Manufacturing of lentiviral vectors

Abstract

A nucleotide sequence encoding the RNA genome of a lentiviral vector, wherein the major splice donor site in the RNA genome of the lentiviral vector is inactivated and a cryptic splice donor site 3' to the major splice donor site is inactivated.

Description

[Technical Field]

[0001] The present invention relates to the production of lentiviral vectors in eukaryotic cells. More specifically, the present invention relates to the inactivation of major splice donor sites and adjacent latent splice donor sites in the vector genome. The present invention provides a nucleotide sequence encoding the RNA genome of a lentiviral vector, wherein the major splice donor site in the RNA genome of the lentiviral vector is inactivated and the latent splice donor site 3' relative to the major splice donor site is inactivated. Methods and uses involving such nucleotide sequences are also included in the present invention. [Background technology]

[0002] The development and manufacture of viral vectors for vaccines and human gene therapy over the past several decades are well documented in scientific journals and patents. The use of engineered viruses to deliver transgenes for therapeutic effects is widespread. Modern gene therapy vectors based on RNA viruses such as γ-retroviruses and lentiviruses (Muhlebach, MD et al., 2010, Retroviruses: Molecular Biology, Genomics and Pathogenesis, 13:347-370; Antoniou, MN, Skipper, KA & Anakok, O., 2013, Hum. Gene Ther., 24:363-374), as well as DNA viruses such as adenoviruses (Capasso, C. et al., 2014, Viruses, 6:832-855) and adeno-associated viruses (AAV) (Kotterman, MA & Schaffer, DV, 2014, Nat. Rev. Genet., 15:445-451), have shown promise in an increasing number of human disease indications. These include ex vivo modification of patient cells with hematological conditions (Morgan, RA & Kakarla, S., 2014, Cancer J., 20:145-150; Touzot, F. et al., 2014, Expert Opin. Bio. Ther., 14:789-798), as well as ophthalmology (Balaggan, KS & Ali, RR, 2012, Gene Ther., 19:145-153), cardiovascular (Katz, MGet al., 2013, Hum. Gene Ther., 24:914-927), neurodegenerative diseases (Coune, PG, Schneider, BL & Aebischer, P., 2012, Cold Spring Harb. Perspect. Med., 4:a009431), and oncology (Pazarentzos, E. & Mazarakis, ND, 2014, Adv. Exp. Med. This includes in vivo treatment as described in Biol., 818:255-280.

[0003] As the success of these approaches in clinical trials begins to build toward regulatory approval and commercialization, it is important to consider the safety aspects involved in administering viral vectors to patients, for example, in the context of vaccination and gene therapy. [Prior art documents] [Non-patent literature]

[0004] [Non-Patent Document 1] Muhlebach,MDet al.,2010,Retroviruses:Molecular Biology,Genomics and Pathogenesis,13:347-370;Antoniou,MN,Skipper,KA&Anakok,O.,2013,Hum.Gene Ther.,24:363-374 [Non-Patent Document 2] Capasso,C.et al.,2014,Viruses,6:832-855 [Non-Patent Document 3] Kotterman, MA & Schaffer, DV, 2014, Nat. Rev. Genet., 15:445-451 [Non-Patent Document 4] Morgan,RA&Kakarla,S.,2014,Cancer J.,20:145-150;Touzot,F.et al.,2014,Expert Opin.Biol.Ther.,14:789-798 [Non-Patent Document 5] Balaggan, KS & Ali, RR, 2012, Gene Ther., 19:145-153 [Non-Patent Document 6] Katz,MGet al.,2013,Hum.Gene Ther.,24:914-927 [Non-Patent Document 7] Coune,PG,Schneider,BL&Aebischer,P.,2012,Cold Spring Harb.Perspect.Med.,4:a009431

Non-Patent Document 8

Summary of the Invention

Problems to be Solved by the Invention

[0005] There is a continuing need in the art for viral vectors with an improved safety profile.

Means for Solving the Problems

[0006] The present invention is based on the inactivation of both the major splice donor site and an adjacent potential splice donor site in the packaging region of the lentiviral vector genome. The major splice donor site (MSD) present within the lentiviral vector genome is typically embedded within the packaging region containing RNA that is highly structured towards the 5’ region of the RNA.

[0007] Splice donor sites within the retroviral genome have been shown to be important for viral RNA (vRNA) stability in the producer cells. However, the inventors show that the activity of the MSD within the lentiviral vector genome expression cassette can be very promiscuous and can splice very efficiently to strong or even weak potential splice acceptor sites within internal expression cassettes typically located >1350 bp downstream. Surprisingly, 95% of the detectable cytoplasmic mRNAs derived from the external promoter driving vRNA production are also spliced according to the internal sequences.

[0008] For efficient vector production, the most desirable product is an unspliced, packageable vRNA, and this vector component is typically a limiting factor in both transient and stable transfection vector production. Furthermore, if this abnormally spliced ​​mRNA encodes the target transgene (e.g., spliced ​​into an internal promoter-utr sequence), this mRNA can be transported and efficiently translated during vector production, regardless of whether the internal promoter is a weak / silent (tissue-specific) promoter.

[0009] Furthermore, other studies have shown that the presence of MSD in the vector backbone delivered to transduced (patient) cells is utilized by the splicing mechanism when read-through transcription occurs from the upstream cell promoter (lentiviral vectors target the active transcription site), resulting in potentially abnormal splice products containing cell exons. Therefore, there are several reasons why it is desirable to functionally mutate the MSD site in the lentiviral vector genome.

[0010] Other early-generation lentiviral vectors produced mutations within the MSD site, but these vectors contained an intrinsic U3 promoter that drove vRNA transcription and were therefore dependent on transactivation by tat supplied in trans. Third-generation lentiviral vectors replace the U3 promoter with a heterologous promoter element and do not require tat for transcription. The U3 / tat independence of third-generation vectors is seen as a significant improvement in regulatory safety, as tat is a transactivator of cellular genes and can play a role in tumorigenesis.

[0011] In one embodiment, a nucleotide sequence encoding the RNA genome of a lentiviral vector is provided, wherein the major splice donor site in the RNA genome of the lentiviral vector is inactivated, and the latent splice donor site 3' relative to the major splice donor site is inactivated.

[0012] In this embodiment, it is demonstrated that inactivation of both the major splice donor site and the latent splice donor site 3' relative to the major splice donor site in the RNA genome of the lentiviral vector provides an improvement over mutating either one alone. As demonstrated in this embodiment, the present invention promotes, for example, at least twofold, the reduction of transcriptional readthrough to the incorporated lentiviral vector in target cells.

[0013] In one embodiment, the nucleotide sequence according to the present invention is for use in a U3 or tat-independent lentiviral vector system. In one embodiment, the lentiviral vector system may be a third-generation lentiviral vector system described herein.

[0014] The latent splice donor site is a first latent splice donor site or sequence 3' relative to the major splice donor site. In one embodiment, the latent splice donor site or sequence is within 6 nucleotides of the major splice donor site. The major splice donor site and the latent splice donor site may be mutated or deleted.

[0015] In one embodiment, the present invention provides a nucleotide sequence encoding an RNA genome for a lentiviral vector, wherein the nucleotide sequence before inactivation of the splice site includes the sequence described in any of SEQ ID NOs: 1, 3, 4, 9, 10, and / or 13. The nucleotide sequence may include a sequence having mutations or deletions from the sequence described in any of SEQ ID NOs: 1, 3, 4, 9, 10, and / or 13. In one embodiment, the sequence includes SEQ ID NO: 13.

[0016] In one embodiment, the nucleotide sequence will include an inactivated major splice donor site, or otherwise have a cleavage site immediately upstream of nucleotide 1 in the major splice donor region (SEQ ID NO: 13).

[0017] In one embodiment, the nucleotide sequence includes an inactivated major splice donor site and an inactivated latent splice donor site, otherwise it will have a cleavage site immediately upstream of nucleotide 1 and between nucleotides 4-5 corresponding to the nucleotides of the major splice donor region (SEQ ID NO: 13).

[0018] In one embodiment, the nucleotide sequence will include an inactivated major splice donor site and otherwise have a cleavage site between nucleotides corresponding to nucleotides 13 and 14 of SEQ ID NO: 1.

[0019] In another embodiment, the nucleotide sequence of the primary splice donor site before inactivation includes the sequence shown in SEQ ID NO: 4. In one embodiment, the latent splice donor site before inactivation includes the sequence shown in SEQ ID NO: 10.

[0020] The nucleotide sequence may contain an inactivated latent splice donor site, or it will have a cleavage site between nucleotides corresponding to nucleotides 17 and 18 of SEQ ID NO: 1.

[0021] In one embodiment, the nucleotide sequence according to the present invention includes the sequence described in any of SEQ ID NOs: 2, 5, 6, 7, 8, 11, 12 and / or 14.

[0022] In a preferred embodiment, the nucleotide sequence includes the sequence shown in SEQ ID NO: 14.

[0023] In a further embodiment, the nucleotide sequence does not include the sequence shown in SEQ ID NO: 9.

[0024] Splicing activity from major and latent splice donor sites of the RNA genome of a lentiviral vector can be suppressed or eliminated, for example, in transfected cells or transduced cells.

[0025] In one embodiment, the nucleotide sequence may be suitable for use in lentiviral vectors in a U3 or tat-independent system for vector production. As described herein, third-generation lentiviral vectors are U3 / tat-independent, and the nucleotide sequence according to the present invention may be used in the context of third-generation lentiviral vectors. In one embodiment of the present invention, tat is not provided in the lentiviral vector production system; for example, tat is not provided in trans. In one embodiment, the cells, vectors, or vector production systems described herein do not contain the tat protein. In one embodiment of the present invention, HIV-1 U3 is not present in the lentiviral vector production system; for example, HIV-1 U3 is not provided in cis to drive transcription of the vector genome expression cassette.

[0026] In one embodiment, the present invention provides a nucleotide sequence encoding the RNA genome of a lentiviral vector, wherein the major splice donor site in the RNA genome of the lentiviral vector is inactivated, and the latent splice donor site 3' relative to the major splice donor site is inactivated, and the nucleotide sequence is intended for use in a tat-independent lentiviral vector.

[0027] In one embodiment, the present invention provides a nucleotide sequence encoding the RNA genome of a lentiviral vector, wherein the major splice donor site in the RNA genome of the lentiviral vector is inactivated, and the latent splice donor site 3' relative to the major splice donor site is inactivated, and the nucleotide sequence is produced in the absence of tat.

[0028] In one embodiment, the present invention provides a nucleotide sequence encoding the RNA genome of a lentiviral vector, wherein the major splice donor site in the RNA genome of the lentiviral vector is inactivated, the latent splice donor site 3' relative to the major splice donor site is inactivated, and the nucleotide sequence is transcribed independently of tat.

[0029] In one embodiment, the present invention provides a nucleotide sequence encoding the RNA genome of a lentiviral vector, wherein the major splice donor site in the RNA genome of the lentiviral vector is inactivated, and the latent splice donor site 3' relative to the major splice donor site is inactivated, and the nucleotide sequence is intended for use in a U3-independent lentiviral vector.

[0030] In one embodiment, the present invention provides a nucleotide sequence encoding the RNA genome of a lentiviral vector, wherein the major splice donor site in the RNA genome of the lentiviral vector is inactivated, the latent splice donor site 3' relative to the major splice donor site is inactivated, and the nucleotide sequence is transcribed independently of the U3 promoter.

[0031] In one embodiment, the present invention provides a nucleotide sequence encoding the RNA genome of a lentiviral vector, wherein the major splice donor site in the RNA genome of the lentiviral vector is inactivated, the latent splice donor site 3' relative to the major splice donor site is inactivated, and the nucleotide sequence is transcribed by a heterologous promoter.

[0032] In one embodiment, the transcription of the nucleotide sequences described herein is independent of the presence of U3. The nucleotide sequences may originate from U3-independent transcription events. The nucleotide sequences may originate from heterologous promoters. The nucleotide sequences described herein do not necessarily contain natural U3 promoters.

[0033] In one embodiment, the nucleotide sequences described herein may further include mutations in the latent splice donor site within the SL4 loop of the packaging sequence. In one embodiment, the GT dinucleotide of the latent splice donor site within the SL4 loop of the packaging sequence is mutated to GC.

[0034] In one embodiment, the nucleotide sequence further comprises a target nucleotide that may produce a therapeutic effect.

[0035] In a further embodiment, the nucleotide sequence encoding the RNA genome of the lentiviral vector is a vector-transfected gene expression cassette.

[0036] In another aspect of the present invention, the nucleotide sequence may further include a nucleotide sequence encoding a modified U1 snRNA, which is modified to bind to a nucleotide sequence within the packaging region of the MSD mutant lentiviral vector genome. The nucleotide sequence encoding the RNA genome of the lentiviral vector can be operably ligated to the nucleotide sequence encoding the modified U1 snRNA. In one aspect, the nucleotide sequence encoding the modified U1 snRNA is on a different nucleotide sequence, e.g., a different plasmid, than the nucleotide sequence encoding the RNA genome of the lentiviral vector.

[0037] In another embodiment, the nucleotide sequence may further include a tryptophan RNA-binding attenuation protein (TRAP) binding site and a Kozak sequence, wherein the TRAP binding site overlaps with the Kozak sequence, or the Kozak sequence includes a portion of the TRAP binding site. The nucleotide sequence may also further include a multicloning site and a Kozak sequence, wherein the multicloning site overlaps with or is located downstream of the 3'KAGN2-3 repeat of the TRAP binding site and upstream of the Kozak sequence. The nucleotide of interest may be operably ligated to the TRAP binding site or a portion thereof.

[0038] In one embodiment, the present invention provides a nucleic acid sequence comprising a target nucleotide (transgene) and a tryptophan RNA-binding attenuation protein (TRAP) binding site, wherein the TRAP binding site overlaps with the transgene start codon ATG.

[0039] Any disclosure herein relating to Kozak sequences / duplicate Kozak sequences is equally applicable (where appropriate) to equivalent embodiments referring to the ATG of the start codon and its duplication.

[0040] In another aspect, the present invention provides a nucleic acid sequence comprising a target nucleotide and a Kozak sequence, wherein the Kozak sequence comprises a portion of a tryptophan RNA-binding attenuation protein (TRAP) binding site.

[0041] In one embodiment, the present invention provides a nucleic acid sequence comprising a target nucleotide (transgene) and a TRAP binding site, wherein the TRAP binding site comprises a portion of the transgene start codon ATG, or vice versa.

[0042] The present invention also provides an expression cassette comprising a nucleotide sequence encoding the RNA genome of a lentiviral vector as defined herein.

[0043] The present invention also provides a viral vector production system comprising a set of nucleotide sequences encoding vector components, including gag-pol, env, optionally rev, and the RNA genome of a lentiviral vector as defined herein.

[0044] In one embodiment, the present invention also provides cells comprising nucleotide sequences encoding an RNA genome, expression cassette, or viral vector production system of a lentiviral vector as defined herein.

[0045] Cells that produce lentiviral vectors are (i) a) nucleotide sequences encoding vector components, including gag-pol and env, and optionally rev, and nucleotide sequences encoding the RNA genome of a lentiviral vector as defined herein or an expression cassette as defined herein; or b) Viral vector production systems as defined herein; and (ii) a nucleotide sequence encoding a modified U1 snRNA, if applicable; and (iii) Depending on the case, the nucleotide sequence encoding TRAP It may include.

[0046] In cells, splicing activity from major splice donor sites and / or splice donor regions of the lentiviral vector's RNA genome can be suppressed or eliminated, for example, during lentiviral vector production. In one embodiment, the translation of the target nucleotide is suppressed during lentiviral vector production.

[0047] The present invention also relates to a method for producing a lentiviral vector, (i) a) nucleotide sequences encoding vector components including gag-pol and env, and optionally rev, and nucleotide sequences encoding the RNA genome of a lentiviral vector as defined herein or an expression cassette as defined herein; or b) A viral vector production system as defined herein, The process of introducing the cells, (ii) Depending on the case, a step of selecting cells containing the nucleotide sequence encoding the vector component and the RNA genome of the lentiviral vector, (iii) A step of culturing cells under conditions suitable for lentiviral vector production, This provides a method that includes this.

[0048] The method may further include introducing a nucleotide sequence encoding TRAP into cells.

[0049] The method may further include introducing a nucleotide sequence encoding a modified U1 snRNA.

[0050] The present invention also extends to lentiviral vectors produced by any of the methods described herein.

[0051] In one embodiment, the present invention provides the use of a lentiviral vector RNA genome, an expression cassette, a viral vector production system, or a nucleotide sequence encoding a cell, as defined herein, in transfected cells or transduced cells, for producing a lentiviral vector or for suppressing or removing splicing activity from major splice donor sites and / or splice donor regions of the lentiviral vector RNA genome. [Brief explanation of the drawing]

[0052] [Figure 1]This figure shows a schematic diagram of the U1 snRNA molecule and an example of a method for modifying the targeting sequence for use in the present invention. The endogenous non-coding RNA, U1 snRNA, binds to the consensus splice donor site (5'-MAGGURR-3') via the 5'-(AC)UUACCUG-3' (highlighted in gray) native splice donor targeting sequence during the initial stages of intron splicing. Stem-loop I binds to the U1A-70K protein, which has been shown to be important for polyA repression. Stem-loop II binds to the U1A protein, and the 5'-AUUUGUGG-3' sequence binds to the Sm protein, which, together with stem-loop IV, is important for U1 snRNA processing. In this invention, the modified U1 snRNA is modified to introduce a heterologous sequence complementary to the target sequence within the vector genome vRNA molecule at the site of the natural splice donor targeting sequence. In this figure, the given example directs the modified U1 snRNA to 15 nucleotides (256-270, 256U1) of the standard HIV-1 lentiviral vector genome (located within the SL1 loop in the case of the packaging signal). [Figure 2A]This figure illustrates the effects of abnormal splicing from the major splice donor site (MSD) within an HIV-1-based lentiviral vector. Figure 2A: A schematic diagram showing the typical configuration of a third-generation (self-inactivating (SIN)) lentiviral vector expression cassette containing a functional major splice donor embedded within the packaging signal stem-loop (SL2), and the types of mRNA produced during lentiviral vector production. It shows the types of mRNA produced from a "standard" lentiviral vector (LV) DNA cassette and a lentiviral vector DNA cassette ("MSD-KO LV DNA cassette") that has (one or more) functional mutations in the MSD region that suppress or remove disordered activity from the MSD. For both cassettes, the full-length ("unsplicing") vector RNA (vRNA) arises from the co-expression of rev that binds to the rev response element (RRE) and is generally thought to suppress splicing from the MSD to splice acceptor 7 (sa7) contained in the RRE sequence. In standard lentiviral vector DNA cassettes, it is generally assumed that splicing of all introns occurs efficiently ("spliced") in the absence of rev. However, MSD can splice very efficiently to splice acceptor sites or latent splice acceptor sites ("abnormally spliced"), and it is possible to produce "abnormal" splice products during lentiviral vector production that typically "miss" RRE-containing introns so that rev has minimal effect on this activity of MSD. Lentiviral vector production can also be carried out by co-expression of a modified U1 snRNA redirected to the packaging region of the MSD mutant lentiviral vector DNA cassette. (Key: Pro, promoter; region from 5'R to gag contains packaging element {Ψ}, msd, major splice donor; cppt, central polyprint lact; Int, intron; sd / sa, splice donor / acceptor; GOI, target gene; gray arrows indicate the positions of forward {f} primers and reverse {r} primers for assessing the percentage of unsplicing vRNA produced during third-generation lentiviral vector production.Post-transcriptional regulatory elements {PRE} are not shown for clarity. Figure 2B: Standard third-generation lentiviral vector production was carried out in HEK293T cells with + / -rev, and total RNA was extracted from the cells after production. Using two primer sets (positions marked with A): f+rT amplified total transcript and f+rUS amplified unsplicing transcript generated from the lentiviral vector expression cassette, total RNA was subjected to qPCR (SYBR green), and thus the ratio of unsplicing vRNA transcript to total vRNA transcript was calculated and plotted. The data show that the proportion of unsplicing vRNA to total during standard third-generation lentiviral vector production is moderate and varies according to the internal transgene cassette (in this case, containing different promoter and GFP genes). Furthermore, this proportion is only minimally increased by the action of rev. [Figure 2B]This figure illustrates the effects of abnormal splicing from the major splice donor site (MSD) within an HIV-1-based lentiviral vector. Figure 2A: A schematic diagram showing the typical configuration of a third-generation (self-inactivating (SIN)) lentiviral vector expression cassette containing a functional major splice donor embedded within the packaging signal stem-loop (SL2), and the types of mRNA produced during lentiviral vector production. It shows the types of mRNA produced from a "standard" lentiviral vector (LV) DNA cassette and a lentiviral vector DNA cassette ("MSD-KO LV DNA cassette") that has (one or more) functional mutations in the MSD region that suppress or remove disordered activity from the MSD. For both cassettes, the full-length ("unsplicing") vector RNA (vRNA) arises from the co-expression of rev that binds to the rev response element (RRE) and is generally thought to suppress splicing from the MSD to splice acceptor 7 (sa7) contained in the RRE sequence. In standard lentiviral vector DNA cassettes, it is generally assumed that splicing of all introns occurs efficiently ("spliced") in the absence of rev. However, MSD can splice very efficiently to splice acceptor sites or latent splice acceptor sites ("abnormally spliced"), and it is possible to produce "abnormal" splice products during lentiviral vector production that typically "miss" RRE-containing introns so that rev has minimal effect on this activity of MSD. Lentiviral vector production can also be carried out by co-expression of a modified U1 snRNA redirected to the packaging region of the MSD mutant lentiviral vector DNA cassette. (Key: Pro, promoter; region from 5'R to gag contains packaging element {Ψ}, msd, major splice donor; cppt, central polyprint lact; Int, intron; sd / sa, splice donor / acceptor; GOI, target gene; gray arrows indicate the positions of forward {f} primers and reverse {r} primers for assessing the percentage of unsplicing vRNA produced during third-generation lentiviral vector production.Post-transcriptional regulatory elements {PRE} are not shown for clarity. Figure 2B: Standard third-generation lentiviral vector production was carried out in HEK293T cells with + / -rev, and total RNA was extracted from the cells after production. Using two primer sets (positions marked with A): f+rT amplified total transcript and f+rUS amplified unsplicing transcript generated from the lentiviral vector expression cassette, total RNA was subjected to qPCR (SYBR green), and thus the ratio of unsplicing vRNA transcript to total vRNA transcript was calculated and plotted. The data show that the proportion of unsplicing vRNA to total during standard third-generation lentiviral vector production is moderate and varies according to the internal transgene cassette (in this case, containing different promoter and GFP genes). Furthermore, this proportion is only minimally increased by the action of rev. [Figure 3] HIV-1 lentiviral vector genomes containing three different promoter-GFP expression cassettes (EF1a, EFS, and CMV) were modified to functionally mutate MSD, thereby obtaining the "MSD-2KO" lentiviral vector genome or backbone (see Figure 10A for an explanation of the mutations). The vectors were prepared in HEK293T cells under a standard protocol and titrated. The data show that the functional mutation in MSD ("MSD-2KO") results in up to a 100-fold decrease in the titer of the lentiviral vector. [Figure 4A]Figure 4A: A schematic diagram showing the composition of the MSD mutant lentiviral vector expression cassette encoding the standard or EF1a-GFP internal expression cassette, and the types of mRNA produced during lentiviral vector production. (Key: Pro, promoter; region from 5'R to gag contains the packaging element {Ψ}; msd, major splice donor; cppt, central polyprint lactate; Int, intron; sd / sa, splice donor / acceptor; GOI, gene of interest; gray arrows indicate the positions of forward {f} primers and reverse {r} primers for assessing the percentage of unsplicing vRNA produced during third-generation lentiviral vector production. Post-transcriptional regulatory elements {PRE} are not shown for clarity). Figure 4B: i. Figures showing the standard lentiviral vector or MSD-2KO lentiviral vector produced and titrated in HEK293T cells + / -tat, or 179U1, or 305U1. ii. This figure shows the results of RT-PCR / gel electrophoresis analysis of total cytoplasmic mRNA extracted from post-production cells using a primer (f+rG) capable of detecting the major “abnormal” splicing product from the SL2 splicing region to the EF1a splice acceptor. The data demonstrate that modified U1 snRNA, redirected to the 5' packaging region of the MSD-2KO lentiviral vector genome (vRNA), was able to increase the titers of both the standard and MSD-2KO lentiviral vectors in a manner similar to tat. The MSD-2KO mutation rendered the detection of the “abnormal” splicing product from the SL2 splicing region to the EF1a splice acceptor obscured (see Figure 4A). Importantly, the titer increase by modified U1 snRNA was accompanied by the maintenance of a substantially undetectable “abnormal” splicing product, in contrast to the use of tat. [Figure 4B]Figure 4A: A schematic diagram showing the composition of the MSD mutant lentiviral vector expression cassette encoding the standard or EF1a-GFP internal expression cassette, and the types of mRNA produced during lentiviral vector production. (Key: Pro, promoter; region from 5'R to gag contains the packaging element {Ψ}; msd, major splice donor; cppt, central polyprint lactate; Int, intron; sd / sa, splice donor / acceptor; GOI, gene of interest; gray arrows indicate the positions of forward {f} primers and reverse {r} primers for assessing the percentage of unsplicing vRNA produced during third-generation lentiviral vector production. Post-transcriptional regulatory elements {PRE} are not shown for clarity). Figure 4B: i. Figures showing the standard lentiviral vector or MSD-2KO lentiviral vector produced and titrated in HEK293T cells + / -tat, or 179U1, or 305U1. ii. This figure shows the results of RT-PCR / gel electrophoresis analysis of total cytoplasmic mRNA extracted from post-production cells using a primer (f+rG) capable of detecting the major “abnormal” splicing product from the SL2 splicing region to the EF1a splice acceptor. The data demonstrate that modified U1 snRNA, redirected to the 5' packaging region of the MSD-2KO lentiviral vector genome (vRNA), was able to increase the titers of both the standard and MSD-2KO lentiviral vectors in a manner similar to tat. The MSD-2KO mutation rendered the detection of the “abnormal” splicing product from the SL2 splicing region to the EF1a splice acceptor obscured (see Figure 4A). Importantly, the titer increase by modified U1 snRNA was accompanied by the maintenance of a substantially undetectable “abnormal” splicing product, in contrast to the use of tat. [Figure 5]This figure shows the titration of standard lentiviral vectors or MSD-mutated lentiviral vectors encoding GFP internal cassettes driven by EF1a, EFS, or CMV promoters in HEK293T cells + / - 256U1. The enhanced lentiviral vector titer with the use of modified U1 snRNA redirected to the 5' packaging region is independent of the promoter used within the transgene cassette. The data show that, in most cases, the attenuated phenotype of the MSD-2KO mutation is rescued by co-expression of modified U1 snRNA, and therefore this dramatically increases the titer of the MSD-mutated lentiviral vector genome disproportionately compared to the standard lentiviral vector genome. [Figure 6]This figure shows that enhancement of the MSD mutant lentiviral vector titer by using a modified U1 snRNA redirected to the 5' packaging region is not associated with suppression of the potential activity of the 5' polyA signaling pathway within the 5'LTR. Previous reports have shown that mutations in MSD can activate the polyA signaling pathway within the 5'R sequence of the 5'LTR of HIV-1 provirus and "mini-reporter" cassettes, leading to early transcriptional termination, and that binding of endogenous U1 snRNA and even redirected U1 snRNA could block this polyA activity. Figure 6A: This figure shows the effects of two polyA signaling variants (pAM1=AAUAAA>AACAAA; pAKO=AAUAAA deletion) and the wild-type polyA signaling pathway (wt pA=AAUAAA) on transcriptional readthrough of the HIV-1 polyA site by designing a GFP-polyAG luciferase reporter cassette. Readthrough of the HIV-1 polyA signaling pathway was measurable by luciferase activity, which was normalized by GFP expression. Figure 6B: To test whether the modified U1 snRNA acts in a similar manner, a functional mutation (pAm1) in the 5' polyA signaling pathway was introduced into the MSD mutant lentiviral vector genome with an EF1a-GFP or CMV-GFP expression cassette. Standard and MSD-2KO lentiviral vector genomes with EF1a-GFP or CMV-GFP expression cassettes were also used. The lentiviral vectors were produced in HEK293T cells + / - 305U1 and titrated. The data showed that functional removal of the 5' polyA signaling pathway resulted in only a very slight increase in the titer of the lentiviral vector; therefore, the observed increase in the titer of the lentiviral vector resulting from the modified U1 snRNA, particularly the increase in the MSD-2KO / polyA mutant lentiviral vector genome, was not due to the suppression of 5' polyA activity. [Figure 7]This figure shows the 305U1 and 256U1 modified U1 snRNAs with several mutations known to remove the U1-70K protein that binds to SL1, the U1A protein that binds to SL2, or the Sm protein that binds to / near SL4 in the vector genome. Standard or MSD mutant lentiviral vectors encoding the EF1a-GFP internal cassette were produced in the presence of these mutant modified U1 snRNAs, titrated, and the titration values ​​were normalized to the standard lentiviral vector produced without the modified U1 snRNAs. The data demonstrate that the titer enhancement of the MSD-2KO lentiviral vector by the modified U1 snRNAs is independent of U1-70K or U1A protein binding, and dependent on the Sm protein binding site. Therefore, the titer enhancement of the MSD-2KO lentiviral vector using modified U1 snRNAs retargeted to the 5' packaging region is unrelated to any known function of the U1 snRNA. [Figure 8] This figure shows the enhancement of MSD mutant lentiviral vector titers by using modified U1 snRNAs containing targeting sequences of various lengths. MSD-2KO lentiviral vectors containing an EF1a-GFP cassette were produced in HEK293T cells in the presence of modified U1 snRNAs targeting the "305" region. Each modified U1 snRNA contained a retargeting sequence of a different complementary length. Increased titers were observed when using modified U1 snRNAs with complementary lengths of 7–15 nucleotides, with the greatest effect observed at lengths of 10 nucleotides or more. [Figure 9]This figure shows the maximum titer recovery / boost of the MSD mutant lentiviral vector when a modified U1 snRNA is targeted to the packaging region of the vector genomic RNA. MSD-2KO lentiviral vectors containing an EF1-GFP cassette were produced in the presence of modified U1 snRNAs with targeting sequences along the 5' end of the vector genomic vRNA molecule, including a 15-nucleotide complement (or 9 nucleotides, if shown). The modified U1 snRNAs are named according to the first nucleotide of the targeting sequence site along the 5' end of the vector genomic vRNA molecule. The data bars for each modified U1 snRNA are aligned (not to scale) below the approximate labeling position of each known functional sequence within the 5' end of the vector genomic vRNA. [Figure 10]This figure illustrates functional major splice donor mutations, their effects on lentiviral vector titers, and recovery by modified U1 snRNA. Figure 10A: The “wild-type” sequence of the HIV-1 stem-loop 2 (SL2) region (NL4-3; the “standard” sequence in current lentiviral vector genomes) is shown at the top. The sequence includes the major splice donor site (MSD: consensus=CTGGT) and the latent splice donor site (used when the MSD site itself mutates) (crSD: consensus=TGAGT). Nucleotides at the splicing site when using the splice donor site are identified in bold and with arrows. Four functional MSD mutations that eliminate both MSD and crSD site splicing activity are described. These include MSD-2KO (and widely used in most examples), which mutates two "GT" motifs from the MSD and crSD sites; MSD-2KOv2, which includes mutations that remove both the MSD and crSD sites; MSD-2KOm5, which introduces a completely novel stem-loop structure lacking the splice donor site; and ΔSL2, which completely deletes the SL2 sequence. Substitutions introduced into the SL2 sequence in MSD-2KO, MSD-2KOv2, and MSD-2KOm5 mutations are shown in lowercase italics. Figure 10B: Four lentiviral vector genomic variants, including the functional MSD mutation (described in Figure 10A), were cloned in an EFS-GFP internal cassette, and the MSD-2KO or MSD-2KOm5 variants were further cloned in EF1a-, CMV-, or huPGK-GFP internal cassettes. Standard and MSD mutation LVs were produced in HEK293T cells + / - 256U1 and titrated. The data indicate that the degree of attenuation of lentiviral vector titers can vary depending on specific mutations, and that the MSD-2KOm5 variant generally produced a less attenuated phenotype. Modified U1 snRNA, when co-expressed during production, was able to increase the lentiviral vector titers of four lentiviral vector genomic variants, including the functional MSD mutation. The titer increase was greatest when 256U1 was expressed with the MSD mutant LV genome containing the MSD-2KOm5 sequence. [Figure 11A]This figure shows that the modified U1 snRNA expression cassette can be placed on the lentiviral vector genome plasmid backbone to facilitate use in transient transfection protocols. Many examples use a separate modified U1 snRNA expression plasmid in cotransfection with the lentiviral vector component plasmid in the production of the lentiviral vector. Three variants were cloned to identify "acceptable" sites on the lentiviral vector genome plasmid backbone to provide the modified U1 snRNA cassette in cis during transient transfection. Figure 11A: Schematic diagram of a lentiviral vector genome variant that provides the modified U1 snRNA cassette in cis during transient transfection. Versions 1 ("[cis]ver1") and 3 ("[cis]ver3") position the modified U1 snRNA cassette between the resistance marker and the origin of replication so that the modified U1 snRNA cassette is inverted relative to the lentiviral vector genome cassette (the orientation of the resistance marker differs between ver1 and ver3), while version 2 ("[cis]ver2") positions the modified U1 snRNA cassette upstream of the lentiviral vector genome cassette in the same orientation. (Key: Pro, promoter; region from 5'R to gag contains the packaging element {Ψ}; msd, primary splice donor {shown here as MSD-2KO}; RRE, rev response element; cppt, central polyprint lact; transgenic heterologous sequence containing the therapeutic payload; U1-Pro, U1 promoter; term [3' box], U1 transcription terminator). Figure 11B: Three "cis" versions of the MSD-2KO lentiviral vector genome plasmid containing the EF1a-GFP cassette were used to produce the lentiviral vector in HEK293T cells in parallel with the "trans" approach, and the same MSD-2KO lentiviral vector genome (without the modified U1 snRNA cassette inserted into the backbone) was used to produce + / - modified U1 snRNA supplied by cotransfection using a separate plasmid.The data show that the MSD-2KO lentiviral vector titer can be increased by using a "cis" lentiviral vector genome, as well as by cotransfection with plasmids encoding a separate modified U1 snRNA. [Figure 11B]This figure shows that the modified U1 snRNA expression cassette can be placed on the lentiviral vector genome plasmid backbone to facilitate use in transient transfection protocols. Many examples use a separate modified U1 snRNA expression plasmid in cotransfection with the lentiviral vector component plasmid in the production of the lentiviral vector. Three variants were cloned to identify "acceptable" sites on the lentiviral vector genome plasmid backbone to provide the modified U1 snRNA cassette in cis during transient transfection. Figure 11A: Schematic diagram of a lentiviral vector genome variant that provides the modified U1 snRNA cassette in cis during transient transfection. Versions 1 ("[cis]ver1") and 3 ("[cis]ver3") position the modified U1 snRNA cassette between the resistance marker and the origin of replication so that the modified U1 snRNA cassette is inverted relative to the lentiviral vector genome cassette (the orientation of the resistance marker differs between ver1 and ver3), while version 2 ("[cis]ver2") positions the modified U1 snRNA cassette upstream of the lentiviral vector genome cassette in the same orientation. (Key: Pro, promoter; region from 5'R to gag contains the packaging element {Ψ}; msd, primary splice donor {shown here as MSD-2KO}; RRE, rev response element; cppt, central polyprint lact; transgenic heterologous sequence containing the therapeutic payload; U1-Pro, U1 promoter; term [3' box], U1 transcription terminator). Figure 11B: Three "cis" versions of the MSD-2KO lentiviral vector genome plasmid containing the EF1a-GFP cassette were used to produce the lentiviral vector in HEK293T cells in parallel with the "trans" approach, and the same MSD-2KO lentiviral vector genome (without the modified U1 snRNA cassette inserted into the backbone) was used to produce + / - modified U1 snRNA supplied by cotransfection using a separate plasmid.The data show that the MSD-2KO lentiviral vector titer can be increased by using a "cis" lentiviral vector genome, as well as by cotransfection with plasmids encoding a separate modified U1 snRNA. [Figure 12A]Abnormally spliced ​​mRNA expressing the transgene during lentiviral vector production is removed in the MSD-2KO lentiviral vector, reducing the amount of transgene mRNA needed to be targeted by TRAP when the TRiP system is utilized. Figure 12A: Schematic diagram of the "TRiP" lentiviral vector genome encoding the EF1a-GFP transgene cassette, with the TRAP binding site (tbs) located within the 5'UTR of the cassette (supply of TRAP during vector production reduces the level of transgene expression). During the production of the MSD-2KO lentiviral vector, full-length, unspliced, packageable vRNA and transgene mRNA are the main forms of RNA produced from the lentiviral vector cassette (i) (if the transgene promoter is active during production). However, the unruly activity of MSD in a standard lentiviral vector genome results in further "abnormal" splice products that can encode the transgene (ii), which can occur independently of the internal transgene promoter, i.e., the tissue-specific promoter. (Key: Pro, promoter; region from 5'R to gag contains packaging element {Ψ}; msd, major splice donor; cppt, central polyprint lact; Int, intron; sd / sa, splice donor / acceptor; GOI, target gene; gray arrows indicate the positions of forward {f} primers and reverse {r} primers for assessing the percentage of unsplicing vRNA produced during third-generation lentiviral vector production. Post-transcriptional regulatory elements {PRE} are not shown for clarity). Figure 12B: Lentiviral vectors were produced in HEK293T cells using standard or MSD-2KO lentiviral vector genomic plasmids containing the EF1a-GFP cassette, and GFP expression scores were generated (%GFP × MFI). Compared to the total amount of GFP produced in culture during standard lentiviral vector production, MSD-2KO had a substantial effect in reducing the amount of GFP produced, even in the absence of TRAP.Therefore, the inhibitory effect of TRAP was enhanced by the use of the MSD-2KO lentiviral vector genome, resulting in much lower levels of GFP in the culture. [Figure 12B]Abnormally spliced ​​mRNA expressing the transgene during lentiviral vector production is removed in the MSD-2KO lentiviral vector, reducing the amount of transgene mRNA needed to be targeted by TRAP when the TRiP system is utilized. Figure 12A: Schematic diagram of the "TRiP" lentiviral vector genome encoding the EF1a-GFP transgene cassette, with the TRAP binding site (tbs) located within the 5'UTR of the cassette (supply of TRAP during vector production reduces the level of transgene expression). During the production of the MSD-2KO lentiviral vector, full-length, unspliced, packageable vRNA and transgene mRNA are the main forms of RNA produced from the lentiviral vector cassette (i) (if the transgene promoter is active during production). However, the unruly activity of MSD in a standard lentiviral vector genome results in further "abnormal" splice products that can encode the transgene (ii), which can occur independently of the internal transgene promoter, i.e., the tissue-specific promoter. (Key: Pro, promoter; region from 5'R to gag contains packaging element {Ψ}; msd, major splice donor; cppt, central polyprint lact; Int, intron; sd / sa, splice donor / acceptor; GOI, target gene; gray arrows indicate the positions of forward {f} primers and reverse {r} primers for assessing the percentage of unsplicing vRNA produced during third-generation lentiviral vector production. Post-transcriptional regulatory elements {PRE} are not shown for clarity). Figure 12B: Lentiviral vectors were produced in HEK293T cells using standard or MSD-2KO lentiviral vector genomic plasmids containing the EF1a-GFP cassette, and GFP expression scores were generated (%GFP × MFI). Compared to the total amount of GFP produced in culture during standard lentiviral vector production, MSD-2KO had a substantial effect in reducing the amount of GFP produced, even in the absence of TRAP.Therefore, the inhibitory effect of TRAP was enhanced by the use of the MSD-2KO lentiviral vector genome, resulting in much lower levels of GFP in the culture. [Figure 13] This figure shows that the successful isolation of HEK293T cells stably expressing modified U1 snRNA, which enables the proliferation of standard or MSD-2KO lentiviral vectors, demonstrates that modified U1 snRNA cassettes can be introduced into lentiviral vector packaging and producer cell lines. Standard or MSD-2KO lentiviral vector genomes containing EFS-GFP cassettes were produced in HEK293T or HEK293T.305U1 (9nt variant) cells + / - additional 305U1 plasmids. The data show that stable cassettes expressing modified U1 snRNA can be introduced into cells without toxicity. [Figure 14]Figure 14A: A schematic diagram showing the identification of the optimal Kozak sequence that overlaps with the 3' end of the tbs within the transgene 5'UTR to position the tbs closer to the ATG start codon. The Kozak sequence is positioned to overlap with the 3' end of the tbs so that (one or more) KAGNN repeats are maintained, in manipulated variants conforming to the core consensus "RVVATG" and the broader consensus "GNNRVVATG". This allows for the identification of tbs-Kozak junction variants that enable improved transgene repression levels (+TRAP) by positioning the tbs closer to the ATG start codon and "hiding" the ATG start codon within the TRAP-tbs complex. Maintaining the consensus Kozak sequence allows for high levels of transgene non-repression (no TRAP) (i.e., modeling vector expression in transduced cells). Figure 14B: Reporters were tested for non-suppression or suppression levels of GFP expression by co-transfection of the reporter plasmid into HEK293T cells with either pBlueScript (without TRAP) or pEF1α-TRAP (TRAP). Transfected cells were analyzed by flow cytometry 2 days after transfection to generate a GFP expression score (%GFP x median fluorescence intensity) and log-10 transformed. All tbs-Kozak junction variant reporters maintained the same non-suppression GFP level compared to the original configuration. Variants "0", "2", and "3" showed improved suppression levels compared to the original configuration (standard deviation bars, n=3). [Figure 15]This figure illustrates the improvement of transgene repression in AAV vector genomic plasmids by using overlapping tbs-Kozak variants. Two tbs-Kozak variants (0 and 3) were cloned into either the EFS or huPGK promoter GFP reporter cassette and further contained either the L33 or L12 improved reader sequence. Non-overlapping tbs / Kozak variants were also cloned into the EFS / huPGK-L33 cassette, and these differed only in the tbs-Kozak region (original = [tbs]-ACAGCCACCATG; HpaI variant = [tbs-GAGTT]AACGCCACCATG). The reporters were pBlueScript (without TRAP) or pEF1α-TR, respectively. Cotransfection of reporter plasmids with either AP (TRAP) was used to test the level of non-repression or repression of GFP expression. Transfected HEK293T cells (suspension, serum-free) were analyzed by flow cytometry 2 days after transfection to generate a GFP expression score (%GFPx median fluorescence intensity) and log-10 transformed. The data demonstrate that overlapping tbs with the Kozak sequence enables improved repression of transgene expression by TRAP compared to non-overlapping tbs / Kozak variants (standard deviation bars, n=3). [Figure 16AB]This figure shows the improvement in TRAP-mediated transgene repression associated with the full-length EF1a promoter. Figure 16A: Three “tbs-Kozak” variants (0, 2, and 3) were cloned into the EF1a promoter GFP reporter cassette. After splicing, the leader sequence contained the L33 sequence (exon 1) and a short 12nt sequence from exon 2 immediately upstream of tbs. Figure 16B: The reporters were tested for non-repression or repression levels of GFP expression by co-transfection of the reporter plasmid with either pBlueScript (without TRAP) or pEF1α-TRAP (TRAP). Transfected HEK293T cells (suspension, serum-free) were analyzed by flow cytometry 2 days after transfection to generate a GFP expression score (%GFPx median fluorescence intensity) and log-10 transformed. Figure 16C: The GFP transgene cassette was cloned into the HIV-1 lentiviral vector genome and tested for non-repression or repression levels of GFP expression as described in B. The data demonstrate that overlapping the tbs with the Kozak sequence enables improved suppression of transgene expression by TRAP (standard deviation bars, n=3). [Figure 16C]This figure shows the improvement in TRAP-mediated transgene repression associated with the full-length EF1a promoter. Figure 16A: Three “tbs-Kozak” variants (0, 2, and 3) were cloned into the EF1a promoter GFP reporter cassette. After splicing, the leader sequence contained the L33 sequence (exon 1) and a short 12nt sequence from exon 2 immediately upstream of tbs. Figure 16B: The reporters were tested for non-repression or repression levels of GFP expression by co-transfection of the reporter plasmid with either pBlueScript (without TRAP) or pEF1α-TRAP (TRAP). Transfected HEK293T cells (suspension, serum-free) were analyzed by flow cytometry 2 days after transfection to generate a GFP expression score (%GFPx median fluorescence intensity) and log-10 transformed. Figure 16C: The GFP transgene cassette was cloned into the HIV-1 lentiviral vector genome and tested for non-repression or repression levels of GFP expression as described in B. The data demonstrate that overlapping the tbs with the Kozak sequence enables improved suppression of transgene expression by TRAP (standard deviation bars, n=3). [Figure 17A]This figure shows the results of a TRAP-mediated transgene repression study of duplicate tbs-Kozak variants in suspension (serum-free) HEK293T cells. The duplicate tbs-Kozak variants from Table IV were cloned into pEF1a-GFP reporter plasmids, transfected HEK293T cells with + / -pTRAP, and flow cytometry was performed 2 days after transfection. Figure 17A: GFP expression scores (%GFP positive × MFI) were generated, and + / -TRAP and fold repression values ​​were generated and plotted. Variants are shown along the x-axis and grouped according to the relative overlap of 3' tbs KAGNN repeats and core Kozak sequences ("overlap group" - KAGatg, KAGNatg), KAGNNatg). KAGNN is shown as a black circle, and core Kozak nucleotides are shown as gray lines. Statistical analysis was performed comparing the following overlapping groups (equal variances within the overlapping groups were confirmed by the F-test): The suppression factor was statistically larger for KAGatg than for KAGNatg (*p=0.0293). For KAGNatg relative to KAGNNatg (**p=0.00000482); and for KAGNNatg relative to non-overlapping tbs (***p=0.000259), a two-tail T-test was used. Figure 17B: Unsuppressed GFP expression scores are plotted from highest to lowest (left to right), highlighting the two KAGatg overlapping group variants tbskzkV0.G and tbskzkV0.T (showing maximum suppression for all variants of A) to show that the "G" variant is preferable to the "T" variant, because the former has a better "ON" (unsuppressed) level. [Figure 17B]This figure shows the results of a TRAP-mediated transgene repression study of duplicate tbs-Kozak variants in suspension (serum-free) HEK293T cells. The duplicate tbs-Kozak variants from Table IV were cloned into pEF1a-GFP reporter plasmids, transfected HEK293T cells with + / -pTRAP, and flow cytometry was performed 2 days after transfection. Figure 17A: GFP expression scores (%GFP positive × MFI) were generated, and + / -TRAP and fold repression values ​​were generated and plotted. Variants are shown along the x-axis and grouped according to the relative overlap of 3' tbs KAGNN repeats and core Kozak sequences ("overlap group" - KAGatg, KAGNatg), KAGNNatg). KAGNN is shown as a black circle, and core Kozak nucleotides are shown as gray lines. Statistical analysis was performed comparing the following overlapping groups (equal variances within the overlapping groups were confirmed by the F-test): The suppression factor was statistically larger for KAGatg than for KAGNatg (*p=0.0293). For KAGNatg relative to KAGNNatg (**p=0.00000482); and for KAGNNatg relative to non-overlapping tbs (***p=0.000259), a two-tail T-test was used. Figure 17B: Unsuppressed GFP expression scores are plotted from highest to lowest (left to right), highlighting the two KAGatg overlapping group variants tbskzkV0.G and tbskzkV0.T (showing maximum suppression for all variants of A) to show that the "G" variant is preferable to the "T" variant, because the former has a better "ON" (unsuppressed) level. [Figure 18A]Improved suppression of intron-containing promoters using an optimal duplicated tbs-Kozak variant. Figure 18A: Schematic diagram of the expression cassette used to illustrate the use of a duplicated tbs-Kozak variant compared to a non-duplicated tbs-Kozak variant. The widely used EF1a promoter sequence, like the widely used CAG promoter, contains its own intron (see Figure 10 and Example 5). The CAG promoter is a very potent artificial promoter containing the CMV enhancer, core promoter, and exon 1 / intron sequence from the chicken β-actin gene and splice acceptor / exon sequence from the rabbit β-globin gene. In this study, the “EF1a-INT” sequence, all of the EF1a intron and splice acceptor, and 12 nucleotides from EF1a exon 2 were cloned into the CAG promoter, replacing the CAG exon / intron sequence. The “EF1a-INT” sequence was also cloned into the CMV promoter construct. Figure 18B: To model transgene expression during viral vector production, constructs were evaluated for GFP expression and TRAP-induced repression in suspension (serum-free) HEK293T cells. GFP expression scores (%GFP × MFI) were generated and plotted, and similarly, double repression scores in the presence of TRAP were shown. [Figure 18B]Improved suppression of intron-containing promoters using an optimal duplicated tbs-Kozak variant. Figure 18A: Schematic diagram of the expression cassette used to illustrate the use of a duplicated tbs-Kozak variant compared to a non-duplicated tbs-Kozak variant. The widely used EF1a promoter sequence, like the widely used CAG promoter, contains its own intron (see Figure 10 and Example 5). The CAG promoter is a very potent artificial promoter containing the CMV enhancer, core promoter, and exon 1 / intron sequence from the chicken β-actin gene and splice acceptor / exon sequence from the rabbit β-globin gene. In this study, the “EF1a-INT” sequence, all of the EF1a intron and splice acceptor, and 12 nucleotides from EF1a exon 2 were cloned into the CAG promoter, replacing the CAG exon / intron sequence. The “EF1a-INT” sequence was also cloned into the CMV promoter construct. Figure 18B: To model transgene expression during viral vector production, constructs were evaluated for GFP expression and TRAP-induced repression in suspension (serum-free) HEK293T cells. GFP expression scores (%GFP × MFI) were generated and plotted, and similarly, double repression scores in the presence of TRAP were shown. [Figure 19]This is an overview of improvements to the 5'UTR sequence downstream of the tbs. Figure 19A: Schematic diagram for showing the DNA expression cassette of the 5'UTR coding region of a TRAP-tbs repressive transgene cassette in which a multicloning site (MCS) is inserted between the transgene tbs and the start codon (TRAP is indicated by a donut shape). The present invention describes preferred duplication restriction enzyme sites that begin at / on the terminal KAGNN repeat of the tbs and include up to five cloning sites upstream of the transgene start codon. Figure 19B: Schematic diagram for showing how the transgene Kozak sequence may be positioned to largely or partially overlap with the 3'KAGNN repeat of the tbs, thereby effectively "hiding" the major start codon within the TRAP-tbs complex, making the translation mechanism even more difficult to access and resulting in an even lower "repressed" level of transgene expression. Figure 19C: Table summarizing preferred duplicated tbs and Kozak consensus sequences. The 3'KAGNN iterations of tbs are shown as squares, and the core Kozak sequence is shown in bold. [Figure 20AB]Figure 20A: DNA sequences used to further illustrate splice donor site mutations in the HIV-1 packaging region of a lentiviral vector. The SL2 loop region of the packaging sequence (containing MSD and crSD1) is boxed, as is the SL4 loop (containing two further smaller latent splice donor sites, crSD2 and crSD3). Importantly, the captured sequence is wild-type (or aligned with it), such as "wt SL2-MSD-SL4(STD)," which also indicates the splice donor nucleotides in bold black. "GT" dinucleotides (considered important for the functional splice donor site) are in bold gray if present. Dashed lines are used to separate aligned sequences for clarity, rather than to represent gaps within the sequence. A forward diagonal line represents a sequence not shown between the SL2 and SL4 loops (and all "missing" sequences are derived from wild-type HIV-1). Underlined sequences indicate nucleotides within the stem of the SL. Lowercase italicized sequences are modified sequences. "1 / 2 / 3 / 4KO" indicates the number of mutated splice donors in each variant. Figure 20B: Schematic diagram showing the wild-type major splice donor site in a standard lentiviral vector genomic RNA, and the predicted annealing of endogenous U1 snRNA to the "MSD-2KO" and "MSD-2KOm5" variants. The "MSD-2KOm5" variant is still functionally mutated at the splice donor site, but is designed to anneal to endogenous U1 snRNA with greater stability (higher complementarity) than "MSD-2KO" (or actually the wild type). Furthermore, "MSD-2KOm5" includes adjacent sequences to allow stem-loop formation to minimize impact on the packaging secondary structure (see A). Figure 20C: This figure shows the lentiviral vector genome encoding the EF1a-GFP transgene cassette and the packaging region containing the standard (STD) MSD region (wild-type sequence), or the MSD-only (MSD-1KO) or MSD / crSd1 (MSD-2KO) mutations constructed.LVs were produced in suspended (serum-free) HEK293T cells by transient transfection, with or without trans-supplied 256U1 modified snRNA. PolyA-selective total mRNA was extracted from post-production cells using primers upstream of MSD and downstream of the EF1a splice to identify the overall impact on aberrant splicing from the MSD region, and subjected to RT-PCR / agarose gel analysis (see Figure 23 for primer positions). Gel images show the location / type of aberrant splice products from the SL2 / SL4 region to the EF1a splice acceptor (confirmed by sequencing of splice junctions [data not shown]). Figure 20D: The titers of both MSD-1KO LV and MSD-2KO LV lentiviral vectors were reduced compared to standard LVs, but these were rescued by using modified U1 snRNA targeting the packaging region of the mutant LV (Y-axis on a log10 scale). [Figure 20CD]Figure 20A: DNA sequences used to further illustrate splice donor site mutations in the HIV-1 packaging region of a lentiviral vector. The SL2 loop region of the packaging sequence (containing MSD and crSD1) is boxed, as is the SL4 loop (containing two further smaller latent splice donor sites, crSD2 and crSD3). Importantly, the captured sequence is wild-type (or aligned with it), such as "wt SL2-MSD-SL4(STD)," which also indicates the splice donor nucleotides in bold black. "GT" dinucleotides (considered important for the functional splice donor site) are in bold gray if present. Dashed lines are used to separate aligned sequences for clarity, rather than to represent gaps within the sequence. A forward diagonal line represents a sequence not shown between the SL2 and SL4 loops (and all "missing" sequences are derived from wild-type HIV-1). Underlined sequences indicate nucleotides within the stem of the SL. Lowercase italicized sequences are modified sequences. "1 / 2 / 3 / 4KO" indicates the number of mutated splice donors in each variant. Figure 20B: Schematic diagram showing the wild-type major splice donor site in a standard lentiviral vector genomic RNA, and the predicted annealing of endogenous U1 snRNA to the "MSD-2KO" and "MSD-2KOm5" variants. The "MSD-2KOm5" variant is still functionally mutated at the splice donor site, but is designed to anneal to endogenous U1 snRNA with greater stability (higher complementarity) than "MSD-2KO" (or actually the wild type). Furthermore, "MSD-2KOm5" includes adjacent sequences to allow stem-loop formation to minimize impact on the packaging secondary structure (see A). Figure 20C: This figure shows the lentiviral vector genome encoding the EF1a-GFP transgene cassette and the packaging region containing the standard (STD) MSD region (wild-type sequence), or the MSD-only (MSD-1KO) or MSD / crSd1 (MSD-2KO) mutations constructed.LVs were produced in suspended (serum-free) HEK293T cells by transient transfection, with or without trans-supplied 256U1 modified snRNA. PolyA-selective total mRNA was extracted from post-production cells using primers upstream of MSD and downstream of the EF1a splice to identify the overall impact on aberrant splicing from the MSD region, and subjected to RT-PCR / agarose gel analysis (see Figure 23 for primer positions). Gel images show the location / type of aberrant splice products from the SL2 / SL4 region to the EF1a splice acceptor (confirmed by sequencing of splice junctions [data not shown]). Figure 20D: The titers of both MSD-1KO LV and MSD-2KO LV lentiviral vectors were reduced compared to standard LVs, but these were rescued by using modified U1 snRNA targeting the packaging region of the mutant LV (Y-axis on a log10 scale). [Figure 21] Further mutations were added to LV genomes containing either the MSD-2KO or MSD-2KOm5 mutation in SL2 to eliminate aberrant splicing from the crSD2 site in the packaging sequence SL4 (see Figure 20). LV was produced in suspended (serum-free) HEK293T cells by transient transfection, with or without the trans-supplied 256U1 modified snRNA. Figure 21A: PolyA-selective total mRNA was extracted from post-production cells using primers upstream of MSD and downstream of the EF1a splice acceptor, and subjected to RT-PCR / agarose gel analysis to identify the overall impact of aberrant splicing from the MSD regions of SL2 and SL4 (see Figure 23 for primer positions). Gel images show the location / type of aberrant splice products from the SL2 / SL4 region to the EF1a splice acceptor (confirmed by sequencing of splice junctions [data not shown]). Figure 21B: The titers of lentiviral vectors for all MSD-1 / 2 / 3 / 4KO genomes were reduced compared to standard LVs, but these were rescued by using modified U1 snRNAs targeting the packaging region of the mutant LVs (Y-axis on a log10 scale). [Figure 22] Integrated MSD mutant lentiviral vectors (LVs) exhibit a lower rate of transcriptional read-through events compared to standard LVs. Lentiviral vectors semi-randomly insert transcriptionally active genes into target cell DNA, typically resulting in the integrated vector being located inside the cell gene transcription unit. If the integrated LV is located downstream of the cell promoter, some transcriptional read-through ("read-in") can occur within the LV unit. Current standard third-generation LVs contain intact MSDs, and theoretically, any read-in into the 5'LTR and packaging region could allow for the recruitment of endogenous U1 snRNA into the RNA. In such a scenario, the recruited U1 snRNA is thought to suppress polyadenylation at the 5' polyA site, leading to further elongation into the LV unit. Furthermore, splicing from the MSD can occur in downstream splice acceptors within the LV unit, or even in the cell transcript via trans-splicing. The use of MSD mutant LV is expected to fail to recruit the endogenous U1 snRNA that yields the splicing-competent precursor, and therefore is less likely to suppress polyadenylation at the 5' polyA site. Consequently, fewer transcriptional read-ins are expected in this new type of vector. To evaluate read-in transcription from upstream of the incorporated LV cassette, the positions of the forward primer (f) and reverse primer (r) used for RT-qPCR of total RNA extracted from transduced cells are indicated by gray arrows. [Figure 23]This figure shows evidence that the integrated MSD mutant LV has a lower rate of transcriptional read-through events compared to the standard LV. HEK293T cells or primary 92BR cells were transduced at a matched MOI using the standard LV vector and the MSD mutant variant vector produced in Example S2. Only the MSD mutant vector preparation produced in the presence of 256U1 was used because it gave a titer comparable to the standard LV genome preparation (see Figure 21B). Transduced cells were passaged for 10 days to remove non-integrated cDNA and reduce the signal of any vector RNA that may have been expressed from non-integrated vector cDNA. Host cell RNA was extracted and DNAse-treated before RT-qPCR analysis to detect read-in transcripts (see Figure 22 for primer positions). Detected HIV Psi RNA copies were normalized separately for detection of GAPDH signaling (loading) and DNA copy number of the integrated vector. The detected HIV Psi DNA copy of the standard LV prepared without 256U1 was set to 1, and all other data points were set relative to this. Statistical comparisons were performed between all MSD variant vectors and the standard vector. After evaluating the mean and variance using an F-test (critical one-tail), a t-test (critical two-tail assuming equal variances [HEK293T] or unequal variances [92BR]) was performed to reveal significant differences between the two groups (*p=0.00012 and **p=0.000073). [Modes for carrying out the invention]

[0053] RNA splicing As described herein, the present invention provides a nucleotide sequence encoding the RNA genome of a lentiviral vector, wherein the major splice donor site in the RNA genome of the lentiviral vector is inactivated and the latent splice donor site 3' relative to the major splice donor site is inactivated.

[0054] RNA splicing is catalyzed by a large RNA-protein complex called a spliceosome, which is composed of five small nuclear ribonucleoproteins (snRNPs). The boundaries between introns and exons are marked by specific nucleotide sequences within premRNA, depicting where splicing will occur. Such boundaries are called “splice sites.” The term “splice site” refers to a polynucleotide that can be recognized by the eukaryotic cell splicing mechanism as suitable for cleavage and / or ligation to another splice site.

[0055] Splice sites allow for the removal of introns present in the premRNA transcript. Typically, the 5' splice boundary is called the “splice donor site” or “5' splice site,” and the 3' splice boundary is called the “splice acceptor site” or “3' splice site.” Examples of splice sites include naturally occurring splice sites, artificial or synthetic splice sites, canonical or consensus splice sites, and / or non-canonical splice sites, such as latent splice sites.

[0056] The splice acceptor site generally consists of three distinct sequence elements: a branching point or branching site, a polypyrimidine pathway, and an acceptor consensus sequence. In eukaryotes, the branching point consensus sequence is YNYTRAC (where Y is a pyrimidine, N is any nucleotide, and R is a purine). The 3' acceptor splice site consensus sequence is YAG (where Y is a pyrimidine) (see, for example, Griffiths et al., eds., Modern Genetic Analysis, 2nd edition, WH Freeman and Company, New York (2002)). The 3' splice acceptor site is typically located at the 3' end of an intron.

[0057] The terms "canonical splice site" and "consensus splice site" can be used interchangeably and refer to splice sites that are conserved across species.

[0058] The consensus sequences for the 5' donor splice and 3' acceptor splice sites used in eukaryotic RNA splicing are well known in the art. These consensus sequences contain nearly invariant dinucleotides at each end of the intron: GT at the 5' end of the intron and AG at the 3' end of the intron.

[0059] The canonical splice donor site consensus sequence (in the case of DNA) may be AG / GTRAGT (wherein A is adenosine, T is thymine, G is guanine, C is cytosine, R is purine, and " / " indicates a cleavage site). This follows the more general splice donor consensus sequence MAGGURR described herein. It is well known in the art that splice donors may deviate from this consensus, particularly in viral genomes where other constraints, such as secondary structures within the vRNA packaging region, are related to the same sequence. Non-canonical splice sites are also well known in the art, but they occur less frequently than canonical splice donor consensus sequences.

[0060] The "major splice donor site" refers to the first (dominant) splice donor site within the viral vector genome, typically encoded and incorporated within the native viral RNA packaging sequence located in the 5' region of the viral vector nucleotide sequence.

[0061] In one embodiment, the nucleotide sequence does not contain an active major splice donor site; that is, splicing does not originate from the major splice donor site in the nucleotide sequence, and splicing activity from the major splice donor site is removed.

[0062] The primary splice donor site is located in the 5' packaging region of the lentiviral genome.

[0063] In the case of the HIV-1 virus, the major splice donor consensus sequence (for DNA) is TG / GTRAGT (where A is adenosine, T is thymine, G is guanine, C is cytosine, R is purine, and " / " indicates a cleavage site).

[0064] In one aspect of the present invention, the splice donor region, i.e., the region of the vector genome containing the major splice donor site before mutation, may have the following sequence. GGGGCGGCGACTGGTGAGTACGCCAAAAAT(Sequence ID 1)

[0065] In one aspect of the present invention, the mutant splice donor region may include the following sequence. GGGGCGGCGACTGCAGACAACGCCAAAAAT(Sequence ID 2-MSD-2KO)

[0066] In one aspect of the present invention, the mutant splice donor region may include the following sequence. GGGGCGGCGAGTGGAGACTACGCCAAAAAT(Sequence ID 11-MSD-2KOv2)

[0067] In one aspect of the present invention, the mutant splice donor region may include the following sequence. GGGGAAGGCAACAGATAAATATGCCTTAAAAT(Sequence ID 12-MSD-2KOm5)

[0068] In one aspect of the present invention, the splice donor region may, before modification, include the following sequence: GGCGACTGGTGAGTACGCC(Sequence No. 9)

[0069] This sequence is also referred to herein as the “stem-loop 2” region (SL2). This sequence can form a stem-loop structure in the splice donor region of the vector genome. In one aspect of the present invention, this sequence (SL2) may be deleted from the nucleotide sequence according to the present invention as described herein.

[0070] Therefore, the present invention includes nucleotide sequences that do not contain SL2. The present invention includes nucleotide sequences that do not contain the sequence defined by SEQ ID NO: 9.

[0071] In one aspect of the present invention, the main splice donor site may have the following consensus sequence, where R is a purine and " / " is a cleavage site. TG / GTRAGT (Sequence No. 3)

[0072] In one embodiment, R may be guanine (G).

[0073] In one aspect of the present invention, the primary splice donor and potential splice donor regions may have the following core sequence, where " / " is the cleavage site of the primary splice donor and potential splice donor regions. / GTGA / GTA (Sequence ID: 13).

[0074] In one embodiment of the present invention, the MSD mutant vector genome may have at least two mutations in the “region” (SEQ ID NO: 13) of the major splice donor and the latent splice donor, wherein the first and second “GT” nucleotides are 3' immediately following the nucleotides of the major splice donor and the latent splice donor, respectively.

[0075] In one aspect of the present invention, the major splice donor consensus sequence is CTGGT (SEQ ID NO: 4). The major splice donor site may include the sequence CTGGT.

[0076] In one embodiment, the nucleotide sequence includes the sequence described in any of SEQ ID NOs: 1, 3, 4, 9, 10 and / or 13 prior to the inactivation of the splice site.

[0077] In one embodiment, the nucleotide sequence will include an inactivated major splice donor site and otherwise have a cleavage site between nucleotides corresponding to nucleotides 13 and 14 of SEQ ID NO: 1.

[0078] According to the present invention as described herein, the nucleotide sequence also includes an inactive latent splice donor site. In one embodiment, the nucleotide sequence does not include an active latent splice donor site adjacent to the major splice donor site (3' of), i.e., splicing does not occur from the adjacent latent splice donor site, and splicing from the latent splice donor site is removed.

[0079] The term "latent splice donor site" refers to a nucleic acid sequence that does not normally function as a splice donor site, or is not utilized very efficiently as a splice donor site due to the circumstances of its neighboring sequences (e.g., the presence of a nearby "preferred" splice donor), but can be activated to function as a more efficient splice donor site by mutations in its neighboring sequences (e.g., mutations in a nearby "preferred" splice donor).

[0080] In one embodiment, the potential splice donor site is the first potential splice donor site 3' of the primary splice donor.

[0081] In one embodiment, the latent splice donor site is located within 6 nucleotides of the major splice donor site on the 3' side of the major splice donor site. Preferably, the latent splice donor site is located within 4 or 5, preferably 4 nucleotides, of the major splice donor cleavage site.

[0082] In one aspect of the present invention, the latent splice donor site has the consensus sequence TGAGT (SEQ ID NO: 10).

[0083] In one embodiment, the nucleotide sequence will include an inactivated latent splice donor site and otherwise have a cleavage site between nucleotides corresponding to nucleotides 17 and 18 of SEQ ID NO: 1.

[0084] In one aspect of the present invention, the primary splice donor site and / or adjacent latent splice donor site contain a "GT" motif. In one aspect of the present invention, both the primary splice donor site and the adjacent latent splice donor site contain a mutated "GT" motif. The mutated GT motif can inactivate splice activity from both the primary splice donor site and the adjacent latent splice donor site. An example of such a mutation is referred to herein as "MSD-2KO".

[0085] In one embodiment, the splice donor region may include the following sequence: CAGACA (Sequence ID 5)

[0086] For example, in one embodiment, the mutant splice donor region may include the following sequence: GGCGACTGCAGACAACGCC (Sequence ID 6)

[0087] Further examples of inactivating mutations are referred to herein as "MSD-2KOv2".

[0088] In one embodiment, the mutant splice donor region may include the following sequence: GTGGAGACT (Sequence ID 7)

[0089] For example, in one embodiment, the mutant splice donor region may include the following sequence: GGCGAGTGGAGACTACGCC (Sequence No. 8)

[0090] For example, in one embodiment, the mutant splice donor region may include the following sequence: AAGGCAACAGATAAATATGCCTT (Sequence ID 14)

[0091] In one embodiment, the above-mentioned stem-loop 2 region can be deleted from the splice donor region to inactivate both the primary splice donor site and the adjacent latent splice donor site. Such a deletion is referred to herein as "ΔSL2".

[0092] Various types of mutations can be introduced into nucleic acid sequences to inactivate major splice donor sites and adjacent latent splice donor sites.

[0093] In one embodiment, the mutation is a functional mutation that removes or suppresses splicing activity in the splice region. The nucleotide sequences described herein may contain mutations or deletions in any of the nucleotides in SEQ ID NOs: 1, 3, 4, 9, 10, and / or 13. Suitable mutations are known to those skilled in the art and are described herein.

[0094] For example, point mutations can be introduced into nucleic acid sequences. As used herein, the term “point mutation” refers to any change to a single nucleotide. Point mutations include, for example, deletions, transpositions, and conversions, which, when present in a protein-coding sequence, can be classified as nonsense mutations, missense mutations, or silent mutations. A “nonsense” mutation produces a stop codon. A “missense” mutation produces a codon that codes for a different amino acid. A “silent” mutation produces a codon that codes for either the same amino acid or a different amino acid, without altering the function of the protein. One or more point mutations can be introduced into a nucleic acid sequence containing a latent splice donor site. For example, a nucleic acid sequence containing a latent splice site can be mutated by introducing two or more point mutations into it.

[0095] Attenuation of splicing from the splice donor region can be achieved by introducing at least two point mutations at several positions within the nucleic acid sequence, including the primary splice donor and potential splice donor sites. In one embodiment, the mutations may be within four nucleotides of the splice donor cleavage site, and in the canonical splice donor consensus sequence, this is A 1 G 2 / G 3 T 4and " / " is the cleavage site. It is well known in the art that splice donor cleavage sites can deviate from this consensus, particularly in viral genomes where other constraints such as secondary structures within the vRNA packaging region, etc. are related to the same sequence. G 3 T 4 Dinucleotides are generally the smallest variable sequences within the canonical splice donor consensus sequence, G 3 and / or T 4 to mutations that are most likely to achieve the greatest attenuation effect. For example, for the major splice donor site of the HIV-1 viral vector genome, this is T 1 G 2 / G 3 T 4 and " / " is the cleavage site. For example, for a potential splice donor site of the HIV-1 viral vector genome, this is G 1 A 2 / G 3 T 4 and " / " is the cleavage site. Further, one or more point mutations can be introduced adjacent to the splice donor site. For example, point mutations can be introduced upstream or downstream of the splice donor site. In embodiments where a nucleic acid sequence containing a major and / or potential splice donor site is mutated by introducing a plurality of point mutations therein, the point mutations can be introduced upstream and / or downstream of the potential splice donor site.

[0096] As described herein and as shown in the examples, the nucleotide sequence encoding the RNA genome of the lentiviral vector according to the invention may further contain mutations in the potential splice donor site within the SL4 loop of the packaging sequence. In one aspect, the GT dinucleotide of the potential splice donor site within the SL4 loop of the packaging sequence is mutated to GC.

[0097] Construction of Splice Site Variants The splice site variants of the present invention can be constructed using various techniques. For example, the mutation can be introduced into a specific locus by synthesizing an oligonucleotide containing a mutant sequence adjacent to a restriction site that allows ligation to a fragment of the native sequence. After ligation, the resulting reconstructed sequence contains derivatives having the desired nucleotide insertion, substitution, or deletion.

[0098] Other known techniques that enable modification of DNA sequences include recombination approaches such as Gibson assembly, Golden-gate cloning, and in-fusion.

[0099] Alternatively, oligonucleotide-directed site-specific (or segment-specific) mutagenesis procedures can be used to provide sequences modified according to the required substitutions, deletions, or insertions. Deletion or cleavage derivatives of splice site variants can also be constructed by utilizing convenient restriction endonuclease sites adjacent to the desired deletion.

[0100] Following the restriction, the overhang can be filled in, and the DNA can be rejoined.

[0101] An exemplary method for making the above modifications is disclosed by Sambrook et al. (Molecular cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, 1989).

[0102] Splice site variants can also be constructed using techniques such as PCR mutagenesis, chemical mutagenesis, chemical mutagenesis by forced nucleotide misintegration (e.g., Liao and Wise, 1990) (Drinkwater and Klinedinst, 1986), or chemical mutagenesis using random mutant oligonucleotides (Horwitz et al., 1989).

[0103] The present invention also provides a method for generating a lentiviral vector nucleotide sequence, (i) a step of providing a nucleotide sequence that encodes the RNA genome of the lentiviral vector described herein, (ii) A step of mutating the major splice donor site and the latent splice donor site described herein in the nucleotide sequence, This provides a method that includes [something].

[0104] Vector / expression cassette A vector is a tool that enables or facilitates the transfer of an entity from one environment to another. According to the present invention, and as an example, some vectors used in recombinant nucleic acid technology enable entities such as nucleic acid segments (e.g., heterologous DNA segments, e.g., heterologous cDNA segments) to be transferred into target cells and expressed by those target cells. Vectors can facilitate the integration of nucleotide sequences encoding viral vector components and the nucleotide sequences encoding viral vector components in order to maintain their expression within target cells.

[0105] A vector may be or may include an expression cassette (also called an expression construct). An expression cassette as described herein includes a region of a transcribable nucleic acid-containing sequence. Therefore, sequences encoding mRNA, tRNA, and rRNA are included within this definition.

[0106] The vector may contain one or more select marker genes (e.g., a neomycin resistance gene) and / or (one or more) traceable marker genes (e.g., a gene encoding green fluorescent protein (GFP)). The vector may be used, for example, to infect and / or transduce target cells. The vector may further contain a nucleotide sequence that allows the vector to replicate in the host cell of the problem, for example, a conditionally replicating tumor cell-disintegrating vector.

[0107] The term "cassette" is synonymous with terms such as "conjugate," "construct," and "hybrid," and includes a polynucleotide sequence directly or indirectly bound to a promoter. An expression cassette for use in the present invention includes a promoter for the expression of a nucleotide sequence encoding a viral vector component, and may include a regulator of the nucleotide sequence encoding the viral vector component. Preferably, the cassette includes at least one polynucleotide sequence operably linked to the promoter.

[0108] The choice of expression cassette, such as plasmid, cosmid, virus, or phage vector, often depends on the host cell into which it is introduced. Expression cassettes can be DNA plasmids (supercoiled, nicked, or linear), minicircle DNA (linear or supercoiled), plasmid DNA containing only the region of interest after removal of the plasmid backbone by restriction enzyme digestion and purification, or DNA produced using an enzyme DNA amplification platform, such as doggybone DNA (dbDNA®) prepared so that the final DNA used is either in a closed ring form or has open breaks (e.g., restriction enzyme digestion).

[0109] Lentiviral vector production system and cells A lentiviral vector production system includes a set of nucleotide sequences that encode the components necessary for the production of a lentiviral vector. Therefore, a vector production system includes a set of nucleotide sequences that encode the viral vector components necessary for the production of lentiviral vector particles.

[0110] A "viral vector production system," "vector production system," or "production system" should be understood as a system containing the components necessary for lentiviral vector production.

[0111] In one embodiment, the viral vector production system includes Gag and Gag / Pol proteins, as well as nucleotide sequences encoding the Env protein and vector genome sequence. The production system may optionally include nucleotide sequences encoding the Rev protein or its functional substitutions.

[0112] In one embodiment, the viral vector production system includes a modular nucleic acid construct (modular construct). The modular construct is a DNA expression construct containing two or more nucleic acids used for the production of a lentiviral vector. The modular construct may be a DNA plasmid containing two or more nucleic acids used for the production of a lentiviral vector. The plasmid may be a bacterial plasmid. The nucleic acids may encode, for example, gag-pol, rev, env, or a vector genome. Furthermore, modular constructs designed for the preparation of packaging cell lines and producer cell lines may further require encoding transcriptional regulatory proteins (e.g., TetR, CymR) and / or translational repression proteins (e.g., TRAP) and selection markers (e.g., Zeocin®, hygromycin, blastosidine, puromycin, neomycin resistance genes). A modular construct suitable for use in the present invention is described in European Patent No. 3502260, which is incorporated herein by reference in its entirety.

[0113] Since the modular constructs for use according to the present invention contain nucleic acid sequences encoding two or more retroviral components in a single construct, the safety profile of these modular constructs has been considered, and further safety features have been directly incorporated into the constructs. These features include the use of insulators for multiple open reading frames of the retroviral vector components, as well as / or specific orientation and arrangement of retroviral genes in the modular constructs. It is believed that by using these features, direct read-through for generating replicable viral particles is prevented.

[0114] Nucleic acid sequences encoding viral vector components may have reverse and / or alternating transcription orientations in a modular construct. Therefore, nucleic acid sequences encoding viral vector components are not presented in the same 5'-to-3' direction, and as a result, viral vector components cannot be produced from the same mRNA molecule. Reverse orientation may mean that at least two coding sequences for different vector components are presented in "head-to-head" and "tail-to-tail" transcription orientations. This can be achieved by providing a coding sequence for one vector component on one strand of the modular construct, e.g., env, and a coding sequence for another vector component on the opposite strand, e.g., rev. Preferably, if coding sequences for three or more vector components are present in a modular construct, at least two of the coding sequences are present in reverse transcription orientation. Therefore, if coding sequences for three or more vector components are present in a modular construct, each component may be oriented such that it lies in the opposite 5'-to-3' direction to all (one or more) adjacent coding sequences of other adjacent vector components; i.e., alternating 5'-to-3' (or transcription) directions may be used for each coding sequence.

[0115] A modular construct for use according to the present invention may include nucleic acid sequences encoding two or more of the following vector components: gag-pol, rev, env, and vector genome. The modular construct may include nucleic acid sequences encoding any combination of the vector components. In one embodiment, the modular construct is as follows: i) RNA genomes and revs of retroviral vectors, or their functional substitutions; ii) RNA genomes and gag-pol of retroviral vectors; iii) Retroviral vectors and RNA genomes of env; iv) gag-pol and rev, or their functional substitutes; v) gag-pol and env; vi) env and rev, or their functional substitutes; vii) RNA genomes of retroviral vectors, rev or their functional substitutions, and gag-pol; viii) RNA genome of retroviral vectors, rev or its functional substitution, and env; ix) RNA genome, gag-pol and env of retroviral vectors; or x) gag-pol, rev, or their functional substitutes, and env, It may contain a nucleic acid sequence that codes for The nucleic acid sequence is reversed and / or alternating in orientation.

[0116] In one embodiment, cells for producing retroviral vectors may contain nucleic acid sequences encoding any one of the combinations i) to x) above, where the nucleic acid sequences are located at the same locus and are oriented in opposite and / or alternating directions. The same locus may refer to a single extrachromosomal locus within the cell, e.g., a single plasmid, or a single locus within the cell's genome (i.e., a single insertion site). The cells may be stable or transient cells for producing retroviral vectors, e.g., lentiviral vectors. In one embodiment, the cells do not contain tat.

[0117] DNA expression constructs may be DNA plasmids (supercoiled, nicked, or linear), minicircle DNA (linear or supercoiled), plasmid DNA containing only the region of interest after removal of the plasmid backbone by restriction enzyme digestion and purification, or DNA produced using an enzyme DNA amplification platform, such as doggybone DNA (dbDNA®) prepared so that the final DNA used is either in a closed ring form or has open breaks (e.g., restriction enzyme digestion).

[0118] In one embodiment, the lentiviral vector is derived from HIV-1, HIV-2, SIV, FIV, BIV, EIAV, CAEV, or visnarentivirus.

[0119] A “viral vector-producing cell,” “vector-producing cell,” or “producing cell” should be understood as a cell capable of producing a lentiviral vector or lentiviral vector particle. A lentiviral vector-producing cell may be a “producer cell” or “packaging cell.” One or more DNA constructs of the viral vector system may be stably incorporated into the viral vector-producing cell or maintained episomelly. Alternatively, all DNA components of the viral vector system may be transiently transfected into the viral vector-producing cell. In yet another alternative, a producing cell that stably expresses some of the components may be transiently transfected with the remaining components required for vector production.

[0120] As used herein, the term “packaging cell” refers to a cell that contains the elements necessary for the production of lentiviral vector particles but lacks a vector genome. Such a packaging cell may contain one or more expression cassettes capable of expressing viral structural proteins (e.g., gag, gag / pol, and env).

[0121] Producer cells / packaging cells can be any suitable cell type. Producer cells are generally mammalian cells, but could also be insect cells, for example.

[0122] As used herein, the terms “producer / producing cell” or “vector producing / producing cell” refer to a cell containing all the elements necessary for the production of lentiviral vector particles. Producer cells may be a stable producer cell line, or they may be transiently induced or stable packaging cells in which a retroviral genome is transiently expressed.

[0123] In the method of the present invention, if the viral vector is a lentiviral vector, the vector components may include gag, env, rev and / or the RNA genome of the lentiviral vector. The nucleotide sequences encoding the vector components can be introduced into cells simultaneously or sequentially in any order.

[0124] Vector-producing cells may be cells cultured in vitro, such as tissue culture cell lines. In some embodiments of the methods and uses of the present invention, suitable producing cells or cells for producing lentiviral vectors are cells that can produce viral vectors or viral vector particles when cultured under suitable conditions. Thus, the cells typically contain nucleotide sequences encoding vector components, which may include gag, env, rev, and the RNA genome of the lentiviral vector. Suitable cell lines include, but are not limited to, mammalian cells such as mouse fibroblast-derived cell lines or human cell lines. They are generally mammalian cells, such as human cells, e.g., HEK293T, HEK293, CAP, CAP-T, or CHO cells, but may also be insect cells, such as SF9 cells. Preferably, the vector-producing cells are derived from human cell lines. Thus, such suitable producing cells may be used in either the methods or uses of the present invention.

[0125] Methods for introducing nucleotide sequences into cells are well known in the art and have been previously described. Therefore, the introduction of nucleotide sequences encoding vector components, including gag, env, rev, and RNA genomes of lentiviral vectors, into cells using conventional techniques in molecular biology and cell biology is within the scope of the skills of those skilled in the art.

[0126] Stable producing cells can be packaging or producer cells. To produce producer cells from packaging cells, a vector genomic DNA construct can be introduced stably or transiently. Packaging / producer cells can be produced by transduction of a retroviral vector expressing one of the vector components, namely the genome, gag-pol component, and envelope, into a suitable cell line, as described in International Publication No. 2004 / 022761.

[0127] Alternatively, nucleotide sequences can be transfected into cells, and then integration into the producing cell genome occurs rarely and randomly. Transfection methods can be carried out using methods well known in the art. For example, a stable transfection process may use constructs engineered to facilitate concatemerization. In another example, the transfection process can be carried out using calcium phosphate or commercially available formulations such as Lipofectamine® 2000CD (Invitrogen, CA), FuGENE® HD, or polyethyleneimine (PEI). Alternatively, nucleotide sequences can be introduced into producing cells via electroporation. Those skilled in the art will be aware of methods to facilitate the integration of nucleotide sequences into producing cells. For example, linearizing the nucleic acid construct may be helpful if it is naturally circular. Less random integration methodologies may include nucleic acid constructs containing shared regions homologous to endogenous chromosomes of mammalian host cells to induce integration into selected sites within the endogenous genome. Furthermore, if recombination sites are present on the construct, they can be used for targeted recombination. For example, a nucleic acid construct may include a loxP site that enables targeted integration when combined with Cre recombinase (i.e., using a Cre / lox system derived from a P1 bacteriophage). Alternatively, or in addition, the recombination site may be an att site (e.g., from a lambda phage) that enables site-specific integration in the presence of lambda integrase. This makes it possible to target lentiviral genes to loci in the host cell genome that enable high and / or stable expression.

[0128] Other methods of targeted integration are well known in the art. For example, targeted recombination at selected chromosomal loci can be promoted by using methods that induce targeted breaks in genomic DNA. These methods often involve the use of methods or systems to induce double-strand breaks (DSBs), e.g., nicks in the endogenous genome, to induce repair of the breaks by physiological mechanisms such as non-homologous end joining (NHEJ). Breaks can be caused by the use of specific nucleases such as engineered zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs), the use of a CRISPR / Cas9 system with an engineered crRNA / tracr RNA ("single guide RNA") to guide specific breaks, and / or the use of Argonaut system-based nucleases (e.g., from T. thermophilus).

[0129] Packaging / producer cell lines can be prepared by nucleotide sequence integration using lentiviral transduction alone, nucleic acid transfection alone, or a combination of both.

[0130] A method for producing retroviral vectors from cells, particularly for processing retroviral vectors, is described in International Publication No. 2009 / 153563.

[0131] In one embodiment, the producing cells may contain RNA-binding proteins (e.g., tryptophan RNA-binding attenuation protein, TRAP) and / or Tet inhibitor (TetR) proteins or alternative regulatory proteins (e.g., CymR).

[0132] The production of lentiviral vectors from producing cells may be by transfection, by production from stable cell lines which may include an induction step (e.g., doxycycline induction), or by a combination of both. The transfection method can be carried out using methods well known in the art, examples of which have been previously described.

[0133] The cell number, virus number, and / or viral titer are increased by culturing a packaging cell line or producer cell line, or producing cells transiently transfected with a component encoding a lentiviral vector. The cell culture is performed to enable the cells to metabolize and / or grow and / or divide and / or produce the viral vector of the present invention. This can be achieved by methods well known to those skilled in the art, including, for example, providing nutrients to the cells in a suitable culture medium. The methods may include surface-adherent growth, growth in suspension, or a combination thereof. The culture can be performed in tissue culture flasks, tissue culture multiwell plates, dishes, roller bottles, wave bags, or bioreactors, for example, using batch, fed-batch, or continuous systems. In order to achieve large-scale production of viral vectors by cell culture, it is preferable in the art to have cells that can grow in suspension. The optimal conditions for culturing cells are well known (see, for example, Tissue Culture, Academic Press, Kruse and Paterson, editors (1973), and RIFreshney, Culture of animal cells: A manual of basic technique, fourth edition (Wiley-Liss Inc., 2000, ISBN 0-471-34889-9)).

[0134] Preferably, the cells are first "bulked up" in a tissue culture flask or bioreactor, and then grown in a multi-layer culture vessel or large bioreactor (over 50 L) to produce vector-producing cells for use in the present invention.

[0135] Preferably, the cells are grown in suspension mode to produce vector-producing cells for use in the present invention.

[0136] lentiviral vectors Lentiviruses are part of a larger group of retroviruses. A detailed list of lentiviruses can be found in Coffin et al (1997) "Retroviruses" (Cold Spring Harbour Laboratory Press Eds: JM Coffin, SM Hughes, HE Varmus pp 758-763). Briefly, lentiviruses can be divided into primate and non-primate groups. Examples of primate lentiviruses include, but are not limited to, human immunodeficiency virus (HIV), the causative agent of human autoimmune deficiency syndrome (AIDS), and simian immunodeficiency virus (SIV). The non-primate lentivirus group includes the prototype "slow virus" Visna-Maedivirus (VMV), as well as related canine arthritis encephalitis virus (CAEV), equine infectious anemia virus (EIAV), feline immunodeficiency virus (FIV), Maedivisna virus (MVV), and bovine immunodeficiency virus (BIV). In one embodiment, the lentiviral vector is derived from HIV-1, HIV-2, SIV, FIV, BIV, EIAV, CAEV, or visnarentivirus.

[0137] Lentiviridae distinguish lentiviruses from retroviruses in that they have the ability to infect both dividing and non-dividing cells (Lewis et al (1992) EMBO J 11(8):3053-3058 and Lewis and Emerman (1994) J Virol 68(1):510-516). In contrast, other retroviruses such as MLV cannot infect non-dividing cells or slowly dividing cells, such as those that make up muscle, brain, lung, and liver tissue.

[0138] A lentiviral vector, as used herein, is a vector comprising at least one component moiety that can be derived from a lentivirus. Preferably, the component moiety is involved in the biological mechanism by which the vector infects or transduces target cells and expresses NOI.

[0139] Lentiviral vectors can be used to replicate NOIs in vitro in compatible target cells. Accordingly, this specification describes a method for producing the protein in vitro by introducing the vector of the present invention into compatible target cells in vitro and growing the target cells under conditions that result in NOI expression. The protein and NOI can be recovered from the target cells by methods well known in the art. Suitable target cells include mammalian cell lines and other eukaryotic cell lines.

[0140] In some embodiments, the vector may have an "insulator" gene sequence that acts as a barrier, blocking the interaction between the promoter and enhancer and reducing read-through from adjacent genes.

[0141] In one embodiment, an insulator is present between one or more lentiviral nucleic acid sequences to prevent promoter interference and read-through from adjacent genes. When an insulator is present in the vector between one or more lentiviral nucleic acid sequences, each of these insulated genes may be arranged as an individual expression unit.

[0142] The basic structure of retroviral and lentiviral genomes shares many common features, such as packaging signals that enable genome packaging, primer binding sites, integration sites that enable integration into the target cell genome, and 5'LTR and 3'LTR located between or within the gag / pol and env genes (which are polypeptides necessary for the assembly of viral particles) that encode packaging components. Lentiviruses have further features, such as the rev gene and RRE sequence in HIV, which enable the efficient transport of the RNA transcript of the integrated provirus from the nucleus to the cytoplasm of the infected target cell.

[0143] In proviruses, these genes are flanked at both ends by regions called long terminal repeats (LTRs). LTRs are responsible for provirus integration and transcription. LTRs also function as enhancer-promoter sequences, which can regulate the expression of viral genes.

[0144] The LTR itself is an identical sequence that can be divided into three elements called U3, R, and U5. U3 originates from a sequence specific to the 3' end of the RNA. R originates from a sequence repeated at both ends of the RNA, and U5 originates from a sequence specific to the 5' end of the RNA. The sizes of the three elements can vary considerably among different retroviruses.

[0145] In the typical lentiviral vectors described herein, at least a portion of one or more protein-coding regions essential for replication can be removed from the virus; for example, gag / pol and env may be absent or non-functional. This results in a defect in viral vector replication.

[0146] Lentiviral vectors may originate from either primate lentiviruses (e.g., HIV-1) or non-primate lentiviruses (e.g., EIAV).

[0147] Generally speaking, a typical retroviral vector production system involves the isolation of the viral genome from essential viral packaging functions. These viral vector components are typically supplied to the producing cells on a separate DNA expression cassette (or known as a plasmid, expression plasmid, DNA construct, or expression construct).

[0148] The vector genome contains an NOI. The vector genome typically requires a packaging signal (ψ), an internal expression cassette containing an NOI, (occasionally) a post-transcription element (PRE), typically a central polyprint lactucle (cppt), 3'-ppu, and a self-inactivating (SIN)LTR. The R-U5 region is necessary for the correct polyadenylation of both the vector genomic RNA and NOI mRNA, as well as the reverse transcription process. The vector genome may include an open reading frame that enables vector production in the absence of rev, as described in International Publication No. 2003 / 064665.

[0149] The packaging function includes the gag / pol and env genes. These are necessary for the production of vector particles by the producing cells. By providing these functions in trans to the genome, the production of replication-deficient viral vectors is facilitated.

[0150] Gamma retroviral vector production systems are typically three-component systems requiring genome, gag / pol, and env expression constructs. HIV-1-based lentiviral vector production systems may further require the provision of an accessory gene, rev, and that the vector genome contain a rev response element (RRE). EIAV-based lentiviral vectors do not require rev to be provided in trans if an open reading frame (ORF) is present in the genome (see International Publication 2003 / 064665).

[0151] Typically, both the "external" promoters (which drive the vector genome cassette) and the "internal" promoters (which drive the NOI cassette), encoded within a vector genome cassette, are potent eukaryotic or viral promoters, similar to those that drive other vector system components. Examples of such promoters include CMV, EF1α, PGK, CAG, TK, SV40, and the ubiquitin promoter. Potent "synthetic" promoters (e.g., the JeT promoter), such as those generated by DNA libraries, can also be used to drive transcription. Alternatively, tissue-specific promoters, such as rhodopsin (Rho), rhodopsin kinase (RhoK), cone rod homeobox-containing gene (CRX), neuroretinal-specific leucine zipper protein (NRL), vitiligo macular degeneration 2 (VMD2), tyrosine hydroxylase, neuron-specific neuron-specific enolase (NSE) promoter, astrolytic collagen fiber acid protein (GFAP) promoter, human α1-antitrypsin (hAAT) promoter, phosphoenolpyruvate carboxykinase (PEPCK), and liver fatty acid-binding protein. Transfer can be driven using the following promoters: chlorine promoter, Flt-1 promoter, INF-β promoter, Mb promoter, SP-B promoter, SYN1 promoter, WASP promoter, SV40 / hAlb promoter, SV40 / CD43, SV40 / CD45, NSE / RU5' promoter, ICAM-2 promoter, GPIIb promoter, GFAP promoter, fibronectin promoter, endoglin promoter, elastase-1 promoter, desmin promoter, CD68 promoter, CD14 promoter, and B29 promoter.

[0152] The production of retroviral vectors includes transient cotransfection of producing cells with these DNA components, or the use of stable producing cell lines in which all components are stably integrated into the producing cell genome (e.g., Stewart HJ, Fong-Wong L, Strickland I, Chipchase D, Kelleher M, Stevenson L, Thoree V, McCarthy J, Ralph GS, Mitrophanous KA and Radcliffe PA. (2011). Hum Gene Ther. March;22(3):357-69). Another approach is to use stable packaging cells (in which the packaging components are stably integrated) and then transiently transfect them with vector genome plasmids as needed (e.g., Stewart, HJ, MALeroux-Carlucci, CJSion, KA Mitrophanous and PARadcliffe (2009). Gene Ther. June;16(6):805-14). It is also possible to create incomplete alternative packaging cell lines (in which only one or two packaging components are stably incorporated into the cell line) and transiently transfect the missing component to produce a vector. Producing cells may also express regulatory proteins such as members of the tet repressor (TetR) protein group of transcription factors (e.g., T-Rex, Tet-On, and Tet-Off), members of the Kumate-inducible switch system group of transcription factors (e.g., Kumat repressor (CymR) proteins), or RNA-binding proteins (e.g., TRAP-tryptophan-activated RNA-binding protein).

[0153] In one embodiment of the present invention, the viral vector is derived from EIAV. EIAV has the simplest genomic structure of a lentivirus and is particularly preferred for use in the present invention. In addition to the gag / pol and env genes, EIAV encodes three other genes, tat, rev, and S2. Tat acts as a transcriptional activator of the viral LTR (Derse and Newbold (1993) Virology 194(2):530-536 and Maury et al (1994) Virology 200(2):632-642), and rev regulates and modulates viral gene expression via the rev response element (RRE) (Martarano et al. (1994) J Virol 68(5):3102-3111). The mechanisms of action of these two proteins are thought to be broadly similar to similar mechanisms in primate viruses (Martarano et al. (1994) J Virol 68(5):3102-3111). The function of S2 is unknown. Furthermore, an EIAV protein, Ttm, has been identified, encoded by the first exon of tat, which is spliced ​​into the env coding sequence at the initiation of the transmembrane protein. In an alternative embodiment of the present invention, the viral vector is derived from HIV. HIV does not encode S2, but unlike EIAV, it encodes vif, vpr, vpu, and nef.

[0154] The term "recombinant retroviral vector or lentiviral vector (RRV)" refers to a vector containing sufficient retroviral genetic information to enable the packaging of an RNA genome into a viral particle that can transduce target cells in the presence of a packaging component. Transduction of target cells may involve reverse transcription and integration into the target cell genome. RRVs carry nonviral coding sequences that are delivered to target cells by the vector. RRVs cannot replicate independently and cannot produce infectious retroviral particles within target cells. Typically, RRVs lack functional gag / pol and / or env genes, as well as other genes essential for replication.

[0155] Preferably, the RRV vector of the present invention has the smallest viral genome.

[0156] As used herein, the term “minimal viral genome” means that a viral vector has been engineered to remove non-essential elements while retaining essential elements that provide the necessary functions for infecting, transducing, and delivering NOI to target cells. Further details of this strategy can be found in International Publication No. 1998 / 17815 and International Publication No. 99 / 32646. Minimal EIAV vectors lack the tat, rev, and S2 genes, which are not provided in trans in the production system. Minimal HIV vectors lack vif, vpr, vpu, tat, and nef.

[0157] The expression plasmid used to produce the vector genome in the producing cell may contain transcriptional regulatory sequences operably linked to the retroviral genome to direct the transcription of the genome in the producing / packaging cell. All third-generation lentiviral vectors have a deletion in the 5'U3 enhancer-promoter region, and the transcription of the vector genomic RNA is driven by another viral promoter, such as a heterologous promoter like the CMV promoter, as described later. This feature enables vector production independently of tat. Some lentiviral vector genomes require additional sequences for efficient virus production. For example, in the case of HIV in particular, this may include RRE sequences. However, the need for RRE for the (separate) GagPol cassette (and the dependence on the rev provided in trans) can be reduced or eliminated by codon optimization of the GagPol ORF. Further details of this strategy can be found in International Publication 2001 / 79518.

[0158] Other sequences that perform the same function as the rev / RRE system are also known. For example, a functional analogue of the rev / RRE system is found in Mason-Pfizer monkey virus. This is known as a constitutive transport element (CTE) and contains an RRE-type sequence in the genome that is thought to interact with factors in infected cells. Cellular factors can be considered rev analogues. Therefore, CTEs can be used as an alternative to the rev / RRE system. Any other functional equivalents of the Rev protein that are known or will become available may be relevant to the present invention. For example, it is known that the Rex protein of HTLV-I can functionally substitute for the Rev protein of HIV-1. Rev and RRE may not be present in the vector for use in the method of the present invention, or may be non-functional, and alternative rev and RRE, or functionally equivalent systems, may exist.

[0159] As used herein, the term “functional substitute” means a protein or sequence that has an alternative sequence that performs the same function as another protein or sequence. The term “functional substitute” is used herein interchangeably with “functional equivalent” and “functional analogue” for the same meaning.

[0160] SIN Vector The lentiviral vectors described herein may be used in a self-inactivating (SIN) configuration in which viral enhancer and promoter sequences are deleted. SIN vectors can be constructed and transduced into non-dividing target cells in vivo, ex vivo, or in vitro with efficacy similar to that of non-SIN vectors. Transcriptional inactivation of long terminal repeat sequences (LTRs) in SIN proviruses should prevent vRNA recruitment and further reduce the likelihood of replication-capable virus formation. This should also allow for regulated gene expression from the internal promoter by eliminating the cis-effect of any LTR.

[0161] As an example, self-inactivating retroviral vector systems are constructed by deleting transcriptional enhancers or enhancer-promoters within the U3 region of the 3'LTR. After a series of vector reverse transcriptions and incorporations, these changes are copied to both the 5'LTR and 3'LTR, producing transcriptionally inactive proviruses. However, any (one or more) promoters within the LTR in such vectors remain transcriptionally active. This strategy is used to eliminate the influence of enhancers and promoters of the viral LTR on transcription from genes located within it. Such effects include increased or suppressed transcription. This strategy can also be used to eliminate downstream transcription from the 3'LTR to genomic DNA. This is of particular concern in human gene therapy, where preventing accidental activation of endogenous oncogenes is critical. Yu et al., (1986) PNAS 83:3194-98; Marty et al., (1990) Biochimie 72:885-7; Naviaux et al., (1996) J. Virol. 70:5701-5; Iwakuma et al., (1999) Virol. 261:120-32; Deglon et al., (2000) Human Gene Therapy 11:179-90. The SIN lentiviral vector is described in U.S. Patent Nos. 6,924,123 and 7,056,699.

[0162] Replication-deficient lentiviral vector In the genome of a replication-deficient lentiviral vector, the gag / pol and / or env sequences may be mutated and / or non-functional.

[0163] In typical lentiviral vectors described herein, at least a portion of the coding regions of one or more proteins essential for viral replication can be removed from the vector. This results in a loss of viral vector replication. A portion of the viral genome can also be replaced with an NOI to create a vector containing an NOI that can be transduced into non-dividing target cells and / or its genome can be incorporated into the target cell genome.

[0164] In one embodiment, the lentiviral vector is a non-embedded vector as described in International Publication No. 2006 / 010834 and International Publication No. 2007 / 071994.

[0165] In further embodiments, the vector has the ability to deliver sequences that are absent or lacking viral RNA. In further embodiments, heterologous binding domains (heterologous to gag) located on the delivered RNA and homologous binding domains on Gag or GagPol can be used to ensure packaging of the delivered RNA. Both of these vectors are described in International Publication No. 2007 / 072056.

[0166] NOI and polynucleotides The polynucleotides of the present invention may include DNA or RNA. They may be single-stranded or double-stranded. It will be understood by those skilled in the art that numerous different polynucleotides may encode the same polypeptide as a result of the degeneracy of the genetic code. Furthermore, it will be understood that, using routine techniques, nucleotide substitutions that do not affect the polypeptide sequence encoded by the polynucleotides of the present invention can be made to reflect the codon usage frequency of any particular host organism in which the polypeptide of the present invention is expressed.

[0167] Polynucleotides can be modified by any method available in the art. Such modifications may be made to enhance the in vivo activity or lifetime of the polynucleotides of the present invention.

[0168] Polynucleotides, such as DNA polynucleotides, can be prepared recombinantly, synthetically, or by any means available to those skilled in the art. They can also be cloned by standard techniques.

[0169] Longer polynucleotides will generally be produced using recombinant methods, for example, polymerase chain reaction (PCR) cloning techniques. This involves producing a primer pair (e.g., about 15-30 nucleotides) adjacent to the target sequence to be cloned; contacting the primers with mRNA or cDNA obtained from animal or human cells; performing PCR under conditions that result in amplification of the desired region; isolating the amplified fragment (e.g., by purifying the reaction mixture on an agarose gel); and recovering the amplified DNA. The primers may be designed to include appropriate restriction enzyme recognition sites to clone the amplified DNA into a suitable vector.

[0170] Common retrovirus vector elements Promoter and enhancer NOI and polynucleotide expression can be controlled using transcriptional or translational repressors, including regulatory sequences such as promoters, enhancers, and other expression regulatory signals (e.g., the tet repressor (TetR) system), or transgene repression in vector-producing cell lines (TRiPs) or other modulo adrenal

[0171] Functional prokaryotic promoters and promoters can be used in eukaryotic cells. Tissue-specific or stimulus-specific promoters may be used. Chimeric promoters containing sequence elements derived from two or more different promoters may also be used.

[0172] Appropriate promotion sequences are potent promoters, including those derived from the genomes of viruses such as polyomavirus, adenovirus, fowlpox virus, bovine papillomavirus, aerosarcoma virus, cytomegalovirus (CMV), retroviruses, and Simian virus 40 (SV40), or those derived from heterologous mammalian promoters such as actin promoter, EF1α, CAG, TK, SV40, ubiquitin, PGK, or ribosomal protein promoters. Alternatively, tissue-specific promoters, such as rhodopsin (Rho), rhodopsin kinase (RhoK), cone rod homeobox-containing gene (CRX), neuroretinal-specific leucine zipper protein (NRL), vitiligo macular degeneration 2 (VMD2), tyrosine hydroxylase, neuron-specific neuron-specific enolase (NSE) promoter, astrolytic collagen fiber acid protein (GFAP) promoter, human α1-antitrypsin (hAAT) promoter, phosphoenolpyruvate carboxykinase (PEPCK), and liver fatty acid-binding protein. Transfer can be driven using the following promoters: chlorine promoter, Flt-1 promoter, INF-β promoter, Mb promoter, SP-B promoter, SYN1 promoter, WASP promoter, SV40 / hAlb promoter, SV40 / CD43, SV40 / CD45, NSE / RU5' promoter, ICAM-2 promoter, GPIIb promoter, GFAP promoter, fibronectin promoter, endoglin promoter, elastase-1 promoter, desmin promoter, CD68 promoter, CD14 promoter, and B29 promoter.

[0173] NOI transcription can be further increased by inserting enhancer sequences into the vector. While the enhancers are relatively orientation and position independent, eukaryotic virus-derived enhancers such as SV40 enhancer and CMV early promoter enhancer may be used. The enhancer can be spliced ​​into the vector at a 5' or 3' position relative to the promoter, but is preferably located 5' from the promoter.

[0174] The promoter may further include features to ensure or increase expression in appropriate target cells. For example, features may be conserved regions, such as the Pribno box or TATA box. The promoter may include other sequences that affect (e.g., maintain, enhance, or decrease) the expression level of the nucleotide sequence. Suitable other sequences include the Sh1-intron or ADH intron. Other sequences may include inductive elements such as temperature, chemical, light, or stress-inducible elements. There may also be suitable elements to enhance transcription or translation.

[0175] NOI Regulator A complex factor in the generation of retroviral packaging / producer cell lines and retroviral vector production is that the constitutive expression of certain retroviral vector components and NOIs is cytotoxic, leading to the death of cells expressing these components and thus preventing vector production. Therefore, the expression of these components (e.g., gag-pol and envelope proteins, e.g., VSV-G) can be regulated. The expression of other non-cytotoxic vector components, e.g., rev, can also be regulated to minimize the metabolic burden on cells. The modular constructs and / or cells described herein may include cytotoxic and / or non-cytotoxic vector components associated with at least one regulatory element. As used herein, the term “regulatory element” refers to any element that can be increased or decreased in relation to the expression of a relevant gene or protein. Regulatory elements include gene switch systems, transcriptional regulators, and translational repressors.

[0176] Numerous prokaryotic regulatory systems have been adapted to generate gene switches in mammalian cells. Many retroviral packaging and producer cell lines are regulated using gene switch systems (e.g., tetracycline and chmate-inducible switch systems), and thus the expression of one or more retroviral vector components can be turned on during vector production. Gene switch systems include those involving transcription factor (TetR) proteins (e.g., T-Rex, Tet-On, and Tet-Off), those involving transcription factor chmate-inducible switch systems (e.g., CymR proteins), and those involving RNA-binding proteins (e.g., TRAP).

[0177] One such tetracycline-inducible system is the tetracycline repressor (TetR) system based on the T-REx® system. For example, in such a system, the tetracycline operator (TetO2) is positioned such that its first nucleotide is 10 bp from the 3' end of the last nucleotide of the TATATAA element of the human cytomegalovirus major pre-early promoter (hCMVp), and then TetR can act as a repressor on its own (Yao F, Svensjo T, Winkler T, Lu M, Eriksson C, Eriksson E. Tetracycline repressor, tetR, rather than the tetR-mammalian cell transcription factor fusion derivatives, regulates inducible gene expression in mammalian cells. 1998. Hum Gene Ther; 9: 1939-1950). In such a system, NOI expression can be controlled by a CMV promoter in which two copies of the TetO2 sequence are inserted in tandem. The TetR homodimer, in the absence of an inducer (tetracycline or its analog doxycycline [dox]), binds to the TetO2 sequence and physically blocks transcription from the upstream CMV promoter. In the presence of the inducer, it binds to the TetR homodimer, causing an allosteric change that prevents it from binding to the TetO2 sequence, resulting in gene expression. The TetR gene can be codon-optimized to improve translation efficiency and potentially lead to tighter control of TetO2 regulatory gene expression.

[0178] The TRiP system, described in International Publication No. 2015 / 092440, provides an alternative method for suppressing NOI expression in producing cells during vector production. TRAP-binding sequence (e.g., TRAP-tbs) interactions form the basis of transgene protein suppression systems for retroviral vector production, particularly when it is desirable for constitutive and / or potent promoters, including tissue-specific promoters, to drive the transgene, especially when the expression of the transgene protein in producing cells results in a decrease in vector titer and / or induces an immune response in vivo due to viral vector delivery of the transgene-derived protein (Maunder et al, Nat Commun. (2017) Mar 27;8).

[0179] In short, the TRAP-tbs interaction forms a translation block and represses the translation of the transgene protein (Maunder et al, Nat Commun. (2017) Mar 27;8). The translation block is effective only in producing cells and therefore does not interfere with DNA or RNA-based vector systems. The TRiP system can repress translation when the transgene protein is expressed from constitutive and / or potent promoters, including tissue-specific promoters derived from one or more cistronic mRNAs. Unregulated expression of the transgene protein has been shown to reduce the vector titer and affect the quality of the vector product. Repression of the transgene protein for both transient and stable PaCL / PCL vector production systems is beneficial to producing cells to prevent a decrease in vector titer, where toxicity or molecular weight issues may lead to cellular stress, the transgene protein may induce an immune response in vivo due to viral vector delivery of the transgene-derived protein, the use of gene-edited transgenes may result in on / off targeted effects, and the transgene protein may affect the elimination of the vector and / or envelope glycoprotein.

[0180] Envelope and pseudotyping In one preferred embodiment, the lentiviral vectors described herein are pseudotyped. In this regard, pseudotyping can provide one or more advantages. For example, the env gene product of an HIV-based vector would restrict these vectors to infecting only cells that express a protein called CD4. However, if the env gene in these vectors is replaced with an env sequence derived from another enveloped virus, they may have a broader infection spectrum (Verma and Somia (1997) Nature 389(6648):239-242). As an example, the researchers pseudotyped an HIV-based vector having a glycoprotein derived from VSV (Verma and Somia (1997) Nature 389(6648):239-242).

[0181] Alternatively, the Env protein may be a modified Env protein, such as a mutant Env protein or an engineered Env protein. Modifications may be made or selected to introduce targeting ability, reduce toxicity, or for other purposes (Valsesia-Wittman et al 1996 J Virol 70:2056-64; Nilson et al (1996) Gene Ther 3(4):280-286; and Fielding et al (1998) Blood 91(5):1802-1809 and references cited therein).

[0182] The vector can be pseudotyped with any selected molecule.

[0183] As used herein, "env" means the endogenous lentiviral envelope or heterologous envelope as described herein.

[0184] VSV-G The envelope glycoprotein (G) of the rhabdovirus vesicular stomatitis virus (VSV) is an envelope protein that has been shown to be capable of pseudotyping specific enveloped viruses and viral vector virions.

[0185] The ability of pseudotyped MoMLV-based retroviral vectors in the absence of retroviral envelope proteins was first demonstrated by Emi et al. (1991) Journal of Virology 65:1202-1207. International Publication No. 1994 / 294440 teaches that retroviral vectors can be successfully pseudotyped with VSV-G. These pseudotyped VSV-G vectors can be used to transduce a wide range of mammalian cells. More recently, Abe et al. (1998) J Virol 72(8)6356-6361 teaches that non-infectious retroviral particles can be made infectious by the addition of VSV-G.

[0186] Burns et al. (1993) Proc. Natl. Acad. Sci. USA 90:8033-7 successfully pseudotyped the retrovirus MLV containing VSV-G, resulting in a vector with a modified host range compared to its native MLV. VSV-G pseudotyped vectors have been shown to infect not only mammalian cells but also cell lines derived from fish, reptiles, and insects (Burns et al. (1993) ibid). They have also been shown to be more efficient than conventional amphotropic envelopes for various cell lines (Yee et al., (1994) Proc. Natl. Acad. Sci. USA 91:9564-9568, Emi et al. (1991) Journal of Virology 65:1202-1207). The VSV-G protein can be used to pseudotype specific retroviruses because its cytoplasmic tail can interact with the retroviral core.

[0187] Providing non-retroviral pseudotyping envelopes such as the VSV-G protein offers the advantage of enriching vector particles to high titers without losing infectivity (Akkina et al. (1996) J. Virol. 70:2581-5). Retroviral envelope proteins, likely consisting of two non-covalently linked subunits, are clearly unable to withstand the shear forces during ultracentrifugation. Interactions between subunits can be disrupted by centrifugation. In comparison, the VSV glycoprotein is composed of a single unit. Therefore, VSV-G protein pseudotyping can offer potential advantages both in efficient target cell infection / transduction and during the manufacturing process.

[0188] International Publication No. 2000 / 52188 describes the construction of a pseudotyped retroviral vector from a stable producer cell line containing the vesicular stomatitis virus-G protein (VSV-G) as a membrane-bound viral envelope protein, and provides the gene sequence of the VSV-G protein.

[0189] Ross River Virus Ross River virus envelopes have been used to pseudotype non-primate lentiviral vectors (FIV), primarily transducing the liver after systemic administration (Kang et al., 2002, J. Virol., 76:9378-9388). The efficiency was reported to be 20 times greater than that obtained with VSV-G pseudotyped vectors, and it caused less cytotoxicity, as measured by serum levels of liver enzymes suggestive of hepatotoxicity.

[0190] Baculovirus GP64 The baculovirus GP64 protein has been shown to be a viable alternative to VSV-G for the large-scale production of high-titer viruses required for clinical and commercial applications (Kumar M, Bradow BP, Zimmerberg J (2003) Hum Gene Ther. 14(1):67-77). Compared to VSV-G pseudotyped vectors, GP64 pseudotyped vectors have similar broad affinity and similar native titers. Since GP64 expression does not kill cells, HEK293T cell lines constitutively expressing GP64 can be constructed.

[0191] Alternative envelope Other envelopes that provide a reasonable titer when used with pseudotyped EIAV include Mocola, rabies, Ebola, and LCMV (lymphocytic choriomeningitis virus). Intravenous injection of pseudotyped lentiviruses with 4070A into mice resulted in maximum gene expression in the liver.

[0192] Packaging sequence When used in the context of this invention, the terms “packaging signal,” interchangeably referred to as “packaging sequence” or “psi,” are used to refer to a non-coding sequence necessary for capsid formation of the retroviral RNA chain during viral particle formation. In HIV-1, this sequence maps to a locus extending from upstream of the major splice donor site (SD) to at least the gag start codon (which may include part or all of the 5' sequence to nucleotide 688 of gag). In EIAV, the packaging signal includes the R region to the 5' coding region of Gag.

[0193] As used herein, the terms “elongation packaging signal” or “elongation packaging sequence” refer to the use of sequences around the psi sequence that further elongates within the gag gene. Including these additional packaging sequences can increase the efficiency of vector RNA insertion into the viral particle.

[0194] The determinants of feline immunodeficiency virus (FIV) RNA capsid formation have been shown to be distinct and discontinuous, comprising one region (R-U5) at the 5' end of the genomic mRNA and the other region mapped within 311 nt proximal to the gag (Kaye et al., J Virol. Oct;69(10):6588-92(1995).

[0195] Internal ribosome entry site (IRES) Insertion of IRES elements enables the expression of multiple coding regions from a single promoter (Adam et al (as above); Koo et al (1992) Virology 186:669-675; Chen et al 1993 J. Virol 67:2142-2148). IRES elements were first found at the untranslated 5' end of picornaviruses, which promote cap-independent translation of viral proteins (Jang et al (1990) Enzyme 44:292-309). When located between open reading frames in RNA, IRES elements enable efficient translation of downstream open reading frames by promoting ribosome entry at the IRES element, followed by downstream translation initiation.

[0196] A review article on IRES was presented by Mountford and Smith (TIG May 1995 vol 11, No 5:179-184). Numerous different IRES sequences are known, including those derived from encephalomyocarditis virus (EMCV) (Ghattas, IR, et al., Mol. Cell. Biol., 11:5848-5859 (1991); BiP protein [Macejak and Sarnow, Nature 353:91 (1991)]; the Antennapedia gene of Drosophila (exons d and e) [Oh, et al., Genes & Development, 6:1643-1653 (1992)] and poliovirus (PV) [Pelletier and Sonenberg, Nature 334:320-325 (1988); Mountford and Smith, TIG 11, 179-184 (1985)].

[0197] IRES elements derived from PV, EMCV, and porcine bullous disease virus have long been used in retroviral vectors (Coffin et al., see above).

[0198] The term "IRES" includes any sequence or combination of sequences that function as an IRES or improve the function of an IRES. An IRES (one or more) may be of viral origin (e.g., EMCV IRES, PV IRES, or FMDV 2A-like sequences) or of cellular origin (e.g., FGF2 IRES, NRF IRES, Notch 2 IRES, or EIF4 IRES).

[0199] In order for the IRES to initiate translation of each polynucleotide, the IRES should be placed between or before polynucleotides in the module construct.

[0200] Nucleotide sequences used for developing stable cell lines require the addition of selection markers to select cells in which stable integration has occurred. These selection markers can be expressed as a single transcription unit within the nucleotide sequence, or it may be preferable to initiate translation of the selection marker with a polycistronic message using an IRES element (Adam et al 1991 J.Virol.65,4985).

[0201] Gene orientation and insulators It is well known that nucleic acids are directional, and this ultimately affects mechanisms such as transcription and replication in cells. Therefore, genes, when part of the same nucleic acid construct, can have relative orientations to each other.

[0202] In certain embodiments of the present invention, at least two nucleic acid sequences present at the same locus in a cell or construct may be oriented in opposite and / or alternating directions. In other words, in certain embodiments of the present invention at this particular locus, a pair of consecutive genes do not have the same orientation. This may help prevent both transcriptional and translational read-through when the regions are expressed within the same physical location in the host cell.

[0203] Having alternating orientations benefits retroviral vector production when the nucleic acids required for vector production are based on the same gene locus within the cell. This can also improve the safety of the resulting construct by preventing the creation of replicable retroviral vectors.

[0204] When nucleic acid sequences are oriented in opposite and / or alternating directions, the use of an insulator can prevent inappropriate expression or silencing of NOIs from the surrounding genetic material.

[0205] The term "insulator" refers to a class of DNA sequence elements that, when bound to an insulator-binding protein, have the ability to protect genes from surrounding regulatory signals. Two types of insulators exist: enhancer-blocking and chromatin barrier functions. When an insulator is located between a promoter and an enhancer, the enhancer-blocking function of the insulator shields the promoter from the enhancer's transcriptional promotion effect (Geyer and Corces 1992; Kellum and Schedl 1992). Chromatin barrier insulators function by preventing the progression of nearby condensed chromatin, resulting in transcriptionally active chromatin regions replacing transcriptionally inactive chromatin regions, thus leading to gene expression silencing. Insulators that inhibit heterochromatin diffusion, and therefore gene silencing, prevent this process by recruiting enzymes involved in histone modification (Yang J, Corces VG. 2011; 110: 43-76; Huang, Li et al. 2007; Dhillon, Raab et al. 2009). Insulators can possess one or both of these functions, and chicken β-globin insulator (cHS4) is one such example. This insulator is the most widely studied vertebrate insulator, is very rich in G+C, and possesses both enhancer-blocking and heterochromatic barrier functions (Chung JH, Whitely M, Felsenfeld G. Cell. 1993;74:505-514). Other such insulators with enhancer-blocking functions include, but are not limited to, human β-globin insulator 5 (HS5), human β-globin insulator 1 (HS1), and chicken β-globin insulator (cHS3) (Farrell CM1, West AG, Felsenfeld G., Mol Cell Biol. 2002 Jun;22(11):3820-31; J Ellis et al. EMBO J. 1996 Feb 1;15(3):562-568). In addition to reducing undesirable distal interactions, insulators also help prevent promoter interference between adjacent retroviral nucleic acid sequences (i.e., when a promoter from one transcription unit impairs the expression of an adjacent transcription unit).If an insulator is used between each of the retroviral vector nucleic acid sequences, the reduction in direct read-through would help prevent the formation of replicable retroviral vector particles.

[0206] Insulators may be present between each of the retroviral nucleic acid sequences. In one embodiment, the use of insulators prevents promoter-enhancer interactions from one NOI expression cassette interacting with another NOI expression cassette in the nucleotide sequence encoding the vector component.

[0207] An insulator may be present between the vector genome and the gag-pol sequence. This thus limits the possibility of producing replicable retroviral vectors and "wild-type"-like RNA transcripts, improving the safety profile of the construct. The use of insulating elements to improve the expression of stably incorporated multigene vectors is described in Moriarity et al, Nucleic Acids Res. 2013 Apr;41(8):e92.

[0208] Vector titer Those skilled in the art will understand that there are numerous different methods for determining the titer of a lentiviral vector. The titer is often expressed as transduction units / mL (TU / mL). The titer can be increased by increasing the number of vector particles and by increasing the specific activity of the vector preparation.

[0209] therapeutic use The lentiviral vectors described herein, or cells or tissues transduced with the lentiviral vectors described herein, may be used in medicine.

[0210] Furthermore, the lentiviral vectors described herein, the cells produced by the present invention, or cells or tissues transduced with the lentiviral vectors described herein may be used in the preparation of pharmaceuticals for delivering the desired nucleotides to the target sites where they are needed. Such use of the lentiviral vectors or transduced cells of the present invention may be for therapeutic or diagnostic purposes, as described above.

[0211] Therefore, cells transduced by the lentiviral vector described herein are provided.

[0212] "Cells transduced by viral vector particles" should be understood as cells into which nucleic acids carried by viral vector particles have been transferred, particularly as target cells.

[0213] In one embodiment of the present invention, the target nucleotide is translated in target cells lacking TRAP.

[0214] "Target cells" should be understood as cells that are desirable to express NOI. NOI can be introduced into target cells using the viral vector of the present invention. Delivery to target cells can be performed in vivo, ex vivo, or in vitro.

[0215] In a preferred embodiment, the nucleotide of interest provides a therapeutic effect.

[0216] NOIs may have therapeutic or diagnostic applications. Appropriate NOIs include, but are not limited to, sequences encoding enzymes, cofactors, cytokines, chemokines, hormones, antibodies, antioxidant molecules, engineered immunoglobulin-like molecules, single-chain antibodies, fusion proteins, immune costimulatory molecules, immunomodulatory molecules, chimeric antigen receptors, transdomain-negative variants of target proteins, toxins, conditional toxins, antigens, transcription factors, structural proteins, reporter proteins, intracellular localization signals, tumor suppressor proteins, growth factors, membrane proteins, receptors, vascular active proteins and peptides, antiviral proteins and ribozymes, and their derivatives (including derivatives with associated reporter groups). NOIs may also encode microRNAs. While we do not wish to be constrained by theory, it is thought that microRNA processing is inhibited by TRAP.

[0217] In one embodiment, NOI may be useful in the treatment of neurodegenerative disorders.

[0218] In another embodiment, NOI may be useful in treating Parkinson's disease.

[0219] In another embodiment, the NOI may encode one or more enzymes involved in dopamine synthesis. For example, the enzymes may be one or more of the following: tyrosine hydroxylase, GTP-cyclohydrolase I, and / or aromatic amino acid dopadecarboxylase. Sequences of all three genes are available (GenBank® accession numbers X05290, U19523, and M76180, respectively).

[0220] In another embodiment, the NOI may encode vesicular monoamine transporter 2 (VMAT2). In an alternative embodiment, the viral genome may include an NOI encoding aromatic amino acid dopa decarboxylase and an NOI encoding VMAT2. Such a genome may be used in the treatment of Parkinson's disease, particularly in conjunction with peripheral administration of L-DOPA.

[0221] In another embodiment, the NOI may encode a therapeutic protein or a combination of therapeutic proteins.

[0222] In another embodiment, NOI may encode one or more proteins selected from the group consisting of glial cell-derived neurotrophic factor (GDNF), brain-derived neurotrophic factor (BDNF), ciliary body neurotrophic factor (CNTF), neurotrophin-3 (NT-3), acid fibroblast growth factor (aFGF), basic fibroblast growth factor (bFGF), interleukin-1β (IL-1β), tumor necrosis factor α (TNF-α), insulin growth factor-2, VEGF-A, VEGF-B, VEGF-C / VEGF-2, VEGF-D, VEGF-E, PDGF-A, PDGF-B, PDFG-A, and heterodimers and homodimers of PDFG-B.

[0223] In another embodiment, the NOI may encode one or more anti-angiogenic proteins selected from the group consisting of angiostatin, endostatin, platelet factor 4, pigment epithelial-derived factor (PEDF), placental growth factor, restin, interferon-α, interferon-inducible protein, gro-β and tubedown-1, interleukin (IL)-1, IL-12, retinoic acid, anti-VEGF antibodies or their fragments / variants, e.g., aflibercept, thrombospondin, VEGF receptor proteins, e.g., those described in U.S. Patent No. 5,952,199 and U.S. Patent No. 6,100,071, and anti-VEGF receptor antibodies.

[0224] In another embodiment, the NOI may encode an anti-inflammatory protein, antibody, or protein or antibody fragment / variant selected from the group consisting of NF-κB inhibitors, IL-1β inhibitors, TGFβ inhibitors, IL-6 inhibitors, IL-23 inhibitors, IL-18 inhibitors, tumor necrosis factor α and tumor necrosis factor β, lymphotoxin α and lymphotoxin β, LIGHT inhibitors, α-synuclein inhibitors, tau inhibitors, β-amyloid inhibitors, and IL-17 inhibitors.

[0225] In another embodiment, the NOI may encode a cystic fibrosis membrane conductance regulator (CFTR).

[0226] In another embodiment, the NOI may encode a protein that is normally expressed in ophthalmic cells.

[0227] In another embodiment, the NOI may encode a protein that is normally expressed in photoreceptor cells and / or retinal pigment epithelial cells.

[0228] In another embodiment, the NOI may encode a protein selected from the group including RPE65, aryl hydrocarbon interaction receptor protein-like 1 (AIPL1), CRB1, lecithin retinal acetyltransferase (LRAT), photoreceptor-specific homeobox (CRX), retinal guanylate cyclise (GUCY2D), RPGR interaction protein 1 (RPGRIP1), LCA2, LCA3, LCA5, dystrophin, PRPH2, CNTF, ABCR / ABCA4, EMP1, TIMP3, MERTK, ELOVL4, MYO7A, USH2A, VMD2, RLBP1, COX-2, FPR, harmonin, Rab escort protein 1, CNGB2, CNGA3, CEP290, RPGR, RS1, RP1, PRELP, glutathione pathway enzymes, and optisin.

[0229] In other embodiments, the NOI may encode human coagulation factor VIII or factor IX.

[0230] In other embodiments, NOI is phenylalanine hydroxylase (PAH), methylmalonyl-CoA mutase, propionyl-CoA carboxylase, isovaleryl-CoA dehydrogenase, branched-chain keto acid dehydrogenase complex, glutaryl-CoA dehydrogenase, acetyl-CoA carboxylase, propionyl-CoA carboxylase, 3-methylcrotonyl-CoA carboxylase, pyruvate carboxylase, carbamoyl-phosphate synthase ammonia, ornithine transcarbamylase, glucosylceramidase β, α-galactosidase A, glucosylceramidase It may encode one or more metabolically involved proteins selected from the group including -ase β, cystinosine, glucosamine (N-acetyl)-6-sulfatase, N-acetyl-α-glucosaminidase, N-sulfoglucosamine sulfohydrolase, galactosamine-6-sulfatase, arylsulfatase A, cytochrome B-245β, ABCD1, ornithine carbamoyltransferase, argininosuccinate synthase, argininosuccinate lyase, arginase 1, alaning's lycoxylate aminotransferase, ATP-binding cassette, and subfamily B members.

[0231] In other embodiments, the NOI may encode a chimeric antigen receptor (CAR) or a T cell receptor (TCR). In one embodiment, the CAR is an anti-5T4 CAR. In other embodiments, NOI may encode B cell maturation antigen (BCMA), CD19, CD22, CD20, CD138, CD30, CD33, CD123, CD70, prostate-specific membrane antigen (PSMA), Lewis Y antigen (LeY), tyrosine-protein kinase transmembrane receptor (ROR1), mucin 1, cell surface binding (Muc1), epithelial cell adhesion molecule (EpCAM), endothelial growth factor receptor (EGFR), insulin, protein tyrosine phosphatase, non-receptor type 22, interleukin 2 receptor, α, interferon induced by helicase C domain 1, human epidermal growth factor receptor (HER2), glypican 3 (GPC3), disiaroganglioside (GD2), mesiothelin, or vesicular endothelial growth factor receptor 2 (VEGFR2).

[0232] In other embodiments, the NOI may encode a chimeric antigen receptor (CAR) against an NKG2D ligand selected from the group consisting of ULBP1, 2, and 3, H60, Rae-1a, b, g, d, MICA, and MICB.

[0233] In further embodiments, the NOI may encode SGSH, SUMF1, GAA, common gamma chain (CD132), adenosine deaminase, WAS protein, globin, alpha-galactosidase A, delta-aminolevulinic acid (ALA) synthase, delta-aminolevulinic acid dehydratase (ALAD), hydroxymethylbilane (HMB) synthase, uroporphyrinogen (URO) synthase, uroporphyrinogen (URO) decarboxylase, coproporphyrinogen (COPRO) oxidase, protoporphyrinogen (PROTO) oxidase, ferrochelatase, alpha-L-iduronidase, iduronic acid sulfatase, heparan sulfamidase, N-acetylglucosaminidase, heparin-alpha-glucosaminide N-acetyltransferase, 3N-acetylglucosamine 6-sulfatase, galactose-6-sulfatase, beta-galactosidase, N-acetylgalactosamine-4-sulfatase, beta-glucuronidase, and hyaluronidase.

[0234] In addition to the NOI, the vector may also contain or encode siRNA, shRNA, or regulatory shRNA (Dickins et al. (2005) Nature Genetics 37:1289-1295, Silva et al. (2005) Nature Genetics 37:1281-1288).

[0235] Indications The retroviral vectors and AAV vectors according to the present invention can be used to deliver (one or more) NOIs useful for the treatment of disorders listed in International Publication No. 1998 / 05635, International Publication No. 1998 / 07859, and International Publication No. 1998 / 09985. The nucleotide of interest may be DNA or RNA. Examples of such diseases are given below.

[0236] Impairment of response to cytokines and cell proliferation / differentiation activity; immunosuppressant or immunostimulatory activity (e.g., to treat immunodeficiency including infection by human immunodeficiency virus, to regulate lymphocyte proliferation; to treat cancer and many autoimmune diseases, and to prevent transplant rejection or induce tumor immunity); regulation of hematopoiesis (e.g., to treat myeloid or lymphoid diseases); promotion of growth of bone, cartilage, tendons, ligaments and nerve tissue (e.g., for wound healing, burns, ulcers and periodontal disease and neurodegeneration); inhibition or activation of follicle-stimulating hormone (regulation of fertility); chemotaxis / chemotactic activity (e.g.) For example; to mobilize specific cell types to the site of injury or infection; hemostatic and thrombolytic activity (e.g., to treat hemophilia and stroke); anti-inflammatory activity (e.g., to treat septic shock or Crohn's disease); macrophage inhibitory activity and / or T cell inhibitory activity, and therefore anti-inflammatory activity; anti-immune activity (i.e., inhibitory effect on cellular and / or humoral immune responses, including non-inflammatory responses); inhibition of the ability of macrophages and T cells to adhere to extracellular matrix components and fibronectin, as well as upregulation of fas receptor expression in T cells.

[0237] Malignant disorders including cancer, leukemia, growth, invasion and spread of benign and malignant tumors, angiogenesis, metastasis, ascites and malignant pleural effusion.

[0238] Autoimmune diseases, including rheumatoid arthritis, hypersensitivity, allergic reactions, asthma, systemic lupus erythematosus, collagen disorders, and other diseases.

[0239] Vascular diseases including arteriosclerosis, atherosclerotic heart disease, reperfusion injury, cardiac arrest, myocardial infarction, vascular inflammatory disorders, respiratory distress syndrome, cardiovascular effects, peripheral vascular disease, migraine and aspirin-dependent antithrombosis, stroke, cerebral ischemia, ischemic heart disease, or other diseases.

[0240] Diseases of the gastrointestinal tract, including peptic ulcers, ulcerative colitis, Crohn's disease, and other related conditions.

[0241] Liver diseases, including hepatic fibrosis and cirrhosis.

[0242] Hereditary metabolic disorders, including phenylketonuria (PKU), Wilson's disease, organic acidemia, urea cycle disorders, cholestasis, and other diseases.

[0243] Diseases of the kidneys and urinary tract, including thyroiditis or other glandular disorders, glomerulonephritis or other diseases.

[0244] Disorders of the ear, nose, and throat, including otitis or other ear, nose, and throat disorders; dermatitis or other skin conditions.

[0245] Dental and oral disorders, including periodontal disease, periodontitis, gingivitis, or other dental / oral diseases.

[0246] Testicular diseases, including orchitis or epididymitis, infertility, testicular trauma, or other testicular disorders.

[0247] Gynecological diseases including placental dysfunction, placental insufficiency, recurrent miscarriage, eclampsia, pregnancy-related eclampsia, endometriosis, and other gynecological disorders.

[0248] Ophthalmic disorders, such as Leber congenital amaurosis (LCA) including LCA10, posterior uveitis, intermediate uveitis, anterior uveitis, conjunctivitis, chorioretinitis, retinouveitis, optic neuritis, glaucoma (including open-angle glaucoma and juvenile congenital glaucoma), intraocular inflammation, such as retinitis or cystoid macular edema, sympathetic ophthalmitis, scleritis, retinitis pigmentosa, macular degeneration including age-related macular degeneration (AMD), and juvenile macular degeneration including Best's disease, Best's disease, Best's vitiligo macular degeneration, Stargardt disease, Usher syndrome, Doin honeycomb retinal dystrophy, and Sorby's disease. Macular dystrophy, juvenile retinoschisis, cone-rod dystrophy, corneal dystrophy, Fuchs dystrophy, Leber congenital amaurosis, Leber hereditary optic neuropathy (LHON), Addie syndrome, Oguchi disease, degenerative retinal diseases, ocular inflammation caused by ocular trauma or infection, proliferative vitreoretinopathy, acute ischemic optic neuropathy, such as excessive scarring after glaucoma filtration surgery, ocular graft rejection, and other eye diseases such as diabetic macular edema, retinal vein occlusion, RLBP1-associated retinal dystrophy, total choroidal atrophy, and color vision deficiencies.

[0249] Parkinson's disease, complications and / or side effects of treatment for Parkinson's disease, AIDS-related dementia, combined HIV-associated encephalopathy, Devic's disease, Sydenham's chorea, Alzheimer's disease and other degenerative diseases, CNS conditions or disorders, stroke, post-polio syndrome, psychiatric disorders, myelitis, encephalitis, subacute sclerosing panencephalitis, encephalomyelitis, acute neuropathy, subacute neuropathy, chronic neuropathy, Fabry disease, Gaucher disease, cystinism, Pompe disease, metachromatic leukodystitis Lophi, Wiscott-Aldrich syndrome, adrenoleukodystrophy, beta-thalassemia, sickle cell disease, Guillaim-Barre syndrome, Sydenham chorea, myasthenia gravis, pseudotumor, Down syndrome, Huntington's disease, CNS compression or CNS trauma or CNS infection, muscular atrophy and dystrophy, diseases, conditions or disorders of the central and peripheral nervous system, motor neuron diseases including amyotrophic lateral sclerosis, spinal muscular atrophy, spinal cord and avulsion injury.

[0250] Cystic fibrosis, Sanfilipo syndrome A, Sanfilipo syndrome B, Sanfilipo syndrome C, Sanfilipo syndrome D, Hunter syndrome, Hurler-Scheie syndrome, mucopolysaccharidosis including Morquio syndrome, ADA-SCID, X-linked SCID, X-linked chronic granulomatous disease, porphyria, hemophilia A, hemophilia B, post-traumatic inflammation, bleeding, coagulation and acute phase reactions, cachexia, anorexia, acute infection, septic shock, infectious diseases, diabetes, complications or side effects of surgery, complications and / or side effects of bone marrow transplantation or other transplantation, complications and side effects of gene therapy resulting from infection by a virus carrier, for example, or other diseases and conditions such as AIDS, tissues and organs such as cornea, bone marrow, organs, lenses, pacemakers, natural or artificial skin tissue, for the prevention and / or treatment of graft rejection in the case of transplantation of natural or artificial cells, for the purpose of suppressing or inhibiting humoral and / or cellular immune responses.

[0251] siRNA, micro-RNA, and shRNA In certain other embodiments, NOIs include microRNAs. MicroRNAs are a very large group of small RNAs produced naturally in organisms, at least some of which regulate the expression of target genes. The forming members of the microRNA family are let-7 and lin-4. The let-7 gene encodes a small, highly conserved RNA species that regulates the expression of endogenous protein-coding genes during helminthic development. The active RNA species is initially transcribed as a precursor of about 70 nt, which is processed post-transcriptionally into a mature form of about 21 nt. Both let-7 and lin-4 are transcribed as hairpin RNA precursors, which are processed into their mature forms by the Dicer enzyme.

[0252] In addition to NOIs, vectors may also contain or encode siRNA, shRNA, or regulatory shRNA (Dickins et al. (2005) Nature Genetics 37:1289-1295, Silva et al. (2005) Nature Genetics 37:1281-1288).

[0253] Post-transcriptional gene silencing (PTGS) mediated by double-stranded RNA (dsRNA) is a conserved cellular defense mechanism for controlling the expression of foreign genes. Random integration of elements such as transposons or viruses is thought to trigger the expression of dsRNA that activates the sequence-specific degradation of homologous single-stranded mRNA or viral genomic RNA. The silencing effect is known as RNA interference (RNAi) (Ralph et al. (2005) Nature Medicine 11:429-433). The mechanism of RNAi involves processing long dsRNA into double-stranded RNAs approximately 21-25 nucleotides (nt) in length. These products are called small interfering RNAs or silencing RNAs (siRNAs), which are sequence-specific mediators of mRNA degradation. In differentiated mammalian cells, dsRNAs longer than 30 bp have been found to activate the interferon response, leading to the shutdown of protein synthesis and nonspecific mRNA degradation (Stark et al., Annu Rev Biochem 67:227-64 (1998)). However, this response can be avoided by using 21-nt siRNA duplexes that enable the analysis of gene function in cultured mammalian cells (Elbashir et al., EMBO J. Dec 3;20(23):6877-88 (2001), Hutvagner et al., Science. Aug 3,293(5531):834-8. Eupub Jul 12(2001)).

[0254] Pharmaceutical composition The present disclosure provides a pharmaceutical composition comprising a lentiviral vector described herein or a cell or tissue transduced with a viral vector described herein, in combination with a pharmaceutically acceptable carrier, diluent or excipient.

[0255] This disclosure provides a pharmaceutical composition for treating an individual by gene therapy, comprising a therapeutically effective amount of a lentiviral vector. The pharmaceutical composition may be for use in humans or animals.

[0256] The composition may contain pharmaceutically acceptable carriers, diluents, excipients, or adjuvants. The selection of pharmaceutically acceptable carriers, excipients, or diluents can be made in relation to the intended route of administration and standard pharmaceutical practices. In addition to carriers, excipients, or diluents, the pharmaceutical composition may also contain any suitable (one or more) binders, (one or more) lubricants, (one or more) suspending agents, (one or more) coating agents, (one or more) solubilizers, and other carriers that can assist or increase the entry of the vector into the target site (e.g., a lipid delivery system).

[0257] Where appropriate, the composition may be administered by inhalation of any one or more; in the form of suppositories or vaginal suppositories; topically in the form of lotions, solutions, creams, ointments or powders; by use as a skin patch; orally in the form of tablets containing excipients such as starch or lactose, or alone or mixed with excipients in the form of capsules or eggs, or in the form of elixirs, solutions or suspensions containing flavorings or colorings; or parenterally, for example, by injection into the corpus cavernosum of the penis, intravenously, intramuscularly, intracranially, intraocularly, intraperitoneally, or subcutaneously. In the case of parenteral administration, the composition may be best used in the form of a sterile aqueous solution that may contain other substances, such as salts or monosaccharides sufficient to make the solution isotonic with blood. In the case of buccal or sublingual administration, the composition may be administered in the form of tablets or lozenges that can be formulated in a conventional manner.

[0258] The lentiviral vectors described herein may also be used ex vivo to transduce target cells or tissues before transferring them to a patient who requires them. An example of such cells may be autologous T cells, and an example of such tissue may be donor cornea.

[0259] Variants, derivatives, analogs, homologs, and fragments In addition to the specific proteins and nucleotides mentioned herein, the present invention also encompasses the use of their variants, derivatives, analogues, homologs, and fragments.

[0260] In the context of the present invention, a variant of any given sequence is a sequence in which a specific sequence of residues (whether amino acid residues or nucleic acid residues) is modified so that the polypeptide or polynucleotide in question retains at least one of its endogenous functions. Variant sequences can be obtained by adding, deleting, substituting, modifying, replacing, and / or muting at least one residue present in naturally occurring proteins.

[0261] As used herein with respect to the protein or polypeptide of the present invention, the term “derivative” includes any substitution, mutation, modification, substitution, deletion and / or addition of one (or more) amino acid residues to or from a sequence, provided that the resulting protein or polypeptide retains at least one of its endogenous functions.

[0262] As used herein with respect to polypeptides or polynucleotides, the term “analog” includes any mimic, i.e., a chemical compound, that has at least one of the endogenous functions of the polypeptide or polynucleotide it mimics.

[0263] Typically, amino acid substitutions, such as 1, 2, or 3 to 10 or 20 substitutions, may be made, as long as the modified sequence retains the desired activity or capability. Amino acid substitutions may include the use of analogues that do not exist in nature.

[0264] The proteins used in this invention may also undergo silent changes, including deletions, insertions, or substitutions of amino acid residues, resulting in functionally equivalent proteins. Intentional amino acid substitutions may be made based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphiphilicity of the residues, as long as the endogenous function is preserved. For example, negatively charged amino acids include aspartic acid and glutamic acid, positively charged amino acids include lysine and arginine, and amino acids with uncharged head groups having similar hydrophilic values ​​include asparagine, glutamine, serine, threonine, and tyrosine.

[0265] Conservative substitutions can be performed, for example, according to the following table. Amino acids in the same block in the second column, preferably in the same line in the third column, may be substituted for each other.

[0266] [Table 1]

[0267] The term "homolog" refers to an entity that has a certain degree of homology to the wild-type amino acid sequence and wild-type nucleotide sequence. The term "homology" can be considered synonymous with "identity."

[0268] In this context, homologous sequences are interpreted as containing amino acid sequences that are at least 50%, 55%, 65%, 75%, 85%, or 90% identical to the target sequence, preferably at least 95%, 97%, or 99% identical. Typically, homologs will contain the same active sites, etc., as the target amino acid sequence. Homology can also be considered in terms of similarity (i.e., amino acid residues having similar chemical properties / functions), but in the context of the present invention, homology is preferably expressed in terms of sequence identity.

[0269] In this context, homologous sequences are interpreted as including nucleotide sequences that are at least 50%, 55%, 65%, 75%, 85%, or 90% identical to the target sequence, and preferably at least 95%, 97%, 98%, or 99% identical. While homology can also be considered in terms of similarity, in the context of the present invention, homology is preferably expressed in terms of sequence identity.

[0270] Homology comparisons can be performed visually, or more generally, with the help of readily available sequence comparison programs. These commercially available computer programs can calculate the percentage of homology or identity between two or more sequences.

[0271] Homology percentages can be calculated over consecutive sequences, that is, by aligning one sequence with the other and directly comparing each amino acid in one sequence with its corresponding amino acid in the other sequence, one residue at a time. This is called "non-gap" alignment. Typically, such non-gap alignment is performed over only a relatively small number of residues.

[0272] While this is a very simple and consistent method, it fails to take into account, for example, that in otherwise identical sequence pairs, a single insertion or deletion in the nucleotide sequence may cause subsequent codons to fall out of alignment, and therefore, when the overall alignment is performed, this can result in a significant decrease in the homology percentage. As a result, most sequence comparison methods are designed to produce an optimal alignment that takes possible insertions and deletions into account without excessively disadvantage the overall homology score. This is achieved by inserting "gaps" into the sequence alignment in an attempt to maximize local homology.

[0273] However, these more complex methods assign a "gap penalty" to each gap that occurs in the alignment, thereby ensuring that, for the same number of identical amino acids, a sequence alignment with as few gaps as possible achieves a higher score than a sequence with many gaps, reflecting a higher relevance between the two sequences being compared. "Affine gap cost" typically places a relatively high cost on the presence of gaps and a smaller penalty on each subsequent residue within the gap. This is the most commonly used gap scoring system. A high gap penalty naturally produces an optimized alignment with fewer gaps. Most alignment programs allow for correction of the gap penalty. However, when using such software for sequence comparison, it is preferable to use the default values. For example, when using the GCG Wisconsin Bestfit package, the default gap penalty for amino acid sequences is -12 for gaps and -4 for each extension.

[0274] Therefore, calculating maximum percentage homology requires first generating an optimal alignment, taking gap penalties into account. A suitable computer program for performing such alignments is the GCG Wisconsin Bestfit package (University of Wisconsin, USA; Devereux et al. (1984) Nucleic Acids Research 12:387). Other software capable of performing sequence comparisons includes, but is not limited to, the BLAST package (see Ausubel et al. (1999) ibid-Ch.18), FASTA (Atschul et al. (1990) J.Mol.Biol.403-410), and the GENEWORKS comparison tools suite. Both BLAST and FASTA are available for offline and online searches (see Ausubel et al. (1999) ibid, pages 7-58 to 7-60). However, for some applications, the GCG Bestfit program is preferred. Another tool called BLAST 2 sequences is also available for comparing protein and nucleotide sequences (see FEMS Microbiol Lett (1999) 174(2):247-50; FEMS Microbiol Lett (1999) 177(1):187-8).

[0275] While the final homology percentage can be measured in terms of identity, the alignment process itself is not typically based on all-or-nothing pair comparisons. Instead, a scaled similarity score matrix is ​​commonly used, which assigns a score to each pair comparison based on chemical similarity or evolutionary distance. An example of such a commonly used matrix is ​​the BLOSUM62 matrix, which is the default matrix for the BLAST program suite. The GCG Wisconsin program generally uses either public default values ​​or custom symbol comparison tables, if provided (see the user manual for further details). In some applications, it is preferable to use the public default values ​​of the GCG package, or a default matrix such as BLOSUM62 in the case of other software.

[0276] Once the software has generated the optimal alignment, it is possible to calculate the homology percentage, preferably the sequence identity percentage. The software typically does this as part of the sequence comparison and generates a numerical result.

[0277] "Fragment" is also a variant, and this term typically refers to a selected region of the polypeptide or polynucleotide of interest, functionally or, for example, in an assay. Therefore, "fragment" refers to an amino acid or nucleic acid sequence that is part of a full-length polypeptide or polynucleotide.

[0278] Such variants can be prepared using standard recombinant DNA techniques, such as site-directed mutagenesis. If an insertion is made, synthetic DNA encoding the insertion can be produced along with 5' and 3' flanking regions corresponding to naturally occurring sequences on either side of the insertion site. The flanking regions include convenient restriction sites corresponding to locations in the naturally occurring sequence, such that the sequence is cleaved by appropriate enzymes (one or more) and the synthetic DNA is linked to the cleavage. The DNA is then expressed according to the present invention to produce the encoded protein. These methods are merely examples of the many standard techniques known in the art for manipulating DNA sequences, and other known techniques may also be used.

[0279] All variants, fragments, or homologs of the regulatory protein suitable for use in cells and / or modular constructs of the present invention retain the ability to bind to the homologous binding site of NOI, thereby suppressing or preventing NOI translation in viral vector-producing cells.

[0280] All variant fragments or homologs of the binding site retain the ability to bind to the congeneral RNA-binding protein, thereby suppressing or preventing NOI translation in viral vector-producing cells.

[0281] Codon optimization The polynucleotides used in this invention (including the NOI and / or components of the vector production system) can be codon-optimized. Codon optimization has been previously described in International Publication No. 1999 / 41397 and International Publication No. 2001 / 79518. Different cells use certain codons differently. This codon bias corresponds to a bias in the relative abundance of a particular tRNA in a cell type. It is possible to increase expression by altering the codons in the sequence to match the relative abundance of the corresponding tRNA. Similarly, it is possible to decrease expression by deliberately selecting codons for which the corresponding tRNA is known to be rare in a particular cell type. Thus, further translational control is available.

[0282] Many viruses, including retroviruses, utilize a large number of rare codons, which can be modified to correspond to commonly used mammalian codons, thereby achieving the expression of a target gene, such as NOI, or an increase in packaging components in mammalian-producing cells. Codon frequency tables are publicly known in the art for mammalian cells and various other organisms.

[0283] Codon optimization of viral vector components offers numerous other advantages. The alteration of their sequences ensures that the nucleotide sequences encoding the packaging components of the viral particles, necessary for assembly in producer / packaging cells, have the RNA instability sequences (INS) removed. Simultaneously, the amino acid sequence coding sequences of the packaging components are maintained so that the viral component encoded by the sequence remains the same, or at least sufficiently similar, without compromising the function of the packaging component. In lentiviral vectors, codon optimization also overcomes Rev / RRE requirements for export, making the optimized sequence Rev-independent. Codon optimization also reduces homologous recombination between different constructs within the vector system (e.g., between overlapping regions in the gag-pol and env open reading frames). Therefore, the overall effect of codon optimization is a significant increase in viral titer and improved safety.

[0284] In one embodiment, only codons related to INS are codon-optimized. However, in a much more preferred practical embodiment, sequences are codon-optimized in their entirety, with a few exceptions, for example, sequences containing the frameshift region of gag-pol (see below).

[0285] The lentiviral vector gag-pol gene contains two overlapping reading frames encoding the gag-pol protein. The expression of both proteins depends on a frameshift during translation. This frameshift occurs as a result of a ribosome "slip" during translation. This slip is thought to be caused, at least partially, by a ribosomal stalled RNA secondary structure. Such a secondary structure is located downstream of the frameshift site in the gag-pol gene. In the case of HIV, the overlapping region extends from nucleotide 1222 (nucleotide 1 is A in gag ATG) downstream of the start of gag to the end of gag (nt 1503). As a result, a 281 bp fragment spanning the frameshift site and the overlapping region of the two reading frames is preferably not codon-optimized. Retaining this fragment would allow for more efficient expression of the Gag-Pol protein. In the case of EIAV, the start of the overlap is interpreted as nt 1262 (nucleotide 1 is A in gag ATG), and the end of the overlap is interpreted as nt 1461. To ensure that the frameshift region and gag-pol overlap are preserved, the wild-type sequence is retained at nt 1156-1465.

[0286] Derivatives from optimal codon usage frequencies may be created, for example, to adapt to favorable restriction sites, and conservative amino acid changes may be introduced into the Gag-Pol protein.

[0287] In one embodiment, codon optimization is based on a low-expression mammalian gene. The third base, and possibly the second and third bases, can be modified.

[0288] It will be understood that, due to the degenerate nature of the genetic code, a large number of gag-pol sequences can be achieved by those skilled in the art. Furthermore, many retroviral variants have been described that can be used as starting points for constructing codon-optimized gag-pol sequences. Lentiviral genomes can be highly diverse. For example, there are many subspecies of HIV-1 that are still functional. This is also true for EIAV. These variants can be used to enhance specific parts of the transduction process. Examples of HIV-1 variants can be found in the HIV Database operated by Los Alamos National Security, LLC at http: / / hiv-web.lanl.gov. Details of EIAV clones can be found in the National Center for Biotechnology Information (NCBI) database at http: / / www.ncbi.nlm.nih.gov.

[0289] The codon-optimized gag-pol sequence strategy can be used for any retrovirus. This would apply to all lentiviruses, including EIAV, FIV, BIV, CAEV, VMR, SIV, HIV-1, and HIV-2. Furthermore, this method can be used to increase the expression of genes derived from HTLV-1, HTLV-2, HFV, HSRV, and human endogenous retroviruses (HERV), MLV, and other retroviruses.

[0290] Codon optimization can make gag-pol expression Rev-independent. However, to enable the use of anti-rev or RRE factors in lentiviral vectors, it would be necessary to make the viral vector production system completely Rev / RRE-independent. Therefore, the genome also needs to be modified. This is achieved by optimizing the vector genome components. Advantageously, these modifications also result in the production of a safer system in which all the additional proteins are absent in both the producing and transduced cells.

[0291] Combination with modified U1 to improve vector titer MSD mutant lentiviral vectors are preferred over current standard lentiviral vectors for use as gene therapy vectors because they have a reduced ability to participate in abnormal splicing events both during LV production and in target cells. However, until now, the production of MSD mutant vectors has been either dependent on the supply of HIV-1 tat protein (first and second generation U3-dependent lentiviral vectors) or has been inefficient due to the destabilizing effect of the MSD mutation on vector RNA levels (in third-generation vectors). For safety reasons, there is neither a desire nor a justification for "reintroducing" tat back into the current third-generation U3-independent LV system, and consequently, there is currently no solution to the reduced productivity of MSD mutant vectors intended for clinical use.

[0292] The inventors demonstrate that MSD-mutated third-generation (i.e., U3 / tat-independent) LV can be produced at high titers by co-expression of modified U1 snRNA directed to bind to the 5' packaging region of the vector genomic RNA during production. Surprisingly, these modified U1 snRNAs have been shown to enhance the production titer of MSD-mutated LV in a manner independent of the presence of a 5' polyA signal in the 5' R region, indicating a novel mechanism for other uses of modified U1 snRNA to suppress polyadenylation (so-called U1 interference, [Ui]). Surprisingly, targeting key sequences in the packaging region with modified U1 snRNA has been shown to maximize the titer of MSD-mutated LV. The inventors also disclose novel sequence mutations within the major splice donor region such that the titer decrease of MSD-mutated LV is not significant and the titer enhancement of such MSD-mutated LV variants by modified U1 snRNA is maximized.

[0293] The inventors have surprisingly discovered that the output titer of a lentiviral vector can be enhanced by co-expressing a non-coding RNA based on a U1 snRNA that has been modified to target sequences within the vRNA molecule, rather than endogenous sequences (splice donor sites). As demonstrated in this embodiment, the inventors show that the relative enhancement of the output titer of a lentiviral vector with attenuation of mutations in the major splice donor region (including major splice donor and latent splice donor sites) by the modified U1 snRNA is greater than that of a standard lentiviral vector containing an unmutated major splice donor region.

[0294] As demonstrated in this embodiment, vector genomes with a wide range of mutations within the major splice donor region (point mutations, region deletions, and sequence substitutions) resulting in reduced titer can be used in combination with modified U1 snRNA. This approach may involve co-expressing modified U1 snRNA with other vector components during vector production. Modified U1 snRNA is designed so that binding to the consensus splice donor site is eliminated by substitution with a heterologous sequence complementary to the target sequence in the vector genome vRNA. This invention describes various applications and optimal features of modified U1 snRNA, including target sequence and complementarity length, expression design, and mode.

[0295] In one aspect of the present invention described herein, the vector may be used in combination with a modified U1 snRNA. This will be further explained below.

[0296] The presence / abundance of modified U1 snRNA molecules can be quantified in vector-producing cell extracts or vector virions by total RNA extraction followed by RT-PCR or RT-qPCR (quantitative) using DNA primers. Importantly, the forward primers are designed to be complementary to the targeting sequence of the modified U1 snRNA molecule so that only the modified U1 snRNA is amplified during qPCR, and endogenous U1 snRNA is not.

[0297] In one embodiment, the present invention provides a vector billion including a modified U1 according to the present invention as described herein.

[0298] Splicing and polyadenylation are crucial processes for mRNA maturation, particularly in higher eukaryotes where most protein-coding transcripts contain multiple introns. Elements within the premRNA necessary for splicing include the 5' splice donor signal, the branching sequence, and the 3' splice acceptor signal. Interacting with these three elements is the spliceosome, formed by five micronuclear RNAs (snRNAs), including U1 snRNA, and associated nuclear proteins (snRNPs). U1 snRNA is expressed by the polymerase II promoter and is present in most eukaryotic cells (Lund et al., 1984, J. Biol. Chem., 259:2013-2021). Human U1 snRNA (nuclear small RNA) is 164 nt long and has a clearly defined structure consisting of four stem-loops (West, S., 2012, Biochemical Society Transactions, 40:846-849). U1 snRNAs contain a short sequence at their 5' end that is broadly complementary to the 5' splice donor site at the exon-intron junction. U1 snRNAs are involved in splice site selection and spliceosome assembly through base pairing with the 5' splice donor site. A known function of U1 snRNA outside of splicing is the regulation of 3' terminal mRNA processing. It represses early polyadenylation (polyA) in early polyA signaling (particularly within introns).

[0299] Human U1 snRNA (small nuclear RNA) is 164 nt long and has a clearly defined structure consisting of four stem-loops (see Figure 1). As an endogenous non-coding RNA, U1 snRNA binds to the consensus 5' splice donor site (e.g., 5'-MAGGURR-3', where M is A or C and R is A or G) via a native splice donor annealing sequence (e.g., 5'-ACUUACCUG-3') during the early stages of intron splicing. Stem-loop I binds to the U1A-70K protein, which has been shown to be important for polyA repression. Stem-loop II binds to the U1A protein, and the 5'-AUUUGUGG-3' sequence binds to the Sm protein, which, along with stem-loop IV, is important for U1 snRNA processing. As defined herein, the modified U1 snRNA for use in accordance with the present invention is modified to introduce a heterologous sequence complementary to the target sequence within the vector genomic vRNA molecule at the site of the natural splice donor targeting / annealing sequence (see Figure 1).

[0300] As used herein, the terms “modified U1 snRNA,” “redirected U1 snRNA,” “retargeted U1 snRNA,” “repurposed U1 snRNA,” and “mutant U1 snRNA” mean U1 snRNA that has been modified so as to no longer be complementary to the consensus 5' splice donor site sequence (e.g., 5'-MAGGURR-3') used to initiate the splicing process of the target gene. Thus, modified U1 snRNA is U1 snRNA that has been modified so as to no longer be complementary to the splice donor site sequence (e.g., 5'-MAGGURR-3'). Instead, modified U1 snRNA is designed to target or be complementary to a nucleotide sequence that has an RNA sequence specific to the packaging region of the MSD mutant lentiviral vector genomic molecule (target site), i.e., a sequence irrelevant to vRNA splicing. The nucleotide sequence within the packaging region of the MSD mutant lentiviral vector genomic molecule can be pre-selected. Therefore, the modified U1 snRNA is a U1 snRNA modified so that its 5' end is complementary to the nucleotide sequence within the packaging region of the MSD mutant lentiviral vector genome molecule. Consequently, although we do not wish to be constrained by theory, it is thought that the modified U1 snRNA binds to the target site sequence based on the complementarity of the target site sequence with the short sequence at the 5' end of the modified U1 snRNA, and thus stabilizes the vRNA, thereby increasing the output vector titer of the MSD mutant lentiviral vector.

[0301] As used herein, the terms “natural splice donor annealing sequence” and “natural splice donor targeting sequence” mean a short sequence at the 5' end of endogenous U1 snRNA that is broadly complementary to the intronic consensus 5' splice donor site. The natural splice donor annealing sequence may be 5'-ACUUACCUG-3'.

[0302] As used herein, the term “consensus 5' splice donor site” means a consensus RNA sequence at the 5' end of an intron used for splice site selection, for example, a consensus RNA sequence having the sequence 5'-MAGGURR-3'.

[0303] As used herein, the terms “nucleotide sequence in the packaging region of the MSD mutant lentiviral vector genome sequence,” “target sequence,” and “target site” mean a site within the packaging region of an MSD mutant lentiviral vector genome molecule that has a specific RNA sequence and is pre-selected as a target site for binding / annealing modified U1 snRNA.

[0304] As used herein, the terms “packaging region of the MSD mutant lentiviral vector genome molecule” and “packaging region of the MSD mutant lentiviral vector genome sequence” mean the 5' terminal region of the MSD mutant lentiviral vector genome from the beginning of the 5' U5 domain to the end of the sequence derived from the gag gene. Thus, the packaging region of the MSD mutant lentiviral vector genome molecule includes the 5' U5 domain, PBS elements, stem-loop (SL)1 elements, SL2 elements, SL3ψ elements, SL4 elements, and the sequence derived from the gag gene. It is common in the art to provide the complete gag gene in trans to the genome during lentiviral vector production to enable the production of replication-deficient viral vector particles. The nucleotide sequence of the trans-provided gag gene does not need to be encoded by wild-type nucleotides and may be codon-optimized. Importantly, the main attribute of the trans-provided gag gene is to encode and direct the expression of the gag and gagpol proteins. Therefore, if the complete gag gene is provided trans during lentiviral vector production, it will be understood by those skilled in the art that the term “packaging region of the lentiviral vector genome molecule” may mean the 5' terminal region of the MSD mutant lentiviral vector genome molecule from the start of the 5' U5 domain to the “core” packaging signal of the SL3ψ element, and the native gag nucleotide sequence from the ATG codon (located within SL4) to the end of the remaining gag nucleotide sequence present on the vector genome.

[0305] As used herein, the term “sequence derived from the gag gene” means any native sequence of the gag gene derived from ATG codon ~ nucleotide 688 that may be present in, for example, persist in, the vector genome (Kharytonchyk, S. et. al., 2018, J. Mol. Biol., 430:2066-79).

[0306] As used herein, the terms “introducing a heterologous sequence into the first 11 nucleotides of a U1 snRNA containing a natural splice donor annealing sequence,” “introducing the heterologous sequence into the nine nucleotides between positions 3 and 11,” and “introducing a heterologous sequence into the first 11 nucleotides of the 5' end of a U1 snRNA” include replacing all or part of the first 11 nucleotides or the nine nucleotides between positions 3 and 11 of the U1 snRNA with the heterologous sequence, or modifying the first 11 nucleotides or the nine nucleotides between positions 3 and 11 of the U1 snRNA to have the same sequence as the heterologous sequence.

[0307] As used herein, the terms “introducing a heterologous sequence into a natural splice donor annealing sequence” and “introducing a heterologous sequence into the natural splice donor annealing sequence at the 5' end of U1 snRNA” include replacing all or part of the natural splice donor annealing sequence with the heterologous sequence, or modifying the natural splice donor annealing sequence to have the same sequence as the heterologous sequence.

[0308] As used herein, the term “enhance the titer of a lentiviral vector” includes “increase the titer of a lentiviral vector,” “restore the titer of a lentiviral vector,” and “improve the titer of a lentiviral vector.”

[0309] Therefore, in one embodiment, the modified U1 snRNA is modified to bind to a nucleotide sequence within the packaging region of the MSD mutant lentiviral vector genome sequence.

[0310] In some embodiments, the modified U1 snRNA is modified at the 5' end compared to the endogenous U1 snRNA to introduce heterologous sequences complementary to the nucleotide sequence within the packaging region of the MSD mutant lentiviral vector genome.

[0311] In some embodiments, the modified U1 snRNA has a modified 5' end compared to endogenous U1 snRNA, introducing a heterologous sequence complementary to the nucleotide sequence within the packaging region of the MSD mutant lentiviral vector genome into the natural splice donor annealing sequence.

[0312] Modified U1 snRNA can be modified at the 5' end of endogenous U1 snRNA, and the sequence containing the natural splice donor annealing sequence can be replaced with a heterologous sequence complementary to that nucleotide sequence.

[0313] Modified U1 snRNA may be a modified U1 snRNA variant. The U1 snRNA variant modified according to the present invention may be a naturally occurring U1 snRNA variant, a U1 snRNA variant containing a mutation in the stem-loop I region that removes U1-70K protein binding, or a U1 snRNA variant containing a mutation in the stem-loop II region that removes U1A protein binding. The U1 snRNA variant containing a mutation in the stem-loop I region that removes U1-70K protein binding may be U1_m1 or U1_m2, preferably U1A_m1 or U1A_m2.

[0314] In some embodiments, the modified U1 snRNA described herein includes a nucleotide sequence having at least 70% identity (appropriately at least 75%, at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity) with the main U1 snRNA sequence [cloverleaf] (nt 410-562) of the U1_256 sequence described herein. In some embodiments, the modified U1 snRNA of the present invention includes the main U1 snRNA sequence [cloverleaf] (nt 410-562) of the U1_256 sequence (SEQ ID NO: 15). The main U1 snRNA sequence [cloverleaf] (nt 410-562) of the U1_256 sequence (SEQ ID NO: 15) is as follows: GCAGGGGAGATACCATGATCACGAAGGTGGTTTTCCCAGGGCGAGGCTTATCCATTGCACTCCGGATGTGCTGACCCCTGCGATTTCCCCAAATGTGGGAAACTCGACTGCATAATTTGTGGTAGTGGGGGACTGCGTTCGCGCTTTCCCCTG. (SEQ ID NO: 66)

[0315] In some preferred embodiments, the first 11 nucleotides of the U1 snRNA containing the natural splice donor annealing sequence may be replaced in whole or in part with heterologous sequences complementary to the nucleotide sequence in the packaging region of the MSD mutant lentiviral vector genome. Preferably, the nucleic acids of the first 11 nucleotides of the U1 snRNA (1-11, preferably 2-11, 3-11, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11) are replaced with heterologous sequences complementary to the nucleotide sequence in the packaging region of the MSD mutant lentiviral vector genome.

[0316] In some embodiments, the natural splice donor annealing sequence may be replaced in whole or in part with a heterologous sequence complementary to the nucleotide sequence in the packaging region of the MSD mutant lentiviral vector genome. Suitablely, 1-11 (preferably 2-11, 3-11, 5-11, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11), the nucleic acids of the natural splice donor annealing sequence are replaced with a heterologous sequence complementary to the nucleotide sequence in the packaging region of the MSD mutant lentiviral vector genome. In preferred embodiments, the entire natural splice donor annealing sequence is replaced with a heterologous sequence complementary to the nucleotide sequence in the packaging region of the MSD mutant lentiviral vector genome; that is, the natural splice donor annealing sequence (e.g., 5'-ACUUACCUG-3') is completely replaced with the heterologous sequence described herein.

[0317] In some embodiments, the heterologous sequence complementary to the nucleotide sequence in the packaging region of the MSD mutant lentiviral vector genome includes at least 7 nucleotides complementary to that nucleotide sequence. In some embodiments, the heterologous sequence complementary to the nucleotide sequence in the packaging region of the MSD mutant lentiviral vector genome includes at least 9 nucleotides complementary to that nucleotide sequence. Preferably, the heterologous sequence for use in the present invention includes 15 nucleotides complementary to that nucleotide sequence.

[0318] Suitablely, heterologous sequences for use in the present invention may contain 7 to 25 (preferably 7 to 20, 7 to 15, 9 to 15, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25) nucleotides.

[0319] Suitablely, heterologous sequences for use in the present invention may include 25 nucleotides.

[0320] In some embodiments, the nucleotide sequences within the packaging region of the MSD mutant lentiviral vector genome are located within sequences derived from the 5' U5 domain, PBS element, SL1 element, SL2 element, SL3ψ element, SL4 element, and / or the gag gene. Preferably, the nucleotide sequences within the packaging region of the MSD mutant lentiviral vector genome are located within (one or more) SL1, SL2, and / or SL3ψ elements. In some preferred embodiments, the nucleotide sequences within the packaging region of the MSD mutant lentiviral vector genome are located within (one or more) SL1 and / or SL2 elements. In some particular preferred embodiments, the nucleotide sequences within the packaging region of the MSD mutant lentiviral vector genome are located within SL1.

[0321] In some embodiments, the nucleotide sequence within the packaging region of the MSD mutant lentiviral vector genome includes at least 7 nucleotides. In some embodiments, the nucleotide sequence within the packaging region of the MSD mutant lentiviral vector genome includes at least 9 nucleotides. Preferably, the nucleotide sequence within the packaging region of the MSD mutant lentiviral vector genome includes 7 to 25 (preferably 7 to 20, 7 to 15, 9 to 15, 7, 8, 9, 10, 11, 12, 13, 14, or 15) nucleotides.

[0322] Preferably, the nucleotide sequence within the packaging region of the MSD mutant lentiviral vector genome contains 15 nucleotides.

[0323] Binding of the modified U1 snRNA described herein to the nucleotide sequence within the packaging region of the MSD mutant lentiviral vector genome may enhance the lentiviral vector titer during lentiviral vector production compared to lentiviral vector production in the absence of the modified U1 snRNA described herein. Therefore, lentiviral vector production in the presence of the modified U1 snRNA described herein increases the lentiviral vector titer compared to lentiviral vector production in the absence of the modified U1 snRNA described herein. Suitable assays for measuring lentiviral vector titer are described herein. Appropriately, lentiviral vector production involves the co-expression of the modified U1 snRNA with vector components including gag, env, rev, and the lentiviral vector RNA genome. The lentiviral vector RNA genome may be the MSD-2KO RNA genome. In some embodiments, the enhancement of lentiviral vector titer occurs in the presence or absence of a functional 5'LTR polyA site. In some embodiments, the enhancement of lentiviral vector titers mediated by the modified U1 snRNA of the present invention is independent of polyA site repression in the 5'LTR of the vector genome.

[0324] In some embodiments, binding of the modified U1 snRNA described herein to the nucleotide sequence within the packaging region of the MSD mutant lentiviral vector genome can increase the titer of the lentiviral vector during lentiviral vector production by at least 30% compared to lentiviral vector production in the absence of the modified U1 snRNA described herein. Appropriately, the binding of the modified U1 snRNA described herein to the nucleotide sequence within the packaging region of the MSD mutant lentiviral vector genome may increase the titer of the MSD mutant lentiviral vector in production by at least 35% (appropriately, at least 40%, 45%, 50%, 60%, 70%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 550%, 600%, 650%, 700%, 750%, 800%, 850%, 900%, 950%, 1,000%, 2,000%, 5,000%, or 10,000%) compared to the production of the MSD mutant lentiviral vector in the absence of the modified U1 snRNA described herein.

[0325] The modified U1 snRNAs described herein may be designed by (a) selecting a target site (a pre-selected nucleotide site) within the packaging region of an MSD mutant lentiviral vector genome for binding to the modified U1 snRNA, and (b) introducing a heterologous sequence complementary to the pre-selected nucleotide site selected in step (a) at the 5' end of the U1 snRNA within a natural splice donor annealing sequence (e.g., 5'-ACUUACCUG-3').

[0326] The introduction of heterologous sequences complementary to the natural splice donor annealing sequence (e.g., 5'-ACUUACCUG-3') at the 5' end of endogenous U1 snRNA, or to an alternative target site, using conventional techniques in molecular biology, is within the capabilities of those skilled in the art. Generally speaking, appropriate routine methods include directional mutagenesis or substitution by homologous recombination.

[0327] It is within the capabilities of those skilled in the art to modify the natural splice donor annealing sequence (e.g., 5'-ACUUACCUG-3') at the 5' end of endogenous U1 snRNA to have the same sequence as a heterologous sequence complementary to the target site, using conventional techniques in molecular biology. For example, suitable methods include directional mutagenesis or random mutagenesis followed by selection of mutations that provide the modified U1 snRNA described herein.

[0328] The modified U1 snRNAs described herein can be produced according to methods generally known in the art. For example, the modified U1 snRNAs can be produced by chemical synthesis or recombinant DNA / RNA technology.

[0329] In one embodiment, the nucleotide sequence encoding the modified U1 snRNA may be on a different nucleotide sequence, for example, on a different plasmid.

[0330] Introducing the nucleotide sequence encoding the modified U1 snRNA described herein into cells using conventional molecular and cell biology techniques is within the capabilities of those skilled in the art.

[0331] Improved TRAP binding site and Kozak sequence combination As described above, the TRIP system, described in International Publication No. 2015 / 092440, provides a method for suppressing NOI expression in producing cells during vector production. TRAP-binding sequence (e.g., TRAP-tbs) interactions form the basis of transgene protein suppression systems for retroviral vector production, particularly when it is desirable that constitutive and / or potent promoters, including tissue-specific promoters, drive the transgene, especially when the expression of the transgene protein in producing cells leads to a decrease in vector titer and / or induces an immune response in vivo due to viral vector delivery of the transgene-derived protein (Maunder et al, Nat Commun. (2017) Mar 27;8).

[0332] In one embodiment, the nucleotide sequence further comprises a tryptophan RNA-binding attenuation protein (TRAP) binding site or a portion thereof.

[0333] In one embodiment, the present invention provides a nucleic acid sequence comprising a target nucleotide (transgene) and a tryptophan RNA-binding attenuation protein (TRAP) binding site, wherein the TRAP binding site overlaps with the transgene start codon ATG.

[0334] Any disclosure herein relating to Kozak sequences / duplicate Kozak sequences is equally applicable (where appropriate) to equivalent embodiments referring to the ATG of the start codon and its duplication.

[0335] In another aspect, the present invention provides a nucleic acid sequence comprising a target nucleotide and a Kozak sequence, wherein the Kozak sequence comprises a portion of a tryptophan RNA-binding attenuation protein (TRAP) binding site.

[0336] In one embodiment, the present invention provides a nucleic acid sequence comprising a target nucleotide (transgene) and a TRAP binding site, wherein the TRAP binding site comprises a portion of the transgene start codon ATG, or vice versa.

[0337] In one embodiment, the nucleotide sequence further comprises the tbs or a portion thereof as described herein, a multicloning site (MCS), and the Kozak sequence as described herein, wherein the MCS is located downstream of the tbs or a portion thereof and upstream of the Kozak sequence. Preferably, the tbs or a portion thereof and the Kozak sequence do not overlap.

[0338] In some embodiments of the present invention, the nucleotide of interest is operably ligated to a tbs or a portion thereof. In some embodiments, the nucleotide of interest is translated in target cells lacking TRAP.

[0339] TBS or a portion thereof can interact with TRAP such that the translation of the target nucleotide is suppressed or prevented in the viral vector-producing cell.

[0340] Therefore, a method is provided for suppressing NOI translation in viral vector-producing cells, comprising introducing the nucleotide sequence and the nucleic acid sequence encoding TRAP of the present invention into viral vector-producing cells, wherein TRAP binds to a TRAP binding site or a part thereof, thereby suppressing NOI translation.

[0341] Table 1 shows sequences that may be used in the present invention, where K may be T or G, “R” should be understood to specify a purine (i.e., A or G) at that position in the sequence, “V” should be understood to specify any nucleotide from G, A, or C, and “N” should be understood to specify any nucleotide at that position in the sequence. For example, this could be G, A, T, C, or U. TRAP binding site (tbs) sequences or 3'tbs sequences are shown in italics, multicloning sites (MCS) are shown underlined, and Kozak sequences are shown in bold.

[0342] [Table 2] TIFF0007883952000003.tif255164TIFF0007883952000004.tif254163TIFF000 7883952000005.tif250165TIFF0007883952000006.tif254165TIFF00078839520 00007.tif253165TIFF0007883952000008.tif252164TIFF0007883952000009.t if253164TIFF0007883952000010.tif254165TIFF0007883952000011.tif198164

[0343] Tryptophan RNA-binding attenuation protein (TRAP) is a bacterial protein widely characterized in Bacillus subtilis. TRAP is described in International Publication No. 2015 / 092440.

[0344] Because bacterial gene sequences are likely not optimal for expression in mammalian cells, the TRAP open reading frame can be codon-optimized for expression in mammalian (e.g., Homo sapiens) cells. Sequences can also be optimized by removing potentially unstable sequences and splicing sites. The use of a C-terminally expressed HIS tag on the TRAP protein appears to provide benefits with respect to translational repression and may be used. This C-terminal HIS tag may improve the solubility or stability of TRAP in eukaryotic cells, but this cannot negate the improved functional benefits. Nevertheless, both HIS-tagged and untagged TRAP enabled robust repression of transgene expression. Certain cis-acting sequences within the TRAP transcription unit can also be optimized; for example, the EF1α promoter-driven construct enables better repression at lower doses of the TRAP plasmid compared to the CMV promoter-driven construct in transient transfection situations.

[0345] In one embodiment, the TRAP used in the present invention is derived from bacteria.

[0346] In one embodiment of the present invention, TRAP is derived from a Bacillus species, such as Bacillus subtilis. For example, TRAP may include the sequence shown in Sequence ID No. 94.

[0347] In a preferred embodiment of the present invention, SEQ ID NO: 94 is C-terminally tagged with six histidine amino acids (HISx6 tag).

[0348] In an alternative embodiment, TRAP is derived from Aminomonas paucivorans. For example, TRAP may include the sequence shown in Sequence ID No. 95.

[0349] In alternative embodiments, TRAP is derived from desulfotomaculum hydrothermare. For example, TRAP may include the sequence shown in SEQ ID NO: 96.

[0350] In an alternative embodiment, TRAP is derived from B. stearothermophilus. For example, TRAP may include the sequence shown in SEQ ID NO: 97.

[0351] In an alternative embodiment, TRAP is derived from B. stearothermophilus S72N. For example, TRAP may include the sequence shown in SEQ ID NO: 98.

[0352] In an alternative embodiment, TRAP is derived from B. halodurans. For example, TRAP may include the sequence shown in SEQ ID NO: 99.

[0353] In alternative embodiments, TRAP is derived from carboxydoterms hydrogenformane. For example, TRAP may include the sequence shown in Sequence ID No. 100.

[0354] In one embodiment, TRAP is encoded by the tryptophan RNA-binding attenuation protein gene family mtrB (e.g., the TrpBP superfamily with NCBI preserved domains database #cl03437).

[0355] In a preferred embodiment, TRAP is C-terminally tagged with six histidine amino acids (HISx6 tag).

[0356] In a preferred embodiment, TRAP comprises an amino acid sequence having 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100% identity with any of SEQ ID NOs 94-100, and which interacts with an RNA binding site to modify, for example, suppress or prevent the expression of an operablely linked NOI in a viral vector-producing cell.

[0357] In a preferred embodiment, the TRAP has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, or 100% identity with any of sequence numbers 94-100, and includes an amino acid sequence that interacts with an RNA binding site to modify, for example, suppress or prevent the expression of an operablely linked NOI in a viral vector-producing cell.

[0358] In another embodiment, TRAP may be encoded by a polynucleotide comprising a nucleotide sequence encoding a protein that interacts with an RNA binding site to modify, for example, suppress or prevent the expression of a operably linked NOI in a viral vector-producing cell. For example, TRAP may be encoded by a polynucleotide comprising a nucleotide sequence encoding the protein of SEQ ID NOs 94-100.

[0359] All variants, fragments, or homologs of TRAP for use in the present invention retain the ability to bind to the TRAP binding site described herein such that the translation of NOI (which may be a marker gene) is suppressed or prevented in viral vector-producing cells.

[0360] TRAP binding site The term "binding site" should be understood as a nucleic acid sequence that can interact with a specific protein.

[0361] The consensus TRAP-binding site sequence that can bind to TRAP is one that is repeated multiple times (e.g., 6, 7, 8, 9, 10, 11, 12 or more times) [KAGNN], and such sequences are found in the natural trp operon. In the natural context, sometimes AAGNN is acceptable, and sometimes additional "spacing" N nucleotides result in a functional sequence. In vitro experiments have demonstrated that at least 6 or more consensus repeats are required for TRAP-RNA binding (Babitzke P, YJ, Campanelli D. (1996) Journal of Bacteriology 178(17):5159-5163). Therefore, preferably, in one embodiment, six or more consecutive [KAGN] repeats are present within the trb. ≧2 The sequence exists, and K can be T or G in DNA and U or G in RNA.

[0362] In the case of TRAP as an RNA-binding protein, the TRIP system preferably functions best with a tbs sequence containing at least eight KAGNN repeats, although robust transgene repression can still be obtained using seven repeats, and sufficient repression of the transgene to a level where the vector titer can be rescued can be obtained using six repeats. The KAGNN consensus sequence may be modified to maintain TRAP-mediated repression, but preferably the selected exact sequence may be optimized to ensure a high level of translation in the unrepressed state. For example, the tbs sequence may be optimized by removing splicing sites, unstable sequences, or stem-loops that may interfere with mRNA translation efficiency in the absence of TRAP (i.e., in target cells). With respect to the configuration of KAGNN repeats in a given tbs, the number of N "spacing" nucleotides between KAG repeats is preferably 2. However, tbs containing three or more N spacers between at least two KAG repeats may be acceptable (as determined by in vitro binding studies, as many as 50% of repeats containing three Ns can result in functional tbs; Babitzke P, YJ, Campanelli D. (1996) Journal of Bacteriology 178(17):5159-5163). In fact, 11x KAGNN tbs sequences have been shown to tolerate up to three substitutions with KAGNNN repeats and still retain some potentially useful translational inhibitory activity in conjunction with TRAP binding.

[0363] In one embodiment of the present invention, the TRAP binding site or a part thereof is the sequence KAGN ≧2 (For example, KAGN 2-3 ) includes. Therefore, to avoid misunderstanding, this tbs or any part thereof includes, for example, any of the following repeating sequences: UAGNN, GAGNN, TAGNN, UAGNNN, GAGNNN, or TAGNNN.

[0364] "N" should be understood to specify any nucleotide at that position in the sequence. For example, this could be G, A, T, C, or U. The number of such nucleotides is preferably 2, but up to 3, e.g., 1, 2, or 3, and the KAG repeats or a portion thereof of the 11x repeat TBS may be separated by nucleotides spaced 3 apart, still retaining some TRAP binding activity that results in translational repression. Preferably, one or fewer N3 spacers will be used in the 11x repeat TBS or a portion thereof to retain maximum TRAP binding activity that results in translational repression.

[0365] In another embodiment, tbs or a part thereof is KAGN ≧2 Multiple iterations of (e.g., KAGN 2-3 Includes multiple repetitions of the above.

[0366] In another embodiment, tbs or a portion thereof includes multiple iterations of the sequence KAGN2.

[0367] In another embodiment, tbs or a part thereof is KAGN ≧2 at least 6 iterations (e.g., KAGN 2-3 This includes at least 6 iterations.

[0368] In another embodiment, tbs or part thereof includes at least six iterations of KAGN2. For example, tbs or part thereof may include six, seven, eight, nine, ten, eleven, twelve, or more iterations of KAGN2. For example, tbs or part thereof may include any one of sequence numbers 125-136 or 139.

[0369] In another embodiment, tbs or a part thereof is KAGN ≧2 At least 8 iterations (e.g., KAGN 2-3 Includes at least 8 repetitions of the above. For example, tbs or a portion thereof may include one of sequence numbers 125, 126, 131-134, or 137-24.

[0370] Preferably, the number of KAGNNN repeats present in the tbs or part thereof is 1 or less. For example, the tbs or part thereof may include one of sequence numbers 125, 126, 131-134, or 136-141.

[0371] In another embodiment, tbs or a part thereof is KAGN ≧2 11 iterations (for example, KAGN 2-3 It includes 11 iterations of the above. Preferably, the number of KAGNNN iterations present in this TBS or part thereof is 3 or less. For example, the TBS or part thereof may include one of sequence numbers 125, 126, 131, 137-139.

[0372] In another embodiment, tbs or a part thereof is KAGN ≧2 12 iterations (for example, KAGN 2-3 This includes 12 repetitions.

[0373] In a preferred embodiment, tbs or part thereof include 8 to 11 iterations of KAGN2 (e.g., 8, 9, 10, or 11 iterations of KAGN2). For example, tbs or part thereof may include any one of sequence numbers 125, 126, 131-134, or 137-141.

[0374] In one embodiment, the TRAP binding site or a part thereof may include any of SEQ ID NOs: 125 to 141.

[0375] For example, the TRAP binding site or a part thereof may include the sequence shown in SEQ ID NO: 125 or SEQ ID NO: 126.

[0376] "KAGN" ≧2 "Repetition of" is a general term for KAGN ≧2 (For example, KAGN 2-3 ) The motif is understood to be repeated. Different KAGNs that meet the criteria of this motif ≧2Sequences may be concatenated to form a TBS or part thereof. While this possibility is included in the definition, it is not intended that the resulting TBS or part thereof is limited to just one sequence repetition that satisfies the requirements of this motif. For example, "KAGN ≧2 The "6 iterations of" include, but are not limited to, the sequences shown in sequence numbers 127-130.

[0377] Eight-repeat TBS sequences or parts thereof containing one KAGNNN repeat and seven KAGNN repeats retain TRAP-mediated inhibitory activity. Less than eight repeat TBS sequences or parts thereof containing one or more KAGNNN repeats (e.g., seven or six repeat TBS sequences or parts thereof) may have lower TRAP-mediated inhibitory activity. Therefore, when fewer than eight repeats are present, it is preferable that the TBS or parts thereof contain only KAGNN repeats.

[0378] Preferred nucleotides for use in the KAGNN repeat consensus are the pyrimidine at the NN spacer position, the pyrimidine at the first NN spacer position, the pyrimidine at both NN spacer positions, and the pyrimidine at at least one of the Gs at the K position.

[0379] Furthermore, if the NN spacer position is AA (i.e., TAGAA is preferably not used as an iteration in the consensus sequence), then G is preferably used at position K.

[0380] "Able to interact" should be understood as meaning that the nucleic acid binding site (e.g., tbs or a part thereof) can bind to a protein, such as TRAP, under the conditions encountered in a cell, such as a eukaryotic viral vector-producing cell. Such interactions with RNA-binding proteins such as TRAP result in the suppression or prevention of translation of the NOI to which the nucleic acid binding site (e.g., tbs or a part thereof) is operably linked.

[0381] It should be understood that "operably coupled" means that the described components are in a relationship that enables them to function in the intended way. Therefore, a tbs or part thereof operably coupled to an NOI for use in this invention is arranged such that the translation of the NOI is altered when the TRAP is coupled to the tbs or part thereof.

[0382] By positioning a tbs (tubules) or a portion thereof that can interact with TRAP upstream of the NOI translation start codon of a given open reading frame (ORF), specific translational repression of mRNA derived from that ORF becomes possible. The number of nucleotides separating the tbs or a portion thereof from the translation start codon can vary, for example, from 0 to 34 nucleotides, without affecting the degree of repression. As a further example, 0 to 13 nucleotides can be used to separate the TRAP binding site or a portion thereof from the translation start codon.

[0383] TBS, or parts thereof, can be positioned downstream of the internal ribosome entry site (IRES) to repress the translation of NOI in multicistronic mRNA. Indeed, this provides further evidence that tbs-bound TRAP can block the passage of 40S ribosomes, and that IRES elements function to sequester 40S ribosomal subunits to mRNA in a CAP-independent manner before the formation of a complete translation complex (see Thompson, S. (2012) Trends in Microbiology 20(11):558-566). Thus, the TRIP system can repress multiple open reading frames from a single mRNA expressed from a viral vector genome. This is a useful feature of the TRIP system when constructing vectors encoding multiple therapeutic genes, especially when all transgene products may have some adverse effect on the vector titer.

[0384] In one embodiment, the nucleotide sequence includes a spacer sequence between the IRES and the tbs or a portion thereof. The IRES may be an IRES described herein under the subheading “Internal Ribosome Entry Site”. The spacer sequence may be 0 to 30 nucleotides long, preferably 15 nucleotides long. The spacer may include a sequence defined by any one of SEQ ID NOs: 151 to 157, preferably the spacer includes a sequence defined by SEQ ID NO: 151.

[0385] In one embodiment, the spacer sequence between the IRES and the tbs or a portion thereof is 3 or 9 nucleotides from the 3' end of the tbs or a portion thereof and the downstream start codon of the NOI.

[0386] In one embodiment, the tbs or a portion thereof lack a type II restriction enzyme site. In a preferred embodiment, the tbs or a portion thereof lack a Sap I restriction enzyme site.

[0387] In some embodiments, the nucleotide sequence further comprises an RRE sequence or a functional substitution thereof.

[0388] Overlapping Kozak sequences and TRAP binding site sequences To our surprise, we found that improved repression levels could be achieved by "hiding" the Kozak sequence within the 3' end of the tbs or a portion thereof, compared to the use of non-duplication tbs and Kozak sequences (see Figures 19B and 19C for use of duplication tbs and Kozak sequences). Furthermore, all of the duplication Kozak and tbs sequences tested resulted in unexpectedly efficient levels of translation initiation; that is, the tested duplication sequences provided similar levels of transgene expression as non-duplication Kozak and tbs sequences in the absence of TRAP. While we do not wish to be constrained by theory, the improved repression levels may be due to improved blockage of the transgene initiation codon by the TRAP-tbs complex when the tbs or a portion thereof overlap with the Kozak sequence.

[0389] The term "Kozak sequence" should be understood as the consensus sequence of eukaryotic mRNA recognized by ribosomes as the translation initiation site. The Kozak sequence contains the ATG start codon (initiation codon, start codon) in DNA (AUG in mRNA). The exact Kozak sequence present in eukaryotic mRNA determines the efficiency of translation initiation; that is, a particular Kozak sequence may not result in efficient translation initiation.

[0390] A complete Kozak sequence is typically understood to have a DNA consensus sequence (gcc)gccRccATGG and an RNA consensus sequence (gcc)gccRccAUGG, where lowercase indicates the most common base at a position where the base can vary, uppercase indicates a highly conserved base at this position, "R" indicates that purine (i.e., A or G) is typically optimal at this position, and the sequence in parentheses (gcc) has an uncertain meaning. T / U are generally the least preferred nucleotides at all positions of the Kozak sequence consensus upstream of the start codon.

[0391] Since the first three bases of a complete Kozak sequence are of uncertain importance, the Kozak sequence can also be understood to have a consensus sequence, referred herein as the “extended Kozak sequence,” GNNRVVATGG for DNA (SEQ ID NO: 103) and GNNRVVAUGG for RNA, where “R” should be understood to designate a purine (i.e., A or G) at that position in the sequence, “V” should be understood to designate any nucleotide from G, A, or C, and “N” should be understood to designate any nucleotide at that position in the sequence. For example, “N” could be G, A, T, C, or U. Note that the positions -1 and “G” and “R” at position +3 (whereas “A” in ATG is at position 0) are considered to be the most important positions in terms of Kozak intensity. However, for the purposes of this specification, the position +3 is not considered part of the “core” Kozak sequence because the presence of “G” at position +3 in the transgene sequence depends on the encoded ORF.

[0392] The bases found at the first six positions of the full Kozak sequence are altered so that any base can be found at those positions (as shown above by (gcc)gcc). Thus, the full Kozak consensus sequence can be considered to include a “core” Kozak sequence consisting of a reduced-variability portion of the full Kozak sequence, as shown above by RccAUG. The “core” Kozak consensus sequence is defined herein as RVVAUG for mRNA and RVVATG for DNA, where “R” should be understood as specifying a purine (i.e., A or G) at that position in the sequence, and “V” should be understood as specifying any nucleotide from G, A, or C.

[0393] In one preferred embodiment of the present invention, the Kozak sequence comprises the sequence RVVATG (SEQ ID NO: 104), where "R" should be understood to specify a purine (i.e., A or G) at that position in the sequence, and "V" should be understood to specify any nucleotide from G, A, or C.

[0394] In one embodiment of the present invention, the Kozak sequence comprises the sequence RNNATG, where "R" should be understood to identify a purine (i.e., A or G) at its position in the sequence, and "N" should be understood to identify any nucleotide from G, A, T / U, or C, recognizing that the use of "T / U" may result in a decrease in expression levels in the absence of TRAP.

[0395] In some embodiments, the Kozak sequence overlaps with the 3' terminal KAGNN repeat of the TRAP binding site or a portion thereof. Therefore, the core Kozak sequence may overlap with the 3' terminal KAGNN repeat of the TRAP binding site or a portion thereof.

[0396] A summary of preferred duplicate TBS and Kozak consensus sequences is provided in Figure 19C.

[0397] In a preferred embodiment, the 3' terminal KAGNN repeat of the TRAP binding site or a portion thereof overlaps with at least the first, or the first two, nucleotides of the ATG triplet in the core Kozak sequence.

[0398] As described herein, in one embodiment of the present invention, the 3'-terminal KAGNN repeat of the TRAP binding site or a portion thereof overlaps with the ATG start codon of the target nucleotide (transgene ORF). In one embodiment, the 3'-terminal KAGNN repeat of the TRAP binding site or a portion thereof overlaps with the first one or two nucleotides of the ATG start codon of the target nucleotide (transgene ORF).

[0399] In one embodiment, the duplicated tbs-Kozak sequence may have the consensus sequence KAGNNG (SEQ ID NO: 113), where "NN" is the first two nucleotides in the ATG triplet of the Kozak sequence.

[0400] The consensus sequence can be KAGATG (sequence number 114), where "K" is either G or T / U.

[0401] In one embodiment, the duplicated tbs-Kozak sequence may be GAGATG (sequence number 142), as shown in Figure 19C.

[0402] In one embodiment, the 3' terminal KAGNN repeat of the TRAP binding site or a portion thereof overlaps with the first nucleotide of the ATG triplet in the target nucleotide.

[0403] In one embodiment, the sequence may include the sequence KAGNNTG (SEQ ID NO: 115), where the second "N" is the first nucleotide in the ATG triplet. The consensus sequence is KAGNATG (SEQ ID NO: 116), where "K" should be understood to specify G or T / U at that position in the sequence, and "N" should be understood to specify any nucleotide from G, A, T, U, or C, preferably "V", i.e., from G, A, or C. For example, a duplicate sequence may be KAGVATG (SEQ ID NO: 143), as shown in Figure 19C.

[0404] In one embodiment, the overlapping Kozak sequences and TRAP binding sites or parts thereof for use in the present invention include the sequences shown in SEQ ID NOs: 142-146.

[0405] In one embodiment, the nucleotide sequence of the present invention includes the sequences shown in SEQ ID NOs: 142-146. In one embodiment, the sequence of the present invention includes the sequence KAGATG.

[0406] Preferred duplicate TBS or a portion thereof for use in the nucleic acids of the present invention and core Kozak sequences corresponding to the consensus sequences GAGATG (SEQ ID NO: 142), KAGVATG (SEQ ID NO: 143), and KAGVVATG (SEQ ID NO: 144) include the sequences shown in SEQ ID NOs. 142 and 69-92, based on the consensus TBS repeat sequences of KAGNN as defined herein and the consensus "core" Kozak sequence RVVATG as defined herein.

[0407] In some embodiments, the nucleotide sequence includes the sequence shown in SEQ ID NOs: 147-150. Preferably, the nucleotide sequence includes the sequence shown in SEQ ID NOs: 147 or 148.

[0408] In a preferred embodiment, the nucleotide sequence of the present invention includes the duplicated tbs and Kozak sequence shown in SEQ ID NO: 106.

[0409] To improve the handling of the TRIP system, it is desirable to have the ability to directly clone the NOI into an expression cassette containing the promoter-5'UTR-tbs sequence via a selection of different restriction enzymes (REs), i.e., the ability to incorporate a multi-cloning site (MCS) between the tbs sequence and the Kozak sequence (see Figure 19A). We have demonstrated that several different MCSs can be tolerated by the TRIP system, i.e., that transgene repression is still obtained when an MCS is used. This was unexpected considering that the 5'UTR reader sequence can modulate the degree of TRAP-mediated repression, the proximity of the tbs to the ATG start codon is important, and an efficient Kozak sequence must be maintained with or between the start codons of the MCS and NOI to ensure efficient translation initiation. In addition, we were unable to predict the number and / or combinations of RE sites that could be used while maintaining TRAP-mediated repression.

[0410] Thus, sequence "compression" was necessary to maintain the efficient core Kozak sequence of RVVATG while incorporating several (overlapping) RE sites at the shortest possible distance from the tbs to the ATG start codon (in order to maintain the proximity of the tbs to the ATG).

[0411] In one embodiment, the nucleotide sequence further comprises the tbs or a portion thereof as described herein, a multicloning site (MCS), and the Kozak sequence as described herein, wherein the MCS is located downstream of the tbs or a portion thereof and upstream of the Kozak sequence. Preferably, the tbs or a portion thereof and the Kozak sequence do not overlap.

[0412] As used herein, a “multicloning site” should be understood as a DNA region containing several restriction enzyme recognition sites (restriction enzyme sites) that are very close to each other. In one embodiment, the RE sites may overlap in the MCS used in the present invention.

[0413] As used herein, a “restriction enzyme site” or “restriction enzyme recognition site” is a location on a DNA molecule containing a specific sequence of nucleotides, 4 to 8 nucleotides in length, that is recognized by a restriction enzyme. The restriction enzyme recognizes a specific RE site (i.e., a specific sequence) and cleaves DNA molecules within or near the RE site.

[0414] In one embodiment, the nucleotide sequence includes the sequences shown in SEQ ID NOs. 158-171.

[0415] In one embodiment, the nucleotide sequence includes the sequences shown in SEQ ID NOs. 165-171.

[0416] In one embodiment, the nucleotide sequence includes the sequence shown in SEQ ID NOs. 165, 168, or 171.

[0417] In a preferred embodiment, the nucleotide sequence of the present invention includes a duplicated tbs-MCS-Kozak sequence shown in SEQ ID NO: 107.

[0418] In one embodiment, the Kozak sequence comprises the sequence RNNATG, where "R" should be understood to specify a purine (i.e., A or G) at that position in the sequence, and "N" should be understood to specify any nucleotide from G, A, T / U, or C.

[0419] The suppression or prevention of NOI translation should be understood as a change in the amount of NOI product (e.g., protein) translated during viral vector production compared to the amount expressed in the absence of the nucleotide sequence of the present invention at an equivalent time point. Such a change in translation results in the suppression or prevention of the expression of the protein encoded by the NOI.

[0420] In one embodiment, the nucleotide sequence of the present invention can interact with TRAP such that the translation of the target nucleotide is suppressed or prevented in a viral vector-producing cell.

[0421] Translation of the NOI at any given time during vector preparation may be reduced to 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%, 4%, 3%, 2%, 1%, 0.5%, or 0.1% of the amount translated in the absence of the nucleotide sequence of the present invention at the same time during vector preparation.

[0422] Translation of the NOI at any given time during vector preparation may be reduced to less than 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%, 4%, 3%, 2%, 1%, 0.5%, or 0.1% of the amount translated in the absence of the nucleotide sequence of the present invention at the same time during vector preparation.

[0423] In the context of the present invention, the translation of the NOI at any given time during vector preparation may be reduced to 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%, 4%, 3%, 2%, 1%, 1%, 0.5%, or 0.1% of the amount translated at the same time during vector preparation in the presence of a nucleic acid sequence containing a non-overlapping Kozak sequence and a tbs sequence (as opposed to the nucleotide sequence of the present invention).

[0424] In the context of the present invention, the translation of the NOI at any given time during vector preparation may be reduced to less than 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%, 4%, 3%, 2%, 1%, 1%, 0.5%, or 0.1% of the amount translated at the same time during vector preparation in the presence of a nucleic acid sequence containing non-overlapping Kozak and tbs sequences (as opposed to the nucleotide sequence of the present invention).

[0425] Preventing the translation of NOIs should be understood as effectively reducing the amount of translation to zero.

[0426] The expression of the protein from the NOI at any given time point during vector preparation may be reduced to 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%, 4%, 3%, 2%, 1%, 0.5%, or 0.1% of the amount expressed at the same time point during vector preparation in the absence of the nucleotide sequence of the present invention.

[0427] The expression of the protein from the NOI at any given time point during vector preparation may be reduced to less than 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%, 4%, 3%, 2%, 1%, 0.5%, or 0.1% of the amount expressed at the same time point during vector preparation in the absence of the nucleotide sequence of the present invention.

[0428] In the context of the present invention, the expression of a protein from the NOI at any given time during vector preparation may be reduced to 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%, 4%, 3%, 2%, 1%, 1%, 0.5%, or 0.1% of the amount expressed at the same time during vector preparation in the presence of a nucleic acid sequence containing a non-duplicate Kozak sequence and a tbs sequence (as opposed to the nucleotide sequence of the present invention).

[0429] In the context of the present invention, the expression of a protein from the NOI at any given time during vector preparation may be reduced to less than 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%, 4%, 3%, 2%, 1%, 0.5%, or 0.1% of the amount expressed at the same time during vector preparation in the presence of a nucleic acid sequence containing a non-duplicate Kozak sequence and a tbs sequence (as opposed to the nucleotide sequence of the present invention).

[0430] Preventing protein expression from NOI should be understood as reducing the amount of expressed protein to virtually zero.

[0431] Methods for the analysis and / or quantification of NOI translations are well known in the art.

[0432] Protein products from lysed cells can be analyzed using methods such as SDS-PAGE analysis with visualization by Coomassi or silver staining. Alternatively, protein products can be analyzed using Western blotting or enzyme-linked immunosorbent assay (ELISA) with antibody probes that bind to the protein products. Protein products in intact cells can be analyzed by immunofluorescence.

[0433] In one embodiment, the distance from the start site / end of the promoter to the start of the TBS or part thereof is less than 34 nucleotides.

[0434] In one embodiment, the distance from the start site / end of the promoter to the start of the TBS or part thereof is less than 13 nucleotides.

[0435] In one embodiment, the nucleotide sequence is a vector-transformed gene expression cassette.

[0436] In one embodiment, the nucleic acid sequence of the present invention further comprises a promoter. Typically, transcription of the promoter results in a 5'UTR encoded in the resulting mRNA transcript. The promoter can be any promoter known in the art and suitable for controlling the expression of the nucleotide of interest. For example, the promoter may be EF1α, EFS, CMV, or CAG.

[0437] In a preferred embodiment, the overlapping tbs and Kozak sequences described herein are located within the 5'UTR of the promoter, the 5'UTR may contain a native sequence derived from the relevant promoter, or more preferably, the 5'UTR may consist of the 5'UTR sequence described herein.

[0438] In a preferred embodiment, the sequence containing a compressed / overlapped MCS between the tbs sequence and the Kozak sequence described herein is located within the 5'UTR.

[0439] The overlapping tbs and Kozak sequences described herein, or sequences containing compressed / overlapping MCS between the tbs and Kozak sequences described herein, may be located at the 3' end of the 5' UTR.

[0440] Preferably, the 5'UTR includes one of the following sequences: SEQ ID NOs: 29-37, 45-58, 69-92, and 108-116. More preferably, the 5'UTR includes SEQ ID NOs: 29 or 108. Even more preferably, the 5'UTR includes SEQ ID NOs: 29.

[0441] The promoter-5'UTR region may contain an intron. The intron may be a native intron or a heterologous intron. For example, the promoter may be EF1α or CAG.

[0442] The promoter could be a viral vector genome that does not contain introns, such as the promoter typically used in CMV.

[0443] In a preferred embodiment, the promoter-5'UTR region is manipulated to include an artificial 5'UTR containing a heterologous intron. Thus, the promoter-5'UTR region is manipulated to contain a heterologous exon-intron-exon sequence, and the mature 5'UTR encoded in the mRNA transcript arises from the splicing out of the intron. The promoter-5'UTR sequence can be manipulated using methods known in the art. For example, the promoter may be manipulated as described herein.

[0444] Preferably, the expression of the transgene protein from the mature mRNA resulting from the splicing out of an intron or heterologous intron is efficiently suppressed by TRAP. Appropriately, the intron or heterologous intron may be the EF1α intron sequence according to SEQ ID NO: 122.

[0445] Introns or heterologous introns may be located upstream, i.e., at 5', of the overlapping tbs and Kozak sequences described herein or sequences containing an MCS between the tbs and Kozak sequences described herein.

[0446] The 5'UTR may contain the following sequence (chicken β-actin / rabbit β-globin chimeric 5'UTR-intron, bolded exon sequence (which splices together to form the 5'UTR leader)).

[0447] The 5'UTR may contain the sequence shown in sequence number 121.

[0448] The 5'UTR may contain the sequence shown in sequence number 122.

[0449] In one embodiment, the promoter includes the sequence shown in sequence number 123.

[0450] In one embodiment, the promoter includes the sequence shown in sequence number 124.

[0451] In one embodiment, the promoter includes the sequence shown in sequence number 117.

[0452] In one embodiment, the promoter includes the sequence shown in sequence number 118.

[0453] The spliced ​​sequence corresponding to sequence number 117 is shown in sequence number 119.

[0454] The spliced ​​sequence corresponding to sequence number 118 is shown in sequence number 120.

[0455] Improved reader layout When applying the TRIP system to different promoters (containing different native 5'UTRs of different lengths and compositions), it is desirable that the tbs sequence can be simply applied within the promoter-UTR context to achieve efficient repression by TRAP, while also maintaining good levels of expression without TRAP. From the outset of this study, it was unknown what level of repression achievable by TRAP-tbs would be when tbs were inserted into the native UTRs of various constitutive promoters. Ideally, to avoid any of the potential variability in repression levels that may be induced by native 5'UTR sequences, it would be advantageous to be able to supply a single conserved 5'UTR leader sequence along with the tbs when modifying a selected promoter. Surprisingly, the first exon of the EF1α promoter (SEQ ID NO: 101) was found to provide consistently good levels of transgene repression by TRAP compared to 5'UTR leaders containing native leader sequences, and this leader also provided good levels of transgene expression in the absence of TRAP.

[0456] In some embodiments, the nucleotide sequence includes a 5' leader sequence upstream of the TBS or a portion thereof. The leader sequence may be immediately upstream of the TRAP binding site or a portion thereof, i.e., no further sequence can separate the leader sequence from the TRAP binding site or a portion thereof. If the 5' leader originates from a splicing event, the sequence from the exon / exon junction to the TBS should be kept to a minimum length (preferably ≤12nt). The leader sequence may include a sequence derived from the non-coding EF1α exon 1 region. In preferred embodiments, the leader sequence includes the sequence defined by SEQ ID NO: 101, SEQ ID NO: 102, or SEQ ID NO: 93.

[0457] Exemplary nucleotide sequences An exemplary nucleotide sequence of the present invention is shown below.

[0458] Sequence ID 172-L33 is an improved leader, containing an exemplary nucleotide sequence 1 containing the optimal (overlapping) tbs([KAGNN]8)-Kozak conjugate. CTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGAGTTTAGCGGAGTGGAGAAGAGCGGAGCCGAGCCGAGATG

[0459] Sequence ID 173-L33 Improved reader, optimal (duplicate) tbs([KAGNN] 11 )-Kozak junction-containing exemplary nucleotide sequence 2 CTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGAGTTTAGCGGAGTGGAGAAGAGCGGAGCCGAGCCTAGCAGAGACGAGCCGAGATG

[0460] Sequence ID 174-L12 Improved reader, optimal (duplicate) tbs([KAGNN] 11 )-Kozak-containing exemplary nucleotide sequence 3 CTTTTTCGCAACGAGTTTAGCGGAGTGGAGAAGAGCGGAGCCGAGCCTAGCAGAGACGAGCCGAGATG

[0461] Sequence ID 175-L33, optimal (duplicate) tbs([KAGNN] 11 Exemplary nucleotide sequence 4 of the intron-containing 5'UTR, resulting in a spliced ​​leader containing a )-Kozak junction. CTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAAGAGTTTAGCGGAGTGGAGAAGAGCGGAGCCGAGCCTAGCAGAGACGAGCCGAGATG

[0462] Sequence ID 176 - Exemplary nucleotide sequence 5 containing an improved spacer, optimal (overlapping) tbs([KAGNN]8)-Kozak junction. ATAGCAGAGACGGCTGAGTTTAGCGGAGTGGAGAAGAGCGGAGCCGAGCCGAGATG

[0463] Sequence ID 177-L33 Improved reader tbs([KAGNN] 11 )-MCS-Kozak-containing exemplary nucleotide sequence 6 CTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGAGTTTAGCGGAGTGGAGAAGAGCGGAGCCGAGCCTAGCAGAGACGAGAA GAGCTCTAGA CCATG

[0464] Sequence ID 178 - Improved spacer, tbs([KAGNN] 11 )-MCS-Kozak-containing exemplary nucleotide sequence 7 ATAGCAGAGACGGCTGAGTTTAGCGGAGTGGAGAAGAGCGGAGCCGAGCCTAGCAGAGACGAGAA GAGCTCTAGA CCATG

[0465] In one embodiment, the nucleotide sequence includes one of sequence numbers 172 to 178.

[0466] In one embodiment, the nucleotide sequence is: (a)(i) Sequence IDs 101 or 102, and / or (ii) Any one of sequence numbers 151 to 157, (b) Any one of sequence numbers 127-130, 132-136, 140, and 141, and (c)(i) Any one of sequence numbers 142 to 149, preferably any one of sequence numbers 147 to 149, or (ii) Any one of sequence numbers 158 to 171, preferably any one of sequence numbers 165 to 171, Includes.

[0467] In one embodiment, the nucleotide sequence is: (a) Sequence ID 101 or 102, (b) Any one of sequence numbers 127-130, 133-136, 140, and 141, and (c) Any one of sequence numbers 142 to 149, preferably any one of sequence numbers 147 to 149, Includes.

[0468] In one embodiment, the nucleotide sequence is: (a) Any one of sequence numbers 151-157, (b) Any one of sequence numbers 127-130, 133-136, 140, and 141, and (c) Any one of sequence numbers 142 to 149, preferably any one of sequence numbers 147 to 149, Includes.

[0469] In one embodiment, the nucleotide sequence is: (a) Sequence ID 101 or 102, (b) Any one of sequence numbers 127-130, 132-136, 140, and 141, and (c) Any one of sequence numbers 157 to 171, preferably any one of sequence numbers 165 to 171, Includes.

[0470] In one embodiment, the nucleotide sequence is: (a) Any one of sequence numbers 151-157, (b) Any one of sequence numbers 127-130, 132-136, 140, and 141, and (c) Any one of sequence numbers 157 to 171, preferably any one of sequence numbers 165 to 171, Includes.

[0471] The implementation of this invention will utilize the prior art of chemistry, molecular biology, microbiology, and immunology, which is within the scope of the skills of those skilled in the art, unless otherwise specified. Such art is described in the literature. For example, J. Sambrook, EFFritsch, and T. Maniatis (1989) Molecular Cloning: A Laboratory Manual, Second Edition, Books 1-3, Cold Spring Harbor Laboratory Press; Ausubel, FMet al. (1995 and periodic supplements) Current Protocols in Molecular Biology, Ch. 9, 13, and 16, John Wiley & Sons, New York, NY;B.Roe,J.Crabtree,and A.Kahn(1996)DNA Isolation and Sequencing:Essential Techniques,John Wiley&Sons;JMPolak and James O'D.McGee(1990)In Situ Hybridization:Principles and Practice;Oxford University Press;MJGait(ed.)(1984)Oligonucleotide Synthesis:A Practical Approach,IRL Press;and,DMJLilley and JEDahlberg(1992)Methods See *of Enzymology: DNA Structure Part A: Synthesis and Physical Analysis of DNA Methods in Enzymology*, Academic Press. Each of these general texts is incorporated herein by reference.

[0472] This disclosure is not limited to the exemplary methods and materials disclosed herein, and any methods and materials similar or equivalent to those described herein may be used in carrying out or testing embodiments of this disclosure. Numerical ranges include the number defining the range. Unless otherwise indicated, any nucleic acid sequence is written from left to right in the 5' to 3' direction, and amino acid sequences are written from left to right in the amino to carboxyl orientation, respectively.

[0473] Where a range of values ​​is provided, unless explicitly indicated in the context, each intervening value between the upper and lower limits of that range, up to one-tenth of the lower limit, is also specifically disclosed. Each smaller range between any stated value or intervening value within the stated range and any other stated value or intervening value within that stated range is included in this disclosure. The upper and lower limits of these smaller ranges may be independently included in or excluded from the range, and each range in which either the upper and lower limits are included, neither is included, or both are included, subject to any specifically excluded limits within the stated range, is also included in this disclosure. Where a stated range includes one or both limits, the range excluding one or both of those limits is also included in this disclosure.

[0474] When used herein and in the appended claims, the singular forms "a," "an," and "the" refer to multiple subjects unless otherwise explicitly indicated by the context.

[0475] As used herein, the terms “comprising,” “comprises,” and “comprised of” are synonymous with “including,” “includes,” or “containing,” and are comprehensive or open-ended, and do not exclude additional unlisted components, elements, or process steps. The terms “comprising,” “comprises,” and “comprised of” also include “consisting of.”

[0476] The publications discussed herein are provided solely for their disclosure prior to the filing date of this application. Nothing in this specification should be construed as an acknowledgment that such publications constitute prior art to the attached claims.

[0477] The present invention will now be further illustrated by examples, which are intended to help those skilled in the art to carry out the invention and are not intended in any way to limit the scope of the invention.

[0478] [Examples] General molecular / cellular biology techniques and assays Modified U1 snRNA expression construct DNA-based expression constructs for modified U1 snRNAs include conserved sequences in the endogenous U1 snRNA gene that drive RNA transcription and termination, as highlighted below in a non-limiting example of 256U1 (also known as U1_256) snRNA: TAAGGACCAGCTTCTTTGGGAGAGAACAGACGCAGGGGCGGGAGGGAAAAAGGGAGAGGCAGACGTCACTTCCCCTTGGCGGCTCTGGCAGCAGATTGGTCGGTTGAGTGGCAGAAAGGCAGACGGGGACTGGGCAAGGC ACTGTCGGTGACATCACGGACAGGGCGACTTCTATGTAGATGAGGCAGCGCAGAGGCTGCTGCTTCGCCACTTGCTGCTTCACCACGAAGGAGTTCCCGTGCCCTGGGAGCGGGTTCAGGACCGCTGATCGGAAGTGAGAA TCCCAGCTGTGTGTCAGGGCTGGAAAGGGCTCGGGAGTGCGCGGGGCAAGTGACCGTGTGTGTAAAGAGTGAGGCGTATGAGGCTGTGTCGGGGCAGAGGCCCAAGATCTCatttgccgtgcgcgcttGCAGGGGAGATA CCATGATCACGAAGGTGGTTTTCCCAGGGCGAGGCTTATCCATTGCACTCCGGATGTGCTGACCCCTGCGATTTCCCCAAATGTGGGAAACTCGACTGCATAATTTGTGGTAGTGGGGGACTGCGTTCGCGCTTTCCCCTG GTTTCAAAAGTAGACTGTACGCTAAGGGTCATATCTTTTTTTGTTTTGGTTTGTGTCTTGGTTGGCGTCTTAAATGTTAA(Sequence No. 15 ) Key: Uppercase only = U1 PolII promoter (nt1-392); lowercase = retargeting region (nt393-409); lowercase bold = retargeting sequence [in this example, targeting nt256-270 of the wild-type HIV-1 packaging signal] (nt395-409); uppercase italics = main U1 snRNA sequence [cloverleaf] (nt410-562); uppercase underline = transcription termination region (nt563-652).

[0479] The following table summarizes the initial modified U1 snRNAs and controls used in the study, showing the new annealing sequences and target site sequences (sequences are shown in the 5' to 3' direction).

[0480] Table I. List of sequences describing the target annealing sequences (heterogeneous sequences complementary to the target sequences) in the experimentally modified U1 snRNA and control U1 snRNA, as well as those target sequences used in the initial experiments. Nucleotides are presented as DNA because they are encoded within their respective expression cassettes in the “retargeting region”. The (AT) motif was present in all initial constructs that formed the first two nucleotides of the U1 snRNA molecule in all cases. Because the lentiviral vector genome in this study contained a hybrid packaging signal consisting of these two highly conserved strains (the packaging sequences used in this study are most similar to the vector sequence in GenBank:MH782475.1), the target sequence numbers refer to the targets in the HIV-1 NL4-3 (GenBank:M19921.2) or HXB2 (GenBank:K03455.1) strains as indicated.

[0481] [Table 3] TIFF0007883952000013.tif52164

[0482] Adherent cell culture, transfection, and lentiviral vector production HEK293T cells were maintained in complete medium (Dulbecco's Modified Eagle Medium (DMEM) (Sigma) supplemented with 10% thermal inactivation (FBS) (Gibco), 2 mM L-glutamine (Sigma), and 1% non-essential amino acids (NEAA) (Sigma)) at 37°C and 5% CO2.

[0483] Standard-scale production of HIV-1 vectors in the adhesion method was in a 10 cm dish under the following conditions (all conditions were scaled by area if performed in other forms): 3.5 x 10⁶ HEK293T cells in 10 mL of complete medium. 5Cells were seeded at a rate of cells / ml, and approximately 24 hours later, cells were transfected using the following plasmid mass ratios per 10cm plate: 4.5 μg genome, 1.4 μg Gag-Pol, 1.1 μg Rev, 0.7 μg VSV-G, and 0.01 μg–2 μg modified U1 snRNA plasmid.

[0484] Transfection was mediated by mixing DNA with Lipofectamine 2000CD in Opti-MEM according to the manufacturer's protocol (Life Technologies). Sodium butyrate (Sigma) was added over 5-6 hours to a final concentration of 10 mM after approximately 18 hours, and then 10 ml of fresh serum-free medium was replaced with the transfection medium. Typically, the vector supernatant was collected after 20-24 hours, then filtered (0.22 μm) and frozen at -20 / -80°C. As a positive control for nuclease treatment, Bensonase® was typically added to the collected material at 5 U / mL for 1 hour before filtration.

[0485] Suspension cell culture, transfection, and lentiviral vector production HEK293T.1-65s suspension cells were grown in a shaking incubator (25 mm orbit set to 190 RPM) in Freestyle + 0.1% CLC (Gibco) at 37°C and 5% CO2. All vector production using the suspension was performed in 24-well plates (1 mL volume on a shaking platform), 25 mL shaking flasks, or bioreactors (≤5 L). HEK293Ts cells were placed in serum-free medium in batches of 8 × 10⁶ cells. 5 Cells were seeded at a concentration of / ml and incubated at 37°C in 5% CO2 with shaking throughout the entire vector production process. Approximately 24 hours after seeding, cells were transfected with plasmid mass ratios per effective final culture volume at transfection: 0.95 μg / mL Genome, 0.1 μg / mL Gag-Pol, 0.6 μg / mL Rev, 0.7 μg / mL VSV-G, and 0.01–0.2 μg / mL modified U1 snRNA plasmids.

[0486] Transfection was mediated by mixing DNA with Lipofectamine 2000CD in Opti-MEM according to the manufacturer's protocol (Life Technologies). Sodium butyrate (Sigma) was added to a final concentration of 10 mM after approximately 18 hours. Typically, the vector supernatant was collected after 20–24 hours, then filtered (0.22 μm) and frozen at -20 / -80°C. As a positive control for nuclease treatment, Bensonase® was typically added to the collected material at 5 U / mL for 1 hour before filtration.

[0487] Lentiviral vector titration assay For lentiviral vector titration using a GFP marker-containing cassette, HEK293T cells were placed in a 96-well plate in a 1.2 × 10⁶ format. 4 Cells were seeded in cells / well. Using a GFP-encoding viral vector, cells were transduced in complete medium containing 8 mg / ml polyblen and 1x penicillin streptomycin, and fresh medium was added approximately 5-6 hours later. Transduced cells were incubated in 5% CO2 at 37°C for 2 days. Cultures were then prepared for flow cytometry using Attune-NxT (Thermofisher). Transduced cell count: 2 × 10⁶ 4 The GFP expression percentage was measured and the vector titer was calculated using the predicted cell number (based on typical proliferation rate), the dilution factor of the vector sample, the percentage of the positive GFP population, and the total volume at the time of transduction.

[0488] For titration of lentiviral vectors by embedded titer, use a 0.5 mL volume of neat ~1:5 diluted vector supernatant and titrate 1 x 10⁶ wells in the presence of 8 μg / mL polybren in a 12-well scale. 5 HEK293T cells were transduced. After subculturing the culture for 10 days (dividing into 1:5 segments every 2-3 days), host DNA was extracted at a rate of 1x10⁻¹⁶. 6Extracted from individual cell pellets. Dual quantitative PCR was performed using FAM primer / probe sets configured for HIV packaging signal (ψ) and RRP1, and the vector titer (TU / mL) was calculated using the following factors: transduction volume, vector dilution, and RRP1-normalized HIV-1 ψ copies detected per reaction.

[0489] Transcriptional read-through ("read-in") analysis of LV transduced cells The HIV vectors shown were produced by transient transfection of suspension mode cells in the presence or absence of 256_U1 snRNA in 24-well plates for 1.65 s. The supernatant was collected after 2 days and titrated by GFP expression using flow cytometry in HEK293T cells. GFP titers were then measured at 4.5 x 10⁶ at an infection multiplicity (MOI) of 1. 4HEK293T cells or 92BR cells (primary donkey fibroblasts) were used as appropriate for transduction. Transduced cells were passaged three times over 10 days before harvesting and divided into two fixed volumes. One was processed for total RNA extraction and the other for genomic DNA extraction. 200 ng (293T) or 80 ng (92BR) of total RNA were treated with DNAse I and subjected to RT-PCR using the SSIV VILO RT system (Life Technologies). cDNA was diluted to 1 ng / µl and 5 µl was subjected to SYBR qPCR using primer sets directed to HIV Psi and cellular GAPDH. To generate expression scores between samples, HIV Psi copies were normalized to GAPDH copies using the Delta Ct method. Genomic DNA extracts were prepared using the Qiacube extraction system (Qiagen), and 5 µl of eluted DNA was subjected to an HIV vector integration assay using qPCR. To calculate the average number of integrated vector genomes per cell, HIV Psi copies were normalized relative to the cell target RPPH1. Then, to account for transduction efficiency, the HIV RNA expression score of the samples was normalized relative to the number of integrated vector copies per cell. This final value is the relative HIV Psi RNA expression score, and for each cell line tested, all values ​​were normalized relative to standard vectors (intact MSD and crSD) prepared in the absence of 256_U1 snRNA.

[0490] [Example 1] Proscus splicing from MSD, decrease in titer of MSD-2KO lentiviral vector, and titer of recovery / boost by redirected U1 snRNA. The general structure of lentiviral vector genomes remains consistent across all three generations of vector systems (Lentiviral vectors: basic to translational. Toshie SAKUMA, Michael A. BARRY and Yasuhiro IKEDA. Biochem. J. (2012) 443, 603-618), and the 5' region of the HIV-1 provirus, including the upstream packaging sequence and RRE location of the transgene cassette, is maintained. However, other aspects differ, with later generations becoming tat-independent at the 3' LTR, self-inactivating, and incorporating the use of cppt and wPRE. The apparent lack of examples in the manipulation of the 5' packaging sequence is likely due to its complex structure and the condensed information encoded therein, which are necessary for many aspects of HIV-1 replication, namely transcription, splicing balance, GagPol translation, genome dimerization, assembly, reverse transcription, and integration. Within this complex region, the major splice donor (MSD) is embedded in the stem-loop 2 (SL2) region between SL1 (dimerization loop) and SL3 (binding to Gag). The rearrangement of the RRE sequence (and the associated splice acceptor 7 (sa7) within the envelope region) immediately downstream of the packaging region in the lentiviral vector genome was thought to "provide" the splice acceptor (sa7) to the MSD in the absence of rev. During lentiviral vector production, the supply of rev was thought to cause rev to bind to the RRE, suppressing MSD splicing to sa7, and consequently producing an unspliced ​​full-length lentiviral vector genome vRNA (Figure 2A). However, we (Figure 4Bii) and other inventors (e.g., Cui et al. (1999), J. Virol., 73:6171-6176) have shown that aberrant splicing from MSD to splice acceptor sites within the transgenic sequence can be substantial, resulting in a relatively moderate level, sometimes less than 5%, of unspliced ​​vRNA available for packaging into vector virions (see Figure 2B).

[0491] The inefficiency in generating vRNA for packaging is not always directly observed in the titer of lentiviral vectors produced by transient transfection methods for the delivery of numerous vector genomic plasmids to cells, and 1x10 7 Standard third-generation vector titers exceeding TU / mL are routinely achievable even with this type of aberrant splicing. However, we anticipate that the problem of aberrant splicing is likely to be more substantial in practice for the development of stable producer cell lines in which a much smaller number of incorporated vector genome cassettes may exist. In fact, we assume that typically, genomic components are restrictive in stable production clones, and that MSD activity can substantially contribute to this restriction.

[0492] The generation of abnormally spliced ​​mRNA resulting from MSD into the transgene cassette, and the (increased) expression of the transgene cassette during production, have further, perhaps less obvious, consequences. Previously, the TRiP system was developed to suppress transgene expression during lentiviral vector production (described in International Publication No. 2015 / 092440), which allows for recovery in vector titer linked in proportion to the negative effect of a particular transgene protein on vector production. We have found that efficient abnormal splicing (e.g., in a standard lentiviral vector including an EF1a-driven cassette, see Figures 4 and 12) typically generates mRNA encoding the transgene. While we do not wish to be bound by theory, in the case of the EF1a-driven cassette, MSD splices into a strong EF1a splice acceptor, but in the case of other promoter-UTR sequences, even in the presence of rev, MSD "selects" a weaker latent splice acceptor. MSD appears to "pass over" the RRE-sa7 sequence, preferentially targeting other more central sites in the vector genome, namely the transgene promoter region. In wild-type HIV-1, MSD typically splices into splice acceptors located in the center and 3' end of the genome, so this may be a "residual" characteristic of the HIV-1 5' packaging region. While MSD aberrantly splices at many locations within the downstream vector sequence, only mRNA that passes through the nonsense mutation-dependent mRNA degradation mechanism (i.e., they appear to be legitimate mRNAs because they encode proteins [transgene proteins]) is transported to the cytoplasm (and / or stable in the cytoplasm) where it may be translated. This places an additional burden on the TRiP system to maintain repression of the transgene encoding the mRNA, resulting in less repressive regulation of the larger pool of mRNA (see Figure 12). Furthermore, the use of tissue-specific promoters (to partially avoid transgene expression during lentiviral vector production) may be "cancelled" by the cytoplasmic emergence of translatable mRNA encoding the transgene due to this aberrant splicing mechanism.Essentially, the transgene is expressed by a (typically potent) constitutive promoter that drives the expression of the vector genome vRNA.

[0493] Therefore, there are many reasons to create an MSD-mutated lentiviral vector, and indeed, others have attempted this with tat-independent lentiviral vectors but without success. We have found that mutations in MSD in HIV-1 tat-independent third-generation vectors activate adjacent latent splice donor sites within SL2, resulting in a substantial level of splicing. For this reason, we have employed mutations in both MSD and the nearby latent splice donor (crSD) (see Figure 10), and we refer to this modification as "MSD-2KO," "MSD2KO," or "functional modification of MSD." Figure 4 shows that this double mutation is highly effective in eliminating abnormal splicing from the splicing region of SL2 (including both MSD and crSD) to the potent EF1a splice acceptor during lentiviral vector production. MSD-2KO lentiviral vector genomes containing three different promoter-GFP transgene cassettes have also been shown to result in a decrease in vector titer, as similarly reported by others (Figure 3). In Figure 4Bi, it has been demonstrated that providing HIV-1 tat in trans can rescue the observed decrease in the titer of the MSD-2KO lentiviral vector genome, but also increases the amount of "abnormal" splice products (derived from minor latent splice donors of SL4) (Figure 4Bii). Importantly, modified U1 snRNA redirected to different regions of the vector packaging signal has been shown to increase the MSD-2KO lentiviral vector genome titer without increasing the presence of minor splice products (Figure 4).

[0494] [Example 2] The enhancement of the MSD mutant lentiviral vector titer is not due to the suppression of the 5' polyA region within the vector genome cassette. To evaluate whether the present invention acts to suppress the 5' polyA site, functional mutations to the 5' polyA site were introduced into the genome of an MSD-2KO lentiviral vector containing either an EF1a or a CMV-driven GFP transgene cassette (Figure 6). The explanation of the "pAm1" polyA mutation is shown in Figure 6A, demonstrating the complete elimination of polyadenylation activity. Surprisingly, the inventors found that mutations in the 5' polyA signaling pathway only partially increased the titer in the EF1a-GFP-containing MSD-2KO lentiviral vector genome and had virtually no effect in the CMV-GFP MSD2KO lentiviral vector genome, which seemed to be consistent with the degree of attenuation effect of the MSD-2KO mutation (the MSD2KO mutation is less pronounced in the EF1a-containing genome). Importantly, the supply of 305U1 molecules in this experiment increased the titers of both the standard lentiviral vector genome (where endogenous U1 snRNA can likely completely suppress potential residual 5' polyA activity) and the MSD2KO / pAm1 lentiviral vector genome lacking potential 5' polyA activity. This provides compelling evidence that the modified U1 snRNA supplied to restore the titer of the MSD mutant lentiviral vector acts in a previously undescribed post-transcriptional process.

[0495] Next, the inventors attempted to mutate the 70K and U1A binding loops of 305U1 and 256U1 to evaluate whether this would affect the observed increase in the titer of the MSD2KO lentiviral vector genome. Figure 7 demonstrates that functional mutations in SL1 or SL2 within the modified U1 snRNA did not affect the ability of these molecules to enhance the titer of the MSD-2KO lentiviral vector when co-expressed during production, and only Sm protein binding mutations blocked this activity. This indicates that the previously unavoidable 70K binding property of redirecting U1 snRNA in suppressing polyA activity is not important in the present invention and provides further evidence that the modified U1 snRNA used to increase the titer of the MSD mutant lentiviral vector functions by a novel mechanism.

[0496] To evaluate whether the titer increase mediated by modified U1 snRNAs when applied to the MSD-2KO lentiviral vector differs from that of standard lentiviral vectors, a panel of modified U1 snRNAs targeting different sites along the 5' region of the MSD-2KO lentiviral vector genome (see Table I) was screened (Figure 9). This screen shows that targeting to the packaging region is preferable, sometimes using a "hotspot" within SL3 (SL1-3). Screening was performed using modified U1 snRNAs with 15 nucleotides (or 9 nucleotides) of complementarity to the target site, as we have previously demonstrated with standard lentiviral vectors, and using a complementarity length greater than 9 nucleotides may result in a more robust titer increase. In fact, the inventors demonstrate that, for the MSD-2KO lentiviral vector, the titer boost observed with modified U1 snRNA (targeting the "305" sequence) can be observed with a complementarity of only 7 nucleotides, but in preferred use, it is better to use a complementarity of 10-15 nucleotides due to the increased titer boost (Figure 8), and this is to minimize any possible "off-target" effects by the modified U1 snRNA.

[0497] [Example 3] Enhancement of MSD mutant lentiviral vector titers by modified U1 snRNA is independent of the splice donor mutation type. Figure 10A shows the genetic modification of the “MSD-2KO” variant in the packaging region of the MSD mutant lentiviral vector genome to the SL2 loop, which mutates both the MSD and the downstream latent splice donor (the MSD-2KO variant is used in many of the non-limiting examples herein). To evaluate whether the effect of titer boosting by the use of modified U1 snRNA was dependent in any way on the specific changes made to the MSD-2KO variant, we created three other splice donor region variants: [1] "MSD2KOv2" (which also introduced two specific changes within the MSD and latent donor sequences), [3] "MSD-2KOm5" (which replaced the entire SL2 loop with an artificial stem loop), and [3] complete SL2 deletion (which thus removed the entire splice donor region, also known as the splicing region). We then produced standard or MSD mutant lentiviral vector variants (including the EFS-GFP expression cassette) in HEK293T cells + / - modified U1 snRNA (256U1) and titrated vector supernatant (Figure 10B). The results showed that all four MSD mutant lentiviral vector variants were attenuated compared to the standard vector, but modified U1 supplied during lentiviral vector production was attenuated. We demonstrated that all four variants could be enhanced using snRNAs, showing that splice donor region mutations by modified U1 snRNAs are not specific sequence-dependent. Interestingly, the MSD-2KOm5 variant showed the least attenuation and, when generated in the presence of 256U1 molecules, resulted in the greatest increase in output titer regardless of the identity of the internal promoter used (comparison of EFS, EF1a, CMV, and human PGK promoters).

[0498] [Example 4] Use of a modified U1 snRNA cassette encoded within the DNA backbone of a cis-lentiviral vector genome plasmid. Previous examples in this specification disclose the use of a modified U1 snRNA molecule in trans mode during lentiviral vector production by transient cotransfection of HEK293T cells with lentiviral vector component plasmids and modified U1 snRNA encoding the plasmid. Three variant constructs were cloned to evaluate whether the MSD mutant lentiviral vector genome cassette and the modified U1 snRNA cassette could be appropriately encoded within the same plasmid DNA molecule (Figure 11A). The MSD mutant lentiviral vector genome cassette (MSD-2KO variant) was modified so that the 256U1 expression cassette was inserted into the lentiviral vector genome cassette and / or functional plasmid backbone sequence in three different configurations. The MSD mutant lentiviral vector was constructed in HEK293T cells using these "cis" versions of the plasmid and compared to the "trans" mode in which the modified U1 snRNA plasmid was cotransfected with the unmodified MSD mutant lentiviral vector genome (Figure 11B). The results show that the titers of these "cis" versions of plasmids were similar to those of the unmodified MSD-2 KO lentiviral vector genome + 256U1 supplied by cotransfection.

[0499] [Example 5] Use of cell lines that stably express modified U1 snRNA to enhance the production of both standard and MSD mutant lentiviral vectors. The 305U1 expression cassette was stably incorporated into HEK293T cells, and standard or MSD-2KO lentiviral vectors were constructed via transient transfection + / - further 305U1 plasmid DNA. The successful generation of stable cells was the first to demonstrate that the modified U1 snRNA can be endogenously expressed intracellularly without cytotoxic effects, and that the modified U1 snRNA does not titrate cytofactors involved in either U1 snRNA synthesis or spliceosomes, and that off-targeting does not occur, or that off-targeting effects do not affect normal cell viability. The output titers of the lentiviral vectors demonstrated that the titer increase mediated by the modified U1 snRNA is possible in both the standard and MSD-2KO lentiviral vectors, demonstrating the stable provision of the modified U1 snRNA (Figure 13). This facilitates the lentiviral vector packaging and integration of the modified U1 snRNA into producer cell lines.

[0500] [Example 6] MSD mutant lentiviral vectors produce fewer transgene proteins during production. A further advantage of eliminating abnormal splicing during lentiviral vector production is the reduction in the amount of transgene-coding mRNA that leads to transgene protein production. Transgene expression can substantially affect lentiviral vector production, which led to the development of the TRiP system for suppressing transgene translation during viral vector production (described in International Publication 2015 / 092440). In short, the bacterial protein "TRAP" is co-expressed during vector production and binds to its "TRAP binding sequence" (tbs) inserted upstream of the transgene ORF in the 5'UTR, thus blocking scanning ribosomes.

[0501] In the course of this research, the inventors unexpectedly discovered that splicing out from the major donor splice region of SL2 to the internal splice acceptor site effectively produces transgene encoding mRNA from the “external” (CMV) promoter that drives the vector genome cassette. The extent to which this occurs depends on the internal sequence between the cppt and the transgene ORF (i.e., the promoter-5'UTR sequence). The use of the EF1a promoter (containing a very strong splice acceptor) in the transgene cassette results in abnormal splicing from MSD in over 95% of all transcripts derived from the external promoter (see Figure 2). By comparing total GFP expression in standard or MSD-2KO lentiviral vector-producing cultures (Figure 12B), the inventors demonstrate that up to 80% of the transgene protein expressed during production originates from abnormal splice products. The inventors found that combining the MSD-2KO genotype with the TRiP system increases the reduction in the amount of transgene protein produced.

[0502] [Example 7] Optimization of the TBS-Kozak junction. Four tbs-Kozak variants were designed (see Table II-Panel I) and cloned into the GFP reporter construct as shown in Figure 14A. Variants 0, 1, and 2 were designed so that the extended Kozak sequence (fitting the consensus GNNRVVATG) overlaps with the last two tbs repeat sequences, while variant 3 overlaps only with the last tbs repeat sequence. These variants were individually co-transfected into HEK293T cell + / -TRAP expression plasmids along with the original reporter (i.e., no overlap) where the Kozak sequence is 3 nucleotides downstream of the final tbs repeat sequence, and GFP expression was measured by flow cytometry 2 days after transfection. GFP expression scores (%GFP-positive cells × MFI) were generated from the flow cytometry data and plotted (Figure 14B).

[0503] Two of these tbs-Kozak variants were tested in conjunction with two different promoters (EFS and huPGK) in the scAAV2 vector genome expression cassette and compared to a tbs-containing cassette without overlapping tbs / Kozak sequences. These GFP reporter vector genome plasmids were individually co-transfected into HEK293T cell + / -TRAP expression plasmids, and GFP expression was measured by flow cytometry two days after transfection. GFP expression scores (%GFP-positive cells × MFI) were generated from the flow cytometry data and plotted (Figure 15). Non-overlapping tbs / Kozak variants (the original variant and a second variant containing an HpaI site between tbs and Kozak) could be suppressed 50- to 100-fold, while the new tbs-Kozak variants (tbs_V0 and tbs_V3) were suppressed at least 10-fold (500- to 3500-fold). These tbs-Kozak variants performed similarly when using either the L33 or L12 improved reader with either the EFS or huPGK promoter cassette. Importantly, the "ON" level (no TRAP) of the novel variants was similar to that of the non-overlapping tbs / Kozak variants, indicating that the Kozak sequences within the novel variants are effective in directing efficient translation.

[0504] The data show that all tbs-Kozak variants were capable of similar levels of "ON" transgene expression, indicating that the Kozak sequence directed efficient levels of translation initiation. Variant 1 was poorly repressed by TRAP compared to the original reporter configuration (GFP expression levels were 10 times higher in the presence of TRAP). Surprisingly, however, variants 0, 2, and 3 were repressed to lower levels compared to the original configuration. [Table 4]

[0505] Table II: Optimal 3'tbs-Kozak junction arrangement [Panel I] Variant Kozak sequences designed to overlap with the 3' end of the upstream tbs sequence. The extended Kozak sequence was positioned so that the main transgene ATG start codon is located 9 nucleotides downstream of the 3' terminal KAGNN repeat of the tbs, i.e., there is no overlap. To bring the main transgene ATG start codon closer to the upstream tbs, four variants were designed to maintain the consensus KAGNN repeat of the 3' terminal tbs repeat while also maintaining an efficient extended Kozak consensus sequence (defined herein as GNNRVVATG). The KAGNN repeat sequence is in parentheses, and the Kozak sequence is in bold.

[0506] [Example 8] The improved duplicate tbs-Kozak variant is incorporated into the full-length intron-containing EF1a promoter. The previous example showed that the overlapping tbs-Kozak variant improved repression compared to the non-overlapping tbs / Kozak variant, which was demonstrated in association with the EFS promoter (the EF1a promoter cleaved by removing its incorporated intron). To evaluate whether the tbs-Kozak variant would similarly "function" within the full-length EF1a promoter (i.e., after splicing out the intron), three tbs-Kozak variants (0, 2, and 3) were cloned into a GFP reporter cassette containing the EF1a promoter (Figure 16A). After splicing, the 5'UTR contained a short 12nt sequence including exon 1 (i.e., the L33 improved leader), the first nucleotide of exon 2, followed by the tbs-Kozak variant sequence (SEQ ID NO: 106). These GFP reporter plasmids, along with reporters without tbs, were individually co-transfected into suspension, serum-free HEK293T cell + / -TRAP expression plasmids, and GFP expression was measured by flow cytometry two days after transfection. GFP expression scores (%GFP-positive cells × MFI) were generated from the flow cytometry data and plotted (Figure 16B). Furthermore, these tbs-containing GFP expression cassettes were cloned into HIV-1-based lentiviral vector genome plasmids (MSD and crSD were inactivated (see below)), and similar experiments were performed in suspension, serum-free HEK293T cells to obtain GFP expression scores (Figure 16C). The data demonstrate that the overlapping tbs-Kozak variants were indeed able to improve transgene repression compared to the non-overlapping tbs / Kozak variants used.

[0507] [Example 9] The progressively greater occlusion of the core Kozak sequence by the 3' terminal KAGNN repeat of tbs leads to progressively greater transgene repression by TRAP. In Example 7, a limited number of overlapping tbs-Kozak variants were generated and tested in association with non-intron-containing promoters EFS and huPGK. These variants were then tested with the complete EF1a promoter containing introns as in Example 5, demonstrating that this difficult-to-suppress promoter can be suppressed by using overlapping tbs-Kozak variants.

[0508] To further illustrate the principle of improved TRAP suppression by "hiding" the core Kozak sequence within the 3'-terminal KAGNN repeat of tbs, a panel of novel variants was designed (see Table IV). These are based on all possible variants encoded by three "overlap groups": KAGatg (KAGNN consensus overlaps as much as possible with the core Kozak ATG, i.e., overlaps with the first two nucleotides of the core Kozak ATG), KAGNatg (KAGNN consensus overlaps with the first nucleotide of the core Kozak ATG), and KAGNNatg (KAGNN consensus does not overlap with the core Kozak ATG). (The initial variants tbs-kzkV0, tbs-kzkV1, and tbs-kzkV2 from Examples 3 and 5 fall into these defined groups). Variants within these groups that produced "GT" dinucleotides were not generated / evaluated due to the undesirable possibility that they could generate latent splice donor sites.

[0509] Table III: Duplicate tbs-Kozak variants created for further examples We generated all possible variants representing the "overlapping group" associated with the KAGatg, KAGNatg, or KAGNNatg consensus, except for those that produce "GT" dinucleotides that can generate undesirable (potential) splice donor sites. The first 10 KAGNN repeats, presented here as consensus for clarity, were primarily the first 48 nucleotides of SEQ ID NO: 8. The KAGNN at the 3' terminal tbs is presented as encoded in each variant (italicized and in parentheses), the core Kozak consensus is in bold, and any nucleotides shown as part of the broader extended Kozak consensus are underlined.

[0510] [Table 5]

[0511] In general, most variants conform to the preferred core Kozak consensus of RVVATG and are limited to containing the indicated KAGNN tbs consensus. Since these variants were cloned into the pEF1a-GFP reporter plasmid, the 5'UTR contains a short 12nt sequence from exon 2 in addition to the L33 leader (exon 1) (after splicing of its introns), which is less repressive by TRAP unless a duplicate tbs-Kozak variant is used, as previously shown in Example 5. Suspension (serum-free) HEK293T cells were transfected individually with or without these variants with or without the TRAP expression plasmid under conditions typically reflecting lentiviral vector (LV) transfection / production (e.g., inclusion of sodium butyrate induction), and flow cytometry was performed at typical LV recovery times (2 days after transfection). Overall GFP expression scores were generated for + / -TRAP conditions (GFP × MFI%; ArbU), and then double repression values ​​were generated and plotted in Figure 17A. The results demonstrate that the more the core Kozak consensus sequence overlaps with the 3' terminal KAGNN tbs repeat, the better the level of TRAP repression. Statistical analysis of the double difference (T-test) for each overlap group demonstrated a significant increase in repression with greater overlap of core Kozak with the 3' terminal KAGNN tbs repeat, with the best repression scores coming from the KAGatg group, where 2 / 3 of the start codons form part of the KAGNN repeat. All overlap variants resulted in statistically greater transgene repression by TRAP compared to non-overlapping tbs variants.

[0512] The data were further stratified in Figure 17B, displaying the non-repressive "on" transgene levels from highest to lowest. Two variants from the KAGatg overlap group are highlighted to show that the GAGatg variant (tbskzkV0.G) gave the highest "on" level for these two best-performing variants with respect to TRAP repression, which is likely because this fits the core Kozak consensus of RVVATG, whereas TAGatg (tbskzkV0.T) does not.

[0513] All of these data support the general principle that duplicated tbs-Kozak variants are more effective in mediating TRAP suppression than non-duplicated tbs variants, and preferably, tbs-Kozak duplication follows the RVVATG core Kozak consensus to ensure good "ON" transgene expression in transduced target cells. Therefore, the use of these novel tbs-Kozak variants enables more efficient transgene suppression during viral vector production and potentially leads to an increase in viral vector titer if the transgene protein activity is detrimental to the viral vector titer and / or activity.

[0514] [Example 10] Further use of the optimal duplicate tbs-Kozak variant to improve TRAP-mediated suppression of common promoters with introns. In Example 8, it was shown that the use of a duplicated tbs-Kozak variant improved TRAP-mediated repression when a full-length EF1a promoter containing an intron was used. In the case of similar promoters widely used in viral vector genomes for gene therapy, such as the CAG promoter, the presence of an integrated exon / intron sequence means that the degree of TRAP-mediated repression may be influenced by the sequence within the “native” exon sequence. From the standpoint of improving TRAP-mediated repression, altering the exon sequence may not be obvious or feasible, especially if these are involved in splicing enhancement (e.g., splice enhancer elements close to the splice donor site). Widely used CAG promoters include the CMV enhancer element, the coa chicken β-actin gene promoter-exon 1-intron sequence, and the splice acceptor-exon sequence derived from the rabbit β-globin gene. In other parts of the present invention, it was surprisingly found that using exon 1 derived from the EF1a promoter (L33) upstream of all types of tbs variants can improve TRAP-mediated inhibition, possibly by providing a favorable sequence situation to support the formation of a stable TRAP-tbs complex, thereby enabling efficient translational inhibition. Overlapping tbs-Kozak variants were shown to aid TRAP-mediated inhibition in both EF1a (intron-containing) and several other intron-less promoters.

[0515] In this embodiment (see Figure 18A), both features were applied to improve TRAP-mediated repression from the CAG promoter by [a] locating the tbskzkV0.G variant (also called variant "0" in other embodiments) within the "natural" 5'UTR region of the CAG promoter (SEQ ID NO: 117), and [b] replacing the entire "natural" intron-containing 5'UTR region with an EF1a 5'UTR-intron region containing the tbskzkV0.G variant (SEQ ID NO: 118). The corresponding spliced ​​sequences are shown as SEQ ID NO: 119 and SEQ ID NO: 120, respectively. In addition, it has been previously shown that an artificial 5'UTR containing heterologous introns can be added to a promoter typically used without introns in viral vector genomes (in this case, CMV), and that its expression can be efficiently repressed by TRAP. Specifically, a 5'UTR containing an EF1a 5'UTR-intron region with the tbskzkV0.G variant (SEQ ID NO: 118) was used in the CMV promoter context.

[0516] These reporter constructs (encoding GFP) were used to model a viral vector production scenario and evaluate both "ON" expression levels and TRAP-mediated repression in suspension (serum-free) HEK293T cells. Cells were transfected with GFP reporter plasmid + / - pTRAP, cultures were induced with sodium butyrate after transfection (due to typical viral vector production), and cells were analyzed for GFP expression approximately 2 days after transfection (i.e., a typical viral vector harvesting site). GFP expression scores (GFP positive × MFI%; ArbU) were created and plotted (Figure 18B), and TRAP repression scores were displayed. These data indicate that TRAP-mediated expression in typical viral vector-producing cells can be improved 3- to 30-fold from the CAG promoter using the tbskzkV0.G variant. Furthermore, the data show that “native” 5'UTR region sequences from different promoters can be replaced with intron-containing EF1a 5'UTRs containing the tbsKzkV0.G variant, resulting in both substantially improved TRAP-mediated repression (30-40x to less than 100x) and maintenance of high gene expression in the absence of TRAP (i.e., modeling expression in transduced target cells with viral vectors). Thus, novel EF1a-5'UTR-intron-tbskzkV0.G sequences may be useful in providing heterologous promoters with the known benefits (i.e., increased gene expression) provided by introns in target cells, but also enable efficient repression of transgene proteins during viral vector production, potentially leading to an increase in viral vector titer if the transgene protein activity is detrimental to the viral vector titer. This also applies to the use of EF1a-5'UTR-intron sequences with other duplicated tbs-Kozak sequences.

[0517] [Example 11] Evaluation of the effects of mutations in the major splice donor alone, or in combination with further mutations in adjacent latent splice donor sites, on abnormal splices, vector titer, and response to modified U1 snRNA. To evaluate the effects of major splice donor site mutations alone, or in combination with latent splice donor (crSD; also referred to here as "crSD1") mutations (present in MSD-2KO), another variant named "MSD-1KO" was cloned (Figure 20A). This variant had only a GT>CA mutation at the MSD site. Using the MSD-1KO variant genome along with the standard LV genome and the MSD-2KO genome (all containing the EF1a-GFP transgene cassette), LV-GFP crude harvest material was produced by transient transfection of suspension (serum-free) HEK293T cells, with or without modified U1 snRNA targeting the vRNA packaging region (256U1). LV-GFP titers are shown in Figure 20D, demonstrating that mutations at the MSD site alone are sufficient to reduce LV titers, and that these titers are recoverable to the same levels observed for the MSD-2KO vector. Cellular analysis following the production of aberrant splicing from the MSD region within the SL2 loop was performed on extracted polyA-selective mRNA by RT-PCR using primers that allow detection of both non-splicing and aberrant splicing products (Figure 20C; see Figure 23 for primer locations). The data show that only mutations in MSD activate the latent splice donor (crSD[1]) immediately downstream. The analysis also revealed that aberrant splicing from the MSD region in SL2 is completely removed by mutations in both MSD and the adjacent latent splice donor (crSD[1]) present in the "MSD-2KO" variant, but this also activates another minor splice donor site located further downstream in the SL4 loop (crSD2) of the packaging sequence. (This was also evident in a previous example - see Figure 4Bii).

[0518] [Example 12] Evaluation of the impact of mutations in latent splice donors in the SL4 loop of the packaging sequence, combined with mutations in major and latent splice donor sites in SL2. In Example 11, mutations in both MSD and crSD1 completely eliminated aberrant splicing from the SL2 region of the packaging signal, but this activated a further potential splice donor within the SL4 loop (see Figure 20A, "crSD2"). To evaluate whether the crSD2 site of SL4 could be mutated to eliminate its activity, and noting that further modifications to the packaging sequence could impair the RNA folding necessary for efficient packaging, MSD-3KO_1 and MSD-3KO_2 variants were designed. These contained the MSD-2KO mutation in SL2 and a single nucleotide mutation in the "GT" dinucleotide at the crSD2 site (see Figure 20A). MSD-3KO_1 mutated the G in the GT dinucleotide to "C", while the MSD-3KO_2 mutation was a T>C mutation in the GT dinucleotide. It should be noted that the T>C mutation predicts good base pairing in the SL4 loop and in a tertiary model of the broader packaging sequence (Keane et al. Science. 2015 May 22;348(6237):917-921). LV-EF1a-GFP vectors containing these modifications were prepared as described in Example 11, including analysis of vector RNA from cells after production (Figure 21A) and titration of the resulting vector harvest (Figure 21B). Abnormal splicing in the MSD-3KO_1 variant did not appear to be removed, and exon-exon sequencing of the RT-PCR product revealed that this product originated from another latent splice donor site (crSD3), which was activated 10 nucleotides downstream (see lanes 7 and 8 in Figure 21A and Figure 20A for the sequence of crSD3). The construction and testing of MSD-4KO_1 and MSD-4KO_2 demonstrated that aberrant splicing from crSD3 is indeed activated by the G>C mutation in crSD2, which is deactivated by the mutation in crSD3 (Figure 21A; lanes 11-14).Surprisingly, however, the MSD-3KO_2 variant not only eliminated the abnormal splicing from crSD2, but also prevented activation of the crSD3 site (Figure 21A; lanes 9, 10), indicating that the latent splicing enhancer for crSD3 was also eliminated by a single T>C mutation in MSD-3KO_2 within the SL4 loop.

[0519] Even more surprisingly, the MSD-2KOm5 mutation had an effect on latent splicing from crSD2 or crSD3. In previous examples, the MSD-2KOm5 variant was shown to be less attenuated than other MSD-2KO splice donor variants, which may provide further benefits in titer recovery with modified U1 snRNA. While we do not wish to be bound by theory, the MSD-2KOm5 variant was designed so that maximal annealing with endogenous U1 snRNA (without a functional splice donor) could occur, based on the hypothesis that mobilization of U1 snRNA by vRNA (apart from and in addition to the use of modified U1 snRNA targeting the SL1 loop) may be beneficial for stability. Figure 20B shows how the standard, MSD-2KO, and MSD-2KOm5 vector genomic vRNAs are predicted to anneal with endogenous U1 snRNA, even though the mutant genomes do not contain splice donor sites. The MSD-2KOm5 variant is theoretically more stable than the MSD-2KO variant (i.e., more hydrogen bonds are split by base pairing) and, perhaps to a greater extent than a standard LV genome, can recruit endogenous U1 snRNA to a critical degree without causing splicing events. Furthermore, MSD-2KOm5 was designed to ensure the formation of a stable SL2 loop, which may be important for the folding of the packaging sequence. When the same analysis was performed on MSD-2KOm5 (and related MSD-3KO_2 and MSD-4KO_2 variants), it was surprisingly found that no aberrant splicing occurred from crSD2 or crSD3 within SL4. Moreover, although not bound by theory, it is proposed that the proximity of endogenous U1 snRNA recruitment to the SL2 loop may interfere with the recognition of latent splice sites within the SL4 loop.

[0520] All splice donor mutant vectors produced in this further study had reduced titers (MSD-2KOm5 was the least attenuated), but all were substantially enhanced by supplying trans-modified U1 snRNA (Figure 21B).

[0521] Overall, this indicates that small mutations resulting in the functional removal of both the MSD and crSD1 sites lead to a robust reduction in common aberrant splicing from the packaging sequence, while auxiliary mutations at the crSD2 / 3 sites in the SL4 loop may be required to completely eliminate it. Preferred modifications resulting in the functional removal of aberrant splicing from the MSD and crSD1 sites are more substantial modifications, such as those described by the MSD-2KOm5 variant, which also have the remarkable effect of not allowing activation of small latent splice donor sites in the downstream SL4 loop, as vectors with this modification can achieve the highest titer in the presence of a modified U1 snRNA targeting its packaging region.

[0522] [Example 13] Splice donor mutant LV genomes reduce transcriptional "readthrough" events by upstream cell promoters in target cells. The integration of lentiviral vectors into target cells is semi-random, and the LV exhibits a preference for integration into transcriptionally active cellular genes. Transcriptional read-through or "read-in" from upstream cellular promoters to the integrated LV can occur, and it has been shown elsewhere that this can lead to mobilization / interaction with sequences within the LV genome (see, e.g., Moiani et al. J Clin Invest. 2012 May 1;122(5):1653-1666). For the purposes of this invention, a further advantage of the MSD mutant LV is expected to be improved patient safety regarding the effects of the LV integrated into the chromosomes of target cells. In wild-type HIV-1, it has been demonstrated that recruitment of endogenous U1 snRNA to the major splice donor results in suppression of 5'LTR polyadenylation signaling; therefore, a similar mechanism occurring in standard LV during read-in may be exacerbated due to U1 snRNA recruitment. Therefore, the removal of MSD (and latent SD) within the LV packaging signal can result in a reduction of transcriptional lead-ins, due to increased use of the polyA signal encoded by 5'-SINLTR (see Figure 22).

[0523] To test this, HEK293T cells and 92BR primary cells (donkey fibroblasts) were transduced at matching MOIs using MSD mutant LV vectors and the standard LV vector produced in Example 12 (see Figure 21B) (only MSD mutant LV vector preparations prepared in the presence of 256U1 were used, as they have similar titers to the standard vector preparations). Transduced cell cultures were passaged for 10 days to lose both unintegrated LV cDNA and the latent RNA generated therefrom. Cellular RNA was then extracted, DNAse-treated, and subjected to RT-qPCR analysis using primers for the LV packaging region (see Figure 22 for primer positions). The detected HIV packaging RNA copies were normalized against the GAPDH RNA signal (RNA loading control) and then normalized against the integrated LV DNA copy number. The total normalized copy number of HIV packaging RNA detected for the standard LV vector (prepared without 256U1) was set to 1 for each cell type, and all other relevant normalized copy numbers were set against this. Figure 23 shows the results of this analysis, demonstrating that the presence of mutant MSD and latent SD within the LV genome resulted in a 2- to 5-fold reduction in transcriptional lead-in events. All of these data indicate that MSD / crSD mutant LVs exhibit a better safety profile in transduced cells than standard LVs and have a lower tendency to enable LV skeletal recruitment and / or interaction with LV sequences.

Claims

1. A nucleic acid comprising a nucleotide sequence encoding the RNA genome of a lentiviral vector, wherein the major splice donor site in the RNA genome of the lentiviral vector is inactivated, and the latent splice donor site 3' relative to the major splice donor site is inactivated, and the nucleic acid comprises the sequence shown in SEQ ID NO: 6 or SEQ ID NO:

14.

2. A nucleic acid comprising a nucleotide sequence encoding the RNA genome of a lentiviral vector according to claim 1, wherein the nucleotide sequence is (i) The sequence shown in sequence number 6 and a) The sequence shown in sequence number 226, b) The sequence shown in sequence number 228, c) The sequence shown in Sequence ID No. 230, or d) The sequence shown in Sequence ID No. 232 or (ii) The sequence shown in sequence number 14 and e) The sequence shown in sequence number 236, f) The sequence shown in sequence number 238 Nucleic acids, including

3. A nucleic acid comprising a nucleotide sequence encoding the RNA genome of a lentiviral vector according to claim 1 or 2, (i) The lentiviral vector is a tat-independent lentiviral vector, (ii) The lentiviral vector is a U3-independent lentiviral vector, and / or (iii) A nucleic acid in which the nucleotide sequence encoding the RNA genome of a lentiviral vector is operably linked to a heterologous promoter.

4. A nucleic acid comprising a nucleotide sequence encoding the RNA genome of a lentiviral vector according to any one of claims 1 to 3, wherein the nucleotide sequence does not include the sequence shown in Sequence ID No.

9.

5. A nucleic acid comprising a nucleotide sequence encoding the RNA genome of a lentiviral vector according to any one of claims 1 to 4, wherein splicing activity from the major splice donor site and the latent splice donor site of the RNA genome of the lentiviral vector is suppressed or removed.

6. A nucleic acid comprising a nucleotide sequence encoding the RNA genome of a lentiviral vector according to any one of claims 1 to 5, wherein the splicing activity from the major splice donor site and the latent splice donor site of the RNA genome of the lentiviral vector is suppressed or removed in transfected cells or transduced cells.

7. A nucleic acid comprising a nucleotide sequence encoding the RNA genome of a lentiviral vector according to any one of claims 1 to 6, wherein the nucleotide sequence further comprises a mutation in a latent splice donor site within the SL4 loop of the packaging sequence.

8. A nucleic acid comprising a nucleotide sequence encoding an RNA genome of a lentiviral vector according to claim 7, wherein the GT dinucleotide of the latent splice donor site in the SL4 loop of the packaging sequence is mutated to GC.

9. A nucleic acid comprising a nucleotide sequence encoding the RNA genome of a lentiviral vector according to any one of claims 1 to 8, wherein the nucleotide sequence further comprises the target nucleotide.

10. A nucleic acid comprising a nucleotide sequence encoding the RNA genome of a lentiviral vector according to claim 9, wherein the nucleotide for the purpose provides the therapeutic effect.

11. A nucleic acid comprising a nucleotide sequence encoding the RNA genome of a lentiviral vector according to any one of claims 1 to 10, wherein the nucleotide sequence encoding the RNA genome of the lentiviral vector is a vector-transformed gene expression cassette.

12. A nucleic acid comprising a nucleotide sequence encoding an RNA genome of a lentiviral vector according to any one of claims 1 to 11, wherein the nucleotide sequence further comprises a nucleotide sequence encoding a modified U1 snRNA, and the modified U1 snRNA is modified to bind to a nucleotide sequence in the packaging region of the MSD mutant lentiviral vector genome.

13. (i) The nucleotide sequence encoding the RNA genome of the lentiviral vector is operably linked to the nucleotide sequence encoding the modified U1 snRNA, and / or (ii) The nucleotide sequence encoding the modified U1 snRNA is located on a different nucleotide than the nucleotide sequence encoding the RNA genome of the lentiviral vector. A nucleic acid comprising a nucleotide sequence encoding the RNA genome of the lentiviral vector according to claim 12.

14. A nucleic acid comprising a nucleotide sequence encoding the RNA genome of a lentiviral vector according to any one of claims 1 to 13, wherein the nucleotide sequence further comprises a tryptophan RNA-binding attenuation protein (TRAP) binding site.

15. A nucleic acid comprising a nucleotide sequence encoding an RNA genome of a lentiviral vector according to claim 14, wherein the nucleotide sequence comprises a target nucleotide, (i) the TRAP binding site overlaps with the start codon ATG of the target nucleotide, and / or the nucleotide sequence also comprises a Kozak sequence, the TRAP binding site overlaps with the Kozak sequence.

16. A nucleic acid comprising a nucleotide sequence encoding an RNA genome of a lentiviral vector according to claim 14, wherein the nucleotide sequence comprises a target nucleotide, and (i) the TRAP binding site comprises a portion of the start codon ATG of the target nucleotide, or the start codon ATG comprises a portion of the TRAP binding site, and / or the nucleotide sequence further comprises a Kozak sequence, the Kozak sequence comprising a portion of the TRAP binding site.

17. A nucleic acid comprising a nucleotide sequence encoding an RNA genome of a lentiviral vector according to claim 14, wherein the nucleotide sequence further comprises a multicloning site and a Kozak sequence, and the multicloning site overlaps with the 3'KAGN2-3 repeat of the TRAP binding site or is located downstream of the 3'KAGN2-3 repeat of the TRAP binding site and upstream of the Kozak sequence.

18. A nucleic acid comprising a nucleotide sequence encoding the RNA genome of a lentiviral vector according to any one of claims 14 to 17, wherein the 3' terminal KAGNN repeat of the TRAP binding site or a part thereof overlaps with at least the first nucleotide of the start codon ATG.

19. A nucleic acid comprising a nucleotide sequence encoding the RNA genome of a lentiviral vector according to any one of claims 14 to 18, wherein the 3'-terminal KAGNN repeat of the TRAP binding site or a portion thereof overlaps with the first two nucleotides of the start codon ATG.

20. A nucleic acid comprising a nucleotide sequence encoding the RNA genome of a lentiviral vector according to any one of claims 14 to 19, wherein the 3'-terminal KAGNN repeat of the TRAP binding site or a part thereof overlaps with the first nucleotide of the start codon ATG in the core Kozak sequence.

21. A nucleic acid comprising a nucleotide sequence encoding the RNA genome of a lentiviral vector according to any one of claims 14 to 20, wherein the nucleotide sequence comprises a sequence defined by SEQ ID NO: 114 or SEQ ID NO:

116.

22. A nucleic acid comprising a nucleotide sequence encoding an RNA genome of a lentiviral vector according to claim 15 or 16, wherein the target nucleotide is operably linked to the TRAP binding site or a part thereof.

23. An expression cassette comprising nucleic acid including a nucleotide sequence encoding the RNA genome of a lentiviral vector according to any one of claims 1 to 22.

24. A viral vector production system comprising a nucleic acid comprising a nucleotide sequence encoding a vector component including gag-pol and env, and a nucleic acid comprising a nucleotide sequence encoding the RNA genome of a lentiviral vector as defined in any one of claims 1 to 22, or a nucleic acid comprising an expression cassette as described in claim 23.

25. A cell comprising a nucleic acid containing a nucleotide sequence encoding the RNA genome of a lentiviral vector according to any one of claims 1 to 22, an expression cassette according to claim 23, or a viral vector production system according to claim 24.

26. Cells for producing lentiviral vectors, a) a nucleic acid comprising a nucleotide sequence encoding a vector component including gag-pol and env and a nucleotide sequence encoding the RNA genome of a lentiviral vector according to any one of claims 1 to 22, or an expression cassette according to claim 23; or b) The viral vector production system according to claim 24; Cells for producing lentiviral vectors, including [specific cells / organizations].

27. Cells for producing the lentiviral vector according to claim 26, further comprising a nucleic acid containing a nucleotide sequence encoding a modified U1 snRNA, and / or a nucleic acid containing a nucleotide sequence encoding TRAP.

28. The cell according to any one of claims 25 to 27, wherein the splicing activity from the major splice donor site and / or splice donor region of the RNA genome of the lentiviral vector is suppressed or removed.

29. The cell according to claim 28, wherein the splicing activity from the major splice donor site and / or splice donor region of the RNA genome of the lentiviral vector is suppressed or removed during lentiviral vector production.

30. The cell according to any one of claims 25 to 29, wherein, if the target nucleotide as defined in any of claims 9, 10, 15, 16 and / or 22 is present, the translation of the target nucleotide is suppressed during lentiviral vector production.

31. A method for producing a lentiviral vector, (i) a) a nucleic acid comprising a nucleotide sequence encoding a vector component including gag-pol and env, and a nucleotide sequence encoding the RNA genome of a lentiviral vector according to any one of claims 1 to 22, or an expression cassette according to claim 23; or b) The viral vector production system according to claim 24, The process of introducing the cells, and (ii) A method for producing a lentiviral vector, comprising the step of culturing the cells under conditions suitable for the production of the lentiviral vector, provided that it is not performed in the human body.

32. The method according to claim 31, further comprising the step of selecting cells containing the nucleotide sequence encoding the vector components and the RNA genome of the lentiviral vector, prior to the step of culturing the cells under conditions suitable for the production of the lentiviral vector, provided that the method is not performed in the human body.

33. The method according to claim 31 or claim 32, further comprising step (i) introducing a nucleic acid containing a nucleotide sequence encoding TRAP into the cells.

34. The method according to any one of claims 31 to 33, further comprising step (i) introducing a nucleic acid comprising a nucleotide sequence encoding a modified u1 snRNA.

35. A lentiviral vector produced by the method described in any one of claims 31 to 34.

36. Use of a nucleic acid comprising a nucleotide sequence encoding the RNA genome of a lentiviral vector according to any one of claims 1 to 22, an expression cassette according to claim 23, a viral vector production system according to claim 24, or a cell according to any one of claims 25 to 30, for the production of a lentiviral vector, except for use in the human body.

37. Use of a nucleic acid comprising a nucleotide sequence encoding the RNA genome of a lentiviral vector according to any one of claims 1 to 22, an expression cassette according to claim 23, a viral vector production system according to claim 24, or a cell according to any one of claims 25 to 30, for suppressing or removing splicing activity from the major splice donor site and / or splice donor region of the RNA genome of the lentiviral vector, except for use in the human body.

38. The use according to claim 37, wherein the splicing activity from the major splice donor site and / or splice donor region of the RNA genome of the lentiviral vector is suppressed or removed in the transfected cells or transduced cells.

39. For suppressing the translation of the target nucleotide, (i) a nucleic acid comprising a nucleotide sequence encoding the RNA genome of a lentiviral vector according to any one of claims 9, 10, 15, 16, or 22; (ii) an expression cassette comprising a nucleotide sequence encoding the RNA genome of a lentiviral vector according to any one of claims 9, 10, 15, 16, or 22; (iii) a viral vector production system comprising a nucleic acid comprising a nucleotide sequence encoding vector components including gag-pol and env, and a nucleic acid comprising a nucleotide sequence encoding the RNA genome of a lentiviral vector according to any one of claims 9, 10, 15, 16, or 22; or (iv) a cell according to claim 29.

40. A lentiviral vector comprising a nucleic acid having a nucleotide sequence encoding the RNA genome of a lentiviral as defined in any one of claims 1 to 22.

41. A viral vector production system according to claim 24, or a cell according to claim 26 or claim 27, wherein the nucleic acid containing a nucleotide sequence encoding a vector component further comprises a sequence encoding rev.

42. The method according to claim 31, wherein the nucleic acid comprising a nucleotide sequence encoding a vector component further comprises a sequence encoding rev.

Images