA encoding the HBs antigen.

[0056] [Test Example 3] (Anti-HBV assay) Using HepG2.2.15 cells (Proc Natl Acad Sci USA, Vol. 84, pp. 1005-1009, 1987), which are hepatoblastoma cell lines HepG2 into which the HBV genome has been introduced to produce the virus continuously, the anti-HBV effects of inhibiting each molecule were evaluated using the following procedure. The following were used as the cell culture medium. DMEM / F-12, GlutaMAX (Invitrogen) + 5 μg / mL insulin (Wako) + 1% penicillin / streptomycin (Sigma) + 10 mmol / L HEPES (Sigma) + 50 μmol / L hydrocortisone (Sigma) + 10% FBS (Equitech-Bio)

[0057] (1) The following dsRNAs were used for transfection (manufactured by Dharmacon): SMARTpool:ON-TARGETplus RBFOX1 siRNA(L-013377-01), SMARTpool:ON-TARGETplus ELAVL1 siRNA(L-003773-00), SMARTpool:ON-TARGETplus ELAVL2 siRNA(L-019801-00), SMARTpool:ON-TARGETplus MBNL1 siRNA(L-014136-00), SMARTpool:ON-TARGETplus RBMX siRNA(L-011691-01), SMARTpool:ON-TARGETplus PUM2 siRNA(L-014031-02), SMARTpool:ON-TARGETplus YTHDC1 siRNA(L-015332-02), SMARTpool:ON-TARGETplus SRSF1 siRNA (L-018672-01), SMARTpool:ON-TARGETplus SRSF9 siRNA (L-019529-01), SMARTpool:ON-TARGETplus SRSF10 siRNA (L-007278-00), SMARTpool:ON-TARGETplus KHDRBS3 siRNA (L-012748-01), SMARTpool:ON-TARGETplus EIF4B siRNA (L-020179-00), and SMARTpool:ON-TARGETplus SNRPA siRNA (L-019435-02). In addition, the on-taRgeTplus Non-targeting Control Pool (Dharmacon) was used as a negative control dsRNA.

[0058] (2) Suspend HepG2.2.15 cells in the above medium and prepare 2 × 10 5 A cell / mL HepG2.2.15 cell suspension was prepared. dsRNA was diluted with Nuclease-Free Water (not DEPC-Treated) (ThermoFisher Scientific) to prepare dsRNA solutions ranging from 2.743 to 2000 nmol / L in a 3-fold dilution series. 1.5 μL of the prepared dsRNA solution and 0.3 μL of Lipofectamine RNAiMAX (ThermoFisher Scientific) were diluted in 8.2 μL of serum-free medium (ThermoFisher Scientific) and incubated at room temperature for 5 minutes. 10 μL of this dsRNA-Lipofectamine RNAiMAX mixture was diluted in 40 μL of cell culture medium to make 50 μL. This was mixed with 50 μL of the aforementioned HepG2.2.15 cell suspension, seeded into a 96-well microtiter plate, and incubated in a 5% CO2 incubator at 37°C for 3 days (final dsRNA concentration: 0.91-30 nmol / L, 3-fold dilution series). Next, the culture medium was changed with 100 μL / well of the aforementioned cell culture medium, and incubated for another 3 days in a 5% CO2 incubator at 37°C. The culture supernatant was then collected, and cell viability was measured using the CellTiter96 AQueous One Solution Cell Proliferation Assay (Promega). The amount of HBs antigen in the collected culture supernatant was measured using the AlphaLISA Hepatitis B Virus Surface Antigen (HBsAg) Kit (Perkin Elmer). Furthermore, the recovered culture supernatant was treated with a mixture of Buffer AL (Qiagen) and Proteinase K (ThermoFisher Scientific), and the HBV DNA in the resulting solution was quantified by real-time PCR. For each marker, the relative value (%) of each dsRNA-added well relative to each negative control dsRNA-added well was calculated (Figures 3 and 4).

[0059] Knockdown of RBFOX1, SRSF10, ELAVL1, and PUM2 reduced HBs antigen by up to 30%, while knockdown of SRSF9, SNRPA, YTHDC1, and SRSF1 reduced HBs antigen by up to 70-90% (Figure 3). Knockdown of PUM2 and SRSF1 reduced HBV DNA by up to 40-50%, and knockdown of YTHDC1 reduced HBV DNA by up to 80%. On the other hand, knockdown of these genes did not affect cell viability (Figure 4). These results demonstrate that inhibiting proteins that bind to the EnhI and EnhII equivalent regions on the RNA encoding HBs antigen can produce anti-HBV effects such as inhibiting HBV protein production and reducing HBV DNA expression.

[0060] [Test Example 4] (Assay using EnhI / EnhII region deletion constructs, genotype analysis) The PCR reaction was performed in a reaction mixture containing 1xPrimeSTAR Max DNA Polymerase (Takara) and 0.2 μmol / L primers. Using HBV genomic DNA (GenBank: AF462041.1; hereinafter also referred to as "genotype A") as a template, a 1086 bp region containing the 3'UTR sequence of the gene encoding the HBs antigen (hereinafter also referred to as "3'UTR (genotype A)") was subjected to PCR using a combination of primers consisting of the nucleotide sequence of SEQ ID NO: 13 and SEQ ID NO: 14, under conditions of 98°C for 10 seconds, 58°C for 5 seconds, and 72°C for 10 seconds repeated 35 times. This resulted in the introduction of amplified fragments into which the restriction enzyme sites of XbaI and SalI were introduced. These fragments were treated with a combination of XbaI (Takara) and SalI (Takara), and a plasmid was obtained by inserting these into the XbaI and SalI sites of the PreS2 / S-Luc-3'UTR (genotype C) prepared in Test Example 1 and ligating them together. Hereafter, this plasmid will also be referred to as "PreS2 / S-Luc-3'UTR (genotype A)". Using the PreS2 / S-Luc-3'UTR (genotype A) plasmid as a template, PCR was performed using primer combinations consisting of the nucleotide sequence of SEQ ID NO: 15 and the nucleotide sequence of SEQ ID NO: 10, and primer combinations consisting of the nucleotide sequence of SEQ ID NO: 7 and the nucleotide sequence of SEQ ID NO: 16, under the conditions of 98°C for 10 seconds, 58°C for 5 seconds, and 72°C for 30 seconds repeated 35 times, to obtain amplified fragments for creating a plasmid lacking the EnhI region. These fragments were ligated using the In-Fusion HD Cloning Kit (Takara Corporation) to obtain a plasmid lacking the EnhI region from the PreS2 / S-Luc-3'UTR (genotype A) plasmid. Hereafter, this plasmid will also be referred to as "PreS2 / S-Luc-3'UTR (genotype A)dEnhI".Using the PreS2 / S-Luc-3'UTR (genotype A) plasmid as a template, PCR was performed using primer combinations consisting of the nucleotide sequence of SEQ ID NO: 17 and the nucleotide sequence of SEQ ID NO: 10, and primer combinations consisting of the nucleotide sequence of SEQ ID NO: 7 and the nucleotide sequence of SEQ ID NO: 18, under the conditions of 98°C for 10 seconds, 58°C for 5 seconds, and 72°C for 30 seconds repeated 35 times, to obtain amplified fragments for creating a plasmid lacking the EnhII region. These fragments were ligated using the In-Fusion HD Cloning Kit (Takara Corporation) to obtain a plasmid lacking the EnhII region from the PreS2 / S-Luc-3'UTR (genotype A) plasmid. Hereafter, this plasmid will also be referred to as "PreS2 / S-Luc-3'UTR (genotype A)dEnhII".

[0061] [Table 3]

[0062] Using HBV genomic DNA (SEQ ID NO: 19, hereinafter also referred to as "genotype B") as a template, a 1095 bp region containing the 3'UTR sequence of the gene encoding the HBs antigen (hereinafter also referred to as "3'UTR (genotype B)") was subjected to PCR using a combination of primers consisting of the nucleotide sequence of SEQ ID NO: 20 and the nucleotide sequence of SEQ ID NO: 21, under the conditions of 98°C for 10 seconds, 58°C for 5 seconds, and 72°C for 10 seconds repeated 35 times, thereby obtaining an amplified fragment into which the restriction enzyme sites of XbaI and SalI were introduced. This fragment was treated with a combination of XbaI (Takara, Inc.) and SalI (Takara, Inc.), and a plasmid was obtained by inserting and ligating this into the XbaI and SalI sites of PreS2 / S-Luc-3'UTR (genotype C) prepared in Test Example 1. Hereinafter, this plasmid will also be referred to as "PreS2 / S-Luc-3'UTR (genotype B)". Using the PreS2 / S-Luc-3'UTR (genotype B) plasmid as a template, PCR was performed using primer combinations consisting of the nucleotide sequence of SEQ ID NO: 22 and SEQ ID NO: 10, and primer combinations consisting of the nucleotide sequence of SEQ ID NO: 7 and SEQ ID NO: 23, under the conditions of 98°C for 10 seconds, 58°C for 5 seconds, and 72°C for 30 seconds repeated 35 times, to obtain amplified fragments for creating a plasmid lacking the EnhI region. These fragments were ligated using the In-Fusion HD Cloning Kit (Takara Corporation) to obtain a plasmid lacking the EnhI region from the PreS2 / S-Luc-3'UTR (genotype B) plasmid. Hereafter, this plasmid will also be referred to as "PreS2 / S-Luc-3'UTR (genotype B)dEnhI". Using the PreS2 / S-Luc-3'UTR (genotype B) plasmid as a template, PCR was performed using primer combinations consisting of the nucleotide sequence of SEQ ID NO: 24 and the nucleotide sequence of SEQ ID NO: 10, and primer combinations consisting of the nucleotide sequence of SEQ ID NO: 7 and the nucleotide sequence of SEQ ID NO: 25, under conditions of 98°C for 10 seconds, 58°C for 5 seconds, and 72°C for 30 seconds repeated 35 times, to obtain amplified fragments for constructing plasmids lacking the EnhII region.These fragments were ligated using the In-Fusion HD Cloning Kit (Takara Corporation) to obtain a plasmid lacking the EnhII region in the PreS2 / S-Luc-3'UTR (genotype B) plasmid. Hereafter, this plasmid will also be referred to as "PreS2 / S-Luc-3'UTR (genotype B) dEnhII".

[0063] [Table 4]

[0064] [Table 5]

[0065] Using HBV genomic DNA (GenBank: U95551.1; hereinafter also referred to as "genotype D") as a template, a 1086 bp region containing the 3'UTR sequence of the gene encoding the HBs antigen (hereinafter also referred to as "3'UTR (genotype D)") was subjected to PCR using a combination of primers consisting of the nucleotide sequence of SEQ ID NO: 26 and SEQ ID NO: 27, under the conditions of 98°C for 10 seconds, 58°C for 5 seconds, and 72°C for 15 seconds repeated 35 times, thereby obtaining an amplified fragment into which the restriction enzyme sites of XbaI and SalI were introduced. This fragment was treated with a combination of XbaI (Takara) and SalI (Takara), and a plasmid was obtained by inserting and ligating this into the XbaI and SalI sites of the PreS2 / S-Luc-3'UTR (genotype C) prepared in Test Example 1. Hereinafter, this plasmid will also be referred to as "PreS2 / S-Luc-3'UTR (genotype D)". Using the PreS2 / S-Luc-3'UTR (genotype D) plasmid as a template, PCR was performed using primer combinations consisting of the nucleotide sequence of SEQ ID NO: 28 and the nucleotide sequence of SEQ ID NO: 10, and primer combinations consisting of the nucleotide sequence of SEQ ID NO: 7 and the nucleotide sequence of SEQ ID NO: 29, under the conditions of 98°C for 10 seconds, 58°C for 5 seconds, and 72°C for 30 seconds repeated 35 times, to obtain amplified fragments for creating a plasmid lacking the EnhI region. These fragments were ligated using the In-Fusion HD Cloning Kit (Takara Corporation) to obtain a plasmid lacking the EnhI region from the PreS2 / S-Luc-3'UTR (genotype D) plasmid. Hereafter, this plasmid will also be referred to as "PreS2 / S-Luc-3'UTR (genotype D)dEnhI". Using the PreS2 / S-Luc-3'UTR (genotype D) plasmid as a template, PCR was performed using primer combinations consisting of the nucleotide sequence of SEQ ID NO: 30 and the nucleotide sequence of SEQ ID NO: 10, and primer combinations consisting of the nucleotide sequence of SEQ ID NO: 7 and the nucleotide sequence of SEQ ID NO: 31, under conditions of 98°C for 10 seconds, 58°C for 5 seconds, and 72°C for 30 seconds repeated 35 times, to obtain amplified fragments for constructing plasmids lacking the EnhII region.These fragments were ligated using the In-Fusion HD Cloning Kit (Takara Corporation) to obtain a plasmid lacking the EnhII region in the PreS2 / S-Luc-3'UTR (genotype D) plasmid. Hereafter, this plasmid will also be referred to as "PreS2 / S-Luc-3'UTR (genotype D) dEnhII".

[0066] [Table 6]

[0067] A reporter assay was performed using HepG2.2.15 cells according to the following procedure. The following were used as the cell culture medium. DMEM / F-12, GlutaMAX (Thermo Fisher Scientific) + 5 μg / mL insulin (Fujifilm Wako Pure Chemical Industries) + 1% penicillin / streptomycin (Fujifilm Wako Pure Chemical Industries) + 10 mmol / L HEPES (Fujifilm Wako Pure Chemical Industries) + 50 μmol / L hydrocortisone (Fujifilm Wako Pure Chemical Industries) + 10% FBS (Equitech-Bio)

[0068] Suspend HepG2.2.15 cells in the above medium, 1 × 10⁶ cells per well. 4 Cells were seeded into 96-well microtiter plates at a cell / 100μL ratio and incubated overnight at 37°C in a 5% CO2 incubator. 64ng of various plasmids (PreS2 / S-Luc-3'UTR (genotype A), PreS2 / S-Luc-3'UTR (genotype A)dEnhI, PreS2 / S-Luc-3'UTR (genotype A)dEnhII, PreS2 / S-Luc-3'UTR (genotype B), PreS2 / S-Luc-3'UTR (genotype B)dEnhI, PreS2 / S-Luc-3'UTR (genotype B)dEnhII, PreS2 / S-Luc-3'UTR (genotype One of the following (C), PreS2 / S-Luc-3'UTR(genotype C)dEnhI, PreS2 / S-Luc-3'UTR(genotype C)dEnhII, PreS2 / S-Luc-3'UTR(genotype D), PreS2 / S-Luc-3'UTR(genotype D)dEnhI, or PreS2 / S-Luc-3'UTR(genotype D)dEnhII), along with 0.25 ng of pRL-SV40 plasmid (Promega) and 0.24 μL of TransIT-X2 Transfection Reagent (Mirus), was diluted in 7.8 μL of serum-free medium (ThermoFisher Scientific) and incubated at room temperature for 20 minutes. 8 μL of this plasmid-TransIT-X2 Transfection Reagent mixture was added to the wells seeded with the aforementioned HepG2.2.15 and incubated for a further day. Next, the culture medium was changed to 100 μL / well of the aforementioned cell culture medium, and the cells were incubated for a further 24 hours at 37°C in a 5% CO2 incubator. After incubation, luminescence from firefly luciferase and sea urchin luciferase was detected using a Dual-Luciferase Reporter Assay System (Promega). For each well, the amount of firefly luciferase luminescence was calculated, corrected for the amount of sea urchin luciferase luminescence.The results of calculating the relative values ​​(%) of the luminescence of firefly luciferase in wells containing the knockout plasmid for each genotype, relative to the luminescence of firefly luciferase in wells containing each plasmid (PreS2 / S-Luc-3'UTR (genotype A), PreS2 / S-Luc-3'UTR (genotype B), PreS2 / S-Luc-3'UTR (genotype C), and PreS2 / S-Luc-3'UTR (genotype D)), are shown in Figure 5.

[0069] Suspend HepG2.2.15 cells in the above medium, 1 × 10⁶ cells per well. 5 Cells were seeded into 24-well microtiter plates at a concentration of 500 μL per cell and incubated overnight at 37°C in a 5% CO2 incubator. 500 ng of various plasmids (PreS2 / S-Luc-3'UTR (genotype A), PreS2 / S-Luc-3'UTR (genotype A)dEnhI, PreS2 / S-Luc-3'UTR (genotype A)dEnhII, PreS2 / S-Luc-3'UTR (genotype B), PreS2 / S-Luc-3'UTR (genotype B)dEnhI, PreS2 / S-Luc-3'UTR (genotype B)dEnhII, PreS2 One of the following plasmids ( / S-Luc-3'UTR(genotype C), PreS2 / S-Luc-3'UTR(genotype C)dEnhI, PreS2 / S-Luc-3'UTR(genotype C)dEnhII, PreS2 / S-Luc-3'UTR(genotype D), PreS2 / S-Luc-3'UTR(genotype D)dEnhI, or PreS2 / S-Luc-3'UTR(genotype D)dEnhII) and 1.5 μL of TransIT-X2 Transfection Reagent (Mirus) were diluted in 50 μL of serum-free medium (ThermoFisher Scientific) and incubated at room temperature for 20 minutes. 52 μL of this plasmid-TransIT-X2 Transfection Reagent mixture was added to the wells seeded with the aforementioned HepG2.2.15 and incubated overnight. Next, the culture medium was changed to 500 μL / well of the aforementioned cell culture medium, and the cells were incubated for another day at 37°C in a 5% CO2 incubator. The culture supernatant was then discarded, the cells were washed with phosphate-buffered saline (1000 μL / well, Fujifilm Wako Pure Chemical Industries, Ltd.), and total RNA was extracted using the RNeasy Mini Kit (Qiagen). The extracted total RNA was reverse transcribed using the PrimeScript RT Reagent Kit with gDNA Eraser (Takara Corporation) to produce cDNA.The expression levels of firefly luciferase RNA were quantified based on the prepared cDNA, and the relative values ​​(%) of the luciferase RNA expression levels in the wells containing the deletion plasmids of each genotype compared to the expression levels of firefly luciferase RNA in the wells containing the PreS2 / S-Luc-3'UTR (genotype A), PreS2 / S-Luc-3'UTR (genotype B), PreS2 / S-Luc-3'UTR (genotype C), and PreS2 / S-Luc-3'UTR (genotype D) plasmids were calculated. The results are shown in Figure 5.

[0070] In genotype A, deletion of the EnhI or EnhII region resulted in an 87%–90% reduction in relative luminescence derived from the firefly luciferase protein (Figure 5). Conversely, deletion of the EnhI or EnhII region resulted in a 31–49% reduction in the relative expression level of firefly luciferase RNA. In genotype B, deletion of the EnhI or EnhII region resulted in a 65%–80% reduction in relative luminescence derived from the firefly luciferase protein. Conversely, deletion of the EnhI or EnhII region resulted in a 39–43% reduction in the relative expression level of firefly luciferase RNA. In genotype C, deletion of the EnhI or EnhII region resulted in a 74%–84% reduction in relative luminescence derived from the firefly luciferase protein. Conversely, deletion of the EnhI or EnhII region resulted in a 34–61% reduction in the relative expression level of firefly luciferase RNA. In genotype D, deletion of the EnhI or EnhII region resulted in an 86%–91% reduction in relative luminescence derived from the firefly luciferase protein. Conversely, deletion of the EnhI or EnhII region resulted in a 51–52% reduction in the relative expression level of firefly luciferase RNA. All of the above results demonstrate the contribution of the EnhI and EnhII regions to the process of RNA-to-protein translation. In other words, it has become clear that, in multiple HBV genotypes, the region corresponding to EnhI or EnhII on the HBV genomic DNA functions on RNA and regulates protein expression levels. [Industrial applicability]

[0071] The pharmaceutical composition of the present invention exhibits excellent anti-HBV activity and is useful as an anti-hepatitis B virus agent.

Claims

1. A pharmaceutical composition for inhibiting the production of hepatitis B virus protein, characterized by inhibiting the expression or function of an RNA-binding protein that binds to at least one sequence selected from a hepatitis B virus RNA sequence corresponding to the enhancer I region sequence on the hepatitis B virus genomic DNA and a hepatitis B virus RNA sequence corresponding to the enhancer II region sequence on the hepatitis B virus genomic DNA. The substance comprises a substance that inhibits the production of hepatitis B virus protein and a pharmaceutically acceptable carrier. The substance that inhibits the production of hepatitis B virus protein is an antisense nucleic acid or double-stranded RNA against a gene encoding at least one protein selected from RBFOX1, SRSF9, SRSF10, SNRPA, ELAVL1, PUM2, YTHDC1, and SRSF1. The hepatitis B virus RNA sequence corresponding to the enhancer I region sequence on the hepatitis B virus genomic DNA is a sequence that has 90% or more sequence identity with SEQ ID NO: 1, and the hepatitis B virus RNA sequence corresponding to the enhancer II region sequence on the hepatitis B virus genomic DNA is a sequence that has 90% or more sequence identity with SEQ ID NO:

2. The RNA-binding protein is at least one protein selected from RBFOX1, SRSF9, SRSF10, SNRPA, ELAVL1, PUM2, YTHDC1, and SRSF1. Pharmaceutical composition.

2. The pharmaceutical composition according to claim 1, wherein the hepatitis B virus protein is the HBs antigen protein.

3. Furthermore, the pharmaceutical composition according to claim 1 or 2, characterized by reducing the expression level of hepatitis B virus genomic DNA.

4. Furthermore, the pharmaceutical composition according to any one of claims 1 to 3, characterized by reducing the expression level of fully double-stranded DNA.

5. The pharmaceutical composition according to any one of claims 1 to 4, wherein the RNA-binding protein is at least one protein selected from SRSF9, SNRPA, YTHDC1, and SRSF1, and the substance that inhibits the production of hepatitis B virus protein is an antisense nucleic acid or double-stranded RNA against a gene encoding at least one protein selected from SRSF9, SNRPA, YTHDC1, and SRSF1.