Akkermansia bacteria growth promoter

Abstract

To provide a novel agent and composition that can promote the growth of Akkermansia bacteria in the intestines and can increase the share of the Akkermansia bacteria.SOLUTION: The inventive agent for promoting the growth of Akkermansia bacteria contains arctigenin and / or arctiin as an active ingredient. The arctigenin and / or arctiin may be contained as burdocks, burdock fruits, burdock sprouts or Forsythia fruits or extract thereof.SELECTED DRAWING: Figure 1

Description

Technical Field

[0001] The present invention relates to an agent for promoting the growth of Akkermansia bacteria in the intestine and a food composition.

Background Art

[0002] Akkermansia muciniphila is a mucin-degrading bacterium present in the human intestine and uses mucin as the sole carbon and nitrogen source. Akkermansia muciniphila is abundantly present in the mucosal layer of the host's intestine, and the largest number is present in the cecum. This bacterium stably forms colonies in the human intestine within one year after birth and increases as the person grows into an adult, but gradually decreases in the elderly (Non-Patent Document 1).

[0003] Non-Patent Document 1, which is a review of Akkermansia muciniphila, describes that Akkermansia muciniphila has an effect of improving the metabolic and immune functions of the host. Furthermore, it has also been suggested that Akkermansia muciniphila may have an effect of modifying cancer treatment. In addition, it has been suggested that Akkermansia muciniphila has an effect of maintaining the balance of the host's intestinal microbiota by converting mucin into beneficial by-products.

[0004] The intestinal mucosa primarily protects epithelial cells from microbial attack and provides microorganisms with energy for growth, which they use as nutrients. It is known that a decrease in the amount of Akkermansia muciniphila in the intestines weakens the intestinal barrier function due to a thinning of the mucosa, making it easier for pathogenic toxins, lipopolysaccharides (LPS), or antigens from allergenic foods to invade the host. The relationship between Akkermansia muciniphila and the host affects not only energy uptake, utilization, and consumption associated with glucose, protein, and lipid metabolism, but also the health of the mucosa and related mucosal immune responses. Akkermansia muciniphila not only plays a role in regulating the host immune system, but also strengthens the health of intestinal epithelial cells and the thickness of the mucosa, thereby promoting intestinal health (Non-Patent Literature 1).

[0005] Thus, the intestines maintain a barrier function that prevents harmful substances from entering the body. Tight junctions, which connect the epithelial cells of the intestinal tract, are composed of cell adhesion factors and are involved in this barrier function. In lipid metabolism disorders and diabetes, this intestinal barrier function is impaired, allowing LPS, a substance that causes metabolic endotoxins, to flow into the body, leading to chronic inflammation and an increase in inflammatory cytokines in the blood. Furthermore, LPS is known to suppress lipid metabolism in the liver and to be involved in the enhancement of inflammation in adipose tissue. In addition, LPS is known to be involved in inflammation of nerve cells in the brain and cognitive decline.

[0006] As mentioned above, Akkermansia muciniphila in the gut is closely involved in the host's gut microbiota balance, metabolism, and immune response. Therefore, increasing or maintaining the amount of Akkermansia muciniphila in the gut is important for the treatment, improvement, and prevention of various diseases related to gut microbiota balance, metabolism, and immune response, as well as for improving quality of life.

[0007] Patent Document 1 discloses a composition for promoting the growth of Ackermansia muciniphila, which contains a sialyl glycopeptide in which a sugar chain is attached to a peptide having threonine and / or serine residues.

[0008] Patent Document 2 discloses a method of using a composition containing astaxanthin to increase the number of bacteria belonging to the genus Akkermansia in the intestinal flora.

[0009] Patent Document 3 discloses an Akkermansia bacterial growth promoter containing plant-derived proanthocyanidins in pentamers or more, or a pharmaceutically acceptable salt thereof, as an active ingredient. [Prior art documents] [Patent Documents]

[0010] [Patent Document 1] Japanese Patent Publication No. 2019-43867 [Patent Document 2] Japanese Patent Publication No. 2019-131527 [Patent Document 3] Japanese Patent Publication No. 2018-8911 [Non-patent literature]

[0011] [Non-Patent Document 1] Ting Zhang, et al., Akkermansia muciniphila is a promising probiotic, “Microbial Biotechnology”, 2019, vol. 12, p. 1109-1125 [Overview of the Initiative] [Problems that the invention aims to solve]

[0012] The present invention aims to provide novel agents and compositions that can promote the growth of Akkermansia bacteria in the intestines and increase the proportion of Akkermansia bacteria in the gut. [Means for solving the problem]

[0013] As a result of diligent research to solve the above problems, the present inventors have found that administering arctigenin, burdock sprout extract containing arctigenin, and forsythia leaf extract to mice increases the proportion of Akkermansia bacteria in the intestines. Furthermore, the present inventors have found that arctigenin, burdock sprout extract, and forsythia leaf extract have the effect of increasing the amount of short-chain fatty acids in the cecum. The present invention was made based on these findings.

[0014] The present invention provides an Akkermansia bacterial growth promoter containing arctigenin and / or arctiin as an active ingredient.

[0015] The present invention also provides an Akkermansia bacterial growth promoter in which the arctigenin and / or arctiin are contained as burdock, burdock root, burdock sprouts, or forsythia or extracts thereof.

[0016] The present invention also provides a food composition for promoting the growth of Akkermansia bacteria, which contains arctigenin and / or arctiin as active ingredients.

[0017] The present invention also provides a food composition for promoting the growth of Akkermansia bacteria, wherein the arctigenin and / or arctiin are contained as burdock, burdock root, burdock sprouts, forsythia, or extracts thereof.

[0018] The present invention also provides a pharmaceutical composition for treating, improving and / or preventing at least one disease selected from the group consisting of alcoholic hepatitis (ASH), IgE-related atopic dermatitis, inflammatory bowel diseases (such as ulcerative colitis and Crohn's disease), irritable bowel syndrome, appendicitis, insulin resistance and diabetes caused by increased LPS, atherosclerosis, and autism, which contains arctigenin and / or arctiin as an active ingredient.

[0019] The present invention also provides an agent for promoting the production of short-chain fatty acids in the intestine, which contains arctigenin and / or arctiin as an active ingredient.

[0020] The present invention also provides an agent for promoting the production of short-chain fatty acids in the intestine, in which the arctigenin and / or arctiin are contained as burdock, burdock root, burdock sprout or lotus root or extracts thereof.

Effects of the Invention

[0021] The present invention can provide a novel agent and composition that can promote the growth of Akkermansia bacteria in the intestine and increase the composition ratio of Akkermansia bacteria. Further, by using the present invention, the amount of short-chain fatty acids in the intestine can be increased by inducing the growth of Akkermansia bacteria. Furthermore, by using the agent for promoting the growth of Akkermansia bacteria of the present invention, a method for improving the intestinal flora can be provided.

Brief Description of the Drawings

[0022] [Figure 1] A diagram showing changes in body weight (g) in the Normal group, Control group, high-dose arctigenin group (AG), high-dose burdock sprout extract group (GSE), and high-dose lotus leaf extract group (RLE). [Figure 2]Graph showing the expression levels of CD11c, PAI-1, and TNFα in the Normal group, Control group, high-dose arctigenin group (AG), high-dose burdock sprout extract group (GSE), and high-dose kale leaf extract group (RLE). [Figure 3] Graph showing the genus-level composition ratios of bacteria contained in the cecal contents for the Normal group, Control group, low-dose arctigenin group (AG Low), high-dose arctigenin group (AG High), low-dose burdock sprout extract group (GSE Low), high-dose burdock sprout extract group (GSE High), low-dose kale leaf extract group (RLE Low), and high-dose kale leaf extract group (RLE High). [Figure 4] Graph showing the composition ratio of Akkermansia bacteria in the bacteria contained in the cecal contents for the Normal group, Control group, low-dose arctigenin group (AG Low), high-dose arctigenin group (AG High), low-dose burdock sprout extract group (GSE Low), high-dose burdock sprout extract group (GSE High), low-dose kale leaf extract group (RLE Low), and high-dose kale leaf extract group (RLE High). [Figure 5] Figure showing the change in body weight (g) in the Normal group, Control group, arctigenin group (AG), metformin group (MF), burdock sprout extract group (GSE), and kale leaf extract group (RLE). [Figure 6] Figure showing the visceral fat weight (g) in the Normal group, Control group, arctigenin group (AG), metformin group (MF), burdock sprout extract group (GSE), and kale leaf extract group (RLE). [Figure 7] Graph showing the genus-level composition ratios of bacteria contained in the feces for the Normal group, Control group, arctigenin group (AG), metformin group (MF), burdock sprout extract group (GSE), and kale leaf extract group (RLE). [Figure 8]This graph shows the quantitative results of qPCR for Akkermansia bacteria contained in feces for the Normal group, Control group, Arctigenin group (AG), Metformin group (MF), Burdock sprout extract group (GSE), and Forsythia leaf extract group (RLE). [Figure 9] This graph shows the quantitative results of short-chain fatty acids contained in cecal contents for the Normal group, Control group, Arctigenin group (AG), Metformin group (MF), Burdock sprout extract group (GSE), and Forsythia leaf extract group (RLE). [Modes for carrying out the invention]

[0023] The present invention provides an Akkermansia bacterial growth promoter containing arctigenin and / or arctiin as active ingredients. By using the Akkermansia bacterial growth promoter of the present invention, a method for improving the intestinal microbiota can be provided.

[0024] In this specification, "Akkermansia bacteria" refers to bacteria belonging to the genus Akkermansia, including, for example, Akkermansia muciniphila.

[0025] In this specification, “promoting bacterial growth” includes, for example, increasing the number of bacteria, maintaining the number of bacteria, inhibiting the decrease in the number of bacteria, increasing the weight of bacteria, maintaining the weight of bacteria, inhibiting the decrease in the weight of bacteria, and increasing the proportion of bacteria.

[0026] The Akkermansia bacterial growth promoter of the present invention can improve the intestinal microbiota by selectively altering the growth and activity of specific intestinal bacteria. By improving the intestinal microbiota, it is possible to obtain prebiotic-like effects that have a favorable impact on the host and induce systemic effects beneficial to the host's health. These beneficial effects include improved bowel function (improved bowel movements), improvement of dyslipidemia, improvement of insulin resistance, promotion of mineral absorption, reduction of urinary nitrogen, prevention and improvement of colorectal cancer and inflammatory bowel disease, allergy suppression, and enhancement of intestinal immunity.

[0027] The present invention also provides an intestinal short-chain fatty acid production promoter containing arctigenin and / or arctiin as an active ingredient. Short-chain fatty acids in the intestines are produced by intestinal bacteria, serve as an energy source for intestinal epithelial cells, and are absorbed from the intestines and metabolized in the liver and muscles. Short-chain fatty acids act on adipocytes to suppress fat accumulation. Furthermore, short-chain fatty acids act on nerve cells and activate systemic metabolism via the sympathetic nervous system. Intestinal short-chain fatty acids also suppress the growth of pathogenic bacteria and improve the balance of the gut microbiota by lowering the pH in the intestines. Furthermore, short-chain fatty acids are known to regulate immune function. For example, short-chain fatty acids strengthen the barrier function of the intestinal epithelium and suppress inflammation and pathogenic infection. In addition, short-chain fatty acids induce the differentiation of B cells into antibody-producing cells, promote the secretion of IgA and IgG, and enhance intestinal immunity. Furthermore, short-chain fatty acids induce the proliferation of Treg cells and suppress excessive immune responses. In other words, by promoting the production of short-chain fatty acids, it is possible to obtain effects such as the prevention of obesity and diabetes, as well as the regulation of immune function.

[0028] In the present invention, short-chain fatty acids include acetic acid, propionic acid, and butyric acid, among others. In this specification, "promoting the production of intestinal short-chain fatty acids" includes increasing the amount of short-chain fatty acids present in the intestines. An increase in short-chain fatty acids includes an increase in at least one type of short-chain fatty acid or an increase in the total amount of multiple short-chain fatty acids. In this specification, "intestines" includes the large intestine. The large intestine consists of the colon, which includes the cecum, ascending colon, transverse colon, descending colon, and sigmoid colon, and the rectum, which includes the rectosigmoid junction, upper rectum, and lower rectum. In this specification, "intestines" may be any or more of these parts.

[0029] Arctigenin and arctiin are diphenylpropanoids (lignans) found in plants such as burdock. Arctiin is a precursor of arctigenin and is known to be metabolized into arctigenin in the body. Chemically synthesized arctigenin and / or arctiin may be used as arctigenin and / or arctiin, or arctigenin and / or arctiin isolated from plants may be used. Alternatively, the plant itself containing arctigenin and / or arctiin, or an extract of this plant, may be used as arctigenin and / or arctiin. Plants containing arctigenin and / or arctiin include, for example, burdock (sprouts, leaves, rhizomes, burdock), ainoko forsythia (flowers, leaves, fruits, rhizomes), kosen forsythia (flowers, leaves, fruits, rhizomes), forsythia (flowers, leaves, fruits, rhizomes), chinensis (flowers, leaves, fruits, rhizomes), safflower, cornflower, American thistle, Santorisou (yellow thistle), and kale. This includes burdock, common thistle, sedge thistle, sesame, maple leaf morning glory, bamboo grass, Korean jasmine, tragus jasmine, dwarf tragus jasmine, oleander, oak jasmine, leucanthemum, oriental jasmine, Japanese knotweed, large knotweed, mountain cherry, Arabidopsis thaliana, amaranth, walnut, oat, spelt wheat, soft wheat, Mexican cypress, and nutmeg. Among these, burdock (especially burdock root and burdock sprouts) and forsythia (especially the leaves) are preferred due to their high content of arctigenin and / or arctiin. When using the plants themselves, they can be used fresh, dried and chopped, or dried and powdered.

[0030] When plant extracts are used as arctigenin and / or arctiin, the extracts may be prepared from the plant by, for example, the following method. The extracts used in the present invention may be extracted from a plant containing arctigenin and / or arctiin by a two-step process consisting of an enzymatic conversion step and an organic solvent extraction step.

[0031] The enzymatic conversion process involves using β-glucosidase, an enzyme inherent in plants, to enzymatically convert arctiin contained in the plant into arctigenin. Specifically, the reaction from arctiin to arctigenin is carried out by allowing the inherent β-glucosidase to act on dried and cut plants by maintaining them at an appropriate temperature. For example, the plant can be maintained at a desired temperature by adding any solution such as water to the cut plant and stirring it at a temperature of around 30°C (between 20 and 50°C).

[0032] The organic solvent extraction step is a process of extracting arctigenin and arctiin from plants using any suitable organic solvent. That is, after the enzymatic conversion step described above has resulted in a high content of arctigenin, an appropriate solvent is added to extract the extract from the plant. For example, an appropriate solvent is added to the plant, and the extract is extracted by heating and stirring for an appropriate time. In addition to heating and stirring, the extract can also be extracted using any extraction method known to those skilled in the art, such as reflux heating, drip extraction, immersion extraction, or pressurized extraction.

[0033] Since arctigenin is poorly soluble in water, the yield of arctigenin can be improved by adding an organic solvent. Any organic solvent can be used. For example, alcohols such as methanol, ethanol, and propanol, as well as acetone, can be used. Considering safety, it is preferable to use 30% ethanol as the organic solvent. When the solvent is removed from the extract by distillation, a paste-like concentrate is obtained, and when this concentrate is further dried, a dry product can be obtained.

[0034] The Akkermansia bacterial growth promoter and intestinal short-chain fatty acid production promoter of the present invention may contain, as arctigenin and / or arctiin, the aforementioned plant itself or an extract thereof, dried and chopped the aforementioned plant, or dried and powdered the aforementioned plant. By including these, a better effect can be obtained than when arctigenin and / or arctiin is included alone.

[0035] The Akkermansia bacterial growth promoter and intestinal short-chain fatty acid production promoter of the present invention can be taken together with dietary fiber, oligosaccharides, polyphenols, fish oil, bifidobacteria, and lactic acid bacteria to obtain even better effects. Dietary fiber includes, for example, root vegetables rich in dietary fiber, indigestible fiber such as indigestible dextrin, and water-soluble dietary fiber found in konjac and yam. Polyphenols include, for example, polyphenols found in blueberries and soybeans. Fish oil includes, for example, fish oil containing omega-3 fatty acids such as DHA and EPA. Bifidobacteria and lactic acid bacteria include probiotics such as bifidobacteria and lactic acid bacteria that produce short-chain fatty acids such as acetic acid, butyric acid, and / or propionic acid.

[0036] The Akkermansia bacterial growth promoter and intestinal short-chain fatty acid production promoter of the present invention can be in any form of formulation. The Akkermansia bacterial growth promoter and intestinal short-chain fatty acid production promoter can be, as an orally administered formulation, tablets such as sugar-coated tablets, buccal tablets, coated tablets and chewable tablets; lozenges; pills; powders; capsules including hard capsules and soft capsules; granules; and liquid formulations such as suspensions, emulsions, syrups and elixirs.

[0037] Furthermore, the Akkermansia bacterial growth promoter and intestinal short-chain fatty acid production promoter of the present invention can be parenteral formulations such as intravenous injection, subcutaneous injection, intraperitoneal injection, intramuscular injection, transdermal administration, nasal administration, pulmonary administration, enteral administration, oral administration, and transmucosal administration. The Akkermansia bacterial growth promoter and intestinal short-chain fatty acid production promoter of the present invention can be, for example, injectable preparations, transdermal tapes, aerosol preparations, and suppositories.

[0038] Furthermore, the Akkermansia bacterial growth promoter and the intestinal short-chain fatty acid production promoter of the present invention can be provided as topical preparations. The topical preparations of the present invention may be pharmaceuticals and cosmetics. The topical preparations of the present invention may be topical preparations for application to the skin, scalp, hair, mucous membranes and nails, etc. Topical preparations include, for example, creams, ointments, liquids, gels, lotions, emulsions, aerosols, sticks, sheet masks, solids, foams, oils and sticks; adhesives such as poultices, plasters, tapes and patches; and sprays.

[0039] Furthermore, the Akkermansia bacterial growth promoter and the intestinal short-chain fatty acid production promoter of the present invention may be in a form suitable for consumption, such as solid, liquid, granular, powder, capsule, cream, or paste.

[0040] The present invention also provides a composition for promoting the growth of Akkermansia bacteria, comprising arctigenin and / or arctiin as an active ingredient. The present invention also provides a composition for promoting intestinal short-chain fatty acid production, comprising arctigenin and / or arctiin as an active ingredient. The compositions of the present invention may be compositions for use in pharmaceuticals, cosmetics and foods, etc. The compositions of the present invention may further contain any ingredients commonly used in pharmaceuticals, cosmetics and foods. For example, the compositions of the present invention may further contain pharmaceutically acceptable bases, carriers, excipients, binders, disintegrants, lubricants and colorants, etc.

[0041] Examples of carriers and excipients used in the compositions of the present invention include lactose, glucose, sucrose, mannitol, dextrin, gum arabic, potato starch, corn starch, calcium carbonate, calcium phosphate, calcium sulfate, and crystalline cellulose.

[0042] Examples of binders include starch, gelatin, syrup, tragacanth gum, polyvinyl alcohol, polyvinyl ether, polyvinylpyrrolidone, hydroxypropyl cellulose, methylcellulose, ethylcellulose, and carboxymethylcellulose.

[0043] Examples of disintegrants include starch, agar, gelatin powder, crystalline cellulose, calcium carbonate, sodium bicarbonate, sodium alginate, sodium carboxymethylcellulose, and calcium carboxymethylcellulose.

[0044] Examples of lubricants include magnesium stearate, hydrogenated vegetable oils, talc, and macrogol. For colorants, any colorant permitted for use in pharmaceuticals, cosmetics, and food products may be used.

[0045] Furthermore, the composition of the present invention may be coated with one or more layers of sucrose, gelatin, purified shellac, gelatin, glycerin, sorbitol, ethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose, polyvinylpyrrolidone, cellulose phthalate acetate, hydroxypropylmethylcellulose phthalate, methyl methacrylate, and methacrylic acid polymer, if necessary.

[0046] Furthermore, the composition of the present invention may optionally contain pH adjusters, buffers, stabilizers, preservatives, antiseptics, diluents, coating agents, sweeteners, flavorings, and solubilizers.

[0047] The present invention also provides a pharmaceutical composition for promoting the growth of Akkermansia bacteria, containing the Akkermansia bacterial growth promoter of the present invention. The present invention also provides a pharmaceutical composition for promoting the production of intestinal short-chain fatty acids, containing the intestinal short-chain fatty acid production promoter of the present invention. The pharmaceutical composition of the present invention can be a pharmaceutical composition for treating, improving and / or preventing various symptoms or diseases that can be treated, improved or prevented by increasing the proportion of Akkermansia bacteria in the intestinal microbiota. The pharmaceutical composition of the present invention can also be a pharmaceutical composition for treating, improving and / or preventing various symptoms or diseases that can be treated, improved or prevented by increasing intestinal short-chain fatty acids. The pharmaceutical composition of the present invention can be a pharmaceutical composition for treating, improving and / or preventing, for example, alcoholic hepatitis (ASH), IgE-related atopic dermatitis, inflammatory bowel disease (such as ulcerative colitis and Crohn's disease), irritable bowel syndrome, appendicitis, insulin resistance and diabetes mellitus due to increased LPS, atherosclerosis, and autism, via its Akkermansia bacterial growth promoting action. The pharmaceutical composition of the present invention may be a pharmaceutical composition for treating, improving and / or preventing obesity, diabetes, autoimmune diseases, atopic dermatitis, allergic diseases, malignant tumors, and inflammatory bowel disease, for example, by increasing intestinal short-chain fatty acids.

[0048] The present invention also provides a food composition for promoting the growth of Akkermansia bacteria, comprising arctigenin and / or arctiin as an active ingredient. The present invention also provides a food composition for promoting intestinal short-chain fatty acid production, comprising arctigenin and / or arctiin as an active ingredient. The food composition of the present invention can be configured in the same manner as the agents and compositions of the present invention described above. The food composition of the present invention can be, for example, a food composition for improving and / or preventing alcoholic hepatitis (ASH), IgE-related atopic dermatitis, inflammatory bowel disease (such as ulcerative colitis and Crohn's disease), irritable bowel syndrome, appendicitis, insulin resistance and diabetes due to increased LPS, atherosclerosis, and autism, via its Akkermansia bacteria growth promoting effect. The food composition of the present invention can also be a food composition for improving and / or preventing obesity, diabetes, autoimmune diseases, atopic dermatitis, allergic diseases, infection defense, malignant tumors, and inflammatory bowel disease, for example, via increased intestinal short-chain fatty acids.

[0049] In this specification, "food composition" includes not only general food and beverages, but also foods for the sick, health foods, functional foods, foods for specified health uses, nutritional supplements, and other supplements. General food and beverages include, for example, various beverages, various foods, processed foods, liquid foods (soups, etc.), seasonings, nutritional drinks, and confectionery. In this specification, "processed food" refers to products made by processing and / or cooking natural ingredients (animals and plants, etc.), and includes, for example, processed meat products, processed vegetable products, processed fruit products, frozen foods, retort foods, canned foods, bottled foods, and instant foods. The food composition of the present invention may be a food product that is labeled as promoting the growth of Akkermansia bacteria or promoting the production of intestinal short-chain fatty acids. The food composition of the present invention may also be provided in a form sealed in bags and containers. The bags and containers used in the present invention can be any bags and containers that are normally used for food.

[0050] The amount of arctigenin and / or arctiin in the agent, composition and food composition of the present invention should be such that it can exert an effect of promoting the growth of Akkermansia bacteria, and can be appropriately set depending on the target, purpose and method of administration (method of intake). For example, when administered orally to humans, it is preferable to include arctigenin and / or arctiin in such a way that the daily intake is 10 to 2000 mg. [Examples]

[0051] The embodiments of the present invention will be described in more detail below, but the present invention is not limited to the embodiments described below.

[0052] (Example 1: Production of Burdock Extract 1) As an example of the Akkermansia bacterial growth promoter of the present invention, an extract was obtained from burdock. Burdock (enzyme activity 8.23 ​​U / g) was chopped, and the resulting material was passed through a 9.5 mm sieve and then through a 0.85 mm sieve to confirm that 75% remained. 80 kg of this chopped burdock was added to 560 L of water kept at 29-33°C and stirred for 30 minutes. Then, 265 L of ethanol was added and the temperature was raised to 85°C, and the mixture was heated under reflux for another 60 minutes. This solution was centrifuged to obtain burdock extract. The extracts obtained by repeating this operation twice were combined, concentrated under reduced pressure, and 25% of the extract solid content was added, followed by spray drying. The arctigenin and arctiin content were 6.2% and 7.1%, respectively, and a burdock extract powder (containing 20% ​​dextrin) with an arctigenin / arctiin (weight ratio) of 0.89 was obtained.

[0053] (Example 2: Production of Burdock Extract 2) As an example of the Akkermansia bacterial growth promoter of the present invention, an extract was obtained from burdock. Burdock (enzyme activity 8.23 ​​U / g) was chopped, and the mixture was passed through a 9.5 mm sieve and then through a 0.85 mm sieve to confirm that 75% remained. 80 kg of this chopped burdock was added to 560 L of water kept at 30-33°C and stirred for 30 minutes. Then, 265 L of ethanol was added and the temperature was raised to 85°C, and the mixture was heated under reflux for another 30 minutes. This solution was centrifuged to obtain burdock extract. The extracts obtained by repeating this operation twice were combined, concentrated under reduced pressure, and 25% of the extract solid content was added, followed by spray drying. The arctigenin and arctiin content were 6.0% and 6.8%, respectively, and a burdock extract powder (containing 20% ​​dextrin) with an arctigenin / arctiin (weight ratio) of 0.87 was obtained.

[0054] (Example 3: Production of Burdock Extract 3) As an example of the Akkermansia bacterial growth promoter of the present invention, an extract was obtained from burdock. Burdock (enzyme activity 7.82 U / g) was chopped, passed through a 9.5 mm sieve, and then through a 0.85 mm sieve to confirm that 75% remained. 80 kg of this chopped burdock was added to 560 L of water kept at 30-32°C and stirred for 40 minutes. After 60 minutes, 258 L of ethanol was added and the temperature was raised to 85°C, and the mixture was heated under reflux for another 30 minutes. This liquid was centrifuged to obtain burdock extract. The extracts obtained by repeating this operation twice were combined, concentrated under reduced pressure, and 25% of the extract solid content was added, followed by spray drying. The arctigenin and arctiin content were 6.2% and 6.7%, respectively, resulting in a burdock extract powder (containing 20% ​​dextrin) with an arctigenin / arctiin (weight ratio) of 0.93.

[0055] (Example 4: Production of Burdock Extract 4) As an example of the Akkermansia bacterial growth promoter of the present invention, an extract was obtained from burdock. Burdock (enzyme activity 7.82 U / g) was chopped, and the resulting material was passed through a 9.5 mm sieve and then through a 0.85 mm sieve, confirming that 75% remained. 80 kg of this chopped burdock was added to 560 L of water kept at 30-32°C and stirred for 30 minutes. Then, 253 L of ethanol was added and the temperature was raised to 85°C, and the mixture was heated under reflux for another 40 minutes. This liquid was centrifuged to obtain the resulting extract. The extracts obtained by repeating this operation twice were combined, concentrated under reduced pressure, and 25% of the extract solid content was added, followed by spray drying. The arctigenin and arctiin content were 6.4% and 7.2%, respectively, and a burdock extract powder (containing 20% ​​dextrin) with an arctigenin / arctiin (weight ratio) of 0.89 was obtained.

[0056] (Example 5: Production of burdock sprout extract) As an example of the Akkermansia bacterial growth promoter of the present invention, an extract was obtained from burdock sprouts. 125 kg of dried burdock sprouts were added to 1680 kg of water and heated to 35±5°C, stirring for 60 minutes. Then, 720 kg of ethanol was added, the temperature was raised, and the mixture was stirred for a further 2 hours. The mixture was then filtered through an 80-mesh filter to obtain a burdock sprout extract. This extract was sterilized at 70°C for 1 hour, and approximately 30% of the extract solids was added as dextrin. The extract was then concentrated under reduced pressure and spray-dried. The arctigenin and arctiin content were 13.7% and 0.4%, respectively, and a burdock sprout extract powder with an arctigenin equivalent of 13.9% was obtained.

[0057] (Example 6: Production of Chinese Forsythia Leaf Extract 1) As an example of the Akkermansia bacterial growth promoter of the present invention, an extract was obtained from the leaves of Forsythia suspensa. 50 g of finely chopped Forsythia suspensa leaves containing 2.53% arctiin and 0.76% arctigenin were added to 350 mL of water and incubated at 37°C for 30 minutes. Then, 150 mL of ethanol was added and heated for 30 minutes to extract the extract. This solution was separated into solid and liquid using a 100-mesh sieve, and freeze-dried to obtain 18.62 g of Forsythia suspensa leaf extract with an arctigenin content of 5.62%.

[0058] (Example 7: Production of Chinese Forsythia Leaf Extract 2) As an example of the Akkermansia bacterial growth promoter of the present invention, an extract was obtained from the leaves of Forsythia suspensa. 720 g of finely chopped Forsythia suspensa leaves containing 7.38% arctiin and 0.78% arctigenin were added to 5 L of water and kept warm at 37°C for 30 minutes. Then, 2.16 L of ethanol was added and heated for 30 minutes to extract the extract. This solution was separated into solid and liquid using a 100-mesh sieve, and freeze-dried to obtain 343.07 g of Forsythia suspensa leaf extract with an arctigenin content of 9.55%.

[0059] (Example 8: Production of Chinese Forsythia Leaf Extract 3) As an example of the Akkermansia bacterial growth promoter of the present invention, an extract was obtained from the leaves of Forsythia suspensa. 10 kg of finely chopped Forsythia suspensa leaves containing 8.77% arctiin and 1.54% arctigenin were added to 140 kg of water, heated to 35±5°C, and kept warm for 60 minutes. Then, 60 kg of ethanol was added and heated for 2 hours, and filtered through an 80-mesh filter to obtain Forsythia suspensa leaf extract. Approximately 20% of the extract solids of this solution were added as dextrin, then concentrated under reduced pressure and spray-dried. 3.63 kg of Forsythia suspensa leaf extract powder with an arctigenin content of 7.73% was obtained.

[0060] (Example 9: Production of Chinese Forsythia Leaf Extract 4) As an example of the Akkermansia bacterial growth promoter of the present invention, an extract was obtained from the leaves of Forsythia suspensa. 95 kg of Forsythia suspensa leaves were mixed with 2000 kg of aqueous ethanol, heated to 50±5°C, and stirred for 2 hours. The mixture was then filtered through an 80-mesh filter to obtain a Forsythia suspensa leaf extract. 10% each of gum arabic and dextrin were added to the extract solids of this solution, which was then concentrated under reduced pressure and spray-dried. 32.6 kg of Forsythia suspensa leaf extract powder with an arctigenin content of 8.60% was obtained.

[0061] (Example 10: Granule preparation containing burdock extract powder) As an example of the Akkermansia bacterial growth promoter of the present invention, a granular preparation was manufactured using burdock extract. The granular preparation was manufactured in accordance with the section on granular preparations in the General Provisions of Pharmaceutical Preparations in the Japanese Pharmacopoeia. Specifically, the following components (1) to (3) were taken and prepared into granules. These were filled into aluminum laminate films in 1.5g portions to obtain granular preparations containing 0.5g of burdock extract powder per sachet.

[0062] (1) Burdock extract powder of Example 2 33.3% (2) Lactose 65.2% (3) Hydroxypropylcellulose 1.5% Total 100%

[0063] (Example 11: Granule preparation containing burdock extract powder) As an example of the Akkermansia bacterial growth promoter of the present invention, a granular preparation was manufactured using burdock extract. The granular preparation was manufactured in accordance with the section on granular preparations in the General Provisions of Pharmaceutical Preparations in the Japanese Pharmacopoeia. Specifically, the following components (1) to (3) were taken and prepared into granules. These were filled into aluminum laminate films in 3.0g portions to obtain granular preparations containing 2g of burdock extract powder per sachet.

[0064] (1) Burdock extract powder of Example 2 66.7% (2) Lactose 30.3% (3) Hydroxypropylcellulose 3.0% Total 100%

[0065] (Example 12: Tablets containing burdock extract powder) As an example of the Akkermansia bacterial growth promoter of the present invention, tablets were prepared using burdock extract. The tablets were prepared in accordance with the "General Provisions for Pharmaceutical Preparations" section of the Japanese Pharmacopoeia, specifically the section on tablets. That is, the following components (1) to (6) were used to obtain tablets.

[0066] (1) Burdock extract powder of Example 2 37.0% (2) Crystalline cellulose 45.1% (3) Carmellose calcium 10.0% (4) Crospovidone 3.5% (5) Hydrated silicon dioxide 3.4% (6) Magnesium stearate 1.0% Total 100%

[0067] (Example 13: Effect of arctigenin on the growth of Akkermansia bacteria) [Laboratory animals] The following examples used 20-week-old male C57BL / 6J-DIO mice (purchased from Charles River Co., Ltd.). The animals were reared in an environment with a temperature of 23.0±5℃, humidity of 50.0±10%, and a 12-hour light-dark cycle.

[0068] [Experimental Method] Male C57BL / 6 DIO mice, 20 weeks old, were supplemented with a high-fat diet (Research Diets' feed D12492, hereafter referred to as HFD) for 9 weeks. Obese model mice with slowed weight gain were divided into the following eight groups, and the test substances were force-administered orally over 4 weeks: Normal group (normal diet), Control group (HFD), Arctigenin low-dose group (AG Low group; HFD + arctigenin 20 mg / kg), Arctigenin high-dose group (AG High group; HFD + arctigenin 60 mg / kg), Burdock sprout extract low-dose group (GSE Low group; HFD + burdock sprout extract 144 mg / kg), Burdock sprout extract high-dose group (GSE High group; HFD + burdock sprout extract 432 mg / kg), Forsythia leaf extract low-dose group (RLE). Low group (HFD + forsythia leaf extract 260 mg / kg) and high-dose forsythia leaf extract group (RLE High group; HFD + forsythia leaf extract 780 mg / kg) (n=6 in each group).

[0069] For the arctigenin, we used a purified arctigenin product (>95.0%) refined from burdock sprout extract by Kracie Holdings, Ltd. For the burdock sprout extract, we used the burdock sprout extract from Example 5. For the forsythia leaf extract, we used the forsythia leaf extract from Example 8. The amounts of burdock sprout extract and forsythia leaf extract were adjusted so that the arctigenin content was equivalent to 20 mg / kg in the low-dose group and 60 mg / kg in the high-dose group.

[0070] The administration method was daily forced oral administration. For feeding, in the HFD-fed groups other than the Normal group, powdered feed was paired to standardize the amount of food consumed.

[0071] After administering the test substance for four weeks, the animals were fasted for 18 hours, blood was drawn from the abdominal vena cava under anesthesia, and after euthanasia by cervical dislocation, liver and cecal contents were collected.

[0072] [Weight changes] Table 1 shows the changes in body weight (g) for each group. Figure 1 shows the changes in body weight (g) for the Normal group, Control group, Arctigenin high-dose group (indicated as "AG" in the figure), Burdock sprout extract high-dose group (indicated as "GSE" in the figure), and Forsythia leaf extract high-dose group (indicated as "RLE" in the figure). As shown in Table 1 and Figure 1, a tendency toward weight loss was observed in the Burdock sprout extract high-dose group and the Forsythia leaf extract high-dose group.

[0073] [Table 1]

[0074] [Expression levels of inflammation-related factors] For the Normal group, Control group, and high-dose groups of each test substance, total RNA was extracted and cDNA was synthesized from the obtained liver tissue. Then, the expression levels of genes encoding inflammation-related factors CD11c, PAI-1, and TNFα were compared by qPCR. 18S rRNA was used as a control for gene expression levels. The primers used for qPCR were 18S (F: TTCTGGCCAACGGTCTAGACAAC, R: CCAGTGGTCTTGGTGTGCTGA), CD11c (F: ACACAGTGTGCTCCAGTATGA, R: GCCCAGGGATATGTTCACAGC), PAI-1 (F: CCGTGGAACAAGAATGAGATCAG, R: CTCTAGGTCCCGCTGGACAA), and TNFα (F: ACCCTCACACTCAGATCATCTTC, R: TGGTGGTTTGCTACGACGT).

[0075] Table 2 and Figure 2 show the expression levels of CD11c, PAI-1, and TNFα in the Normal group, Control group, high-dose arctigenin group (indicated as "AG" in the figure), high-dose burdock sprout extract group (indicated as "GSE" in the figure), and high-dose forsythia leaf extract group (indicated as "RLE" in the figure). The values ​​in Figure 3 represent the mean ± standard error (Mean ± SEM) of 3-6 animals. An asterisk (*) is used if the p-value is less than 0.05 compared to the Control group based on Dunnett's t-test results. The high-dose arctigenin group, high-dose burdock sprout extract group, and high-dose forsythia leaf extract group showed lower expression levels of CD11c, PAI-1, and TNFα compared to the Control group.

[0076] [Table 2]

[0077] These results indicate that arctigenin, burdock sprout extract, and forsythia leaf extract have the effect of suppressing the expression of genes encoding CD11c, PAI-1, and TNFα.

[0078] [Analysis of the microbiome of cecal contents] For each group, DNA was extracted from the collected cecal contents and amplicon sequencing analysis was performed. Table 3 and Figure 3 show the genus-level percentages (%) of the 11 species and other bacteria that made up the largest proportion of the cecal contents for all groups.

[0079] [Table 3]

[0080] Table 4 and Figure 4 show the percentage composition of Akkermansia bacteria in the cecal contents for each group. The values ​​in Figure 4 represent the mean ± standard error (Mean ± SEM) of 3 to 6 organisms. If the p-value of the Dunnett test is less than 0.01, it is marked with "**".

[0081] [Table 4]

[0082] As shown in Figures 3 and 4, a dose-dependent increase in the proportion of Akkermansia bacteria was observed in the groups administered arctigenin, burdock sprout extract, and forsythia leaf extract compared to the control group. A significant increase in the proportion of Akkermansia bacteria was observed in the high-dose groups of arctigenin, burdock sprout extract, and forsythia leaf extract.

[0083] (Example 14: Effect of arctigenin on the growth of Akkermansia bacteria) [Laboratory animals] The following examples used 5-week-old male C57BL / 6J mice (purchased from Nippon SLC Co., Ltd.). The animals were reared in an environment with a temperature of 23.0±5℃, humidity of 50.0±10%, and a 12-hour light-dark cycle.

[0084] [Experimental Method] Six-week-old male C57BL / 6J mice were divided into the following six groups and administered the test substance in their diet for eight weeks: Normal group (normal diet), Control group (high-fat, high-sucrose diet: HFHS), Arctigenin group (AG group; HFHS containing 0.5% arctigenin), Metformin group (MF group; HFHS containing 0.5% metformin), Burdock sprout extract group (GSE group; HFHS containing 5% burdock sprout extract), and Forsythia leaf extract group (RLE group; HFHS containing 5% forsythia leaf extract) (n=6 in each group).

[0085] For arctigenin, we used a purified arctigenin product (>95.0%) refined from burdock sprout extract by Kracie Holdings, Ltd. Metformin (M2009) was purchased from Tokyo Chemical Industry Co., Ltd. For burdock sprout extract, we used the burdock sprout extract from Example 5. For forsythia leaf extract, we used the forsythia leaf extract from Example 9.

[0086] After administering the test substance for 7 weeks, the mice were moved to wire cages and fresh feces were collected. Eight weeks after administration, the mice were sacrificed under anesthesia, and visceral fat (perididymal fat and mesenteric fat) and cecal contents were collected.

[0087] [Weight changes] Figure 5 shows the change in body weight (g) for each group. The values ​​in Figure 5 represent the mean ± standard error (Mean ± SEM) of the six animals. Significant difference tests were performed using repeated measures ANOVA, and an asterisk (*) was used if the p-value was less than 0.05 compared to the control group, and a special symbol (**) was used if the p-value was less than 0.01. Significant suppression of body weight gain was observed in all groups compared to the control group.

[0088] [Visceral fat weight] Figure 6 shows the visceral fat weight (g) of each group at the time of dissection. The values ​​in Figure 6 represent the mean ± standard error (Mean ± SEM) of the six animals. If the p-value of the Dunnett test is less than 0.01, it is marked with "**". A significant decrease in visceral fat weight was observed in all groups compared to the control group.

[0089] [Analysis of the bacterial flora in feces] For each group, DNA was extracted from the collected feces and amplicon sequencing analysis was performed. Figure 7 shows the percentage (%) of the 10 species and other bacteria that were most frequently present in the feces for all groups.

[0090] [Quantitative determination of Akkermansia bacteria in feces] For each group, DNA was extracted from the collected feces, and the copy number of Akkermansia bacteria in the feces was quantified by qPCR. The primers used for qPCR were Akk-F: CAGCACGTGAAGGTGGGGAC and Akk-R: CCTTGCGGTTGGCTTCAGAT. Figure 8 shows the qPCR quantification results of Akkermansia bacteria in the feces for all groups. The values ​​in Figure 8 represent the mean ± standard error (Mean ± SEM) of 6 organisms. If the p-value of the Dunnett test was less than 0.01, it was marked with "**". Compared to the control group, the arctigenin group, burdock sprout extract group, and forsythia leaf extract group showed a significant increase in Akkermansia bacteria in the feces.

[0091] [Amount of short-chain fatty acids in cecal contents] For each group, the amount of short-chain fatty acids (acetic acid, propionic acid, butyric acid, and total short-chain fatty acids) in the collected cecal contents was quantified using a Prominence™ HPLC organic acid analysis system (Shimadzu, Japan). Figure 9 shows the quantification results of short-chain fatty acids contained in the cecal contents for all groups. The values ​​in Figure 9 represent the mean ± standard error (Mean ± SEM) of 6 animals. If the p-value of the Dunnett test is less than 0.05, it is marked with "*", and if it is less than 0.01, it is marked with "**". Compared to the control group, the amounts of acetic acid, propionic acid, and total short-chain fatty acids were significantly increased in the arctigenin group and the forsythia leaf extract group, and the amount of total short-chain fatty acids was significantly increased in the burdock sprout extract group.

[0092] These results indicate that arctigenin, burdock sprout extract, and forsythia leaf extract induce the growth of Akkermansia bacteria and increase the amount of short-chain fatty acids in the cecum. [Industrial applicability]

[0093] The present invention is suitably applicable to pharmaceuticals and foods for promoting the growth of Akkermansia bacteria in the intestines.

Claims

1. A growth promoter for Akkermansia bacteria, containing arctigenin and / or arctiin as active ingredients.

2. The Akkermansia bacterial growth promoter according to claim 1, wherein the arctigenin and / or arctiin is contained as burdock, burdock root, burdock sprouts, or forsythia or an extract thereof.

3. A food composition for promoting the growth of Akkermansia bacteria, containing arctigenin and / or arctiin as active ingredients.

4. The food composition for promoting the growth of Akkermansia bacteria according to claim 3, wherein the arctigenin and / or arctiin is contained as burdock, burdock root, burdock sprouts, or forsythia or an extract thereof.

5. It contains arctigenin and / or arctiin as active ingredients, The aforementioned arctigenin and / or arctiin are contained as burdock (excluding the root), burdock sprouts, burdock sprouts, or forsythia, or extracts thereof. An agent that promotes the production of short-chain fatty acids in the intestines.

Images