Gene regulatory elements

Abstract

Disclosed is an expression-enhancing element comprising a 36-nucleotide DNA sequence that can be used to increase gene expression in plants, particularly to increase expression of endogenous plant genes. Also disclosed are plants, plant parts, and commercial plant products that contain the expression-enhancing element, along with related methods of using the expression-enhancing element and plants that contain the expression-enhancing element.

Description

Technical Field

[0001] Reference to Electronically Submitted Sequence Listing The sequence listing contained in the file named "10074WO1_ST25.txt" electronically submitted together with this application is hereby incorporated by reference in its entirety into this specification.

Background Art

[0002] Methods of using CRISPR, zinc finger nucleases, and transcription activator-like effector nuclease (TALEN) technologies for plant genome editing are disclosed in U.S. Patent Application Publication No. 20150082478, U.S. Patent Application Publication No. 2015 / 0059010A1, and Bortesi et al., 2015, Biotechnology Advances, pp. 41-52, Vol. 33, No. 1. Ellis et al., 1987, EMBO J. (6):11:3203-3208 discloses a 16-base pair bacterial octopine synthase gene enhancer element that was able to increase the expression of exogenous genes in maize and tobacco protoplasts in a transient expression assay. International Publication No. 2018 / 140899 pamphlet discloses the insertion of an expression enhancing element homologous to the bacterial octopine synthase gene enhancer element for increasing the expression of the maize Lc gene into the promoter region of the maize Lc gene in the maize protoplast genome. Sequences derived from plants that have the ability to reliably increase the transcription of plant genes have continued to be needed.

Prior Art Documents

Patent Documents

[0003]

Patent Document 1

Patent Document 2

Patent Document 3

[0004] [Non-Patent Document 1] Bortesi et al.,2015,Biotechnology Advances,pp.41-52,Vol.33,No.1 [Non-Patent Document 2] Ellis et al.,1987,EMBO J.(6):11:3203-3208 [Overview of the Initiative] [Means for solving the problem]

[0005] A DNA molecule containing the polynucleotide sequence of SEQ ID NO: 3 is provided. Also provided are biological samples, plant chromosomes, plant cells, tissue cultures of regenerative cells containing plant cells, plant parts, and plants containing the polynucleotide sequence of SEQ ID NO: 3. In certain aforementioned embodiments, the polynucleotide sequence of SEQ ID NO: 3 is operably ligated to a polynucleotide sequence containing a promoter, the promoter being optionally an endogenous promoter, and the endogenous promoter being optionally located on a plant chromosome. Also provided are uses of the aforementioned DNA molecule containing the polynucleotide sequence of Sequence ID No. 3 for (i) to increase the expression of one or more elements encoded by transcription units operably linked to a promoter in a plant; (ii) to confer useful traits to a plant containing the recombinant DNA molecule, which are optionally improved abiotic stress, structural, abiotic stress tolerance, photosynthesis, or resource splitting compared to a control plant lacking the recombinant DNA molecule; (iii) to obtain a plant or seeds therefrom that exhibiting the useful trait of (ii); or (iv) to grow a population of plants exhibiting the useful trait of (ii); optionally, the plant of (i), (ii), (iii), or (iv) is a maize, soybean, cotton, or canola plant; or optionally, the seeds of (iii) are a maize, soybean, cotton, or canola plant. A method for producing plant seeds is provided, comprising producing plant seeds by crossing a plant containing the aforementioned DNA molecule including the polynucleotide sequence of Sequence ID No. 3 with a second plant, and optionally harvesting the seeds. A method for producing plant seeds is provided, which includes producing plant seeds by self-pollinating a plant containing the aforementioned DNA molecule that includes the polynucleotide sequence of Sequence ID No. 3, and optionally harvesting the seeds.

[0006] A method is provided for producing a plant containing an additional desired trait, comprising introducing a trans gene, a targeted gene alteration, or a gene locus that confers the desired trait into a plant containing the aforementioned DNA molecule containing the polynucleotide sequence of Sequence ID No. 3.

[0007] A method for producing commercial plant products is provided, comprising processing a plant or seed containing the aforementioned DNA molecule including the polynucleotide sequence of Sequence ID No. 3, and recovering commercial plant products from the processed plant or seed.

[0008] A method is provided for producing plant material, comprising growing a plant having an expression-enhancing element containing Sequence ID No. 3 operably linked to a transcript-coding polynucleotide, wherein the expression of the transcript-coding polynucleotide in the plant is increased compared to a control plant lacking the expression-enhancing element.

[0009] A method for producing plant material is provided, comprising: (a) providing a plant having an expression-enhancing element comprising sequence number 3 operably linked to a transcript-coding polynucleotide, wherein the expression of the transcript-coding polynucleotide is increased in the plant compared to a control plant lacking the expression-enhancing element; and (b) growing the plant under conditions that enable the expression of the transcript-promoting polynucleotide.

[0010] A method is provided for identifying a biological sample containing polynucleotides that include modified plant genes, the method comprising the step of detecting the presence of SEQ ID NO: 3 in the biological sample.

[0011] A method for producing treated plant seeds is provided, comprising contacting seeds containing the aforementioned DNA molecule having the polynucleotide sequence of SEQ ID NO: 3 with a composition comprising a biological agent, an insecticide, or a fungicide.

[0012] A method is provided for increasing the expression of an RNA molecule in a plant, comprising expressing an RNA molecule encoded by a DNA molecule in a plant, wherein the DNA molecule encoding the RNA molecule is operably ligated to one or more DNA molecules comprising (i) an expression enhancement element including sequence number 3; (ii) a promoter; and optionally (iii) a DNA molecule encoding a 5' untranslated region (5'UTR), an intron, an exon, a 3'UTR, a polyadenylation site, or a combination thereof; and the RNA expression is increased compared to a control plant lacking the expression enhancement element. [Brief explanation of the drawing]

[0013] [Figure 1] This shows the insertion efficiency of a dimer (SEQ ID NO: 2), trimer (SEQ ID NO: 3), or tetramer (SEQ ID NO: 4) of the 12-nucleotide core element (SEQ ID NO: 1) inserted into the ZmGln1-3 promoter. [Figure 2] The effects of dimers (SEQ ID NO: 2), trimers (SEQ ID NO: 3), or tetramers (SEQ ID NO: 4) of the core element 12-nucleotide sequence (SEQ ID NO: 1) inserted into the ZmGln1-3 promoter on ZmGln1-3 expression are shown in comparison to the control. [Figure 3] The expression of Lc (first panel), Gln1-3 (middle panel), and Gln1-4 (right panel) in protoplasts with the insertion of the 36bp enhancer (SEQ ID NO: 3) in these promoters (black bars) is shown compared to expression in protoplasts without the 36bp enhancer (white bars). Each of the three biological replicas is shown separately. [Figure 4] This chart shows the relative expression of Gln1-3 (compared to ZmActin1) in T0 events with a 36bp enhancer insertion (SEQ ID NO: 3) in the Gln1-3 promoter (black bars), compared to expression in T0 events without enhancer insertion or in wild-type B104 control (white bars). [Figure 5]Expression of Gln1-3 in primary roots, mesocotyls, and roots of T1 individuals with a 36 bp enhancer (SEQ ID NO: 3) inserted into the Gln1-3 promoter, compared to siblings or wild type without enhancer insertion, is shown (relative to ZmAct1).

Mode for Carrying Out the Invention

[0014] As used herein, the phrase "allelic variant" refers to a polynucleotide or polypeptide sequence variant found in different strains, varieties, or isolates of a given organism.

[0015] The term "and / or" should be construed herein as a specific disclosure of each of the two designated features or components, with or without the other. Thus, the term "and / or" as used herein in phrases such as "A and / or B" is intended to include "A and B", "A or B", "A" (alone), and "B" (alone). Similarly, the term "and / or" as used in phrases such as "A, B, and / or C" is intended to include each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0016] As used herein, the phrase "biological sample" refers to either intact plant tissue or non-intact plant tissue (e.g., ground seeds or plant tissue, finely minced plant tissue, lyophilized tissue). This may also be an extract containing intact or non-intact seeds or plant tissue. Biological samples can include flowers, meals, flakes, syrups, oils, starches, and cereals that are produced such that they contain, in whole or in part, crop plant by-products. In certain embodiments, the biological sample is "non-renewable" (i.e., it cannot be regenerated into a plant or plant part).

[0017] As used herein, the terms "endogenous promoter", "endogenous gene", "endogenous plant transcription unit", etc. refer to a promoter, gene, or plant transcription unit in its native form that is in its natural position in an organism or in the genome of an organism.

[0018] The term "exogenous", when used herein with respect to a DNA molecule, nucleotide, or polynucleotide inserted into a plant genome, refers to any DNA molecule, nucleotide, or polynucleotide that is synthetic or that has been removed from its natural position and inserted into a new genomic position.

[0019] The term "isolated", as used herein, means that it has been removed from its natural environment.

[0020] As used herein, the terms "include", "includes", and "including" should be interpreted to mean that they have at least the characteristic(s) they are recited as having, without excluding any additional characteristic(s) not specified.

[0021] As used herein, the phrase "operatively linked" refers to an arrangement in which the components so described are in a relationship that permits them to function in their intended manner. For example, a promoter is operatively linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. In another non-limiting example, an "expression enhancing element" (e.g., a transcriptional enhancer element) is operatively linked to a promoter if the expression enhancing element increases the activity of the promoter (e.g., as measured by the accumulation of a transcript driven by the promoter or a protein encoded by the transcript).

[0022] As used herein, the terms “ortholog” or “ortholog” refer to genes or proteins encoded by such genes that originate from different species but have the same function (e.g., encoding an enzyme that catalyzes the same reaction, or encoding a transcription factor that controls the expression of a gene with a similar function). Orthologous genes typically encode proteins with some degree of sequence identity (e.g., at least 40%, 50%, 60%, 70%, 80%, 90%, or 95% sequence identity, conservation of sequence motifs, and / or conservation of structural features).

[0023] As used herein, the term “plant” includes the whole plant and any offspring, cells, tissues, or parts of a plant. The term “plant part” includes, for example, without limitation, seeds (including mature and immature seeds); plant cuttings; plant cells; plant cell cultures; or plant organs (e.g., pollen, embryos, flowers, fruits, shoots, leaves, roots, stems, and explants) of any one or more parts of a plant. Plant tissue or plant organ may be seeds, protoplasts, callus, or any other collection of plant cells organized into structural or functional units. Plant cells or tissue cultures may have the ability to regenerate plants having the physiological and morphological characteristics of the plant from which the cells or tissues were obtained, and to regenerate plants having substantially the same genotype as that plant. Regenerative cells in plant cells or tissue cultures may include embryos, protoplasts, meristematic cells, callus, pollen, leaves, anthers, roots, root tips, hairs, flowers, grains, ears, rachis, husks, or culms. In contrast, some plant cells lack the regenerative capacity to produce a plant and are referred to herein as “non-regenerative” plant cells.

[0024] The term "purified," as used herein, defines an isolate of a molecule or compound in a form substantially free of impurities that would normally be bound to the molecule or compound in nature or the natural environment, and means that its purity has been increased as a result of separation from other components of the original composition. The term "purified DNA molecule" is used herein to refer to a nucleic acid sequence that has been isolated from other compounds, including, but not limited to, polypeptides, lipids, and carbohydrates.

[0025] To the extent that any of the definitions provided herein conflict with any definition provided in any patent or non-patent document incorporated herein by reference, any patent or non-patent document cited herein, or any patent or non-patent document found in any other part thereof, the definitions provided herein shall be used herein.

[0026] An expression-enhancing DNA element that can be used to increase the expression of a transcript-coding polynucleotide in a plant containing the polynucleotide 5'-GTAAGCGCTTACGTAAGCGCTTACGTAAGCGCTTAC-3' (SEQ ID NO: 3) is disclosed. Also disclosed are plants, plant parts (e.g., seeds, leaves, roots, stems), and renewable or non-renewable plant cells containing SEQ ID NO: 3. A biological sample including seed meal containing the polynucleotide containing SEQ ID NO: 3 is also disclosed. Related methods for producing plant material including seeds, or plant commercial products containing SEQ ID NO: 3, using plants, plant parts, and plant cells containing SEQ ID NO: 3 are also disclosed.

[0027] The expression of endogenous plant genes can be increased by the insertion or formation of SEQ ID NO: 3 in the endogenous plant gene such that SEQ ID NO: 3 is operably ligated to the endogenous promoter of the plant gene. In certain embodiments, operable ligation to the endogenous promoter is achieved by the insertion or formation of one or more copies of SEQ ID NO: 3 in one or more of the endogenous promoter, 5' untranslated region (5'UTR), intron, and / or 3' untranslated region of the endogenous plant gene. Because SEQ ID NO: 3 contains a palindrom, the insertion or formation of the expression-enhancing element in the endogenous gene is orientation-independent. SEQ ID NO: 3 contains a core element 12-nucleotide palindromic repeat unit GTAAGCGCTTAC (SEQ ID NO: 1) in triples.

[0028] The 12-nucleotide core element nucleotide sequence of Sequence ID No. 1 is present at several locations in the corn genome. For example, it can be found at several chromosomal locations in the maize variety B73. According to the B73v4 version of the maize genome sequence (available at https: / / worldwideweb.com / maizegdb.org / genome / assembly / Zm-B73-REFERENCE-GRAMENE-4.0, hereafter referred to as the "B73v4 maize genome"), Sequence ID No. 1 is located at Chr3 coordinates 1,063,395..1,063,406 (intron of Zm00001d039287), Chr3 coordinates 12,253,969..12,253,980 (immediately downstream of Zm00001d039695), and Chr3 coordinates 12,265,615. It can be found at .12,265,626 (intron of Zm00001d039695), Chr3 coordinates 12,277,428..12,277,439 (intron of Zm00001d039695), Chr3 coordinates 147,698,750..147,698,761 (not within 2kb of the annotated gene model), Chr6, coordinates 107,132,183..107,132,194 (approximately 2kb downstream from Zm00001d036949), and Chr10, coordinates 53,761,662..53,761,673 (not within 2kb of the annotated gene model). Since sequence number 1 is a palindrome, it can also be found on the complementary strands of these coordinates.

[0029] The 12-nucleotide core element nucleotide sequence of Sequence ID No. 1 is also present at several locations in the soybean genome. For example, it can be found at several chromosomal locations in the soybean variety W82 (Williams 82). According to this version of the soybean genome sequence (available at the https: / / worldwideweb.internet.com / ncbi.nlm.nih.gov / genome entry "Glycine_max_v2.1", hereafter referred to as the "W82 soybean genome"), Sequence ID 1 can be found at chromosome 1 coordinates 44968347~44968358, chromosome 3 coordinates 3983755~398873766, chromosome 6 coordinates 26074553~26074564, and chromosome 19 coordinates 44574051~44574062, 44575338~44575349 (overlapping with the GLYMA_19G187100 gene), and 44581677~44581688. Since Sequence ID 1 is a palindrome, it can also be found on the complementary strand of these coordinates.

[0030] In certain embodiments, a polynucleotide, plant gene, or plant containing SEQ ID NO: 3 may further contain at least one, two, three, or more additional copies of SEQ ID NO: 1. The endogenous plant gene targeted for insertion or formation of SEQ ID NO: 3 may include a promoter that is recognized by RNA polymerase II and operably ligated to a transcription unit. In certain embodiments, such a transcription unit may include transcription unit elements including a 5' untranslated region (5'UTR), introns, exons, microRNA coding regions, microRNA precursor coding regions, 3'UTR, polyadenylation sites, or combinations thereof. In certain embodiments, the polynucleotide sequence of SEQ ID NO: 3 may include Transcription unit Transcription initiation site (TSS) )( That is, it is inserted or formed at approximately 10, 20, 30, or 40 base pairs (bp) to approximately 100, 240, 300, 400, 500, 1000, 2000, 3000, or 5000 bp from the 5' cap site of the transcript produced by the transcription unit. In a particular embodiment, the polynucleotide sequence of SEQ ID NO: 3 is, Transcription unitTranscription initiation site (TSS) )mosquito The insertion or formation of SEQ ID NO: 3 occurs at approximately 40 base pairs (bp) to approximately 100, 240, 300, or 400 bp. The insertion or formation of SEQ ID NO: 3 can occur either on the 5' side (i.e., upstream) or 3' side (i.e., downstream) of the TSS of the transcription unit. When the polynucleotide sequence of SEQ ID NO: 3 is inserted or formed on the 5' side of the TSS, the polynucleotide sequence of SEQ ID NO: 3 is located in a non-transcription region of the endogenous promoter upstream of the TSS. In certain embodiments, the insertion or formation of SEQ ID NO: 3 occurs in the promoter of the endogenous gene (e.g., approximately 40 base pairs (bp) to approximately 100, 240, 300, or 400 bp 5' side (i.e., upstream) from the TSS). The expression of a transgene integrated into a plant genome can also be increased by the insertion or formation of SEQ ID NO: 3 in a transgene such that SEQ ID NO: 3 is operably ligated to a promoter operably ligated to the transgene. In a particular embodiment, the insertion or formation of the sequence number 3 occurs approximately 50 bp to 280 bp from the 5' side of the TSS, approximately 50 bp to 240 bp from the 5' side of the TSS, approximately 50 bp to 200 bp from the 5' side of the TSS, approximately 50 bp to 180 bp from the 5' side of the TSS, and approximately 50 bp to 160 bp from the 5' side of the TSS. 、T The insertion or formation of the signal path 3 occurs at the promoter of an endogenous gene located approximately 50 bp to 140 bp 5' from SS, approximately 50 bp to 120 bp 5' from TSS, approximately 50 bp to 100 bp 5' from TSS, approximately 50 bp to 80 bp 5' from TSS, approximately 50 bp to 70 bp 5' from TSS, or approximately 50 bp to 60 bp 5' from TSS. In a particular embodiment, the insertion or formation of the signal path 3 occurs approximately 40 bp to 280 bp 5' from TSS, approximately 40 bp to 240 bp 5' from TSS, approximately 40 bp to 200 bp 5' from TSS, approximately 40 bp to 180 bp 5' from TSS, or approximately 40 bp to 160 bp 5' from TSS. 、TThe insertion or formation of the sequence number 3 occurs at the promoter of an endogenous gene located approximately 40 bp to 140 bp 5' from SS, approximately 40 bp to 120 bp 5' from TSS, approximately 40 bp to 100 bp 5' from TSS, approximately 40 bp to 80 bp 5' from TSS, approximately 40 bp to 70 bp 5' from TSS, or approximately 40 bp to 60 bp 5' from TSS. In a particular embodiment, the insertion or formation of sequence number 3 occurs approximately 35 bp to 280 bp 5' from TSS, approximately 35 bp to 240 bp 5' from TSS, approximately 35 bp to 200 bp 5' from TSS, approximately 35 bp to 180 bp 5' from TSS, or approximately 35 bp to 160 bp 5' from TSS. 、T The expression of the trans gene is located at the promoter of the endogenous gene approximately 35 bp to 140 bp 5' from SS, approximately 35 bp to 120 bp 5' from TSS, approximately 35 bp to 100 bp 5' from TSS, approximately 35 bp to 80 bp 5' from TSS, approximately 35 bp to 70 bp 5' from TSS, or approximately 35 bp to 60 bp 5' from TSS. Trans gene expression can also be increased by in vitro insertion or formation of SEQ ID NO: 3 in the trans gene such that SEQ ID NO: 3 is operably ligated to a promoter operably ligated to the trans gene, and then by introduction of the trans gene into the plant genome (e.g., by Agrobacterium-mediated transformation or gene gun).

[0031] The expression of a transcript-coding polynucleotide operably linked to an enhancement element containing Sequence ID No. 3 may be increased compared to a control plant containing the transcript-coding polynucleotide but lacking the enhancement element. Such an increase in expression mediated by Sequence ID No. 3 can be measured by various methods. In certain embodiments, the traits conferred by the increased expression of the transcript-coding polynucleotide are measured in plants containing Sequence ID No. 3 and compared to a control plant lacking Sequence ID No. 3. Examples of such traits that can be measured and compared in this way include improvements in abiotic stress, biotic stress, structure, photosynthesis, or resource splitting. Such improvements in traits can be evaluated by comparing any measure of the trait itself in plants containing Sequence ID No. 3 (e.g., water use efficiency, disease resistance, height reduction, improved photosynthesis, or nitrogen use efficiency) or a surrogate indicator of the trait (e.g., seed and / or other biomass yield in kg / hectare) and compared to a control plant lacking Sequence ID No. 3. In certain embodiments, the increased expression of the encoded transcript itself is directly measured and compared by determining the amount of the transcript (e.g., mRNA or non-coding RNA) in plants containing SEQ ID NO: 3, thereby determining the amount of the transcript-coding polynucleotide in control plants lacking SEQ ID NO: 3. The amount of the transcript can be determined by a variety of techniques, including PCR (e.g., quantitative reverse transcriptase PCR; qRT-PCR), hybridization, CRISPR-based, and / or sequencing-based techniques (Khodakov et al., doi.org / 10.1016 / j.addr.2016.04.005; Gootenberg, et al. doi:10.1126 / science.aaq0179). In certain embodiments, the expression of the transcript-coding polynucleotide is also Sequence ID 3The amount of protein encoded by the transcript in plants containing the sequence number 3 may be determined by measuring the amount of protein encoded by the transcript and comparing it to the amount of protein in a control plant lacking Sequence ID 3. The amount of protein can be determined by a variety of techniques, including enzyme assays (e.g., if the protein is an enzyme), immuno-based, and mass spectrometry-based techniques (Chen et al. doi:10.1186 / s12967-015-0537-6; Bruce et al. doi:10.1002 / 0471250953.bi1321s41). The magnitude of the increase in transcript production may depend on the baseline expression level of the unmodified endogenous transcript-coding polynucleotide in each cell or tissue. As a non-limiting example, the magnitude of the increase in expression of an endogenous gene modified by the insertion or formation of Sequence ID 3, compared to the baseline expression level of an unmodified endogenous gene, will be greatest at lower baseline expression levels. In certain embodiments, the expression of an endogenous gene modified by insertion or formation of SEQ ID NO: 3 may increase by at least 1.2 times, 1.5 times, 2 times, 3 times, 4 times, or 5 times compared to the baseline expression level of the unmodified endogenous gene. In certain embodiments, the expression of an endogenous gene modified by insertion or formation of SEQ ID NO: 3 may increase by at least about 1.2 times or 1.5 times to about 2 times, 3 times, 4 times, 5 times, 6 times, or more compared to the baseline expression level of the unmodified endogenous gene.

[0032] In certain embodiments, it may be desirable to introduce or form Sequence ID No. 3 in a plant genome using genome editing molecules. Useful gene editing molecules in the methods provided herein include molecules capable of introducing double-strand breaks ("DSBs") or single-strand breaks ("SSBs") at specific sites or sequences within double-stranded DNA, such as within genomic DNA or within target genes located within the range of genomic DNA, as well as accompanying guide RNA or donor or other DNA template polynucleotides. Examples of such gene editing molecules include (a) RNA-inducible nucleases, RNA-inducible DNA endonucleases or RNA-directed DNA endonucleases (RdDe), Class 1 CRISPR-type nuclease systems, type II Cas nucleases, Cas9, nCas9 nickase, type V Cas nucleases, Cas12a nucleases, nCas12a nickase, Cas12d (CasY), Cas12e (CasX), Cas12b (C2c1), Cas12c (C2c3), Cas12i, Cas12j, Cas14, engineered nucleases, codon-optimized nucleases, zinc finger nucleases (ZFNs) or nickases, transcription activator-like effector nucleases (TAL-effector nucleases or TALENs) or nickases (TALE-nickases), algonauts, and nucleases including meganucleases or engineered meganucleases. (b) a rease; a polynucleotide encoding one or more nucleases capable of causing site-specific alterations of a target nucleotide sequence (including the introduction of DSBs or SSBs); a guide RNA (gRNA) for use with an RNA-induced nuclease, or DNA encoding a gRNA for use with an RNA-induced nuclease; a donor DNA template polynucleotide suitable for insertion by homologous recombination repair (HDR) or microhomology-mediated end joining (MMEJ) at cleavage sites in genomic DNA; and (e) other DNA templates suitable for insertion by non-homologous end joining (NHEJ) at cleavage sites in genomic DNA (e.g., dsDNA, ssDNA, or a combination thereof).

[0033] CRISPR technology for editing eukaryotic genes is disclosed in U.S. Patent Publication Nos. 2016 / 0138008A1 and 2015 / 0344912A1, as well as U.S. Patent Nos. 8,697,359, 8,771,945, 8,945,839, 8,999,641, 8,993,233, 8,895,308, 8,865,406, 8,889,418, 8,871,445, 8,889,356, 8,932,814, 8,795,965, and 8,906,616. The Cpf1 endonuclease, along with its corresponding guide RNA and PAM site, is disclosed in U.S. Patent Application Publication 2016 / 0208243 A1. The CRISPR guide RNA and the plant RNA promoter for the expression of the plant codon-optimized CRISPR Cas9 endonuclease are disclosed in PCT / US2015 / 018104 (published as International Publication 2015 / 131101 and claiming priority to U.S. Provisional Patent Application 61 / 945,700). Methods for using CRISPR technology for genome editing in plants are disclosed in U.S. Patent Application Publications 2015 / 0082478A1, 2015 / 0059010A1, and PCT / US2015 / 038767 A1 (claiming priority to U.S. Provisional Patent Application 62 / 023,246, published as International Publication Brochure 2016 / 007347). In certain embodiments, RNA-inducible endonucleases that leave blunt ends after cleaving the target site are used. Examples of RNA-inducible endonucleases that cleave at blunt ends include Cas9, Cas12c, Cas12i, and Cas12h (Yan et al., 2019). In certain embodiments, after cleaving the target site RegardingRNA-inducible endonucleases that leave attached end overhangs in single-stranded DNA are used. Examples of RNA-inducible endonucleases that cleave at the attached end include Cas12a, Cas12b, and Cas12e. All patent references in this paragraph are incorporated herein by reference in their entirety.

[0034] CRISPR genome editing can be applied in several ways to the plant cells and methods provided herein. Gene editing molecules comprising CRISPR elements, for example, CRISPR endonucleases and CRISPR guide RNAs, which include a single guide RNA or a guide RNA in combination with tracrRNA or scoutRNA, or polynucleotides encoding them, are useful for achieving genome editing in which no CRISPR element residues or selective genetic markers appear in offspring. In certain embodiments, CRISPR elements are provided directly in eukaryotic cells (e.g., plant cells), systems, methods, and compositions as isolated molecules, as isolated or semi-purified products of cell-free synthesis processes (e.g., in vitro translation), or as isolated or semi-purified products of cell-based synthesis processes (e.g., in bacterial or other cell lysates). In certain embodiments, the plants or plant cells used in the systems, methods, and compositions provided herein may include transgenes expressing CRISPR endonucleases (e.g., Cas9, Cpf1 type, or other CRISPR endonucleases). In certain embodiments, one or more CRISPR endonucleases having unique PAM recognition sites can be used. Guide RNAs (sgRNA or crRNA and tracrRNA) for forming an RNA-inducible endonuclease / guide RNA complex capable of specifically binding to a sequence in a gDNA target site adjacent to a protospacer-adjacent motif (PAM) sequence. Typically, the type of RNA-inducible endonuclease provides information about the location of a suitable PAM site and the design of the crRNA or sgRNA. G-rich PAM sites, e.g., 5'-NGG, are typically targets for the design of crRNA or sgRNAs used with the Cas9 protein.Examples of PAM sequences include 5'-NGG (Streptococcus pyogenes), 5'-NNAGAA (Streptococcus thermophilus CRISPR1), 5'-NGGNG (Streptococcus thermophilus CRISPR3), 5'-NNGRRT or 5'-NNGRR (Staphylococcus aureus Cas9, SaCas9), and 5'-NNNGATT (Neisseria meningitidis). T-rich PAM sites (e.g., 5'-TTN or 5'-TTTV, where "V" is A, C, or G) are typically targets for the design of crRNA or sgRNA used with the Cas12a protein. In some cases, Cas12a can also recognize the 5'-CTA PAM motif. Other examples of possible Cas12a PAM sequences include TTN, CTN, TCN, CCN, TTTN, TCTN, TTCN, CTTN, ATTN, TCCN, TTGN, GTTN, CCCN, CCTN, TTAN, TCGN, CTCN, ACTN, GCTN, TCAN, GCCN, and CCGN (wherein N is defined as any nucleotide). The Cpf1 endonuclease and the corresponding guide RNA and PAM site are disclosed in U.S. Patent Application Publication 2016 / 0208243 A1 (which is incorporated herein by reference for its disclosure of the DNA encoding the Cpf1 endonuclease and the guide RNA and PAM site).

[0035] In certain embodiments, zinc finger nucleases or zinc finger niccases can also be used in the methods provided herein. A zinc finger nuclease is a site-specific endonuclease comprising two protein domains: a DNA-binding domain comprising multiple individual zinc finger repeats, each of which recognizes 9 to 18 base pairs, and a DNA-cleaving domain comprising a nuclease domain (typically Fokl). The cleaving domain dimerizes to cleave DNA; therefore, a pair of ZFNs is required to target non-palindromic target polynucleotides. In certain embodiments, the zinc finger nuclease and zinc finger nickase design methods described herein (Urnov et al. (2010) Nature Rev. Genet., 11:636-646; Mohanta et al. (2017) Genes vol. 8, 12:399; Ramirez et al. Nucleic Acids Res. (2012); 40(12):5560-5568; Liu et al. (2013) Nature Communications, 4:2565) can be applied to use in the methods described herein. The zinc finger binding domain of a zinc finger nuclease or nickase provides specificity and can be engineered to specifically recognize any desired target DNA sequence. The zinc finger DNA binding domain is derived from the DNA binding domain of a large class of eukaryotic transcription factors called zinc finger proteins (ZFPs). The DNA-binding domain of a ZFP typically has a tandem array of at least three zinc "fingers," each recognizing a specific DNA triplet. Several strategies can be used to design the binding specificity of the zinc finger-binding domain. One approach, called "modular assembly," relies on the functional autonomy of individual zinc fingers associated with DNA. This approach targets a given sequence by identifying zinc fingers for each component triplet in the sequence and ligating them into a multi-finger peptide.Several alternative strategies have also been developed for designing zinc finger DNA-binding domains. These methods are designed to adapt to the ability of zinc fingers to contact neighboring fingers and nucleotide bases outside their target triplets. Typically, engineered zinc finger DNA-binding domains exhibit novel binding specificity compared to naturally occurring zinc finger proteins. Engineering methods include, for example, rational design and various selections. Rational design involves, for example, the use of databases of triplet (or quadruplet) nucleotide sequences and individual zinc finger amino acid sequences, where each triplet or quadruplet nucleotide sequence is associated with one or more amino acid sequences of zinc fingers that bind to a particular triplet or quadruplet sequence. See, for example, U.S. Patent Nos. 6,453,242 and 6,534,261 (both incorporated herein by reference in whole). Exemplary selection methods (e.g., phage display and yeast 2 hybrid systems) can be applied to the methods described herein. In addition, enhancement of the binding specificity of the zinc finger binding domain is described in U.S. Patent No. 6,794,136 (in whole, incorporated herein by reference). Furthermore, individual zinc finger domains may be linked together using any suitable linker sequence. Examples of linker sequences are publicly known; see, for example, U.S. Patents No. 6,479,626; No. 6,903,185; and No. 7,153,949 (in whole, incorporated herein by reference). The nucleic acid cleavage domain is nonspecific and is typically a restriction endonuclease such as Fokl. This endonuclease must dimerize to cleave DNA. Therefore, cleavage by Fokl as part of a ZFN requires two adjacent, independent binding events, which must occur both in the correct orientation and at an appropriate interval to allow for dimerization. The requirement of two DNA binding events makes it possible to target long, potentially unique recognition sites with higher specificity.Enhanced Fokl mutants have been described and can be applied to the methods described herein; see, for example, Guo et al. (2010) J.Mol.Biol., 400:96-107.

[0036] Transcriptional activator-like effectors (TALEs) are proteins secreted by certain Xanthomonas species to regulate gene expression in host plants and promote bacterial colonization and survival. TALEs act as transcription factors, regulating the expression of resistance genes in plants. Recent studies of TALEs have revealed the coding that links their repeating regions to their target DNA binding sites. TALEs contain highly conserved repeating regions consisting of tandem repeats of segments, most often 33 or 34 amino acids long. These monomeric repeats differ primarily at amino acid positions 12 and 13. A strong correlation has been found between the unique amino acid pairs at positions 12 and 13 and the corresponding nucleotides at the TALE binding site. Because the relationship between the amino acid sequence and the DNA recognition of the TALE-binding domain is simple, it is possible to design DNA-binding domains with any desired specificity. TALEs can be linked to nonspecific DNA cleavage domains to prepare genome editing proteins called TAL-effector nucleases or TALENs. As in the case of ZFN, restrictive endonucleases such as Fokl can be conveniently used. The use of TALENs in plants is described and can be applied to the methods described herein; see Mahfouz et al. (2011) Proc. Natl. Acad. Sci. USA, 108:2623-2628; Mahfouz (2011) GM Crops, 2:99-103; and Mohanta et al. (2017) Genes vol. 8, 12:399). TALEN nickases are also described and can be applied to the methods described herein (Wu et al.; Biochem Biophys Res Commun. (2014); 446(1):261-6; Luo et al; Scientific Reports 6, Article number: 20657 (2016)).

[0037] In certain embodiments in which Sequence ID No. 3 is inserted into the genome at a double-strand break site in a plant genome introduced by one or more nucleases or nickases (e.g., a site-specific endonuclease or nickase, aZF nuclease or nickase, and / or a CRISPR / guide RNA complex including a TALE nuclease or nickase), the donor DNA template or other DNA template contains Sequence ID No. 3. In certain embodiments in which Sequence ID No. 3 is formed in the genome at a double-strand break site in a plant genome introduced by a nuclease, the donor DNA template or other DNA template may contain less than a complete 36-nucleotide or base-pair sequence of Sequence ID No. 3, and the genomic DNA of the integration site may contribute nucleotides or base pairs of Sequence ID No. 3 that are not present in the donor DNA template or other DNA template. In certain embodiments in which Sequence ID No. 3 is formed on genomic DNA, the donor DNA template or other DNA template may contain 24 to 35 consecutive nucleotides or base pairs of Sequence ID No. 3, and the genomic DNA at the integration site may contribute 1 to 12 nucleotides or base pairs of the Sequence ID No. 3 sequence that are missing from the donor DNA template or other DNA template, and the complete 36 base pair sequence of Sequence ID No. 3 is formed at the integration site in the genome. The donor DNA template molecule used in the method provided herein comprises a DNA molecule having a first homology arm, substitution DNA, and a second homology arm from 5' to 3', wherein the homology arms have sequences that are partially or completely homologous to the genomic DNA (gDNA) sequence adjacent to the target site-specific endonuclease cleavage site in the gDNA. In certain embodiments, the substitution DNA may include one or more DNA base pair insertions, deletions, or substitutions compared to the target gDNA. In one embodiment, the donor DNA template molecule is double-stranded and is fully base-paired over all or most of its length, except that there may be some unpaired nucleotides at one or both ends. In another embodiment, the donor DNA template molecule is double-stranded and contains one or more unterminal mismatches or unterminal unpaired nucleotides within the range of the double helix, which is inherently double-stranded.In one embodiment, a donor DNA template molecule to be incorporated into at least one double-strand break (DSB) site contains 2 to 20 nucleotides on one strand (in the case of single-stranded DNA) or both strands (in the case of double-stranded DNA), for example, containing 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides on one or both strands, each of which can base-pair with a nucleotide on the reverse strand of the target integration site (in the case of a fully base-paired double-stranded polynucleotide molecule). Such a donor DNA template can be incorporated into genomic DNA having blunt-end and / or adheret-end double-strand DNA breaks by homologous recombination repair (HDR) or microhomology-mediated end joining (MMEJ). In certain embodiments, the donor DNA template homology arm may be about 20, 50, 100, 200, 400, or 600 to about 800, or 1000 base pairs long. In certain embodiments, the donor DNA template molecule may be delivered to plant cells as a circular (e.g., viral vector including plasmids or geminiviral vectors) or linear DNA molecule. In certain embodiments, the circular or linear DNA molecule used may include a modified donor DNA template molecule comprising, from 5' to 3', a first copy of the target sequence-specific endonuclease cleavage site sequence, a first homology arm, substitution DNA, a second homology arm, and a second copy of the target sequence-specific endonuclease cleavage site sequence. In other embodiments, a DNA template suitable for NHEJ insertion would lack homology arms that are partially or completely homologous to the genomic DNA (gDNA) sequence adjacent to the target site-specific endonuclease cleavage site in the gDNA. In certain embodiments, a DNA template containing all sequence numbers 3 (e.g., dsDNA, ssDNA, or a combination thereof) may be inserted into a double-strand break in the gDNA by non-homologous end joining (NHEJ).In certain embodiments, a DNA template (e.g., dsDNA, ssDNA, or a combination thereof) containing a complete set of 36 nucleotides or less than a base pair of sequence ID 3 may be inserted into a double-strand break in the gDNA by non-homologous end joining (NHEJ), the gDNA at the insertion site may contribute nucleotides or base pairs of ID 3 that are not present in the DNA template, and ID 3 may be formed at the double-strand break site in the gDNA.

[0038] In some embodiments, the enhancer of SEQ ID NO: 3 replaces or largely replaces a corresponding sequence in a plant gene, such as a promoter. Accordingly, because this is by replacement rather than insertion, the positional relationships of other elements remain unchanged. The replacement target site may be selected based on its similarity to SEQ ID NO: 3. The replacement template may be used in an HDR process, and / or DNA-based editing and / or genome editing may be used to create the desired replacement region corresponding to SEQ ID NO: 3. Base editing factors include, for example, site-directed base editing mediated by C*G→T·A or A·T→G*C base editing deaminase enzymes (Gaudelli et al., "Programmable base editing of A·T to G*C in genomic DNA without DNA cleavage." Nature (2017); Nishida et al., "Targeted nucleotide editing using hybrid prokaryotic and vertebrate adaptive immune systems." Science 353(6305)(2016); Komor et al., "Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage." Nature). 533(7603)(2016):420-4. When catalytically dead dCas9 is fused with cytidine deaminase or adenine deaminase protein, it becomes a specific base-editing factor that can modify DNA bases without inducing DNA cleavage. The base-editing factor converts C→T (or G→A on the reverse strand) (or, in the case of an adenine base-editing factor, can convert adenine to inosine), resulting in an A→G change within the editing window specified by the gRNA.

[0039] Various processes can be used to deliver gene editing molecules and / or other molecules to plant cells. In certain embodiments, one or more processes are used to deliver gene editing or other molecules (e.g., polynucleotides, polypeptides, or combinations thereof) to eukaryotic cells or plant cells, for example, through barriers such as the cell wall, cell membrane, nuclear membrane, and / or other lipid bilayers. In certain embodiments, polynucleotide-containing, polypeptide-containing, or RNP (ribonucleoprotein)-containing compositions containing these molecules are delivered directly, for example, by direct contact of the composition with plant cells. The aforementioned compositions may be provided in the form of liquids, solutions, suspensions, emulsions, reverse emulsions, colloids, dispersions, gels, liposomes, micelles, injection materials, aerosols, solids, powders, particulate matter, nanoparticles, or combinations thereof, and can be directly applied to plants, plant parts, plant cells, or plant explants (for example, by microinjection, by abrasion, puncture, or other disruption of the cell wall or cell membrane, by spraying, immersion, or other direct contact). For example, immersion of plant cells or plant protoplasts in a liquid genome editing molecule-containing composition delivers the drug to the plant cells. In certain embodiments, the drug-containing composition is delivered using negative or positive pressure, for example, by depressurization infiltration or the application of hydrodynamic or fluid pressure. In certain embodiments, the drug-containing composition is introduced into plant cells or plant protoplasts, for example, by microinjection, or by physical treatment such as the application of negative or positive pressure or shear force, or by treatment with chemical or physical delivery agents such as surfactants, liposomes, or nanoparticles, which disrupt or deform the cell wall or cell membrane; see, for example, the delivery of material to cells using microfluidic flow by cell deformation and contraction, as described in U.S. Patent Application Publication No. 2014 / 0287509 (in whole, incorporated herein by reference).Other techniques useful for delivering drug-containing compositions to eukaryotic cells, plant cells, or plant protoplasts include ultrasonic or sound wave treatment; vibration, friction, shear stress, vortex, cavitation; application of centrifugation or mechanical force; mechanical deformation or damage to cell walls or cell membranes; enzymatic damage or permeabilization of cell walls or cell membranes; abrasion or mechanical scratching (e.g., abrasion with carborundum or other particulate abrasives or scratching with files or sandpaper) or chemical scratching (e.g., treatment with acids or corrosive agents); and electroporation. In certain embodiments, the drug-containing composition is mediated by bacteria (e.g., Agrobacterium sp., Rhizobium sp., Sinorhizobium sp., Mesorhizobium sp., Bradyrhizobium sp., Azo). to Bacter species (Azo to This is provided by transfection of plant cells or plant protoplasts with polynucleotides encoding genome editing molecules (e.g., RNA-dependent DNA endonucleases, RNA-dependent DNA-binding proteins, RNA-dependent nickases, ABEs, or CBEs, and / or guide RNAs) by bacterium sp., Phyllobacterium sp., etc. (see, e.g., Broothaerts et al. (2005) Nature, 433:629-633). Alternatively, one or a combination of these techniques may be used on plant explants, plant parts or tissues, or intact plants (or seeds) from which plant cells are optionally obtained or isolated; in certain embodiments, the drug-containing composition is delivered in a separate step after the plant cells have been isolated.

[0040] Techniques for achieving genome editing in crop plants (e.g., maize) include the use of morphogenetic factors such as Wuschel (WUS), ovule development protein (ODP), and / or Babyboom (BBM), which can improve the efficiency of recovering plants with the desired genome edit. In some embodiments, the morphogenetic factors include WUS1, WUS2, WUS3, WOX2A, WOX4, WOX5, WOX9, BBM2, BMN2, BMN3, and / or ODP2. In specific embodiments, compositions and methods for using WUS, BBM, and / or ODP, as well as other techniques that can be applied to achieve genome editing in plants and other germplasm, are described in U.S. Patent Publication No. 20030082813, U.S. Patent Publication No. 20080134353, U.S. Patent Publication No. 20090328252, U.S. Patent Publication No. 20100100981, U.S. Patent Publication No. 20110165679, U.S. Patent Publication No. 20140157453, U.S. Patent Publication No. 20140173775, and U.S. Patent Publication No. 20170240911 (each of which is incorporated by reference as a whole). In certain embodiments, genome editing can be achieved by transiently providing a gene editing molecule or a polynucleotide encoding it in a regenerative plant part of a crop plant (e.g., a plant embryo), without necessarily incorporating a selectable marker gene into the plant genome (e.g., U.S. Patent Application Publication No. 20160208271 and U.S. Patent Application Publication No. 20180273960, both of which are incorporated herein by reference in their entirety; Svitashev et al. Nat Commun. 2016;7:13274).

[0041] Expression-enhancing elements, including Sequence ID No. 3, compared to control plants lacking the targeted genetic alteration, result in improved yield, improved food and / or feed properties (e.g., improved quality or quantity of oils, starches, proteins, or amino acids), improved nitrogen utilization efficiency (e.g., glutamine synthetase gene), improved biofuel applicability (e.g., increased ethanol production), delayed flowering, non-flowering, increased resistance to biological stress (e.g., resistance to insect, nematode, bacterial, or fungal damage), and increased resistance to abiotic stress (e.g., drought, cold). Polynucleotides containing Sequence ID No. 3 can be operably ligated to exogenous (i.e., trans-encoded) or endogenous transcript-coding genes that confer traits such as increased resistance to heat, metal, or salt, enhanced lodging resistance, increased growth rate, increased biomass, increased tillering, increased branching, delayed flowering, delayed senescence, increased flower count, improved high-density planting composition, improved photosynthesis, increased root mass, increased cell count, improved viability, improved seedling size, increased cell division rate, improved metabolic efficiency, and / or increased meristematic size. A polynucleotide containing Sequence ID No. 3 can be operably ligated to an endogenous plant gene by inserting a polynucleotide into the plant genome that causes the insertion or formation of Sequence ID No. 3 in the endogenous plant gene. Suitable sites in endogenous plant genes for the insertion or formation of Sequence ID No. 3 include promoters, coding regions, and non-coding regions (e.g., 5'UTR, introns, and 3'UTR). Suitable target plants for insertion or formation of Sequence ID No. 3 include plants and plant cells of any target species, including dicotyledons and monocotyledons. Target plants include row crop plants, fruit-producing plants and trees, vegetables, trees and ornamental plants including ornamental flowers, shrubs, trees, ground cover plants and turfgrasses.Examples of commercially important cultivated crops, trees, and plants include alfalfa (Medicago sativa), almond (Prunus dulcis), apple (Malus x domestica), apricot (Prunus armeniaca, P. brigantine, P. mandshurica, P. mume, P. sibirica), asparagus (Asparagus officinalis), banana (Musa spp.), barley (Hordeum vulgare), and legume (Phaseolus genus). spp.), blueberries and cranberries (Vaccinium spp.), cacao (Theobroma cacao), canola and rapeseed or rapeseed (Brassica napus), carnation (Dianthus caryophyllus), carrots (Daucus carota sativus), cassava (Manihot esculentum), cherries (Prunus avium), chickpeas (Ci. cidel arietinum). c(er arietinum), chicory (Cichorium intybus), chili pepper and other chili peppers (Capsicum annuum, C. frutescens, C. chinense, C. pubescens, C. baccatum), chrysanthemum (Chrysanthemum spp.), coconut (Cocos nucifera), coffee (Coffea spp. including Coffea arabica and Coffea canephora), cotton (Gossypium hirsutum L.) Grapes (including Vitus vinifera) include: L.), cowpea (Vigna unguiculata), cucumber (Cucumis sativus), currant and gooseberry (Ribes spp.), eggplant or eggplant (aubergine) (Solanum melongena), eucalyptus (Eucalyptus spp.), flax (Linum usitatissumum L.), geranium (Pelargonium spp.), grapefruit (Citrus x paradisi), and grapes (Vitus vinifera) used for wine. Tee Vit i(s spp.), guava (Psidium guajava), hops (Humulus lupulus), hemp and cannabis (Cannabis sativa and Cannabis spp.), iris (Iris spp.), lemon (Citrus limon), lettuce (Lactuca sativa), lime (Citrus spp.), corn (Zea mays L.), mango (Mangifera indica), mangosteen (Garcinia mangostana), melon (Cucumis melo) Melo), foxtail millet (Setaria spp., Echinochloa spp., Eleusine spp., Panicum spp., Pennisetum spp.), oats (Avena sativa), oil palm (E Laei El ginensis ae is g (Pyrus sinensis), olive (Olea europaea), onion (Allium cepa), orange (Citrus sinensis), papaya (Carica papaya), peach and nectarine (Prunus persica), pear (Pyrus spp.), pea (Pyrus pi) Sum · Sativum (Pis umsativum), peanuts (Arachis hypogaea), peonies (Paeonia spp.), petunias (Petunia spp.), pineapples (Ananas comosus), plantains (Musa spp.), European plums (Prunus domestica), poinsettias (Euphorbia pulcherrima), Polish canola (Brassica rapa), poplars (Populus spp.), potatoes (Solanum tuberosum), pumpkins (Cucurbita pepo) pepo), rice (Oryza sativa L.), rose (Rosa spp.), rubber (Hevea brasiliensis), rye (Secale cereale), safflower (Carthamus tinctorius L.), sesame seeds (sesame seeds) Mum ·in Dick Mu (Sesam um indi cum), sorghum (Sorghum bicolor), soybeans (Glycine max L.), pumpkins (Cucurbita pepo), strawberries (Fragaria spp., Fragaria x ananassa), sugar beets (Beta vulgaris), sugarcane (Saccharum spp.), sunflowers (Helianthus annus), sweet potatoes (Ipomoea batatas), tangerines (Citrus tangerina), tea (Camellia sinensis) (sinensis), tobacco (Nicotiana tabacum L.), tomato (Lycopersicon esculentum), tulip (Tulipa spp.), turnip (Brassica rapa rapa), walnut (Juglans spp. L.), watermelon (Citrus ranatus). l us lanatus), wheat (Tricho mosquito Mu Estivum (Triti c um aestivum), and yam (di O Scolea species (Di o (Scorea spp.)) is one example.

[0042] General categories of target genes include, but are not limited to, information-related genes such as transcription factors including zinc finger-containing transcription factors, communication-related genes such as kinases and / or other signaling-transduction factors, and housekeeping-related genes such as heat shock proteins. More specific categories include, but are not limited to, genes encoding crop-cultivationally important traits (e.g., increased yield, improved nitrogen use efficiency), abiotic stress tolerance (e.g., increased water use efficiency, heat tolerance, cold tolerance, and drought tolerance), abiotic stress tolerance (e.g., insect pest resistance, fungal or bacterial disease resistance, and nematode resistance), herbicide resistance, sterility, grain or seed characteristics, and commercial products. Target genes generally include genes involved in oil, starch, carbohydrate, or nutrient metabolism, as well as genes that affect seed size, plant development, plant growth regulation, and yield improvement. Plant development and growth regulation also refers to the regulation of the development and growth of various parts of a plant, such as flowers, seeds, roots, leaves, and shoots.

[0043] Disease and / or insect pest resistance genes can encode resistance to pests that cause significant yield reductions, such as maize sooty spot, smut, anthracnose, soybean mosaic virus, soybean cyst nematode, rhizophore nematode, brown spot, downy mildew, purple spot, seed rot, and seedling diseases, generally caused by fungi—species of the genera Pythium, Phytophthora, Rhizoctonia, and Diaporthe. Another example is bacterial spot disease caused by the bacterium Pseudomonas syringae pv. Glycinea. Examples of genes that confer insect pest resistance include the Bacillus thuringiensis toxic protein gene (US Patent Nos. 5,366,892; 5,747,450; 5,737,514; 5,723,756; 5,593,881; and Geiser et al (1986) Gene 48:109); and lectins (Van Damme et al. (1994) Plant Mol. Biol. 24:825).

[0044] Herbicide resistance traits may include genes encoding resistance to acetolactate synthase (ALS), specifically to herbicides that inhibit the action of sulfonylurea-type herbicides (e.g., mutations leading to such resistance, specifically the acetolactate synthase ALS gene with S4 and / or HRA mutations). ALS gene mutants encode resistance to the herbicide chlorsulfuron. Glyphosate acetyltransferase (GAT) is an N-acetyltransferase from Bacillus licheniformis that has been optimized for acetylation of the broad-spectrum herbicide glyphosate through gene shuffling, and forms the basis of a novel glyphosate resistance mechanism in transgenic plants (Castle et al. (2004) Science 304, 1 151-1 154).

[0045] Genes involved in plant growth and development have been identified in plants. One such gene is isopentenyltransferase (IPT), which is involved in cytokinin biosynthesis. Cytokinins play a crucial role in plant growth and development by stimulating cell division and cell differentiation (Sun et al. (2003), Plant Physiol. 131:167-176).

[0046] In certain embodiments, the disclosure intends to insert enhancer sequences into two or more favorable gene loci into a receptor cell.

[0047] Provided are commercial plant products obtained from plants or plant parts including Sequence ID No. 3, and methods for producing such products. In certain embodiments, the commercial products are processed products made from plants or their seeds, including (a) corn, soybean, cotton, or canola seed meal (defatted or undefatted); (b) extracted proteins, oils, sugars, syrups, and starches; (c) fermented products; (d) animal feed or human food products (e.g., feeds and foods containing corn, soybean, cotton, or canola seed meal (defatted or undefatted) and other raw materials (e.g., other grains, other seed meals, other protein meals, other oils, other starches, other sugars, binders, preservatives, humectants, vitamins, and / or minerals); (e) pharmaceuticals; (f) raw or processed biomass (e.g., cellulosic and / or lignocellulosic materials; silage); and (g) various industrial products.

[0048] Furthermore, this specification also provides methods for detecting SEQ ID NO: 3 in any of the aforementioned biological samples and commercial products. Detection of DNA molecules containing SEQ ID NO: 3 can be achieved by any combination of nucleic acid amplification (e.g., PCR amplification), hybridization, sequencing, and / or mass spectrometry-based techniques. Methods for detecting foreign nucleic acids at transgenic loci as shown in U.S. Patent Application Publication No. 20190136331 and U.S. Patent No. 9,738,904 (both incorporated herein by reference as a whole) can be applied to the nucleic acid detection methods provided herein. In certain embodiments, such detection is achieved by amplification and / or hybridization-based detection methods using methods (e.g., selective amplification primers) and / or probes (e.g., those with selective hybridization ability or the ability to produce specific primer extension products) that specifically recognize target DNA molecules (e.g., transgenic locus excision sites) but do not recognize DNA from unmodified transgenic loci. In certain embodiments, the hybridization probe (e.g., a polynucleotide containing at least 15-36 nucleotides of SEQ ID NO: 3) may include a detectable label (e.g., fluorescent, radioactive, epitope, and chemiluminescent label). In certain embodiments, the single nucleotide polymorphism detection assay can be applied to the detection of a target DNA molecule (e.g., an insertion or formation site of SEQ ID NO: 3 in a plant genome).

[0049] This specification provides inbred and hybrid plants and seeds containing Sequence ID No. 3 operably linked to a transcript-coding polynucleotide, along with methods for producing and using such hybrids and inbred seeds. Methods for producing inbred seeds include self-pollinating the inbred plants and restricting cross-pollination by any plants other than the inbred plants. Methods for producing such hybrid seeds may also include crossing superior crop plant strains, where at least one of the pollen provider or pollinator contains Sequence ID No. 3 operably linked to a transcript-coding polynucleotide. In certain embodiments, the pollen provider and pollinator contain germplasm of a characteristic hybrid vigor group, resulting in hybrid seeds and plants exhibiting hybrid vigor. In certain embodiments, inbred plants, hybrid plants, pollen providers and / or pollinators may each contain a characteristic transgenic locus that confers one of the following traits: a characteristic trait (e.g., herbicide resistance or insect pest resistance), a different type of trait (e.g., resistance to a characteristic herbicide, or resistance to a characteristic insect, such as a beetle or lepidopteran insect), or a different mode of action for the same trait (e.g., resistance to beetle insects by two characteristic modes of action or resistance to lepidopteran insects by two characteristic modes of action).Transgenes that can be introduced into plant strains containing Sequence ID No. 3 operably linked to a transcript-coding polynucleotide by breeding or direct transformation include (i) transgenes that confer insect pest resistance (e.g., Cry1Ab, Cry1Ac, Cry1F, Cry2Ab, Cry2Ae, Cry3A, Cry3Bb, Cry9c, Cry34, Cry35, VIP3A, and their variants, including Bacillus thuringiensis). (ii) Trans genes that produce the thuringiensis protein; trans genes that induce insect inhibitory RNAi responses, including dvsnf7; and (ii) trans genes that confer herbicide resistance (e.g., CP4-EPSPS or other EPSPS genes that confer glyphosate resistance; PAT or BAR genes that confer resistance to glufosinate herbicides; aad-1 gene that confers resistance to 2,4-D and aryloxyphenoxypropionic acid herbicides; DMO gene that confers resistance to dicamba herbicides). Examples of selected transgenic corn, soybean, cotton, and canola plant events that confer traits such as herbicide resistance and / or insect resistance are given in U.S. Patent Nos. 7,323,556, 8575,434, 6040497, 10316330; 8618358, 8212113, 9428765, 8455720, 7897748, 8273959, 8093453, 8901378, and 8466346. This is disclosed in the following specifications: No. 8680363, No. 8049071, No. 9447428, No. 9944945, No. 8592650, No. 10184134, No. 7179965, No. 7371940, No. 9133473, No. 8735661, No. 7381861, No. 8048632, and No. 9738903 (all of which are incorporated herein by reference).Transgenes that can be used to confer insect resistance in corn are disclosed in U.S. Patent Publication Nos. 20150361446 and 20200190533 (in whole, incorporated herein by reference), and in U.S. Patent Nos. 6342660, 6852915, 7323556, 7695914, 7705216, 7897748, 8212113, 8455720, 8466346, 8575434, 8901378, 9428765, and 10316330 (in whole, incorporated herein by reference). Transgenes that can be used to confer herbicide resistance in maize are disclosed in U.S. Patent Publication Nos. 20120244533 and 20200190533 (both incorporated herein by reference), and in U.S. Patent Nos. 6040497, 6852915, 8273959, 8618358, 8759618, and 9994863 (both incorporated herein by reference). In certain embodiments, pollinators will be made male-sterile or conditionally male-sterile. Methods for inducing male sterility or conditional male sterility include emasculation (e.g., removal of male inflorescences), cytoplasmic male sterility, chemical hybrids or systems, transgenes or transgene systems, and / or one or more mutations in one or more endogenous plant genes. Descriptions of various male sterility systems that can be applied for use with crop plants provided herein are given in Wan et al. Molecular Plant; 12, 3, (2019): 321-342 and in U.S. Patent No. 8,618,358; U.S. Patent Application Publication No. 20130031674; and U.S. Patent Application Publication No. 2003188347.

[0050] In certain embodiments, the plants provided herein, including Sequence ID No. 3, may further include one or more targeted genetic alterations introduced by one or more gene editing molecules or systems. Such targeted genetic alterations may include improved yield compared to a control plant lacking the targeted genetic alteration, improved food and / or feed properties (e.g., improved quality or quantity of oils, starches, proteins, or amino acids), improved nitrogen utilization efficiency, improved biofuel properties (e.g., improved ethanol production), male sterility / conditional male sterility systems (e.g., by targeting endogenous MS26, MS45, and MSCA1 genes), herbicide resistance (e.g., by targeting endogenous ALS, EPSPS, HPPD, or other herbicide target genes), and delayed flowering. These include traits that confer traits such as non-flowering, increased resistance to biological stress (e.g., resistance to insect, nematode, bacterial, or fungal damage), increased resistance to abiotic stress (e.g., resistance to drought, cold, heat, metal, or salinity), enhanced lodging resistance, increased growth rate, increased biomass, increased tillering, enhanced branching, delayed flowering, delayed senescence, increased flower count, improved high-density planting composition, improved photosynthesis, increased root mass, increased cell number, improved viability, improved seedling size, increased cell division rate, improved metabolic efficiency, and increased meristematic size. The types of targeted gene alterations that can be introduced include insertions, deletions, and substitutions of one or more nucleotides in the crop plant genome. The sites of targeted gene alterations in endogenous plant genes include promoters, coding regions, and non-coding regions (e.g., 5'UTR, introns, splice donor / receptor sites, and 3'UTR). In certain embodiments, the targeted genetic alteration includes the insertion of a regulatory sequence or other DNA sequence in an endogenous plant gene. Non-limiting examples of regulatory sequences that can produce targeted genetic alterations conferring a useful phenotype when inserted into an endogenous plant gene with a gene editing molecule include: (a) auxin response element (AuxRE) sequences; (b) at least one D1-4 sequence (Ulmasov et al. (1997) Plant Cell, 9:1963-1971); (c) at least one DR5 sequence (Ulmasov et al.(1997) Plant Cell, 9:1963-1971; (d) at least one m5-DR5 sequence (Ulmasov et al. (1997) Plant Cell, 9:1963-1971); (e) at least one P3 sequence; (f) a small RNA recognition site sequence to which the corresponding small RNA binds (e.g., siRNA, microRNA (miRNA), trans-acting siRNA as described in U.S. Patent No. 8,030,473, or phased sRNA as described in U.S. Patent No. 8,404,928). (sRNA) (both of these cited patents are incorporated herein by reference); (g) microRNA (miRNA) recognition site sequence; (h) microRNA (miRNA) recognition sequence for engineered miRNA such that the specific binding agent is the corresponding engineered mature miRNA; (i) transposon recognition sequence; (j) sequence recognized by ethylene response element binding factor-associated amphiphilic repression (EAR) motif; (k) splice site sequence (e.g., donor site, branching site, or recipient site; e.g., internet site lemur[dot]a See splice sites and splicing signals shown at mu[dot]edu[dot]pl / share / ERISdb / home.html); (l) recombinase recognition site sequences recognized by site-specific recombinases; (m) sequences encoding RNA, amino acid aptamers, or RNA-riboswitches, the specific binder being the corresponding ligand, with changes in expression being upregulated or downregulated; (n) hormone response elements recognized by nuclear receptors or their hormone-binding domains; (o) transcription factor binding sequences; and (p) Polycomb response elements (Xiao et al. (2017) Nature Genetics, 49:1546-1552, doi:10.1038 / ng.Examples include those shown in U.S. Patent Application Publication No. 20190352655 (which is incorporated herein by reference in its entirety), such as (see 3937). Non-limiting examples of target maize genes that can be subjected to targeted gene editing to confer useful traits include: (a) ZmIPK1 (herbicide-resistant and phytic acid-reduced maize; Shukla et al., Nature. 2009; 459: 437-41); (b) ZmGL2 (reduction of epipicticla wax in leaves; Char et al. Plant Biotechnol J. 2015; 13: 1002); (c) ZmMTL (induction of haploid plants; Kelliher et al. Nature. 2017; 542: 105); (d) Wx1 (high amylopectin content; U.S. Patent Application Publication No. 20190032070; incorporated herein by reference in whole); (e) TMS5 (thermosensitivity to male sterility; Li et al. J Genet Examples include (f) ALS (herbicide resistance; Svitashev et al.; Plant Physiol. 2015; 169: 931-45) and (g) ARGOS8 (drought stress resistance; Shi et al., Plant Biotechnol J. 2017; 15: 207-16). Non-limiting examples of target soybean genes that can be subjected to targeted gene editing to confer useful traits include (a) FAD2-1A, FAD2-1B (increased oleic acid content; Haun et al.; Plant Biotechnol J.2014;12:934-40); (b) FAD2-1A, FAD2-1B, FAD3A (increased oleic acid content and decreased linolenic acid content; Demorest et al., BMC Plant Biol.2016;16:225); and (c) ALS (herbicide resistance; Svitashev et al.; Plant Physiol.2015;169:931-45). A non-limiting example of a target Brassica gene that can be used for targeted gene editing to confer a useful trait is (a) the FRIGIDA gene (Sun Z, et al. J Integr Plant Biol.), which confers early flowering.(b) ALS (herbicide resistance; U.S. Patent Application Publication No. 20160138040, which is incorporated herein by reference in whole) is an example. Non-limiting examples of target genes in crop plants, including corn and soybeans, that can be used for targeted genetic alterations that confer useful phenotypes include U.S. Patent Application Publications No. 20190352655, No. 20200199609, No. 20200157554, and No. 20200231982 (each incorporated herein by reference in whole); and those shown in Zhang et al. (Genome Biol. 2018;19:210). In certain embodiments, such targeted genetic alterations can be combined with plants containing Sequence ID No. 3 by breeding techniques. Such breeding techniques include gene transfer by cross and / or backcross with a repeating parent. In such cross, the plant containing SEQ ID NO: 3 may be either a pollen provider or a pollinator. In certain embodiments, the plant containing SEQ ID NO: 3 can be used as a repeating parent in such backcross for gene transfer of a targeted gene mutation into the germplasm of the plant containing SEQ ID NO: 3. In certain embodiments, the plant containing one or more targeted gene mutations can be used as a repeating parent in such backcross for gene transfer of a genomic region containing SEQ ID NO: 3 into the germplasm of the plant containing one or more targeted gene mutations.

[0051] In certain embodiments, the plants provided herein, including SEQ ID NO: 3, exhibit improved yield, improved food and / or feed properties (e.g., improved quality or quantity of oils, starches, proteins, or amino acids), improved nitrogen utilization efficiency, improved biofuel properties (e.g., improved ethanol production), male sterility / conditional male sterility systems (e.g., by targeting endogenous MS26, MS45, and MSCA1 genes), herbicide resistance (e.g., by targeting endogenous ALS, EPSPS, HPPD, or other herbicide target genes), and delayed flowering compared to control plants lacking the targeted genetic mutation. The loci may further include one or more loci that confer traits such as delayed flowering, non-flowering, increased resistance to biological stress (e.g., resistance to insect, nematode, bacterial, or fungal damage), increased resistance to abiotic stress (e.g., resistance to drought, cold, heat, metal, or salinity), enhanced lodging resistance, increased growth rate, increased biomass, increased tillering, increased branching, delayed flowering, delayed senescence, increased flower count, improved high-density planting configuration, improved photosynthesis, increased root mass, increased cell number, improved viability, improved seedling size, increased cell division rate, improved metabolic efficiency, and increased meristematic size. Sources of such loci include superior cultivars, sexually reproductively compatible related wild species (e.g., soybeans of the genus Glycine), and plant germplasm subjected to random mutagenesis (e.g., by chemical mutagens such as EMS or by gamma-ray mutagenesis). In certain embodiments, such loci can be combined with a plant containing SEQ ID NO: 3 by breeding techniques. Such breeding techniques include gene transfer by crossing and / or backcrossing with a repeating parent. In such crossing, the plant containing SEQ ID NO: 3 may be either a pollen provider or a pollinator. In certain embodiments, a plant containing SEQ ID NO: 3 can be used as a repeating parent in such backcrossing to transfer a locus into the germplasm of a plant containing SEQ ID NO: 3. In certain embodiments, a plant containing one or more loci can be used as a repeating parent in such backcrossing to transfer a genomic region containing SEQ ID NO: 3 into the germplasm of a plant containing one or more loci.

[0052] Furthermore, this specification also provides a method for producing commercial plant products or plant materials, comprising growing any of the aforementioned plants comprising SEQ ID NO: 3, or growing plants from seeds comprising SEQ ID NO: 3. In certain embodiments, such plants and / or seeds are irrigated, fertilized, and / or treated with biological agents (e.g., beneficial microorganisms including Bacillus sp., Rhizobium sp., etc.), nematicides (e.g., carbamate or organophosphate insecticides), insecticides (e.g., neonicotinoid, pyrethroid, carbamate, or organophosphate insecticides), and / or fungicides (e.g., benzimidazole, imidazole, or strobilurin fungicides). The plants may be treated with such fertilizers, biological agents, nematicides, insecticides, and fungicides by methods including spraying, fumigation, and / or soil application. Seeds can be treated with such fertilizers, biological agents, nematicides, insecticides, and fungicides by methods including in-furrow application or by coating (e.g., using drum coaters, rotary coaters, tumbler drums, fluidized beds, and / or jet bed devices). Various binders, fillers, film coats, and methods and compositions for seed coating that can be applied to use with the seeds provided herein, including fertilizers, surfactants, plant growth regulators, crop desiccants, fungicides, fungicides, bacteriostatic agents, insecticides, and insecticides, are disclosed in U.S. Patent No. 1,0745,578 (which is incorporated herein by reference in its entirety).

[0053] Embodiment Various embodiments of the DNA molecules, plants, plant parts, genomes, chromosomes, methods, biological samples, and other compositions described herein are shown in the following set of numbered embodiments.

[0054] 1. A DNA molecule containing the polynucleotide sequence of Sequence ID No. 3.

[0055] 2. The DNA molecule according to Embodiment 1, which is an isolated, synthetic, and / or recombinant DNA molecule.

[0056] 3. The DNA molecule according to Embodiment 1 or 2, wherein the polynucleotide sequence of Sequence ID No. 3 is operably ligated to a polynucleotide sequence containing a promoter, the promoter is optionally an endogenous promoter, and the endogenous promoter is optionally located on a plant chromosome.

[0057] 4. The DNA molecule according to Embodiment 1, 2, or 3, wherein the polynucleotide sequence of SEQ ID NO: 3 and the promoter are operably linked to a transcription unit, and the expression of the transcript or protein encoded by the transcription unit in plant cells is increased compared to control plant cells containing a promoter that does not have the polynucleotide sequence of SEQ ID NO: 3.

[0058] 5. A DNA molecule according to any one of Embodiments 1 to 4, wherein the polynucleotide sequence of Sequence ID No. 3 is located approximately 10, 20, 30, 35, 40, or 50 base pairs (bp) to approximately 70, 80, 100, 120, 140, 160, 180, 200, 240, 300, 400, 500, 1000, 2000, 3000, or 5000 bp from the transcription start site of the transcription unit, and optionally, the polynucleotide sequence of Sequence ID No. 3 is located at the 5' end of the TSS.

[0059] 6. A DNA molecule according to any one of Embodiments 1 to 5, wherein the promoter is an endogenous plant promoter, the transcription unit is an endogenous plant transcription unit, the promoter and transcription unit are located on a plant chromosome, and optionally, the endogenous plant promoter and endogenous plant transcription unit elements are maize, soybean, cotton, or canola plant promoters and transcription units.

[0060] 7. A biological sample containing the DNA molecule described in any one of Embodiments 1 to 6.

[0061] 8. A biological sample according to Embodiment 7, comprising (i) cereal flour, syrup, oil, or starch; or (ii) corn, soybean, cotton, or canola seed meal or flakes.

[0062] 9. A plant chromosome comprising a DNA molecule as described in any one of Embodiments 1 to 6, wherein the plant chromosome is optionally a corn, soybean, cotton, or canola plant chromosome.

[0063] 10. A plant chromosome according to Embodiment 9, which is a maize plant chromosome.

[0064] 11. The plant chromosome according to Embodiment 9 or 10, wherein one or more nucleotides of SEQ ID NO: 3 are endogenous nucleotides of the plant chromosome, and optionally, at least 24 nucleotides of SEQ ID NO: 3 are exogenous nucleotides inserted into the plant chromosome.

[0065] 12. A plant cell comprising a DNA molecule as described in any one of Embodiments 1 to 6, wherein the plant cell is optionally a corn, soybean, cotton, or canola plant cell.

[0066] 13. The plant cell according to Embodiment 12, wherein the polynucleotide sequence of Sequence ID No. 3 is operably ligated to a polynucleotide sequence containing a promoter, the promoter is an endogenous promoter, and the endogenous promoter is located on a plant chromosome.

[0067] 14. A plant cell according to Embodiment 12 or 13, which is a maize plant cell.

[0068] 15. A tissue culture of regenerative cells comprising the plant cells described in Embodiment 12.

[0069] 16. A plant comprising the DNA molecule described in any one of Embodiments 1 to 6, which is optionally a corn, soybean, cotton, or canola plant.

[0070] 17. The plant according to Embodiment 16, which is a corn, soybean, cotton, or canola plant.

[0071] 18. The plant according to Embodiment 16 or 17, wherein the polynucleotide sequence of Sequence ID No. 3 is operably ligated to a polynucleotide sequence containing a promoter, the promoter being an endogenous promoter, and the endogenous promoter is located on a plant chromosome.

[0072] 19. A plant part containing a DNA molecule as described in any one of Embodiments 1 to 6, which is optionally a corn, soybean, cotton, or canola plant part.

[0073] 20. A plant part of maize, as described in Embodiment 19.

[0074] 21. The plant part according to Embodiment 19 or 20, wherein the plant part is a seed, and optionally the seed is a maize seed.

[0075] 22. The plant part according to Embodiment 19, 20, or 21, wherein the seeds are hybrid seeds, optionally the hybrid seeds are F1 hybrid seeds, and optionally the F1 hybrid seeds exhibit hybrid vigor.

[0076] 23. A plant part according to any one of Embodiments 19 to 22, wherein the seeds are inbred seeds.

[0077] 24. A method for producing plant seeds, comprising producing plant seeds by crossing a plant described in any one of embodiments 16 to 18 with a second plant, and optionally harvesting the seeds.

[0078] 25. The method according to Embodiment 24, wherein the genotype of the first plant and the genotype of the second plant are different genotypes, and the seeds are hybrid seeds.

[0079] 26. The method according to Embodiment 24 or 25, wherein a plant or a second plant further comprises a trans gene, a targeted gene alteration, or a gene locus that confers a desired trait, and the harvested seeds comprise the trans gene, the targeted gene alteration, or the gene locus.

[0080] 27. A method for producing plant seeds, comprising producing plant seeds by self-propagating a plant described in any one of embodiments 16 to 18, and optionally harvesting the seeds.

[0081] 28. The method according to Embodiment 27, wherein the plants and seeds are inbred.

[0082] 29. A method for producing a plant containing an additional desired trait, comprising introducing a trans gene, a targeted gene alteration, or a gene locus that confers the desired trait to the plant described in Embodiments 16, 17, or 18.

[0083] 30. A method for producing commercial plant products, comprising processing a plant or seed containing a DNA molecule as described in any one of Embodiments 1 to 6, and recovering commercial plant products from the processed plant or seed.

[0084] 31. The method according to Embodiment 30, wherein the commercial plant product is seed meal, starch, syrup, silage, oil, or protein.

[0085] 32. The method according to Embodiment 30 or 31, wherein the commercial plant product contains a detectable amount of DNA molecules.

[0086] 33. A method for producing plant material, comprising growing a plant having an expression-enhancing element comprising Sequence ID No. 3 operably linked to a transcript-coding polynucleotide, wherein the expression of the transcript-coding polynucleotide in the plant is increased compared to a control plant lacking the expression-enhancing element.

[0087] 34. The method according to Embodiment 33, wherein growing includes at least one of sowing seeds that germinate and form plants, watering seeds or plants, and / or treating plants or seeds with a biological agent, herbicide, insecticide, or fungicide.

[0088] 35. A method for preparing plant material, (a) To provide a plant having an expression-enhancing element comprising Sequence ID No. 3 operably linked to a transcript-coding polynucleotide, wherein the expression of the transcript-coding polynucleotide is increased in the plant compared to a control plant lacking the expression-enhancing element; and, (b) Growing plants under conditions that enable the expression of transcript-enhancing polynucleotides. A method that includes this.

[0089] 36. The method according to any one of embodiments 33 to 35, wherein the plant material includes seeds, and optionally further comprises harvesting seeds from the plant.

[0090] 37. The method according to any one of embodiments 33 to 36, wherein the expression enhancement element is located in an endogenous promoter operably linked to a transcript-coding polynucleotide, or in the 5'UTR, intron, or 3'UTR of the transcript-coding polynucleotide, and the endogenous promoter, 5'UTR, intron, or 3'UTR is located on a plant chromosome.

[0091] 38. The method according to any one of embodiments 33 to 37, wherein the polynucleotide sequence of SEQ ID NO: 3 is located approximately 10, 20, 30, 40, or 50 base pairs (bp) to approximately 70, 80, 100, 120, 140, 160, 180, 200, 240, 300, 400, 500, 1000, 2000, 3000, or 5000 bp from the transcription start site of the transcription unit, and optionally the polynucleotide sequence of SEQ ID NO: 3 is located on the 5' side of the TSS.

[0092] 39. The method according to any one of Embodiments 33 to 38, wherein the transcript-coding polynucleotide is an endogenous plant transcription unit, the promoter and transcription unit are located on a plant chromosome, and optionally the transcript-coding polynucleotide is a maize, soybean, cotton, or canola plant transcript-coding polynucleotide.

[0093] 40. The method according to any one of embodiments 33 to 39, wherein the plant is a maize plant and / or the seeds are maize plant seeds.

[0094] 41. A method for identifying a biological sample containing polynucleotides that include modified plant genes, comprising the step of detecting the presence of SEQ ID NO: 3 in the biological sample.

[0095] 42. The method according to Embodiment 41, wherein the biological sample is obtained from plant cells, plants, or plant parts, and optionally the plant part is a seed, and / or optionally the plant is a maize, soybean, cotton, or canola plant.

[0096] 43. A method for producing a nucleic acid containing the polynucleotide sequence of Sequence ID No. 3, comprising isolating the nucleic acid from a plant described in Embodiment 16, 17, or 18, or from a plant part described in any one of Embodiments 19 to 23.

[0097] 44. A method for producing treated plant seeds, comprising contacting seeds containing DNA molecules according to any one of Embodiments 1 to 6 with a composition comprising a biological agent, a nematicide, an insecticide, or a fungicide.

[0098] 45. The method according to Embodiment 44, wherein the seeds are corn, soybean, cotton, or canola plant seeds.

[0099] 46. ​​A method for increasing the expression of a polynucleotide sequence in a plant, comprising expressing a polynucleotide sequence operably linked to an expression-enhancing element containing SEQ ID NO: 3 and a promoter, wherein the expression of the polynucleotide is increased compared to a control plant lacking the expression-enhancing element.

[0100] 47. The method according to Embodiment 46, wherein the plant is a maize, soybean, cotton, or canola plant, and optionally includes a gene whose polynucleotide sequence confers increased yield, improved food and / or feed properties (e.g., improved quality or quantity of oil, starch, protein, or amino acids), improved nitrogen utilization efficiency, improved biofuel properties (e.g., increased ethanol production), delayed flowering, non-flowering, increased resistance to biological stress (e.g., resistance to insect, nematode, bacterial, or fungal damage), increased resistance to abiotic stress (e.g., resistance to drought, cold, heat, metal, or salinity), enhanced lodging resistance, increased growth rate, increased biomass, increased tillering, enhanced branching, delayed flowering, delayed senescence, increased flower count, improved high-density planting composition, improved photosynthesis, increased root mass, increased cell number, improved viability, improved seedling size, increased cell division rate, improved metabolic efficiency, and / or increased meristematic size.

[0101] 48. Increased expression in a part of the plant, and randomly selected, that part is the seed, leaf, stem, flower, or root. ,also The method according to embodiment 46 or 47, wherein the cell is a cell.

[0102] 49. (i) To increase the expression of one or more elements encoded by transcription units operably linked to a promoter in a plant; (ii) To provide plants containing DNA molecules or recombinant DNA molecules with useful traits, optionally selected, compared to control plants lacking recombinant DNA molecules, such as improved yield, improved food and / or feed properties (e.g., improved quality or quantity of oils, starches, proteins, or amino acids), improved nitrogen utilization efficiency, improved biofuel properties (e.g., improved ethanol production), delayed flowering, non-flowering, increased resistance to biological stress (e.g., resistance to insect, nematode, bacterial, or fungal damage), increased resistance to abiotic stress (e.g., resistance to drought, cold, heat, metals, or salinity), enhanced lodging resistance, increased growth rate, and biomass Use of a DNA molecule according to any one of Embodiments 1 to 6 for the purpose of conferring useful traits such as enhancement, enhanced tillering, enhanced branching, delayed flowering, delayed senescence, increased number of flowers, improved high-density planting configuration, improved photosynthesis, increased root mass, increased cell number, improved viability, improved seedling size, increased cell division rate, improved metabolic efficiency, and / or increased meristematic size; for the purpose of obtaining a plant or seeds therefrom that exhibits the useful trait of (iii)(ii); or for the purpose of growing a population of plants exhibiting the useful trait of (iv)(ii); optionally, the plant of (i), (ii), (iii), or (iv) is a maize, soybean, cotton, or canola plant; or optionally, the seed of (iii) is a maize, soybean, cotton, or canola plant. [Examples]

[0103] Example 1. This example illustrates the insertion of a transcription-enhancing element into a single target in a maize protoplast by NHEJ. The maize protoplast was prepared using an established method (see U.S. Patent Application Publication No. 20190352655, which is incorporated herein by reference in its entirety).

[0104] Maize protoplasts were isolated from leaf material of B104 seedlings and transfected with RNPs consisting of Cas9 protein complexed with a double-stranded oligonucleotide and tracrRNA that targets the ZmGln1-3 promoter (crRNA sequence: UACACGUACGAUUACAACCAGUUUUAGAGCUAUGCU; SEQ ID NO: 5). The double-stranded oligonucleotide is described below. The Cas9 / tracrRNA / crRNA complex causes a double-strand break 66 bp upstream from the transcription start site of ZmGln1-3 in DNA (i.e., the Zm00001d017958 gene related to the B73v4 maize genome encoding the polypeptide of SEQ ID NO: 6). Three types of double-stranded oligonucleotides were tested: a 24 nt configuration with two repeats of the enhancer sequence, a 36 bp configuration with three repeats of the enhancer sequence, and a 48 nt configuration with four repeats of the enhancer sequence. These oligonucleotides were 5' phosphorylated and contained two phosphorothioate bonds at both ends. As a control, protoplasts were transfected with RNP only, i.e., no oligonucleotides were added. Each transfection was performed in triplicates. After transfection, cells were washed and incubated for 48 hours. At the end of the incubation period, cells were harvested for gDNA and RNA preparation.

[0105] To analyze the insertion sites, gDNA was used as a template, and PCR was performed on it with primers adjacent to the insertion sites. After bead cleanup, the resulting amplicons were sequenced by next-generation sequencing. The reads were aligned with the target gene loci, and the percentage of reads containing the enhancer sequence was used as a surrogate indicator of the proportion of cells that incorporated the enhancer. The data are summarized in Figure 1. For transfection with a dual enhancer, it was estimated that 7% of cells incorporated the enhancer element into the Gln1-3 target gene loci. For cells transfected with triple or quadruple enhancers, 44% and 41% of cells, respectively, incorporated the enhancer element into the target gene loci. All figures are averaged across three biological replicas. This data indicates that the triple element performs best in terms of insertion efficiency.

[0106] To evaluate the effect of the inserted enhancer sequence on the expression level of Gln1-3, bulk RNA was extracted from recovered protoplasts and converted to cDNA. Relative ZmGln1-3 expression levels were measured using qRT-PCR compared to the well-known reference gene ZmAct1; the data are summarized in Figure 2. In cells transfected with the dual enhancer, the ZmGln1-3 expression level was indistinguishable from that of control cells transfected with RNP alone. However, in cells transfected with the triple enhancer, the ZmGln1-3 expression level was approximately 4.5 times higher than that of the control. In cells transfected with the quadruple enhancer, the increase was only 2.7 times. This data indicates that both the triple and quadruple enhancers enhance the expression of the target gene when incorporated into the promoter, but the triple enhancer enhances it more efficiently.

[0107] Example 2. This example illustrates transcriptional enhancement at multiple gene targets in maize protoplasts by a 36bp enhancer. Maize protoplasts were isolated from leaf material of B104 seedlings and transfected with RNPs consisting of tracrRNA:Cas9 complexed with a crRNA double helix, either with or without a double-stranded 5' phosphorylated 36nt enhancer (SEQ ID NO: 3) oligo containing a 36-nucleotide enhancer sequence (SEQ ID NO: 3) with two phosphorothioate bonds at both ends. Three crRNAs were used in this experiment. The first crRNA (UACACGUACGAUUACAACCAGUUUUAGAGCUAUGCU; SEQ ID NO: 5) targets the ZmGln1-3 promoter (i.e., the promoter of the Zm00001d017958 gene related to the B73v4 maize genome encoding the polypeptide of SEQ ID NO: 6). The second crRNA (UGUAUCCGUAUUUAUACGUGGUUUUAGAGCUAUGCU; SEQ ID NO: 7) targets the ZmGln1-4 promoter (i.e., the promoter of the Zm00001d0518 gene related to the B73v4 maize genome encoding the polypeptide of SEQ ID NO: 8). The 04 gene promoter is targeted. The third crRNA (CUCCAAGUGACCGAGCAAGAGUUUUAGAGCUAUGCU; SEQ ID NO: 9) targets the ZmLc promoter (i.e., the promoter of the Zm00001d026147 gene related to the B73v4 maize genome encoding the polypeptide of SEQ ID NO: 10). Each transfection was performed in triplicates. After transfection, the cells were washed and incubated for 48 hours. At the end of the incubation period, the cells were harvested for gDNA and RNA preparation.

[0108] To analyze the insertion sites, gDNA was used as a template, and PCR was performed on it with primers adjacent to the insertion sites. After bead cleanup, the resulting amplicons were sequenced by next-generation sequencing. Reads were aligned with target loci, and the percentage of reads containing enhancer sequences was used as a surrogate indicator of the proportion of cells incorporating the enhancer. For reads without enhancer sequences, the number of reads containing indels due to NHEJ was determined. The insertion efficiency was approximately half of the total editing efficiency (sum of reads with only indels and reads with inserted oligonucleotides) in all three cases, but the absolute insertion efficiency differed among targets: 31% for ZmGln1-3, 9% for Gln1-4, and 12% for Lc.

[0109] To evaluate the effect of the inserted Sequence ID No. 3 enhancer sequence on the expression levels of Gln1-3, bulk RNA was extracted from the recovered protoplasts and converted to cDNA. Using qRT-PCR, the relative expression levels of target genes (ZmGln1-3, ZmGln1-4, or ZmLc) were measured compared to the well-known reference gene ZmAct1. These results are summarized in Figure 3, clearly showing a more than 400-fold increase in Lc expression, a 2.3-fold increase in Gln1-3 expression, and a 1.9-fold increase in Gln1-4 expression due to the insertion of the maize enhancer sequence into the gene promoter. As discussed above, considering that only a small fraction of cells incorporated the enhancer sequence, the increase in gene expression in cells with the enhancer is even greater, indicating that the enhancer effectively increases the expression levels of multiple targets.

[0110] Example 3. This example describes maize genome editing and transformation. Immature embryos from maize strains ubiquitously expressing CRISPR / Cas nuclease in a B104 background were bombarded with gold particles coated with double-stranded 5' phosphorylated oligonucleotides containing a guide RNA targeting the Gln1-3 promoter of the Gln1.3 gene (i.e., the promoter of the Zm00001d017958 gene related to the B73v4 maize genome encoding the polypeptide of SEQ ID NO: 6) and a 36-nucleotide enhancer sequence (SEQ ID NO: 3), along with plasmids encoding the pat resistance gene and a fluorescent protein. Plants with complete or partial 36bp enhancer elements (SEQ ID NO: 3) were regenerated through standard tissue culture procedures with selection for pat resistance and fluorescence. Leaf tissue was collected from the regenerated plants, gDNA was extracted, and the presence of insertions was confirmed using primers adjacent to the gRNA target site. Increasing amplicon size allowed for the selection of events in which insertions were present. Amplicon sequencing confirmed that for Gln1-3, oligo insertion occurred at the predicted target site 66 bp upstream from the transcription start site (TSS), with efficiencies ranging from 0.4% to 1.1%, as shown in Table 1.

[0111] [Table 1]

[0112] RNA was prepared from leaf samples taken from young regenerated plants from single bombardment experiments aimed at inserting a maize enhancer element into the Gln1-3 promoter, and converted to cDNA. Expression levels of Gln1-3 and the control ZmAct1 were measured using SYBR-based qRT-PCR. Genotyping was also performed on the same plants for the presence of the enhancer. The results are summarized in Figure 4, showing that plants from events without enhancer insertion had low Gln1-3 levels, similar to the B104 untransformed control, while plants from events with the 36bp enhancer element (SEQ ID NO: 3) had levels 4 to 10 times higher than the control.

[0113] Plants with the insertion were grown to maturity and crossed with wild-type B104 plants. Next, a T1BC1 population derived from these heterozygous plants for the full-length 36 bp enhancer insertion was grown for further analysis. From these plants, leaf tissue was sampled for PCR gene typing for the insertion, and leaves, mesocotyls, and primary root tissue were collected for RNA extraction, cDNA synthesis, and qRT-PCR for Gln1-3 and ZmAct1. The results of these experiments are shown in Figure 5. Individuals with the insertion were compared to siblings that did not inherit the enhancer insertion allele, and to wild-type B104 plants grown in parallel with the T1BC1 plants. In plants with the insertion, there was a significant 2-fold increase in Gln1-3 expression in both the roots and mesocotyls (p<0.05, two-sided Student's t-test) compared to siblings without the insertion and B104 plants. In the leaves, we were unable to detect any difference in expression, which is likely due to the fact that Gln1-3 expression is already extremely high in the leaves compared to the roots and mesocotyl.

[0114] Example 4. This example illustrates the enhancement of transcript expression in soybean cells. Soybean protoplasts were prepared using an established method (see U.S. Patent Application Publication No. 20190352655).

[0115] Two plasmids were prepared for protoplast transfection. The control plasmid had an expression cassette containing the soy Tfl1b gene promoter, 5'UTR, and start codon, which drives the expression of the GFP fluorescent marker (SEQ ID NO: 11). The test plasmid differed from the control plasmid only in the insertion of a 36bp enhancer element (SEQ ID NO: 3), which is located 484 nucleotides from the start codon of the Tfl1b protein (SEQ ID NO: 12).

[0116] [Table 2]

[0117] In soybean protoplasts transfected with a plasmid containing the insertion of the 36bp enhancer element of Sequence ID No. 3 into the soybean Tlf1b gene promoter, increased expression of the GFP marker gene was observed at 16, 24, and 40 hours post-transfection compared to controls transfected with a plasmid containing the soybean Tlf1b gene promoter.

[0118] The scope and width of this disclosure shall not be limited by any of the exemplary embodiments described above, but shall be defined solely by the following claims and equivalents. In certain embodiments, for example, the following are provided: (Item 1) A DNA molecule containing the polynucleotide sequence of Sequence ID No. 3. (Item 2) The DNA molecules described in item 1, which are isolated, synthetic, and / or recombinant DNA molecules. (Item 3) The DNA molecule described in item 1, wherein the polynucleotide sequence of sequence number 3 is located within a polynucleotide sequence containing a promoter. (Item 4) The DNA molecule according to item 3, wherein the polynucleotide sequence of SEQ ID NO: 3 and the promoter are operably linked to a transcription unit, and the expression of the transcript or protein encoded by the transcription unit in the plant cell is increased compared to a control plant cell containing the promoter that does not have the polynucleotide sequence of SEQ ID NO: 3. (Item 5) The DNA molecule described in item 4, wherein the polynucleotide sequence of Sequence ID No. 3 is located approximately 10, 20, 30, or 40 base pairs (bp) to approximately 100, 240, 300, 400, 500, 1000, 2000, 3000, or 5000 bp from the transcription start site of the transcription unit. (Item 6) The DNA molecule according to item 4, wherein the promoter is a plant promoter, the transcription unit is a plant transcription unit, and optionally, the endogenous plant promoter and endogenous plant transcription unit element are a maize or soybean plant promoter and transcription unit. (Item 7) A plant cell containing the DNA molecule described in item 3, which is optionally a non-regenerative plant cell that cannot regenerate to produce a plant. (Item 8) The plant cell according to item 7, wherein the polynucleotide sequence of Sequence ID No. 3 is located in a polynucleotide sequence containing a promoter, the promoter is an endogenous promoter, and the endogenous promoter is located in its native position within the plant genome. (Item 9) Plant cells as described in item 7, which are maize or soybean plant cells. (Item 10) Plants containing the DNA molecules described in item 3. (Item 11) The plant according to item 10, wherein the polynucleotide sequence of Sequence ID No. 3 is located in a polynucleotide sequence containing a promoter, the promoter is an endogenous promoter, and the endogenous promoter is located in its native position within the genome of the plant. (Item 12) Plant parts containing the DNA molecules described in item 3. (Item 13) Seeds, the plant part described in item 12. (Item 14) A method for producing plant material, comprising growing a plant having an expression-enhancing element containing SEQ ID NO: 3 located in a promoter, wherein the expression-enhancing element of SEQ ID NO: 3 and the promoter are operably linked to a transcript-coding polynucleotide, and the expression of the transcript-coding polynucleotide in the plant is increased compared to a control plant lacking the expression-enhancing element. (Item 15) The method according to item 14, wherein growing includes sowing seeds that germinate and form the plant, watering the seeds or plant, and / or treating the plant or seeds with a biological agent, herbicide, insecticide, or fungicide. (Item 16) The method according to item 14, wherein the plant material includes seeds, and the method further comprises harvesting the seeds from the plant. (Item 17) The method according to item 14, wherein the expression-enhancing element is located in an endogenous promoter operably linked to the endogenous transcript-coding polynucleotide, and the endogenous promoter and the endogenous transcript-coding polynucleotide are located in their native positions in the plant genome. (Item 18) The method according to item 14, wherein the polynucleotide sequence of Sequence ID No. 3 is located approximately 10, 20, 30, or 40 base pairs (bp) to approximately 100, 240, 300, 400, 500, 1000, 2000, 3000, or 5000 bp from the transcription start site of the transcription unit. (Item 19) The method according to item 17, wherein the plant is a maize or soybean plant, and the endogenous promoter and the endogenous transcription unit are endogenous maize or soybean plant promoter and endogenous transcript coding polynucleotides located in their natural positions within the genome of the maize or soybean plant. (Item 20) The method according to item 14, wherein the plant is a maize or soybean plant. (Item 21) A method for producing a plant material, comprising inserting a transcription-enhancing element of Sequence ID No. 3 into the promoter of a plant, and producing the plant material by growing the plant, wherein the expression-enhancing element and the promoter are operably linked to a transcript-coding polynucleotide, and the expression of the transcript-coding polynucleotide in the plant is increased compared to a control plant lacking the expression-enhancing element. (Item 22) The method according to item 21, wherein growing includes sowing seeds that germinate and form the plant, watering the seeds or plant, and / or treating the plant or seeds with a biological agent, herbicide, insecticide, or fungicide. (Item 23) The method according to item 21, wherein the plant material includes seeds, and the method further comprises harvesting the seeds from the plant. (Item 24) The method according to item 21, wherein the expression-enhancing element is located in an endogenous promoter operably linked to the endogenous transcript-coding polynucleotide, and the endogenous promoter and the endogenous transcript-coding polynucleotide are located in their native positions in the plant genome. (Item 25) The method according to item 21, wherein the polynucleotide sequence of SEQ ID NO: 3 is located approximately 10, 20, 30, 40, or 50 base pairs (bp) to approximately 70, 80, 100, 120, 140, 160, 180, 200, 240, 300, 400, 500, 1000, 2000, 3000, or 5000 bp from the transcription start site of the transcription unit, and optionally, the polynucleotide sequence of SEQ ID NO: 3 is located on the 5' side of the TSS. (Item 26) The method according to item 21, wherein the plant is a maize or soybean plant, the expression enhancement element is located in an endogenous maize or soybean promoter operably linked to the endogenous transcript coding polynucleotide, and the endogenous promoter and the endogenous transcript coding polynucleotide are located in their native positions in the genome of the maize or soybean plant. (Item 27) A biological sample containing the DNA molecules described in item 1, which is optionally "non-regenerative" and cannot be regenerated into a plant or plant part. (Item 28) A biological sample as described in item 27, containing corn, soybeans, cotton, or canola seed meal. (Item 29) A method for identifying a biological sample according to item 27, comprising a polynucleotide containing a modified plant gene in which the polynucleotide sequence of SEQ ID NO: 3 is located within a polynucleotide sequence containing a promoter, the method comprising the step of detecting the presence of SEQ ID NO: 3 in the biological sample. (Item 30) The method according to item 29, wherein the biological sample is obtained from plant cells, plants, or plant parts, and optionally the plant part is a seed, and / or optionally the plant is a maize, soybean, cotton, or canola plant. (Item 31) A method for producing commercial plant products, comprising processing a plant or seed containing a DNA molecule as described in any one of items 1 to 6, and recovering the commercial plant product from the processed plant or seed. (Item 32) The method according to item 31, wherein the commodity plant product is seed meal, starch, syrup, silage, oil, or protein. (Item 33) A method for producing a nucleic acid containing the polynucleotide sequence of Sequence ID No. 3, comprising isolating the nucleic acid from a plant part as described in item 12. (Item 34) A method for producing treated plant seeds, comprising contacting seeds containing DNA molecules as described in any one of items 1 to 6 with a composition comprising a biological agent, a nematicide, an insecticide, or a fungicide. (Item 35) The method according to item 34, wherein the seeds are corn, soybean, cotton, or canola plant seeds. (Item 36) A method for increasing the expression of a polynucleotide sequence in a plant, comprising expressing a polynucleotide sequence operably linked to an expression-enhancing element containing SEQ ID NO: 3 and a promoter, wherein the expression of the polynucleotide is increased compared to a control plant lacking the expression-enhancing element. (Item 37) The method according to item 36, wherein the plant is a maize, soybean, cotton, or canola plant, and optionally the polynucleotide sequence includes a gene that confers increased yield, improved food and / or feed properties (e.g., improved quality or quantity of oil, starch, protein, or amino acids), improved nitrogen utilization efficiency, improved biofuel properties (e.g., increased ethanol production), delayed flowering, non-flowering, increased resistance to biological stress (e.g., resistance to insect, nematode, bacterial, or fungal damage), increased resistance to abiotic stress (e.g., resistance to drought, cold, heat, metal, or salinity), enhanced lodging resistance, increased growth rate, increased biomass, increased tillering, enhanced branching, delayed flowering, delayed senescence, increased flower count, improved high-density planting composition, improved photosynthesis, increased root mass, increased cell number, improved viability, improved seedling size, increased cell division rate, improved metabolic efficiency, and / or increased meristematic size. (Item 38) The method according to item 36 or 37, wherein the expression is increased in a part of the plant, and optionally the part is a seed, leaf, stem, flower, root, stalk, or cell. (Item 39) (i) To increase the expression of one or more elements encoded by transcription units operably linked to the promoter in a plant; (ii) To provide plants containing the DNA molecule or recombinant DNA molecule with useful traits, optionally selected, compared to control plants lacking the recombinant DNA molecule, such as improved yield, improved food and / or feed properties (e.g., improved quality or quantity of oils, starches, proteins, or amino acids), improved nitrogen utilization efficiency, improved biofuel properties (e.g., improved ethanol production), delayed flowering, non-flowering, increased resistance to biological stress (e.g., resistance to insect, nematode, bacterial, or fungal damage), increased resistance to abiotic stress (e.g., resistance to drought, cold, heat, metals, or salinity), enhanced lodging resistance, increased growth rate, and increased biomass. Use of DNA molecules described in any one of items 1 to 6 for the purpose of conferring useful traits such as enhanced tillering, enhanced branching, delayed flowering, delayed senescence, increased number of flowers, improved high-density planting configuration, improved photosynthesis, increased root mass, increased cell number, improved viability, improved seedling size, increased cell division rate, improved metabolic efficiency, and / or increased meristematic size; for the purpose of obtaining plants or seeds therefrom that exhibit the useful traits of (iii)(ii); or for the purpose of growing a population of plants exhibiting the useful traits of (iv)(ii); optionally, the plant in (i), (ii), (iii), or (iv) is a maize, soybean, cotton, or canola plant; or optionally, the seed in (iii) is a maize, soybean, cotton, or canola plant.

Claims

1. A DNA molecule comprising a polynucleotide sequence of Sequence ID No. 3 located within a promoter, wherein the polynucleotide sequence of Sequence ID No. 3 and the promoter are operably linked to a transcription unit, and the DNA molecule increases the expression of a transcript or protein encoded by the transcription unit in the plant cell compared to a control plant cell containing the promoter without the polynucleotide sequence of Sequence ID No.

3.

2. The DNA molecule according to claim 1, wherein the polynucleotide sequence of Sequence ID No. 3 is located approximately 10, 20, 30, or 40 base pairs (bp) to approximately 100, 240, 300, 400, 500, 1000, 2000, 3000, or 5000 bp from the transcription start site of the transcription unit.

3. The DNA molecule according to claim 1, wherein the promoter is a plant promoter and the transcription unit is a plant transcription unit.

4. The DNA molecule according to claim 3, wherein the promoter is an endogenous plant promoter, the transcription unit is an endogenous plant transcription unit element, and the endogenous plant promoter and the endogenous plant transcription unit element are a maize or soybean plant promoter and transcription unit.

5. A plant cell comprising the DNA molecule described in any one of claims 1 to 4.

6. The plant cell according to claim 5, which is a plant cell of rice, wheat, barley, potato, sweet potato, corn, or soybean.

7. A plant comprising the DNA molecule described in any one of claims 1 to 4.

8. The plant according to claim 7, wherein the polynucleotide sequence of Sequence ID No. 3 is located within a polynucleotide sequence containing a promoter, the promoter is an endogenous promoter, and the endogenous promoter is located at its natural position in the genome of the plant.

9. A plant part containing the DNA molecule described in any one of claims 1 to 4.

10. The plant part according to claim 9, which is a seed.

11. A method for producing a plant material, comprising inserting an expression-enhancing element of Sequence ID No. 3 into the promoter of a plant, and producing the plant material by growing the plant, wherein the expression-enhancing element and the promoter are operably linked to a transcript-coding polynucleotide, and the expression of the transcript-coding polynucleotide in the plant is increased compared to a control plant lacking the expression-enhancing element.

12. The method according to claim 11, wherein growing comprises at least one of sowing seeds that germinate and form the plant, watering the seeds or plant, and / or treating the plant or seeds with a biological agent, herbicide, insecticide, or fungicide.

13. The method according to claim 11, wherein the plant material includes seeds, and the method further comprises harvesting the seeds from the plant.

14. The method according to claim 11, wherein the expression-enhancing element is located within an endogenous promoter operably linked to the transcript-coding polynucleotide, the transcript-coding polynucleotide is an endogenous transcript-coding polynucleotide, and the endogenous promoter and the endogenous transcript-coding polynucleotide are located in their native positions within the plant genome.

15. The method according to claim 11, wherein the polynucleotide sequence of Sequence ID No. 3 is located approximately 10, 20, 30, 40, or 50 base pairs (bp) to approximately 70, 80, 100, 120, 140, 160, 180, 200, 240, 300, 400, 500, 1000, 2000, 3000, or 5000 bp from the transcription start site of the transcript coding polynucleotide, and the polynucleotide sequence of Sequence ID No. 3 is located 5' to the transcription start site.

16. The method according to claim 11, wherein the plant is a maize or soybean plant, the expression enhancement element is located within an endogenous maize or soybean promoter operably linked to the transcript-coding polynucleotide, the transcript-coding polynucleotide is an endogenous transcript-coding polynucleotide, and the endogenous promoter and the endogenous transcript-coding polynucleotide are located in their natural positions within the genome of the maize or soybean plant.

17. A biological sample comprising the DNA molecule described in any one of claims 1 to 4.

18. The biological sample according to claim 17, comprising rice, wheat, barley, corn, soybean, cotton, or canola seed meal.

19. A method for identifying a biological sample according to claim 17, comprising a polynucleotide containing a modified plant gene in which the polynucleotide sequence of SEQ ID NO: 3 is located within a polynucleotide sequence containing a promoter, the method comprising the step of detecting the presence of SEQ ID NO: 3 in the biological sample.

20. The method according to claim 19, wherein the biological sample is obtained from plant cells, plants, or plant parts, wherein the plant part is a seed, leaf, stem, flower, or root, and / or the plant is rice, wheat, barley, potato, sweet potato, corn, soybean, cotton, or canola plant.

21. A method for producing commercial plant products, comprising processing a plant or seed containing a DNA molecule as described in any one of claims 1 to 4, and recovering the commercial plant product from the processed plant or seed.

22. The method according to claim 21, wherein the commercial plant product is seed meal, starch, syrup, silage, oil, or protein.

23. A method for producing a nucleic acid containing the polynucleotide sequence of Sequence ID No. 3, comprising isolating the nucleic acid from the plant part described in claim 9.

24. A method for producing treated plant seeds, comprising contacting seeds containing the DNA molecule described in any one of claims 1 to 4 with a composition comprising a biological agent, a nematicide, an insecticide, or a fungicide.

25. The method according to claim 24, wherein the seeds are rice, wheat, barley, corn, soybean, cotton, or canola plant seeds.

26. A method for increasing the expression of a polynucleotide sequence in a plant, comprising expressing a polynucleotide sequence operably linked to an expression-enhancing element containing Sequence ID No. 3 and a promoter, wherein the expression of the polynucleotide is increased compared to a control plant lacking the expression-enhancing element.

27. The method according to claim 26, wherein the plant is rice, wheat, barley, potato, sweet potato, corn, soybean, cotton, or canola plant, and / or the polynucleotide sequence includes a gene that confers improved yield, improved food and / or feed properties, improved nitrogen utilization efficiency, improved biofuel use properties, delayed flowering, non-flowering, increased resistance to biological stress, increased resistance to abiotic stress, enhanced lodging resistance, increased growth rate, increased biomass, enhanced tillering, enhanced branching, delayed flowering period, delayed senescence, increased number of flowers, improved high-density planting configuration, improved photosynthesis, increased root mass, increased cell number, improved viability, improved seedling size, increased cell division rate, improved metabolic efficiency, and / or increased meristematic size.

28. The method according to claim 26 or 27, wherein the expression is increased in a part of the plant, the part being a seed, leaf, stem, flower, root, or cell.

29. (i) to increase the expression of one or more elements encoded by a transcription unit operably linked to the promoter in a plant; or (ii) to provide plants containing the DNA molecule or recombinant DNA molecule with useful traits, such as improved yield, improved food and / or feed properties, improved nitrogen utilization efficiency, improved biofuel properties, delayed flowering, non-flowering, increased resistance to biological stress, increased resistance to abiotic stress, enhanced lodging resistance, increased growth rate, increased biomass, and Use of a DNA molecule according to any one of claims 1 to 4 for the purpose of conferring useful traits such as enhanced spur growth, enhanced branching, delayed flowering, delayed senescence, increased number of flowers, improved high-density planting configuration, improved photosynthesis, increased root mass, increased cell number, improved viability, improved seedling size, increased cell division rate, improved metabolic efficiency, and / or increased meristematic size; for the purpose of obtaining a plant or seeds therefrom that exhibits the useful traits of (iii)(iii); or for the purpose of growing a population of plants that exhibit the useful traits of (iv)(iii); Herein, the plant in (i), (ii), (iii), or (iv) is rice, wheat, barley, potato, sweet potato, corn, soybean, cotton, or canola plant; or the seed in (iii) is rice, wheat, barley, corn, soybean, cotton, or canola plant.

Images