Self-purified nucleic acid coding library
The method of selective cleavage from a solid support using cleavage groups and orthogonal linkers addresses the limitations of existing DEL construction, enabling high-purity and complex nucleic acid coding libraries with enhanced screening performance and automation suitability.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- ショイエルマン イェルク
- Filing Date
- 2021-10-21
- Publication Date
- 2026-07-01
AI Technical Summary
Existing methods for constructing DNA-encoded chemical libraries (DELs) are limited by variable yields and the number of consecutive synthesis steps, restricting the size and purity of the libraries, particularly in incorporating complex structures and numerous building blocks.
A method for generating nucleic acid coding libraries that involves selective cleavage from a solid support using cleavage groups to release intact or complete library members, allowing for the production of large and/or pure libraries with complex structures by covalently bonding chemical building blocks and coding oligonucleotides to a scaffold, and then releasing them from the support using orthogonal linkers.
Enables the production of high-purity and complex nucleic acid coding libraries with improved screening performance, eliminating the need for additional purification steps and facilitating automation, thus enhancing the efficiency and quality of DELs.
Smart Images

Figure 0007883239000003 
Figure 0007883239000004 
Figure 0007883239000005
Abstract
Description
[Technical Field]
[0001] This invention relates to nucleic acid coding chemical libraries, particularly self-purified nucleic acid coding chemical libraries, as well as methods for producing and applying the same. [Background technology]
[0002] DNA-coded chemical libraries (DELs) are a powerful tool for drug development. The first proposed method for generating DNA-coded chemical libraries involves the stepwise synthesis of polymers (e.g., peptides) and oligonucleotide sequences (functioning as coding sequences) alternately on a common linker (e.g., beads) using split and pool cycles (Brenner, S. and Lerner, RAPNAS USA 89(1992), 5381-5383; U.S. Patent No. 5,573,905; WO93 / 20242). After affinity capture against the target protein, a population of identifier oligonucleotides of selected library members is amplified by PCR. The structure of the chemical is then deciphered by sequencing of the PCR product. The coding procedure was assumed to be performable by various methods, including chemical synthesis, DNA polymerization, or ligation of DNA fragments (Brenner, S. and Lerner, RAPNAS USA 89(1992), 5381-5383; U.S. Patent No. 5,573,905; WO93 / 20242).Subsequently, various methods for generating DNA-encoded chemical libraries have been described in the field (e.g., Mannocci, L. et al. PNAS USA 105(46):17670-17675; Brenner, S. and Lerner, RAsupra; Nielsen, J., et al., J.Am.Chem.Soc.115(1993); Needels et al., MC, PNAS USA 90(1993), 10700-10704; Gartner, ZJ, et al., Science 305(2004), 1601-1605; Melkko, S., et al., Nat.Biotechnol.22 568-574(2004); Sprinz, KI, et al., Bioorg.Med.Chem.Lett.15(2005), pp.3908-3911; Leimbacher (See also: et al Chemistry. 2012 Jun 18;18(25):7729-37; Clark et al Nat Chem Biol. 2009 Sep;5(9):647-54; WO2009 / 077173; WO2003 / 076943; European Patent No. 3284851; European Patent No. 3184674).
[0003] The established use of DEL technology enables the screening of a large number of compounds (typically on the order of 1 million to 100 million) individually encoded by specific nucleic acid tags, and allows screening based on the overall affinity of DELs to the target protein to be performed in a single experiment. DEL technology is now widely used in the pharmaceutical industry.
[0004] Previously, the variable yields of individual synthesis steps in the construction of DELs have limited the number of consecutive synthesis steps and the properties of the building blocks that can be incorporated. A method that allows for the construction of DELs of increased size and / or purity would be useful. [Overview of the project]
[0005] The inventors have developed a method for generating nucleic acid coding libraries that self-purifies intact or complete library members from intermediates by selective cleavage from a solid support. This can facilitate the production of large and / or pure nucleic acid coding libraries and / or nucleic acid coding libraries in which, for example, individual members have complex structures and / or numerous building blocks. Libraries produced by these methods may, for example, exhibit improved screening performance and / or contain members that can bind to large surfaces of target proteins.
[0006] A first aspect of the present invention is a method for producing a nucleic acid coding compound, comprising the following steps: To provide a new compound including a scaffold connected to a solid support by a linker, Covalently bonding one or more chemical building blocks to a newly formed compound to form a chemical moiety bonded to a scaffold, Covalently bonding one or more coding oligonucleotides encoding chemical building blocks to a nascent compound to form a coding nucleic acid portion bound to a scaffold, The process involves attaching a cleavage group to the chemical part, nucleic acid part, or scaffold of a compound, The present invention provides a method comprising reacting a linker with a cleaving group such that the linker is cleaved and the compound is released from the solid support.
[0007] A second aspect of the present invention is a method for generating a nucleic acid coding chemical library for each library member, the following: To provide a new member including a scaffold connected to a solid support by a linker, Covalently bonding one or more chemical building blocks to a newly formed member to form a chemical part connected to the scaffold, Covalently bonding one or more coding oligonucleotides encoding chemical building blocks to a newly formed member to form a coding nucleic acid portion bound to a scaffold, coupling a cleavage group to a chemical moiety, nucleic acid moiety, or scaffold; and reacting a linker with a cleavage group such that the linker is cleaved and a member is released from the solid support.
[0008] In some embodiments of the first and second aspects, a cleavage group can be attached to a chemical moiety (Figure 1A). Selective release from the solid support can be initiated by the presence of a complete chemical moiety, or a complete segment of a chemical moiety.
[0009] In other embodiments of the first and second aspects, a cleavage group may be attached to a coding nucleic acid moiety (Figure 1B). Selective release from the solid support can be initiated by the presence of a complete nucleic acid moiety, or a complete segment of a nucleic acid moiety.
[0010] In other embodiments of the first and second aspects, a cleavage group may be attached to a scaffold (Figure 1C). Selective release from the solid support can be initiated by the presence of a complete scaffold.
[0011] In some embodiments of the first and second aspects, a nascent compound or a member's scaffold can be further connected to the solid support by a second linker such that the scaffold is connected to the solid support by a first linker and a second linker. The method comprises providing a nascent compound or member comprising a scaffold linked to the solid support by a first linker and a second linker; covalently attaching one or more chemical building blocks to the nascent compound or member to form a chemical moiety attached to the scaffold; covalently attaching a coding oligonucleotide encoding one or more chemical building blocks to the nascent compound or member to form a coding nucleic acid moiety attached to the scaffold; attaching a first cleavage group to one of the chemical moiety or scaffold of the coding nucleic acid moiety; attaching a second cleavage group to another coding nucleic acid moiety, chemical moiety or scaffold; The first linker and the first cleaving group are reacted so that the first linker is cleaved. This may include reacting a second linker with a second cleaving group such that the second linker is cleaved and a compound or member is released from the solid support.
[0012] The first and second linkers may be cleaved sequentially or simultaneously in any order.
[0013] A compound or member is released from the solid support if the solid support contains (i) both a complete chemical portion or a complete segment of that chemical portion and a complete nucleic acid portion or a complete segment of that nucleic acid portion, (ii) a complete chemical portion or a complete segment of that chemical portion and a complete scaffold, or (iii) a complete coding nucleic acid portion, or both a complete segment of that coding nucleic acid portion and a complete scaffold.
[0014] In some embodiments, the cleavage group or the first cleavage group may be covalently bonded to the chemical moiety or scaffold. Preferably, the cleavage group is covalently bonded to the terminal chemical building block of the chemical moiety.
[0015] In other embodiments, the cleavage group may be non-covalently bonded to a chemical moiety or scaffold. For example, this can be achieved by bonding an anchor oligonucleotide to a chemical moiety or scaffold, preferably to the terminal chemical building block of the chemical moiety, and by hybridizing the anchor oligonucleotide with an auxiliary oligonucleotide linked to the cleavage group. For example, a method for generating a nucleic acid coding compound or chemical library involves the following steps: Binding anchor oligonucleotides to a chemical moiety or scaffold, To provide an auxiliary oligonucleotide bound to a cleavage group, Hybridizing the bound oligonucleotide with the auxiliary oligonucleotide, This may also include reacting the linker with a cleaving group so that the linker is cleaved.
[0016] In some embodiments, the cleavage group may be covalently bonded to the nucleic acid moiety. Preferably, the cleavage group is covalently bonded to the end of the nucleic acid moiety.
[0017] In other embodiments, the cleavage group may be non-covalently bonded to the nucleic acid moiety by, for example, hybridizing the coding nucleic acid moiety with an auxiliary oligonucleotide linked to the cleavage group. Preferably, the auxiliary oligonucleotide is hybridized to the terminal of the coding nucleic acid moiety. For example, a method for generating a nucleic acid coding compound or chemical library is as follows: To provide an auxiliary oligonucleotide covalently bonded to a cleavage group, Hybridizing auxiliary oligonucleotides into the coding nucleic acid portion, This may include reacting the linker with a cleaving group so that the linker is cleaved.
[0018] The linker may be converted or activated after binding to the chemical moiety, scaffold, or coding nucleic acid moiety, and before reaction with the cleavage group.
[0019] In some embodiments, the cleavage group may not require further transformation after binding to the chemical moiety, scaffold, or coding nucleic acid moiety, and before reaction with the linker. In other embodiments, the cleavage group may be activated after binding to the chemical moiety, scaffold, or coding nucleic acid moiety, and before reaction with the cleavage group.
[0020] In some preferred embodiments, the capping step may be performed after the addition of each chemical building block and optionally after the addition of each coding oligonucleotide. This prevents the cleavage group from binding to an incomplete nucleic acid or peptide nucleic acid coding compound.
[0021] In embodiments described herein, in addition to cleaving the linker and liberating the compound or member, the cleaving group may form covalent bonds that connect the ends of the chemical moiety to the scaffold, generating a macrocyclic ring. For example, the reaction between the linker and the cleaving group may generate cyclizing elements or cleavage segments that covalently bond the chain of chemical building blocks to the scaffold, such that the chemical substance presented by the member is macrocyclic.
[0022] A third aspect of the present invention is a method for producing a nucleic acid coding compound, comprising the following steps: To provide a new compound including a scaffold connected to a solid support by a first linker, Covalently bonding one or more chemical building blocks to a newly formed compound to form a chemical moiety bonded to a scaffold, Covalently bonding one or more coding oligonucleotides encoding chemical building blocks to a nascent compound to form a coding nucleic acid portion bound to a scaffold, Connecting the chemical part of the compound to a solid support with a second linker, To break open the first linker, The present invention provides a method comprising cleaving a second linker so that the compound is released from the solid support.
[0023] The first and second linkers according to the third embodiment may be orthogonally cleavable.
[0024] In the third embodiment of the method, compounds having a complete chemical moiety are covalently bonded to a solid support by a second linker. Compounds having an incomplete chemical moiety are not covalently bonded to the solid support by the second linker. Therefore, compounds having an incomplete chemical moiety are selectively released from the solid support by cleavage of the first linker. Compounds having a complete chemical moiety remain bonded to the solid support by the second linker. Cleavage of the second linker selectively releases these compounds from the solid support.
[0025] Preferably, the capping step is performed after the addition of each chemical building block. Compounds with incomplete chemical portions may be left capped to prevent connection to the second linker.
[0026] In all of the first to third embodiments described herein, chemical building blocks can be sequentially added to a nascent member or compound to form a linear chemical moiety (i.e., a chain of chemical building blocks) with its terminus bonded to the nascent member and free ends. A coding oligonucleotide encoding each chemical building block can be sequentially added to a nascent member to form a linear coding nucleic acid moiety. The method of the present invention may include covalently bonding a chemical building block to a nascent compound or member, and covalently bonding a coding oligonucleotide encoding a chemical building block to a nascent member. This can be repeated one or more times to generate chemical moieties and coding nucleic acid moieties. Following the bonding of a chemical building block, unreacted species lacking the bonded chemical building block may be capped before the addition of the next chemical building block.
[0027] A fourth aspect provides a nucleic acid coding library generated by the methods of the first to third aspects.
[0028] These and other aspects and embodiments of the present invention will be described in more detail below. [Brief explanation of the drawing]
[0029] [Figure 1] Schematic diagrams of possible solid support compounds are shown. Solid support compounds (A), (B), and (C) each contain a solid support bonded to a scaffold by a linker. In each of (A), (B), and (C), the chemical moiety and the nucleic acid moiety are bonded to the scaffold. In (A), the cleavage group is bonded to the chemical moiety. In (B), the cleavage group is bonded to the nucleic acid moiety, and in (C), the cleavage group is bonded to the scaffold. Abbreviation: cleavage group (CG). [Figure 2]A schematic diagram of the self-purification of nucleic acids or peptide nucleic acid-coding compounds or chemical library members is shown. In the shown embodiment, the cleavage group is bound to the chemical moiety. The reaction between the cleavage group and the chemical moiety releases the self-purified compound from the solid support. In this shown embodiment, the reaction between the cleavage group and the linker results in a product (CG / linker product; or cleavage moiety) that connects the chemical moiety to the scaffold. A portion of the cleaved linker may remain bound to the solid support compound. Abbreviation: cleavage group (CG). [Figure 3] A schematic diagram of the self-purification of nucleic acids or peptide nucleic acid-coding compounds or chemical library members is shown. In the shown embodiment, the cleavage group is bound to the chemical moiety. The reaction between the cleavage group and the chemical moiety releases the self-purified compound from the solid support. In this shown embodiment, the reaction between the cleavage group and the linker results in a cleavage group product (CG product) bound to the chemical moiety. A portion of the cleaved linker may remain bound to the solid support compound. Abbreviation: cleavage group (CG). [Figure 4] This diagram illustrates the self-purification of nucleic acids or peptide nucleic acid coding compounds or chemical library members, using two orthogonal linkers for the purification of separate chemical and coding nucleic acid moieties. Two orthogonal cleavage groups are used, with cleavage group 1 (CG1) bound to the chemical moiety and cleavage group 2 (CG2) bound to the nucleic acid moiety. In the shown embodiment, cleavage group 1 (CG1) reacts with linker 1 to cleave linker 1, resulting in a product (CG1 / linker 1 product) that connects the chemical moiety to the scaffold. In the shown embodiment, cleavage group 2 (CG2) reacts with linker 2 to cleave linker 2, resulting in a cleavage group product (CG2 product) that connects to the nucleic acid moiety. Once both linkers are cleaved, the self-purified compound is released from the solid support. A portion of each cleaved linker may remain bound to the solid support compound. Abbreviations: cleavage group (CG), cleavage group 1 (CG1), cleavage group 2 (CG2). [Figure 5]Schematic diagrams of two possible arrangements of chemical building blocks in a solid support compound are shown. (A) shows a linear arrangement of chemical building blocks. In (A), building block 1 (chemical building block 1) is attached to the scaffold. In (A), building block 2 (chemical building block 2) is bonded to building block 1 (chemical building block 1). In (A), the building blocks are arranged to form a linear chain of building blocks ending with terminal building blocks (chemical building block n), which are bonded to cleavage groups (CG) in the embodiments shown next. (B) shows a cross-linked structure of the chemical moiety, which is formed by first bonding three building blocks to form a linear chain, and then bonding building block 4 (chemical building block 4) to both building block 3 (chemical building block 3) and building block 1 (chemical building block 1). In the embodiment shown in (B), further building blocks may be bonded to building block 3 (chemical building block 3), terminating at a terminal building block (chemical building block n), which is then bonded to a cleavage group (CG). Abbreviations: cleavage group (CG), building block (chemical building block), building block 1 (chemical building block 1), building block 2 (chemical building block 2), building block 3 (chemical building block 3), building block 4 (chemical building block 4), terminal building block (chemical building block n). [Figure 6]Schematic diagrams of two possible structures of the self-purified compound are shown. Each self-purified compound includes a scaffold bound to the nucleic acid moiety and a chemical moiety. Embodiment (A) shows a linear self-purified compound. In (A), the building blocks are arranged linearly, and the self-purification reaction produces a cleavage group product (CG product) bound to the terminal building block (chemical building block n). In (A), the scaffold, building blocks, and cleavage group product (CG product) are arranged linearly. Embodiment (B) shows a cyclic self-purified compound. In (A), the building blocks are arranged linearly, and the self-purification reaction produces a product (CG / linker product) that links the terminal building block (chemical building block n) and the scaffold. In (B), the scaffold, building blocks, and cleavage group / linker product (CG / linker product) are arranged cyclically. [Figure 7]Schematic diagrams of two possible structures of the self-purified compound are shown. Each self-purified compound includes a scaffold bound to the nucleic acid moiety and a chemical moiety. Embodiment (A) shows a branched self-purified compound. In (A), building block 1 (chemical building block 1), building block 2 (chemical building block 2), building block 4 (chemical building block 4), and terminal building block (chemical building block n) are arranged in a linear structure. In (A), building block 3 (chemical building block 3) is bound to building block 2 (chemical building block 2) as an appendage. In (A), the building blocks are arranged in a branched manner, and the self-purification reaction produces a cleavage group product (CG product) bound to the terminal building block (chemical building block n). In (A), the scaffold, building blocks, and cleavage group product (CG product) are arranged in a branched manner. Embodiment (B) shows a cyclic self-purified compound. In (B), building block 1 is arranged in a straight line from the terminal building block, and building block 2 (chemical building block 2) and building block 4 (chemical building block 4) are further bridged. In (B), a product (CG / linker product) that connects the terminal building block (chemical building block n) to the scaffold is produced by a self-purification reaction. In (B), the scaffold, building blocks, and cleavage group / linker product (CG / linker product) are arranged in a bicyclic manner. Abbreviations: cleavage group (CG), building block (chemical building block), building block 1 (chemical building block 1), building block 2 (chemical building block 2), building block 3 (chemical building block 3), building block 4 (chemical building block 4), terminal building block (chemical building block n). [Figure 8]This diagram illustrates the selective cleavage of pure nucleic acids or peptide nucleic acid-coding compounds or chemical library members from a solid support. Solid support compounds containing a fully synthesized structure between the linker and the cleavage group (CG) are released from the solid support (upper panel). The cleaved product, being capped in synthesis and lacking the cleavage group (CG), is not cleaved from the solid support (lower panel). Abbreviation: cleavage group (CG). [Figure 9] A schematic diagram of selective ligation of continuous nucleic acid codes is shown. Within the nucleic acid moiety, code 1 can only bind to code 2, but not to code 3. Compounds containing a complete code 1 ligated to code 2 can bind to code 3 (upper panel). In contrast, compounds that are cleaved due to the failure of code 2 to bind to code 1 may not be ligated to code 3 in subsequent ligation (lower panel). [Figure 10] This diagram shows a schematic representation of the selective introduction of linker 2 into a completely synthesized solid support compound. For complete solid support compounds, the chemical moiety can be linked to the solid support, or to the branching region between the solid support and linker 1, via linker 2 (top panel). In contrast, linker 2 may not be successfully installed in compounds with incomplete chemical moieties, such as capped compounds (bottom panel). [Figure 11] This diagram illustrates the selective release of nucleic acid or peptide nucleic acid coding compounds or chemical library members with incomplete chemical moieties from a solid support. Cleavage of linker 1 releases compounds without a second linker (linker 2) from the solid support. Nucleic acid coding compounds with cleaved chemical moieties are released from the solid support by cleavage of linker 1 (lower panel). Nucleic acid coding compounds or library members containing both linker 1 and linker 2 remain bound to the solid support after cleavage of linker 1 (upper panel). The selective release of compounds with cleaved or capped chemical moieties results in a self-purification effect. [Figure 12]A schematic diagram illustrates the release of nucleic acids or peptide nucleic acid-coding compounds or chemical library members with complete chemical moieties from a solid support by cleavage of a second linker (linker 2). Linker 2 removes undesirable impurity compounds, following the cleavage of linker 1 and washing of the solid support. [Figure 13] The analytical LCMS data for the preparation of the 5'-azide modified single-strand oligonucleotide (Example 1) are shown. (A) shows a chromatogram measuring the absorbance at 260 nm for the starting oligonucleotide (sequence 1). The deconvoluted mass spectrum for the starting oligonucleotide (sequence 1) is shown in (C). (B) shows a chromatogram measuring the absorbance at 260 nm for the product 5'-azide modified single-strand oligonucleotide. (D) shows the deconvoluted mass spectrum of the product peak. [Figure 14] The LCMS data for cleavage of newly formed library members are shown (Example 2). (A) and (B) show chromatograms with absorbance measured at 260 nm. (C) and (D) show the mass spectrum of the product peak at 3.84 min and the deconvoluted mass spectrum, respectively. [Figure 15] Chemical structures detailing the activation of the MeDbz linker in nucleic acid coding library members are shown (Examples 4 and 5). Conversion (A) shows the reaction of MeDbz with p-nitrophenyl chloroformate. Reaction (B) shows the final step of linker activation. This is an example of a linker activation step for self-purification. [Figure 16] The chemical structures for the reduction of disulfide bonds in lipoic acid cleavage groups are shown (Examples 4 and 5). This is an example of a cleavage group deprotection step for self-purification. [Figure 17]The self-elution of nucleic acid coding library members is demonstrated (Examples 4 and 5). The shown chemical structures represent the reaction of a thiol-containing cleavage group with an activated MeNbz linker. This releases the self-eluted library member from the solid support. This step yields a cyclic compound having a thioester. Two possible cyclic compounds are obtained, one of which has a thiol in one of the cleavage groups that reacted with the linker. [Figure 18] The chemical structure of the hydrolysis of the cyclic self-purified library member via thioester linkage is shown (Example 4). In this case, the product obtained after thioester hydrolysis is linear. [Figure 19] The chemical structures and analytical LCMS spectra of the autoeluting model nucleic acid coding library members observed after precipitation of the supernatant in the further incubation step following TCEP reduction are shown (Example 4). Chemical structures (A) and (B) were observed in the LCMS spectra of (C) and (D). (B) is a linear autoeluting product formed by hydrolysis of a cyclic thioester intermediate. (A) is a linear autoeluting product formed by ring-opening of a cyclic thioester intermediate with ethanol, which is added in the precipitation step. (C) is a chromatogram of absorbance at 260 nm, and (D) is a chromatogram of absorbance at 280 nm. [Figure 20] The mass spectra obtained from LCMS analysis of self-eluting model nucleic acid coding library members are shown (Example 4). (A) and (B) show the mass spectra and deconvoluted mass spectra of the self-eluting library member compounds shown in Figure 19A, respectively. (C) and (D) show the mass spectra and deconvoluted mass spectra of the self-eluting library member compounds shown in Figure 19B, respectively. [Figure 21]The chemical structures and LCMS spectra of the autoeluting nucleic acid library members prepared in Example 5 are shown. (A) shows the structures of two possible cyclic autoeluting nucleic acid coding library members. (B) shows the chromatogram at 260 nm, and (C) is the total ion current (TIC). The mass peak corresponding to the cyclic autoeluting library member is observed at 5.88 min. [Figure 22] The chemical structures and LCMS spectra of the autoeluting nucleic acid library members prepared in Example 5 are shown. (A) shows the structures of two possible cyclic autoeluting nucleic acid coding library members. (B) and (C) are the peak mass spectra and corresponding deconvoluted mass spectra of the autoeluting nucleic acid library members, respectively. The mass of the desired cyclic autoeluting nucleic acid coding library member was observed. [Figure 23] The reaction schemes of the steps in the synthesis of the new library members are shown (Examples 6 and 7). First, the amine-functionalized solid support was bonded to Fmoc-Lys(Mtt)-OH (A). Next, Fmoc deprotection and coupling to HMBA followed (B). Subsequently, amide coupling to Fmoc-Pra-OH is shown (C). [Figure 24] The reaction scheme of the steps in the synthesis of nucleic acid coding library members is shown (Example 6). First, the product shown in Figure 23 was deprotected with Fmoc and then coupled to the 1-(1,1-dimethylethyl)butanedioate building block (A). Next, the distal group of the building block was deprotected with tBu, and the lysine side chain was deprotected with Mtt using TFA in dichloromethane (B). [Figure 25] The reaction scheme of the steps in the synthesis of nucleic acid coding library members is shown (Example 6). Oligonucleotide bonding by copper-catalyzed azide-alkyne cycloaddition (CuAAC) is shown in (A). (B) shows the amide coupling reaction carried out on a solid support in the presence of DNA. (B) is the first step of the installation of the second linker. [Figure 26]The reaction scheme of the steps in the synthesis of nucleic acid coding library members is shown (Example 6). The product shown in Figure 25 was reacted with an alkyne-containing Dbz linker derivative by amide coupling (A). Next, a CuAAC reaction was carried out to obtain a cyclic solid support compound (B). The cyclized compound contains a first linker, the HMBA linker, and a second linker, the Dbz linker. [Figure 27] The reaction scheme for the first step in the self-purification of nucleic acid coding library members is shown (Example 6). The first linker of the product in Figure 26 was cleaved under basic conditions. In this step, the non-cyclized compound was released from the solid support. Undesirable by-products may be washed away from the solid support in this step. [Figure 28] The reaction scheme for cleaving the second linker for the self-purification of nucleic acid coding library members is shown (Example 6). First, the second linker, Dbz, was activated using isopentyl nitrite (A). In (B), the activated linker was then cleaved under basic conditions in water and DMSO. This released the self-purified nucleic acid coding library members from the solid support. [Figure 29]The LCMS spectra of the sample prepared in Example 6 are shown. (A) shows the LCMS spectrum obtained by cleaving the intermediate in the synthesis of the nucleic acid coding library member from a solid support. The analyzed intermediate is after coupling to the Dbz linker derivative and before CuAAC. Cleavage of the HMBA linker yields the desired intermediate, as shown at 4.01 min of chromatogram (A). The chemical structure of the desired intermediate is shown in (A). Furthermore, the analyzed sample contains undesirable intermediate products. These may be, for example, compounds that did not undergo the preceding amide coupling step in the synthesis. (B) shows the chromatogram obtained by cleaving the HMBA linker, which is the first linker, after the final CuAAC step in the synthesis of the nucleic acid coding library member (Example 6). This is the first step in the self-purification of the nucleic acid coding library member. In this step, undesirable, uncyclized products are released from the solid support. Comparing chromatogram (B) with chromatogram (A), it is shown that all compounds are cleaved from the solid support in (B), except for the desired intermediate in (A). This is because the compound contains an alkyne and underwent CuAAC before cleavage in (B). This indicates that the CuAAC reaction was successful and only the undesirable product was released from the solid support in this step. (C) shows the chromatogram of the sample obtained after cleaving the second linker Dbz. The chromatogram shows the self-purified nucleic acid coding library member. The structure of the desired self-purified nucleic acid coding library member is shown in (C). [Figure 30] The LCMS spectra of the self-purified nucleic acid coding library members prepared in Example 6 are shown. (A) shows the chromatogram at 260 nm absorbance. (B) shows the chromatogram at 280 nm absorbance. (C) shows the mass spectrum of the product peak at 3.94 min. (D) shows the deconvoluted mass spectrum of the product peak at 3.94 min. The mass corresponding to the desired self-purified nucleic acid coding library member is observed. [Figure 31] The reaction scheme of the steps in the synthesis of a model nucleic acid coding library member is shown (Example 7). (A) shows Fmoc deprotection followed by amide coupling to Fmoc-Dbz-OH. (B) shows Mtt deprotection of the lysine side chain in a solid support compound. [Figure 32] The reaction scheme of the steps in the synthesis of a model nucleic acid coding library member is shown (Example 7). Oligonucleotide bonding by copper-catalyzed azide-alkyne cycloaddition (CuAAC) is shown in (A). (B) shows the amide coupling reaction carried out on a solid support in the presence of DNA. (B) is the first step of the installation of the second linker. [Figure 33] The reaction scheme of the steps in the synthesis of a model nucleic acid coding library member is shown (Example 7). Following the Fmoc deprotection of the product shown in Figure 32, amide coupling to hexic acid was performed (A). Next, a CuAAC reaction was carried out to obtain a cyclic solid support compound (B). The cyclized compound contains a first linker, the HMBA linker, and a second linker, the Dbz linker. [Figure 34] The reaction scheme for the first step in the self-purification of nucleic acid coding library members is shown (Example 7). The first linker of the product in Figure 33 was cleaved under basic conditions. In this step, the non-cyclized compound was released from the solid support. Undesirable by-products may be washed away from the solid support in this step. [Figure 35] The reaction scheme for cleaving the second linker for the self-purification of nucleic acid coding library members is shown (Example 7). First, the second linker, Dbz, was activated using isopentyl nitrite (A). In (B), the activated linker was then cleaved under basic conditions in water and DMSO. This released the self-purified nucleic acid coding library members from the solid support. [Figure 36]The LCMS spectra of the self-purified nucleic acid coding library members prepared in Example 7 are shown. (A) shows the chromatogram at 260 nm absorbance. (B) shows the chromatogram at 280 nm absorbance. (C) shows the mass spectrum of the product peak at 3.97 min. (D) shows the deconvoluted mass spectrum of the product peak at 3.97 min. These data indicate that the desired self-purified nucleic acid coding library members were obtained. These data further indicate that the Dbz linker is activated. [Figure 37] Figure 37(A) shows a schematic diagram of DNA ligation on a solid support (Example 8). The code is ligated to the oligonucleotide bound to the solid support using an adapter oligonucleotide and T4 DNA ligase. The LCMS chromatogram (B) of the absorbance at 260 nm was obtained by cleaving the ester linker after ligation conditions. The ligation product was observed at 4.47 mins. The remaining adapter, code, and unligated starting material were further observed. (C) shows the deconvoluted mass spectrum of the ligation product peak. The mass of the desired ligation product was observed. [Figure 38] (A) shows the adapter oligonucleotide, (B) the code, and (C) the deconvoluted mass spectrum of the starting material peak in the LC-MS chromatogram shown in Figure 37B. [Figure 39] The reaction scheme for the transformation performed in Example 9 is shown. [Figure 40]The LCMS spectra of the sample prepared in Example 9 are shown. Figure 40A shows the chromatogram at 260 nm of the sample prepared in step 9.6 and the chemical structure of the starting material. The major peak observed in Figure 40A corresponds to the desired starting material. Figure 40C shows the deconvoluted mass spectrum at the retention time of the major peak in the chromatogram (Figure 40A). The mass corresponding to the desired starting material is observed. Figure 40B shows the chromatogram at 260 nm of the sample prepared in step 9.8 and the chemical structure of the desired product. The major peak observed in Figure 40B corresponds to the desired product. Figure 40D shows the deconvoluted mass spectrum at the retention time of the major product in the chromatogram (Figure 40B). The mass corresponding to the desired product is observed. This example demonstrates that chemical transformations can be performed on a solid support on DNA with a high conversion rate. [Modes for carrying out the invention]
[0030] In some embodiments, a nucleic acid coding library may be produced as described herein by a method comprising preparing, for each library member, a scaffold bonded to a solid support via a linker, a chemical moiety bonded to the scaffold, a nucleic acid, a solid support comprising a nuclear moiety bonded to the scaffold, and a cleavage group bonded to the chemical moiety, scaffold, or nucleic acid moiety. This method further comprises reacting the cleavage group with a linker to release the compound from the solid support and form the library member.
[0031] Macrocyclic molecules can be generated by the cleavage of the linker by cleavage groups. These macrocyclic molecules may include a chemical moiety and a scaffold. The ends of the chemical moiety can be covalently bonded to the scaffold of the macrocyclic molecule by cyclizing elements generated by the reaction of cleavage groups with activated linkers.
[0032] Members having a cleavage group for a complete chemical moiety, scaffold, or coding nucleic acid moiety (i.e., species containing all the intended chemical building blocks, coding oligonucleotides, or other elements) are selectively released from the solid support via linker cleavage by the cleavage group. For example, a complete chemical moiety may be a chain of linked chemical building blocks (i.e., species in which all the intended chemical building blocks are present in the chemical moiety). Since the cleavage group does not bind to compounds or members having a cleavage group for an incomplete or partial chemical moiety, scaffold, or coding nucleic acid moiety (e.g., a capped unreacted or partially reacted intermediate), these compounds or members are not released from the solid support. For example, members with an incomplete or partial chemical moiety that does not contain all the intended chemical building blocks are not released from the solid support. This may result in the self-purification of complete compounds or library members, eliminating the need for further purification using chromatographic techniques such as HPLC. The self-purification described herein enables the production of very pure members and facilitates the production of complex library members involving many synthetic steps. The methods described herein may be faster compared to existing DEL production techniques. These could be suitable for automation, enabling the creation of a wide variety of high-quality DELs.
[0033] The process of separating a complete member or compound from an incompletely synthesized compound that has not been cleaved from a solid support may be referred to herein as autopurification. A compound or member that is released from the solid support after the cleavage of a linker(s) and comprises a scaffold, a chemical moiety, and a nucleic acid moiety, and may also contain a portion of the linker and a portion of the cleavage group that reacted together in the cleavage reaction, may be referred to as an autopurified compound or member.
[0034] In other embodiments, a nucleic acid coding library may be produced as described herein by a method comprising preparing a solid support compound for each library member, comprising a scaffold bonded to a solid support via a first linker, a chemical moiety bonded to the scaffold, a nucleic acid moiety bonded to the scaffold, and a second linker connecting the chemical moiety to the solid support. This method further comprises cleaving the first linker, optionally washing, and then cleaving the second linker to release the compound from the solid support and form the library member.
[0035] The second linker does not bind to compounds or members having incomplete or partial chemical moieties (e.g., capped unreacted or partially reacted intermediates). These compounds or members are bound to the solid support only by the first linker and are released from the solid support by cleavage of the first linker. For example, a member having an incomplete or partial chemical moiety that does not contain all of the intended chemical building blocks can be released from the solid support and removed by cleavage of the first linker. Members having a complete chemical moiety (i.e., species in which all of the intended chemical building blocks are present) are bound to the solid support by both the first and second linkers. For example, a complete chemical moiety may be a chain of linked chemical building blocks (i.e., species in which all of the intended chemical building blocks are present in the chemical moiety). These members are selectively released from the solid support by cleavage of the second linker. This may result in the self-purification of complete compounds or library members, eliminating the need for further purification using chromatographic techniques such as HPLC. The self-purification described herein enables the production of very pure members and facilitates the production of complex library members involving many synthetic steps. The methods described herein may be faster compared to existing DEL production technologies. They may be suitable for automation and will enable the production of a wide variety of high-quality DELs.
[0036] The process of separating a complete compound from an incompletely synthesized compound released from a solid support by the cleavage of a first linker may be referred to herein as autopurification. A compound or member released from the solid support after the cleavage of a second linker, comprising a scaffold, a complete chemical moiety, and a nucleic acid moiety, and potentially comprising a portion of the linker retained after the cleavage reaction, may be referred to as an autopurified compound or member.
[0037] The first and second linkers may be orthogonally cleavable. For example, the reaction conditions required to cleave the first linker may differ from those required to cleave the second linker. Thus, the first and second linkers can be cleaved independently by changing the reaction conditions. The first linker must be stable during the synthesis of the solid-supporting compound. The second linker must be stable to the cleavage conditions of the first linker (i.e., the second linker must not be cleaved under conditions that cause the cleavage of the first linker). The cleavage conditions of the first and second linkers must not cause degradation or destruction of the nucleic acid moiety.
[0038] In some embodiments, the first and / or second linker may be activated before cleavage.
[0039] Suitable first and / or second linkers may include ester linkers, photocleavable linkers, amino(methyl)aniline (MeDbz), aminoaniline (Dbz), masked thioesters, sulfonamides, oxidatively cleavable linkers, reductively cleavable linkers, and enzymatically cleavable linkers.
[0040] A suitable first and / or second linker may include a linker that can be cleaved by a nucleophile. Examples of linkers that can be cleaved by a nucleophile may include thioesters, sulfonamides, benzimidazolone (e.g., MeNbz), and benzotriazole (e.g., the Dbz linker activated by isopentyl nitrite).
[0041] Suitable base-cleavable linkers, such as ester linkers, can be cleaved at high pH. Examples of base-based linkers include esters, benzyl esters, and 4-(hydroxymethyl)benzoic acid (HMBA) (Usanov, DL et al Nat. Chem. 10, 704-714 (2018); Soural, M. et al Linkers for Solid-Phase Peptide Synthesis. in Amino Acids, Peptides and Proteins in Organic Chemistry vol. 3 273-312 (Wiley-VCH, 2011)).
[0042] Photocleavable linkers can be cleaved by light irradiation. Examples of photocleavable linkers include ortho-nitrobenzyloxy and ortho-nitrobenzylamino, ortho-nitrobetallyl, phenacyl, pivaloyl, benzoin linkers, and other photounstable linkers (Mikkelsen, RJTet et al. Photolabile Linkers for Solid-Phase Synthesis. (2018) doi:10.1021 / acscombsci.8b00028).
[0043] Examples of linkers that can be oxidatively cleaved include geminal diols such as L-tartaric acid, Ceramox, and linkers based on isoceramox linkers (Usanov, DL et al Nat. Chem. 10, 704-714 (2018); Pomplun et al Angew. Chemie-Int. Ed. 59, 11566-11572 (2020). These can be cleaved by, for example, sodium periodate.
[0044] Other suitable first and / or second linkers are available in the art and include sulfonamide linkers (Mende, F et al. J. Am. Chem. Soc. 132, 11110-11118 (2010)) and cleavable linkers (Scott, PJH Linker Strategies in Solid-Phase Organic Synthesis (2009); Hermanson, GT, Bioconjugate Techniques: Third Edition (2013); Leriche, G., Chisholm, L. & Wagner, A., Cleavable linkers in chemical biology (2012)). In some embodiments, the first and second linkers may be incorporated into a single chemical substance. For example, a single first and second linker may be based on iminodiacetic acid. The first linker may be cleaved in a deprotection-mediated cyclization to produce a second linker of diketopiperazine, which is then cleaved at high pH. (Pa Tek, M. & Lebl, M. Safety-Catch and Multiply Cleavable Linkers in Solid-Phase Synthesis. Biopoly vol. 47 (1998); Kocis, P., Krchnak, V. & Lebl, Tetrahedron Lett. 34, 7251-7252 (1993)).
[0045] Other suitable first and / or second linkers may contain two or more binding groups before binding to the solid support and scaffold and / or chemical moiety and / or nucleic acid moiety. For example, the linker may be bound to the solid support via a first binding group and to the scaffold and / or chemical moiety and / or nucleic acid moiety via a second binding group. The binding groups of the linker may be functional groups. Suitable first and / or second linkers may be homobifunctional or heterobifunctional with respect to their binding groups. A suitable heterobifunctional linker may include 3-[[(9H-fluoren-9-ylmethoxy)carbonyl]amino]-4-(methylamino)benzoic acid (Fmoc-MeDbz-OH), where the carboxylic acid group may be bound to the solid support and amine group, for example, after Fmoc deprotection, or to the scaffold, for example. Other suitable heterobifunctional linkers include 4-amino-3-[[(9H-fluoren-9-ylmethoxy)carbonyl]amino]benzoic acid (Fmoc-Dbz-OH) and 4-(hydroxymethyl)benzoic acid (HMBA).
[0046] A DNA-coding chemical library (DEL) is a collection of chemically diverse library members, each containing (i) a chemical moiety formed from a set of chemically bonded chemical building blocks, and (ii) a nucleic acid that codes for the set of chemical building blocks that make up this chemical moiety. The number of different members in a library represents the complexity of the library and is defined by the number of building blocks that make up each chemical moiety and the number of different variants of each building block.
[0047] A chemical moiety is a chemical substance or molecular structure represented by a library member and comprises one, two, or more chemical building blocks. The chemical moiety is covalently bonded to a scaffold and generated by the continuous covalent bonding of one or more chemical building blocks to form a linear or main chain with a terminal bonded to the scaffold and a free end. A cleavage group may be bonded to the chemical moiety. The various chemical moieties represented by members of the DEL library are formed from various combinations of chemical building blocks. Chemical moieties represented by DEL can be linear, macrocyclic, bicyclic, polycyclic, or branched compounds of varying sizes (e.g., Lipinski-like small and large compounds). In some embodiments, the chemical moiety can be any small molecule (i.e., a molecule with a molecular weight of less than about 1,000 daltons). In other embodiments, the chemical moiety can be any intermediate-sized molecule (i.e., a molecule with a molecular weight of less than about 5,000 daltons). The small molecules may be organic or inorganic, isolated (e.g., from a compound library or natural source), or obtained by derivatization of known compounds. The chemical portion may be designed or constructed to have one or more desired properties, such as the ability to bind to a biological target, solubility, availability of hydrogen bond donors and receptors, rotational degrees of freedom of bonding, positive charge, negative charge, in vivo stability, cell permeability, and / or oral availability.
[0048] The chemical moieties displayed in the nucleic acid coding chemistry library can bind to a single strand of nucleic acid ("single pharmacophore library") or to two different strands of hybridized nucleic acid, with one or more building blocks bound to each strand ("dual pharmacophore library").
[0049] The coding nucleic acid moiety is a nucleic acid tag or peptide nucleic acid tag that identifies chemical building blocks in the chemical moiety. The coding nucleic acid moiety may be a linear nucleic acid molecule including terminals and free ends attached to a compound or member. Preferably, the coding nucleic acid moiety is bound to a scaffold. To record previously or subsequently introduced chemical building blocks, the coding nucleic acid moiety may be extended by covalently attaching a coding oligonucleotide to the free end. The coding nucleic acid moiety may be used for the identification of self-purified compounds after amplification and nucleic acid sequencing. In some embodiments, a cleavage group may be bound to the nucleic acid moiety, for example, at the free end.
[0050] In the method described herein, members of a nucleic acid coding chemical library may be constructed on a solid support by adding chemical building blocks and coding oligonucleotides to a nascent member.
[0051] When bonded to a solid support, the nascent member may be called a solid support compound. A solid support compound is a compound that includes a solid support connected via a linker to a scaffold, a chemical moiety, a nucleic acid moiety, a cleavage group, and other elements of the nascent member.
[0052] Examples of solid support compounds according to several embodiments are shown in Figure 1. For example, a nucleic acid coding chemical library can be prepared as described herein in the following steps; To provide a set of newly formed members, each containing a scaffold connected to a solid support by a linker, Covalently bonding one or more chemical building blocks to newly formed members within the set to form a chemical part connected to the scaffold, and then bonding different chemical parts to different newly formed members within the set, To form a coding nucleic acid moiety bound to the scaffold of the nascent members within the set, each nascent member covalently binds to an oligonucleotide encoding one or more chemical building blocks bound to the nascent member, The process involves attaching cleavage groups to the chemical, nucleic acid, or scaffold parts of the newly formed members. It can be produced by a method that includes reacting the linker with the cleavage groups of each member such that the linker is cleaved and the members of the library are released from their respective solid supports.
[0053] Examples of self-purification reactions (i.e., reactions between cleavage groups and linkers) are illustrated in Figures 2 and 3. In Figures 2 and 3, self-purification is illustrated using a solid support compound within a cleavage group bonded to a chemical moiety.
[0054] The reaction between the cleavage group and the linker may result in the liberation of a compound or member from the solid support containing the cleavage portion (also called a cyclization element) formed by the reaction between the linker and the cleavage group (i.e., the cleavage group / linker product, see Figure 2). Part of the linker (i.e., the cleaved linker) may remain bound to the solid support.
[0055] In some embodiments, the cleavage portion may be connected to the chemical moiety when the cleavage group is connected to the chemical moiety, or to the scaffold when the linker is connected to the scaffold. The reaction between the cleavage group and the linker may result in a cyclization reaction that produces a cyclic compound bonded to the coding nucleic acid moiety (Figure 2). The cyclic compound may include the chemical moiety, the scaffold, and the cleavage portion.
[0056] In other embodiments, the cleaved portion may be connected to the chemical moiety if the cleaving group is connected to the chemical moiety. The reaction between the cleaving group and the linker may not result in cyclization during self-purification so that the cleaved portion is not connected to the scaffold (see Figure 3). In some embodiments, all or part of the linker (i.e., the cleaved linker) may remain connected to the scaffold.
[0057] An example of a solid support compound according to another embodiment is shown in Figure 10. For example, a nucleic acid coding chemical library is prepared as described herein in the following steps; To provide a set of newly formed members, each containing a scaffold connected to a solid support by a first linker, By covalently bonding one or more chemical building blocks to a newly formed member within the set, a chemical part is formed that is connected to the scaffold, and different chemical parts are bonded to different newly formed members within this set. To form a coding nucleic acid moiety bound to the scaffold of the nascent members in this set, each nascent member covalently binds to an oligonucleotide encoding one or more chemical building blocks bound to the nascent member, The chemical component of the new member is connected to the solid support by the second linker, and the first linker is cleaved. The second linker is cleaved so that the members of the library are released from their respective solid supports, It can be produced by a method that includes [this].
[0058] As described above, the first and second linkers may be able to be split orthogonally.
[0059] Examples of self-purification reactions (i.e., reactions between cleavage groups and linkers) are illustrated in Figures 10-12. Figures 10-12 illustrate self-purification using a solid support compound having a second linker bonded to the chemical moiety.
[0060] Cracks in the first linker may result in the liberation of compounds or members having incomplete or partial chemical parts from the solid support. These compounds or members can be removed, for example, by washing. Cracks in the second linker may result in the liberation of compounds or members having complete chemical parts from the solid support. The liberated compounds or members may each contain first and / or second cleavage portions (also called cyclization elements) formed by the cleavage of the first and / or second linkers. All or part of the first and / or second linkers (i.e., the cleaved linkers) may remain bonded to the solid support.
[0061] In some preferred embodiments, a nucleic acid coding chemical library may be synthesized by a series of splitting and pooling steps, each step including the incorporation of chemical building blocks into chemical moieties prior to, subsequently, or simultaneously with, the incorporation of coding oligonucleotides.
[0062] Individual nucleic acid coding compounds or library members may be synthesized by a method that first involves preparing a solid support compound.
[0063] In some embodiments, the solid support compound is prepared by linking a scaffold to the solid support via a linker, linking a coding nucleic acid moiety to the scaffold, linking a chemical moiety to the scaffold, and linking a cleavage group to the chemical moiety, scaffold, or nucleic acid moiety. Following the preparation of the solid support compound, the cleavage group is reacted with the linker so that the linker is cleaved and the nucleic acid coding compound or library member is released from the solid support. For example, the nucleic acid coding compound or library member is prepared as described herein in the following steps; To provide a new compound including a scaffold connected to a solid support by a linker, Covalently bonding one or more chemical building blocks to a newly formed compound to form a chemical moiety bonded to a scaffold, Covalently bonding one or more coding oligonucleotides encoding chemical building blocks to a nascent compound to form a coding nucleic acid portion, The cleavage group is attached to the chemical moiety, nucleic acid moiety, or scaffold. It can be produced by a method comprising reacting a linker with a cleaving group such that the linker is cleaved and the self-purified compound or library member is released from the solid support.
[0064] In other embodiments, a solid support compound is prepared by linking a scaffold to the solid support via a first linker, linking the coding nucleic acid portion to the scaffold, linking the chemical portion to the scaffold, and linking the chemical portion to the solid support via a second linker. Following the preparation of the solid support compound, the first linker is cleaved, then the second linker is cleaved, and the nucleic acid coding compound or library member is released from the solid support. For example, the nucleic acid coding compound or library member is released as described herein in the following steps; To provide a nascent compound including a scaffold connected to a solid support by a first linker, Covalently bonding one or more chemical building blocks to a newly formed compound to form a chemical moiety bonded to a scaffold, Covalently bonding one or more coding oligonucleotides encoding chemical building blocks to a nascent compound to form a coding nucleic acid portion, Connecting the chemical portion to the solid support with a second linker, To break open the first linker, The second linker is cleaved so that the second linker is cleaved and the self-purified compound or library member is released from the solid support, It can be produced by a method that includes [a specific method].
[0065] The first chemical building block can be bonded to the scaffold before, after, or simultaneously with the bonding of the first coding oligonucleotide to the scaffold.
[0066] Solid support compounds can be prepared, for example, by first bonding a linker to a solid support and then bonding a scaffold to the linker on the solid support; or by first bonding a scaffold to a linker to form a linker-scaffold conjugate and then bonding the linker-scaffold conjugate to a solid support.
[0067] The coding nucleic acid portion or a fragment of the coding nucleic acid portion may be bound to the scaffold before, after, or concurrently with the binding of the scaffold to the solid support.
[0068] Chemical parts or fragments of chemical parts, such as chemical building blocks, can be attached to the scaffolding before, after, or simultaneously with the attachment of the scaffolding to the solid support.
[0069] A scaffold is a chemical moiety to which chemical building blocks forming a chemical moiety are bonded. In some embodiments, preferably, the same chemical moiety forms the scaffold for all members of the library. The scaffold may be a solid support, a nucleic acid moiety, and at least a trifunctional chemical moiety connecting the chemical moieties.
[0070] The scaffold may contain a scavenging group. The scavenging group is a reactive chemical group that can react with the chemical building block to form a covalent bond connecting the chemical building block to the scaffold. This makes it possible to attach the chemical building block, which forms the chemical moiety, to the scaffold.
[0071] A cleavage group is a chemical reagent or enzyme capable of cleaving the linker, with or without prior activation of the cleavage group. In some embodiments, to provide a self-purified compound or member, the cleavage group may be covalently or noncovalently linked to a chemical moiety, nucleic acid moiety, or scaffold. The cleavage group may need to be activated after incorporation. The compound or member may be purified by selective liberation from the solid support due to linker cleavage by the cleavage group.
[0072] In some embodiments, the cleaving groups may be bound to the scaffold. Compounds or library members having a complete scaffold and cleaving groups can be selectively released from the solid support via linker cleavage by the cleaving groups.
[0073] In other embodiments, the cleavage group may be bonded to the chemical moiety. A compound or library member having a complete scaffold, chemical moiety, and cleavage group can be selectively released from the solid support via linker cleavage by the cleavage group.
[0074] In other embodiments, the cleavage group may be bound to a nucleic acid moiety, preferably to the terminal of the nucleic acid moiety. A compound or library member having a complete scaffold, a nucleic acid moiety, and a cleavage group can be selectively released from the solid support via linker cleavage by the cleavage group.
[0075] In other embodiments, the scaffold may be connected to a solid support by two different linkers (first and second linkers), and two different cleavage groups (a first cleavage group that cleaves the first linker and a second cleavage group that cleaves the second linker) may be present in the solid support compound. One of the cleavage groups may be bonded to a chemical moiety or scaffold, and the other cleavage group may be bonded to a nucleic acid moiety. For example, this method further: The first cleavage group is bonded to the chemical moiety or scaffold, Attaching the second cleavage group to the nucleic acid portion, The first linker and the first cleaving group are reacted so that the first linker is cleaved. The method may also include reacting a second linker with a second cleaving group such that the second linker is cleaved and a compound or member is released from the solid support. For example, the first linker may contain or consist of a substituted quinoxaline group, and the first cleaving group may contain or consist of an orthodithiophenol; the second linker may contain or consist of an amino(methyl)aniline (MeDbz) group, and the second cleaving group may contain or consist of a thiol cleaving group.
[0076] Selective release from the solid support may be initiated by the presence of both a complete chemical moiety and a complete scaffold, both a complete coding nucleic acid moiety and a complete scaffold, or more preferably both a complete chemical moiety and a complete nucleic acid moiety.
[0077] Figure 4 shows an example of the selective liberation of a compound or member prepared using two different linkers and two different cleavage groups. In Figure 4, the first cleavage group (CG1) is bound to the chemical moiety, and the second cleavage group (CG2) is bound to the nucleic acid moiety. The two different linkers connect the scaffold to the solid support. CG1 can react only with linker 1, while CG2 can react only with linker 2. The reaction between CG1 and linker 1 can occur before, during, or after the reaction between CG2 and linker 2. The compound is liberated from the solid support only when both linkers are cleaved. In the example shown in Figure 4, the reaction between CG1 and linker 1 is a cyclization reaction, resulting in the formation of a first cleavage group (i.e., the CG1 / linker 1 reaction product) that connects to the chemical moiety and the scaffold. CG2 reacts with linker 2 to produce a second cleavage group (i.e., the CG2 reaction product) that is bound to the nucleic acid moiety.
[0078] In some embodiments, the compound or member may be released from the solid support only if it includes both a complete chain of chemical building blocks of the chemical part and a complete nucleic acid molecule containing the coding oligonucleotides of all the chemical building blocks of the chemical part.
[0079] In some embodiments, the cleavage group may be non-covalently bonded to the chemical moiety or scaffold. Preferably, the cleavage group may be covalently bonded to terminal chemical building blocks in the chemical moiety (i.e., at the free ends of the chains of chemical building blocks forming the chemical moiety). This allows for the self-purification of the members or compounds constituting the entire chemical moiety.
[0080] In other embodiments, the cleavage group may be non-covalently bonded to the chemical moiety or scaffold by hybridization of two oligonucleotides. An anchor oligonucleotide may be covalently bonded to the chemical moiety or scaffold, preferably to the terminal chemical building blocks of the chemical moiety. The auxiliary oligonucleotide covalently bonded to the cleavage group may then be hybridized to the anchor oligonucleotide. This results in the cleavage group being non-covalently bonded to the chemical moiety or scaffold. The cleavage group can then react with the linker to cleave it, releasing a member or compound from the solid support. For example, the cleavage group may be bonded to the chemical moiety or scaffold as follows: Binding anchor oligonucleotides to a chemical moiety or scaffold, To provide an auxiliary oligonucleotide covalently bonded to a cleavage group, Hybridizing an auxiliary oligonucleotide with an anchor oligonucleotide, The linker can be bonded by a method that includes reacting the linker with a cleaving group so that the linker is cleaved.
[0081] In some embodiments, anchor oligonucleotides bound to a chemical moiety or scaffold can be synthesized sequentially on the chemical moiety or scaffold, respectively. The anchor oligonucleotides may be nucleic acid analogs, such as peptide nucleic acids. Peptide nucleic acids can be synthesized sequentially, for example, on the scaffold or chemical moiety.
[0082] Preferably, the anchor oligonucleotide can be covalently bonded to the terminal chemical building block of the chemical moiety.
[0083] The auxiliary oligonucleotide covalently bonded to the cleavage group may be a single-stranded polynucleotide that can specifically hybridize with the anchor oligonucleotide. Preferably, the auxiliary oligonucleotide covalently bonded to the cleavage group contains 10 or more base pairs.
[0084] In some embodiments, the cleavage group may be covalently bonded to a nucleic acid moiety, for example, the free end of the nucleic acid moiety.
[0085] In some preferred embodiments, the cleavage group may be linked to the coding nucleic acid moiety in a solid support compound by hybridization of an auxiliary oligonucleotide covalently bonded to the cleavage group. For example, the cleavage group may be linked to the coding nucleic acid moiety as follows: To provide an auxiliary oligonucleotide covalently bonded to a cleavage group, Hybridizing an oligonucleotide covalently bonded to a cleavage group into the coding nucleic acid portion, The linker can be bonded by a method that includes reacting the linker with a cleaving group so that the linker is cleaved.
[0086] Preferably, the auxiliary oligonucleotide hybridizes to the terminal portion of the coding nucleic acid (i.e., the region, segment, or part of the nucleic acid furthest or distal from the scaffold). This allows for the self-purification of the member or compound containing the entire nucleic acid portion.
[0087] The auxiliary oligonucleotide may be a single-stranded polynucleotide that can specifically hybridize to the coding nucleic acid portion. Preferably, the auxiliary oligonucleotide covalently bonded to the cleavage group contains 10 or more base pairs. Preferably, the auxiliary oligonucleotide covalently bonded to the cleavage group hybridizes to the terminal region of the coding nucleic acid portion, for example, within 10, 20, or 30 bases of the free end of the coding nucleic acid portion.
[0088] The coding, binding, anchoring, and auxiliary oligonucleotides described herein, as well as the coding nucleic acid moiety, may independently be natural nucleic acids such as DNA or RNA, or nucleic acid analogs, such as peptide nucleic acids (PNA), phosphorodiamidate morpholino oligomers (PMO), phosphorothioate oligomers (PTO), locked nucleic acids (LNA), glycol nucleic acids (GNA), or threose nucleic acids (TNA). The auxiliary oligonucleotides may be bonded to cleavage groups by any convenient chemical means.
[0089] In other embodiments, the scaffold may be connected to a solid support by a first linker, and the chemical portion may be connected to the solid support by a second linker. The first and second linkers are orthogonally cleavable, i.e., the first linker is cleaved under first reaction conditions, and the second linker is cleaved under second reaction conditions. For example, the method further; Exposing or providing the solid support compound to the first reaction conditions so that the first linker is cleaved, The method may also include exposing or providing the solid support compound to or under second reaction conditions such that the second linker is cleaved and the compound or member is released from the solid support.
[0090] Suitable first and second linkers are described elsewhere in this specification.
[0091] Reacting groups, such as scavenging groups, bonding groups, and cleaving groups, can be protected during one or more steps in which they do not need to react. Reacting groups can be conveniently protected by covalent bonding to a protecting group. Reacting groups may also be deprotected by removing the protecting group before the step in which their reaction is required.
[0092] A protecting group is a chemical group that reversibly protects a scavenging group, binding group, cleaving group, or other reactive group described herein from an undesirable reaction in one or more steps that does not require the reaction of the scavenging group, binding group, cleaving group, or other reactive group. Commonly used protecting groups are disclosed in Greene's "Protective Groups in Organic Synthesis," 4th Edition (John Wiley & Sons, New York, 2007). Examples of suitable protecting groups include ester groups (e.g., (methoxyethyl) esters, isovaleryl esters, and levlinyl esters), trityl groups (e.g., dimethoxytrityl and monomethoxytrityl), xanthenyl groups (e.g., 9-20phenylxanthene-9-yl and 9-(p-methoxyphenyl)xanthene-9-yl), acyl groups (e.g., phenoxyacetyl and acetyl), silyl groups (e.g., t-butyldimethylsilyl), 2-nitrobenzyl, allyloxycarbonyl-aminomethyl, Allocam oNv, tert-butyl group, tert-butylsulfenyl (StBu) group, sulfonate groups, 9-fluorenylmethyl group, 9-fluorenylmethoxycarbonyl group, or intramolecular disulfides.
[0093] For example, a scaffolding scavenging group can be protected, for example, by covalent bonding to a protecting group. The scavenging group can be deprotected before reaction with the first chemical building block, for example, by removing the protecting group.
[0094] Protecting groups can be added and removed in any convenient manner. Appropriate techniques are well established in the art. In some embodiments, protecting groups can be added and removed by chemical reactions suitable for nucleic acids, or more generally, by reactions suitable for the coding system. In other embodiments, protecting groups can be added or removed by enzymatic conversion. For example, enzymatic catalyzed reactions may be used to protect or deprotect the binding groups of nascent members.
[0095] Preferably, the chemical moiety is generated by continuously adding chemical building blocks to a nascent member to produce a linear arrangement (i.e., a chain) of chemical building blocks that are proximal to a scaffold. Chemical building blocks in a chain can form a chemical moiety represented by the member to which it is bound. For example, a first chemical building block may be covalently bonded to a trapping group of the scaffold. A second chemical building block may be bonded to the first chemical building block to form a linear arrangement or chain consisting of two chemical building blocks. The chain of chemical building blocks may have a proximal end bonded to the scaffold and a free distal end. The first chemical building block may be at the proximal end position, and the second chemical building block may be at the distal end position (i.e., the second chemical building block is the end of the chain or a terminal chemical building block). The chain can be extended by continuously bonding further chemical building blocks to the distal end of the chain, for example, by reaction with chemical building blocks at terminal positions. Following the completion of the chemical building block chain, cleavage groups can be bonded to the distal end of the complete chain, for example, by reaction with a chemical building block at the distal end (terminal chemical building block).
[0096] A chemical building block is a chemical group that forms the structural unit of a chemical moiety displayed by a library member. A chemical building block can be any chemical group containing one, two, or more bonding groups. When a chemical building block is incorporated into a chain of chemical building blocks, this chemical building block can be any chemical group containing two or more bonding groups.
[0097] Preferably, a chemical building block may contain two or more bonding groups that enable covalent bonding to a scaffold or other chemical building blocks. The two or more bonding groups may exhibit different or orthogonal reactivity. For example, a chemical building block may contain a proximal and distal bonding group (e.g., a bifunctional building block). For example, a chemical building block may be covalently bonded to a nascent member via a proximal bonding group. The distal bonding group of a chemical building block may be protected and / or used to bond further chemical building blocks to the nascent member. Each bonding group may be a reactive functional group that can react with bonding groups from other chemical building blocks. The proximal and distal bonding groups of two different building blocks; or the bonding groups on a building block and the capturing groups on a scaffold should be complementary, i.e., they should be able to react with each other to form a covalent bond. Any reaction that is suitable for the integrity of the coding system, solid support, and linker may be used. In some embodiments, any suitable DNA-compatible chemistry, such as amidation, Sonogashira coupling, Suzuki coupling, or copper(I)-catalyzed azido-alkyne cycloaddition (CuAAC) or other click reactions may be used. For example, one of the first and second bonding groups may be a carboxyl group and the other an amine group.
[0098] Suitable bonding groups include carboxylic acids, alkynes, aryl halides, alkyl halides, aldehydes, ketones, nitriles, sulfonyl halides, thiols, alcohols, acetylenes, primary amines, secondary amines, azides, amidines, diamines, epoxides, isocyanates, sulfonamides, and boronic acids. Suitable chemical building blocks containing two or more bonding groups include unnatural amino acids, D-amino acids, N-alkylated amino acids, and acid alkynes.
[0099] In some embodiments, the chemical building block may include additional bonding groups that allow for crosslinking between different chemical building blocks within the chain of the chemical building block, for example, to produce macrocyclic, bicyclic, or polycyclic chemicals. For example, a trifunctional building block may be an amino acid having a side chain with a functional group such as an alkyne, azide, amine, carboxylic acid, thiol, alcohol, or alkyl halide. In some embodiments, the chemical building block may be crosslinked, for example, between a chemical building block containing an alkyne bonding group and a chemical building block containing an azide bonding group, using a CuAAC reaction or other click reaction.
[0100] In some preferred embodiments, chemical building blocks may be covalently bonded to nascent members or compounds in reactions using multiple reagent additions and washes. For example, the solid support may be washed to remove the reaction mixture, or a new reaction mixture containing, for example, fresh solvent and reagents may be added. This may be useful, for example, to accelerate the reaction between the chemical building blocks and the nascent members toward completion, to increase the incorporation of the chemical building blocks, and to reduce the proportion of unreacted chemical building blocks and nascent members. Multiple reactions may allow for the incorporation of chemical building blocks that typically have low reaction yields, such as N-methylated amino acids.
[0101] Chemical building blocks can be covalently bonded to the newly formed member via their proximal bonding groups. Further chemical building blocks or cleavage groups may be bonded to the ends of the chain in subsequent steps using the distal bonding groups of the chemical building blocks. During the reaction between the proximal bonding groups of the chemical building blocks and the newly formed member, the distal bonding groups of the chemical building blocks may be protected, for example, by covalent bonding to a protecting group. For example, the distal bonding groups may be deprotected, for instance, by removing a protecting group, before the sequential addition of the next chemical building block in the chemical building block chain.
[0102] After each chemical building block assembly step, any nascent member molecular species that failed to assemble into the chemical building block (i.e., unreacted members) may be capped. For example, to prevent a cleavage group from binding to an unreacted scavenging group or distal bond, a capping group may be covalently bonded to an unreacted scavenging group after the assembly of the first chemical building block, and to an unreacted distal bond after the assembly of any further chemical building blocks.
[0103] A capping group is a chemical group that irreversibly caps a reactant, such as a scavenging group or distal bonder, as described herein, preventing it from participating in further chemical reactions. A capping group is used in the method herein to prevent unreacted species from one step of the method from reacting in subsequent steps of the method. In particular, a capping group prevents a cleavage group from binding to an intermediate species. For example, in a chain of chemical building blocks, the distal bonder of the chemical building block at the end of a complete chain remains uncapped and available to react with a cleavage group. This allows for the selective binding of the cleavage group to the end of a complete chain of chemical building blocks.
[0104] Suitable capping reagents may include monofunctional carboxylic acid derivative reactive groups such as acetic anhydride for capping amines; azides for capping alkyne reactive groups; and monofunctional amines for capping carboxylic acid reactive groups.
[0105] In some embodiments, capping may not be necessary. For example, in some embodiments, the distal bonding group of a chemical building block (e.g., building block 1) may be used solely for reacting with a subsequent building block (e.g., building block 2) due to the properties of its functional group. Subsequent building blocks (e.g., building block 3, building block 4, etc.) do not need to contain functional groups that are compatible with bonding to the second-to-last building block (e.g., building block 1). Therefore, a compound that could not incorporate an intermediate building block (e.g., building block 2) cannot incorporate any further building blocks. This can achieve an effect similar to capping.
[0106] The methods described herein may be repeated one or more times using different combinations of chemical building blocks to generate a library containing diverse members exhibiting different chemical moieties. For example, the number, identity, and / or order of chemical building blocks may differ in the chemical moieties of different members of the library.
[0107] Chemical building blocks and coding oligonucleotides can be conveniently added to nascent library members by splitting and pooling procedures as described herein. Alternatively, parallel synthesis of each library member is also possible, even for sufficiently small libraries.
[0108] The splitting and pooling procedure for nucleic acid-coding chemical library synthesis consists of the following steps; Dividing newly formed members or nucleic acid coding library intermediates into separate compartments, Combining one or more chemical building blocks, The process involves binding one or more coding oligonucleotides that encode chemical building blocks, This may include pooling components or intermediates from separate compartments into one or more compartments.
[0109] This procedure may be repeated one or more times.
[0110] Preferably, chemical building blocks added to a newly formed member form a linear chain of chemical building blocks bonded to the scaffold at its proximal end. Compounds and members containing a complete chain of chemical building blocks can be purified by the self-purification method described herein. The chain of chemical building blocks is optimal for maximizing the self-purification of the chemical moiety. For chemical building blocks to be incorporated into a chain of chemical building blocks, they must be at least bifunctional (i.e., contain at least two bonding groups). The proximal and distal bonding groups of a chemical building block may exhibit different or orthogonal reactivity. An example of a solid-supported compound with building blocks arranged linearly is shown in Figure 5A.
[0111] In other embodiments, chemical building blocks added to the new member may form a branched structure bonded to a scaffold. The scaffold may be at least tetrafunctional (i.e., may contain two or more scavenging groups), or one or more chemical building blocks may be at least trifunctional, allowing for bonding points for two or more additional chemical building blocks to form a branched structure.
[0112] In other embodiments, chemical building blocks added to a newly formed member may form annular or macrocyclic structures bonded to the scaffolding. This may require bridging of the chemical building blocks with other chemical building blocks within the chemical part or with the scaffolding. This annular structure may be macrocyclic. Further bridging of the chemical building blocks with other chemical building blocks or scaffolding may result in a chemical part having a bicyclic, macrocyclic, or polycyclic structure formed by the chemical building blocks bonded to the scaffolding. Figure 5B shows an example of a solid support compound having annular and branched arrangements of building blocks formed by bridging chemical building block 1 and chemical building block 3 using an additional building block, chemical building block 4.
[0113] The capping step may be performed after the synthesis step in the synthesis of the member or solid support compound. Preferably, the capping step may be performed after the addition of each chemical building block and, optionally, each coding oligonucleotide. The chemical capping step may involve reaction with monofunctional moieties or ligation with non-extendable nucleic acid molecules such as oligonucleotides. The functionalized solid support, linker, scaffold, chemical building blocks, chemical moieties, cleavage groups, and coding nucleic acid moieties may be capped. The capping step may involve reacting unreacted functional groups, such as binding groups or scavenging groups, with a capping reagent to form unreacted capping groups. Suitable capping reagents include activated carboxylic acid derivatives.
[0114] An example of the selective release of a complete compound or member from a solid support is shown in Figure 8. In the lower panel of Figure 8, compounds capped with a chemical moiety are not released from the solid support because they are incompletely synthesized, capped, and therefore do not contain cleavage groups.
[0115] The coding nucleic acid moiety may be capped by using a coding oligonucleotide having a terminal that is compatible only with the immediately preceding coding oligonucleotide and cannot ligate to other coding oligonucleotides previously attached to the nucleic acid moiety. An example of “capping” of the coding nucleic acid moiety is shown in Figure 9. A solid support compound containing all of the desired nucleic acid codes, code 1 and code 2, may be ligated to a further code, code 3. Code 1 can only be ligated to code 2, and code 2 can only be ligated to code 3. Code 1 cannot be ligated to code 3. This is because these codes may not contain sequences suitable for ligation. Therefore, an incompletely synthesized solid support compound containing only code 1 and not code 2 in this example may not be ligated to a further code, code 3 in this example.
[0116] The preparation of members or compounds described herein may include any reactions that conform to the coding system and solid support, as well as linker integrity. In some embodiments, possible reactions may include DNA compatibility reactions. Possible reactions may include amide bond formation, Suzuki coupling, Sonogashira coupling, reductive amination, and copper-catalyzed alkyne-azide cycloaddition. DNA compatibility reactions are described in the literature, for example (Malone, ML, Paegel, BM, ACS Comb. Sci. 2016, 18(4), 182-187).
[0117] In some embodiments, macrocyclization reactions may be used during the reaction of a cleavage group with a linker, the introduction of a second linker, the crosslinking of other chemicals in a solid support compound, or further transformation in solution after liberation from the solid support. For example, in some embodiments, the second linker may first be bonded to the solid support and then to the chemical moiety in the macrocyclization reaction. Macrocyclization reactions may preferably include reactions that yield high yields, such as copper-catalyzed azide-alkyne cyclization reactions. Macrocyclization reactions are known in the art and may include those described in (Wang, W., Khojasteh, SC & Su, D., Mol. (2021); Zhang, RY, Thapa, P., Espiritu, MJ, Menon, V. & Bingham, JP, Bioorg. Med. Chem. (2018)).
[0118] The members or compounds may be further transformed during and after preparation. For example, the method may include: For example, bridging two or more chemical building blocks, scaffolds, or cleavage groups to produce cyclic or polycyclic members or compounds, Incorporation of one or more additional chemical building blocks, and / or Modification or transformation of one or more chemical building blocks, or scaffolds, linkers, or cleavage groups.
[0119] The member or compound can be recaptured onto a new solid support.
[0120] In some embodiments, covalent bond formation can be mediated by a nucleic acid template reaction.
[0121] In some embodiments, polymers capable of mediating conversions, such as enzymes, may be used during or after the preparation of the self-purified compound. For example, enzymes may be recruited by nucleic acid template reactions.
[0122] The members of a nucleic acid coding library include the nucleic acid portion.
[0123] The coding nucleic acid portion may consist of a single-stranded or double-stranded nucleic acid, or a combination of single-stranded and double-stranded nucleic acids. In some embodiments, only one nucleic acid strand may be attached to the scaffold. In other embodiments, both nucleic acid strands of the double-stranded coding nucleic acid portion may be attached to the scaffold.
[0124] The scaffold, chemical moiety, and / or cleavage group may be encoded by coding sequences in one or more nucleic acid strands of the nucleic acid moiety. Extension of the coding nucleic acid moiety to incorporate the coding sequences may be performed by enzymatic ligation of the coding oligonucleotide; chemical ligation of the coding oligonucleotide; extension of the entire coding oligonucleotide template using a polymerase enzyme; or a combination of any three of these methods.
[0125] The coding oligonucleotide may be added to the nucleic acid moiety before or after the synthetic step that generates or transforms the scaffold, chemical moiety, or cleavage group. The coding sequence may be present on only one nucleic acid strand or on two nucleic acid strands. The coding sequence on one nucleic acid strand can be conveniently amplified by PCR, for example. The coding sequence may be on one or two nucleic acid strands, or it may be transcribed onto a single nucleic acid strand that is PCR-amplified. The coding sequence may encode a scaffold, one or more building blocks, a cleavage group, one or more linkers, or a combination thereof.
[0126] The coding sequence may be added to the coding nucleic acid moiety before or after the synthetic step that generates, extends, or transforms the scaffold, chemical moiety, or cleavage group.
[0127] In some embodiments, only chemical building blocks may be coded. In other embodiments, scaffolding, linkers, cleavage groups, or other entities may also be coded. The chemical building blocks to be coded are listed below, but it should be understood that other entities may also be coded in the same way that the chemical building blocks listed below are coded.
[0128] Preferably, a member of a nucleic acid coding library includes a coding nucleic acid portion that codes for all the chemical building blocks in the chemical moiety bound to the member. Sequencing of the coding nucleic acid portion bound to the member allows for the identification of the chemical building blocks in the chemical moiety revealed by the member.
[0129] The nascent member or compound may include a binding oligonucleotide (also called a headpiece). In some preferred embodiments, the binding oligonucleotide is bound to the scaffold of the nascent member.
[0130] A bound oligonucleotide is a nucleic acid to which a coding oligonucleotide, which encodes chemical building blocks, is bound in order to form a nucleic acid moiety. A bound oligonucleotide may have the same nucleotide sequence in different members of the library (i.e., a constant nucleotide sequence). The combination of coding oligonucleotides, and therefore the sequence of the coding nucleic acid moiety, may differ in different members of the library.
[0131] The binding oligonucleotide may have a terminal that binds to the newly formed binding member and a free terminal to which the coding oligonucleotide binds. The free terminal of the binding oligonucleotide may be compatible with the binding of the coding oligonucleotide. For example, the free terminal may include a short 5' or 3' overhang ("sticky end") to facilitate ligation.
[0132] The bound oligonucleotide may be a natural nucleic acid such as DNA or RNA, or a nucleic acid analog, such as peptide nucleic acid (PNA), phosphorodiamidate morpholino oligomer (PMO), phosphorothioate oligomer (PTO), locked nucleic acid (LNA), glycol nucleic acid (GNA), or threose nucleic acid (TNA).
[0133] A first coding oligonucleotide encoding a first chemical building block can be bound to a binding oligonucleotide. Suitable techniques for oligonucleotide binding are well established and include enzymatic ligation. Subsequent coding oligonucleotides encoding second and further chemical building blocks can be bound to the previous coding oligonucleotide to form a coding nucleic acid containing the coding oligonucleotide of the chemical building block in the member-bound chain.
[0134] In some embodiments, the binding oligonucleotide may be double-stranded.
[0135] Double-stranded oligonucleotides may be formed from intramolecular hybridization of a single nucleotide chain (i.e., a hairpin) or from intermolecular hybridization of two separate nucleotide chains. The double-stranded nucleotide sequence may be denatured to generate single-stranded nucleic acids before linker cleavage. Hybridization of a single-stranded nucleic acid of a first free member with a single-stranded nucleic acid of a second free member may be useful, for example, in generating members of an ESAC library. Alternatively, double-stranded oligonucleotides in which two oligonucleotide chains are covalently linked may be used.
[0136] Double-stranded coding oligonucleotides can be bound to double-stranded binding oligonucleotides by ligation using ligases such as T4 DNA ligase, according to standard techniques.
[0137] In other embodiments, the binding oligonucleotide may be single-stranded. The single-stranded coding oligonucleotide can be bound to the binding oligonucleotide by splint ligation using an adapter oligonucleotide, according to standard techniques.
[0138] Coding oligonucleotides are nucleic acid molecules that contain a nucleotide coding sequence that codes for chemical building blocks and, optionally, cleavage groups, scaffolds, and / or linkers. The coding sequence (or coding region) can be any sequence of nucleic acid bases that are uniquely associated with a particular chemical building block. This makes it possible to determine the identity of a chemical moiety by sequencing or otherwise "reading" the coding sequence.
[0139] A coding sequence contains enough nucleotides to uniquely identify the chemical building block it codes for. For example, if there are 20 variants in the chemical part, the coding sequence must contain at least 3 nucleotides (4 2 =16, 4 3 (=64). The coding sequence may be longer than necessary. The advantage of using a longer coding sequence is that it provides an opportunity to distinguish the code beyond the difference of a single nucleotide, thereby increasing the reliability of the decoding process. For example, a first chemical building block from a population of 20 different chemical building blocks (20 compounds) may be coded by 6 nucleotides, and a second chemical building block from a population of 200 different parts may be coded by 8 nucleotides. Thus, the size of the coding sequence depends on the number of chemical building blocks being coded (i.e., the number of different chemical building blocks in the library). Chemical building blocks can be coded using a sequence of nucleotides and / or their complements as the coding sequence. Suitable sequences for coding chemical building blocks in a library are well known in the art.
[0140] The coding sequence of the coding oligonucleotide may be adjacent to the constant region. The constant region may be long enough to allow efficient hybridization and ligation, for example, 2 to 20 bases, preferably 9 to 15 bases.
[0141] Coding oligonucleotides are sequentially added to a member or compound simultaneously with the incorporation of building blocks, resulting in a nucleic acid molecule (i.e., a nucleic acid moiety) containing a series of coding oligonucleotides that encode combinations of chemical building blocks present in the member or compound. A first coding oligonucleotide encoding a first chemical building block may be linked to a binding oligonucleotide, and each further coding oligonucleotide may be linked to a series of preceding coding oligonucleotides to form a nucleic acid molecule (i.e., a nucleic acid moiety). The sequence of the nucleic acid moiety of a library member encodes the chemical building blocks of that library member. Therefore, sequencing the coding nucleic acid moiety makes it possible to identify the chemical building blocks of the member.
[0142] The first chemical building block and coding oligonucleotide are, for the nascent member or compound, as follows: The first chemical building block is covalently bonded to a scaffold of new members or compounds, The bonding may be achieved by a method comprising covalently bonding a coding oligonucleotide encoding a first chemical building block to a binding oligonucleotide of a nascent member.
[0143] After the reaction, unreacted species can be removed by washing or capping to prevent further reaction. For example, this method may further include capping scaffolds that are not covalently bonded to the first chemical building block. Appropriate methods of capping are described above.
[0144] To prevent undesirable reactions, the first chemical building block may be protected. For example, the distal bond group of the first chemical building block may be covalently bonded to a protecting group. The first chemical building block may then be deprotected, for example, after the bonding of a coding oligonucleotide. The method may include removing the protecting group from the distal bond group of the first chemical building block bonded to the scaffold. This makes it possible to add the second chemical building block.
[0145] In some embodiments, the first chemical building block is used to synthesize a new compound or member as follows: The first chemical building block is covalently bonded to the scaffold of a new member, wherein the first chemical building block contains a proximal bond that reacts with the scavenging group of the scaffold to form a covalent and protected distal bond, Capping unreacted scavenging groups not bound to the first chemical building block, The first coding oligonucleotide encoding the first chemical building block is covalently bonded to the binding oligonucleotide of the nascent member to form a coding nucleic acid, The bonding may be achieved by a method comprising deprotecting the distal bonding group of the first chemical building block.
[0146] Following the deprotection of the distal bond, the second chemical building block is applied to the newly formed member as follows: The second chemical building block is covalently bonded to the first chemical building block of the newly formed member, The bonding may be achieved by a method including covalently bonding a coding oligonucleotide encoding a second chemical building block to the nascent member.
[0147] After the reaction, unreacted species can be removed by washing or capping to prevent further reaction. For example, this method may further include capping the distal bonding groups of any chemical building blocks that are not covalently bonded to further chemical building blocks.
[0148] To prevent undesirable reactions, additional chemical building blocks may be protected. For example, the distal bond of an additional chemical building block may be covalently bonded to a protecting group. The additional chemical building block may then be deprotected, for example, after the binding of a coding oligonucleotide. The method may include removing the protecting group from the distal bond of an additional chemical building block bound to the scaffold. This allows for the binding of additional chemical building blocks or cleavage groups.
[0149] In some embodiments, further chemical building blocks are added to the new member as follows: The method involves covalently bonding an additional chemical building block to a chain of chemical building blocks, wherein the additional chemical building block includes a proximal bonding group and a distal bonding group, and the proximal bonding group of the additional chemical building block reacts with the distal bonding group of the chemical building block at the distal end to form a covalent bond, thereby adding the additional chemical building block to the distal end of the chain of chemical building blocks. The method involves covalently bonding an additional chemical building block to a chain of chemical building blocks, wherein the additional chemical building block comprises a protected distal bonding group and a proximal bonding group that reacts with the distal bonding group of the chemical building block at the distal end of its chain to form a covalent bond. The distal end, which is not bound to further chemical building blocks, caps the unreacted distal groups of the chemical building blocks, Covalently bonding further coding oligonucleotides, which encode further chemical building blocks, to the coding nucleic acid, Further bonding may be achieved by a method including deprotecting the distal bonding groups of the chemical building blocks.
[0150] Further covalent bonding of coding oligonucleotides may be performed before, after, or simultaneously with the deprotection of the distal binding group.
[0151] This process may be repeated one or more times to incorporate multiple additional chemical building blocks and generate a chemical part. For example, a chemical part may include a chain of 1, 2, 3, 4, 5 or more chemical building blocks. In some preferred embodiments, a chemical part may include up to 20 chemical building blocks. In other preferred embodiments, a chemical part may include up to 10 chemical building blocks. In yet another preferred embodiment, a chemical part may include up to 6 chemical building blocks.
[0152] In some embodiments, the chemical building blocks at the ends of the chain of chemical building blocks (i.e., terminal chemical building blocks) may include protected distal bonding groups, such as distal bonding groups covalently bonded to a protecting group. The method may include removing the protecting group from the distal bonding group of the chemical building block at the end of the chain of chemical building blocks before bonding of the cleavage group.
[0153] A solid support is an insoluble object exhibiting a surface to which nascent members or compounds can be bound during production, as described herein. Examples of suitable supports include resins, beads, nanoparticles, and polymers, e.g., polystyrene-polyethylene glycol (PEG) composites, PEG, and poly-ε-lysine (ε-PL) (see, e.g., Albericio F (2000). Solid-Phase Synthesis: A Practical Guide. Boca Raton: CRC Press). Conveniently, the support may be in the form of particles such as beads. In some embodiments, the solid support may be beads of a graft copolymer consisting of a polystyrene matrix grafted with poly(ethylene glycol) (PEG). The solid support may be produced using standard techniques or may be obtained from commercial suppliers (e.g., Tentagel®, Rapp Polymere GmbH, DE). Separation of compounds on the solid support from solution may be achieved by any convenient method such as filtration, magnetic interaction (in the case of magnetic beads), or centrifugation.
[0154] Other suitable solid supports include polystyrene beads, crosslinked polystyrene beads, polymer beads, glass beads, coated glass beads, controlled pore glass beads, bead-controlled pore glass beads, silica microparticles, coated silica microparticles, iron oxide particles, coated iron oxide particles, PEGA (polyethylene glycol-acrylamide) resin, and other commercially available or custom-synthesized solid supports of different sizes, or combinations thereof. Suitable solid supports may also be magnetic. Examples of magnetic solid supports include Magnefy® and ProMag1® microspheres (Bangs Laboratories, Inc.). Examples of solid supports include copolymers, e.g., acrylamide-PEG copolymers, polymer particles further containing paramagnetic or ferromagnetic materials, core-shell particles, porous particles, non-porous particles, or other organic chemicals combined with ferromagnetic materials. Other suitable solid supports are known in the art (see, for example, Pon, RTCurr. Protoc. Nucleic Acid Chem. (2000); Chaudhuri, RG & Paria, S., Chem. Rev. (2011); Wu, W., He, Q. & Jiang, C. Nanoscale Res. Lett. (2008); Hermanson, GT, Bioconjugate Techniques: Third Edition (2013)).
[0155] In some embodiments, binding entities may be used for capture onto a solid support. For example, small organic or inorganic entities may be used for capture onto a solid support so that the compound bound to the solid support can be physically separated from the solution. Suitable small organic or inorganic binding entities may include biotin and quantum dots such as magnetic quantum dots. In some embodiments, one or more steps in the synthesis of nucleic acid coding compounds or libraries described herein may be performed in solution before or after capture onto a solid support.
[0156] In some embodiments, the solid support may be further functionalized with linear (e.g., polyethylene glycol (PEG) spacers) or dendrimer structures (e.g., polyamidoamine (PAMAM) dendrimers). Dendrimers and spacers are described in literature including Hermanson, GT, Bioconjugate Techniques: Third Edition (2013). In some embodiments, the surface of the solid support may be modified with small molecules. In some embodiments, for example, small molecules may connect a portion of the solid support to a first and / or second linker.
[0157] Preferably, if necessary, the aggregate of solid support particles can be easily suspended in a solution to allow for division and pooling. In some embodiments, a small solid support particle size may be preferred for the easy synthesis of libraries having a large number of distinct members. For example, microparticles or nanoparticles may be used.
[0158] The solid support allows the bound members or compounds to be washed after one or more steps of the construction described herein to remove unbound reactants. Only complete members are self-liberating. This may allow for the separation of pure library members from incompletely synthesized library members, enabling the production of high-purity DEL. In some embodiments, separation of liberated members in solution from species remaining bound to the solid support allows for the concentration or purification of complete members, enabling the production of high-purity DEL. In other embodiments, the separation of liberated members in solution may be followed by a step of liberating only, or preferentially liberating, incompletely synthesized species from the solid support. Subsequently, liberating members remaining bound to the solid support allows for the concentration or purification of complete members, enabling the production of high-purity DEL.
[0159] In some embodiments, the members or compounds described herein are released from the solid support by a reaction between the cleavage group and the linker. An electrophilic cleavage group and a nucleophilic linker, or more preferably a nucleophilic cleavage group and an electrophilic linker, may be used. In some embodiments, the reaction between the linker and the cleavage group may be a substitution reaction in which the solid support is replaced with the cleavage group. The substitution reaction may be a nucleophilic substitution reaction, such as a nucleophilic aromatic substitution reaction. Other suitable reactions between the linker and the cleavage group may include metal-catalyzed reactions or metathesis reactions.
[0160] In some preferred embodiments, one of the linker and the cleaving group may be a thiol or selenothiol group, and the other may be a carbonyl group. This reaction may form a thioester intermediate. The thioester intermediate may then be cleaved intermolecularly or intramolecularly, which may lead to irreversible cyclization of library members (Figure 2).
[0161] In some embodiments, the linker is a cleavable chemical portion that can connect the scaffold to a solid support. The linker may connect the scaffold directly to the solid support or indirectly, for example, via an anchor. The linker may be cleaved by a chemical reaction mediated by a specific reagent (e.g., a cleaving group) or reaction conditions.
[0162] In other embodiments, first and second linkers may be present. The first linker may be a cleavable chemical moiety that covalently bonds the scaffold to a solid support. The second linker may be a cleavable chemical moiety that covalently bonds the chemical moiety to a solid support. The first and second linkers are orthogonally cleavable; that is, the first linker may be cleaved by certain reagents (e.g., cleaving groups) or reaction conditions that do not cleave the second linker.
[0163] In some embodiments, the linker may not require further conversion or activation after being bound to the solid support and scaffold before reacting with the cleavage group. The linker may be incorporated into the nascent member in an active state (i.e., the linker is in a form that reacts with the cleavage group). Suitable linkers include substituted quinoxalines or derivatives thereof, which can be cleaved by orthodithiophenol cleavage groups without further conversion or activation.
[0164] A substituted quinoxaline may contain a quinoxaline group having one or more substitutions, for example, substitutions at positions 2, 3, and 5 or positions 2, 3, and 6. In some embodiments, the 2 position of the substituted quinoxaline may be a halogen, e.g., F, Cl, Br, or I, preferably Cl, or an electron-withdrawing group; the 3 position may be -SR, -OR, or -NR, and the 5 or 6 position may be -COOR, -CONR, or an alkyne. In other embodiments, the 2 position of the substituted quinoxaline may be -SR, -OR, or -NR; the 3 position may be a halogen, e.g., F, Cl, Br, or I, preferably Cl, or an electron-withdrawing group; and the 5 or 6 position may be -COOR, -CONR, or an alkyne. R is a hydrogen atom, or C 1-6 Alkyl alkyl group, C 5-20 Ariel, C 1-6 Alkoxy group, C 1-6 Acyloxy group, or C 1-6 The reverse ester group can be selected independently; any of these may be linear or branched, and may be optionally substituted. Suitable examples of substituted quinoxalines include 3-chloro-2-((2-hydroxyethyl)thio)quinoxaline-6-carboxylic acid; 3-chloro-2-(4-(hydroxymethyl)phenoxy)quinoxaline-6-carboxylic acid; and N-(3-aminopropyl)-3-chloro-2-(4-(hydroxymethyl)phenoxy)quinoxaline-6-carboxamide.
[0165] In other embodiments, the linker may require activation after bonding to the solid support and scaffold, but before reacting with the cleaving group; that is, the linker may be an activatable linker. The linker may be incorporated into the nascent member in an inactive state (i.e., the linker is in a form that does not react with the cleaving group). Activation of the linker converts it from an inactive form to an active form. The active form of the linker is selectively cleaved by the cleaving group, while the inactive form of the linker is not cleaved by the cleaving group. For example, the inactive form of the linker may contain a protecting group, and the linker may be activated by removing the protecting group. Methods described herein may include activating an activatable linker. In embodiments where the cleaving group requires activation, the linker may be activated before, after, or simultaneously with the activation of the cleaving group.
[0166] Suitable activatable linkers include masked thioesters such as N-alkylcysteine. The masked thioester can be activated to produce a thioester that can be cleaved by a thiol cleavage group (natural chemical ligation). The thiol in the masked thioester can be protected, for example, by a tert-butyl group, an allyloxycarbonylaminomethyl group, a 2-nitroberatryl group, a 9-fluorenylmethyl group, or as an S-sulfonate. After deprotection of the masked thioester, the cysteine derivative may undergo an N-to-S rearrangement during thiol deprotection to obtain the thioester.
[0167] Other suitable activatable linkers include the diaminobenzoyl group or its derivatives, such as the methyldiaminobenzoyl group. For example, the activatable linker may be amino(methyl)aniline (MeDbz). MeDbz can be activated by reaction with para-nitrophenyl chloroformate to produce N-acylN'-methylbenzimidazoline (MeNbz), which can be cleaved by a thiol cleavage group. Another example of a suitable activatable linker is 3,4-diaminobenzoic acid (Dbz) and its derivatives, which can be activated with isopentyl nitrite to produce benzotriazole derivatives (Selvaraj, A. et al, Chem. Sci., 2018, 9, 345-349).
[0168] Other suitable activatable linkers include enzyme substrates. For example, the activating linker may be an oligonucleotide cleaved by a nuclease cleavage group or an oligonucleotide cleaved by a peptidase.
[0169] In some embodiments, the linker is cleaved by a cleavage group to release the solid support compound. A cleavage group is a reactive chemical group, reagent, or enzyme that reacts with the linker to cleave it and release the newly formed member from the solid support. To provide a self-purifying compound, the cleavage group may be covalently bonded to or reversibly associated with a chemical moiety, nucleic acid moiety, or scaffold. For example, the cleavage group may be bonded to the distal end of the chain of chemical building blocks after the completion of the chemical moiety. The cleavage group may be bonded to the distal binding group of the chemical building block at the distal terminal position of the chain of chemical building blocks in the chemical moiety. In other embodiments, the cleavage group may be bonded to any position of the chemical moiety, scaffold, or nucleic acid moiety.
[0170] In some embodiments, the cleavage group does not require further transformation or activation after binding to the chemical moiety, scaffold, or coding nucleic acid moiety, and before reaction with the linker.
[0171] In other embodiments, the cleavage group may require activation after binding to a chemical moiety, scaffold, or coding nucleic acid moiety and before reaction with the linker; that is, the cleavage group may be an activatable cleavage group. The cleavage group may include a functional group that is protected once incorporated into a member or compound and cleaves the linker after deprotection. For example, the cleavage group may include a protecting group and may be activated by removing the protecting group.
[0172] In some preferred embodiments, the cleavage group may be protected. For example, the cleavage group may be covalently bonded to a protecting group. The protected cleavage group may be inert or activated by deprotection. The method may further include deprotecting the cleavage group, for example, by removing the protecting group. The cleavage group may be deprotected before, after, or simultaneously with the potential activation of the linker. Suitable protecting groups are described above.
[0173] The cleavage group may preferably be at the end of a chain of chemical building blocks that form a chemical moiety bonded to the scaffold (i.e., the distal end of the chemical moiety). Alternatively, the cleavage group may be bonded to chemical building blocks in the chain other than the terminal chemical building block, or it may be incorporated between two chemical building blocks in the chain.
[0174] In some embodiments, the compound or member may contain multiple different cleavage groups. For example, two different or orthogonal cleavage groups may be bonded to two different positions on the chemical moiety.
[0175] The selection of cleavage groups depends on the activatable linkers.
[0176] Suitable cleavage groups may include or consist of thiols. In some embodiments, thiol cleavage groups may be used to cleave thioester linkers, e.g., thioester linkers produced by the activation of masked thioesters or masked N-alkylcysteines; or diaminobenzoyl linkers such as MeNbz linkers, e.g., MeNbz linkers produced by the activation of MeDbz. The thiols may be protected during incorporation into the solid support compound.
[0177] Other suitable cleavage groups may include, or consist of, selenothiols, which can be protected during incorporation into the member or compound on a solid support. Selenothiols may exhibit similar reactivity to linkers compared to thiols. Selenothiols can be protected during incorporation into the compound on the solid support. For example, the cleavage group may be cysteine or a derivative thereof, or selenocysteine or a derivative thereof. In addition to thiols or selenothiols, amines in the cleavage group may result in intramolecular cleavage of the thioester or selenoester formed after the reaction of the cleavage group with the linker by the amine.
[0178] In some embodiments, the cleavage group may include multiple thiol or selenothiol groups.
[0179] Other suitable cleavage groups may include or consist of orthodithiophenol. The orthodithiophenol cleavage group may be used to cleave the substituted quinoxaline linker. The substituted quinoxaline linkers are described in more detail above.
[0180] Other suitable cleavage groups may include or consist of enzymes. Enzymatic cleavage groups may be used to cleave linkers containing structures that can be enzymatically cleaved. For example, nuclease cleavage groups may be used to cleave polynucleotide linkers, and peptidases may be used to cleave peptide linkers.
[0181] Other reactions may be used for the cleavage of the linker by the cleavage group. Reactions suitable for the selective reaction of the cleavage group and linker described herein may be used. For example, the linker may be an N- and O-substituted hydroxylamine, and the cleavage group may include an α-keto acid group. In another example, the linker may include an orthohydroxybenzaldehyde carboxylic acid ester further derivatized on an aromatic ring, and the cleavage group may include serine or a derivative thereof, or threonine or a derivative thereof, linked to the chemical moiety, scaffold, or coding nucleic acid moiety via its carboxyl group.
[0182] Protecting groups of the same or different types may be used as scaffolding, chemical building blocks, and cleavage groups, provided that they do not unnecessarily interfere with the synthesis of the self-purified compound or member.
[0183] For example, the thiol cleavage group can be protected by the formation of an S-sulfonate or by covalent bonding to an allyloxycarbonyl-aminomethyl group, an o-nitrobenzyl group, a 2-nitroberatryl (Nv) group, a tert-butyl (tBu) group, or a 9-fluorenylmethyl group via a disulfide bond or selenyl sulfide bond. Preferably, the protection by a disulfide or selenyl sulfide bond can be intramolecular.
[0184] The selenothiol cleavage group can be protected via a selen sulfide or diselenide bond.
[0185] The ortho-dithiophenol cleavage group can be protected by covalent bonding through the formation of intermolecular disulfide bonds between each thiol. For example, each thiol group in the ortho-dithiophenol cleavage group can be protected by an S-tert-butyl group. In some embodiments, the thiols can be protected by other protecting groups as described above.
[0186] In some embodiments, the protecting group of the functional group in the cleavage group may be photounstable and may be bonded to the cleavage group by a photounstable bond. The protecting group can be removed by cleaving the photounstable bond with light and activating the cleavage group. The cleavage group may be deprotected before, after, or simultaneously with the potential activation of the linker. Suitable photounstable protecting groups include 2-nitrobenzyl groups such as 2-nitroveratryl groups.
[0187] In other embodiments, the solid support member may include first and second linkers that can be independently cleaved by exposing the member to suitable conditions without requiring a cleavage group. The first linker may connect the scaffold to the solid support. The second linker may connect the chemical portion to the solid support. Cleavage of the first linker may release a member that is not connected by the second linker (i.e., a member having an incomplete chemical portion).
[0188] One or different enzymes may mediate one or more reactions involved in the production of the self-purified compounds or members described herein.
[0189] Selectively liberated self-purified library members may include a chemical moiety and optionally a linear, branched, cyclic, macrocyclic, or polycyclic structure formed from the scaffold, and one or more cleavage segments resulting from the reaction of the linker with the cleavage group, or one or more segments remaining after the cleavage of the linker. Figure 6A shows an example of a self-purified compound having a linear structure. Figure 6B shows an example of a self-purified compound having a cyclic or macrocyclic structure. Figure 7A shows an example of a self-purified compound having a branched structure. Figure 7B shows an example of a self-purified compound having a bicyclic structure.
[0190] After the self-purified library members are selectively released from the solid support, further reactions may be carried out. For example, additional transformations may be carried out in solution, or the self-purified compounds may be recaptured on the solid support for additional transformations, including transformations and subsequent self-purification reactions. Further transformations include chemical building block integration reactions, chemical building block bridging, chemical building block bridging to a scaffold, cleavage reactions, ring-opening reactions, and macrocyclic reactions. For example, a bicyclic structure may be formed after the macrocyclic self-purified library member is released from the solid support by bridging the two building blocks of CuAAC (copper-catalyzed azide-alkyne cycloaddition).
[0191] In some embodiments, individual solid support-linked library members may be compartmentalized before they are released from the solid support. This enables activity-based assays of the self-purified library members. This also allows for the physical separation of the released members from the nucleic acid molecules, including the coding oligonucleotides, within the compartment. The presence of the nucleic acid molecules and the released members in the same compartment makes it possible to identify and sequence the nucleic acid molecules encoding the released members to determine the chemical building blocks that form the chemical portion of the member. This can be useful, for example, in activity-based assay systems.
[0192] Members can be compartmentalized by separating each particle of the solid support into a separate compartment. Isolation prevents members bound to the solid support of different particles from interacting with each other, allowing the coding nucleic acid to remain associated with the freed member even if physically separated by linker cleavage. Compartments may include isolated volumes or droplets. For example, volumes or droplets between approximately 0.5 pL and approximately 100 nL may be used. However, smaller or larger volumes may also be used. Compartments may contain solid support-bound members and appropriate reactants, buffers, and other reagents to facilitate linker cleavage and release of members from the support. The compartmentalized library may be in any suitable form, such as an array, a microfluidic or micropatterning device, or a multi-well dish.
[0193] In some embodiments, the coding nucleic acid portion, including the coding oligonucleotide, may be bonded to an anchor located between the linker and the solid support such that the anchor and the coding nucleic acid portion remain ligated to the solid support when the linker is cleaved and the member is released.
[0194] An anchor is the chemical moiety to which a binding oligonucleotide is bound. Preferably, the same chemical moiety forms the anchors for all members of the library.
[0195] In some embodiments, the method for preparing a DNA coding library involves the following steps for each member: To provide a new member including a scaffold and an anchor, wherein the scaffold is connected to a linker by an anchor; and the anchor contains a bound oligonucleotide and is bound to a solid support, Covalently bonding one or more chemical building blocks to a newly formed member to form a chemical part connected to the scaffold, Covalently bonding one or more coding oligonucleotides to a binding oligonucleotide to form an anchored nucleic acid portion, Binding the cleavage group to the chemical moiety or scaffold, The new members will be separated into compartments, This may include reacting the linker with a cleaving group such that the linker is cleaved and the chemical portion bonded to the scaffold is released from the solid support within the compartment.
[0196] In other embodiments, the method for preparing a DNA coding library involves the following steps for each member: To provide a new member including a scaffold and an anchor, wherein the scaffold is connected to a first linker by an anchor, and this anchor contains a bound oligonucleotide and is bound to a solid support, Covalently bonding one or more chemical building blocks to a newly formed member to form a chemical part connected to the scaffold, Covalently bonding one or more coding oligonucleotides to a binding oligonucleotide to form an anchored nucleic acid portion, The chemical part is connected to a solid support by bonding a second linker to the chemical part, To break open the first linker, The new members will be separated into compartments, This may include cleaving the second linker so that the second linker is cleaved and the chemical portion bonded to the scaffold is released from the solid support within the compartment.
[0197] The chemical moiety remains compartmentally related to the nucleic acid moiety, and sequencing of the nucleic acid moiety allows for the identification of the compartmentally related chemical moiety.
[0198] In other embodiments, the coding nucleic acid moiety, including the coding oligonucleotide, may be bound to a solid support such that the coding nucleic acid moiety remains bound to the solid support when the linker is cleaved and the member is released. For example, a method for generating a DNA coding library involves the following steps for each member: To provide a nascent member comprising a scaffold connected to a solid support by a linker; wherein the solid support comprises a bound oligonucleotide, Covalently bonding one or more chemical building blocks to a newly formed member to form a chemical part connected to the scaffold, The process involves covalently bonding one or more coding oligonucleotides to a binding oligonucleotide to form a coding nucleic acid portion bound to a solid support, Binding the cleavage group to the chemical moiety or scaffold, The new members will be separated into a different compartment, This may include reacting the linker with a cleaving group such that the linker is cleaved and the chemical portion bonded to the scaffold is released from the solid support within this compartment.
[0199] Another method for generating a DNA coding library involves the following steps for each member: The present invention provides a nascent member comprising a scaffold connected to a solid support by a first linker; the solid support comprising a bound alkyl group, Covalently bonding one or more chemical building blocks to a newly formed member to form a chemical part connected to the scaffold, The process involves covalently bonding one or more coding oligonucleotides to a binding oligonucleotide to form a coding nucleic acid portion bound to a solid support, By attaching a second linker to the chemical part, the chemical part is connected to a solid support, The first linker is ruptured, and the newly formed members are separated into a compartment. The second linker is cleaved so that the chemical portion bonded to the scaffold is released from the solid support within the compartment. It may include.
[0200] In some preferred embodiments of the above-described aspects of the present invention, linker 1 to 10 15 A copy may exist on a single solid support entity, such as a particle or a bead.
[0201] Following liberation from the support, the member or compound may be further purified. For example, additional HPLC purification may be performed after self-purification.
[0202] Libraries prepared by the methods described herein can be screened for members that bind to target molecules. Library members that bind to target molecules can be identified, and nucleic acid molecules can be sequenced to identify the chemical building blocks that form the chemical substances presented by the identified library members.
[0203] The binding of identified library members can be verified in the absence of coding nucleic acids. For example, the method is as follows: (i) To provide a new member including a labeled scaffold connected to a solid support by a linker, (ii) Covalently bonding the chemical building blocks of the identified chemical portion of the library member to a scaffold to generate a labeled new member containing the chemical portion, (iii) Bonding the cleavage group to the chemical moiety or scaffold, (iv) Reacting the linker with a cleaving group, thereby cleaving the linker and releasing the member from the solid support, (vi) Determining the binding of the released label member to the target molecule.
[0204] The binding of the released members to the target molecule can be determined using labeling. The scaffold may be labeled with any convenient label, such as a fluorescent label.
[0205] Other aspects and embodiments of the present invention provide the above aspects and embodiments in which the term "includes" is replaced with the term "consisting of", and the above aspects and embodiments including the term "includes" replaced with the term "essentially consists of".
[0206] Unless otherwise required by context, this application should be understood to disclose all combinations of any of the above embodiments and embodiments with respect to each other. Similarly, unless otherwise required by context, this application discloses all combinations of preferred features and / or optional features, either individually or in conjunction with any of the other embodiments.
[0207] Modifications to the above embodiments, further embodiments and their modifications will be apparent to those skilled in the art upon reading this disclosure, and therefore fall within the scope of the present invention.
[0208] All documents and array database entities referenced herein are incorporated herein by reference in their entirety for all purposes.
[0209] Priority is claimed in European Patent No. 20203475.7, the disclosure thereof, which is incorporated herein by reference in its entirety for all purposes.
[0210] When used herein, “and / or” should be considered as each of two specified features or components that are either present or absent from each other. For example, “A and / or B” should be considered as each of (i) A, (ii) B, and (iii) A and B, as if each were described separately herein.
[0211] experiment Materials and methods Resin swelling Before first use or after storage at -20 °C, TentaGel® beads (Rapp Polymere GmbH) were incubated in a suitable solvent for 10 minutes.
[0212] Drying and washing of the solid support TentaGel® beads (Rapp Polymere GmbH) were used in a solid-phase synthesis reaction vessel with a frit. Vacuum filtration was used to remove the solvent or solution incubated with the TentaGel® beads. The beads were washed by adding a suitable solvent and subsequently removing the resulting solvent or solution. The magnetic solid support was separated from the solution using a magnet.
[0213] Amount of solid support The amount of solid support used in each experiment was given as millimoles, mass (g or mg), or volume (μL) of the respective surface functional groups (loading amount), where the volume of the beads refers to the volume of the bead suspension used at the same concentration supplied by the manufacturer. Solid support storage Functionalized TentaGel® beads (Rapp Polymere GmbH) were stored dried at -20 °C. Other solid support types were stored as suspensions in a suitable solvent or aqueous solution at 4 °C.
[0214] Oligonucleotide The purchased custom oligonucleotides were further purified by ethanol precipitation. The oligonucleotides redissolved in mQ were analyzed by LCMS and their concentrations were measured using a NanoDrop 2000c spectrophotometer.
[0215] Amino-modified single-stranded (ss) DNA (Sequence 1): 5’dAminoC6-GGAGCTTCTGAATT3’ Molecular weight = 4473.02 Da, ε 260 = 133700 M -1 cm -1 Amino-modified double-stranded (ds) DNA (sequence 2): 5'd Phos-GAGTCA-Spacer9-AminoC7-Spacer9-TGACTCCC 3' Molecular weight=4937.24Da, ε 260 =127872M -1 cm -1 Adapter (array 3): 3'CCTCGAAGACTTAAGACACACGAC5' Code (array 4): 5'd Phos-CTGTGTGCTGACAGCTCGAGTCCCATGGCGC3' Molecular weight=9584.16Da, ε 260 =280300M -1 cm -1
[0216] Ethanol precipitation of oligonucleotides Ethanol precipitation was performed by adding 10% (v / v) 5M NaCl and 3.5 times the volume of EtOH. After storing the samples at -20°C for at least 2 hours, they were centrifuged at 20800 × g for 1 hour at 4°C. After centrifugation, the supernatant was discarded. The precipitate was completely dried in a Christ Alpha RVC Speedvac rotary vacuum concentrator and dissolved in mQ (Milli-Q®) water.
[0217] Concentration evaluation of oligonucleotide solutions The concentration of the oligonucleotide solution was determined by measuring the UV absorbance at 260 nm using a NanoDrop 2000c Spectrophotometer instrument. 2 μL of oligonucleotide solution was used for each measurement. The oligonucleotide concentration was calculated from the known absorption coefficient of the DNA sequence and the UV absorbance measured at 260 nm.
[0218] Liquid chromatography-mass spectrometry (LCMS) Mass spectrometry (LCMS) spectra were recorded using a Waters Acquity UPLC and a Waters Xevo G2-XS QTof Quadrupole Time of Flight Mass Spectrometer. For LCMS analysis of oligonucleotides, an XBridge® Oligonucleotide BEH® C18, 130 Å, 2.5 μm, 2.1 mm × 50 mm column or an XBridge® Oligonucleotide BEH® C18, 130 Å, 1.7 μm, 2.1 mM × 50 mM column was used. For LCMS analysis of small molecules, an Acquity UPLC® CSH® C18, 1.7 μm, 2.1 mM × 50 mM column was used.
[0219] General Procedure 1: General procedure for amide coupling of carboxylic acids to amine-functionalized solid supports Functionalized TentaGel® beads were swollen with DMF (10 mL). Amine-functionalized TentaGel® beads (1 equivalent amine load) were incubated at room temperature on a rotating shaker for 2 hours using dimethylformamide (6 mL per 0.1 mmol load) containing 66.7 mM of each acid (4 equivalents), 133.3 mM N,N-diisopropylethylamine (DIPEA) (8 equivalents), and 66.7 mM N-[(dimethylamino)-1H-1,2,3-triazolo-[4,5-b]pyridine-1-ylmethylene]-N-methylmethanaminonium hexafluorophosphate N-oxide (HATU) (4 equivalents). Functionalized TentaGel® beads were washed with dimethylformamide (3 × 10 mL), dichloromethane (3 × 10 mL), and then with dimethylformamide (3 × 10 mL).
[0220] General Procedure 2: General Procedure for Fmoc Deprotection on Solid Supports Functionalized TentaGel® beads were swollen with DMF (10 mL). Next, the dried functionalized TentaGel® beads were incubated in a rotary shaker at room temperature for 30 minutes with dimethylformamide containing 20% (v / v) piperidine (6 mL per 0.1 mmol load). The functionalized TentaGel® beads were washed with dimethylformamide (3 × 10 mL), dichloromethane (3 × 10 mL), and then with dimethylformamide (3 × 10 mL).
[0221] General Procedure 3: General Procedure for Amide Coupling of Acids to Amine-Functionalized Magnetic Solid Supports Amine-functionalized solid support (50 μL) was washed with dimethylformamide (200 μL). Amine-functionalized beads were incubated at room temperature for 4 hours in a rotating shaker with solutions of 50 mM diisopropylcarbodiimide (DIC), 50 mM ethylcyano(hydroxyimino)acetate (OxymaPure), and dimethylformamide (150 μL) containing 50 mM of each acid. The functionalized beads were washed with dimethylformamide (6 × 200 μL).
[0222] General Procedure 4: General Procedure for Fmoc Deprotection on Magnetic Solid Supports Functionalized beads (50 μL) were washed with dimethylformamide (200 μL). The functionalized beads were incubated with 20% (v / v) piperidine (200 μL) in dimethylformamide at room temperature on a rotating shaker for 1 hour. The functionalized beads were washed with dimethylformamide (6 × 200 μL).
[0223] General Procedure 5: Binding of 5'-azide-modified single-stranded oligonucleotides (or 5'-azide-modified double-stranded oligonucleotides) to a solid support using the CuAAC method 1. This procedure was adapted from MacConnell et al 2015. Alkyne-functionalized TentaGel® beads (20 mg) were swollen in 30 mM triethylammonium acetate pH 8.5 in 50% DMSO in mQ water containing 0.034% (v / v) Tween 20 at room temperature using a rotating shaker for 15 minutes. The dried solid support was reacted with 1 to 5 nmol of 5'-azide-modified single-chain oligonucleotides (synthesized in Example 1) in a solution of 20 mM triethylammonium acetate (pH 8.5) containing 2.6 mM 1-(phenylmethyl)-N,N-bis[[1-(phenylmethyl)-1H-1,2,3-triazole-4-yl]methyl]-1H-1,2,3-triazole-4-methaneamine (TBTA), 14.0 mM sodium ascorbate, and 2.8 mM copper sulfate, on a rotating shaker at 60°C for 3 hours in 48% DMSO in mQ water containing 0.035% (v / v) Tween 20 (195 μL). The solid support was washed with a solution of 10 mM 2,2'-(1,3-propanediyldiimino)bis[2-(hydroxymethyl)-1,3-propanediol] containing 1% (v / v) Tween 20 and 1% (w / v) sodium dodecyl sulfate (SDS), pH 7.6 (3 × 0.6 mL), 100 mM sodium chloride, and 10 mM N,N'-1,2-ethanediylbis[N-(carboxymethyl)glycine] (EDTA).
[0224] General procedure 6: Binding of 5'-azide-modified single-strand oligonucleotides to a solid support using the CuAAC method 2. An alkyne-functionalized magnetic solid support (25 μL) with excess loading capacity was washed with 50% DMSO in mQ water (3 × 200 μL). The solid support was reacted with 1 to 5 mmol of 5'-azide-modified single-chain oligonucleotide (synthesized in Example 1) in a mixture of 993 μM 1-(phenylmethyl)-N,N-bis[[1-(phenylmethyl)-1H-1,2,3-triazole-4-yl]methyl]-1H-1,2,3-triazole-4-methaneamine (TBTA), 945 μM copper sulfate (CuSO4), 5.672 mM sodium ascorbate (NaAsc), and 100 mM lithium chloride (in 42% DMSO contained in mQ water (90 μL)) in a rotating shaker at room temperature for 1 hour. The solid support was washed with 50% DMSO in mQ water (3 × 200 μL).
[0225] Example 1: Preparation of 5'-azide-modified single-strand oligonucleotides Amino-modified ssDNA: 5'd-aminoC6-GGAGCTTCTGAATT3' (sequence 1) Acid azide: 3-[2-[2-[2-(2-azidoethoxy)ethoxy]ethoxy]ethoxy]propanoic acid 3-[2-[2-[2-(2-azidoethoxy)ethoxy]ethoxy]ethoxy]propanoic acid (300 μL, 100 mM in DMSO), 1-hydroxy-2,5-dioxo-3-pyrrolidinesulfonic acid (S-NHS) (145 μL, 100 mM in 33% (v / v) mQ water in DMSO), and N 3 -(ethylcarbonimidoyl)-N 1 ,N 1-Dimethyl-1,3-propanediamine (EDC) (145 μL, 100 mM in DMSO) was added to a tube containing 1 mL of dimethyl sulfoxide (DMSO) and incubated in a rotating shaker at 37°C for 30 minutes. Meanwhile, 250 nmol of amino-modified ssDNA in 504 μL of mQ water was incubated with 350 μL of 250 mM borate buffer pH 9.5 on a rotating shaker at 37°C for 30 minutes. An activation solution containing S-NHS, EDC, and 3-[2-[2-[2-(2-azidoethoxy)ethoxy]ethoxy]ethoxy]propanoic acid was mixed with the DNA in borate buffer and reacted in a rotating shaker at 37°C for 45 minutes. The reaction was monitored by LC-MS. The DNA was precipitated by adding 20% (v / v) 5 M NaCl, followed by 3.5 volumes of anhydrous ethanol. The samples were stored at -20°C for 18 hours, then centrifuged at 4°C and 4000×g. The supernatant was discarded, and the precipitate was completely dried using a Speedvac rotary vacuum concentrator. The dried precipitate was dissolved in 1 mL of 100 mM TEAA pH 7.0. The crude product was purified by RP-HPLC using a gradient of Waters XBridge® BEH C18 OBD® Prep Column (130 Å, 5 μm, 10 mM × 150 mM) and buffer 1 (100 mM TEAA pH 7.0 buffer) and buffer 2 (mQ water containing 80% acetonitrile in 100 mM TEAA pH 7.0). The collected fractions were combined and concentrated, and oligonucleotides were precipitated by adding 20% (v / v) 5 M NaCl, followed by 3.5 volumes of anhydrous ethanol. The samples were stored at -20°C for 2 hours, then centrifuged at 4°C and 4000×g. The supernatant was discarded, and the precipitate was completely dried using a Speedvac rotary vacuum concentrator. The dried precipitate was dissolved in 500 μL of mQ water. Concentration evaluation by measuring UV absorbance at 260 nm with a NanoDrop 2000c spectrophotometer showed a yield of 61%. The product was analyzed by LC-MS (Figure 13). In Figure 13B, the chromatogram measuring the absorbance at 260 nm is shown for the product, a 5'-azide-modified single-strand oligonucleotide. The desired product is the major product.(Figure 13D) shows the deconvolution (decon.) mass spectrum of the product peak. The mass corresponding to the desired product is observed. For comparison, the LCMS spectra of the starting materials are shown in (Figure 13A) and (Figure 13C). In (Figure 13A), a chromatogram measuring absorbance at 260 nm is shown for the starting material oligonucleotide (Sequence 1). The deconvolved mass spectrum is shown in (Figure 13C) for the starting material oligonucleotide (Sequence 1).
[0226] Example 2: Preparation of New Library Members (Linker + Cleavage Group Approach) NH2-functionalized 10 μm TentaGel® beads (Rapp Polymere GmbH) (385 mg, 0.1 mmol loading) were added to a solid-phase synthesis reaction vessel with a frit. The TentaGel® beads were swollen with dimethylformamide (6 mL) for 10 minutes at room temperature on a rotary shaker and then washed with dimethylformamide (3 × 10 mL).
[0227] Step 2.1 Coupling to Succinic Acid Mono-tert-Butyl The functionalized TentaGel® beads were coupled to succinic acid mono-tert-butyl according to General Procedure 1.
[0228] Step 2.2 Capping The functionalized TentaGel® beads were swollen with dichloromethane (6 mL) for 10 minutes at room temperature on a rotary shaker and then washed with dichloromethane (3 × 10 mL). The functionalized TentaGel® beads were incubated with a mixture of dichloromethane (6 mL), acetic anhydride (2 mL), and N,N-diisopropylethylamine (DIPEA) (2 mL) for 1 hour at room temperature. The functionalized TentaGel® beads were washed with DCM (3 × 10 mL).
[0229] Step 2.3 tert-Butyl Deprotection A mixture of 50% (v / v) trifluoroacetic acid in dichloromethane (5 mL) was added to functionalized TentaGel® beads. The solution was removed after 10 minutes at room temperature using a rotary shaker. Next, a fresh mixture of 50% (v / v) trifluoroacetic acid in dichloromethane (5 mL) was incubated with the TentaGel® beads in a rotary shaker at room temperature for 20 minutes. The resin was washed with dichloromethane (3 × 10 mL) and then with dimethylformamide (3 × 10 mL).
[0230] Step 2.4 Coupling to N-Boc-ethylenediamine Functionalized TentaGel® beads were swollen with DMF (10 mL). Next, the dried functionalized TentaGel® beads were incubated with N-Boc-ethylenediamine (63 μL, 0.4 mmol, 4 equivalents), N,N-diisopropylethylamine (DIPEA) (136 μL, 0.8 mmol, 8 equivalents), and dimethylformamide (6 mL) containing N-[(dimethylamino)-1H-1,2,3-triazolo-[4,5-b]pyridine-1-ylmethylene]-N-methylmethanaminonium hexafluorophosphate N-oxide (HATU) (152 mg, 0.4 mmol, 4 equivalents) at room temperature on a rotating shaker for 2 hours. Functionalized TentaGel® beads were washed with dimethylformamide (3 × 10 mL), dichloromethane (3 × 10 mL), and then with dimethylformamide (3 × 10 mL).
[0231] Step 2.5 Boc Deprotection A mixture of 50% (v / v) trifluoroacetic acid in dichloromethane (5 mL) was added to functionalized TentaGel® beads. The solution was removed after 10 minutes at room temperature using a rotary shaker. Next, a fresh mixture of 50% (v / v) trifluoroacetic acid in dichloromethane (5 mL) was incubated with the TentaGel® beads in a rotary shaker at room temperature for 20 minutes. The resin was washed with dichloromethane (3 × 10 mL) and then with dimethylformamide (3 × 10 mL).
[0232] Step 2.6 Coupling to 6-(Fmoc-amino)hexanoic acid Functionalized TentaGel® beads were swollen with DMF (10 mL). Next, the functionalized TentaGel® beads were coupled to 6-(Fmoc-amino)hexanoic acid according to general procedure 1.
[0233] Step 2.7 Fmoc Deprotection Functionalized TentaGel® beads were deprotected with Fmoc according to general procedure 2.
[0234] Step 2.8 Coupling to 3-[[(9H-fluoren-9-ylmethoxy)carbonyl]amino]-4-(methylamino)benzoic acid Functionalized TentaGel® beads were reacted with 3-[[(9H-fluoren-9-ylmethoxy)carbonyl]amino]-4-(methylamino)benzoic acid (Fmoc-MeDbz-OH) according to general procedure 1.
[0235] Step 2.9 Fmoc Deprotection Functionalized TentaGel® beads were deprotected with Fmoc according to general procedure 2.
[0236] Step 2.10 Coupling to 6-(Fmoc-amino)hexanoic acid Functionalized TentaGel® beads were reacted with 6-(Fmoc-amino)hexanoic acid according to general procedure 1.
[0237] Step 2.11Fmoc Deprotection The functionalized TentaGel® beads were deprotected with Fmoc according to general procedure 2.
[0238] Step 2.12 Coupling to (2S)-2-[[(9H-fluoren-9-ylmethoxy)carbonyl]amino]-4-pentic acid Functionalized TentaGel® beads were coupled to (2S)-2-[[(9H-fluoren-9-ylmethoxy)carbonyl]amino]-4-pentic acid (Fmoc-Pra-OH) according to general procedure 1.
[0239] Step 2.13 Fmoc Deprotection Functionalized TentaGel® beads were deprotected with Fmoc according to general procedure 2.
[0240] Step 2.14 Oligonucleotide bonding The compounds synthesized in steps 2.1 to 2.13 are solid supports equipped with MeDbz linkers to connect to a scaffold, and contain sites for constructing block bonds with amine functional groups and alkynes for nucleic acid binding. 5 nmol of 5'-azide-modified single-strand oligonucleotides (synthesized in Example 1) were conjugated to functionalized TentaGel (steps 2.1 to 2.13, 20 mg) according to general procedure 5.
[0241] Decomposition of newly formed library members for LCMS analysis Step 2.15 Activation of the MeDbz linker Step 1 Incubation with p-nitrophenyl chloroformate Oligonucleotide-bound functionalized TentaGel® beads (20 mg) were incubated with 100 mM p-nitrophenyl chloroformate in 600 μL of dichloromethane in a rotating shaker at room temperature for 30 minutes. The resin was washed with 3 × 600 μL of dichloromethane.
[0242] Step 2.16 Activation of the MeDbz linker Step 2: Incubation with N,N-diisopropylethylamine (DIPEA) Oligonucleotide-bound functionalized TentaGel® beads (20 mg) were incubated with 600 μL of dichloromethane containing 8.7% (v / v) N,N-diisopropylethylamine (DIPEA) in a rotating shaker at room temperature for 30 minutes. The resin was washed with 2 × 600 μL of dichloromethane.
[0243] Step 2.17 MeDbz cleavage by cysteamine Oligonucleotide-bound functionalized TentaGel® beads (20 mg) were incubated with excess cysteamine in 50% (v / v) DMSO in mQ water containing 0.01% (w / v) sodium dodecyl sulfate (SDS) (150 μL) using a rotating shaker at 60°C for 1 hour. The resulting solution was separated from the beads by centrifugation and collected. The collected solution was analyzed by LCMS (Figure 14). Figure 14 shows the analytical LCMS data regarding the cleavage of the nascent library members. (Figure 14A) and (Figure 14B) show chromatograms with absorbance measured at 260 nm. (Figure 14C) and (Figure 14D) show the mass spectrum of the product peak and the deconvoluted mass spectrum at 3.80 min, respectively. These LCMS spectra indicate that the desired nascent library members were obtained. The large peak observed at later retention times represents LCMS impurities found in all LCMS measurements on that instrument at that point in time.
[0244] Example 3: Synthesis of self-eluting model compound off-DNA The functionalized solid supports prepared in steps 2.1 to 2.13 were used as starting materials for the synthesis of self-eluting model compounds (off-DNA). Functionalized TentaGel® beads were swollen with dimethylformamide (6 mL) in a rotating shaker at room temperature for 10 minutes, and then washed with dimethylformamide (3 × 10 mL).
[0245] Step 3.1 Resin splitting The functionalized TentaGel® beads prepared in steps 2.1 to 2.13 were divided into two 0.05 mmol portions. One of the two portions was used to continue the synthesis on a 0.05 mmol scale.
[0246] Step 3.2 Coupling to 6-(Fmoc-amino)hexanoic acid Functionalized TentaGel® beads were reacted with 6-(Fmoc-amino)hexanoic acid according to general procedure 1.
[0247] Step 3.3 Fmoc Deprotection Functionalized TentaGel® beads were deprotected with Fmoc according to general procedure 2.
[0248] Step 3.4 Coupling to (2S)-2-([[(9H-fluoren-9-yl)methoxy]carbonyl]amino)-3-(naphthalen-1-yl)propanoic acid Functionalized TentaGel® beads were reacted with (2S)-2-([[(9H-fluoren-9-yl)methoxy]carbonyl]amino)-3-(naphthalen-1-yl)propanoic acid (Fmoc-1-Nal-OH) according to the general procedure 1.
[0249] Step 3.5 Resin splitting Functionalized TentaGel® beads were split into two 0.025 mmol portions. Synthesis was continued on a 0.025 mmol scale using one of the two portions.
[0250] Step 3.6 Fmoc Deprotection The functionalized TentaGel® beads were deprotected with Fmoc according to general procedure 2.
[0251] Step 3.7 (RS) - Coupling to lipoic acid Functionalized TentaGel® beads were reacted with (RS)-lipoic acid according to general procedure 1.
[0252] Example 4: Autoelution of Model Nucleic Acid Code Library Members Step 4.1 Oligonucleotide bonding Following general procedure 5, 5 nmol of a 5'-azide-modified single-strand oligonucleotide was conjugated to the autoeluting model compound (20 mg) synthesized in Example 3.
[0253] Step 4.2 Activation of the MeDbz linker Step 1 Incubation with p-nitrophenyl chloroformate Oligonucleotide-bound functionalized TentaGel® beads (20 mg) were incubated with 100 mM p-nitrophenyl chloroformate in 600 μL of dichloromethane in a rotating shaker at room temperature for 30 minutes. The resin was washed with 3 × 600 μL of dichloromethane.
[0254] Step 4.3 Activation of the MeDbz linker Step 2 - Incubation with N,N-diisopropylethylamine (DIPEA) The functionalized beads were incubated with 600 μL of dichloromethane containing 8.7% (v / v) N,N-diisopropylethylamine (DIPEA) at room temperature in a rotary shaker for 30 minutes. The resin was then washed with 3 × 600 μL of dichloromethane.
[0255] Step 4.4 Deprotection of cleavage groups Functionalized beads were incubated in a solution (0.01% w / v) (containing sodium dodecyl sulfate (SDS)) in mQ water containing 6% (v / v) triethylamine, 100 mM Tris(2-carboxyethyl)phosphine hydrochloride (TCEP), and 53% dimethyl sulfoxide (DMSO) at pH 8-9 (150 μL) using a rotary shaker at 60°C for 1 hour. The beads were dried by centrifugation.
[0256] Step 4.5 Autoelution of Model Nucleic Acid Code Library Members Functionalized beads were incubated in mQ water containing 0.01% (w / v) sodium dodecyl sulfate (SDS) (150 μL) and a solution of 10% (v / v) N,N-diisopropylethylamine (DIPEA) in 80% acetonitrile at 60°C for 1 hour using a rotary shaker. The resulting solution was separated from the beads by centrifugation and collected. The collected solution was concentrated using a Speedvac rotary vacuum concentrator.
[0257] Step 4.6 Ethanol precipitation of autoeluting model nucleic acid coding library members The residue obtained after step 4.5 was resuspended in 50% (v / v) dimethyl sulfoxide (DMSO) in mQ water (150 μL). The sample was filtered, and 10 μL of the sample was used for LC-MS analysis. Using 125 μL of the sample, the autoeluting model nucleic acid coding library members were precipitated with ethanol by adding 10% (v / v) 5 M sodium chloride (12.5 μL), 10% (v / v) 2.5 M sodium acetate buffer pH 4.79 (12.5 μL), followed by 3.5 volumes of anhydrous ethanol (525 μL). After storing the sample at -20°C for 18 hours, it was centrifuged at 4°C and 20800 × g for 1 hour. The supernatant was discarded, and the precipitate was completely dried in a Speedvac rotary vacuum concentrator. The dried precipitate was dissolved in mQ water (100 μL). LC-MS analysis revealed the masses of the self-eluting model nucleic acid coding library members (Figures 19 and 20). The chemical structures (Figure 19A) and (Figure 19B) were observed in absorbance chromatograms at 260 nm (Figure 19C) and 280 nm (Figure 19D). (Figure 19B) is a linear self-eluting product formed by hydrolysis of a cyclic thioester intermediate. (Figure 19A) is a linear self-eluting product formed by ring-opening of the cyclic thioester intermediate with ethanol, which was added for the precipitation step. The observed compounds can be formed by oxidation of thiol groups forming intramolecular disulfide bonds. (Figures 20A) and (Figure 20B) show the mass spectra and deconvoluted mass spectra of the self-eluting library member compounds shown in Figure 19A, respectively. (Figures 20C) and (Figure 20D) show the mass spectra and deconvoluted mass spectra of the self-eluting library member compounds shown in Figure 19B, respectively. These data indicate that autolysis was achieved.
[0258] Example 5: Autoelution of Model Nucleic Acid Code Library Members Step 5.1 Oligonucleotide binding Following general procedure 5, 5 nmol of a 5'-azide-modified single-strand oligonucleotide was conjugated to the autoeluting model compound (20 mg) synthesized in Example 3.
[0259] Step 5.1 Activation of the MeDbz linker Step 1: Incubation with p-nitrophenyl chloroformate Oligonucleotide-bound functionalized TentaGel® beads (20 mg) were incubated with 100 mM p-nitrophenyl chloroformate in 600 μL of dichloromethane in a rotating shaker at room temperature for 30 minutes. The resin was washed with 3 × 600 μL of dichloromethane.
[0260] Step 5.2 Activation of the MeDbz linker Step 2 - Incubation with N,N-diisopropylethylamine (DIPEA) The functionalized beads were incubated with 600 μL of dichloromethane containing 8.7% (v / v) N,N-diisopropylethylamine (DIPEA) at room temperature in a rotating shaker for 30-40 minutes. The resin was then washed with 3 × 600 μL of dichloromethane.
[0261] Step 5.3 Deprotection of cleavage groups The functionalized beads were incubated in a solution of 6% (v / v) triethylamine containing 100 mM Tris(2-carboxyethyl)phosphine hydrochloride (TCEP), 53% dimethyl sulfoxide (DMSO), and mQ water (0.01% (w / v) (containing sodium dodecyl sulfate (SDS))) (pH 8-9) using a rotary shaker at 60°C for 1 hour. The beads were dried by centrifugation.
[0262] Step 5.4 Autoelution of Model Nucleic Acid Code Library Members Functionalized beads were incubated with a 150 μL solution of 10% (v / v) N,N-diisopropylethylamine (DIPEA) in dichloromethane on a rotating shaker at 60°C for 1 hour. The beads were then dried by centrifugation. The beads were washed with a solution of 1 mM sodium carbonate (Na2CO3) in 49% DMSO in mQ water containing 0.01% SDS, pH 9, and the resulting solution collected by centrifugation was analyzed by LC-MS (Figures 21 and 22). Figure 21A shows the structures of two possible cyclic autoeluting nucleic acid coding library members. Figure 21B is the chromatogram at 260 nm, and Figure 21C is the TIC. The mass peak corresponding to the cyclic autoeluting library member is observed at 5.88 min. Figures 22B and 22C are the mass spectra of the peaks of the autoeluting nucleic acid library member and the corresponding deconvoluted mass spectra, respectively. The mass of the desired circular autoeluting nucleic acid coding library member was observed, indicating that autoelution was achieved.
[0263] Example 6: Auto-purification of model nucleic acid coding library members Step 6.1 Synthesis of Dbz linker derivatives [ka]
[0264] 4-amino-3-[[(9H-fluoren-9-ylmethoxy)carbonyl]amino]benzoic acid (Fmoc-Dbz-OH) (200 mg, 0.534 mmol, 1.0 equivalent) was dissolved in 10 mL of dimethylformamide (DMF) in a round-bottom flask. Propargylamine (68.3 μL, 1.068 mmol, 2.0 equivalents), N,N-diisopropylethylamine (DIPEA) (372 μL, 2.137 mmol, 4.0 equivalents), and N-[(dimethylamino)-1H-1,2,3-triazolo-[4,5-b]pyridine-1-ylmethylene]-N-methylmethanaminonium hexafluorophosphate N-oxide (HATU) (407 mg, 1.068 mmol, 2.0 equivalents) were added, and the solution was stirred at room temperature for 2 hours. The reaction mixture was quenched with water. The aqueous components were extracted with ethyl acetate. The combined organic components were concentrated under reduced pressure. The crude product was purified by flash column chromatography (70% (v / v) ethyl acetate in hexane) to obtain a white solid. [ka]
[0265] The above product was stirred at room temperature for 5 hours in 20% (v / v) diethylamine in THF (10 mL). The reaction mixture was concentrated under reduced pressure. The crude reaction product was used for binding to a solid support.
[0266] Preparation of new library members Step 6.2 N 2 -[(9H-fluoren-9-ylmethoxy)carbonyl]-N 6 Coupling to -[(4-methylphenyl)diphenylmethyl]-L-lysine (Fmoc-Lys(Mtt)-OH) Amine-functionalized solid support (Functionalized ProMag® 1, Bangs Labarotories, Inc.) (50 μL) was prepared according to general procedure 3, N 2 -[(9H-fluoren-9-ylmethoxy)carbonyl]-N 6-[(4-methylphenyl)diphenylmethyl]-L-lysine (Fmoc-Lys(Mtt)-OH) was coupled to it.
[0267] Step 6.3 Fmoc Deprotection Functionalized beads (50 μL) were deprotected with Fmoc according to the general procedure 4.
[0268] Step 6.4 Coupling to 4-(hydroxymethyl)benzoic acid (HMBA) Following the general procedure 3, an amine-functionalized solid support (50 μL) was coupled to 4-(hydroxymethyl)benzoic acid (HMBA).
[0269] Step 6.5 Coupling to (2S)-2-[[(9H-fluoren-9-ylmethoxy)carbonyl]amino]-4-pentic acid (Fmoc-Pra-OH) Alcohol-functionalized solid supports (50 μL) were washed with dimethylformamide (200 μL). Functionalized beads were incubated with a solution of 100 mM diisopropylcarbodiimide (DIC), 5.76 mM DMAP, and 150 μL of dimethylformamide containing 80 mM (2S)-2-[[(9H-fluoren-9-ylmethoxy)carbonyl]amino]-4-pentic acid (Fmoc-Pra-OH) in a rotary shaker at 4°C for 4 hours. Functionalized beads were washed with dimethylformamide (6 × 200 μL).
[0270] Step 6.6 Fmoc Deprotection The functionalized beads (50 μL) were deprotected with Fmoc according to general procedure 4.
[0271] Step 6.7 Coupling to 1-(1,1-dimethylethyl)butanedioate building block Amine-functionalized solid support (50 μL) was coupled to 1-(1,1-dimethylethyl)butanediate according to general procedure 3.
[0272] Step 6.8 Mtt Deprotection and tBu Deprotection Functionalized beads (50 μL) were incubated with dichloromethane (600 μL) containing 50% (v / v) trifluoroacetic acid at room temperature on a rotating shaker for 3 minutes (the step was repeated 3 times). The functionalized beads were washed with 10% (v / v) N,N-diisopropylethylamine (DIPEA) in dimethylformamide (3 × 200 μL), and then washed with dimethylformamide (3 × 200 μL).
[0273] Step 6.9 Binding of oligonucleotides to the solid support 5 nmol of 5'-azide-modified single-strand oligonucleotides (synthesized in Example 1) were conjugated to alkyne-functionalized beads (50 μL) using twice the amount described in General Procedure 6.
[0274] Step 6.10 Low molecular weight alkyne quenching 50 μL of functionalized beads after DNA binding were subjected to CuAAC conditions with benzyl azide to quench any unreacted alkyne functional groups. 50 μL of the functionalized solid support was washed with dimethyl sulfoxide (DMSO) (3 × 200 μL). The solid support was incubated for 1 hour at room temperature in a rotating shaker in a mixture of 50 mM benzyl azide, 993 μM 1-(phenylmethyl)-N,N-bis[[1-(phenylmethyl)-1H-1,2,3-triazole-4-yl]methyl]-1H-1,2,3-triazole-4-methaneamine (TBTA), 945 μM copper sulfate (CuSO4), and 360 μL of mQ water containing 89% sodium ascorbate (NaAsc) dimethyl sulfoxide (DMSO). The solid support was washed with DMSO (3 × 200 μL). 5 μL of the functionalized solid support was stored for analysis.
[0275] Installing Linker 2 Step 6.11 Coupling to 5-azidopentanoic acid (reaction on DNA on a solid support) N 3 -(ethylcarbonimidoyl)-N 1 ,N1 Stocks of dimethyl-1,3-propanediamine (EDC) and 1-hydroxy-2,5-dioxo-3-pyrrolidinesulfonic acid (S-NHS) at 50 mg / mL were prepared in 100 mM 2-(N-morpholino)ethanesulfonic acid (MES) buffer (pH 4.5). 40 μL of each stock was mixed with 120 μL of 450 mM 5-azidopentanoic acid in dimethylformamide (DMF) to a final volume of 200 μL. This solution was incubated at room temperature for 15 minutes. Next, this solution was added to functionalized beads (45 μL), and the reaction mixture was left in a rotating shaker at room temperature for 2 hours. The functionalized beads were washed with dimethylformamide (DMF) (3 × 200 μL).
[0276] Step 6.12 Coupling to reverse Dbz linker 2 (reaction on DNA on a solid support) 5 μL of the functionalized solid support was set aside for analysis. The remaining 40 μL of the functionalized solid support was washed with dimethylformamide (DMF) (200 μL). The functionalized beads were incubated at 40°C for 1 hour on a rotating shaker with a solution of 360 mM amine (reverse Dbz linker prepared in step 6.1), 360 mM HATU, and 100 μL of 1.50 M DIPEA in dimethylformamide (DMF). The functionalized beads were washed with dimethylformamide (DMF) (3 × 200 μL).
[0277] Step 6.13 Oligonucleotide cleavage of 10 μL beads from solid support for LC-MS analysis A portion of the functionalized solid support (10 μL) was incubated with 100 mM lithium hydroxide (LiOH) in 25% dimethyl sulfoxide (DMSO) in mQ water (60 μL) in a rotary shaker at 40°C for 1 hour. The sample was filtered and analyzed by LC-MS (Figure 29A). The LC-MS spectrum shows that cleavage of the HMBA linker generates the desired intermediate, as shown at 4.01 min of the chromatogram (Figure 29A). The chemical structure of the desired intermediate is shown (Figure 29A). Furthermore, the analyzed sample contains undesirable intermediates. These may be, for example, compounds that did not undergo the preceding amide coupling step in the synthesis.
[0278] Step 6.14 Cyclization with CuAAC The remaining functionalized solid support (30 μL) was washed with dimethyl sulfoxide (DMSO) (3 × 200 μL). The solid support was incubated at room temperature for 1 hour in a rotating shaker in a mixture of 89% DMSO in mQ water (270 μL) containing 993 μM 1-(phenylmethyl)-N,N-bis[[1-(phenylmethyl)-1H-1,2,3-triazole-4-yl]methyl]-1H-1,2,3-triazole-4-methaneamine (TBTA), 945 μM copper sulfate (CuSO4), and 5.672 mM sodium ascorbate (NaAsc). The solid support was washed with DMSO (3 × 200 μL).
[0279] self-purification Step 6.15 Dehiscence of Linker 1 For the functionalized solid support (30 μL), HMBA linker 1 was cleaved in mQ water (60 μL) with 100 mM lithium hydroxide (LiOH) in 25% DMSO using a rotating shaker at 40°C for 1.5 hours. LC-MS analysis of this solution showed undesirable products cleaved from the solid support during this step (Figure 29B). Comparison of chromatograms (Figure 29B) and (Figure 29A) shows that all compounds are cleaved from the solid support in step 6.15, except for the desired intermediate formed in step 6.12. This is because the compound contains an alkyne and has undergone a CuAAC reaction prior to cleavage in step 6.15. This indicates that the CuAAC reaction was successful and only the undesirable products were released from the solid support in this step.
[0280] Step 6.16 Dehiscation of Linker 2 (End Linker) Dbz linker 2 on a functionalized solid support (30 μL) was activated by incubation with 36 mM isopentyl nitrite in mQ water (200 μL) for 1.5 hours at room temperature using a rotating shaker. The solid support was washed with mQ water (2 × 200 μL). The activated linker was cleaved with 100 mM lithium hydroxide (LiOH) in 25% DMSO in mQ water (60 μL). LC-MS analysis showed the desired self-purified nucleic acid coding library members (Figure 29C, Figure 30). Figure 29C shows the chromatogram of the sample obtained after cleaving the second linker Dbz. The chromatogram shows the self-purified nucleic acid coding library members. The structure of the desired self-purified nucleic acid coding library members is shown (Figure 29C). Figure 30A shows the absorbance chromatogram at 260 nm. Figure 30B shows the absorbance chromatogram at 280 nm. Figure 30C shows the mass spectrum of the product peak at 3.94 min. Figure 30D shows the deconvoluted mass spectrum of the product peak at 3.94 min. The mass corresponding to the desired self-purified nucleic acid model nucleic acid coding library member is observed. The desired self-purified model nucleic acid coding library member is the main product obtained in step 6.16.
[0281] Example 7: Auto-purification of model nucleic acid coding library members Step 7.1 N 2 -[(9H-fluoren-9-ylmethoxy)carbonyl]-N 6 Coupling to -[(4-methylphenyl)diphenylmethyl]-L-lysine (Fmoc-Lys(Mtt)-OH) Amine-functionalized solid support (Functionalized ProMag® 1, Bangs Labarotories, Inc.) (50 μL) was prepared according to general procedure 3, N 2 -[(9H-fluoren-9-ylmethoxy)carbonyl]-N 6 It was coupled to -[(4-methylphenyl)diphenylmethyl]-L-lysine (Fmoc-Lys(Mtt)-OH).
[0282] Step 7.2 Fmoc Deprotection The functionalized beads (50 μL) were deprotected with Fmoc according to general procedure 4.
[0283] Step 7.3 Coupling to 4-(hydroxymethyl)benzoic acid (HMBA) Following the general procedure 3, an amine-functionalized solid support (50 μL) was coupled to 4-(hydroxymethyl)benzoic acid (HMBA).
[0284] Step 7.4 Coupling to (2S)-2-[[(9H-fluoren-9-ylmethoxy)carbonyl]amino]-4-pentic acid (Fmoc-Pra-OH) Alcohol-functionalized solid supports (50 μL) were washed with dimethylformamide (DMF) (200 μL). Functionalized beads were incubated with a solution of 100 mM diisopropylcarbodiimide (DIC), 5.76 mM N,N-dimethyl-4-pyridineamine (DMAP), and 150 μL of dimethylformamide containing 80 mM (2S)-2-[[(9H-fluoren-9-ylmethoxy)carbonyl]amino]-4-pentic acid (Fmoc-Pra-OH) in a rotary shaker at 4°C for 4 hours. The functionalized beads were washed with dimethylformamide (DMF) (6 × 200 μL).
[0285] Step 7.5 Fmoc Deprotection The functionalized beads (50 μL) were deprotected with Fmoc according to general procedure 4.
[0286] Step 7.6 Coupling to Fmoc-Dbz-OH Amine-functionalized solid support (50 μL) was coupled to 4-amino-3-[[(9H-fluoren-9-ylmethoxy)carbonyl]amino]benzoic acid (Fmoc-Dbz-OH) according to general procedure 3.
[0287] Step 7.7 MTT Deprotection Functionalized beads (50 μL) were incubated with dichloromethane (600 μL) containing 50% (v / v) trifluoroacetic acid at room temperature on a rotating shaker for 3 minutes (the step was repeated 3 times). The functionalized beads were washed with 10% (v / v) N,N-diisopropylethylamine (DIPEA) in dimethylformamide (3 × 200 μL), and then washed with dimethylformamide (3 × 200 μL).
[0288] Step 7.8 Binding of oligonucleotides to the solid support 5 nmol of 5'-azide-modified single-strand oligonucleotides (synthesized in Example 1) were conjugated to alkyne-functionalized beads (50 μL) using twice the amount described in General Procedure 6.
[0289] Step 7.9 Low Molecular Weight Alkine Quenching The functionalized beads (50 μL) after DNA binding were subjected to CuAAC conditions with benzyl azide to quench any unreacted alkyne functional groups. The functionalized solid support (50 μL) was washed with DMSO (3 × 200 μL). The solid support was incubated at room temperature for 1 hour in a rotating shaker in a mixture of 50 mM benzyl azide, 993 μM 1-(phenylmethyl)-N,N-bis[[1-(phenylmethyl)-1H-1,2,3-triazole-4-yl]methyl]-1H-1,2,3-triazole-4-methaneamine (TBTA), 945 μM copper sulfate (CuSO4), and 360 μL of mQ water containing DMSO with 89% 5.672 mM sodium ascorbate (NaAsc). The solid support was washed with DMSO (3 × 200 μL). 5 μL of the functionalized solid support was stored for analysis.
[0290] Step 7.10 Coupling to 5-azidopentanoic acid (reaction on DNA on a solid support) N 3 -(ethylcarbonimidoyl)-N 1 ,N 1Stocks of dimethyl-1,3-propanediamine (EDC) and 1-hydroxy-2,5-dioxo-3-pyrrolidinesulfonic acid (S-NHS) at 50 mg / mL were prepared in 100 mM 2-(N-morpholino)ethanesulfonic acid (MES) buffer (pH 4.5). 40 μL of each stock was mixed with 120 μL of 450 mM 5-azidopentanoic acid in dimethylformamide to a final volume of 200 μL. The solution was incubated at room temperature for 15 minutes. Next, this solution was added to functionalized beads (45 μL), and the reaction mixture was left in a rotating shaker at room temperature for 2 hours. The functionalized beads were washed with dimethylformamide (3 × 200 μL). 5 μL of the functionalized solid support was set aside for analysis.
[0291] Step 7.11 Fmoc Deprotection The functionalized beads (40 μL) were deprotected with Fmoc according to general procedure 4, using 80% of the stated volume.
[0292] Step 7.12 Coupling to 5-hexine A functionalized solid support (40 μL) was washed with DMSO (200 μL). The solid support was then treated with 5 mM 3-hydroxy-3H-1,2,3-triazolo[4,5-b]pyridine (HOAt), 500 mM 5-hexic acid, and 50 mM N 3 -(ethylcarbonimidoyl)-N 1 ,N 1 Dimethyl-1,3-propanediamine (EDC) was incubated in a 500 μL solution of DMSO (Dimethyl-1,3-propanediamine) in a rotary shaker at room temperature for 2 hours. The solid support was washed with 3 × 200 μL of DMSO, and 10 μL of the functionalized solid support was set aside for analysis.
[0293] Step 7.13 Cyclization with CuAAC Alkyne and azide-functionalized solid supports (30 μL) were washed with DMSO (3 × 200 μL).
[0294] The solid support was incubated for 1 hour at room temperature in a rotating shaker in a mixture of 89% DMSO in mQ water (360 μL) containing 993 μM 1-(phenylmethyl)-N,N-bis[[1-(phenylmethyl)-1H-1,2,3-triazole-4-yl]methyl]-1H-1,2,3-triazole-4-methaneamine (TBTA), 945 μM copper sulfate (CuSO4), and 5.672 mM sodium ascorbate (NaAsc). The solid support was washed with DMSO (3 × 200 μL).
[0295] self-purification Step 7.14 Destruction of Linker 1 For the functionalized solid support (30 μL), HMBA linker 1 was cleaved with 100 mM lithium hydroxide (LiOH) in 25% DMSO in mQ water (60 μL) for 1.5 hours at 40°C using a rotating shaker.
[0296] Step 7.15 Dehiscence of Linker 2 (End Linker) For a functionalized solid support (30 μL), Dbz linker 2 was activated by incubation with 36 mM isopentyl nitrite in mQ water (200 μL) for 2 hours at room temperature using a rotating shaker. The solid support was washed with mQ water (2 × 200 μL). The activated linker was cleaved with 100 mM lithium hydroxide (LiOH) in 25% DMSO in mQ water (60 μL). The cleaved solution was analyzed by LC-MS (Figure 36). Figure 36A shows the absorbance chromatogram at 260 nm. Figure 36B shows the absorbance chromatogram at 280 nm. Figure 36C shows the mass spectrum of the product peak at 3.97 min. Figure 36D shows the deconvoluted mass spectrum of the product peak at 3.97 min. Masses corresponding to the desired self-purified nucleic acid model nucleic acid coding library members are observed. This embodiment further demonstrates that the Dbz linker is activated before cleavage.
[0297] Example 8: DNA ligation on a solid support Adapter (array 3): 3'-CCTCGAAGACTTAAGACACACGAC-5' Code (array 4): 5'd Phos-CTGTGTGCTGACAGCTCGAGTCCCATGGCGC3' Molecular weight=9584.16Da, ε 260 =280300M -1 cm -1
[0298] Step 8.1 Coupling to ethylenediamine Carboxylic acid-functionalized magnetic solid support (ProMag® 1, Bangs Labarotories, Inc.) (25 μL) was washed with DMSO (1 × 1 mL) and dimethylformamide (DMF) (2 × 1 mL). The functionalized beads were incubated with a DMF solution of 360 mM HATU, 360 mM ethylenediamine, and 1.1 M DIPEA (25 μL, 2 × 30 min). The functionalized beads were washed with dimethylformamide (3 × 200 μL).
[0299] Step 8.2 Coupling to 4-(hydroxymethyl)benzoic acid (HMBA) Amine-functionalized solid supports (25 μL) were coupled to 4-(hydroxymethyl)benzoic acid (HMBA) using half of the respective volumes, according to general procedure 3.
[0300] Step 8.3 N 2 -[(9H-fluoren-9-ylmethoxy)carbonyl]-N 6 Coupling to -[(4-methylphenyl)diphenylmethyl]-L-lysine (Fmoc-Lys(Mtt)-OH) Amine-functionalized solid support (25 μL) 2 -[(9H-fluoren-9-ylmethoxy)carbonyl]-N 6 -[(4-methylphenyl)diphenylmethyl]-L-lysine (Fmoc-Lys(Mtt))-OH) was coupled using half the volume described for each, according to general procedure 3.
[0301] Step 8.4 Fmoc Deprotection Each functionalized bead (25 μL) was deprotected with Fmoc using half the volume indicated, following general procedure 4.
[0302] Step 8.5 Coupling to 1-(9H-fluoren-9-ylmethyl)5,8,11,14-tetraoxa-2-azaheptadecanedioate (Fmoc-PEG4-OH) Amine-functionalized solid supports (25 μL) were coupled to 1-(9H-fluoren-9-ylmethyl)5,8,11,14-tetraoxa-2-azaheptadecanedioate (Fmoc-PEG4-OH) using half the volume indicated for each, according to general procedure 3.
[0303] Step 8.6 Fmoc Deprotection Each functionalized bead (25 μL) was deprotected with Fmoc using half the volume indicated, following general procedure 4.
[0304] Step 8.7 Coupling to 5-hexic acid Amine-functionalized solid supports (25 μL) were coupled to 5-hexic acid using half of the respective volumes, according to general procedure 3.
[0305] Step 8.8 Mtt Deprotection Functionalized beads (25 μL) were incubated with dichloromethane (300 μL) containing 50% (v / v) trifluoroacetic acid at room temperature on a rotating shaker for 3 minutes (the step was repeated 3 times). The functionalized beads were washed with 10% (v / v) N,N-diisopropylethylamine (DIPEA) in dimethylformamide (3 × 200 μL), and then washed with dimethylformamide (3 × 200 μL).
[0306] Step 8.9 Binding of oligonucleotides to a solid support 1 nmol of 5'-azide-modified single-chain oligonucleotide (synthesized in Example 1) was conjugated to a functionalized solid support (25 μL) according to general procedure 6, but lithium chloride was not used.
[0307] Step 8.10 Ligation on a solid support The ligation procedure was adapted from Pengpumkiat et al 2016. The functionalized solid support was washed with a solution of 10 mM Tris, 1 mM EDTA, 2 M NaCl, and 0.05% (v / v) Tween 20, pH 7.4 (1 × 200 μL). Next, the functionalized solid support was washed with mQ water (2 × 200 μL). To a functionalized solid support (25 μL), 90 μL of mQ water containing 1.9 nmol adapter (sequence 3) and 10 μL of a solution of 100 mM Tris, 500 mM NaCl, 10 mM EDTA, pH 7.4 were added. The mixture was heated at 95°C for 10 minutes. The sample was allowed to cool to room temperature for 1 hour. 1.5 nmol of code (sequence 4), 17 μL of mQ water, 2 μL of 10×T4 ligase buffer (500 mM Tris-HCl, 100 mM mgCl2, 10 mM ATP, 100 mM DTT, pH 7.5, New England Biolabs), and 600 U (1 μL) of T4 DNA ligase (New England Biolabs) were added to the mixture, and ligation was performed at room temperature for 18 hours. The functionalized solid support was washed with TE buffer (10 mM Tris, 1 mM EDTA, and 0.05% (v / v) Tween 20, pH 7.4).
[0308] Step 8.11 Oligonucleotide cleavage from solid support for LCMS analysis A functionalized solid support (25 μL) was incubated with 100 mM lithium hydroxide (LiOH) in 25% DMSO in mQ water (60 μL) in a rotating shaker at 40°C for 1 hour. The sample was filtered and analyzed by LC-MS (Figures 37 and 38). Figure 37A shows a schematic diagram of DNA ligation on the solid support. The code is ligated to the oligonucleotide bound to the solid support using an adapter oligonucleotide and T4 DNA ligase. The LC-MS chromatogram of absorbance at 260 nm (Figure 37B) was obtained by cleaving the ester linker after ligation conditions (Step 8.11). The ligation product is observed at 4.47 min. The remaining adapter, code, and unligated starting material were further observed. Figure 37C shows the deconvoluted mass spectrum of the ligation product peak. The mass of the desired ligation product was observed. Figure 38 shows the deconvolutional mass spectra for (Figure 38A) the adapter oligonucleotide, (Figure 38B) the code, and (Figure 38C) the starting material peaks for the LC-MS chromatogram shown in Figure 37B.
[0309] Example 9: Reactions on on-DNA on a solid support A carboxylic acid-functionalized solid support (Functionalized ProMag® 1, Bangs Laboratories, Inc.) was used.
[0310] Step 9.1 Coupling to N-Boc-ethanolamine A carboxylic acid-functionalized magnetic solid support (50 μL) was washed with DMSO (1 × 1 mL) and dimethylformamide (2 × 1 mL). The functionalized beads were incubated with DMF (25 μL, 2 × 30 min) containing 360 mM HATU, 360 mM N-Boc-ethanolamine, and 1.1 M DIPEA. The functionalized beads were washed with dimethylformamide (DMF) (3 × 200 μL).
[0311] Step 9.2 Boc Deprotection Functionalized beads (50 μL) were incubated with 50% (v / v) trifluoroacetic acid in dichloromethane (600 μL) at room temperature on a rotating shaker for 5 minutes. The beads were then incubated again with a fresh solution of 50% (v / v) trifluoroacetic acid in dichloromethane (600 μL) on a rotating shaker at room temperature for 15 minutes. The functionalized beads were washed with 1 × PBS pH 7.4 (3 × 600 μL), and then with dimethylformamide (3 × 600 μL).
[0312] Step 9.3 Coupling to (2S)-2-[[(9H-fluoren-9-ylmethoxy)carbonyl]amino]-4-pentic acid (Fmoc-Pra-OH) Amine-functionalized solid support (50 μL) was coupled to (2S)-2-[[(9H-fluoren-9-ylmethoxy)carbonyl]amino]-4-pentic acid (Fmoc-Pra-OH) according to general procedure 3.
[0313] Step 9.4 Fmoc Deprotection The functionalized beads (50 μL) were deprotected with Fmoc according to general procedure 4.
[0314] Step 9.5 Binding of oligonucleotides to a solid support 2 nmol of 5'-azide-modified single-strand oligonucleotides (synthesized in Example 1) were conjugated to alkyne-functionalized beads (50 μL) using twice the volume specified in each example, according to general procedure 6.
[0315] Step 9.6 Oligonucleotide cleavage of 25 μL beads from solid support for LC-MS analysis Half of a functionalized solid support (25 μL) was incubated with 100 mM lithium hydroxide (LiOH) in 25% DMSO in mQ water (60 μL) for 1 hour at 40°C using a rotating shaker. The sample was filtered and analyzed by LC-MS. Figure 40A shows the chromatogram at 260 nm and the chemical structure of the starting material. The major peak observed in Figure 40A corresponds to the desired starting material. Figure 40C shows the deconvoluted mass spectrum at the retention time of the major peak in the chromatogram (Figure 40A). The mass corresponding to the desired starting material is observed.
[0316] Step 9.7 Coupling to 5-azidopentanoic acid (reaction on DNA on a solid support) The remaining half of the functionalized solid support (25 μL) prepared in Step 9.5 was used. 3 -(ethylcarbonimidoyl)-N 1 ,N 1 Stocks of dimethyl-1,3-propanediamine (EDC) and 1-hydroxy-2,5-dioxo-3-pyrrolidinesulfonic acid (S-NHS) at 50 mg / mL were prepared in 100 mM 2-(N-morpholino)ethanesulfonic acid (MES) buffer (pH 4.5). 20 μL of each stock was mixed with 60 μL of 450 mM 5-azidopentanoic acid in dimethylformamide (DMF) to a final volume of 100 μL. The solution was incubated at room temperature for 15 minutes. Next, this solution was added to functionalized beads (25 μL), and the reaction mixture was left in a rotating shaker at room temperature for 2 hours. The functionalized beads were washed with dimethylformamide (DMF) (3 × 200 μL).
[0317] Step 9.8 Oligonucleotide cleavage from solid support for LC-MS analysis The functionalized solid support (25 μL) prepared in Step 9.7 was incubated with 100 mM lithium hydroxide (LiOH) in 25% dimethyl sulfoxide (DMSO) in mQ water (60 μL) in a rotating shaker at 40°C for 1 hour. The sample was filtered and analyzed by LC-MS. Figure 40B shows the chromatogram at 260 nm and the chemical structure of the desired product. The major peak observed in Figure 40B corresponds to the desired product. Figure 40D shows the deconvoluted mass spectrum at the retention time of the major product in the chromatogram (Figure 40B). The mass corresponding to the desired product is observed. This example demonstrates that chemical transformation can be performed on a solid support on DNA with a high conversion rate.
[0318] References (1)Agouridas,V et al Native Chemical Ligation and Extended Methods:Mechanisms,Catalysis,Scope,and Limitations.Chemical Reviews.American Chemical Society June 26,2019.https: / / doi.org / 10.1021 / acs.chemrev.8b00712. (2)Li, Y. et al.Bioorthogonal Ligation and Cleavage by Reactions of Chloroquinoxalines with Ortho -Dithiophenols.Angew.Chemie lnt.Ed.2020,59(9),3671-3677.https: / / doi.org / 10.1002 / anie.201913620. (3)Gless BH,et al.Direct Peptide Cyclization and One-Pot Modification Using the MeDbz Linker.J.Org.Chem.2018,83(17),10525-10534.https: / / doi.org / 10.1021 / acs.joc.8b01237. (4)Fan,L.;Davie,C.P.Zirconium(IV)-Catalyzed Ring Opening of on-DNA Epoxides in Water.ChemBioChem 2017,18(9),843-847.https: / / doi.org / 10.1002 / cbic.201600563. (5)Serra,G.;et al.On-Resin Synthesis of Cyclic Peptides:Via Tandem N -to-S Acyl Migration and lntramolecular Thiol Additive-Free Native Chemical Ligation.Chem.Commun.2020,56(6),956-959. https: / / doi.org / 10.1039 / c9cc07783a. (6)Kondasinghe,T.D.et al Direct Palladium-Mediated on-Resin Disulfide Formation from Allocam Protected Peptides.Org.Biomol.Chem.2017,15(14),2914-2918.https: / / doi.org / 10.1039 / c7ob00536a. (7)Mende,F.;Seitz,0.Solid-Phase Synthesis of Peptide Thioesters with Self-Purification.Angew.Chemie lnt.Ed.2007,46(24),4577-4580.https: / / doi.org / 10.1002 / anie.200700356. (8)Mende,F.;Beisswenger,M.;Seitz,O.Automated Fmoc-Based Solid Phase Synthesis of Peptide Thioesters with Self-Purification Effect and Application in the Construction of Immobilized SH3 Domains.J.Am.Chem.Soc.2010,132(32),11110-11118.https: / / doi.org / 10.1021 / ja101732a. (9)Liu,H.;Li,X.Serine / Threonine Ligation:Origin,Mechanistic Aspects,and Applications.Acc.Chem.Res.2018,51(7),1643-1655.https: / / doi.org / 10.1021 / acs.accounts.8b00151. (10)Clark,M.A.et al.A.Design,Synthesis and Selection of DNA-Encoded Small-Molecule Libraries.Nat.Chem.Biol.2009,5(9),647-654.https: / / doi.org / 10.1038 / nchembio.211. (11)Rhodes,C.A.;Pei,D.Bicyclic Peptides as Next-Generation Therapeutics.Chem.A Eur.J.2017,23(52),12690-12703.https: / / doi.org / 10.1002 / chem.201702117. (12)Malone,M.L,Paegel,B.M.,What is a “DNA-Compatible” Reaction?,ACS Comb.Sci.2016,18(4),182-187.https: / / doi.org / 10.1021 / acscombsci.5b00198. (13)Decurtins,W.,Wichert,M.,Franzini,R.et al.Automated screening for small organic ligands using DNA-encoded chemical libraries.Nat Protoc 11,764-780(2016).https: / / doi.org / 10.1038 / nprot.2016.039 (14)Selvaraj,A.;Chen,H.-T.;Ya,A.;Huang,T.;Kao,C.-L.Expedient On-Resin Modification of a Peptide C-Terminus through a Benzotriazole Linker.Chem.Sci.,2018,9,345-349.https: / / doi.org / 10.1039 / C7SC03229C. (15)Andrew B.MacConnell,Patrick J.McEnaney,Valerie J.Cavett,and Brian M.Paegel,ACS Combinatorial Science 2015 17(9),518-534,DOI:10.1021 / acscombsci.5b00106 (16)Pengpumkiat S,Koesdjojo M,Rowley ER,Mockler TC,Remcho VT(2016).PLOS ONE 11(3):e0149774.https: / / doi.org / 10.1371 / journal.pone.0149774 (17)Scott,P.J.H.Linker Strategies in Solid-Phase Organic Synthesis.Link.Strateg.Solid-Phase Org.Synth.1-677(2009).https: / / doi / 10.1002 / 9780470749043. (18)Hermanson,G.T.Bioconjugate Techniques:Third Edition.Bioconjugate Tech.Third Ed.1-1146(2013)https: / / doi.org / 10.1016 / C2009-0-64240-9. (19)Leriche,G.,Chisholm,L.& Wagner,A.Cleavable linkers in chemical biology.Bioorg.Med.Chem.20,571-582(2012).https: / / doi.org / 10.1016 / j.bmc.2011.07.048 (20)Chaudhuri,R.G.& Paria,S.Core / Shell Nanoparticles:Classes,Properties,Synthesis Mechanisms,Characterization,and Applications.Chem.Rev.112,2373-2433(2011).https: / / doi.org / 10.1021 / cr100449n (21)Wu,W.,He,Q.& Jiang,C.Magnetic Iron Oxide Nanoparticles:Synthesis and Surface Functionalization Strategies.Nanoscale Res.Lett.2008 311 3,397-415(2008).https: / / doi.org / 10.1007 / s11671-008-9174-9 (22)Pon,R.T.Solid‐Phase Supports for Oligonucleotide Synthesis.Curr.Protoc.Nucleic Acid Chem.00,(2000).https: / / doi.org / 10.1002 / 0471142700.nc0301s00 (23)Wang,W.,Khojasteh,S.C.& Su,D.Biosynthetic Strategies for Macrocyclic Peptides.Mol.26,3338(2021).https: / / doi.org / 10.3390 / molecules26113338 (24)Zhang,R.Y.,Thapa,P.,Espiritu,M.J.,Menon,V.& Bingham,J.P.From nature to creation:Going around in circles,the art of peptide cyclization.Bioorg.Med.Chem.26,1135-1150(2018).https: / / doi.org / 10.1016 / j.bmc.2017.11.017
Claims
1. A method for producing nucleic acid coding compounds, comprising the following steps: To provide a new compound including a scaffold connected to a solid support by a linker, Covalently bonding one or more chemical building blocks to the newly formed compound to form a chemical portion bonded to the scaffold, Covalently bonding one or more coding oligonucleotides encoding the aforementioned chemical building blocks to the newly formed compound to form a coding nucleic acid portion bound to the scaffold, Binding the cleavage group to the chemical moiety, coding nucleic acid moiety, or scaffold, The linker and the cleavage group are reacted such that the linker is cleaved and the nucleic acid encoding compound is released from the solid support. The method comprising the above.
2. A method for generating a nucleic acid coding chemical library, comprising the following steps for each library member: To provide a new compound including a scaffold connected to a solid support by a linker, Covalently bonding one or more chemical building blocks to the newly formed compound to form a chemical portion bonded to the scaffold, Covalently bonding one or more coding oligonucleotides encoding the aforementioned chemical building blocks to the newly formed compound to form a coding nucleic acid portion bound to the scaffold, Binding the cleavage group to the chemical moiety, coding nucleic acid moiety, or scaffold, The linker and the cleaving group are reacted such that the linker is cleaved and the library member is released from the solid support. The method comprising the above.
3. A method according to claim 1 or 2, wherein the scaffold of the nascent compound is connected to the solid support by a first linker and a second linker, and further: The first cleavage group and the second cleavage group are bonded to the chemical moiety or scaffold of the newly formed compound, The first linker and the first cleaving group are reacted so that the first linker is cleaved, The second linker and the second cleavage group are reacted such that the second linker is cleaved and the newly formed compound is released from the solid support. The method comprising the above.
4. The method according to any one of claims 1 to 3, wherein the cleavage group is bonded to the chemical moiety or scaffold.
5. The method according to claim 4, wherein the cleavage group is covalently bonded to a chemical building block located at the end of the chemical moiety.
6. The method according to claim 4, wherein the cleavage group is, with respect to the chemical moiety or scaffold, the following: Binding an anchor oligonucleotide to the chemical moiety or scaffold, To provide an auxiliary oligonucleotide covalently bonded to a cleavage group, Hybridizing the auxiliary oligonucleotide and the anchor oligonucleotide, The method comprising reacting the linker with the cleaving group such that the linker is cleaved.
7. The method according to any one of claims 1 to 3, wherein the cleavage group is bound to the coding nucleic acid portion.
8. The method according to claim 7, wherein the cleavage group is, with respect to the coding nucleic acid portion, the following: To provide an auxiliary oligonucleotide covalently bonded to a cleavage group, Hybridizing the auxiliary oligonucleotide covalently bonded to the cleavage group to the coding nucleic acid portion, The method comprising reacting the linker with the cleaving group such that the linker is cleaved.
9. The method according to any one of claims 1 to 8, wherein the linker is activated to be able to react with the cleaving group before the reaction with the cleaving group.
10. The method according to any one of claims 1 to 9, wherein the cleaving group is activated to be able to react with the linker before the reaction with the linker.
11. A method for producing nucleic acid coding compounds, To provide a new compound including a scaffold connected to a solid support by a first linker, Covalently bonding one or more chemical building blocks to the newly formed compound to form a chemical portion bonded to the scaffold, Covalently bonding one or more coding oligonucleotides encoding the aforementioned chemical building blocks to the newly formed compound to form a coding nucleic acid portion bound to the scaffold, The chemical portion of the newly formed compound is connected to the solid support by a second linker, The first linker is to be opened, The method comprising cleaving the second linker so that the nucleic acid coding compound is released from the solid support.
12. A method for generating a nucleic acid coding chemical library, comprising the following steps for each library member: To provide a new compound including a scaffold connected to a solid support by a first linker, Covalently bonding one or more chemical building blocks to the newly formed compound to form a chemical portion bonded to the scaffold, Covalently bonding one or more coding oligonucleotides encoding the aforementioned chemical building blocks to the newly formed compound to form a coding nucleic acid portion bound to the scaffold, The chemical portion of the library member is connected to the solid support by a second linker, The first linker is to be opened, The method comprising cleaving the second linker so that the library member is released from the solid support.
13. A method for producing a nucleic acid coding compound, comprising the following steps: To provide a new compound including a scaffold connected to a solid support by a first linker, Covalently bonding one or more chemical building blocks to the newly formed compound to form a chemical portion bonded to the scaffold, Covalently bonding one or more coding oligonucleotides encoding the aforementioned chemical building blocks to the newly formed compound to form a coding nucleic acid portion bound to the scaffold, Connecting the scaffold or coding nucleic acid portion to the solid support with a second linker, The first linker is to be opened, The method comprising cleaving the second linker so that the nucleic acid coding compound is released from the solid support.
14. A method for generating a nucleic acid coding chemical library according to claim 2 or 12, comprising the following steps: Dividing the newly synthesized compound or the intermediate formed during the synthesis process of the nucleic acid coding chemical library into separate compartments, Bonding one or more chemical building blocks to the nascent compound or intermediate, Bonding one or more coding oligonucleotides encoding the chemical building block to the nascent compound or intermediate, The method is produced by a method comprising pooling members or intermediates from separate compartments into one or more compartments.
15. The method according to claim 14, wherein the chemical building block and coding oligonucleotide bound to the nascent compound or intermediate in the first compartment are different from the chemical building block and coding oligonucleotide bound to the nascent compound or intermediate in the second compartment.
16. A method according to claim 14 or 15, comprising repeating the steps of the method one or more times.
17. The method according to any one of claims 11 to 13, wherein the first and second linkers are orthogonally cleavable.
18. The method according to any one of claims 11 to 13 and 17, wherein the first and / or second linker is activated to become cleavable before the first and / or second linker cleaves.
19. The method according to any one of claims 1 to 18, wherein the chemical building block is continuously bonded to the nascent compound to form the chemical moiety.
20. The method according to any one of claims 1 to 19, comprising covalently bonding a first chemical building block to the scaffolding.
21. The method according to claim 20, wherein the scaffold includes a trapping group, and the method comprises reacting a first chemical building block with the trapping group to covalently bond the first chemical building block to the scaffold.
22. The method according to claim 21, wherein the first chemical building block includes a proximal bonding group, and the method comprises reacting the proximal bonding group with the scavenging group of the scaffold to covalently bond the first chemical building block to the scaffold.
23. The method according to claim 21 or claim 22, wherein the scavenging group is protected, and the method further comprises deprotecting the scavenging group of the scaffold before bonding the first chemical building block of the chemical portion.
24. The method according to any one of claims 21 to 23, wherein the method comprises capping unreacted scavenging groups that are not covalently bonded to the first chemical building block.
25. The method according to any one of claims 20 to 24, comprising covalently bonding a second chemical building block to the first chemical building block to form a chemical portion having the second chemical building block at its terminal position.
26. The method according to claim 25, wherein the first chemical building block includes a distal bonding group, and the method comprises reacting the second chemical building block with the distal bonding group of the first chemical building block to covalently bond the second chemical building block to the first chemical building block.
27. The method according to claim 26, wherein the second chemical building block includes a proximal bonding group, and the method comprises reacting the proximal bonding group of the second chemical building block with the distal bonding group of the first chemical building block to covalently bond the second chemical building block to the first chemical building block.
28. The method according to claim 26 or 27, wherein the distal bond group of the first chemical building block is protected, and the distal bond group of the first chemical building block is deprotected before the bond of the second chemical building block.
29. The method according to any one of claims 26 to 28, comprising capping the unreacted distal bonding groups of the first chemical building block that are not covalently bonded to the second chemical building block.
30. The method according to any one of claims 25 to 29, comprising bonding a further chemical building block to the chemical building block at the terminal position of the chemical portion.
31. The method according to claim 30, wherein the chemical building block at the terminal position includes a distal bonding group, and the method comprises reacting the further chemical building block with the distal bonding group of the chemical building block at the terminal position to covalently bond the further chemical building block to form a chain of chemical building blocks having the further chemical building block at the terminal position.
32. The method according to claim 31, wherein the further chemical building block includes a proximal bonding group, and the method comprises reacting the proximal bonding group of the further chemical building block with the distal bonding group of the chemical building block at the terminal position to covalently bond the further chemical building block.
33. A method according to claim 31 or claim 32, wherein the distal bond group of the chemical building block is protected at the terminal position, and the method comprises deprotecting the distal bond group of the chemical building block at the terminal position before the bonding of the further chemical building block.
34. The method according to any one of claims 31 to 33, further comprising capping unreacted distal bonding groups that are not covalently bonded to the further chemical building blocks.
35. A method comprising repeating the method described in claims 30 to 34 one or more times.
36. The method according to any one of claims 25 to 29, wherein coding oligonucleotides encoding each chemical building block are sequentially added to the nascent compound to form the coding nucleic acid portion, and the coding oligonucleotides encoding the chemical building blocks are added to the nascent compound before, after, or simultaneously with the addition of the chemical building blocks to the nascent compound.
37. The method according to claim 36, comprising covalently bonding a first coding oligonucleotide encoding the first chemical building block to the scaffold.
38. The method according to claim 37, wherein the scaffold includes a bound oligonucleotide, and the first coding oligonucleotide is covalently bonded to the bound oligonucleotide to form a coding nucleic acid portion bound to the scaffold.
39. The method according to claim 37 or 38, comprising covalently bonding a second coding oligonucleotide encoding the second chemical building block to the coding nucleic acid portion.
40. The method according to claim 39, comprising attaching one or more further coding oligonucleotides encoding further chemical building blocks to the coding nucleic acid portion.
41. The method according to any one of claims 1 to 40, comprising crosslinking two or more chemical building blocks in the chemical portion.
42. A method for generating a nucleic acid coding chemical library, comprising the following steps for each member: To provide a new compound including a scaffold connected to an anchor by a linker, wherein the anchor is connected to a solid support, Covalently bonding one or more chemical building blocks to the newly formed compound to form a chemical portion bonded to the scaffold, Covalently bonding one or more coding oligonucleotides encoding one or more chemical building blocks to the nascent compound to form a coding nucleic acid portion bound to the anchor, Bonding the cleavage group to the aforementioned chemical moiety, The aforementioned newly formed compound is separated into compartments, The linker and the cleaving group are reacted such that the linker is cleaved and the scaffold is released from the solid support of the compartment. The method comprising the above.
43. A method for generating a nucleic acid coding chemical library, comprising the following steps for each member: To provide a new compound comprising a scaffold and an anchor, wherein the scaffold is connected to the anchor by a first linker, the anchor comprises a bound oligonucleotide and is bound to a solid support, Covalently bonding one or more chemical building blocks to the newly formed compound to form a chemical portion bonded to the scaffold, To form a coding nucleic acid portion bound to the anchor by covalently bonding one or more coding oligonucleotides that encode one or more chemical building blocks to the binding oligonucleotide, The chemical portion is bonded to the solid support by a second linker, The first linker is to be opened, The aforementioned newly formed compound is separated into compartments, The method comprising: cleaving the second linker such that the second linker is cleaved and the chemical portion bonded to the scaffold is released from the solid support within the compartment.
44. The method according to claim 42 or 43, wherein the anchor includes a binding oligonucleotide, and coding oligonucleotides encoding each chemical building block are sequentially added to the binding oligonucleotide to form the coding nucleic acid portion bound to the anchor.
45. A method for generating a nucleic acid coding chemical library, wherein for each member, the following steps are taken: To provide a new compound including a scaffold connected to a solid support by a linker, Covalently bonding one or more chemical building blocks to the newly formed compound to form a chemical portion bonded to the scaffold, Covalently bonding one or more coding oligonucleotides that encode one or more chemical building blocks to the solid support to form a coding nucleic acid portion bound to the solid support, Bonding the cleavage group to the aforementioned chemical moiety, The aforementioned newly formed compound is separated into compartments, The linker and the cleaving group are reacted such that the linker is cleaved and the scaffold is released from the solid support of the compartment. The method comprising the above.
46. A method for generating a nucleic acid coding chemical library, wherein for each member, the following steps are taken: To provide a nascent compound comprising a scaffold connected to a solid support by a first linker, wherein the solid support comprises a bound oligonucleotide, Covalently bonding one or more chemical building blocks to the newly formed compound to form a chemical portion bonded to the scaffold, To form a coding nucleic acid portion bound to the solid support by covalently bonding one or more coding oligonucleotides that encode one or more chemical building blocks to the binding oligonucleotide, The chemical portion is bonded to the solid support by a second linker, The first linker is to be opened, The aforementioned newly formed compound is separated into compartments, The second linker is cleaved so that the chemical portion bonded to the scaffold is released from the solid support within the compartment, The method, including the method described above.
47. The method according to claim 45 or 46, wherein the solid support comprises a bound oligonucleotide, and the coding oligonucleotides encoding each chemical building block are sequentially added to the bound oligonucleotide to form the coding nucleic acid portion.
48. The method according to any one of claims 42 to 47, wherein the compartment is located on an array.
49. The method according to any one of claims 1 to 48, further comprising purifying the nascent compound.
50. The method according to any one of claims 2, 12, 14-16, and 42-48, further comprising purifying the nucleic acid coding chemical library.
51. The method according to any one of claims 1 to 50, further comprising generating a diverse population of compounds or library members, screening the diverse population for binding to a target molecule, and identifying library members in the population that bind to the target molecule.
52. The method according to claim 51, To provide a nascent compound comprising a labeled scaffold connected to a solid support by a linker, Covalently bonding the chemical moiety of the identified library member to the scaffold to generate a labeled new compound containing the chemical moiety, Bonding the cleavage group to the chemical moiety or scaffold, The linker is reacted with the cleavage group, thereby cleaving the linker and releasing the labeled library member from the solid support. To determine the binding of the free labeled library member to the target molecule, The method, including the method described above.
53. The method according to claim 51, To provide a nascent compound comprising a labeled scaffold connected to a solid support by a first linker, Covalently bonding the chemical moiety of the identified library member to the scaffold to generate a labeled new compound containing the chemical moiety, The chemical portion is connected to the solid support by a second linker, The first linker is to be opened, The second linker is cleaved, and the labeled library member is released from the solid support. To determine the binding of the free labeled library member to the target molecule, The method, including the method described above.
54. A nucleic acid coding library prepared by the method described in any one of claims 2, 12, and 14 to 16.