Osteogenesis-promoting oligonucleotides

Abstract

To provide a novel bone differentiation-promoting agent.SOLUTION: A bone differentiation-promoting agent comprises an oligonucleotide having an activity of promoting bone differentiation. The oligonucleotide comprises a core base sequence TCCTC and is featured by the following (1) or (2). (1) The oligonucleotide is featured by the following (1-1) to (1-3). (1-1) One of the base sequences AA and TT is contained in five bases on the 5'end side of the oligonucleotide. (1-2) the other of the base sequences AA and TT is contained in five bases on the 3'end side of the oligonucleotide. (1-3) T is not adjacent to the base sequence AA shown in the above (1-1) and (1-2), and A is not adjacent to the base sequence TT. (2) A is not contained in two bases on the 5'end side and two bases on the 3'end side.SELECTED DRAWING: None

Description

Technical Field

[0001] The present disclosure relates to an oligo-oligonucleotide having a function of promoting bone differentiation.

Background Art

[0002] In a super-aged society, locomotive syndrome (locomotor organ syndrome) due to the decline of locomotor organs (muscles, bones, joints) is increasing, and it ranks first among the causes of requiring support or care in Japan. Osteoporosis is one of the three major causative diseases of locomotive syndrome, along with osteoarthritis and spinal canal stenosis. The estimated number of osteoporosis patients in Japan is about 11 million, which is a major factor in reducing activities of daily living (ADL) and quality of life (QOL).

[0003] Bone density decreases with aging, but bone mass also decreases due to metabolic diseases such as diabetes, chronic kidney disease (CKD), and arteriosclerosis. It is also known that hormonal imbalance caused by cancer treatment induces a decrease in bone density. Thus, the decrease in bone mass and bone density is associated with aging and various diseases. In order to extend the healthy life expectancy in a super-aged society, it is essential to prevent bone loss and develop treatment methods for bone-related diseases.

[0004] Bone tissue maintains bone mass, bone strength, and bone elasticity through bone remodeling consisting of bone formation and bone resorption. First, preosteoblasts that express the early marker Msx2 of bone lineage cells differentiate from mesenchymal stem cells. After proliferation by cell division, preosteoblasts differentiate into osteoblasts by the action of the master transcription factor Runx2 of bone differentiation. Runx2 induces the expression of the bone differentiation transcription factorosterix (gene name Sp7), positively regulates the expression of type I collagen (gene name Col1a1), non-collagenous bone matrix osteocalcin (gene name Bglap2), and bone morphogenetic factor BMP4, and forms an extracellular matrix that serves as a scaffold for osteoblasts. Then, as osteoblasts mature, the expression of alkaline phosphatase (ALP) is enhanced, and substrate mineralization progresses. Finally, osteoblasts are buried in the bone matrix they produced and complete differentiation into osteocytes.

[0005] Thus, osteoblasts play a central role in bone formation. However, in osteoporosis, bone resorption by osteoclasts becomes dominant over bone formation by osteoblasts, leading to a decrease in bone mass. Therefore, molecules that specifically induce osteoblast differentiation and promote bone formation are considered effective in normalizing bone remodeling.

[0006] Technologies using oligonucleotides (oligoDNA) to promote osteogenic differentiation are being investigated. For example, it has been reported that the 27-base oligoDNA (ODN) "MT01" derived from the human mitochondrial DNA sequence promotes osteoblast differentiation (Non-Patent Literature 1). In addition, a method for promoting bone formation using oligoDNA (TCATCATTTTGTCATTTTGTCATT: Sequence ID No. 48) in which the bases constituting CpG oligoDNA (CpG-2006) are substituted with A and A with T has been disclosed (Patent Literature 1). However, given the importance of osteogenic differentiation technologies as described above, the development of new osteogenic differentiation promoters is eagerly awaited. [Prior art documents] [Patent Documents]

[0007] [Patent Document 1] Special Publication 2008-520545 [Non-patent literature]

[0008] [Non-Patent Document 1] X. Hou, “A Specific Oligodeoxynucleotide Promotes the Differentiation of Osteoblasts via ERK and p38 MAPK Pathways”, Int J Mol Sci. 2012; 13(7): 7902-7914. [Non-Patent Document 2] Nigar S. et al., Synergistic oligodeoxynucleotide strongly promotes CpG-induced interleukin-6 production. BMC Immunology, 2012; 18: 44. [Overview of the project] [Problems that the invention aims to solve]

[0009] The problem that this invention aims to solve is to provide a novel bone differentiation promoting agent. [Means for solving the problem]

[0010] Under these circumstances, the present inventors conducted diligent research and found that oligonucleotides containing TCCTC as a core base sequence, in which one of the base sequences AA and TT is contained in the 5' terminal 5 bases and the other in the 3' terminal 5 bases, and in which no T is adjacent to the base sequence AA and no A is adjacent to the base sequence TT, and oligonucleotides containing TCCTC as a core base sequence, in which A is not contained in the 5' terminal 2 bases and the 3' terminal 2 bases, have the ability to promote osteogenic differentiation. The present invention is based on these new findings. Accordingly, the present invention provides the following:

[0011] Item 1. An osteogenic agent comprising an oligonucleotide having activity to promote osteogenic differentiation, wherein the oligonucleotide comprises the core base sequence TCCTC and has the following characteristics: (1) It has the following characteristics (1-1) to (1-3): (1-1) The 5' end of the oligonucleotide contains one of the base sequences AA and TT. (1-2) The 3' end of the oligonucleotide contains the other of the base sequences AA and TT. (1-3) The base sequence AA shown in (1-1) and (1-2) above does not have a T adjacent to it, and the base sequence TT does not have an A adjacent to it. (2) A is not contained in the two bases on the 5'-terminal side and the two bases on the 3'-terminal side.

[0012] Item 2. The bone differentiation promoter according to Item 1, wherein the oligonucleotide has a length of 20 bases or less.

[0013] Item 3. The oligonucleotide is (i-1) the base sequence represented by SEQ ID NO: 34: SEQ ID NO: 34: GGAACGATCCTCAAGCTT or (i-2) consists of a base sequence in which one or several bases are substituted, added or deleted within the range satisfying the requirement of (1) in the base sequence represented by SEQ ID NO: 34, The bone differentiation promoter according to Item 1 or 2.

[0014] Item 4. The oligonucleotide is (ii-1) the base sequence represented by SEQ ID NO: 38: SEQ ID NO: 38: CGATCCTCAAGCTTAGGT or (ii-2) consists of a base sequence in which one or several bases are substituted, added or deleted within the range satisfying the requirement of (2) in the base sequence represented by SEQ ID NO: 38, The bone differentiation promoter according to Item 1 or 2. ;

[0015] Item 5. The bone differentiation promoter according to any one of Items 1 to 4 for application to mammalian or avian cells or individuals.

Effect of the Invention

[0016] According to the present invention, a new bone differentiation promoter can be provided.

Brief Description of the Drawings

[0017] [Figure 1] Shows the structural diagram (left) and proximity map (right) of iSN40 in Reference Example 1 [Figure 2]Structural diagram (left) and proximity map (right) of iSN41 in Reference Example 2 [Figure 3] Microscopic images of osteoblasts stained by ALP enzyme activity in Example 1 [Figure 4] ALP signal intensity of each ODN-added sample in Example 1 [Figure 5] Expression levels of transcription factors controlling osteogenic differentiation in the iSN40 sample and control in Example 2 [Figure 6] Expression levels of genes related to the formation of extracellular matrix, which are bone metabolism markers, in Example 2 [Figure 7] Alizarin staining images of osteoblasts administered with iSN40 in Example 3 [Figure 8] Experimental results in Figure 7 of Example 3 were quantified and graphed [Figure 9] Experimental results showing the induction of osteoblast calcification by changing the concentration of iSN40 to be administered in Example 3 [Figure 10] Experimental results in Figure 9 of Example 3 were quantified and graphed [Figure 11] Microscopic images of osteoblasts stained by ALP enzyme activity in Example 4 [Figure 12] Ratio of the area of ALP-positive cells in the iSN40 and GC-iSN40 added samples in Example 4 [Figure 13] Alizarin staining images of osteoblasts administered with iSN40 and GC-iSN40 in Example 5 [Figure 14] Experimental results in Figure 13 of Example 5 were quantified and graphed

Mode for Carrying Out the Invention

[0018] In this specification, “oligonucleotides” may be DNA, RNA, or DNA-RNA hybrids. These may be double-stranded or single-stranded, and when referring to an oligonucleotide having a certain sequence, unless otherwise specified, this comprehensively includes oligonucleotides having complementary sequences. These nucleic acid molecules may be cyclic or linear, and may be synthetic or of biological origin.

[0019] An osteogenic agent according to one aspect of the present invention includes an oligonucleotide that has the activity to promote osteogenic differentiation when applied to cells or an organism. In the present invention, "having the activity to promote osteogenic differentiation" can be interpreted appropriately in reference to the common technical knowledge in the art to which the present invention belongs, but in the present invention, an oligonucleotide can be evaluated as having the activity to promote osteogenic differentiation if it significantly increases the amount of alkaline phosphatase (ALP) expressed by osteoblasts compared to a control group. The amount of ALP expression can be measured and evaluated, for example, in the test shown in Example 1 (Figure 4) described later. More precisely, the osteogenic differentiation-promoting activity can also be evaluated by whether or not calcium deposition (cellular calcification) progresses in osteocytes differentiated from osteoblasts compared to a control group. Calcium deposition can be measured and evaluated, for example, in the test (alizarin staining) shown in Example 3 (Figures 7 and 9) described later.

[0020] In one embodiment of the present invention, oligonucleotides having activity to promote osteogenic differentiation can be those containing the core base sequence TCCTC and having the characteristics of (1-1) to (1-3): (1-1) The 5' end of the oligonucleotide contains one of the base sequences AA and TT. (1-2) The 5 bases at the 3' end of the oligonucleotide contain the other of the base sequences AA and TT, (1-3) The base sequence AA shown in (1-1) and (1-2) above does not have a T adjacent to it, and the base sequence TT does not have an A adjacent to it.

[0021] In this embodiment, the 5' terminal 5 bases of the oligonucleotide contain one of the base sequences AA and TT. In this embodiment, one of the base sequences AA and TT may be contained in the 4 bases at the 5' terminal of the oligonucleotide. In this embodiment, the 3' terminal 5 bases of the oligonucleotide contain the other of the base sequences AA and TT. In this embodiment, the other of the base sequences AA and TT may be contained in the 4 bases at the 3' terminal of the oligonucleotide.

[0022] As described later in Example 1, the inventors found that an oligonucleotide having a core base sequence TCCTC, with one of the base sequences AA and TT in the 5' terminal 5 bases and the other in the 3' terminal 5 bases, in which the base sequence AA in the 5' terminal or 3' terminal 5 bases is not adjacent to T and the base sequence TT is not adjacent to A (iSN40: SEQ ID NO: 34), exhibits significantly higher osteogenic activity compared to an oligonucleotide in which the base sequence TT in the 3' terminal 5 bases is adjacent to A (iSN41: SEQ ID NO: 35). Furthermore, as described later in Reference Examples 1 and 2, molecular simulations of the three-dimensional structures of iSN40 and iSN41 suggested that iSN40 has a structure in which the AA at the 5' terminal and the TT at the 3' terminal are in close proximity (U-shaped or O-shaped structure), while in iSN40, the AA at the 5' terminal and the TT at the 3' terminal are not in close proximity as in iSN4, suggesting a relatively linear structure. This structural difference is thought to be partly due to the fact that in iSN40, the AA at the 5' end and the TT at the 3' end are close together in an attempt to pair by hydrogen bonding, whereas in iSN41, the presence of A adjacent to the TT base sequence at the 3' end weakens the hydrogen bond between AA and TT. From these results, it is thought that oligonucleotides having the core base sequence TCCTC, containing one of the base sequences AA or TT in the 5' end 5 bases and the other in the 5' end 5 bases, where T is not adjacent to the AA base sequence in the 5' or 3' end 5 bases, and A is not adjacent to the TT base sequence, adopt a structure in which the AA and TT base sequences are close together, similar to iSN40, and exhibit high osteogenic activity. In fact, as described later in Example 4, GC-iSN40, an oligonucleotide having the core base sequence TCCTC, with one of the base sequences AA and TT in the 5' terminal 5 bases and the other in the 3' terminal 5 bases, and in which two bases were substituted within the range satisfying the requirement that no T is adjacent to the base sequence AA in the 5' terminal or 3' terminal 5 bases, and no A is adjacent to the base sequence TT, also showed high osteogenic activity.

[0023] Such oligonucleotides are not particularly limited as long as they contain the core base sequence TCCTC and satisfy the requirements of (1) above, but for example, (i-1) the base sequence represented by Sequence ID No. 34: Sequence ID 34: GGAACGATTCCTCAAGCTT Examples of oligonucleotides comprising the above include: (i-2) Examples of oligonucleotides include those comprising a base sequence in which one or several bases (e.g., 1 to 3, 1 to 2, or 1) are substituted, added, or deleted in the base sequence represented by Sequence ID No. 34, within the range that satisfies the requirements of (1) above. Examples of such substitutions include substituting a partial sequence CG with GC, or substituting a partial sequence GC with CG, in the base sequence represented by Sequence ID No. 34, within the range that satisfies the requirements of (1) above.

[0024] Furthermore, while the length of the oligonucleotide, which is the active ingredient of the osteogenic agent of the present invention, is not particularly limited, a length of 20 base pairs or less is preferred, and a length of 18 base pairs or less is more preferred, from the viewpoint of structural strength and stability of the oligonucleotide, absorption efficiency to organs and cells, and the ability to suppress the cost of chemical artificial synthesis. Also, since the oligoDNAs that have been conventionally studied for osteogenic activity have had a base length longer than 20, oligonucleotides with a base length of less than or equal to the above are particularly useful. Furthermore, while the lower limit of the length of the oligonucleotide, which is the active ingredient of the osteogenic agent of the present invention, is not particularly limited, for example, a length of 12 base pairs or more is preferred, and a length of 16 base pairs or more is more preferred. Examples of such oligonucleotides include: GAACGATCCTCAAGCTT (Sequence ID 49) GGGAACGATCCTCAAGCTT (Sequence ID 50) GCAACGATCCTCAAGCTT (Sequence ID 51) GCAACGATCCTCAAGGTT (Sequence ID 52) GGAACGATCCTCAAGTTC (Sequence ID 53) GAAGCGATCCTCAAGCTT (Sequence ID 54) GGAAGCATCCTCAAGCTT (Sequence ID 55) These are some examples.

[0025] Furthermore, in another embodiment of the present invention, an oligonucleotide having activity to promote osteogenic differentiation can be used that contains the core base sequence TCCTC and does not contain A in the two bases at the 5' end and the two bases at the 3' end.

[0026] Such oligonucleotides are not particularly limited as long as they satisfy the above requirements, but for example, (ii-1) the base sequence represented by SEQ ID NO: 38: Sequence ID 38: CGATCCTCAAGCTTAGGT Examples of oligonucleotides consisting of (for example, 1 to 3, 1 to 2, or 1) are available. In another embodiment of the present invention, examples of such oligonucleotides include (ii-2) oligonucleotides consisting of a base sequence in which one or more bases are substituted, added, or deleted in the base sequence represented by Sequence ID No. 38 within the range that satisfies the requirements of (2) above.

[0027] In this embodiment as well, the length of the oligonucleotide, which is the active ingredient of the osteogenic agent of the present invention, is not particularly limited, but from the viewpoint described above, a length of 20 base pairs or less is preferred, and a length of 18 base pairs or less is more preferred. Also in this embodiment as well, the lower limit of the length of the oligonucleotide, which is the active ingredient of the osteogenic agent of the present invention, is not particularly limited, but for example, a length of 12 base pairs or more is preferred, and a length of 16 base pairs or more is more preferred.

[0028] The oligonucleotide, which is the active ingredient of the bone differentiation promoter of the present invention, may be an oligonucleotide having a phosphodiester bond, in which the oxygen atom of the phosphate group is replaced with a sulfur atom (e.g., a phosphorothioate bond) to enhance resistance to nucleolytic enzymes, but is not limited to these. Furthermore, the oligonucleotide may be extracted and fragmented from organisms such as lactic acid bacteria and Escherichia coli, or produced by chemical synthesis or genetic engineering, but is not limited to these.

[0029] In the present invention, the above oligonucleotide, which is the active ingredient of the present invention, may be used as an osteogenic agent, or it may be used as a pharmaceutical composition in combination with various pharmaceutically acceptable carriers (for example, isotonic agents, stabilizers, pH adjusters, antioxidants, solubilizers, viscosity modifiers, preservatives, etc.). Examples of isotonic agents include sugars such as glucose, trehalose, lactose, fructose, mannitol, xylitol, and sorbitol; polyhydric alcohols such as glycerin, polyethylene glycol, and propylene glycol; and inorganic salts such as sodium chloride, potassium chloride, and calcium chloride. Examples of pH adjusting agents include acids such as hydrochloric acid, carbonic acid, acetic acid, and citric acid, as well as alkali metal hydroxides such as sodium hydroxide and potassium hydroxide, alkali metal carbonates or bicarbonates such as sodium carbonate, alkali metal acetates such as sodium acetate, alkali metal citrates such as sodium citrate, and bases such as trometamol. Examples of antioxidants include sodium bisulfite, anhydrous sodium sulfite, and sodium pyrosulfite. Examples of solubilizers include sodium benzoate, glycerin, D-sorbitol, glucose, propylene glycol, hydroxypropyl methylcellulose, polyvinylpyrrolidone, macrogol, and D-mannitol. Examples of viscosity-concentrating agents include polyethylene glycol, methylcellulose, ethylcellulose, carmellose sodium, xanthan gum, chondroitin sulfate sodium, hydroxyethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose, polyvinylpyrrolidone, and polyvinyl alcohol. Examples of preservatives include sorbic acid, potassium sorbate, parahydroxybenzoic acid esters such as methyl parahydroxybenzoate, ethyl parahydroxybenzoate, propyl parahydroxybenzoate, and butyl parahydroxybenzoate, chlorhexidine gluconate, benzalkonium chloride, benzethonium chloride, cetylpyridinium chloride, and other quaternary ammonium salts, alkyl polyaminoethylglycine, chlorobutanol, polyquad, polyhexamethylene biguanide, and chlorhexidine. Furthermore, the above-mentioned pharmaceutical composition may further contain compounds known to have osteogenic differentiation-promoting effects, in addition to the oligonucleotide. Examples of compounds known to have osteogenic differentiation-promoting effects include ascorbic acid (vitamin C), vitamin K2, and parathyroid hormone. These compounds known to have osteogenic differentiation-promoting effects can be used in amounts commonly used in the art to which the present invention belongs. In particular, since the oligonucleotide, which is the active ingredient of the present invention, can unexpectedly synergistically promote osteogenic differentiation when combined with ascorbic acid, it is preferable to use ascorbic acid as the compound known to have osteogenic differentiation-promoting effects. When using ascorbic acid, the ratio of oligonucleotide to ascorbic acid is not particularly limited, but for example, 0.1 to 5000 moles and more preferably 1 to 1000 moles per 1 mole of the former is preferred. In embodiments of the pharmaceutical composition, the content of the oligonucleotide in the composition is not particularly limited and can be appropriately set from conditions such as 90% by mass or more, 70% by mass or more, 50% by mass or more, 30% by mass or more, 10% by mass or more, 5% by mass or more, 1% by mass or more, etc. The amount of oligonucleotides of the present invention contained in the formulation cannot be specified in general terms as it varies depending on the route of administration, the patient's age, weight, symptoms, etc., but it should be an amount that results in a daily dose of oligonucleotides of approximately 10 to 5000 mg, more preferably 100 to 1000 mg. If administered once a day, this amount should be contained in one formulation, and if administered three times a day, one-third of this amount should be contained in one formulation. The osteogenic agent according to the present invention can be formulated into various commonly used carriers and excipients, and can be manufactured in the form of injections, topical agents, tablets, capsules, syrups, suppositories, etc., according to known methods, but is not limited thereto. Furthermore, the osteogenic agent can be administered orally, intravenously, intramuscularly, intra-articularly, intra-arterially, intramedullarily, intramedullarily, intraventricularly, percutaneously, subcutaneously, intraperitoneally, enterally, topically, sublingually, or rectally, but is not limited thereto.

[0030] The osteogenic agent according to the present invention is applicable to cells that make up an individual, as well as cells cultured on a culture medium. Furthermore, the osteogenic agent can be used in mammals including mice and humans, or birds including chickens, but is not limited to these. [Examples]

[0031] The following describes specific embodiments of the present invention using examples, comparative examples, and reference examples, but the present invention is not limited to these specific embodiments.

[0032] (Reference example 1) The three-dimensional structure of the 18-base-length oligoDNA (iSN40), represented by Sequence ID No. 34 (GGAACGATCCTCAAGCTT), was simulated using simple trajectory sum multicanonical molecular dynamics (McMD). Figure 1 shows the structural diagram (left) and proximity map (right) of iSN40. Note that this simulation did not assume that iSN40 is a single-stranded DNA with a phosphorothioate backbone (it was assumed to have phosphodiester bonds).

[0033] The numbers on the horizontal and vertical axes of the proximity map represent the positions of bases counted from the 5' end. The intensity of the colors in the proximity map indicates the degree of proximity, with darker colors indicating closer bases. A black diagonal line means that the distance between identical bases (1-1, 2-2, 3-3, ...) is zero. Conversely, the intersection of 10 on the horizontal axis and 4 on the vertical axis (10-4) is white, indicating that these two bases (C and A) are separated. Overall, it is suggested that the bases adjacent to each other in opposite directions on the '5' end side and the '3' end side, with the base around the 10th position (TCCTC) as the boundary, form a U-shaped or O-shaped structure.

[0034] As shown in Example 1 below, iSN40 has a remarkable osteogenic effect, whereas the oligo DNA shown in Sequence ID No. 35 (hereinafter referred to as iSN41) shows only about half the osteogenic effect of iSN40. The base sequence of iSN41 is shown as GAACGATCCTCAAGCTTA, which is iSN40 shifted by one base toward the 5' end and A added to the 3' end. The significant difference in effect despite 16 of the 18 bases being the same suggests that the bases at both ends are involved. Figure 2 shows the structural diagram (left) and proximity map (right) of the iSN41 three-dimensional structure analyzed by molecular simulation.

[0035] In Example 1, described later, it was shown that iSN44 (SEQ ID NO: 38) had the second highest osteogenic differentiation-promoting effect after iSN40 (SEQ ID NO: 34). The base sequence of iSN44 is shown as CGATCCTCAAGCTTAGGT, and although it is slightly closer to the 3' end, it has the sequence TCCTC and shares the same characteristics as iSN40 in that it does not contain A (adenine) in the two bases at either end.

[0036] The oligoDNA samples used in the following experiments were synthesized by substituting phosphodiester bonds with phosphorothioate bonds between nucleotides to enhance resistance to nucleases, and then purified by HPLC.

[0037] (Example 1) This example describes the effects of the LGG library on osteoblast differentiation through screening experiments and their results. The mouse osteoblast cell line MC3T3-1 (RIKEN BioResource Research Center, RCB No.: RCB1126) was used as the osteoblast cell line (the same was used in Examples 2-5). 10,000 osteoblasts per well were seeded in growth medium in 96-well plates, and the following day, pure water (Ctrl) was administered as a negative control, and 50 μg / ml ascorbic acid (AA) or 10 μM ODN was administered as a positive control. The administered ODNs were 44 sequences from the LGG library (iSN04, 08-50), CpG-ODN (SEQ ID NO: 46) which promotes the immune response, and Tel-ODN (SEQ ID NO: 47) which inhibits the immune response. The nucleotide sequences of the ODNs used are shown in the table below. [Table 1] [Table 2] Here, iSN04 and iSN 08-50 represent nucleotides from sequence numbers 1 and 2-44, respectively. Forty-eight hours after ODN administration, osteoblast differentiation was evaluated using ALP expression as an indicator. Osteoblasts were stained purple by ALP enzyme activity, and microscopic images were taken. The results are shown in Figure 3.

[0038] After imaging, ALP signal intensity was quantified using image analysis software (ImageJ). The results are shown in Figure 4. The ALP intensity of the AA-administered group, a positive control, reached nearly twice that of the Ctrl-administered group, a negative control. The ALP intensity of the iSN40-administered group was similar to that of the AA-administered group. No significant increase in ALP intensity was observed in the other ODN-administered groups, indicating that the effect of iSN40 is sequence-dependent. Furthermore, since no increase in ALP intensity was observed in the CpG-ODN and Tel-ODN-administered groups, it is presumed that the mechanism by which iSN40 induces osteogenic differentiation is independent of immune signaling. In addition, our previous research has shown that iSN40 does not affect muscle differentiation or immune responses (Non-Patent Literature 2), suggesting that iSN40 specifically acts on osteoblasts to promote osteogenic differentiation.

[0039] (Example 2) In this example, we conducted an experiment to demonstrate the effect of iSN40 on gene expression in osteoblasts. 100,000 osteoblasts per 3 cm dish were seeded in growth medium, and after reaching confluence, 10 μM iSN40 was administered. Total RNA from osteoblasts was collected 24 and 48 hours after iSN40 administration, or 4 and 8 days later, and the expression of bone-specific genes was confirmed by quantitative PCR. The results are shown in Figures 5 and 6.

[0040] Figure 5 shows the expression levels of bone-specific genes in the early stages of osteogenic differentiation. Compared to the negative control, the expression levels of Bglap2, Bmp4, and Sp7 were significantly increased 48 hours after iSN40 administration. This suggests that iSN40 promotes preosteoblast differentiation by inducing the expression of bone-specific genes. Figure 6 shows the expression levels of bone-specific genes in the later stages of osteogenic differentiation. Compared to the negative control, the expression levels of Bglap2, Col1a1, Sp7, and Spp1 were significantly increased 4 or 8 days after iSN40 administration. This demonstrates that iSN40 also induces the expression of bone-specific genes in the later stages of osteogenic differentiation.

[0041] (Example 3) In this example, the promotion of osteoblast calcification by iSN40 is explained using Figures 7 to 10. First, during the process of osteoblast differentiation and maturation into osteocytes, the synthesis of bone matrix proteins and calcification (calcium deposition) via matrix vesicles proceed. In this experiment, the calcification of osteoblasts administered with iSN40 was examined by alizarin staining. Alizarin is a red dye that binds to a metal group and can stain calcium deposited in cells; therefore, alizarin staining is widely used as an indicator of calcified osteocytes.

[0042] Figure 7 shows the alizarin staining of osteoblasts administered with iSN40. Osteoblasts were seeded in growth medium in 24-well plates and, after reaching confluence, were replaced with differentiation medium containing 5, 15, or 50 μg / ml of AA to induce calcification. Simultaneously, pure water or 10 μM iSN40 was administered as a negative control, and alizarin staining was performed on day 12 of calcification induction. Compared with the negative control (Control), the area stained with alizarin was significantly larger in the iSN40-administered group. Furthermore, the effect of iSN40 was found to be dependent on the concentration of AA that promotes osteogenic differentiation. From these results, it is clear that iSN40 enhances the calcification of osteoblasts and promotes terminal differentiation into osteocytes.

[0043] Figure 8 shows the quantitative results of the experiment in Figure 7, graphed in graph form. The percentage of area stained with alizarin (calcified by calcium deposition) was calculated using image analysis software (ImageJ). First, in the absence of iSN40, there was no significant difference in calcification among the AA administration groups of 5, 15, and 50 μg / ml (comparison of black bars). In all cases of AA concentration, administration of 10 μM iSN40 significantly increased calcification (comparison of black and white bars). The calcification-promoting effect of iSN40 was significantly enhanced as the AA concentration increased (comparison of white bars). From the above, it can be seen that iSN40 acts synergistically with AA, a known osteogenic factor, to induce osteoblast calcification.

[0044] Figure 9 shows the experimental results of inducing osteoblast calcification by varying the concentration of administered iSN40. Osteoblasts were seeded in growth medium in 24-well plates, and after reaching confluence, the medium was replaced with differentiation medium containing 5 or 15 μg / ml AA to induce calcification. Simultaneously, pure water (0 μM in the figure) or 0.1, 1, or 10 μM iSN40 was administered as a negative control, and alizarin staining was performed on day 9 of calcification induction. In both the 5 and 15 μg / ml AA administration groups, calcification was enhanced in a concentration-dependent manner for iSN40.

[0045] Figure 10 shows the quantitative results of the experiment in Figure 9, graphed in a graph. The percentage of area stained with alizarin was calculated using image analysis software (ImageJ). There was no significant difference in calcification between the 5 μg / ml AA administration group and the 15 μg / ml AA administration group for all iSN40 concentrations (comparison of gray and white bars). In particular, when iSN40 was 0 μM, none of the AA concentrations induced calcification, making it clear that calcification does not occur by day 9 with AA at 5 to 15 μg / ml alone. Therefore, it can be seen that a concentration of AA of 5 μg / ml is sufficient to enhance the osteogenic effect of iSN40. Calcification of osteoblasts was observed from the 0.1 μM iSN40 administration group. Furthermore, in all AA concentrations, significantly greater calcification was observed in the 1 μM and 10 μM iSN40 administration groups compared to the 0.1 μM iSN40 administration group (comparison between gray bars, comparison between white bars). On the other hand, in all AA concentrations, there was no significant difference between the 1 μM iSN40 administration group and the 10 μM iSN40 administration group. These results indicate that iSN40 promotes osteoblast calcification from a concentration of at least 0.1 μM, and that a sufficient effect can be obtained at a concentration of 1 μM.

[0046] (Example 4) The "CG" sequence, also present in the iSN40 sequence, is generally known to be recognized by Toll-like receptor 9 (TLR9) and can induce an inflammatory response. To investigate the importance of the CG sequence in the osteogenic effect of iSN40, GC-iSN40 (SEQ ID NO: 55) was created by substituting the CG sequence with "GC," and its osteogenic effect was examined. Figure 11 shows the results of seeding 100,000 osteoblasts per well in a 12-well plate. The following day, growth medium containing 50 μg / ml ascorbic acid was administered with pure water (Control) as a negative control, and 10 μM iSN40 or GC-iSN40 as a positive control. After 48 hours, the activity of ALP in osteoblasts was visualized (see Figure 3). Figure 12 shows the results of quantitative analysis of the area of ​​ALP-positive cells in Figure 11 and statistical analysis. The results showed that GC-iSN40 significantly promoted ALP activity in osteoblasts to a similar extent as iSN40.

[0047] (Example 5) Osteoblasts were seeded at a rate of 75,000 cells / well in 24-well plates. The following day, differentiation medium containing 50 μg / ml ascorbic acid was administered with pure water (Control) as a negative control and 1 μM iSN40 or GC-iSN40 as a positive control. After 9 days, osteoblast calcification was visualized and quantified by alizarin staining (see Figures 7-10). The results are shown in Figures 13 and 14. As shown in Figures 13 and 14, GC-iSN40 was found to significantly promote osteoblast calcification to a degree comparable to iSN40.

[0048] From the above, it was revealed that the osteogenic effect of GC-iSN40 is comparable to that of iSN40, meaning that the CG sequence in iSN40 is not essential for osteogenic effect. The osteogenic effect of iSN40 is CG sequence independent, i.e., TLR9 independent, and it was shown that its mechanism of action is completely different from that of well-known immunotype oligoDNAs.

[0049] In summary, this disclosure confirms that it is possible to create an osteogenic oligoDNA that induces osteoblast differentiation and promotes maturation into osteocytes accompanied by calcification. In particular, in comparison with prior art, the effects of MT01 have only been confirmed to enhance ALP activity and increase the expression of bone genes, and the long-term effects leading to calcification remain unclear. Furthermore, when chemically synthesized ODN is applied industrially, its synthesis cost depends on the base length, so iSN40, which has a base length of two-thirds that of MT01, can be synthesized at low cost.

[0050] In addition to ascorbic acid (AA), other molecules known to promote osteogenic differentiation besides ODN include activated vitamin D and parathyroid hormone (PTH), but these are molecules that are not specific to osteoblasts. iSN40 is expected to be osteoblast-specific, as it does not affect skeletal muscle differentiation or immune responses. Furthermore, results from experiments combining iSN40 and AA suggest that additive and synergistic effects of promoting osteogenic differentiation may be obtained when iSN40 is used in combination with known osteogenic differentiation factors. [Industrial applicability]

[0051] This invention is considered useful for the prevention and / or treatment of primary osteoporosis caused by menopause or aging, as well as secondary osteoporosis caused by diseases such as diabetes and kidney disease, or by drug administration. Furthermore, by inducing the differentiation of pluripotent stem cells such as ES / iPS cells, or somatic stem cells such as mesenchymal stem cells, into osteoblasts and osteocytes, it can be used to create at least one of the group consisting of preosteoblasts, osteoblasts, and osteocytes for drug screening, and furthermore, to create artificial bones and artificial teeth. In addition, by administering it to osteosarcoma (bone tumor) originating from osteoblasts, it is thought that it can be used to suppress the proliferation and metastasis of osteosarcoma by promoting its osteogenic differentiation and suppressing cell division.

Claims

1. An osteogenic agent comprising an oligonucleotide having activity that promotes osteogenic differentiation, wherein the oligonucleotide is (i-1) The base sequence represented by Sequence ID No. 34: Sequence ID 34: GGAACGATCTCAAGCTT It consists of, or (i-2) The base sequence represented by Sequence ID No. 55: Sequence ID 55: Consists of GGAAGCATCCTCAAGCTT, A drug that promotes osteogenic differentiation.

2. The bone differentiation promoter according to claim 1, for application to cells or individuals of mammals or birds.

Images