Production methods, broccoli, and seeds

Abstract

The present invention provides a crop having more suitable properties by using genome editing, and promotes understanding of genome editing.　The present invention uses, as target broccoli, broccoli to be subjected to genetic manipulation, and involves performing genetic manipulation for knocking out, among the genes of the target broccoli, ACO3 that causes production of ethylene which deteriorates the broccoli in a predetermined post-harvesting period. Next, seeds are produced from the target broccoli after the genetic manipulation. The seeds are sown, and grown into broccoli to be shipped. As a result, broccoli to be shipped is produced.

Description

[Technical Field]

[0001] This invention relates to a production method, broccoli, and seeds. [Background technology]

[0002] Genome editing technology has existed for some time (see, for example, Patent Document 1). [Prior art documents] [Patent Documents]

[0003] [Patent Document 1] International Publication No. 2013 / 176772 brochure [Overview of the project] [Problems that the invention aims to solve]

[0004] Conventional genome editing technologies, including the one described in Patent Document 1 above, are constantly evolving. Using such genome editing technologies, more specific genome editing techniques are being attempted, for example, to improve the disease resistance, quality, and cultivation adaptability of crops. In Japan, crops that have undergone such genome editing can be sold after safety checks and various notifications are required. However, some consumers do not understand genome editing technology and may avoid genome-edited crops.

[0005] The Brassicaceae family includes many important vegetables (crops) that are major domestic crops, such as radishes, cabbage, broccoli, and Chinese cabbage, and various breeding techniques such as hybrid vigor, interspecific hybridization, and the establishment of F1 seed production systems have been utilized in their breeding efforts. Naturally, vegetables (crops) deteriorate after harvesting. In particular, broccoli begins to yellow within about three days of harvesting, reducing its market value. The inventors conceived the idea of ​​reducing crop waste by improving properties that affect the decline in commercial value through genome editing.

[0006] This invention has been made in view of these circumstances, and aims to provide crops with more desirable properties using genome editing and to promote understanding of genome editing. [Means for solving the problem]

[0007] To achieve the above objective, a method for producing broccoli according to one aspect of the present invention is: The first step involves using a broccoli variety as the target broccoli and performing a genetic modification to knock out at least one of the genes ACO2 and ACO3, which generate ethylene that causes degradation within a predetermined period after harvest, in the target broccoli variety. The second step is to produce seeds from the target broccoli after the genetic manipulation described above, The third step involves growing broccoli for shipment using the aforementioned seeds or seeds sown from said seeds, Includes.

[0008] Furthermore, broccoli or seeds according to one embodiment of the present invention are Broccoli that has been genetically modified to knock out at least one of ACO2 and ACO3, which produce ethylene that causes deterioration within a predetermined period after harvest, or broccoli derived from such broccoli. [Effects of the Invention]

[0009] According to the present invention, it is possible to provide crops with more desirable properties using genome editing and to promote understanding of genome editing. [Brief explanation of the drawing]

[0010] [Figure 1] This figure shows an example of the difference in broccoli aging with and without ACO3 gene knockout, including a method for producing broccoli according to one embodiment of the present invention. [Figure 2] Figure 1 shows an example of the effect of knocking out the ACO3 gene on broccoli aging. [Figure 3] It is a diagram showing the ethylene resynthesis pathway. [Figure 4] It is a diagram showing the ethylene resynthesis pathway in Figure 3 in more detail. [Figure 5] It is a diagram showing the overall flow of the experiment. [Figure 6] It is a diagram showing the image of gene introduction. [Figure 7] It is a diagram showing an example of a Ti plasmid and a CFRISPR / Cas9 vector in the Agrobacterium method. [Figure 8] It is a diagram showing the flow of the CRISPR-Cas9 method. [Figure 9] It is a diagram showing the primer sequence information used for ACO3 gene fragment amplification. [Figure 10] It is an example of the nucleotide sequence of the ACO3 transformant. [Figure 11] It is a diagram showing the results of direct sequencing analysis. [Figure 12] It is a diagram showing the flow of the method for producing broccoli of the present invention. [Figure 13] It is a diagram showing the results of the flower bud deterioration test using the T1 generation. [Figure 14] It is a diagram showing the ACO3 mutant line (1) 210611-6. [Figure 15] It is a diagram showing the ACO3 mutant line (2) 210226-1. [Figure 16] It is a diagram showing the ACO2 mutant line (1) 230306-1. [Figure 17] It is a diagram showing the ACO2 mutant line (2) 230306-3. [Figure 18] It is a diagram showing the ACO2 mutant line (3) 230516-1. [Figure 19] It is a diagram showing the ACO2 mutant line (4) 230516-2.

Embodiments for Carrying Out the Invention

[0011] Embodiments of the present invention will be described below with reference to the drawings.

[0012] In this invention, broccoli is used as an example of a crop. The following explains the background and purpose behind the selection of broccoli.

[0013] In recent years, the genome structures of various Brassicaceae crops have been elucidated, leading to a better understanding of the origins of their domestication, and molecular breeding using DNA markers has been actively pursued. In order to respond to the diversification of cultivation methods due to future global warming and the diversification of consumer food preferences, it is important to utilize these molecular breeding technologies to introduce new traits such as disease resistance, high quality, and cultivation adaptability. Furthermore, establishing methods for utilizing genome editing technology as an efficient and rapid method for introducing targeted mutations, as well as methods for evaluating its effectiveness, are essential challenges.

[0014] Here, broccoli is a green leafy vegetable whose edible parts are the stem and flower heads. It is harvested and commercialized when the inflorescence structure is immature and growing rapidly. Furthermore, as mentioned above, broccoli turns yellow about three days after harvest. Specifically, this is due to a deficiency of chlorophyll, causing the florets to yellow after harvest. This post-harvest tissue degeneration in broccoli is not a typical aging process, but rather caused by a severe disruption of metabolic processes. This post-harvest yellowing has been clearly identified as being due to the effects of ethylene. Thus, fresh broccoli has a short lifespan, and yellowing was a major cause of broccoli waste.

[0015] As will be explained in more detail later, three ACC oxidases (hereinafter abbreviated as "ACO" as appropriate) are involved in the biosynthesis of ethylene in broccoli.

[0016] The first ACO gene (hereinafter referred to as the "ACO1 gene") is a gene that contributes to the synthesis of basic ethylene. The ethylene produced through the involvement of the ACO1 gene contributes to the aging of vegetative tissues.

[0017] The second ACO gene (hereinafter referred to as the "ACO2 gene") is a gene that contributes to ethylene synthesis in the reproductive organs. The ethylene produced through the involvement of the ACO2 gene contributes to early senescence after harvest.

[0018] The third ACO gene (hereinafter referred to as the "ACO3 gene") is a gene whose expression is synchronized with yellowing and which contributes to the synthesis of ethylene after harvest. The ethylene produced through the involvement of the ACO3 gene contributes to late aging after harvest.

[0019] As described above, the inventors have conceived that by knocking out the ACO3 gene in particular, it is possible to suppress late aging of broccoli after harvest and maintain the commercial value of broccoli. Figure 1 shows an example of the difference in broccoli aging with and without ACO3 gene knockout, including a method for producing broccoli according to one embodiment of the present invention. Figure 2 shows an example of the effect of knocking out the ACO3 gene in Figure 1 on broccoli aging.

[0020] As shown in Figure 1(A), flower buds develop approximately 40 days after sowing and transplanting. Harvesting takes place when these flower buds reach a predetermined size during their growth. For example, broccoli harvested from midnight to morning is displayed in stores as freshly picked broccoli on the same day it is harvested. The number written in the upper left of the broccoli indicates the number of days since harvest. Broccoli on day 0 or day 1 after harvest is green, indicated by dark hatching. Subsequently, for example, on day 2 after harvest, some of the broccoli flower buds turn yellow, as indicated by light hatching. Then, for example, on day 3 after harvest, all of the broccoli flower buds turn yellow. Broccoli with partially or completely yellowed flower buds has reduced commercial value.

[0021] In this embodiment, as shown in Figure 1(A), the ACO2 and ACO3 genes are knocked out. As a result, the broccoli florets remain unchanged until harvest, and even on the second or third day after harvest, some or all of the florets do not turn yellow, allowing the broccoli to be sold in stores.

[0022] Specifically, in this embodiment, the broccoli retains the ACO1 gene while knocking out the ACO2 and ACO3 genes. In other words, as shown in Figure 2, the ACO1 gene is expressed in the same way as in the conventional Figure 1(A). As a result, the flower bud grows (ages) as before.

[0023] Furthermore, the ACO2 gene is conventionally expressed starting two hours after harvest and contributes to ethylene production in the early post-harvest period. However, in this embodiment, the ACO2 gene is knocked out, so it is not expressed, and there is no ethylene production due to the contribution of the ACO2 gene in the early post-harvest period. This prevents yellowing of broccoli florets in the early post-harvest period.

[0024] Furthermore, the ACO2 gene is conventionally expressed around 2 or 3 days after harvest, triggered by harvesting. It then contributes to ethylene production in the later post-harvest period. However, in this embodiment, the ACO3 gene is knocked out, so the ACO3 gene is not expressed, and there is no ethylene production in the later post-harvest period due to the contribution of the ACO3 gene. This prevents yellowing of broccoli florets in the later stages after harvest.

[0025] As a result, yellowing does not occur even on the second or third day after harvest, thus maintaining the market value. In this way, the commercial value of broccoli is maintained even on the second or third day after harvest, making it possible to display broccoli in stores even after that date. This helps to reduce food waste. Furthermore, even after the broccoli is purchased and remains in the consumer's possession, yellowing does not occur during storage. In other words, consumers can actually experience how the broccoli, a product of genome editing, has been improved. This allows for the improvement of traits that affect the commercial value of crops through genome editing, thereby reducing crop waste and demonstrating the usefulness of genome editing technology in breeding methods by contributing to the improvement of traits that consumers notice.

[0026] In contrast, conventional genome editing has focused on improving crop disease resistance, quality, and adaptability to cultivation. However, from the perspective of some consumers, measurement and verification are fundamentally difficult. As a result, they have not been able to perceive the effects (for example, reduced cultivation costs). Consequently, some consumers have not gained an understanding of genome editing technology, and have even avoided genome-edited crops. The broccoli of this embodiment solves this problem.

[0027] The properties of the ACO1 to ACO3 genes described above, as well as the broccoli knockout and the resulting tests in this embodiment, will be explained in more detail below using Figures 3 to 11. It is well known that the significant increase in the activity and mRNA expression levels of 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase in the reproductive organs of flowers after harvest is largely involved in ethylene production. Figure 3 shows the resynthesis pathway of ethylene. Figure 4 is a diagram showing the ethylene resynthesis pathway in Figure 3 in more detail. Ethylene is synthesized in the following order: methionine, S-adenosylmethionine, 1-aminocyclopropane-1-carboxylic acid (hereinafter abbreviated as "ACC" as appropriate), and then ethylene. Here, ACS is an enzyme that catalyzes the reaction of ACC from S-adenosylmethionine. Furthermore, ACO is an enzyme that catalyzes the reaction between ACC and ethylene.

[0028] In this embodiment, ACS, an enzyme that occurs one step before ethylene biosynthesis, is not included, but the following facts exist regarding ACS. In broccoli, there are three cDNAs—BROCACS1, BROCACS2, and BROCACS3—that function as ACS, the enzymes that precede ethylene biosynthesis. The homology between these cDNAs is relatively low, indicating they are paralogs. The translation level of BROCACS1 is induced by injury or mechanical stress, reaches high levels after harvest, and then becomes undetectable. The translation level of BROCACS2 remains constant throughout the aging process and only increases at the end, suggesting it is a major ACC synthase. BROCACS 3 is at a level that is almost undetectable.

[0029] In this embodiment, the enzymes ACC, which are the final step in ethylene biosynthesis, include ACC Ox1 (cDNA derived from the ACO1 gene), ACC Ox2 (cDNA derived from the ACO2 gene), and Bo-ACO3 (cDNA derived from the ACO3 gene). Translation levels of ACO1 are low in the entire inflorescence at harvest time, but increase significantly after harvest. They also increase in the sepals after harvest and in the yellowed leaves after cutting. It is hardly expressed in the reproductive organs. ACO2 translation is detected only in the reproductive organs and is not expressed at harvest, but it begins to increase within two hours and accumulates significantly. In other words, IAA and ABA treatments and wound treatments do not change the translation level of ACC Ox1. ACO2 increases with abscisic acid and propylene treatment. Furthermore, the ACO3 gene was observed to be expressed on the third day after harvest.

[0030] These facts indicate that, as mentioned above, ACO1 is involved in basal ethylene production and senescence in vegetative tissues (such as leaves). Furthermore, since ACO2 is expressed only in the reproductive organs of harvested florets, it is involved in ethylene production in the reproductive organs in response to the stimulation during harvesting, and in turn, is involved in the initial degeneration of other floral organs such as the calyx after harvesting. ACO3 is involved in aging through late-stage ethylene synthesis rather than early-stage ethylene synthesis after harvest.

[0031] Furthermore, there are studies showing that inhibiting ACO2 by introducing antisense (expression suppression) inhibits ethylene biosynthesis, significantly reducing ethylene biosynthesis in the early post-harvest period and suppressing yellowing of broccoli florets.

[0032] This invention aims to introduce knockout mutations targeting ACO3 in addition to ACO2 by performing genome editing using the Agrobacterium method. This will verify that broccoli can be improved by not expressing ACO3, and enable the commercialization of broccoli with these knockout mutations. In the experiment, we successfully created one transformant line in which a single nucleotide is inserted into Bo-ACO3, resulting in the biosynthesis of an incomplete ACO3 protein. By breeding the self-pollinated progeny and test cross progeny of this line, we will evaluate the degree of senescence of flower buds after harvest.

[0033] Therefore, we attempted to disrupt the function of the 1-aminocyclopropane-1-carboxylate oxidase (ACO) gene, which is involved in maintaining the freshness of broccoli (Brassica oleracea var. italica), a cruciferous vegetable, and to introduce mutations into the psbA gene encoded in the plastid genome using genome editing. We report the results of these attempts.

[0034] Figure 5 shows the overall flow of the experiment. First, the hypocotyls were sectioned. Next, they were immersed in Agrobacterium culture medium. This introduced Cas9, gRNA, and marker genes. Then, culture, sterilization, and callus induction were performed. Next, shoot growth was carried out. Next, total DNA was isolated. Next, target gene fragments were amplified by PCR. Finally, mutant types were identified by restriction enzyme digestion. More specifically, for the ACO gene, we constructed a CRISPR-Cas9 genome editing construct and infected hypocotyl sections of broccoli with Agrobacterium that carries it to create transformants. Although there are three copies of the ACO gene in the broccoli genome, it has been reported that the expression levels of ACO2 and ACO3 increase after harvest, so we created constructs that can edit ACO2 and ACO3 individually. After isolating total DNA from the shoots of the resulting transformants using a simplified method, we amplified the mutation site of the target gene by PCR, determined the base sequence of the resulting fragment, and analyzed whether or not mutations had been introduced.

[0035] Figure 6 is a diagram illustrating the concept of gene transfer. As shown in Figure 6, the binary vector used in this experiment has a structure containing gRNA, Cas9 (transgene), and hygromycin regime gene (selection marker gene). By using such a binary vector, gRNA, Cas9 (transgene), and the hygromycin regime gene (selection marker gene) are introduced into the chromosomes contained in the nucleus of plant cells (broccoli cells in this example). The binary vector pZH_gYSA_FFCas9 used in this experiment was constructed based on data provided by the National Agriculture and Food Research Organization under a Material Transfer Agreement (MTA).

[0036] Figure 7 shows an example of a Ti plasmid and CFRISPR / Cas9 vector in the Agrobacterium method. As shown in Figure 7(A), the Ti plasmid used in this experiment contains plant hormone production-related genes (T-DNA), a group of genes involved in DNA transfer, and a replication origin (Agrobacterium). Furthermore, as shown in Figure 7(B), the CRISPR / Cas9 vector used in this experiment contains T-DNA consisting of gRNA, Cas9 (transgene), and hygromycin regime gene (selection marker gene), as well as a replication origin (Agrobacterium / Escherichia coli).

[0037] Figure 8 shows the flow of the CRISPR-Cas9 method. In this experiment, as described above, hypocotyls are sectioned and immersed in Agrobacterium culture medium to infect them with Agrobacterium, and then the CRISPR / Cas9 vector is introduced. In other words, in the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)-Cas9 method, Cas9 and sgRNA are expressed, and guide RNA binds to the gene, inducing Cas9 and resulting in gene modification (introduction of the CRISPR / Cas9 vector). Subsequently, after culturing, sterilization, and callus induction, shoot formation takes place.

[0038] The following explains the overall flow of this experiment using more specific parameters.

[0039] As a premise, broccoli (Brassica oleracea L. var. italica, 2n=18), a cruciferous vegetable, is said to have originated from kale, which has been cultivated in the eastern Mediterranean since before the Common Era. Its distinctive large flower heads contain many vitamins, carotenoids, and polyphenols, and its production is increasing worldwide as a vegetable rich in functional components. In Japan, production has continued to increase since the 1990s, and demand for it as sprouts has also been rising. Transformation methods using the Agrobacterium method have been reported for Brassica oleracea, including broccoli. Furthermore, due to its high genetic homology with Arabidopsis thaliana, it is possible to identify target genes involved in various traits. In addition, because resources such as genomic information are abundant, it is possible to set gRNAs that minimize off-target mutations, and the development of breeding using genome editing can be expected. In this experiment, we performed the following steps to create mutant lines of broccoli through genome editing: transformation using the Agrobacterium method, identification of the edited lines, and seed collection to obtain progeny.

[0040] The specifications of the materials, equipment, and culture medium used in this experiment are as follows. Broccoli seeds were transformed using the F1 variety Ryokurei, sold by Sakata Seed Corporation.

[0041] The equipment to be prepared is as follows: (1) Sterilized filter paper A (two sheets of Advantec quantitative filter paper No. 2, φ125mm, wrapped in foil, autoclaved, and then dried) (2) Sterilized filter paper B (Whatman 5 quantitative filter paper, φ70mm, placed in a petri dish, autoclaved, and then dried) (3) Lutz tweezers (17 cm, various manufacturers) (4) Razor (Feather double-edged blue razor) (5) Leather blade holder (Kenis, etc.) Scalpel (Feather, stainless steel surgical replacement blade scalpel 11) (6) 50 mL disposable tube (Corning, 430290, etc.) (7) Plastic petri dishes (such as IWAKI sterilized petri dish, deep type, 90 mm x 20 mm) (8) Surgical tape (3M Micropore code: 1530-0, etc.) (9) 5 mL disposable pipette (Falcon, #357543)

[0042] The specifications of the culture medium used in this experiment are as follows: We transformed broccoli by modifying the transformation method for rapeseed (Brassica napus) reported by Kohno-Murase et al. (1) Agrobacterium culture solution (YEB): 0.1% yeast extract, 0.5% beef extract, 0.5% peptone, 0.5% sucrose, 0.05% MgSO4·7H2O (pH7) (2) BY2 culture liquid medium (D0.2): MS medium containing 30 g / L sucrose and 0.2 mg / L 2,4-D, dispensed into 100 mL of colubene in 30 mL aliquots. pH adjusted to 5.6 to 5.8. (3) Seeding medium: MS medium containing 30 g / L sucrose and 4 g / L Gelrite (Fujifilm Wako, 075-05655). pH adjusted to 5.6 to 5.8. After autoclaving, dispense into magenta boxes (Sigma, GA-7) in 50 mL portions. (4) Infection liquid medium (MSH): MS medium containing 30 g / L sucrose. pH adjusted to 5.6 to 5.8. (5) Pre-culture, co-culture, and sterilization medium (MB3D): MSB5 medium containing 30 g / L sucrose and 1 mg / L 2,4-D, 0.6% agarose (Sigma, Type 1, A0169). pH is adjusted to 5.6 to 5.8. For sterilization, use a medium containing 500 mg / L carbenicin. (6) Selection medium 1 (MB1): MSB5 medium containing 10 g / L sucrose, 3 mg / L BAP, 500 mg / L carbenicin, 10 mg / L hygromycin, and 0.6% agarose. pH is adjusted to 5.6 to 5.8. MB1 containing AgNO3 is added after sterilization to bring the total AgNO3 concentration to 5 mg / L. (7) Selection medium 2 (B5BZ): B5 medium containing 30 g / L sucrose, 3 mg / L BAP, 1 mg / L zeatin, 500 mg / L carbenicin, 10 mg / L hygromycin, and 0.6% agarose. pH is adjusted to 5.6 to 5.8. (8) Shoot growth medium (B5P): B5 medium containing 30 g / L sucrose, 0.1 mg / L BAP, 500 mg / L carbenicin, 10 mg / L hygromycin, and 0.6% agarose. pH is adjusted to 5.6 to 5.8. (9) Rooting medium (MSNB): MS medium containing 10 g / L sucrose, 0.1 mg / L NAA, 0.01 mg / L BAP, and 4 g / L Gelrite. pH is adjusted to 5.6 to 5.8. After autoclaving, dispense into 50 mL magenta boxes (Sigma, GA-7). (10) Magenta box for acclimatization: Place approximately 100 mL of vermiculite No. 3 (Bermitec Co., Ltd.) into the magenta box, add approximately 50 mL of 1000-fold diluted Hyponex, and autoclave sterilize. (11) MS medium is prepared by combining MS I-IV preservation solutions to a 1:1 ratio. MSB5 is prepared by combining MS I-III preservation solutions and B5 vitamin preservation solution to a 1:1 ratio. B5 medium is prepared by combining B5 vitamin preservation solution and B5 inorganic preservation solution to a 1:1 ratio. (12) Zeatin, carbenicin, and hygromycin should be added after autoclaving and once the culture medium has cooled sufficiently. MS3D medium is dispensed in 20 mL portions per petri dish, and other media in 25 mL portions, then wrapped in plastic wrap and stored in the refrigerator.

[0043] The method for producing transformants is as follows: (1) Seed sterilization The seeds of the Green Peak variety used for transformation are sterilized as follows: The Green Peak seeds are sold as coated seeds. This sterilization process washes off the coating from the seeds. When sowing seeds that have been stored in the refrigerator, do not remove the seal until they return to room temperature. The germination rate will be maintained for about a year, but if the germination rate decreases, it is preferable to sterilize them again. Add approximately 2-5 g of seeds and 70% ethanol to a 50 mL disposable tube and shake at room temperature for 1 minute. Next, remove the 70% ethanol using a Pasteur pipette, add the solution prepared earlier by adding about 2 drops of Tween20 or household neutral detergent to approximately 40 mL of 5x diluted sodium hypochlorite, and then shake at room temperature for 25 minutes. Next, remove the sodium hypochlorite solution using a Pasteur pipette and repeat the washing process with sterile water 5 to 6 times. Next, spread the seeds on sterile filter paper A in a clean bench and air dry them until completely dry. We took almost a full day to dry them completely. After that, divide them into several 3 cm sterile petri dishes, seal them with Parafilm or similar material, and store them in the refrigerator.

[0044] (2) Seeding (7 days before infection) Using tweezers, 25 seeds were placed in each magenta box, taking care not to bury them in the seeding medium. In this experiment, two boxes were sown per experiment.

[0045] (3) Culture of Agrobacterium (the day before infection) One microspatula-full of Agrobacterium glycerol stock containing the binary vector is added to a 50 mL disposable tube containing 10 mL of YEB with antibiotics, and incubated overnight at 28°C with shaking.

[0046] (4) Broccoli hypocotyl sectioning (the day before infection) Add approximately 0.5 mL of BY2 cells (7 days post-subplantation) to MB3D medium using a folded 5 mL disposable pipette, and then place sterile filter paper B on top, ensuring no air is trapped inside. Next, on day 7 after sterile sowing, the hypocotyl is cut using a single-edged razor blade mounted in a blade holder, and then sliced ​​into 2-5 mm long sections on filter paper placed on MB3D medium. Care should be taken to avoid including the shoot apical meristem in the hypocotyl sections near the cotyledons. The sections are laid flat on the filter paper to prevent drying and cultured until the next day. (23°C, 16 hL / 8 hD, illumination approximately 30 cm away from two 50W fluorescent lamps on a culture shelf)

[0047] (5) Infection treatment (Day 0 of infection) After culturing Agrobacterium culture overnight, centrifuge the culture at 2600 xg for 15 minutes, add 10 mL of MSH to the precipitate, and suspend the precipitated Agrobacterium. Next, after centrifugation under the same conditions, 10 mL of MSH is added to the precipitate and resuspended. A portion of the resuspended solution is set aside, diluted approximately 10-fold with MSH, and the OD600 is measured. From this value, 20 mL of an infection solution prepared to an OD600 of 0.1 is made and placed in a 9 cm sterile petri dish. Next, use the handle of a spatula to gather the pre-cultured hypocotyl sections and place them into the infection solution in a petri dish, then gently shake at room temperature for 20 minutes. Next, remove the infection solution with a pipette, spread the hypocotyl sections on sterile filter paper A to remove excess infection fluid, and return them to the MB3D medium used for pre-culture. At this time, arrange them flat to prevent the cut surfaces from drying out. Next, seal the sides of the petri dish with surgical tape, place it in a dark box, and incubate it in co-incubation mode at 23°C for 3 days.

[0048] (6) Disinfection (3 days after infection treatment) Transplant the hypocotyl sections into MB3D containing 500 mg / L of carbenicin. Since there will only be about 4 days until the next subculturing, the spacing between sections does not need to be too wide. After this, culture at 23°C under conditions of 16 hours of light and 8 hours of darkness. For light intensity, use the equivalent of two 50 W fluorescent lamps (using 2-3 culture media per 2 seeding boxes).

[0049] (7) Selection 1 (1 week after infection treatment) Transplant hypocotyl sections into MB1 containing AgNO3. Leave some space between sections, anticipating that they will grow slightly during callus formation (use 3-4 sections of medium per 2 seeding boxes). Subsequently, when adventitious buds appear, cut them out as needed and transplant them into B5P.

[0050] (8) Selection 2 (3 weeks after infection treatment) Two weeks after subplanting selection 1, transplant to MB1 (use 3-4 culture media per 2 seeding boxes).

[0051] (9) Selection 3 and beyond (5 weeks after infection treatment) Two weeks after selection 2, transplant into B5BZ. From here on, transplant into B5BZ every two weeks. After three transplants into B5BZ, decide whether to transplant further. Sections that do not form adventitious buds will turn black and should be discarded without transplanting as appropriate.

[0052] (10) Shooting development Once adventitious buds appear, remove excess tissue with a scalpel and transplant into B5P medium. The guideline for transplanting is two weeks, but the decision to transplant to MSNB should be made based on the growth status of the shoot (e.g., when several true leaves have unfolded).

[0053] (11) Rooting Transplant the cut shoots into MSNB medium. Removing excess tissue fragments from the base with a scalpel often promotes rooting. Transplant the shoots every 2-3 weeks, shaping them as needed until rooting occurs. At this stage, it is also possible to divide the plant by transplanting the branched shoots into NSNB medium. If rooting is not observed, the plants can be cultured in 1 / 2 MS medium containing 10 g / L sucrose and 4 g / L gelrite. Once sufficient rooting has occurred in the magenta box, transplant them into vermiculite medium.

[0054] (12) Acclimatization Carefully remove the agarose and transplant the plant into vermiculite growing medium. Cover the vermiculite medium with a plastic bag and secure it with a rubber band. Once roots can be seen from the bottom of the magenta box, cut one corner of the plastic bag to let in fresh air and allow the plant to acclimate. After about a week, when root development is observed, cut the other corner and continue acclimatization. Regularly remove any dead leaves to prevent mold growth. If the plant continues to grow without wilting even after both ends of the plastic bag are cut off, it can be transplanted into a pot. Water with sterilized 1000x diluted Hyponex solution.

[0055] (13) Potting up Carefully remove the plant from the vermiculite growing medium, wash off the vermiculite from the roots, and then plant it in a 3-inch plastic pot filled with horticultural soil and water thoroughly. Cover the pot with a plastic bag and grow it in a greenhouse. Two to three days after transplanting, cut the corners of the plastic bag to allow it to acclimate. Roots can often be observed from the bottom of the pot about 10 to 20 days after transplanting; use this as a guide to remove the plastic bag and continue cultivation until the leaves have fully developed. After that, perform vernalization to induce flower bud differentiation. The inventor has induced flower buds by performing this treatment for about 40 days under conditions of 10 hours of light at 12°C and 14 hours of darkness at 8°C.

[0056] The primer sequence information used in this experiment is shown below. Figure 9 shows the primer sequence information used for amplification of the ACO3 gene fragment. The sequence information shown in Figure 9 is the genomic sequence of the Bo-ACO3 gene. The database registration number is GenBank:LR031877.1. The introns are the characters starting from "GGT" (6th character from the end of line 6) up to the 16th character of line 8 (ending with "ACA"), and the characters starting from "AGG" (26th character from line 12) up to the 5th character from the end of line 14 (ending with "AAC"). The "CCA" shown in the center of the 8th row is the PAM sequence. The black, inverted regions from line 5 to line 6, and the black, inverted region in line 9, represent the primer pairs used for ACO3 gene fragment amplification.

[0057] The target gene, the Bo-ACO3 gene fragment, was amplified using the following procedure. For PCR amplification, the mixture per sample consisted of: DW: 26 μL, 5×PrimeSTAR GXL Buffer (TAKARA): 10 μL, 2.5 mM dNTP Mixture: 4 μL, 10 μM Forward primer: 2.5 μL, 10 μM Reverse primer: 2.5 μL, and Prime STAR GXL DNA Polymerase (TAKARA, 1.25 U / μL) 1.0 μL. To this, 4 μL of DNA prepared from the transformant was added to prepare the reaction solution. The PCR amplification cycle consisted of the following steps: Step 1: 1 minute at 95°C, Step 2: 20 seconds at 95°C, Step 3: 20 seconds at 60°C, and Step 4: 30 seconds at 68°C. Steps 2 through 4 were repeated for 35 cycles. After that, the gel was stored at 4°C after 3 minutes at 68°C. The amplified product was analyzed by electrophoresis on a 1.2% agarose gel prepared by TAE or TBE. The sequence of the primers used was AGAGAGAGGACTCACGATGGAG for the forward primer and TGAATCTGTCTTCCATGCACTT for the reverse primer. PCR products were purified using the QIAquick PCR Purification Kit (Qiqgen), and then sequenced using Sanger sequencing. Furthermore, the purified PCR products were cloned and sequenced similarly using Sanger sequencing.

[0058] The following results were obtained from these experiments. Figure 10 shows an example of the nucleotide sequence of an ACO3 transformant. Figure 11 shows the results of the direct sequencing analysis. The base sequence of the broccoli used in this experiment is shown as "210611-9★A". The top of Figures 10 and 11 are labeled with base numbers. We will use these numbers for explanation. Using the 108th base as a reference, and referring to the subsequent base sequences, the amino acids are arranged as IPHELLDR… in all plants except the broccoli used in this experiment. In contrast, the base sequence of the broccoli in this experiment is DSTRAT★Q…, with the amino acids arranged in that order.

[0059] As a result of this experiment, 11 lines of ACO3-targeted construct transformants were obtained. A single nucleotide insertion was detected bially in one of these lines. This line was crossed with an inbred line and with Ryokurei, and the resulting seeds were sown and are currently being cultivated. Thus, genome editing is possible for the ACO3 gene.

[0060] Figure 12 is a diagram showing the flow of the broccoli production method according to the present invention. In step S11, the target broccoli is knocked out. The method for knocking out the target broccoli is as described above. In step S12, seeds are produced from the target broccoli.

[0061] In step S13, the trait is introduced into another broccoli variety using the target broccoli line as the mother plant. Specifically, broccoli grown from the seeds of the target broccoli in step S12 is crossed with broccoli of the other variety to produce broccoli that possesses the aforementioned trait and the trait of the other broccoli variety, and seeds of this broccoli are produced. Furthermore, this trait may be introduced not only to the seeds from step S12, but also to other broccoli varieties by directly crossbreeding them with the target broccoli from step S11.

[0062] In step S14, seeds are sown and broccoli is grown for shipment. This allows for the production of broccoli with the target gene knocked out, making it suitable for market sale.

[0063] Next, we will explain the contents related to (1) through (5) below. (1) ACO3 *The individual showed the same growth conditions as the control group, Green Peak, in the artificial climate chamber. (2) When degradation tests were conducted at high temperatures (20°C), there was no change compared to Ryokurei on the fourth day. (3) After 10 days, ACO3 * We observed that many individual plants had viable flower buds. (4) New ACO3 * Two mutant strains were obtained. (5) ACO2 * I obtained four mutant strains.

[0064] The yellowing of plants is thought to be a phenomenon of aging, caused by the accelerated breakdown of chlorophyll by the action of ethylene. In plants, ethylene biosynthesis (see Figure 4) involves the synthesis of the cyclic compound 1-aminocyclopropane-1-carboxylic acid (hereinafter abbreviated as ACC) from the precursor methionine via S-adenosylmethionine, and then the catalytic action of ACC oxidase (hereinafter abbreviated as ACO) using this compound as a substrate to produce ethylene. If it becomes possible to suppress ACO expression or introduce mutations, it is thought that ethylene biosynthesis can be reduced with less cold treatment than before, thereby suppressing the aging process. Bo-ACO1 is involved in basal ethylene synthesis and ethylene synthesis in vegetative tissues. Bo-ACO2 is involved in ethylene synthesis in the reproductive organs and in early post-harvest ethylene biosynthesis. It is not expressed immediately after harvest but increases within two hours post-harvest. Bo-ACO3 is involved in ethylene synthesis in the late post-harvest period and has been reported to be expressed on the third day after harvest.

[0065] Here, the aforementioned genome editing is applied to Bo-ACO2 and Bo-ACO3 to create a lineage that suppresses yellowing. Specifically, when we attempted to create mutant broccoli with the ACO gene, we obtained ACO2 with a different sequence from ACO3 and ACO1.

[0066] First, let me explain the flower bud deterioration test. Broccoli of the T0 generation (the 210611-9 strain mentioned above) that had undergone genome editing was grown to a large size, and then self-pollinated to produce T1 generation broccoli seeds, which were used in a flower head deterioration test. The date shown is just an example, but the sowing date was June 25, 2022. The growing conditions were as follows: germination using soil pots ready for planting (23°C). Seedlings were then grown in 9cm plastic pots (23°C, light conditions / 18°C, dark conditions until September 18). Vernalization treatment was performed (12°C, light conditions for 10 hours / 8°C, dark conditions for 14 hours starting September 18).

[0067] In the T1 generation, ACO3 is a strain in which ACO3 is knocked out, meaning both chromosomes are recessively homozygous. * / ACO3 * The combination of those with ACO3 knocked out and those without (ACO3 * We used heterozygous strains that are / ACO3, and furthermore, we used Green Ridge (ACO3 / ACO3). Vernalization treatment was used to promote the development of flower buds, and when growth was observed on November 10th, no problems were found (individual T1 showed no significant difference in growth compared to the wild-type Green Peak during the vegetative growth stage. In other words, the content of (1) above was confirmed). On December 21st, fully developed flower buds were formed. These buds were then cut off and placed in a predetermined state (in this case, a state where the cut portion was placed in a tube), and a deterioration test was started in an environment of 20°C. The flower bud deterioration test, in other words, is an experiment on the aging of flower buds, and was conducted at room temperature using the wild type (Ryokurei), ACO3 mutant heterozygous lines, and ACO3 recessive homozygous lines (loss-of-function type).

[0068] Figure 13 shows the results of a flower bud deterioration test using the T1 generation. Figure 13 shows the state 10 days after the flower bud deterioration test. As a result, 10 days later, in the wild type and the mutant heterozygous line, the aging of the flower buds progressed and yellowing and shedding advanced. On the other hand, in the loss-of-function mutant homozygous line, the number of surviving flower buds was significantly large (the content of (3) above could be confirmed), and those that bloomed also appeared. Note that there was no change compared to the green ridge 4 days later (the content of (2) above could be confirmed).

[0069] Specifically, in the wild type (green ridge ACO3 / ACO3) shown in the upper part of Figure 13, as yellowing progressed, the flower buds fell apart and none of the flower buds were seen to have grown larger. Also, in the ACO3 mutant heterozygous line (ACO3 * hetero) shown in the middle part of Figure 13, as yellowing progressed, the flower buds fell apart, and only some of the flower buds became slightly larger. In contrast, in the ACO3 recessive homozygous line (ACO3 * homo) shown in the lower part of Figure 13, although there was yellowing, the number of surviving flower buds was significantly large, and the surviving flower buds grew larger, and those that bloomed, although not specifically shown, also appeared. Therefore, the ACO3 mutant homozygous line was able to suppress the aging of the flower buds. Through this flower bud deterioration test, it was confirmed that it was properly inherited from the T0 generation to the T1 generation.

[0070] Next, regarding the new results related to the introduction of mutations by genome editing, a report will be made while referring to Figures 14 to 19. Since genome editing is as described above, the explanation will be omitted here.

[0071] Figure 14 is a diagram showing the ACO3 mutant system (1) 210611-6. As a mutant system for knocking out ACO3, one with a single-base insertion in A was obtained. As shown in Figure 14, a stop codon was formed, and as a result, a loss-of-function mutant line (where a full-length enzyme protein is not produced) was obtained. Also, one with a 22-base deletion and a different amino acid sequence was obtained. A stop codon was formed, and a loss-of-function mutant line was obtained.

[0072] Figure 15 shows the ACO3 mutant line (2) 210226-1. A mutant line that knocked out ACO3 was obtained in which a single T base insertion was present. As shown in Figure 15, a stop codon was formed, resulting in a loss-of-function mutant line. The contents of (4) above can be confirmed from the explanations of Figures 14 and 15.

[0073] On the other hand, Figure 16 shows the ACO2 mutant line (1) 230306-1. The mutant lines that knocked out ACO2 had a single nucleotide insertion of A or G. As shown in Figure 16, a stop codon was formed, resulting in a loss-of-function mutant line.

[0074] Figure 17 shows the ACO2 mutant line (2) 230306-3. A mutant line that knocked out ACO2 was obtained in which a single nucleotide insertion of C was present. As shown in Figure 17, a stop codon was formed, resulting in a loss-of-function mutant line.

[0075] Figure 18 shows the ACO2 mutant line (3) 230516-1. The mutant lines that knocked out ACO2 had a single nucleotide insertion of G or T. As shown in Figure 18, a stop codon was formed, resulting in a loss-of-function mutant line.

[0076] Figure 19 shows the ACO2 mutant line (4) 230516-2. A mutant line that knocked out ACO2 was obtained in which a single nucleotide insertion of T was present. As shown in Figure 19, a stop codon was formed, resulting in a loss-of-function mutant line. The contents of (5) above can be confirmed from the explanations in Figures 16 to 19.

[0077] The above explanation has been given with reference to Figures 13 to 19. ACO2 mutant lines and double mutant lines with ACO3 can be created, and lines with an even higher degree of aging suppression can be obtained.

[0078] Although one embodiment of the present invention has been described so far, the present invention is not limited to the above-described embodiment, and any modifications, improvements, etc. that can achieve the objectives of the present invention are considered to be included in the present invention.

[0079] The broccoli production method to which the present invention is applied only needs to have the following characteristics, and various embodiments can be taken. In other words, the method for producing broccoli to which the present invention applies (for example, the broccoli shown in Figure 1) is: The first step (for example, step S11 in Figure 12) involves using a target broccoli as the target broccoli and performing a genetic modification to knock out at least one of the genes ACO2 and ACO3, which generate ethylene that causes deterioration within a predetermined period after harvest, in the target broccoli. The second step (for example, step S12 in Figure 12) is to produce seeds from the target broccoli after the genetic manipulation, The third step (for example, step S13 in Figure 12) involves growing broccoli for shipment using the aforementioned seeds or seeds sown from said seeds, Includes. This makes it possible to provide crops with more desirable properties using genome editing and to promote understanding of genome editing.

[0080] Furthermore, the seeds to which the present invention is applied only need to have the following characteristics, and various embodiments can be taken. That is, the broccoli to which the present invention applies (for example, the broccoli shown in Figure 1) or seeds (for example, the T1 generation broccoli seeds mentioned above) are, Broccoli that has been genetically modified to knock out at least one of ACO2 and ACO3, which produce ethylene that causes deterioration within a predetermined period after harvest, or broccoli derived from such broccoli. This makes it possible to provide crops with more desirable properties using genome editing and to promote understanding of genome editing. [Explanation of Symbols]

[0081] ST1, ST2, ST3... Steps

Claims

1. The first step involves using a broccoli variety as the target broccoli and performing a genetic modification to knock out the ACO3 gene in the target broccoli, which generates ethylene that causes deterioration within a predetermined period after harvest. The second step is to produce seeds from the target broccoli after the genetic manipulation described above, A third step involves growing broccoli for sale using recessive homozygous seeds from the progeny of the broccoli produced from the broccoli in which AOC3 has been knocked out, in which AOC3 has been knocked out. A method for producing broccoli that includes [the specified ingredient].

2. Among the offspring of the seeds produced from the broccoli in which AOC3 has been knocked out, recessive homozygous seeds in which AOC3 has been knocked out, or broccoli produced from such seeds.

Images