LNP composition containing mRNA therapeutic agent with extended half-life

Abstract

The present disclosure features polynucleotides encoding polypeptides, the polynucleotides including a 5' UTR described herein, a coding region including a payload and a termination element described herein, and a 3' UTR described herein, as well as LNP compositions comprising the same. The polynucleotides and / or LNP compositions of the present disclosure can increase the level and / or activity of the payload by increasing the half-life and / or duration of expression of the polynucleotide encoding the payload or the payload polypeptide. Also disclosed herein are methods of treating a disease or disorder in a subject using the LNP compositions of the present disclosure.

Description

[Background technology]

[0001] Cross-reference of related applications This application claims the benefits of U.S. Provisional Application No. 63 / 042,822 filed June 23, 2020, U.S. Provisional Application No. 63 / 165,094 filed March 23, 2021, and U.S. Provisional Application No. 63 / 165,469 filed March 24, 2021. The contents of the aforementioned applications are incorporated herein by reference in their entirety.

[0002] Sequence List This application includes a sequence listing submitted electronically in ASCII format, which is incorporated herein by reference in its entirety. A copy of the said ASCII format, prepared on 23 June 2021, is named M2180-7007WO_SL.txt and is 45,216 bytes in size.

[0003] Attempts to enhance mRNA efficacy have focused on generating mRNA with optimally designed open reading frames (ORFs). However, these efforts have not indicated that the potential and persistence of mRNA expression have reached their peak. This is especially true for mRNA therapeutics. Therefore, it is necessary to further improve the potential and persistence of mRNA expression by utilizing RNA biology. [Overview of the project]

[0004] This disclosure provides, in particular, polynucleotides encoding polypeptides, comprising a coding region including (a) a 5'UTR (e.g., as described herein), (b) a stop element (e.g., as described herein), and (c) a 3'UTR (e.g., as described herein), as well as LNP compositions comprising them. In one embodiment, the coding region comprises a polynucleotide sequence (e.g., mRNA, e.g., an open reading frame (ORF)) encoding a peptide or polypeptide payload (e.g., a therapeutic payload or a preventive payload). In one embodiment, the polynucleotide (e.g., mRNA) or the polypeptide encoded by the polynucleotide has improved levels and / or activity (e.g., expression level or half-life) compared to versions lacking the 5'UTR, 3'UTR, or stop element described herein. In one embodiment, the level and / or activity of the polynucleotide (e.g., mRNA) is improved. In one embodiment, the level, activity, and / or duration of expression of the polypeptide encoded by the polynucleotide are improved. Furthermore, methods of using LNP compositions comprising the polynucleotides disclosed herein to treat a disease or disorder in a subject, or to promote a desired biological effect, are disclosed herein. It will be understood that any ORF can be combined with an ORF encoding a disclosed element, for example, a polypeptide or peptide (whether intracellular, transmembrane, or secretory). Further aspects of this disclosure are described in more detail below.

[0005] Combinations including 5'UTR and 3'UTR and / or cadence elements In one embodiment, the Specified Publicly Provided Polynucleotides (e.g., mRNA) encoding a polypeptide, comprising (a) a 5'UTR containing the sequence of SEQ ID NO: 1 or a variant or fragment thereof, (b) a coding region containing a stop element (e.g., as described herein), and (c) a 3'UTR (e.g., as described herein).

[0006] In one embodiment, the 5'UTR is the nucleic acid sequence of formula A: GGAAAUCGCAAAA(N2) X (N3) X CU(N4) X (N5) X CGCGUUAGAUUUCUUUUAGUUUUCUN6N7CAACUAGCAAGCUUUUUGUUCUCGCC(N8CC)x (Sequence ID 46) is included in the formula, (N2) x is uracil, and x is an integer between 0 and 5 (for example, x = 3 or 4); (N3) x x is guanine, and x is an integer between 0 and 1; (N4) x x is cytosine, and x is an integer between 0 and 1; (N5) x N6 is uracil, and x is an integer from 0 to 5 (for example, x = 2 or 3); N6 is uracil or cytosine; N7 is uracil or guanine; and / or N8 is adenine or guanine, and x is an integer from 0 to 1.

[0007] In one embodiment, a variant of SEQ ID NO: 1 includes a sequence that is at least 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 1 or nucleotides 2-75, 3-75, 4-75, 5-75, 6-75, or 7-75. In one embodiment, a variant of SEQ ID NO: 1 includes a sequence that is at least 50% identical to SEQ ID NO: 1 or nucleotides 2-75, 3-75, 4-75, 5-75, 6-75, or 7-75. In one embodiment, a variant of SEQ ID NO: 1 includes a sequence that is at least 60% identical to SEQ ID NO: 1 or nucleotides 2-75, 3-75, 4-75, 5-75, 6-75, or 7-75. In one embodiment, a variant of SEQ ID NO: 1 includes a sequence that is at least 70% identical to SEQ ID NO: 1 or nucleotides 2-75, 3-75, 4-75, 5-75, 6-75, or 7-75 of SEQ ID NO: 1. In one embodiment, a variant of SEQ ID NO: 1 includes a sequence that is at least 80% identical to SEQ ID NO: 1 or nucleotides 2-75, 3-75, 4-75, 5-75, 6-75, or 7-75 of SEQ ID NO: 1. In one embodiment, a variant of SEQ ID NO: 1 includes a sequence that is at least 90% identical to SEQ ID NO: 1 or nucleotides 2-75, 3-75, 4-75, 5-75, 6-75, or 7-75 of SEQ ID NO: 1. In one embodiment, a variant of SEQ ID NO: 1 includes a sequence that is at least 95% identical to SEQ ID NO: 1 or nucleotides 2-75, 3-75, 4-75, 5-75, 6-75, or 7-75 of SEQ ID NO: 1. In one embodiment, a variant of SEQ ID NO: 1 includes a sequence that is at least 96% identical to SEQ ID NO: 1 or nucleotides 2-75, 3-75, 4-75, 5-75, 6-75, or 7-75 of SEQ ID NO: 1. In one embodiment, a variant of SEQ ID NO: 1 includes a sequence that is at least 97% identical to SEQ ID NO: 1 or nucleotides 2-75, 3-75, 4-75, 5-75, 6-75, or 7-75 of SEQ ID NO: 1.In one embodiment, a variant of SEQ ID NO: 1 includes a sequence that is at least 98% identical to SEQ ID NO: 1 or nucleotides 2-75, 3-75, 4-75, 5-75, 6-75, or 7-75 of SEQ ID NO: 1. In one embodiment, a variant of SEQ ID NO: 1 includes a sequence that is at least 99% identical to SEQ ID NO: 1 or nucleotides 2-75, 3-75, 4-75, 5-75, 6-75, or 7-75 of SEQ ID NO: 1. In one embodiment, a variant of SEQ ID NO: 1 includes a sequence that is at least 100% identical to SEQ ID NO: 1 or nucleotides 2-75, 3-75, 4-75, 5-75, 6-75, or 7-75 of SEQ ID NO: 1.

[0008] In one embodiment, the variant of SEQ ID NO: 1 is composed of a uridine content of at least 30%, 40%, 50%, 60%, 70%, or 80%. In one embodiment, the variant of SEQ ID NO: 1 is composed of a uridine content of at least 30%. In one embodiment, the variant of SEQ ID NO: 1 is composed of a uridine content of at least 40%. In one embodiment, the variant of SEQ ID NO: 1 is composed of a uridine content of at least 50%. In one embodiment, the variant of SEQ ID NO: 1 is composed of a uridine content of at least 60%. In one embodiment, the variant of SEQ ID NO: 1 is composed of a uridine content of at least 70%. In one embodiment, the variant of SEQ ID NO: 1 is composed of a uridine content of at least 80%.

[0009] In one embodiment, the variant of SEQ ID NO: 1 contains at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 consecutive uridines (e.g., polyuridine tracts). In one embodiment, the variant of SEQ ID NO: 1 contains at least 2 consecutive uridines. In one embodiment, the variant of SEQ ID NO: 1 contains at least 3 consecutive uridines. In one embodiment, the variant of SEQ ID NO: 1 contains at least 4 consecutive uridines. In one embodiment, the variant of SEQ ID NO: 1 contains at least 5 consecutive uridines. In one embodiment, the variant of SEQ ID NO: 1 contains at least 6 consecutive uridines. In one embodiment, the variant of SEQ ID NO: 1 contains at least 7 consecutive uridines. In one embodiment, the variant of SEQ ID NO: 1 contains at least 8 consecutive uridines. In one embodiment, the variant of SEQ ID NO: 1 contains at least 9 consecutive uridines. In one embodiment, the variant of SEQ ID NO: 1 contains at least 10 consecutive uridines. In one embodiment, the variant of SEQ ID NO: 1 contains at least 11 consecutive uridines. In one embodiment, the variant of Sequence ID No. 1 contains at least 12 consecutive uridines.

[0010] In one embodiment, the polyuridine tract in the variant of SEQ ID NO: 1 contains at least 2-12, 2-11, 2-10, 2-9, 2-8, 2-7, 2-6, 2-5, 2-4, 2-3, 3-12, 4-12, 5-12, 6-12, 7-12, 8-12, 9-12, 10-12, 11-12, 2-6, or 3-5 consecutive uridines. In one embodiment, the polyuridine tract in the variant of SEQ ID NO: 1 contains at least 2-6 consecutive uridines. In one embodiment, the polyuridine tract in the variant of SEQ ID NO: 1 contains at least 2-5 consecutive uridines. In one embodiment, the polyuridine tract in the variant of SEQ ID NO: 1 contains at least 2-4 consecutive uridines. In one embodiment, the polyuridine tract in the variant of SEQ ID NO: 1 contains at least 3-4 consecutive uridines. In one embodiment, the polyuridine tract in the variant of SEQ ID NO: 1 contains at least 3 to 5 consecutive uridine molecules. In another embodiment, the polyuridine tract in the variant of SEQ ID NO: 1 contains at least 4 to 5 consecutive uridine molecules.

[0011] In one embodiment, the variant of SEQ ID NO: 1 contains two consecutive uridine units. In one embodiment, the variant of SEQ ID NO: 1 contains three consecutive uridine units. In one embodiment, the variant of SEQ ID NO: 1 contains four consecutive uridine units. In one embodiment, the variant of SEQ ID NO: 1 contains five consecutive uridine units. In one embodiment, the variant of SEQ ID NO: 1 contains six consecutive uridine units. In one embodiment, the variant of SEQ ID NO: 1 contains seven consecutive uridine units. In one embodiment, the variant of SEQ ID NO: 1 contains eight consecutive uridine units. In one embodiment, the variant of SEQ ID NO: 1 contains nine consecutive uridine units. In one embodiment, the variant of SEQ ID NO: 1 contains ten consecutive uridine units. In one embodiment, the variant of SEQ ID NO: 1 contains eleven consecutive uridine units. In one embodiment, the variant of SEQ ID NO: 1 contains twelve consecutive uridine units.

[0012] In one embodiment, the variant of SEQ ID NO: 1 includes polyuridine tracts 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15. In one embodiment, the variant of SEQ ID NO: 1 includes one polyuridine tract. In one embodiment, the variant of SEQ ID NO: 1 includes two polyuridine tracts. In one embodiment, the variant of SEQ ID NO: 1 includes three polyuridine tracts. In one embodiment, the variant of SEQ ID NO: 1 includes four polyuridine tracts. In one embodiment, the variant of SEQ ID NO: 1 includes five polyuridine tracts. In one embodiment, the variant of SEQ ID NO: 1 includes six polyuridine tracts. In one embodiment, the variant of SEQ ID NO: 1 includes seven polyuridine tracts. In one embodiment, the variant of SEQ ID NO: 1 includes eight polyuridine tracts.

[0013] In one embodiment, one or more of the polyuridine tracts are adjacent to different polyuridine tracts. In one embodiment, each (e.g., all) of the polyuridine tracts are adjacent to one another (e.g., all of the polyuridine tracts are contiguous). In one embodiment, one or more of the polyuridine tracts are separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 2, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, or 60 nucleotides. In one embodiment, each (e.g., all) of the polyuridine tracts are separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 2, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, or 60 nucleotides. In one embodiment, the first polyuridine tract and the second polyuridine tract are adjacent to each other.

[0014] In one embodiment, the 5'UTR includes a Kozak sequence (for example, the GCCRCC nucleotide sequence (SEQ ID NO: 43), where R is adenine or guanine).

[0015] In one embodiment, the 5'UTR includes the sequence of SEQ ID NO: 1 or a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 1 or nucleotides 2-75, 3-75, 4-75, 5-75, 6-75, or 7-75 of SEQ ID NO: 1. In one embodiment, the 5'UTR includes the sequence of SEQ ID NO: 1 or nucleotides 2-75, 3-75, 4-75, 5-75, 6-75, or 7-75 of SEQ ID NO: 1.

[0016] In one embodiment, the 5'UTR includes the sequence of SEQ ID NO: 41 or a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 41 or nucleotides 2-81, 3-81, 4-81, 5-81, 6-81, or 7-81 of SEQ ID NO: 41. In one embodiment, the 5'UTR includes the sequence of SEQ ID NO: 41 or nucleotides 2-81, 3-81, 4-81, 5-81, 6-81, or 7-81 of SEQ ID NO: 41.

[0017] In one embodiment, the 5'UTR includes the sequence of SEQ ID NO: 42 or a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 42, or nucleotides 2-81, 3-81, 4-81, 5-81, 6-81, or 7-81 of SEQ ID NO: 42. In one embodiment, the 5'UTR includes the sequence of SEQ ID NO: 42 or nucleotides 2-81, 3-81, 4-81, 5-81, 6-81, or 7-81 of SEQ ID NO: 42.

[0018] In one embodiment, the 5'UTR increases the half-life of the polynucleotide (for example, by about 1.5 to 20 times). In one embodiment, the increase in the half-life of the polynucleotide is compared to other similar polynucleotides that do not have a 5'UTR, have a different 5'UTR, or do not have a 5'UTR disclosed herein. In one embodiment, the increase in the half-life of the polynucleotide is measured according to an assay for measuring the half-life of a polynucleotide (for example, the assay described in any one of the examples herein).

[0019] In one embodiment, the 5'UTR increases the level and / or activity (e.g., production) of the polypeptide encoded by the polynucleotide. In one embodiment, the 5'UTR increases the level and / or activity (e.g., production) of the polypeptide encoded by the polynucleotide by about 1.5 to 20 times. In one embodiment, the increase in activity is compared to other similar polynucleotides that do not have a 5'UTR, have a different 5'UTR, or do not have a 5'UTR disclosed herein.

[0020] In one embodiment, the code region of (b) includes a termination element selected from the termination elements shown in Table 3 (for example, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 62, SEQ ID NO: 93, or SEQ ID NO: 96).

[0021] In one embodiment, the 3'UTR of (c) includes a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the 3'UTR sequences shown in Table 2 (for example, a fragment lacking the first (i.e., the 5' end) 1, 2, 3, 4, 5, 6, or more nucleotides of the 3'UTR sequence shown in Table 2). In one embodiment, the 3'UTR includes a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence numbers 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 45, 79, 80, 81, 82, 83, 84, 85, 86, 87, 94, or 95 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides in any of the aforementioned sequences). In one embodiment, the 3'UTR includes a microRNA (miRNA) binding site (for example, one of the sequences described herein, e.g., any of sequence numbers 38-40).

[0022] In one embodiment, the 3'UTR comprises one or more (e.g., two or three) TENT recruit sequences described herein. In one embodiment, the 3'UTR comprises a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 91 or 92.

[0023] In one embodiment, (i) the coding region of (b) includes a termination element selected from the termination elements shown in Table 3 (e.g., SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 62, SEQ ID NO: 93, or SEQ ID NO: 96), and (ii) the 3'UTR of (c) includes a 3'UTR sequence shown in Table 2 or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a 3'UTR sequence shown in Table 2 (e.g., a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides in a 3'UTR sequence shown in Table 2).

[0024] In one embodiment, the 3'UTR includes a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NOs. 11, SEQ ID NOs. 12, SEQ ID NOs. 13, SEQ ID NOs. 14, SEQ ID NOs. 15, SEQ ID NOs. 16, SEQ ID NOs. 17, SEQ ID NOs. 18, SEQ ID NOs. 19, SEQ ID NOs. 20, SEQ ID NOs. 21, SEQ ID NOs. 22, SEQ ID NOs. 23, SEQ ID NOs. 24, SEQ ID NOs. 25, SEQ ID NOs. 45, SEQ ID NOs. 79, SEQ ID NOs. 80, SEQ ID NOs. 81, SEQ ID NOs. 82, SEQ ID NOs. 83, SEQ ID NOs. 84, SEQ ID NOs. 85, SEQ ID NOs. 86, SEQ ID NOs. 87, SEQ ID NOs. 94, or SEQ ID NOs. 95. (For example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides in any of the aforementioned sequences.) In one embodiment, the 3'UTR includes a microRNA binding site (for example, one of the sequences described herein, e.g., any of SEQ ID NOs. 38-40).

[0025] In one embodiment, the 3'UTR comprises one or more (e.g., two or three) TENT recruit sequences described herein. In one embodiment, the 3'UTR comprises a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 91 or 92.

[0026] Combinations including 3'UTR and 5'UTR and / or cadence elements In one embodiment, the Specified Description of a polynucleotide encoding a polypeptide is disclosed, comprising (a) a 5'UTR (e.g., as described herein), (b) a coding region comprising a termination element (e.g., as described herein), and (c) a 3'UTR comprising a core sequence or a fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 11.

[0027] In one embodiment, the 3'UTR core sequence is located immediately downstream of the termination element of (b). In one embodiment, the 3'UTR core sequence is located at the C-terminus of the polynucleotide.

[0028] In one embodiment, the 3'UTR including the core array includes a first flanking array. In one embodiment, the 3'UTR includes a core array including a second flanking array. In one embodiment, the 3'UTR including the core array includes a first flanking array and a second flanking array.

[0029] In one embodiment, the first flanking sequence includes a sequence of about 5-25, about 5-20, about 5-15, about 5-10, about 10-25, about 15-25, and about 20-25 nucleotides. In one embodiment, the first flanking sequence includes a sequence of about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides (e.g., 11 nucleotides).

[0030] In one embodiment, the second flanking sequence includes a sequence of about 20-80, about 20-75, about 20-70, about 20-65, about 20-60, about 20-55, about 20-50, about 20-45, about 20-40, about 20-35, about 20-30, about 20-25, about 25-80, about 30-80, about 35-80, about 40-80, about 45-80, about 50-80, about 55-80, about 60-80, about 65-80, about 70-80, or about 75-80 nucleotides. In one embodiment, the second flanking sequence includes a sequence of about 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, or 80 nucleotides (e.g., 39 nucleotides).

[0031] In one embodiment, the first flanking array is located upstream or downstream of the core array. In one embodiment, the second flanking array is located upstream or downstream of the core array.

[0032] In one embodiment, the 3'UTR includes a fragment of SEQ ID NO: 11 (for example, a 5-nucleotide (nt), 10nt, 15nt, 20nt, 25nt, 30nt, 35nt, 40nt, 45nt, 50nt, 55nt, 60nt, 65nt, or 70nt fragment of SEQ ID NO: 11). In one embodiment, the 3'UTR includes a 15-25nt fragment composed of a 60nt fragment of SEQ ID NO: 11.

[0033] In one embodiment, the 3'UTR includes the sequence or fragment of sequence number 45. In another embodiment, the 3'UTR includes the sequence or fragment of sequence number 11.

[0034] In one embodiment, the 3'UTR increases the half-life of the polynucleotide (for example, the half-life of the polynucleotide increases by about 1.5 to 10 times, as measured by an assay for measuring the half-life of a polynucleotide (for example, the assay described in any one of the examples disclosed herein)).

[0035] In one embodiment, the 3'UTR causes the mean half-life score of the polynucleotide to exceed 10. In one embodiment, the 3'UTR increases the level and / or activity (e.g., production) of the polypeptide encoded by the polynucleotide. In one embodiment, the increase is compared to other similar polynucleotides that do not have a 3'UTR, have a different 3'UTR, or do not have a 3'UTR disclosed herein.

[0036] In one embodiment, the 3'UTR includes a microRNA (miRNA) binding site (e.g., one of those described herein). In one embodiment, the 3'UTR includes the miRNA binding site of SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, or a combination thereof. In one embodiment, the 3'UTR includes multiple miRNA binding sites (e.g., 2, 3, 4, 5, 6, 7, or 8 miRNA binding sites). In one embodiment, the multiple miRNA binding sites include identical or different miRNA binding sites.

[0037] In one embodiment, the 5'UTR of (a) includes a 5'UTR sequence shown in Table 1 or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the 5'UTR sequence shown in Table 1 (for example, a fragment lacking the first (i.e., the 5'-most) 1, 2, 3, 4, 5, or 6 nucleotides of the 5'UTR sequence shown in Table 1). In one embodiment, the 5'UTR includes a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 88, SEQ ID NO: 89, or SEQ ID NO: 90 (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides in any of the aforementioned sequences).

[0038] In one embodiment, the code region of (b) includes the sequence of termination elements shown in Table 3. In one embodiment, the code region of (b) includes termination elements selected from the termination elements shown in Table 3 (for example, sequence number 26, sequence number 27, sequence number 28, sequence number 29, sequence number 30, sequence number 31, sequence number 32, sequence number 33, sequence number 34, sequence number 35, sequence number 36, sequence number 37, sequence number 56, sequence number 57, sequence number 62, sequence number 93, or sequence number 96).

[0039] In one embodiment, (i) the 5'UTR of (a) comprises a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the 5'UTR sequence shown in Table 1 (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of the 5'UTR sequence shown in Table 1), and (ii) the stop element of (b) comprises a stop element sequence shown in Table 3.

[0040] In one embodiment, the 5'UTR includes a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 88, SEQ ID NO: 89, or SEQ ID NO: 90 (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides in any of the aforementioned sequences).

[0041] In one embodiment, the code region of (b) includes a termination element selected from the termination elements shown in Table 3 (for example, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 62, SEQ ID NO: 93, or SEQ ID NO: 96).

[0042] Ending elements and combinations including 5'UTR and / or ending elements In another aspect, provided herein is a polynucleotide encoding a polypeptide, the polynucleotide comprising: (a) a 5'UTR (e.g., as described herein), (b) a coding region comprising a termination element selected from the termination elements shown in Table 3, and (c) a 3'UTR (e.g., as described herein).

[0043] In one embodiment, the termination element comprises the sequence of SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 93 or SEQ ID NO: 96.

[0044] In one embodiment, the coding region of (b) has the formula B: X -3 -X -2 -X -1 -U-A-A-X1-X2-X3-X4-X5-X6-X7-X8-X9-X 10 -X 11 -X 12 (SEQ ID NO: 37) (wherein, X1 is G or A; X2, X4, X5, X6 or X7 are each independently C or U; X3 is C or A; X8, X 10 , X 11 , X 12 , X -1 0]] or X -3 are each independently C or G; X9 is G or U; and / or X -2 is A or U) and comprises a termination element comprising a consensus sequence.

[0045] In one embodiment, the coding region of (b) has the formula C X -3 -X -2 -X -1 -U-G-A-X1-X2-X3-X4-X5-X6-X7-X8-X9-X10 -X 11 -X 12 (Sequence ID 56) (In the formula, X -3 , X -1 X2, X5, X6, X7, X8, X9, or X 12 Each is independently either G or C; X -2 X3 or X4 are independently A or C; X1 is A or G; and / or X 10 Or X 11 Each contains a terminating element which includes a consensus sequence of (each independently being either C or U).

[0046] In one embodiment, the code area of ​​(b) is formula D: X -3 -X -2 -X -1 -UAG-X1-X2-X3-X4-X5-X6-X7-X8-X9-X 10 -X 11 -X 12 (Sequence ID 57) (In the formula, X -3 , X -1 X2, X3, X 10 Each is independently either G or C; X -2 Alternatively, X9 is either A or U, independently of each other; X1 or X4 is independently A or G; X5 or X8 is independently A or C; and / or X6, X7, X 11 Or X 12 Each contains a terminating element which includes a consensus sequence of (each independently being either C or U).

[0047] In one embodiment, the consensus sequence has a high GC content (e.g., a GC content of about 50%, 60%, 70%, 80%, 90%, or 99%).

[0048] In one embodiment, the termination element increases the half-life of the polynucleotide (for example, by about 1.5 to 20 times). In one embodiment, the increase in the half-life of the polynucleotide is compared to other similar polynucleotides that do not have a termination element, have a different termination element, or do not have the termination element disclosed herein. In one embodiment, the increase in the half-life of the polynucleotide is measured according to an assay for measuring the half-life of a polynucleotide (for example, the assay described in any one of the examples disclosed herein).

[0049] In one embodiment, the termination element increases the level and / or activity (e.g., the amount or duration of expression) of the polypeptide encoded by the polynucleotide. In one embodiment, the increase in the level and / or activity (e.g., the amount or duration of expression) of the polypeptide is measured according to an assay that measures the level and / or activity (e.g., the amount or duration of expression) (e.g., the assay described in any one of the examples disclosed herein). In one embodiment, the termination element increases the level and / or activity (e.g., the amount produced) of the polypeptide encoded by the polynucleotide by about 1.5 to 20 times. In one embodiment, the termination element increases the level and / or activity (e.g., a detectable level or activity) of the polypeptide encoded by the polynucleotide by about 1.5 to 20 times for about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 14 days. In one embodiment, the termination element makes the level or activity of the polypeptide encoded by the polynucleotide detectable for about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 14 days.

[0050] In one embodiment, the increase is compared to other similar polynucleotides that do not have a termination element, have a different termination element, or do not have the termination element disclosed herein.

[0051] In one embodiment, the 5'UTR of (a) includes a 5'UTR sequence shown in Table 1 or a sequence, variant, or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the 5'UTR sequence shown in Table 1 (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of the 5'UTR sequence shown in Table 1). In one embodiment, the 5'UTR includes a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 88, SEQ ID NO: 89, or SEQ ID NO: 90 (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides in any of the aforementioned sequences).

[0052] In one embodiment, the 3'UTR of (c) includes a 3'UTR sequence shown in Table 2 or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a 3'UTR sequence shown in Table 2 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of a 3'UTR sequence shown in Table 2). In one embodiment, the 3'UTR includes a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NOs. 11, SEQ ID NOs. 12, SEQ ID NOs. 13, SEQ ID NOs. 14, SEQ ID NOs. 15, SEQ ID NOs. 16, SEQ ID NOs. 17, SEQ ID NOs. 18, SEQ ID NOs. 19, SEQ ID NOs. 20, SEQ ID NOs. 21, SEQ ID NOs. 22, SEQ ID NOs. 23, SEQ ID NOs. 24, SEQ ID NOs. 25, SEQ ID NOs. 45, SEQ ID NOs. 79, SEQ ID NOs. 80, SEQ ID NOs. 81, SEQ ID NOs. 82, SEQ ID NOs. 83, SEQ ID NOs. 84, SEQ ID NOs. 85, SEQ ID NOs. 86, SEQ ID NOs. 87, SEQ ID NOs. 94, or SEQ ID NOs. 95. (For example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides in any of the aforementioned sequences.) In one embodiment, the 3'UTR includes a microRNA binding site (for example, one of the sequences described herein, e.g., any of SEQ ID NOs. 38-40).

[0053] In one embodiment, the 3'UTR comprises one or more (e.g., two or three) TENT recruit sequences described herein. In one embodiment, the 3'UTR comprises a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 91 or 92.

[0054] In one embodiment, (i) the 5'UTR of (a) comprises a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the 5'UTR sequence shown in Table 1 or the 3'UTR sequence shown in Table 1 (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of the 5'UTR sequence shown in Table 1), and (ii) the 3'UTR of (c) comprises a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the 3'UTR sequence shown in Table 2 or the 3'UTR sequence shown in Table 2 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of the 3'UTR sequence shown in Table 2).

[0055] In one embodiment, the 5'UTR includes a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 88, SEQ ID NO: 89, or SEQ ID NO: 90 (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides in any of the aforementioned sequences).

[0056] In one embodiment, the 3'UTR includes a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NOs. 11, SEQ ID NOs. 12, SEQ ID NOs. 13, SEQ ID NOs. 14, SEQ ID NOs. 15, SEQ ID NOs. 16, SEQ ID NOs. 17, SEQ ID NOs. 18, SEQ ID NOs. 19, SEQ ID NOs. 20, SEQ ID NOs. 21, SEQ ID NOs. 22, SEQ ID NOs. 23, SEQ ID NOs. 24, SEQ ID NOs. 25, SEQ ID NOs. 45, SEQ ID NOs. 79, SEQ ID NOs. 80, SEQ ID NOs. 81, SEQ ID NOs. 82, SEQ ID NOs. 83, SEQ ID NOs. 84, SEQ ID NOs. 85, SEQ ID NOs. 86, SEQ ID NOs. 87, SEQ ID NOs. 94, or SEQ ID NOs. 95. (For example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides in any of the aforementioned sequences.) In one embodiment, the 3'UTR includes a microRNA binding site (for example, one of the sequences described herein, e.g., any of SEQ ID NOs. 38-40).

[0057] In one embodiment, the 3'UTR comprises one or more (e.g., two or three) TENT recruit sequences described herein. In one embodiment, the 3'UTR comprises a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 91 or 92.

[0058] Any characteristics of the mRNA constructs disclosed herein In one embodiment, the coding region of the polynucleotide includes a sequence encoding a therapeutic payload or a preventive payload.

[0059] In one embodiment, the therapeutic or prophylactic payload includes a secretory protein, a membrane-bound protein, or an intercellular protein.

[0060] In one embodiment, the therapeutic or prophylactic payload is selected from cytokines, antibodies, vaccines (e.g., antigens, immunogenic epitopes), receptors, enzymes, hormones, transcription factors, ligands, membrane transporters, structural proteins, nucleases, or components, variants, or fragments thereof (e.g., biologically active fragments). In one embodiment, the therapeutic or prophylactic payload comprises a protein or peptide.

[0061] In one embodiment, the polynucleotide further comprises at least one 5' cap structure (e.g., as described herein) and / or a poly-A tail (e.g., as described herein).

[0062] In one embodiment, the 5' cap structure is [ka] The sequence includes the following, where the underlined italicized G is an inverted G nucleotide followed by a 5'-5'-triphosphate group.

[0063] In one embodiment, the polynucleotide further comprises a 3' stabilizing region (e.g., a stabilizing tail, e.g., as described herein). In one embodiment, the 3' stabilizing region comprises a poly-A tail (e.g., a poly-A tail containing 80 to 150 adenines, e.g., 120 adenines (SEQ ID NO: 123)). In one embodiment, the poly-A tail comprises one or more non-adenosine residues (e.g., one or more guanosines, e.g., as described herein). In one embodiment, the poly-A tail comprises a UCUAG sequence (SEQ ID NO: 44). In one embodiment, the poly-A tail contains about 80 to 120 adenines (e.g., 100) upstream of SEQ ID NO: 44. In one embodiment, the poly-A tail contains about 1 to 40 adenines (e.g., 20) downstream of SEQ ID NO: 44.

[0064] In one embodiment, the 3' stabilizing region comprises at least one alternative nucleoside, which is optionally an inverted thymidine (idT).

[0065] In one embodiment, the 3' stabilization region has the structure of formula VII: [ka] or a salt thereof, where each X is independently either O or S, A represents adenine, and T represents thymine.

[0066] In one embodiment, the polynucleotide constitutes mRNA.

[0067] LNP composition and method of use In another embodiment, this specification discloses lipid nanoparticle (LNP) compositions comprising polynucleotides disclosed herein.

[0068] In one embodiment, this specification discloses a pharmaceutical composition comprising an LNP composition comprising a polynucleotide disclosed herein.

[0069] In one embodiment, the present disclosure provides cells comprising an LNP composition comprising a polynucleotide disclosed herein.

[0070] In yet another embodiment, the Specified provides a method for increasing the expression level of a payload (e.g., a therapeutic payload or a preventive payload) in cells, the method comprising administering to the cells an LNP composition comprising a polynucleotide disclosed herein.

[0071] In a related embodiment, the Specified herein provides compositions comprising LNP compositions containing polynucleotides disclosed herein for use in methods of increasing the expression levels of payloads (e.g., therapeutic payloads or preventive payloads) in cells.

[0072] In one embodiment, a method for delivering an LNP composition comprising a polynucleotide disclosed herein is provided. In one embodiment, the method includes contacting the cells with the LNP composition in vitro, in vivo, or ex vivo.

[0073] In one embodiment, this specification provides a method for delivering an LNP composition comprising a polynucleotide disclosed herein to a subject having a disease or disorder (e.g., as described herein).

[0074] In another embodiment, the Specified provides a method for modulating an immune response in a subject, comprising administering to the subject in need of such modification an effective amount of an LNP composition comprising a polynucleotide disclosed herein.

[0075] In a related embodiment, the Disclosure provides compositions comprising LNP compositions containing polynucleotides disclosed herein for use in methods of modulating immune responses in subjects.

[0076] In one embodiment, the Specified provides a method for treating, preventing, or preventing the symptoms of a disease or disorder, comprising administering an effective amount of an LNP composition containing a polynucleotide disclosed herein to a subject in need thereof.

[0077] In a related embodiment, the Disclosure provides compositions comprising LNP compositions comprising polynucleotides disclosed herein for use in methods of treating, preventing, or preventing the symptoms thereof of a disease or disorder.

[0078] In one embodiment of any method or composition for use disclosed herein, the LNP is formulated for intravenous, subcutaneous, intramuscular, intranasal, intraocular, rectal, pulmonary, or oral delivery.

[0079] In one embodiment of any method or composition for use disclosed herein, the subject is a mammal (e.g., human).

[0080] In one embodiment of any method or composition for use disclosed herein, the subject has a disease or disorder disclosed herein.

[0081] Further characteristics of the compositions and methods disclosed herein Further characteristics of any of the LNP compositions, pharmaceutical compositions, methods, or compositions disclosed herein for use include the following embodiments.

[0082] In some embodiments of any of the methods or compositions disclosed herein, the LNP composition comprises (i) an ionized lipid (e.g., an amino lipid), (ii) a sterol or other structural lipid, (iii) a noncationic helper lipid or phospholipid, and (iv) a PEG lipid. In some embodiments, the ionized lipid comprises a compound of formula (IIa). In some embodiments, the ionized lipid comprises a compound of formula (IIe).

[0083] In some embodiments of any of the LNP compositions, methods, or uses disclosed herein, the coding region of the polynucleotide includes a sequence encoding a secretory protein, a membrane-bound protein, or an intercellular protein.

[0084] In some embodiments, the therapeutic or preventive payload is selected from cytokines, antibodies, vaccines (e.g., antigens, immunogenic epitopes), receptors, enzymes, hormones, transcription factors, ligands, membrane transporters, structural proteins, nucleases, or components, variants, or fragments thereof (e.g., biologically active fragments).

[0085] In some embodiments, the therapeutic or preventive payload includes a cytokine, or a variant or fragment thereof (e.g., a biologically active fragment).

[0086] In some embodiments, the therapeutic or prophylactic payload includes an antibody, or a variant or fragment thereof (e.g., a biologically active fragment).

[0087] In some embodiments, the therapeutic or prophylactic payload includes a vaccine (e.g., an antigen, an immunogenic epitope) or a component, variant, or fragment thereof (e.g., a biologically active fragment).

[0088] In some embodiments, the therapeutic or preventive payload comprises a protein or peptide.

[0089] In some embodiments of any of the LNP compositions, methods, or uses disclosed herein, the polynucleotide constitutes mRNA. In some embodiments, the mRNA comprises at least one chemical modification (e.g., those described herein). In one embodiment, the chemical modification is selected from the group consisting of pseudouridine, N1-methylpsoiduridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thio-l-methyl-1-deaza-psoiduridine, 2-thio-l-methylpsoiduridine, 2-thio-5-aza-uridine, 2-thio-dihydropsoiduridine, 2-thio-dihydrouridine, 2-thiopsoiduridine, 4-methoxy-2-thiopsoiduridine, 4-methoxypsoiduridine, 4-thio-l-methylpsoiduridine, 4-thiopsoiduridine, 5-aza-uridine, dihydropsoiduridine, 5-methyluridine, 5-methyluridine, 5-methoxyuridine, and 2'-O-methyluridine. In one embodiment, the chemical modification is selected from the group consisting of pseudouridine, N1-methylpsoiduridine, 5-methylcytosine, 5-methoxyuridine, and combinations thereof. In one embodiment, the chemical modification is N1-methylpsoiduridine. In one embodiment, each mRNA in the lipid nanoparticle contains fully modified N1-methylpsoiduridine.

[0090] In some embodiments of any of the LNP compositions, methods, or uses disclosed herein, the LNP is formulated for intravenous, subcutaneous, intramuscular, intranasal, intraocular, rectal, pulmonary, or oral delivery. In some embodiments, the LNP is formulated for intravenous delivery. In some embodiments, the LNP is formulated for subcutaneous delivery. In some embodiments, the LNP is formulated for intramuscular delivery. In some embodiments, the LNP is formulated for intranasal delivery. In some embodiments, the LNP is formulated for intraocular delivery. In some embodiments, the LNP is formulated for rectal delivery. In some embodiments, the LNP is formulated for pulmonary delivery. In some embodiments, the LNP is formulated for oral delivery.

[0091] In some embodiments of any of the LNP compositions, methods, or uses disclosed herein, the LNP further comprises a pharmaceutically acceptable carrier or excipient.

[0092] In one embodiment of any LNP composition, method, or composition for use disclosed herein, the LNP composition comprises (i) an ionized lipid (e.g., an amino lipid), (ii) a sterol or other structural lipid, (iii) a noncationic helper lipid or phospholipid, and optionally (iv) a PEG lipid.

[0093] In one embodiment of any LNP composition, method, or composition for use disclosed herein, the LNP composition comprises an ionized lipid containing an aminolipid. In one embodiment, the ionized lipid comprises any compound of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg), (III), (IIIa1), (IIIa2), (IIIa3), (IIIa4), (IIIa5), (IIIa6), (IIIa7), or (IIIa8). In one embodiment, the ionized lipid comprises a compound of formula (I). In one embodiment, the ionized lipid comprises a compound of formula (IIa). In one embodiment, the ionized lipid comprises a compound of formula (IIe).

[0094] In one embodiment of any LNP composition, method, or composition for use disclosed herein, the LNP composition is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2 -Dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-Dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-Dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-Diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-Palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-Di-O-Octadecenyl-sn-glycero-3-phosphocholine (18:0 Diether PC), 1-oleoyl-2-cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-difytanol-sn-glycero-3-phosphoethanolamine (ME 16.0 The noncationic helper lipid or phospholipid comprises a compound selected from the group consisting of PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), sphingomyelin, and mixtures thereof. In one embodiment, the phospholipid is DSPC (e.g., a variant of DSPC, e.g., a compound of formula (IV)).

[0095] In one embodiment of any LNP composition, method, or composition for use disclosed herein, the LNP composition comprises a structural lipid. In one embodiment, the structural lipid is a phytosterol or a combination of phytosterol and cholesterol. In one embodiment, the phytosterol is selected from the group consisting of β-sitosterol, stigmasterol, β-sitostanol, campesterol, brassicasterol, and combinations thereof.

[0096] In one embodiment, the structural lipid may be selected from a group including, but not limited to, cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, tomatine, ursolic acid, alpha-tocopherol, hopanoids, phytosterols, steroids, and mixtures thereof. In some embodiments, the structural lipid is a sterol. As defined herein, “sterol” is a subgroup of steroids consisting of steroid alcohols. In certain embodiments, the structural lipid is a steroid. In certain embodiments, the structural lipid is cholesterol. In certain embodiments, the structural lipid is an analog of cholesterol. In certain embodiments, the structural lipid is alpha-tocopherol.

[0097] In one embodiment, the structural lipid is selected from β-sitosterol and cholesterol. In one embodiment, the structural lipid is β-sitosterol. In one embodiment, the structural lipid is cholesterol.

[0098] In one embodiment of any LNP composition, method, or composition for use disclosed herein, the LNP composition comprises a PEG lipid. In one embodiment, the PEG lipid is selected from the group consisting of PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol, and mixtures thereof.

[0099] In one embodiment, the PEG lipid is selected from the group consisting of PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol, and mixtures thereof. In one embodiment, the PEG lipid is selected from the group consisting of PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, and PEG-DSPE lipids. In one embodiment, the PEG lipid is PEG-DMG.

[0100] In one embodiment, the PEG lipid is selected from compounds of formula (V), formula (VI-A), formula (VI-B), formula (VI-C), or formula (VI-D). In one embodiment, the PEG lipid is a compound of formula (VI-A). In one embodiment, the PEG lipid is a compound of formula (VI-B). In one embodiment, the PEG lipid is a compound of formula (VI-C). In one embodiment, the PEG lipid is a compound of formula (VI-D).

[0101] In one embodiment of any LNP composition, method, or composition for use disclosed herein, the LNP comprises about 20 mol% to about 60 mol% of ionized lipids, about 5 mol% to about 25 mol% of noncationic helper lipids or phospholipids, about 25 mol% to about 55 mol% of sterols or other structural lipids, and about 0.5 mol% to about 15 mol% of PEG lipids. In one embodiment of the LNP or method of the present disclosure, the LNP comprises about 35 mol% to about 55 mol% of ionized lipids, about 5 mol% to about 25 mol% of noncationic helper lipids or phospholipids, about 30 mol% to about 40 mol% of sterols or other structural lipids, and about 0 mol% to about 10 mol% of PEG lipids. In one embodiment of the LNP or method of the present disclosure, the LNP comprises about 50 mol% ionized lipids, about 10 mol% noncationic helper lipids or phospholipids, about 38.5 mol% sterols or other structural lipids, and about 1.5 mol% PEG lipids. In one embodiment of the LNP or method of the present disclosure, the LNP comprises about 49.83 mol% ionized lipids, about 9.83 mol% noncationic helper lipids or phospholipids, about 30.33 mol% sterols or other structural lipids, and about 2.0 mol% PEG lipids.

[0102] In one embodiment of any LNP composition, method, or composition for use disclosed herein, the LNP contains about 45 mol% to about 50 mol% of ionized lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 45.5 mol% to about 49.5 mol% of ionized lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 46 mol% to about 49 mol% of ionized lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 46.5 mol% to about 48.5 mol% of ionized lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 47 mol% to about 48 mol% of ionized lipids.

[0103] In one embodiment of any LNP composition, method, or composition for use disclosed herein, the LNP contains about 45 mol% to about 49.5 mol% of ionized lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 45 mol% to about 49 mol% of ionized lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 45 mol% to about 48.5 mol% of ionized lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 45 mol% to about 48 mol% of ionized lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 45 mol% to about 47.5 mol% of ionized lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 45 mol% to about 47 mol% of ionized lipids. In one embodiment of the LNP or method of the present disclosure, the LNP contains about 45 mol% to about 46.5 mol% of ionized lipids. In one embodiment of the LNP or method of the present disclosure, the LNP contains about 45 mol% to about 46 mol% of ionized lipids. In one embodiment of the LNP or method of the present disclosure, the LNP contains about 45 mol% to about 45.5 mol% of ionized lipids.

[0104] In one embodiment of any LNP composition, method, or composition for use disclosed herein, the LNP contains about 45.5 mol% to about 50 mol% of ionized lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 46 mol% to about 50 mol% of ionized lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 46.5 mol% to about 50 mol% of ionized lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 47 mol% to about 50 mol% of ionized lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 47.5 mol% to about 50 mol% of ionized lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 48 mol% to about 50 mol% of ionized lipids. In one embodiment of the LNP or method of the present disclosure, the LNP contains about 48.5 mol% to about 50 mol% of ionized lipids. In one embodiment of the LNP or method of the present disclosure, the LNP contains about 49 mol% to about 50 mol% of ionized lipids. In one embodiment of the LNP or method of the present disclosure, the LNP contains about 49.5 mol% to about 50 mol% of ionized lipids.

[0105] In one embodiment of any LNP composition, method, or composition for use disclosed herein, the LNP contains about 45 mol% to about 46 mol% of ionized lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 45.5 mol% to about 46.5 mol% of ionized lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 46 mol% to about 47 mol% of ionized lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 46.5 mol% to about 47.5 mol% of ionized lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 47 mol% to about 48 mol% of ionized lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 47.5 mol% to about 48.5 mol% of ionized lipids. In one embodiment of the LNP or method of the present disclosure, the LNP contains about 48 mol% to about 49 mol% of ionized lipids. In one embodiment of the LNP or method of the present disclosure, the LNP contains about 48.5 mol% to about 49.5 mol% of ionized lipids. In one embodiment of the LNP or method of the present disclosure, the LNP contains about 49 mol% to about 50 mol% of ionized lipids.

[0106] In one embodiment of any LNP composition, method, or composition for use disclosed herein, the LNP contains about 45 mol% ionized lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 45.5 mol% ionized lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 46 mol% ionized lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 46.5 mol% ionized lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 47 mol% ionized lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 47.5 mol% ionized lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 48 mol% ionized lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 48.5 mol% ionized lipids. In one embodiment of the LNP or method of the present disclosure, the LNP contains about 49 mol% ionized lipids. In one embodiment of the LNP or method of the present disclosure, the LNP contains about 49.5 mol% ionized lipids. In one embodiment of the LNP or method of the present disclosure, the LNP contains about 50 mol% ionized lipids.

[0107] In one embodiment of any LNP composition, method, or composition for use disclosed herein, the LNP contains about 1 mol% to about 5 mol% of PEG lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 1.5 mol% to about 4.5 mol% of PEG lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 2 mol% to about 4 mol% of PEG lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 2.5 mol% to about 3.5 mol% of PEG lipids.

[0108] In one embodiment of any of the LNP compositions, methods, or compositions for use disclosed herein, the LNP contains about 1 mol% to about 4.5 mol% of PEG lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 1 mol% to about 4 mol% of PEG lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 1 mol% to about 3.5 mol% of PEG lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 1 mol% to about 3 mol% of PEG lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 1 mol% to about 2.5 mol% of PEG lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 1 mol% to about 2 mol% of PEG lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 1 mol% to about 1.5 mol% of PEG lipids.

[0109] In one embodiment of any of the LNP compositions, methods, or compositions for use disclosed herein, the LNP contains about 1.5 mol% to about 5 mol% of PEG lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 2 mol% to about 5 mol% of PEG lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 2.5 mol% to about 5 mol% of PEG lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 3 mol% to about 5 mol% of PEG lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 3.5 mol% to about 5 mol% of PEG lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 4 mol% to about 5 mol% of PEG lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 4.5 mol% to about 5 mol% of PEG lipids.

[0110] In one embodiment of the LNP or method of this disclosure, the LNP contains about 1 mol% to about 2 mol% of PEG lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 1.5 mol% to about 2.5 mol% of PEG lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 2 mol% to about 3 mol% of PEG lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 3.5 mol% to about 4.5 mol% of PEG lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 4 mol% to about 5 mol% of PEG lipids.

[0111] In one embodiment of any of the LNP compositions, methods, or compositions disclosed herein for use, the LNP contains about 1 mol% of PEG lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 1.5 mol% of PEG lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 2 mol% of PEG lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 2.5 mol% of PEG lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 3 mol% of PEG lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 3.5 mol% of PEG lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 4 mol% of PEG lipids. In one embodiment of the LNP or method of this disclosure, the LNP contains about 4.5 mol% of PEG lipids. In one embodiment of the LNP or method of the present disclosure, the LNP contains about 5 mol% of PEG lipids.

[0112] In one embodiment, the mol% of sterols or other structural lipids is 18.5% phytosterols, and the total mol% of structural lipids is 38.5%.

[0113] In one embodiment of the LNP or method of the present disclosure, the LNP comprises about 50 mol% of the compound of formula (IIa) and about 10 mol% of a noncationic helper lipid or phospholipid. In one embodiment of the LNP or method of the present disclosure, the LNP comprises 50 mol% of the compound of formula (IIa) and about 10 mol% of a noncationic helper lipid or phospholipid. In one embodiment of the LNP or method of the present disclosure, the LNP comprises about 50 mol% of the compound of formula (IIa) and 10 mol% of a noncationic helper lipid or phospholipid. In one embodiment of the LNP or method of the present disclosure, the LNP comprises 50 mol% of the compound of formula (IIa) and 10 mol% of a noncationic helper lipid or phospholipid. In one embodiment of the LNP or method of the present disclosure, the LNP comprises about 49.83 mol% of the compound of formula (IIa), about 9.83 mol% of a noncationic helper lipid or phospholipid, about 30.33 mol% of a sterol or other structural lipid, and about 2.0 mol% of a PEG lipid.

[0114] In one embodiment of the LNP or method of the present disclosure, the LNP comprises about 50 mol% of the compound of formula (IIe) and about 10 mol% of a noncationic helper lipid or phospholipid. In one embodiment of the LNP or method of the present disclosure, the LNP comprises 50 mol% of the compound of formula (IIe) and about 10 mol% of a noncationic helper lipid or phospholipid. In one embodiment of the LNP or method of the present disclosure, the LNP comprises about 50 mol% of the compound of formula (IIe) and 10 mol% of a noncationic helper lipid or phospholipid. In one embodiment of the LNP or method of the present disclosure, the LNP comprises 50 mol% of the compound of formula (IIe) and 10 mol% of a noncationic helper lipid or phospholipid. In one embodiment of the LNP or method of the present disclosure, the LNP comprises about 49.83 mol% of the compound of formula (IIe), about 9.83 mol% of a noncationic helper lipid or phospholipid, about 30.33 mol% of a sterol or other structural lipid, and about 2.0 mol% of a PEG lipid.

[0115] In one embodiment of any LNP composition, method, or composition for use disclosed herein, the LNP is formulated for intravenous, subcutaneous, intramuscular, intraocular, intranasal, rectal, pulmonary, or oral delivery. In one embodiment, the LNP is formulated for intravenous delivery. In one embodiment, the LNP is formulated for subcutaneous delivery. In one embodiment, the LNP is formulated for intramuscular delivery. In one embodiment, the LNP is formulated for intraocular delivery. In one embodiment, the LNP is formulated for intranasal delivery. In one embodiment, the LNP is formulated for rectal delivery. In one embodiment, the LNP is formulated for pulmonary delivery. In one embodiment, the LNP is formulated for oral delivery.

[0116] In one embodiment of any method or composition for use disclosed herein, the subject is a mammal (e.g., human).

[0117] Further characteristics of either the aforementioned LNP composition or the method of using the LNP composition include one or more of the embodiments listed below. Those skilled in the art will recognize or confirm numerous equivalents to specific embodiments of the invention described herein simply by performing ordinary experiments. Such equivalents are intended to be encompassed by the embodiments listed below.

[0118] Other embodiments of this disclosure 1. A polynucleotide that codes for a polypeptide, (a) 5'UTR containing the sequence of sequence number 1 or a variant or fragment thereof, (b) Code regions including a termination element (for example, as described herein), and (c) The polynucleotide comprising 3'UTR (for example, as described herein).

[0119] 2. The 5'UTR is the nucleic acid sequence of formula A: GGAAAUCGCAAAA(N2) X (N3) X CU(N4) X(N5) X CGCGUUAGAUUUCUUUUAGUUUUCUN6N7CAACUAGCAAGCUUUUUGUUCUCGCC(N8CC)x (Sequence ID 46) is included in the formula, (N2) x is uracil, and x is an integer between 0 and 5 (for example, x = 3 or 4); (N3) x x is guanine, and x is an integer between 0 and 1; (N4) x x is cytosine, and x is an integer between 0 and 1; (N5) x is uracil, and x is an integer between 0 and 5 (for example, x = 2 or 3); N6 is either uracil or cytosine; N7 is uracil or guanine; and / or The polynucleotide according to Embodiment 1, wherein N8 is adenine or guanine, and x is an integer between 0 and 1.

[0120] 3. The polynucleotide according to Embodiment 1, wherein a variant of SEQ ID NO: 1 comprises a sequence or fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 1) that is at least 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 1.

[0121] 4. The polynucleotide according to Embodiment 1 or 3, wherein the variant of Sequence ID No. 1 comprises a uridine content of at least 30%, 40%, 50%, 60%, 70%, or 80%.

[0122] 5. The variant of Sequence ID No. 1 is a polynucleotide according to Embodiment 1 or any one of Embodiments 3-4, comprising at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 consecutive uridines (e.g., polyuridine tracts).

[0123] 6. The polynucleotide according to Embodiment 5, wherein the polyuridine tract in the variant of Sequence ID No. 1 contains at least 2-12, 2-11, 2-10, 2-9, 2-8, 2-7, 2-6, 2-5, 2-4, 2-3, 3-12, 4-12, 5-12, 6-12, 7-12, 8-12, 9-12, 10-12, 11-12, 2-6, or 3-5 consecutive uridines.

[0124] 7. The polyuridine tract in the variant of Sequence ID No. 1 is a polynucleotide according to Embodiment 1 or any one of Embodiments 3 to 6, comprising four consecutive uridines.

[0125] 8. The polyuridine tract in the variant of Sequence ID No. 1 is a polynucleotide according to Embodiment 1 or any one of Embodiments 3 to 7, comprising five consecutive uridine units.

[0126] 9. The variant of Sequence ID No. 1 is a polynucleotide according to any one of Embodiments 1 or 3-8, comprising the polyuridine tract of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15.

[0127] 10. The variant of Sequence ID No. 1 is the polynucleotide according to Embodiment 9, comprising three polyuridine tracts.

[0128] 11. The variant of Sequence ID No. 1 is the polynucleotide according to Embodiment 9, comprising four polyuridine tracts.

[0129] 12. The variant of Sequence ID No. 1 is the polynucleotide according to Embodiment 9, comprising five polyuridine tracts.

[0130] 13. The polynucleotide according to any one of Embodiments 1 or 3 to 12, wherein one or more of the polyuridine tracts are adjacent to different polyuridine tracts.

[0131] 14. The polynucleotide according to any one of Embodiments 1 or 3 to 13, wherein each (e.g., all) of the polyuridine tracts are adjacent to each other (e.g., all of the polyuridine tracts are contiguous).

[0132] 15. The polynucleotide according to Embodiment 1 or any one of Embodiments 3-14, wherein one or more of the polyuridine tracts are separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 2, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, or 60 nucleotides.

[0133] 16. The polynucleotide according to Embodiment 1 or any one of Embodiments 3-15, wherein each (e.g., all) of the polyuridine tracts is separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 2, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, or 60 nucleotides.

[0134] 17. The polynucleotide according to Embodiment 1 or any one of Embodiments 3 to 16, wherein the first polyuridine tract and the second polyuridine tract are adjacent to each other.

[0135] 18. The polynucleotide according to Embodiment 17, wherein a subsequent polyuridine tract (e.g., a third, fourth, fifth, sixth, or seventh, eighth, ninth, or tenth) is separated from any one of the first polyuridine tract, the second polyuridine tract, or the subsequent polyuridine tract by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 2, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, or 60 nucleotides.

[0136] 19. The polynucleotide according to Embodiment 1 or any one of Embodiments 3 to 18, wherein the first polyuridine tract is separated from a subsequent polyuridine tract (e.g., the second, third, fourth, fifth, sixth, or seventh, eighth, ninth, or tenth polyuridine tract) by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 2, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, or 60 nucleotides.

[0137] 20. The polynucleotide according to Embodiment 19, wherein one or more of the subsequent polyuridine tracts are adjacent to different polyuridine tracts.

[0138] 21. The 5'UTR is a polynucleotide according to any one of the prior embodiments, comprising a Kozak sequence (e.g., GCCRCC nucleotide sequence (SEQ ID NO: 43), where R is adenine or guanine).

[0139] 22. The polynucleotide according to Embodiment 21, wherein the Kozak sequence is located at the 3' end of the 5'UTR sequence.

[0140] 23. The polynucleotide according to any one of the prior embodiments, wherein the 5'UTR comprises the sequence of SEQ ID NO: 1 or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 1.

[0141] 24. The polynucleotide according to Embodiment 23, wherein the 5'UTR comprises the sequence of Sequence ID No. 1.

[0142] 25. The polynucleotide according to any one of the prior embodiments, wherein the 5'UTR comprises the sequence of SEQ ID NO: 41 or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 41 (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 41).

[0143] 26. The polynucleotide according to Embodiment 25, wherein the 5'UTR comprises the sequence of SEQ ID NO: 41 or a fragment thereof lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 41.

[0144] 27. The polynucleotide according to any one of the prior embodiments, wherein the 5'UTR comprises the sequence of SEQ ID NO: 42 or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 42 (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 42).

[0145] 28. The polynucleotide according to Embodiment 27, wherein the 5'UTR comprises the sequence of SEQ ID NO: 42 or a fragment thereof lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 42.

[0146] 29. The polynucleotide according to any one of the prior embodiments, wherein the 5'UTR increases the half-life of the polynucleotide (for example, the half-life of the polynucleotide increases by approximately 1.5 to 20 times).

[0147] 30. The polynucleotide according to Embodiment 29, wherein the increase in the half-life of the polynucleotide is compared with other similar polynucleotides that do not have a 5'UTR, have a different 5'UTR, or do not have a 5'UTR as described in any one of Embodiments 1 to 28.

[0148] 31. The polynucleotide according to any one of Embodiments 29 to 30, wherein the increase in the half-life of the polynucleotide is measured according to an assay for measuring the half-life of the polynucleotide (for example, the assay described in any one of the examples disclosed herein).

[0149] 32. The polynucleotide according to any one of the prior embodiments, wherein the 5'UTR increases the level and / or activity (e.g., production) of the polypeptide encoded by the polynucleotide.

[0150] 33. The polynucleotide according to Embodiment 32, wherein the 5'UTR increases the level and / or activity (e.g., production) of the polypeptide encoded by the polynucleotide by about 1.5 to 20 times.

[0151] 34. The polynucleotide according to Embodiment 32 or 33, wherein the increase in the level and / or activity (e.g., production) of the polypeptide encoded by the polynucleotide is compared with other similar polynucleotides having no 5'UTR, having a different 5'UTR, or having no 5'UTR as described in any one of Embodiments 1 to 28.

[0152] 35. The polynucleotide according to any one of embodiments 32 to 34, wherein the increase in the level and / or activity (e.g., production) of the polypeptide encoded by the polynucleotide is measured according to an assay that measures the level and / or activity of the polypeptide (e.g., the assay described in any one of the examples disclosed herein).

[0153] 36. The polynucleotide according to Embodiment 35, wherein the 5'UTR increases the activity of the polypeptide encoded by the polynucleotide (for example, by about 1.2 to 10 times).

[0154] 37. The polynucleotide according to Embodiment 36, wherein the increase in activity is compared with other similar polynucleotides that do not have a 5'UTR, have a different 5'UTR, or do not have a 5'UTR as described in any one of Embodiments 1 to 28.

[0155] 38. The polynucleotide according to Embodiment 36 or 37, wherein the increase in the level of the polypeptide encoded by the polynucleotide is measured according to an assay for measuring the level of the polypeptide (for example, the assay described in any one of the examples disclosed herein).

[0156] 39. A polynucleotide that codes for a polypeptide, (a) A 5'UTR containing the sequence of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 88, SEQ ID NO: 89 or SEQ ID NO: 90, or a variant or fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides in any of the aforementioned sequences), (b) A chord region containing a terminating element, and (c)3'UTR included, The 5'UTR is the polynucleotide comprising at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 consecutive uridines (e.g., polyuridine tracts).

[0157] 40. The polynucleotide according to Embodiment 39, wherein the 5'UTR includes a variant of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, or SEQ ID NO: 8, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 88, SEQ ID NO: 89, or SEQ ID NO: 90.

[0158] 41. The polynucleotide according to Embodiment 40, wherein the 5'UTR variant comprises a sequence or fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides in any of the aforementioned sequences) that is at least 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, or SEQ ID NO: 8, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 88, SEQ ID NO: 89, or SEQ ID NO: 90.

[0159] 42. The polynucleotide according to Embodiment 40 or 41, wherein the 5'UTR variant comprises at least 30%, 40%, 50%, 60%, 70%, or 80% uridine content.

[0160] 43. The polynucleotide according to any one of embodiments 40 to 42, wherein the 5'UTR variant comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 consecutive uridines (e.g., a polyuridine tract).

[0161] 44. The polynucleotide according to Embodiment 43, wherein the polyuridine tract in the 5'UTR variant contains at least 2-12, 2-11, 2-10, 2-9, 2-8, 2-7, 2-6, 2-5, 2-4, 2-3, 3-12, 4-12, 5-12, 6-12, 7-12, 8-12, 9-12, 10-12, 11-12, 2-6, or 3-5 consecutive uridines.

[0162] 45. The polyuridine tract in the 5'UTR variant comprises four consecutive uridine molecules, the polynucleotide according to any one of embodiments 40 to 44.

[0163] 46. ​​The polyuridine tract in the 5'UTR variant comprises five consecutive uridine molecules, the polynucleotide according to any one of embodiments 40 to 44.

[0164] 47. The 5'UTR variant comprises a polynucleotide according to any one of embodiments 40 to 46, wherein the 5'UTR variant comprises a polyuridine tract of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15.

[0165] 48. The 5'UTR variant is a polynucleotide according to Embodiment 47, comprising three polyuridine tracts.

[0166] 49. The 5'UTR variant is the polynucleotide according to Embodiment 47, comprising four polyuridine tracts.

[0167] 50. The polynucleotide according to Embodiment 47, wherein the 5'UTR variant comprises five polyuridine tracts.

[0168] 51. A polynucleotide according to any one of Embodiments 40 to 50, wherein one or more of the polyuridine tracts are adjacent to different polyuridine tracts.

[0169] 52. The polynucleotide according to any one of Embodiments 40 to 51, wherein each (e.g., all) of the polyuridine tracts are adjacent to each other (e.g., all of the polyuridine tracts are contiguous).

[0170] 53. The polynucleotide according to any one of embodiments 40 to 52, wherein one or more of the polyuridine tracts are separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 2, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, or 60 nucleotides.

[0171] 54. The polynucleotide according to any one of embodiments 40 to 53, wherein each (e.g., all) of the polyuridine tracts is separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 2, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, or 60 nucleotides.

[0172] 55. A polynucleotide according to any one of embodiments 40 to 54, wherein the first polyuridine tract and the second polyuridine tract are adjacent to each other.

[0173] 56. The polynucleotide according to Embodiment 55, wherein a subsequent polyuridine tract (e.g., a third, fourth, fifth, sixth, or seventh, eighth, ninth, or tenth) is separated from any one of the first polyuridine tract, the second polyuridine tract, or the subsequent polyuridine tract by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 2, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, or 60 nucleotides.

[0174] 57. The polynucleotide according to any one of embodiments 40 to 56, wherein the first polyuridine tract is separated from a subsequent polyuridine tract (e.g., the second, third, fourth, fifth, sixth, or seventh, eighth, ninth, or tenth polyuridine tract) by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 2, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, or 60 nucleotides.

[0175] 58. The polynucleotide according to Embodiment 57, wherein one or more of the subsequent polyuridine tracts are adjacent to different polyuridine tracts.

[0176] 59. The polynucleotide according to any one of Embodiments 39 to 58, wherein the 5'UTR comprises a Kozak sequence (e.g., GCCRCC nucleotide sequence (SEQ ID NO: 43), where R is adenine or guanine).

[0177] 60. The polynucleotide according to Embodiment 59, wherein the Kozak sequence is located at the 3' end of the 5'UTR sequence.

[0178] 61. The polynucleotide according to any one of embodiments 39 to 60, wherein the 5'UTR comprises the sequence of SEQ ID NO: 2 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 2).

[0179] 62. The polynucleotide according to any one of embodiments 39 to 60, wherein the 5'UTR comprises the sequence of SEQ ID NO: 3 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 3).

[0180] 63. The polynucleotide according to any one of embodiments 39 to 60, wherein the 5'UTR comprises the sequence of SEQ ID NO: 4 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 4).

[0181] 64. The polynucleotide according to any one of embodiments 39 to 60, wherein the 5'UTR comprises the sequence of SEQ ID NO: 5 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 5).

[0182] 65. The polynucleotide according to any one of embodiments 39 to 60, wherein the 5'UTR comprises the sequence of SEQ ID NO: 6 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 6).

[0183] 66. The polynucleotide according to any one of embodiments 39 to 60, wherein the 5'UTR comprises the sequence of SEQ ID NO: 8 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 8).

[0184] 67. The polynucleotide according to any one of embodiments 39 to 60, wherein the 5'UTR comprises the sequence of SEQ ID NO: 41 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 41).

[0185] 68. The polynucleotide according to any one of embodiments 39 to 60, wherein the 5'UTR comprises the sequence of SEQ ID NO: 42 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 42).

[0186] 69. The polynucleotide according to any one of embodiments 39 to 60, wherein the 5'UTR comprises the sequence of SEQ ID NO: 63 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 63).

[0187] 70. The polynucleotide according to any one of embodiments 39 to 60, wherein the 5'UTR comprises the sequence of SEQ ID NO: 64 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 64).

[0188] 71. The polynucleotide according to any one of embodiments 39 to 60, wherein the 5'UTR comprises the sequence of SEQ ID NO: 65 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 65).

[0189] 72. The polynucleotide according to any one of embodiments 39 to 60, wherein the 5'UTR comprises the sequence of SEQ ID NO: 66 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 66).

[0190] 73. The polynucleotide according to any one of embodiments 39 to 60, wherein the 5'UTR comprises the sequence of SEQ ID NO: 67 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 67).

[0191] 74. The polynucleotide according to any one of embodiments 39 to 60, wherein the 5'UTR comprises the sequence of SEQ ID NO: 68 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 68).

[0192] 75. The polynucleotide according to any one of embodiments 39 to 60, wherein the 5'UTR comprises the sequence of SEQ ID NO: 69 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 69).

[0193] 76. The polynucleotide according to any one of embodiments 39 to 60, wherein the 5'UTR comprises the sequence of SEQ ID NO: 70 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 70).

[0194] 77. The polynucleotide according to any one of embodiments 39 to 60, wherein the 5'UTR comprises the sequence of SEQ ID NO: 70 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 70).

[0195] 78. The polynucleotide according to any one of embodiments 39 to 60, wherein the 5'UTR comprises the sequence of SEQ ID NO: 71 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 71).

[0196] 79. The polynucleotide according to any one of embodiments 39 to 60, wherein the 5'UTR comprises the sequence of sequence number 72 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of sequence number 72).

[0197] 80. The polynucleotide according to any one of embodiments 39 to 60, wherein the 5'UTR comprises the sequence of SEQ ID NO: 73 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 73).

[0198] 81. The polynucleotide according to any one of embodiments 39 to 60, wherein the 5'UTR comprises the sequence of SEQ ID NO: 74 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 74).

[0199] 82. The polynucleotide according to any one of embodiments 39 to 60, wherein the 5'UTR comprises the sequence of SEQ ID NO: 75 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 75).

[0200] 83. The polynucleotide according to any one of embodiments 39 to 60, wherein the 5'UTR comprises the sequence of SEQ ID NO: 76 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 76).

[0201] 84. The polynucleotide according to any one of embodiments 39 to 60, wherein the 5'UTR comprises the sequence of SEQ ID NO: 77 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 77).

[0202] 85. The polynucleotide according to any one of embodiments 39 to 60, wherein the 5'UTR comprises the sequence of SEQ ID NO: 78 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 78).

[0203] 86. The polynucleotide according to any one of embodiments 39 to 60, wherein the 5'UTR comprises the sequence of sequence number 88 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of sequence number 88).

[0204] 87. The polynucleotide according to any one of embodiments 39 to 60, wherein the 5'UTR comprises the sequence of sequence number 89 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of sequence number 89).

[0205] 88. The polynucleotide according to any one of embodiments 39 to 60, wherein the 5'UTR comprises the sequence of sequence number 90 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of sequence number 90).

[0206] 89. The polynucleotide according to any one of embodiments 39 to 88, wherein the half-life of the polynucleotide is increased by approximately 1.5 to 20 times due to the 5'UTR.

[0207] 90. The polynucleotide according to Embodiment 89, wherein the 5'UTR increases the level and / or activity (e.g., production) of the polypeptide encoded by the polynucleotide.

[0208] 91. The polynucleotide according to any one of the prior embodiments, wherein the code region of (b) above includes a termination element selected from the termination elements shown in Table 3 (for example, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 62, SEQ ID NO: 93, or SEQ ID NO: 96).

[0209] 92. The polynucleotide according to Embodiment 91, wherein the termination element includes the sequence of Sequence ID No. 26.

[0210] 93. The polynucleotide according to Embodiment 91, wherein the termination element includes the sequence of Sequence ID No. 27.

[0211] 94. The polynucleotide according to Embodiment 91, wherein the termination element includes the sequence of Sequence ID No. 28.

[0212] 95. The polynucleotide according to Embodiment 91, wherein the termination element includes the sequence of Sequence ID No. 29.

[0213] 96. The polynucleotide according to Embodiment 91, wherein the termination element includes the sequence of Sequence ID No. 30.

[0214] 97. The polynucleotide according to Embodiment 91, wherein the termination element includes the sequence of Sequence ID No. 31.

[0215] 98. The polynucleotide according to Embodiment 91, wherein the termination element includes the sequence of Sequence ID No. 32.

[0216] 99. The polynucleotide according to Embodiment 91, wherein the termination element includes the sequence of Sequence ID No. 33.

[0217] 100. The polynucleotide according to Embodiment 91, wherein the termination element includes the sequence of Sequence ID No. 34.

[0218] 101. The polynucleotide according to Embodiment 91, wherein the termination element includes the sequence of Sequence ID No. 35.

[0219] 102. The polynucleotide according to Embodiment 91, wherein the termination element includes the sequence of Sequence ID No. 36.

[0220] 103. The polynucleotide according to Embodiment 91, wherein the termination element includes the sequence of Sequence ID No. 62.

[0221] 104. The polynucleotide according to Embodiment 91, wherein the termination element includes the sequence of Sequence ID No. 93.

[0222] 105. The polynucleotide according to Embodiment 91, wherein the termination element includes the sequence of Sequence ID No. 96.

[0223] 106. The polynucleotide according to Embodiment 91, wherein the coding region of (b) comprises a stop element containing the consensus sequence of SEQ ID NO: 37, SEQ ID NO: 56, or SEQ ID NO: 57.

[0224] 107. A polynucleotide according to any one of Embodiments 1 to 90, wherein the 3'UTR in (c) comprises a 3'UTR sequence shown in Table 2 or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a 3'UTR sequence shown in Table 2 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of a 3'UTR sequence shown in Table 2), The polynucleotide optionally includes a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequences shown in Table 4.

[0225] 108. A polynucleotide according to Embodiment 107, wherein the 3'UTR comprises a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 45, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 87, SEQ ID NO: 94, or SEQ ID NO: 95 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides in any of the aforementioned sequences), The polynucleotide optionally comprises a sequence, variant or fragment thereof, that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any of sequence numbers 47, 48, 49, 50, 122, 52, 53, 54, 55, 59, 60, 61, 126, 127, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, or 120.

[0226] 109. The polynucleotide according to Embodiment 107 or 108, wherein the 3'UTR comprises the sequence of SEQ ID NO: 11, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 11 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 11).

[0227] 110. The polynucleotide according to Embodiment 107 or 108, wherein the 3'UTR comprises the sequence of SEQ ID NO: 12, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 12 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 12).

[0228] 111. The polynucleotide according to Embodiment 107 or 108, wherein the 3'UTR comprises the sequence of SEQ ID NO: 13, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 13 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 13).

[0229] 112. The polynucleotide according to Embodiment 107 or 108, wherein the 3'UTR comprises the sequence of SEQ ID NO: 14, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 14 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 14).

[0230] 113. The polynucleotide according to Embodiment 107 or 108, wherein the 3'UTR comprises the sequence of SEQ ID NO: 15, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 15 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 15).

[0231] 114. The polynucleotide according to Embodiment 107 or 108, wherein the 3'UTR comprises the sequence of SEQ ID NO: 16, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 16 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 16).

[0232] 115. The polynucleotide according to Embodiment 107 or 108, wherein the 3'UTR comprises the sequence of SEQ ID NO: 17, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 17 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 17).

[0233] 116. The polynucleotide according to Embodiment 107 or 108, wherein the 3'UTR comprises the sequence of SEQ ID NO: 18, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 18 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 18).

[0234] 117. The polynucleotide according to Embodiment 107 or 108, wherein the 3'UTR comprises the sequence of SEQ ID NO: 19, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 19 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 19).

[0235] 118. The polynucleotide according to Embodiment 107 or 108, wherein the 3'UTR comprises a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 21, or to SEQ ID NO: 20 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 20).

[0236] 119. The polynucleotide according to Embodiment 107 or 108, wherein the 3'UTR comprises the sequence of SEQ ID NO: 21, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 21 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 21).

[0237] 120. The polynucleotide according to Embodiment 107 or 108, wherein the 3'UTR comprises the sequence of SEQ ID NO: 22, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 22 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 22).

[0238] 121. The polynucleotide according to Embodiment 107 or 108, wherein the 3'UTR comprises the sequence of SEQ ID NO: 23, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 23 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 23).

[0239] 122. The polynucleotide according to Embodiment 107 or 108, wherein the 3'UTR comprises the sequence of SEQ ID NO: 24, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 24 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 24).

[0240] 123. The polynucleotide according to Embodiment 107 or 108, wherein the 3'UTR comprises the sequence of SEQ ID NO: 25, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 25 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 25).

[0241] 124. The polynucleotide according to Embodiment 107 or 108, wherein the 3'UTR comprises the sequence of SEQ ID NO: 45, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 45 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 45).

[0242] 125. The polynucleotide according to Embodiment 107 or 108, wherein the 3'UTR comprises the sequence of SEQ ID NO: 79, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 79 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 79).

[0243] 126. The polynucleotide according to Embodiment 107 or 108, wherein the 3'UTR comprises the sequence of SEQ ID NO: 80, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 80 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 80).

[0244] 127. The polynucleotide according to Embodiment 107 or 108, wherein the 3'UTR comprises the sequence of SEQ ID NO: 81, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 81 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 81).

[0245] 128. The polynucleotide according to Embodiment 107 or 108, wherein the 3'UTR comprises the sequence of SEQ ID NO: 82, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 82 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 82).

[0246] 129. The polynucleotide according to Embodiment 107 or 108, wherein the 3'UTR comprises the sequence of SEQ ID NO: 83, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 83 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 83).

[0247] 130. The polynucleotide according to Embodiment 107 or 108, wherein the 3'UTR comprises the sequence of SEQ ID NO: 84, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 84 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 84).

[0248] 131. The polynucleotide according to Embodiment 107 or 108, wherein the 3'UTR comprises the sequence of SEQ ID NO: 85, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 85 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 85).

[0249] 132. The polynucleotide according to Embodiment 107 or 108, wherein the 3'UTR comprises the sequence of SEQ ID NO: 86, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 86 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 86).

[0250] 133. The polynucleotide according to Embodiment 107 or 108, wherein the 3'UTR comprises the sequence of SEQ ID NO: 87, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 87 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 87).

[0251] 134. The polynucleotide according to Embodiment 107 or 108, wherein the 3'UTR comprises the sequence of SEQ ID NO: 94, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 94 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 94).

[0252] 135. The polynucleotide according to Embodiment 107 or 108, wherein the 3'UTR comprises the sequence of SEQ ID NO: 95, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 95 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 95).

[0253] 136. The polynucleotide according to Embodiment 107 or 108, wherein the 3'UTR comprises a microRNA (miRNA) binding site (e.g., as described herein) and / or a TENT recruitment sequence (e.g., as described herein).

[0254] 137. The polynucleotide according to Embodiment 136, wherein the miRNA binding site comprises one of the sequences of SEQ ID NOs. 38 to 40, and / or the TENT recruitment sequence comprises the sequence of SEQ ID NO. 91 or 92.

[0255] 138. A polynucleotide according to any one of Embodiments 1 to 90, (i) The code region in (b) above includes a termination element selected from the termination elements shown in Table 3 (for example, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 62, SEQ ID NO: 93 or SEQ ID NO: 96), and (ii) The 3'UTR in (c) above includes a 3'UTR sequence shown in Table 2 or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the 3'UTR sequence shown in Table 2 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of the 3'UTR sequence shown in Table 2), The polynucleotide optionally comprises a sequence, variant or fragment thereof, that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any of the sequences shown in Table 4 (e.g., sequence numbers 47, 48, 49, 50, 122, 52, 53, 54, 55, 59, 60, 61, 126, 127, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, or 120).

[0256] 139. The polynucleotide according to Embodiment 138, wherein the termination element comprises the sequence of Sequence ID No. 26.

[0257] 140. The polynucleotide according to Embodiment 138, wherein the termination element includes the sequence of Sequence ID No. 27.

[0258] 141. The polynucleotide according to Embodiment 138, wherein the termination element includes the sequence of Sequence ID No. 28.

[0259] 142. The polynucleotide according to Embodiment 138, wherein the termination element includes the sequence of Sequence ID No. 29.

[0260] 143. The polynucleotide according to Embodiment 138, wherein the termination element includes the sequence of Sequence ID No. 30.

[0261] 144. The polynucleotide according to Embodiment 138, wherein the termination element includes the sequence of Sequence ID No. 31.

[0262] 145. The polynucleotide according to Embodiment 138, wherein the termination element includes the sequence of Sequence ID No. 32.

[0263] 146. The polynucleotide according to Embodiment 138, wherein the termination element comprises the sequence of Sequence ID No. 33.

[0264] 147. The polynucleotide according to Embodiment 138, wherein the termination element includes the sequence of Sequence ID No. 34.

[0265] 148. The polynucleotide according to Embodiment 138, wherein the termination element comprises the sequence of Sequence ID No. 35.

[0266] 149. The polynucleotide according to Embodiment 138, wherein the termination element includes the sequence of Sequence ID No. 36.

[0267] 150. The polynucleotide according to Embodiment 138, wherein the termination element includes the sequence of Sequence ID No. 37.

[0268] 151. The polynucleotide according to Embodiment 138, wherein the termination element includes the sequence of Sequence ID No. 56.

[0269] 152. The polynucleotide according to Embodiment 138, wherein the termination element comprises the sequence of Sequence ID No. 57.

[0270] 153. The polynucleotide according to Embodiment 138, wherein the termination element comprises the sequence of Sequence ID No. 62.

[0271] 154. The polynucleotide according to Embodiment 138, wherein the termination element includes the sequence of Sequence ID No. 93.

[0272] 155. The polynucleotide according to Embodiment 138, wherein the termination element comprises the sequence of Sequence ID No. 96.

[0273] 156. The polynucleotide according to Embodiment 139, wherein the coding region of (b) includes a stop element containing the consensus sequence of Sequence ID No. 37.

[0274] 157. The polynucleotide according to any one of embodiments 139 to 156, wherein the 3'UTR comprises the sequence of SEQ ID NO: 11, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 11 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 11).

[0275] 158. The polynucleotide according to any one of embodiments 139 to 156, wherein the 3'UTR comprises the sequence of SEQ ID NO: 12, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 12 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 12).

[0276] 159. The polynucleotide according to any one of embodiments 139 to 156, wherein the 3'UTR comprises the sequence of SEQ ID NO: 13, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 13 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 13).

[0277] 160. The polynucleotide according to any one of Embodiments 139 to 156, wherein the 3'UTR comprises the sequence of SEQ ID NO: 14, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 14 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 14).

[0278] 161. The polynucleotide according to any one of Embodiments 139 to 156, wherein the 3'UTR comprises the sequence of SEQ ID NO: 15, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 15 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 15).

[0279] 162. The polynucleotide according to any one of Embodiments 139 to 156, wherein the 3'UTR comprises the sequence of SEQ ID NO: 16, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 16 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 16).

[0280] 163. The polynucleotide according to any one of Embodiments 139 to 156, wherein the 3'UTR comprises the sequence of SEQ ID NO: 17, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 17 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 17).

[0281] 164. The polynucleotide according to any one of Embodiments 139 to 156, wherein the 3'UTR comprises the sequence of SEQ ID NO: 18, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 18 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 18).

[0282] 165. The polynucleotide according to any one of Embodiments 139 to 156, wherein the 3'UTR comprises the sequence of SEQ ID NO: 19, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 19 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 19).

[0283] 166. The polynucleotide according to any one of Embodiments 139 to 156, wherein the 3'UTR comprises the sequence of SEQ ID NO: 21, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 20 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 20).

[0284] 167. The polynucleotide according to any one of Embodiments 139 to 156, wherein the 3'UTR comprises the sequence of SEQ ID NO: 21, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 21 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 21).

[0285] 168. The polynucleotide according to any one of Embodiments 139 to 156, wherein the 3'UTR comprises the sequence of SEQ ID NO: 22, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 22 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 22).

[0286] 169. The polynucleotide according to any one of Embodiments 139 to 156, wherein the 3'UTR comprises the sequence of SEQ ID NO: 23, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 23 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 23).

[0287] 170. The polynucleotide according to any one of Embodiments 139 to 156, wherein the 3'UTR comprises the sequence of SEQ ID NO: 24, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 24 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 24).

[0288] 171. The polynucleotide according to any one of Embodiments 139 to 156, wherein the 3'UTR comprises the sequence of SEQ ID NO: 25, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 25 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 25).

[0289] 172. The polynucleotide according to any one of Embodiments 139 to 156, wherein the 3'UTR comprises the sequence of SEQ ID NO: 45, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 45 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 45).

[0290] 173. The polynucleotide according to any one of Embodiments 139 to 156, wherein the 3'UTR comprises the sequence of SEQ ID NO: 79, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 79 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 79).

[0291] 174. The polynucleotide according to any one of Embodiments 139 to 156, wherein the 3'UTR comprises the sequence of SEQ ID NO: 80, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 80 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 80).

[0292] 175. The polynucleotide according to any one of Embodiments 139 to 156, wherein the 3'UTR comprises the sequence of SEQ ID NO: 81, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 81 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 81).

[0293] 176. The polynucleotide according to any one of Embodiments 139 to 156, wherein the 3'UTR comprises the sequence of SEQ ID NO: 82, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 82 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 82).

[0294] 177. The polynucleotide according to any one of Embodiments 139 to 156, wherein the 3'UTR comprises the sequence of SEQ ID NO: 83, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 83 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 83).

[0295] 178. The polynucleotide according to any one of Embodiments 139 to 156, wherein the 3'UTR comprises the sequence of SEQ ID NO: 84, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 84 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 84).

[0296] 179. The polynucleotide according to any one of Embodiments 139 to 156, wherein the 3'UTR comprises the sequence of SEQ ID NO: 85, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 85 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 85).

[0297] 180. The polynucleotide according to any one of Embodiments 139 to 156, wherein the 3'UTR comprises the sequence of SEQ ID NO: 86, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 86 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 86).

[0298] 181. The polynucleotide according to any one of Embodiments 139 to 156, wherein the 3'UTR comprises the sequence of SEQ ID NO: 87, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 87 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 87).

[0299] 182. The polynucleotide according to any one of Embodiments 139 to 156, wherein the 3'UTR comprises the sequence of SEQ ID NO: 94, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 94 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 94).

[0300] 183. The polynucleotide according to any one of Embodiments 139 to 156, wherein the 3'UTR comprises the sequence of SEQ ID NO: 95, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 95 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 95).

[0301] 184. The polynucleotide according to any one of Embodiments 139 to 156, wherein the 3'UTR comprises a microRNA binding site (e.g., as described herein) and / or a TENT recruitment sequence (e.g., as described herein).

[0302] 185. The polynucleotide according to Embodiment 184, wherein the miRNA binding site comprises one of the sequences of SEQ ID NOs. 38 to 40, and / or the TENT recruit sequence comprises the sequence of SEQ ID NO. 91 or 92.

[0303] 186. A polynucleotide that codes for a polypeptide, (a) 5'UTR (for example, as described herein), (b) A code region containing a terminating element selected from the terminating elements shown in Table 3, and (c) The polynucleotide comprising 3'UTR (for example, as described herein).

[0304] 187. The polynucleotide according to Embodiment 186, wherein the termination element comprises the sequence of SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 62, SEQ ID NO: 93, or SEQ ID NO: 96.

[0305] 188. The polynucleotide according to Embodiment 186, wherein the termination element comprises the sequence of Sequence ID No. 26.

[0306] 189. The polynucleotide according to Embodiment 186, wherein the termination element includes the sequence of Sequence ID No. 27.

[0307] 190. The polynucleotide according to Embodiment 186, wherein the termination element comprises the sequence of Sequence ID No. 28.

[0308] 191. The polynucleotide according to Embodiment 186, wherein the termination element includes the sequence of Sequence ID No. 29.

[0309] 192. The polynucleotide according to Embodiment 186, wherein the termination element includes the sequence of Sequence ID No. 30.

[0310] 193. The polynucleotide according to Embodiment 186, wherein the termination element comprises the sequence of Sequence ID No. 31.

[0311] 194. The polynucleotide according to Embodiment 186, wherein the termination element includes the sequence of Sequence ID No. 32.

[0312] 195. The polynucleotide according to Embodiment 186, wherein the termination element comprises the sequence of Sequence ID No. 33.

[0313] 196. The polynucleotide according to Embodiment 186, wherein the termination element comprises the sequence of Sequence ID No. 34.

[0314] 197. The polynucleotide according to Embodiment 186, wherein the termination element comprises the sequence of Sequence ID No. 35.

[0315] 198. The polynucleotide according to Embodiment 186, wherein the termination element comprises the sequence of Sequence ID No. 36.

[0316] 199. The polynucleotide according to Embodiment 186, wherein the termination element comprises the sequence of Sequence ID No. 62.

[0317] 200. The polynucleotide according to Embodiment 186, wherein the termination element includes the sequence of Sequence ID No. 93.

[0318] 201. The polynucleotide according to Embodiment 186, wherein the termination element includes the sequence of Sequence ID No. 96.

[0319] 202. The code area in (b) above is: Equation B: X -3 -X -2 -X -1 -UAA-X1-X2-X3-X4-X5-X6-X7-X8-X9-X 10 -X 11 -X 12 (Sequence ID 37) (In the formula, X1 is either G or A; X2, X4, X5, X6, or X7 are each independently either C or U; X3 is either C or A; X8, X 10 , X 11 , X 12 , X -1 Or X -3 Each of these is independently either C or G; X9 is G or U; and / or X -2 The polynucleotide according to Embodiment 186, comprising a stop element containing a consensus sequence (where is A or U).

[0320] 203. The code area in (b) above is formula C: X -3 -X -2 -X -1 -UGA-X1-X2-X3-X4-X5-X6-X7-X8-X9-X 10 -X 11 -X 12 (Sequence ID 56) (In the formula, X -3 , X -1 X2, X5, X6, X7, X8, X9, or X 12 Each of these is independently either G or C; X -2 X3 or X4 are independently A or C; X1 is A or G; and / or X 10 Or X 11 The polynucleotide according to Embodiment 186, comprising a stop element containing a consensus sequence (each independently being C or U).

[0321] 204. The code area in (b) above is Equation D: X -3 -X -2 -X -1 -UAG-X1-X2-X3-X4-X5-X6-X7-X8-X9-X 10 -X 11 -X 12(Sequence ID 57) (In the formula, X -3 , X -1 X2, X3, X 10 Each is independently either G or C; X -2 Alternatively, X9 is either A or U, independently of each other; X1 or X4 is independently A or G; X5 or X8 is independently A or C; and / or X6, X7, X 11 Or X 12 The polynucleotide according to Embodiment 186, comprising a stop element containing a consensus sequence (each independently being C or U).

[0322] 205. The consensus sequence has a high GC content (e.g., a GC content of about 50%, 60%, 70%, 80%, 90%, or 99%), and is a polynucleotide according to any one of Embodiments 202 to 204.

[0323] 206. A polynucleotide according to any one of embodiments 202 to 205, wherein the half-life of the polynucleotide is increased or the level and / or activity (e.g., production) of the polypeptide encoded by the polynucleotide is increased.

[0324] 207. The polynucleotide according to any one of embodiments 202 to 206, wherein the polynucleotide has a half-life increased by approximately 1.2 to 10 times.

[0325] 208. The polynucleotide according to Embodiment 207, wherein the increase in half-life is measured using an assay for measuring the half-life of a polynucleotide (for example, the assay described in any one of the examples disclosed herein).

[0326] 209. The increase in the half-life is the polynucleotide according to embodiment 207, which is compared with other similar polynucleotides including a coding region without a termination element of embodiment 199.

[0327] 210. Position X -1 is the third position of a codon (e.g., a codon specifying an amino acid) of the polynucleotide according to embodiment 202.

[0328] 211. The nucleotide at the position X -1 of the polynucleotide according to embodiment 210 does not change the amino acid incorporated into the polypeptide.

[0329] 212. By C at position X -1 of the polynucleotide according to embodiment 202, the half-life of the polynucleotide increases or the level and / or activity (e.g., production amount) of the polypeptide encoded by the polynucleotide increases.

[0330] 213. The increase in the half-life of the polynucleotide according to embodiment 212 is measured by an assay for measuring the half-life of the polynucleotide (e.g., the assay described in any one of the examples disclosed herein).

[0331] 214. The polynucleotide according to any one of embodiments 186 to 213, wherein the half-life of the polynucleotide increases (e.g., the half-life of the polynucleotide increases by about 1.5 to 20 times) due to the termination element.

[0332] 215. The increase in the half-life of the polynucleotide according to embodiment 214 is compared with other similar polynucleotides having no termination element, having a different termination element, or having no termination element of the termination element described in embodiment 186.

[0333] 216. The polynucleotide according to Embodiment 214 or 215, wherein the increase in the half-life of the polynucleotide is measured according to an assay for measuring the half-life of the polynucleotide (for example, the assay described in any one of the examples disclosed herein).

[0334] 217. The polynucleotide according to any one of embodiments 186 to 216, wherein the termination element increases the level and / or activity (e.g., the amount or duration of expression) of the polypeptide encoded by the polynucleotide.

[0335] 218. The polynucleotide according to Embodiment 217, wherein the increase in the level and / or activity (e.g., the amount or duration of expression) of the polypeptide is measured according to an assay for measuring the level and / or activity (e.g., the amount or duration of expression) of the polypeptide (e.g., the assay described in any one of the examples disclosed herein).

[0336] 219. The polynucleotide according to Embodiment 218, wherein the termination element increases the level and / or activity (e.g., production) of the polypeptide encoded by the polynucleotide by about 1.5 to 20 times.

[0337] 220. The polynucleotide according to Embodiment 218, wherein the termination element increases the level and / or activity (e.g., a detectable level or activity) of the polypeptide encoded by the polynucleotide by about 1.5 to 20 times for about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 14 days.

[0338] 221. The polynucleotide according to Embodiment 220, wherein the termination element makes the level or activity of the polypeptide encoded by the polynucleotide detectable for about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 14 days.

[0339] 222. The polynucleotide according to any one of Embodiments 217-221, wherein the increase in the level and / or activity (e.g., production or duration of expression) of the polypeptide encoded by the polynucleotide is compared with other similar polynucleotides having no stop element, having a different stop element, or having no stop element as described in Embodiment 186.

[0340] 223. The polynucleotide according to any one of Embodiments 186 to 222, wherein the 5'UTR in (a) above comprises a sequence, variant or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the 5'UTR sequence shown in Table 1 (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of the 5'UTR sequence shown in Table 1).

[0341] 224. The polynucleotide according to Embodiment 223, wherein the 5'UTR comprises a sequence or fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides in any of the aforementioned sequences) that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 88, SEQ ID NO: 89, or SEQ ID NO: 90.

[0342] 225. The polynucleotide according to Embodiment 223, wherein the 5'UTR comprises a sequence or fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 1) that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 1.

[0343] 226. The polynucleotide according to Embodiment 223, wherein the 5'UTR comprises a sequence or fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 2) that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 2.

[0344] 227. The polynucleotide according to Embodiment 223, wherein the 5'UTR comprises a sequence or fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 3) that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 3.

[0345] 228. The polynucleotide according to Embodiment 223, wherein the 5'UTR comprises a sequence or fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 4) that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 4.

[0346] 229. The polynucleotide according to Embodiment 223, wherein the 5'UTR comprises a sequence or fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 5) that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 5.

[0347] 230. The polynucleotide according to Embodiment 223, wherein the 5'UTR comprises a sequence or fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 6) that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 6.

[0348] 231. The polynucleotide according to Embodiment 223, wherein the 5'UTR comprises a sequence or fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 8) that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 8.

[0349] 232. The polynucleotide according to Embodiment 223, wherein the 5'UTR comprises a sequence or fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 41) that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 41.

[0350] 233. The polynucleotide according to Embodiment 223, wherein the 5'UTR comprises a sequence or fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 42) that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 42.

[0351] 234. The polynucleotide according to Embodiment 223, wherein the 5'UTR comprises the sequence of Sequence ID No. 63 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of Sequence ID No. 63).

[0352] 235. The polynucleotide according to Embodiment 223, wherein the 5'UTR comprises the sequence of SEQ ID NO: 64 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 64).

[0353] 236. The polynucleotide according to Embodiment 223, wherein the 5'UTR comprises the sequence of SEQ ID NO: 65 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 65).

[0354] 237. The polynucleotide according to Embodiment 223, wherein the 5'UTR comprises the sequence of SEQ ID NO: 66 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 66).

[0355] 238. The polynucleotide according to Embodiment 223, wherein the 5'UTR comprises the sequence of Sequence ID No. 67 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of Sequence ID No. 67).

[0356] 239. The polynucleotide according to Embodiment 223, wherein the 5'UTR comprises the sequence of SEQ ID NO: 68 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 68).

[0357] 240. The polynucleotide according to Embodiment 223, wherein the 5'UTR comprises the sequence of SEQ ID NO: 69 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 69).

[0358] 241. The polynucleotide according to Embodiment 223, wherein the 5'UTR comprises the sequence of SEQ ID NO: 70 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 70).

[0359] 242. The polynucleotide according to Embodiment 223, wherein the 5'UTR comprises the sequence of SEQ ID NO: 70 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 70).

[0360] 243. The polynucleotide according to Embodiment 223, wherein the 5'UTR comprises the sequence of SEQ ID NO: 71 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 71).

[0361] 244. The polynucleotide according to Embodiment 223, wherein the 5'UTR comprises the sequence of SEQ ID NO: 72 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 72).

[0362] 245. The polynucleotide according to Embodiment 223, wherein the 5'UTR comprises the sequence of Sequence ID No. 73 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of Sequence ID No. 73).

[0363] 246. The polynucleotide according to Embodiment 223, wherein the 5'UTR comprises the sequence of Sequence ID No. 74 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of Sequence ID No. 74).

[0364] 247. The polynucleotide according to Embodiment 223, wherein the 5'UTR comprises the sequence of SEQ ID NO: 75 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 75).

[0365] 248. The polynucleotide according to Embodiment 223, wherein the 5'UTR comprises the sequence of SEQ ID NO: 76 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 76).

[0366] 249. The polynucleotide according to Embodiment 223, wherein the 5'UTR comprises the sequence of Sequence ID No. 77 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of Sequence ID No. 77).

[0367] 250. The polynucleotide according to Embodiment 223, wherein the 5'UTR comprises the sequence of Sequence ID No. 78 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of Sequence ID No. 78).

[0368] 251. The polynucleotide according to Embodiment 223, wherein the 5'UTR comprises the sequence of Sequence ID No. 88 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of Sequence ID No. 88).

[0369] 252. The polynucleotide according to Embodiment 223, wherein the 5'UTR comprises the sequence of SEQ ID NO: 89 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 89).

[0370] 253. The polynucleotide according to Embodiment 223, wherein the 5'UTR comprises the sequence of SEQ ID NO: 90 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 90).

[0371] 254. A polynucleotide according to any one of Embodiments 186 to 222, wherein the 3'UTR in (c) comprises a 3'UTR sequence shown in Table 2 or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a 3'UTR sequence shown in Table 2 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of a 3'UTR sequence shown in Table 2), The polynucleotide optionally includes a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequences shown in Table 4.

[0372] 255. A polynucleotide according to Embodiment 254, wherein the 3'UTR comprises a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 45, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 87, SEQ ID NO: 94, or SEQ ID NO: 95 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides in any of the aforementioned sequences), The polynucleotide optionally comprises a sequence, variant or fragment thereof, that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any of sequence numbers 47, 48, 49, 50, 122, 52, 53, 54, 55, 59, 60, 61, 126, 127, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, or 120.

[0373] 256. The polynucleotide according to Embodiment 254, wherein the 3'UTR comprises the sequence of SEQ ID NO: 11, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 11 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 11).

[0374] 257. The polynucleotide according to Embodiment 254, wherein the 3'UTR comprises the sequence of SEQ ID NO: 12, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 12 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 12).

[0375] 258. The polynucleotide according to Embodiment 254, wherein the 3'UTR comprises the sequence of SEQ ID NO: 13, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 13 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 13).

[0376] 259. The polynucleotide according to Embodiment 254, wherein the 3'UTR comprises the sequence of SEQ ID NO: 14, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 14 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 14).

[0377] 260. The polynucleotide according to Embodiment 254, wherein the 3'UTR comprises the sequence of SEQ ID NO: 15, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 15 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 15).

[0378] 261. The polynucleotide according to Embodiment 254, wherein the 3'UTR comprises the sequence of SEQ ID NO: 16, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 16 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 16).

[0379] 262. The polynucleotide according to Embodiment 254, wherein the 3'UTR comprises the sequence of SEQ ID NO: 17, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 17 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 17).

[0380] 263. The polynucleotide according to Embodiment 254, wherein the 3'UTR comprises the sequence of SEQ ID NO: 18, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 18 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 18).

[0381] 264. The polynucleotide according to Embodiment 254, wherein the 3'UTR comprises the sequence of SEQ ID NO: 19, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 19 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 19).

[0382] 265. The polynucleotide according to Embodiment 254, wherein the 3'UTR comprises a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 21 or SEQ ID NO: 20 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of any of the aforementioned sequences).

[0383] 266. The polynucleotide according to Embodiment 254, wherein the 3'UTR comprises the sequence of SEQ ID NO: 21, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 21 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 21).

[0384] 267. The polynucleotide according to Embodiment 254, wherein the 3'UTR comprises the sequence of SEQ ID NO: 22, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 22 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 22).

[0385] 268. The polynucleotide according to Embodiment 254, wherein the 3'UTR comprises the sequence of SEQ ID NO: 23, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 23 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 23).

[0386] 269. The polynucleotide according to Embodiment 254, wherein the 3'UTR comprises the sequence of SEQ ID NO: 24, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 24 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 24).

[0387] 270. The polynucleotide according to Embodiment 254, wherein the 3'UTR comprises the sequence of SEQ ID NO: 25, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 25 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 25).

[0388] 271. The polynucleotide according to Embodiment 254, wherein the 3'UTR comprises the sequence of SEQ ID NO: 45, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 45 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 45).

[0389] 272. The polynucleotide according to Embodiment 254, wherein the 3'UTR comprises the sequence of SEQ ID NO: 79, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 79 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 79).

[0390] 273. The polynucleotide according to Embodiment 254, wherein the 3'UTR comprises the sequence of SEQ ID NO: 80, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 80 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 80).

[0391] 274. The polynucleotide according to Embodiment 254, wherein the 3'UTR comprises the sequence of SEQ ID NO: 81, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 81 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 81).

[0392] 275. The polynucleotide according to Embodiment 254, wherein the 3'UTR comprises the sequence of SEQ ID NO: 82, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 82 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 82).

[0393] 276. The polynucleotide according to Embodiment 254, wherein the 3'UTR comprises the sequence of SEQ ID NO: 83, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 83 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 83).

[0394] 277. The polynucleotide according to Embodiment 254, wherein the 3'UTR comprises the sequence of SEQ ID NO: 84, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 84 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 84).

[0395] 278. The polynucleotide according to Embodiment 254, wherein the 3'UTR comprises the sequence of SEQ ID NO: 85, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 85 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 85).

[0396] 279. The polynucleotide according to Embodiment 254, wherein the 3'UTR comprises the sequence of SEQ ID NO: 86, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 86 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 86).

[0397] 280. The polynucleotide according to Embodiment 254, wherein the 3'UTR comprises the sequence of SEQ ID NO: 87, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 87 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 87).

[0398] 281. The polynucleotide according to Embodiment 254, wherein the 3'UTR comprises the sequence of SEQ ID NO: 94, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 94 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 94).

[0399] 282. The polynucleotide according to Embodiment 254, wherein the 3'UTR comprises the sequence of SEQ ID NO: 95, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 95 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 95).

[0400] 283. The polynucleotide according to Embodiment 254, wherein the 3'UTR comprises a microRNA binding site (e.g., as described herein) and / or a TENT recruitment sequence (e.g., as described herein).

[0401] 284. The polynucleotide according to Embodiment 254, wherein the miRNA binding site includes one of the sequences of SEQ ID NOs. 38 to 40, or the TENT recruitment sequence includes the sequence of SEQ ID NO. 91 or 92.

[0402] 285. A polynucleotide according to any one of embodiments 186 to 222, (i) The 5'UTR in (a) above includes a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the 5'UTR sequence shown in Table 1 or the 3'UTR sequence shown in Table 1 (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of the 5'UTR sequence shown in Table 1), and (ii) The 3'UTR in (c) above includes a 3'UTR sequence shown in Table 2 or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the 3'UTR sequence shown in Table 2 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of the 3'UTR sequence shown in Table 2), The polynucleotide optionally comprises a sequence, variant or fragment thereof, that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any of the sequences shown in Table 4 (e.g., sequence numbers 47, 48, 49, 50, 122, 52, 53, 54, 55, 59, 60, 61, 126, 127, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, or 120).

[0403] 286. The polynucleotide according to Embodiment 285, wherein the 5'UTR comprises a sequence or fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides in any of the aforementioned sequences) that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 88, SEQ ID NO: 89, or SEQ ID NO: 90.

[0404] 287. The polynucleotide according to Embodiment 285, wherein the 5'UTR comprises a sequence or fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 1) that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 1.

[0405] 288. The polynucleotide according to Embodiment 285, wherein the 5'UTR comprises a sequence or fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 2) that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 2.

[0406] 289. The polynucleotide according to Embodiment 285, wherein the 5'UTR comprises a sequence or fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 3) that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 3.

[0407] 290. The polynucleotide according to Embodiment 285, wherein the 5'UTR comprises a sequence or fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 4) that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 4.

[0408] 291. The polynucleotide according to Embodiment 285, wherein the 5'UTR comprises a sequence or fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 5) that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 5.

[0409] 292. The polynucleotide according to Embodiment 285, wherein the 5'UTR comprises a sequence or fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 6) that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 6.

[0410] 293. The polynucleotide according to Embodiment 285, wherein the 5'UTR comprises a sequence or fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 8) that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 8.

[0411] 294. The polynucleotide according to Embodiment 285, wherein the 5'UTR comprises a sequence or fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 41) that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 41.

[0412] 295. The polynucleotide according to Embodiment 285, wherein the 5'UTR comprises a sequence or fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 42) that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 42.

[0413] 296. The polynucleotide according to Embodiment 285, wherein the 5'UTR comprises the sequence of SEQ ID NO: 63 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 63).

[0414] 297. The polynucleotide according to Embodiment 285, wherein the 5'UTR comprises the sequence of SEQ ID NO: 64 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 64).

[0415] 298. The polynucleotide according to Embodiment 285, wherein the 5'UTR comprises the sequence of SEQ ID NO: 65 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 65).

[0416] 299. The polynucleotide according to Embodiment 285, wherein the 5'UTR comprises the sequence of SEQ ID NO: 66 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 66).

[0417] 300. The polynucleotide according to Embodiment 285, wherein the 5'UTR comprises the sequence of Sequence ID No. 67 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of Sequence ID No. 67).

[0418] 301. The polynucleotide according to Embodiment 285, wherein the 5'UTR comprises the sequence of Sequence ID No. 68 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of Sequence ID No. 68).

[0419] 302. The polynucleotide according to Embodiment 285, wherein the 5'UTR comprises the sequence of SEQ ID NO: 69 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 69).

[0420] 303. The polynucleotide according to Embodiment 285, wherein the 5'UTR comprises the sequence of SEQ ID NO: 70 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 70).

[0421] 304. The polynucleotide according to Embodiment 285, wherein the 5'UTR comprises the sequence of SEQ ID NO: 70 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 70).

[0422] 305. The polynucleotide according to Embodiment 285, wherein the 5'UTR comprises the sequence of SEQ ID NO: 71 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 71).

[0423] 306. The polynucleotide according to Embodiment 285, wherein the 5'UTR comprises the sequence of SEQ ID NO: 72 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 72).

[0424] 307. The polynucleotide according to Embodiment 285, wherein the 5'UTR comprises the sequence of SEQ ID NO: 73 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 73).

[0425] 308. The polynucleotide according to Embodiment 285, wherein the 5'UTR comprises the sequence of SEQ ID NO: 74 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 74).

[0426] 309. The polynucleotide according to Embodiment 285, wherein the 5'UTR comprises the sequence of SEQ ID NO: 75 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 75).

[0427] 310. The polynucleotide according to Embodiment 285, wherein the 5'UTR comprises the sequence of SEQ ID NO: 76 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 76).

[0428] 311. The polynucleotide according to Embodiment 285, wherein the 5'UTR comprises the sequence of Sequence ID No. 77 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of Sequence ID No. 77).

[0429] 312. The polynucleotide according to Embodiment 285, wherein the 5'UTR comprises the sequence of SEQ ID NO: 78 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 78).

[0430] 313. The polynucleotide according to Embodiment 285, wherein the 5'UTR comprises the sequence of Sequence ID No. 88 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of Sequence ID No. 88).

[0431] 314. The polynucleotide according to Embodiment 285, wherein the 5'UTR comprises the sequence of SEQ ID NO: 89 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 89).

[0432] 315. The polynucleotide according to Embodiment 285, wherein the 5'UTR comprises the sequence of SEQ ID NO: 90 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 90).

[0433] 316. The polynucleotide according to any one of embodiments 285 to 315, wherein the 3'UTR comprises a sequence or fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6 or more nucleotides in any of the aforementioned sequences) that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 11, sequence number 12, sequence number 13, sequence number 14, sequence number 15, sequence number 16, sequence number 17, sequence number 18, sequence number 19, sequence number 20, sequence number 21, sequence number 22, sequence number 23, sequence number 24, sequence number 25, sequence number 45, sequence number 79, sequence number 80, sequence number 81, sequence number 82, sequence number 83, sequence number 84, sequence number 85, sequence number 86, sequence number 87, sequence number 94, or sequence number 95.

[0434] 317. The polynucleotide according to any one of embodiments 285 to 315, wherein the 3'UTR comprises the sequence of SEQ ID NO: 11, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 11 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 11).

[0435] 318. The polynucleotide according to any one of embodiments 285 to 315, wherein the 3'UTR comprises the sequence of SEQ ID NO: 12, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 12 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 12).

[0436] 319. The polynucleotide according to any one of embodiments 285 to 315, wherein the 3'UTR comprises the sequence of SEQ ID NO: 13, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 13 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 13).

[0437] 320. The polynucleotide according to any one of Embodiments 285 to 315, wherein the 3'UTR comprises the sequence of SEQ ID NO: 14, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 14 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 14).

[0438] 321. The polynucleotide according to any one of Embodiments 285 to 315, wherein the 3'UTR comprises the sequence of SEQ ID NO: 15, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 15 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 15).

[0439] 322. The polynucleotide according to any one of embodiments 285 to 315, wherein the 3'UTR comprises the sequence of SEQ ID NO: 16, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 16 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 16).

[0440] 323. The polynucleotide according to any one of embodiments 285 to 315, wherein the 3'UTR comprises the sequence of SEQ ID NO: 17, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 17 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 17).

[0441] 324. The polynucleotide according to any one of embodiments 285 to 315, wherein the 3'UTR comprises the sequence of SEQ ID NO: 18, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 18 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 18).

[0442] 325. The polynucleotide according to any one of embodiments 285 to 315, wherein the 3'UTR comprises the sequence of SEQ ID NO: 19, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 19 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 19).

[0443] 326. The polynucleotide according to any one of Embodiments 285 to 315, wherein the 3'UTR comprises the sequence of SEQ ID NO: 20, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 20 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 20).

[0444] 327. The polynucleotide according to any one of embodiments 285 to 315, wherein the 3'UTR comprises the sequence of SEQ ID NO: 21, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 21 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 21).

[0445] 328. The polynucleotide according to any one of Embodiments 285 to 315, wherein the 3'UTR comprises the sequence of SEQ ID NO: 22, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 22 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 22).

[0446] 329. The polynucleotide according to any one of embodiments 285 to 315, wherein the 3'UTR comprises the sequence of SEQ ID NO: 23, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 23 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 23).

[0447] 330. The polynucleotide according to any one of Embodiments 285 to 315, wherein the 3'UTR comprises the sequence of SEQ ID NO: 24, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 24 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 24).

[0448] 331. The polynucleotide according to any one of embodiments 285 to 315, wherein the 3'UTR comprises the sequence of SEQ ID NO: 25, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 25 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 25).

[0449] 332. The polynucleotide according to any one of Embodiments 285 to 315, wherein the 3'UTR comprises the sequence of SEQ ID NO: 45, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 45 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 45).

[0450] 333. The polynucleotide according to any one of embodiments 285 to 315, wherein the 3'UTR comprises the sequence of SEQ ID NO: 79, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 79 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 79).

[0451] 334. The polynucleotide according to any one of embodiments 285 to 315, wherein the 3'UTR comprises the sequence of SEQ ID NO: 80, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 80 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 80).

[0452] 335. The polynucleotide according to any one of embodiments 285 to 315, wherein the 3'UTR comprises the sequence of SEQ ID NO: 81, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 81 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 81).

[0453] 336. The polynucleotide according to any one of Embodiments 285 to 315, wherein the 3'UTR comprises the sequence of SEQ ID NO: 82, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 82 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 82).

[0454] 337. The polynucleotide according to any one of embodiments 285 to 315, wherein the 3'UTR comprises the sequence of SEQ ID NO: 83, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 83 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 83).

[0455] 338. The polynucleotide according to any one of Embodiments 285 to 315, wherein the 3'UTR comprises the sequence of SEQ ID NO: 84, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 84 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 84).

[0456] 339. The polynucleotide according to any one of Embodiments 285 to 315, wherein the 3'UTR comprises the sequence of SEQ ID NO: 85, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 85 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 85).

[0457] 340. The polynucleotide according to any one of Embodiments 285 to 315, wherein the 3'UTR comprises the sequence of SEQ ID NO: 86, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 86 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 86).

[0458] 341. The polynucleotide according to any one of embodiments 285 to 315, wherein the 3'UTR comprises the sequence of SEQ ID NO: 87, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 87 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 87).

[0459] 342. The polynucleotide according to any one of embodiments 285 to 315, wherein the 3'UTR comprises the sequence of SEQ ID NO: 94, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 94 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 94).

[0460] 343. The polynucleotide according to any one of Embodiments 285 to 315, wherein the 3'UTR comprises the sequence of SEQ ID NO: 95, or a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 95 (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 95).

[0461] 344. The polynucleotide according to any one of Embodiments 285 to 315, wherein the 3'UTR comprises a microRNA binding site (e.g., as described herein) and / or a TENT recruitment sequence (e.g., as described herein).

[0462] 345. The polynucleotide according to Embodiment 344, wherein the miRNA binding site includes one of the sequences of SEQ ID NOs. 38 to 40, or the TENT recruitment sequence includes the sequence of SEQ ID NO. 91 or 92.

[0463] 346. Polynucleotides that encode polypeptides, (a) 5'UTR (for example, as described herein), (b) Code regions including a termination element (for example, as described herein), and (c) The polynucleotide comprising a 3'UTR having a core sequence or a variant or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 11.

[0464] 347. The polynucleotide according to embodiment 346, wherein the 3'UTR core sequence is located immediately downstream of the stop element of (b).

[0465] 348. The polynucleotide according to embodiment 347, wherein the 3'UTR core sequence is located at the C-terminus of the polynucleotide.

[0466] 349. The polynucleotide according to any one of embodiments 346 to 348, wherein the 3'UTR containing the core sequence contains a first flanking sequence.

[0467] 350. The polynucleotide according to any one of embodiments 346 to 349, wherein the 3'UTR containing the core sequence contains a second flanking sequence.

[0468] 351. The polynucleotide according to Embodiment 349 or 350, wherein the 3'UTR containing the core sequence contains a first flanking sequence and a second flanking sequence.

[0469] 352. The polynucleotide according to any one of Embodiments 349 to 351, wherein the first flanking sequence comprises a sequence of about 5 to 25, about 5 to 20, about 5 to 15, about 5 to 10, about 10 to 25, about 15 to 25, and about 20 to 25 nucleotides.

[0470] 353. The polynucleotide according to any one of Embodiments 349 to 351, wherein the first flanking sequence comprises a sequence of approximately 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides (e.g., 11 nucleotides).

[0471] 354. The polynucleotide according to any one of Embodiments 349 to 351, wherein the second flanking sequence comprises a sequence of about 20-80, about 20-75, about 20-70, about 20-65, about 20-60, about 20-55, about 20-50, about 20-45, about 20-40, about 20-35, about 20-30, about 20-25, about 25-80, about 30-80, about 35-80, about 40-80, about 45-80, about 50-80, about 55-80, about 60-80, about 65-80, about 70-80, or about 75-80 nucleotides.

[0472] 355. The polynucleotide according to any one of Embodiments 349 to 351, wherein the second flanking sequence comprises a sequence of approximately 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, or 80 nucleotides (e.g., 39 nucleotides).

[0473] 356. The first flanking sequence is a polynucleotide according to any one of embodiments 349 to 351, located upstream of the core sequence.

[0474] 357. The first flanking sequence is a polynucleotide according to any one of embodiments 349 to 351, located downstream of the core sequence.

[0475] 358. The second flanking sequence is a polynucleotide according to any one of embodiments 349 to 351, located upstream of the core sequence.

[0476] 359. The second flanking sequence is a polynucleotide according to any one of embodiments 349 to 351, located downstream of the core sequence.

[0477] 360. The polynucleotide according to any one of embodiments 346 to 359, wherein the 3'UTR comprises a fragment of SEQ ID NO: 11 (for example, a 5-nucleotide (nt), 10nt, 15nt, 20nt, 25nt, 30nt, 35nt, 40nt, 45nt, 50nt, 55nt, 60nt, 65nt, or 70nt fragment of SEQ ID NO: 11).

[0478] 361. The polynucleotide according to any one of embodiments 346 to 360, wherein the 3'UTR comprises a 15-25nt fragment composed of the 60nt fragment of Sequence ID No. 11.

[0479] 362. The 3'UTR is a polynucleotide according to any one of embodiments 346 to 361, comprising the sequence of sequence number 45.

[0480] 363. The 3'UTR is a polynucleotide according to any one of embodiments 346 to 361, comprising the sequence of SEQ ID NO: 11.

[0481] 364. The polynucleotide according to any one of Embodiments 346 to 363, wherein the 3'UTR increases the half-life of the polynucleotide (for example, the half-life of the polynucleotide increases by about 1.5 to 10 times, as measured by an assay for measuring the half-life of a polynucleotide (for example, the assay described in any one of the examples disclosed herein).

[0482] 365. The polynucleotide according to Embodiment 364, wherein the average half-life score of the polynucleotide exceeds 10 due to the 3'UTR.

[0483] 366. The polynucleotide according to any one of embodiments 346 to 365, wherein the increase in the half-life of the polynucleotide is compared with other similar polynucleotides having a different 3'UTR, having a different 3'UTR, or having a different 3'UTR as described in any one of embodiments 346 to 244.

[0484] 367. The polynucleotide according to any one of embodiments 346 to 363, wherein the 3'UTR increases the level and / or activity (e.g., production) of the polypeptide encoded by the polynucleotide.

[0485] 368. The polynucleotide according to Embodiment 248, wherein the increase in the level and / or activity (e.g., production) of the polypeptide encoded by the polynucleotide is compared with other similar polynucleotides having a different 3'UTR, having no 3'UTR, or having no 3'UTR as described in any one of Embodiments 346-363.

[0486] 369. The polynucleotide according to any one of Embodiments 346 to 368, wherein the 3'UTR comprises a microRNA (miRNA) binding site (e.g., as described herein) and / or a TENT recruitment sequence (e.g., as described herein).

[0487] 370. The polynucleotide according to Embodiment 369, wherein the 3'UTR includes the miRNA binding site of SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40 or a combination thereof, and / or the TENT recruit sequence includes the sequence of SEQ ID NO: 91 or 92.

[0488] 371. The polynucleotide according to Embodiment 369 or 370, wherein the 3'UTR comprises a plurality of miRNA binding sites (e.g., 2, 3, 4, 5, 6, 7, or 8 miRNA binding sites).

[0489] 372. The polynucleotide according to Embodiment 371, wherein the plurality of miRNA binding sites include the same or different miRNA binding sites.

[0490] 373. The polynucleotide according to any one of Embodiments 346 to 372, wherein the 5'UTR in (a) above comprises a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the 5'UTR sequence shown in Table 1 (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of the 5'UTR sequence shown in Table 1).

[0491] 374. The polynucleotide according to Embodiment 373, wherein the 5'UTR comprises a sequence or fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides in any of the aforementioned sequences) that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 88, SEQ ID NO: 89, or SEQ ID NO: 90.

[0492] 375. The polynucleotide according to Embodiment 373, wherein the 5'UTR comprises a sequence or fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6 or more nucleotides of sequence number 2) that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 1.

[0493] 376. The polynucleotide according to Embodiment 373, wherein the 5'UTR comprises a sequence or fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 2) that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 2.

[0494] 377. The polynucleotide according to Embodiment 373, wherein the 5'UTR comprises a sequence or fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 3) that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 3.

[0495] 378. The polynucleotide according to Embodiment 373, wherein the 5'UTR comprises a sequence or fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 4) that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 4.

[0496] 379. The polynucleotide according to Embodiment 373, wherein the 5'UTR comprises a sequence or fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 5) that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 5.

[0497] 380. The polynucleotide according to Embodiment 373, wherein the 5'UTR comprises a sequence or fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 6) that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 6.

[0498] 381. The polynucleotide according to Embodiment 373, wherein the 5'UTR comprises a sequence or fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 8) that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 8.

[0499] 382. The polynucleotide according to Embodiment 373, wherein the 5'UTR comprises a sequence or fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 41) that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 41.

[0500] 383. The polynucleotide according to Embodiment 373, wherein the 5'UTR comprises a sequence or fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 42) that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 42.

[0501] 384. The polynucleotide according to Embodiment 373, wherein the 5'UTR comprises the sequence of SEQ ID NO: 63 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 63).

[0502] 385. The polynucleotide according to Embodiment 373, wherein the 5'UTR comprises the sequence of SEQ ID NO: 64 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 64).

[0503] 386. The polynucleotide according to Embodiment 373, wherein the 5'UTR comprises the sequence of SEQ ID NO: 65 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 65).

[0504] 387. The polynucleotide according to Embodiment 373, wherein the 5'UTR comprises the sequence of SEQ ID NO: 66 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 66).

[0505] 388. The polynucleotide according to Embodiment 373, wherein the 5'UTR comprises the sequence of SEQ ID NO: 67 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 67).

[0506] 389. The polynucleotide according to Embodiment 373, wherein the 5'UTR comprises the sequence of SEQ ID NO: 68 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 68).

[0507] 390. The polynucleotide according to Embodiment 373, wherein the 5'UTR comprises the sequence of SEQ ID NO: 69 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 69).

[0508] 391. The polynucleotide according to Embodiment 373, wherein the 5'UTR comprises the sequence of SEQ ID NO: 70 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 70).

[0509] 392. The polynucleotide according to Embodiment 373, wherein the 5'UTR comprises the sequence of SEQ ID NO: 70 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 70).

[0510] 393. The polynucleotide according to Embodiment 373, wherein the 5'UTR comprises the sequence of SEQ ID NO: 71 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 71).

[0511] 394. The polynucleotide according to Embodiment 373, wherein the 5'UTR comprises the sequence of SEQ ID NO: 72 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 72).

[0512] 395. The polynucleotide according to Embodiment 373, wherein the 5'UTR comprises the sequence of SEQ ID NO: 73 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 73).

[0513] 396. The polynucleotide according to Embodiment 373, wherein the 5'UTR comprises the sequence of SEQ ID NO: 74 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 74).

[0514] 397. The polynucleotide according to Embodiment 373, wherein the 5'UTR comprises the sequence of SEQ ID NO: 75 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 75).

[0515] 398. The polynucleotide according to Embodiment 373, wherein the 5'UTR comprises the sequence of SEQ ID NO: 76 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 76).

[0516] 399. The polynucleotide according to Embodiment 373, wherein the 5'UTR comprises the sequence of SEQ ID NO: 77 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 77).

[0517] 400. The polynucleotide according to Embodiment 373, wherein the 5'UTR comprises the sequence of Sequence ID No. 78 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of Sequence ID No. 78).

[0518] 401. The polynucleotide according to Embodiment 373, wherein the 5'UTR comprises the sequence of Sequence ID No. 88 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of Sequence ID No. 88).

[0519] 402. The polynucleotide according to Embodiment 373, wherein the 5'UTR comprises the sequence of SEQ ID NO: 89 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 89).

[0520] 403. The polynucleotide according to Embodiment 373, wherein the 5'UTR comprises the sequence of SEQ ID NO: 90 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 90).

[0521] 404. The stop element in (b) is a polynucleotide according to any one of embodiments 346 to 372, comprising the stop element sequence shown in Table 3.

[0522] 405. The polynucleotide according to Embodiment 404, wherein the code region of (b) above includes a termination element selected from the termination elements shown in Table 3 (for example, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 62, SEQ ID NO: 93, or SEQ ID NO: 96).

[0523] 406. The polynucleotide according to Embodiment 404, wherein the termination element includes the sequence of Sequence ID No. 26.

[0524] 407. The polynucleotide according to Embodiment 404, wherein the termination element includes the sequence of Sequence ID No. 27.

[0525] 408. The polynucleotide according to Embodiment 404, wherein the termination element includes the sequence of Sequence ID No. 28.

[0526] 409. The polynucleotide according to Embodiment 404, wherein the termination element comprises the sequence of Sequence ID No. 29.

[0527] 410. The polynucleotide according to Embodiment 404, wherein the termination element includes the sequence of Sequence ID No. 30.

[0528] 411. The polynucleotide according to Embodiment 404, wherein the termination element includes the sequence of Sequence ID No. 31.

[0529] 412. The polynucleotide according to Embodiment 404, wherein the termination element includes the sequence of Sequence ID No. 32.

[0530] 413. The polynucleotide according to Embodiment 404, wherein the termination element includes the sequence of Sequence ID No. 33.

[0531] 414. The polynucleotide according to Embodiment 404, wherein the termination element includes the sequence of Sequence ID No. 34.

[0532] 415. The polynucleotide according to Embodiment 404, wherein the termination element includes the sequence of Sequence ID No. 35.

[0533] 416. The polynucleotide according to Embodiment 404, wherein the termination element includes the sequence of Sequence ID No. 36.

[0534] 417. The polynucleotide according to Embodiment 404, wherein the termination element includes the sequence of Sequence ID No. 62.

[0535] 418. The polynucleotide according to Embodiment 404, wherein the termination element includes the sequence of Sequence ID No. 93.

[0536] 419. The polynucleotide according to Embodiment 404, wherein the termination element comprises the sequence of Sequence ID No. 96.

[0537] 420. The polynucleotide according to Embodiment 404, wherein the coding region of (b) above includes a stop element containing the consensus sequence of Sequence ID No. 37.

[0538] 421. A polynucleotide according to any one of embodiments 346 to 372, (i) The 5'UTR in (a) above includes a sequence or fragment thereof that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the 5'UTR sequence shown in Table 1 (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of the 5'UTR sequence shown in Table 1), and (ii) The termination element of (b) above is the polynucleotide comprising the termination elements shown in Table 3.

[0539] 422. The polynucleotide according to Embodiment 421, wherein the 5'UTR comprises a sequence or fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides in any of the aforementioned sequences) that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 88, SEQ ID NO: 89, or SEQ ID NO: 90.

[0540] 423. The polynucleotide according to Embodiment 421, wherein the 5'UTR comprises a sequence or fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6 or more nucleotides of sequence number 2) that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 1.

[0541] 424. The polynucleotide according to Embodiment 421, wherein the 5'UTR comprises a sequence or fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 2) that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 2.

[0542] 425. The polynucleotide according to Embodiment 421, wherein the 5'UTR comprises a sequence or fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 3) that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 3.

[0543] 426. The polynucleotide according to Embodiment 421, wherein the 5'UTR comprises a sequence or fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 4) that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 4.

[0544] 427. The polynucleotide according to Embodiment 421, wherein the 5'UTR comprises a sequence or fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 5) that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 5.

[0545] 428. The polynucleotide according to Embodiment 421, wherein the 5'UTR comprises a sequence or fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 6) that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 6.

[0546] 429. The polynucleotide according to Embodiment 421, wherein the 5'UTR comprises a sequence or fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 8) that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 8.

[0547] 430. The polynucleotide according to Embodiment 421, wherein the 5'UTR comprises a sequence or fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6 or more nucleotides of sequence number 41) that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 41.

[0548] 431. The polynucleotide according to Embodiment 421, wherein the 5'UTR comprises a sequence or fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 42) that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 42.

[0549] 432. The polynucleotide according to Embodiment 421, wherein the 5'UTR comprises the sequence of Sequence ID No. 63 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of Sequence ID No. 63).

[0550] 433. The polynucleotide according to Embodiment 421, wherein the 5'UTR comprises the sequence of SEQ ID NO: 64 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 64).

[0551] 434. The polynucleotide according to Embodiment 421, wherein the 5'UTR comprises the sequence of SEQ ID NO: 65 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 65).

[0552] 435. The polynucleotide according to Embodiment 421, wherein the 5'UTR comprises the sequence of SEQ ID NO: 66 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 66).

[0553] 436. The polynucleotide according to Embodiment 421, wherein the 5'UTR comprises the sequence of Sequence ID No. 67 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of Sequence ID No. 67).

[0554] 437. The polynucleotide according to Embodiment 421, wherein the 5'UTR comprises the sequence of Sequence ID No. 68 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of Sequence ID No. 68).

[0555] 438. The polynucleotide according to Embodiment 421, wherein the 5'UTR comprises the sequence of SEQ ID NO: 69 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 69).

[0556] 439. The polynucleotide according to Embodiment 421, wherein the 5'UTR comprises the sequence of SEQ ID NO: 70 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 70).

[0557] 440. The polynucleotide according to Embodiment 421, wherein the 5'UTR comprises the sequence of SEQ ID NO: 70 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 70).

[0558] 441. The polynucleotide according to Embodiment 421, wherein the 5'UTR comprises the sequence of SEQ ID NO: 71 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 71).

[0559] 442. The polynucleotide according to Embodiment 421, wherein the 5'UTR comprises the sequence of SEQ ID NO: 72 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 72).

[0560] 443. The polynucleotide according to Embodiment 421, wherein the 5'UTR comprises the sequence of SEQ ID NO: 73 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 73).

[0561] 444. The polynucleotide according to Embodiment 421, wherein the 5'UTR comprises the sequence of SEQ ID NO: 74 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 74).

[0562] 445. The polynucleotide according to Embodiment 421, wherein the 5'UTR comprises the sequence of SEQ ID NO: 75 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 75).

[0563] 446. The polynucleotide according to Embodiment 421, wherein the 5'UTR comprises the sequence of SEQ ID NO: 76 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 76).

[0564] 447. The polynucleotide according to Embodiment 421, wherein the 5'UTR comprises the sequence of Sequence ID No. 77 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of Sequence ID No. 77).

[0565] 448. The polynucleotide according to Embodiment 421, wherein the 5'UTR comprises the sequence of Sequence ID No. 78 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of Sequence ID No. 78).

[0566] 449. The polynucleotide according to Embodiment 421, wherein the 5'UTR comprises the sequence of SEQ ID NO: 88 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 88).

[0567] 450. The polynucleotide according to Embodiment 421, wherein the 5'UTR comprises the sequence of SEQ ID NO: 89 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 89).

[0568] 451. The polynucleotide according to Embodiment 421, wherein the 5'UTR comprises the sequence of SEQ ID NO: 90 or a fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of SEQ ID NO: 90).

[0569] 452. The polynucleotide according to any one of Embodiments 421 to 451, wherein the code region of (b) above includes a termination element selected from the termination elements shown in Table 3 (for example, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 62, SEQ ID NO: 93, or SEQ ID NO: 96).

[0570] 453. The polynucleotide according to Embodiment 452, wherein the termination element includes the sequence of Sequence ID No. 26.

[0571] 454. The polynucleotide according to Embodiment 452, wherein the termination element includes the sequence of Sequence ID No. 27.

[0572] 455. The polynucleotide according to Embodiment 452, wherein the termination element includes the sequence of Sequence ID No. 28.

[0573] 456. The polynucleotide according to Embodiment 452, wherein the termination element includes the sequence of Sequence ID No. 29.

[0574] 457. The polynucleotide according to Embodiment 452, wherein the termination element includes the sequence of Sequence ID No. 30.

[0575] 458. The polynucleotide according to Embodiment 452, wherein the termination element includes the sequence of Sequence ID No. 31.

[0576] 459. The polynucleotide according to Embodiment 452, wherein the termination element includes the sequence of Sequence ID No. 32.

[0577] 460. The polynucleotide according to Embodiment 452, wherein the termination element includes the sequence of Sequence ID No. 33.

[0578] 461. The polynucleotide according to Embodiment 452, wherein the termination element includes the sequence of Sequence ID No. 34.

[0579] 462. The polynucleotide according to Embodiment 452, wherein the termination element includes the sequence of Sequence ID No. 35.

[0580] 463. The polynucleotide according to Embodiment 452, wherein the termination element includes the sequence of Sequence ID No. 36.

[0581] 464. The polynucleotide according to Embodiment 452, wherein the termination element includes the sequence of Sequence ID No. 62.

[0582] 465. The polynucleotide according to Embodiment 452, wherein the termination element includes the sequence of Sequence ID No. 93.

[0583] 466. The polynucleotide according to Embodiment 452, wherein the termination element includes the sequence of Sequence ID No. 96.

[0584] 467. The polynucleotide according to Embodiment 452, wherein the coding region of (b) includes a stop element containing the consensus sequence of SEQ ID NO: 37, SEQ ID NO: 56, or SEQ ID NO: 57.

[0585] 468. The polynucleotide according to any one of the prior embodiments, wherein the coding region of the polynucleotide comprises a sequence encoding a therapeutic payload or a preventive payload.

[0586] 469. The therapeutic or prophylactic payload comprises a secreted protein, a membrane-bound protein, or an intercellular protein, as described in Embodiment 468, the polynucleotide.

[0587] 470. The polynucleotide according to Embodiment 469, wherein the therapeutic or prophylactic payload is selected from cytokines, antibodies, vaccines (e.g., antigens, immunogenic epitopes), receptors, enzymes, hormones, transcription factors, ligands, membrane transporters, structural proteins, nucleases, or components, variants, or fragments thereof (e.g., biologically active fragments).

[0588] 471. The polynucleotide according to Embodiment 469, wherein the therapeutic or prophylactic payload comprises a cytokine, or a variant or fragment thereof (e.g., a biologically active fragment).

[0589] 472. The therapeutic or prophylactic payload comprises an antibody or a variant or fragment thereof (e.g., a biologically active fragment), as described in Embodiment 469, the polynucleotide.

[0590] 473. The therapeutic or prophylactic payload comprises a vaccine (e.g., an antigen, an immunogenic epitope) or a component, variant, or fragment thereof (e.g., a biologically active fragment), as described in Embodiment 469, the polynucleotide.

[0591] 474. The therapeutic or preventive payload is a polynucleotide according to any one of embodiments 468 to 473, comprising a protein or peptide.

[0592] 475. A polynucleotide according to any one of the prior embodiments, wherein the level and / or activity of the polypeptide encoded by the polynucleotide is increased by a polynucleotide comprising the 5'UTR of SEQ ID NO: 1, a coding region including the termination element of SEQ ID NO: 28, and the 3'UTR of SEQ ID NO: 11.

[0593] 476. The polynucleotide according to Embodiment 475, wherein the increase in the level and / or activity of the polypeptide is about 1.2 to 10 times.

[0594] 477. The polynucleotide according to Embodiment 475 or 476, wherein the increase in the level and / or activity of the polypeptide is measured by an assay that measures the activity of the polypeptide (e.g., the assay described in Example 18).

[0595] 478. A polynucleotide according to any one of Embodiments 1 to 474, comprising a 3' stabilizing region including the 5' UTR of SEQ ID NO: 1, SEQ ID NO: 41, or SEQ ID NO: 42, and an inverted thymidine (idT), thereby increasing the level and / or activity (e.g., expression level) of the polypeptide encoded by the polynucleotide.

[0596] 479. The polynucleotide according to Embodiment 478, wherein the increase in the expression level of the polypeptide is approximately 1.2 to 10 times, as measured by an assay that measures the expression level of the polypeptide (e.g., immunoblotting, ELISA, or flow cytometry, e.g., the assay described in any one of the examples disclosed herein).

[0597] 480. The polynucleotide according to Embodiment 478, wherein the increase in the activity of the polypeptide is approximately 1.2 to 10 times, as measured by an assay that measures the activity of the polypeptide (e.g., an assay that tracks the dynamics of metabolite formation).

[0598] 481. The increase in the level and / or activity of the polypeptide is compared to other similar polypeptides encoded by polynucleotides that do not have a 5'UTR, 3'UTR, termination element and / or 3' stabilizing region as described herein, as described in Embodiment 479 or 480.

[0599] 482. A polynucleotide according to any one of the prior embodiments, further comprising at least one 5' cap structure (e.g., one described herein).

[0600] 483. The 5' cap structure is, [ka] The polynucleotide according to Embodiment 482, comprising a sequence, where the underlined italicized G is an inverted G nucleotide followed by a 5'-5'-triphosphate group.

[0601] 484. The 5' cap structure is, [ka] The polynucleotide according to Embodiment 483, comprising the sequence, where the underlined italicized G is an inverted G nucleotide followed by a 5'-5'-triphosphate group.

[0602] 485. The 5' cap structure is, [ka] The polynucleotide according to Embodiment 483, comprising the sequence, where the underlined italicized G is an inverted G nucleotide followed by a 5'-5'-triphosphate group.

[0603] A polynucleotide according to any one of the prior embodiments, further comprising a 486.3' stabilizing region (e.g., a stabilizing tail, e.g., as described herein).

[0604] 487. The polynucleotide according to Embodiment 486, wherein the 3' stabilizing region comprises a poly A tail (for example, a poly A tail containing 80 to 150 adenines, for example, 120 adenines (SEQ ID NO: 123)), and optionally the poly A tail comprises one or more non-adenosine residues (for example, one or more guanosines).

[0605] 488. The polynucleotide according to embodiment 486 or 487, wherein the poly-A tail comprises a UCUAG sequence (SEQ ID NO: 44).

[0606] 489. The polynucleotide according to Embodiment 488, wherein the poly-A tail contains about 80 to 120 (e.g., 100) adenines upstream of Sequence ID No. 44.

[0607] 490. The polynucleotide according to Embodiment 488 or 489, wherein the poly-A tail contains about 1 to 40 (e.g., 20) adenines downstream of Sequence ID No. 44.

[0608] 491. The polynucleotide according to any one of embodiments 486 to 490, wherein the 3' stabilizing region comprises at least one alternative nucleoside.

[0609] 492. The polynucleotide according to Embodiment 491, wherein the alternative nucleoside is an inverted thymidine (idT).

[0610] 493. The alternative nucleoside is located at the 3' terminus of the 3' stabilizing region, the polynucleotide according to embodiment 491 or 492.

[0611] 494. The 3' stabilization region has the structure of formula VII: [ka] A polynucleotide according to any one of embodiments 486 to 493, comprising or a salt thereof, wherein each X is independently O or S, A represents adenine, and T represents thymine.

[0612] 495. The polynucleotide is a polynucleotide according to any one of the prior embodiments, which constitutes mRNA.

[0613] 496. The polynucleotide according to Embodiment 495, wherein the mRNA comprises at least one chemical modification.

[0614] 497. The polynucleotide according to Embodiment 495 or 496, wherein the chemical modification is selected from the group consisting of pseudouridine, N1-methylpsoiduridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thio-l-methyl-1-deaza-psoiduridine, 2-thio-l-methylpsoiduridine, 2-thio-5-aza-uridine, 2-thio-dihydropsoiduridine, 2-thio-dihydrouridine, 2-thiopsoiduridine, 4-methoxy-2-thiopsoiduridine, 4-methoxypsoiduridine, 4-thio-l-methylpsoiduridine, 4-thiopsoiduridine, 5-aza-uridine, dihydropsoiduridine, 5-methyluridine, 5-methyluridine, 5-methoxyuridine, and 2'-O-methyluridine.

[0615] 498. The polynucleotide according to Embodiment 497, wherein the chemical modification is selected from the group consisting of pseudouridine, N1-methylpsoiduridine, 5-methylcytosine, 5-methoxyuridine, and combinations thereof.

[0616] 499. The polynucleotide according to Embodiment 497, wherein the chemical modification is N1-methylpsoiduridine.

[0617] 500. The mRNA is a polynucleotide according to Embodiment 497, comprising fully modified N1-methylpsoiduridine.

[0618] 501. A lipid nanoparticle (LNP) composition comprising a polynucleotide as described in any one of the prior embodiments.

[0619] 502. A pharmaceutical composition comprising the LNP composition described in Embodiment 501.

[0620] 503. Cells comprising the LNP composition described in Embodiment 501 or 502.

[0621] 504. The cell according to Embodiment 503, in contact with the LNP composition.

[0622] 505. The cells according to Embodiment 503 or 504, maintained under conditions sufficient to enable the expression of the polynucleotide or the polypeptide encoded by the polynucleotide.

[0623] 506. A method for increasing the expression level of a payload (e.g., a therapeutic payload or a preventive payload) in cells, comprising administering the LNP composition described in Embodiment 501 or 502 to the cells.

[0624] 507. A method for delivering the LNP composition described in Embodiment 501 or 502 to cells.

[0625] 508. The method according to Embodiment 507, comprising contacting the cells with the LNP composition in vitro, in vivo, or ex vivo.

[0626] 509. A method for delivering the LNP composition according to Embodiment 501 or 502 to a subject having a disease or disorder (for example, those described herein).

[0627] 510. A method for modulating an immune response in a subject, comprising administering to the subject in need of such modification an effective amount of the LNP composition described in Embodiment 501 or 502.

[0628] 511. A method for treating, preventing, or preventing symptoms of a disease or disorder, comprising administering an effective amount of the LNP composition described in Embodiment 501 or 502 to a subject in need thereof.

[0629] 512. The method according to any one of Embodiments 501 to 511, or an LNP composition, comprising (i) an ionized lipid (e.g., an amino lipid), (ii) a sterol or other structural lipid, (iii) a noncationic helper lipid or phospholipid, and (iv) a PEG lipid (e.g., one described herein).

[0630] 513. The ionized lipid comprises an amino lipid, as described in the method of Embodiment 512, or an LNP composition.

[0631] 514. The method according to Embodiment 512 or 513, or an LNP composition, wherein the ionized lipid comprises a compound of any of the formulas described herein (for example, formula (I), (IA), (IB), (IC), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg), (III), (IIIa1), (IIIa2), (IIIa3), (IIIa4), (IIIa5), (IIIa6), (IIIa7), or (IIIa8)).

[0632] 515. The ionized lipid comprises a compound of formula (I), as described in any one of embodiments 512 to 514, or an LNP composition.

[0633] 516. The ionized lipid comprises a compound of formula (IC) as described in any one of embodiments 512 to 514, or an LNP composition.

[0634] 517. The ionized lipid comprises a compound of formula (IIa), as described in any one of embodiments 512 to 514, or an LNP composition.

[0635] 518. The ionized lipid comprises a compound of formula (IIe), as described in any one of Embodiments 512 to 514, or an LNP composition.

[0636] 519. The method according to any one of Embodiments 512 to 518, or an LNP composition, wherein the noncationic helper lipid or phospholipid comprises a compound selected from the group consisting of DSPC, DPPC, or DOPC.

[0637] 520. The method according to any one of Embodiments 512 to 519, or an LNP composition, wherein the phospholipid is DSPC (e.g., a variant of DSPC, e.g., a compound of formula (IV)).

[0638] 521. The structural lipid is selected from alpha-tocopherol, β-sitosterol, or cholesterol, according to the method of any one of Embodiments 512 to 519, or an LNP composition.

[0639] 522. The method according to any one of Embodiments 512 to 520, or an LNP composition, wherein the structural lipid is alpha-tocopherol.

[0640] 523. The method according to any one of Embodiments 512 to 520, or an LNP composition, wherein the structural lipid is β-sitosterol.

[0641] 524. The method according to any one of Embodiments 512 to 521, or an LNP composition, wherein the structural lipid is cholesterol.

[0642] 525. The PEG lipid is selected from the group consisting of PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol, and mixtures thereof, according to any one of Embodiments 512 to 524, or an LNP composition.

[0643] 526. The PEG lipid is selected from the group consisting of PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, and PEG-DSPE lipids, according to any one of Embodiments 512 to 525, or an LNP composition.

[0644] 527. The method according to any one of Embodiments 512 to 525, or an LNP composition, wherein the PEG lipid is PEG-DMG.

[0645] 528. The method according to any one of Embodiments 512 to 525, or an LNP composition, wherein the PEG lipid is a compound selected from formula (V), formula (VI-A), formula (VI-B), formula (VI-C), or formula (VI-D).

[0646] 529. The method according to any one of Embodiments 512 to 525 or 528, or an LNP composition, wherein the PEG lipid is a compound of formula (VI-A).

[0647] 530. The method according to any one of Embodiments 512 to 525 or 528, or an LNP composition, wherein the PEG lipid is a compound of formula (VI-B).

[0648] 531. The method according to any one of Embodiments 512 to 530, or an LNP composition, wherein the LNP is composed of approximately 20-60% ionized lipids, 5-25% phospholipids, 25-55% cholesterol, and 0.5-15% PEG lipids in a molar ratio.

[0649] 532. The method according to any one of Embodiments 512 to 531, or an LNP composition, wherein the LNP is composed of approximately 50% ionized lipids, approximately 10% phospholipids, approximately 38.5% cholesterol, and approximately 1.5% PEG lipids in a molar ratio.

[0650] 533. The method according to any one of Embodiments 512 to 532, or an LNP composition, wherein the LNP is composed of approximately 49.83% ionized lipids, approximately 9.83% phospholipids, approximately 30.33% cholesterol, and approximately 2.0% PEG lipids in molar ratio.

[0651] 534. The method according to any one of Embodiments 501 to 533, or an LNP composition, wherein the LNP or system is formulated for intravenous, subcutaneous, intramuscular, intranasal, intraocular, rectal, pulmonary, or oral delivery.

[0652] 535. The method according to any one of Embodiments 501 to 534, or an LNP composition, wherein the subject is a mammal (e.g., human).

[0653] 536. The subject is a disease or disorder as disclosed herein, and is a method or LNP composition according to any one of embodiments 501 to 535. [Brief explanation of the drawing]

[0654] [Figure 1] This graph shows GFP fluorescence from GFP proteins encoded by mRNA constructs having either an A11 reference 5'UTR or an A1 5'UTR. [Figure 2A] This shows the in vivo ffLuc activity in mice administered with LNP-formulated ffLuc mRNA. The mRNA construct contained either the A11 reference 5'UTR or the A1 5'UTR. The total flux is shown 6 hours after administration. [Figure 2B] This shows the in vivo ffLuc activity in mice administered with LNP-formulated ffLuc mRNA. The mRNA construct contained either the A11 reference 5'UTR or the A1 5'UTR. The total flux is shown 48 hours after administration. [Figure 2C] This shows the in vivo ffLuc activity in mice administered with LNP-formulated ffLuc mRNA. The mRNA construct contained either the A11 reference 5'UTR or the A1 5'UTR. The combined ffLuc activity observed at both time points is shown. [Figure 3] This graph shows the target protein expression levels in rats administered with the LNP-formulated target mRNA containing the displayed 5'UTR. A shows the target protein expression level at the displayed time point. B shows the total target protein expression level, evaluated by the area under the curve (AUC). [Figure 4A] This graph shows the median expression levels of target proteins in HepatoPac cells seeded from primary rat hepatocytes. [Figure 4B] This graph shows the median expression level of target proteins in HepatoPac cells seeded from primary hepatocytes of rhesus monkeys. [Figure 4C] This graph shows the median expression levels of target proteins in HepatoPac cells seeded with hepatocytes derived from primary human hepatocytes. [Figure 5A]This graph shows the expression levels of the target protein in human PBMCs (Primary Birth Control Mills) T cells. Human PBMCs were contacted with LNP-formulated mRNA encoding the target protein. The mRNA construct contained either an A11 reference 5'UTR or an A1 5'UTR. The graph shows the expression levels of the target protein in T cells. [Figure 5B] This graph shows the expression levels of the target protein in human PBMCs (Primary Birth Control Mills) T cells. Human PBMCs were contacted with LNP-formulated mRNA encoding the target protein. The mRNA construct contained either an A11 reference 5'UTR or an A1 5'UTR. The graph shows the expression levels of the target protein in T cells. [Figure 5C] This graph shows the expression levels of the target protein in human PBMCs (Primary B Cells). Human PBMCs were contacted with LNP-formulated mRNA encoding the target protein. The mRNA construct contained either the A11 reference 5'UTR or the A1 5'UTR. The graph shows the expression levels of the target protein in B cells. [Figure 5D] This graph shows the expression levels of the target protein in human PBMCs (Primary B Cells). Human PBMCs were contacted with LNP-formulated mRNA encoding the target protein. The mRNA construct contained either the A11 reference 5'UTR or the A1 5'UTR. The graph shows the expression levels of the target protein in B cells. [Figure 6] This graph shows the expression levels of target proteins associated with rare diseases. Hep3B cells were transfected with mRNA constructs encoding these target proteins. mRNA constructs containing two versions (v1, v2) of the ORF sequence were used. These mRNA constructs had either an A1 5' UTR or an A11 reference 5' UTR. [Figure 7] This graph shows the in vivo protein expression levels from a construct (A3) containing a modified A1 5'UTR sequence or a construct containing a reference A11 5'UTR. [Figure 8]This shows the output of in vitro high-throughput 3'UTR screening for mRNA half-life extension. The left panel shows the change in the relative abundance of 3'UTR sequences evaluated over time. Data points represent the mean and standard deviation of all ORFs and cell types. Sequence B1 had the highest half-life score among all sequences evaluated. The right panel shows a histogram of half-life scores. The prominent tail on the left indicates that there were more 3'UTR sequences that shortened half-lives than that that extended them. The blue and orange marks represent B10 reference 3'UTR and B1 3'UTR, respectively. [Figure 9] This shows an overview of the 3'UTR bakeoff and the ORFs and cell types used. Figure 9A discloses "KDEL" as Sequence ID No. 130. [Figure 10A] The results of the 3'UTR bake-off are shown. The graph shows the relationship between the inferred mRNA half-life and total expression level for cytoplasmic mRNA encoding green fluorescent protein with different 3'UTRs. Red dots were used for 3'UTRs derived from high-throughput 3'UTR screening for half-life extension. All values ​​are normalized against the in-plate v1.1 3'UTR control. [Figure 10B] This shows the results of the 3'UTR bake-off. The data is similar to that in Figure 10A, but the inferred translation efficiency is compared with the AUC expression level. [Figure 10C] This shows the results of a 3'UTR bake-off. The graph shows data from IncuCyte expression experiments for mRNA encoding green fluorescent protein, either with B10 reference 3'UTR or B1 3'UTR. [Figure 11A] This graph shows the mRNA half-lives of mRNAs with different stop elements. It also shows the distribution of median native mRNA half-lives for mRNAs with different stop codon + 2 downstream nucleotide contexts. Each point represents a different 5nt sequence (e.g., UAAGC, with the stop codon itself underlined). [Figure 11B]This shows the mRNA half-lives of mRNAs with different stop elements. It also shows examples of median mRNA half-lives for mRNAs with different stop codon cassettes. [Figure 11C] This figure shows the mRNA half-lives of mRNAs with different stop elements. It presents data from an IncuCyte expression experiment comparing mRNA with a C1 stop element and a B10 reference 3' UTR (see black line) with a C4 stop element (SEQ ID NO: 29, UAAAGCUAA, see red line) encoding a red fluorescent protein. Note that the codons in the figure captions and tables are based on DNA nomenclature, using "T" instead of "U". [Figure 11D] This shows the mRNA half-lives of mRNAs with different stop elements. It also shows the median native mRNA half-lives in HeLa cells for mRNAs containing each of the potential nucleotides at several positions relative to the UAA stop codon. This analytical approach was used to generate stop elements C7 and C6 in Table 3. Sequence ID 129 is disclosed. [Figure 11E] This shows the mRNA half-lives of mRNAs with different stop elements. The data is similar to that shown in Figure 11D, but for the UAG stop codon. [Figure 11F] This shows the mRNA half-lives of mRNAs with different stop elements. The data is similar to that shown in Figure 11D, but for UGA stop codons. [Figure 12] This shows the expression levels of target proteins associated with rare diseases in Hep G2 cells. These target proteins are encoded by mRNA constructs with different termination elements: C5, C4, C11, C3, or a reference termination element (C1). Target protein expression levels were assessed by immunoblotting and plotted over time. [Figure 13]This graph shows the expression levels of target proteins encoded by mRNA constructs having various stop elements in the 3'UTR. The mRNA constructs used included the following 3'UTR and stop element sequences: SEQ ID NO: 25 (B16 control), SEQ ID NO: 59 (3'UTR with C10 stop element), SEQ ID NO: 60 (3'UTR with C7 stop element), and SEQ ID NO: 61 (3'UTR with C8 stop element). [Figure 14] The figures show the in vivo expression levels of immune checkpoint proteins encoded by mRNA constructs having the mRNA elements specified in the figures. A shows the immune checkpoint protein levels in the spleen of mice intravenously injected with 0.5 mg / kg of LNP-formulated mRNA encoding the immune checkpoint protein. B shows the immune checkpoint protein levels in the liver of mice intravenously injected with 0.5 mg / kg of LNP-formulated mRNA encoding the immune checkpoint protein. [Figure 15] This shows the percentage of cells with immune checkpoint protein in CD11c+MHCII+ cells derived from mice administered 0.5 mg / kg of LNP-formulated mRNA containing an specified mRNA element encoding an immune checkpoint protein. [Figure 16A] This graph shows the expression levels of luciferase or target proteins encoded by mRNA constructs containing A1 5'UTR (with a cap containing the GA sequence), B1 3'UTR, or both. Expression levels in the spleen are shown. [Figure 16B] This graph shows the expression levels of luciferase or target proteins encoded by mRNA constructs containing A1 5'UTR (with a cap containing the GA sequence), B1 3'UTR, or both. Expression levels are shown in the liver. [Figure 16C]This graph shows the expression levels of luciferase or target proteins encoded by mRNA constructs having A1 5'UTR (with a cap containing the GA sequence), B1 3'UTR, or both. It also shows serum expression levels of the target protein. [Figure 17] This figure shows the expression of a target protein in human bronchial epithelial cells. The target protein is encoded by mRNA containing the various elements shown in the figure. In this experiment, two different open reading frames (ORFs) encoding the target protein were used. The mRNA was transfected into cells, and the activity of the target protein was measured. [Figure 18A] This is a schematic design diagram of an exemplary mRNA construct described herein. [Figure 18B] This graph shows the expression levels of red fluorescent protein in Hela cells. The target protein is encoded by mRNA constructs having different termination elements: C1, C5, C7, and C9. [Figure 18C] This graph shows the expression levels of green fluorescent protein in Hela cells. The target protein is encoded by mRNA constructs with different termination elements: C1, C5, C7, and C9. [Figure 18D] This graph shows the expression levels of green fluorescent protein in Hela cells. The target protein is encoded by mRNA constructs with different termination elements: C1, C5, C7, and C9. [Figure 18E] This graph shows the expression levels of red fluorescent protein in HEK293 cells. The target protein is encoded by mRNA constructs having different termination elements: C1, C5, C7, and C9. [Figure 18F] This graph shows the expression levels of green fluorescent protein in HEK293 cells. The target protein is encoded by mRNA constructs having different termination elements: C1, C5, C7, and C9. [Figure 18G]This graph shows the expression levels of green fluorescent protein in HEK293 cells. The target protein is encoded by mRNA constructs having different termination elements: C1, C5, C7, and C9. [Figure 18H] This plot shows the read-through rate of green fluorescent protein in HeLa cells. The target protein is encoded by mRNA constructs with different termination elements: C1, C3, C5, C7, and C9. [Figure 18I] This plot shows the read-through rate of green fluorescent protein in HEK293 cells. The target protein is encoded by mRNA constructs having different termination elements: C1, C3, C5, C7, and C9. [Figure 19A] This plot shows the expression levels of the target protein in HeLa cells over 24 hours. The target protein is encoded by mRNA constructs having different termination elements: C1, C5, C10, C7, C8, and C9. [Figure 19B] This plot shows the expression levels of the target protein in HeLa cells after 48 hours. The target protein is encoded by mRNA constructs having different termination elements: C1, C5, C10, C7, C8, and C9. [Figure 19C] This plot shows the expression levels of the target protein in HeLa cells at 24 and 48 hours. The target protein is encoded by mRNA constructs having different termination elements: C1, C5, C10, C7, C8, and C9. [Figure 19D] This plot shows the expression levels of the target protein in HEK293 cells over 24 hours. The target protein is encoded by mRNA constructs having different termination elements: C1, C5, C10, C7, C8, and C9. [Figure 19E] This plot shows the expression levels of the target protein in HEK293 cells after 48 hours. The target protein is encoded by mRNA constructs having different termination elements: C1, C5, C10, C7, C8, and C9. [Figure 19F] This plot shows the expression levels of the target protein in HEK293 cells at 24 and 48 hours. The target protein is encoded by mRNA constructs having different termination elements: C1, C5, C10, C7, C8, and C9. [Figure 20A] This plot shows the expression levels of the target protein in HeLa cells at 24 and 48 hours. The target protein is encoded by mRNA constructs having different termination elements: C1, C5, C10, C7, C8, and C9. [Figure 20B] This plot shows the expression levels of the target protein in Hep3b cells at 24 and 48 hours. The target protein is encoded by mRNA constructs having different termination elements: C1, C5, C10, C7, C8, and C9. [Figure 21A] This plot shows the in vivo expression levels of target proteins encoded by mRNA constructs having different stop codon elements: C1, C5, C10, C7, C8, and C9. [Figure 21B] This plot shows the in vivo expression levels of target proteins encoded by mRNA constructs having different stop codon elements: C1, C5, C10, C7, C8, and C9. [Figure 21C] This plot shows the in vivo expression levels of target proteins encoded by mRNA constructs having different stop codon elements: C1, C5, C10, C7, C8, and C9. [Figure 21D] This plot shows the in vivo expression levels of target proteins encoded by mRNA constructs having different stop codon elements: C1, C5, C10, C7, C8, and C9. [Figure 21E] This plot shows the in vivo expression levels of target proteins encoded by mRNA constructs having different stop codon elements: C1, C5, C10, C7, C8, and C9, over time. [Figure 22A]This plot shows the in vivo expression levels of target proteins encoded by mRNA constructs having different stop codon elements: C1, C10, C7, C8, and C9. [Figure 22B] This plot shows the in vivo expression levels of target proteins encoded by mRNA constructs having different stop codon elements: C1, C10, C7, and C8, over time. [Figure 22C] This plot shows the expression levels in hepatocytes of target proteins encoded by mRNA constructs having different stop codon elements: C1, C10, C7, C8, and C9. [Figure 22D] This plot shows the expression levels in spleen cells of target proteins encoded by mRNA constructs having different stop codon elements: C1, C10, C7, C8, and C9. [Figure 22E] This plot shows the in vivo expression levels of target proteins encoded by mRNA constructs having different stop codon elements: C1, C10, C7, C8, and C9. [Figure 23A] This plot shows the expression levels in hepatocyte islets of target proteins encoded by mRNA constructs having different stop codon elements: C1, C5, C10, C7, C8, and C9. [Figure 23B] This plot shows the expression levels in hepatocyte islets of target proteins encoded by mRNA constructs having different stop codon elements: C1, C5, C10, C7, C8, and C9. [Figure 23C] This plot shows the expression levels in hepatocyte islets of target proteins encoded by mRNA constructs having different stop codon elements: C1, C5, C10, C7, C8, and C9. [Figure 23D] This plot shows the expression levels in hepatocyte islets of target proteins encoded by mRNA constructs having different stop codon elements: C1, C5, C10, C7, C8, and C9. [Figure 24A]This plot shows the expression levels in hepatocyte islets of target proteins encoded by mRNA constructs having different stop codon elements: C1, C5, C10, C7, C8, and C9. [Figure 24B] This plot shows the expression levels in hepatocyte islets of target proteins encoded by mRNA constructs having different stop codon elements: C1, C5, C10, C7, C8, and C9. [Figure 24C] This plot shows the expression levels in hepatocyte islets of target proteins encoded by mRNA constructs having different stop codon elements: C1, C5, C10, C7, C8, and C9. [Figure 24D] This plot shows the expression levels in hepatocyte islets of target proteins encoded by mRNA constructs having different stop codon elements: C1, C5, C10, C7, C8, and C9. [Figure 25A] This plot shows the time course of target protein expression in rat hepatocyte islets in vivo. The target protein is encoded by mRNA constructs having different stop codon elements: C1, C5, C10, C7, C8, and C9. [Figure 25B] This plot shows the time course of target protein expression in cynomolgus monkey hepatocyte islets in vivo. The target protein is encoded by mRNA constructs having different stop codon elements: C1, C5, C10, C7, C8, and C9. [Figure 25C] This plot shows the time course of the expression level of a target protein in human hepatocyte islets in vivo. The target protein is encoded by mRNA constructs having different stop codon elements: C1, C5, C10, C7, C8, and C9. [Figure 25D] This plot shows the time course of target protein expression in rat hepatocyte islets in vivo. The target protein is encoded by mRNA constructs having different stop codon elements: C1, C5, C10, C7, C8, and C9. [Figure 25E]This plot shows the time course of target protein expression in cynomolgus monkey hepatocyte islets in vivo. The target protein is encoded by mRNA constructs having different stop codon elements: C1, C5, C10, C7, C8, and C9. [Figure 25F] This plot shows the time course of the expression level of a target protein in human hepatocyte islets in vivo. The target protein is encoded by mRNA constructs having different stop codon elements: C1, C5, C10, C7, C8, and C9. [Figure 26] A and B are plots showing the expression levels of immune checkpoint proteins in CD11c+MHCII+ cells 24 hours and 72 hours after administration of mRNA constructs with and without the 3' stabilizing region. [Figure 27A] This plot shows the expression levels of immune checkpoint proteins in the livers of mice administered with mRNA constructs containing a 3' stabilizing region and those without. [Figure 27B] This plot shows the expression levels of immune checkpoint proteins in the spleen of mice administered with mRNA constructs having and without a 3' stabilizing region. [Figure 27C] This plot shows the expression levels of immune checkpoint proteins in the plasma of mice administered with mRNA constructs having a 3' stabilizing region and those without. [Figure 28] Plots A and B show the expression levels of immune checkpoint proteins in CD11c+MHCII+ cells 72 hours and 120 hours after administration of mRNA constructs with and without the 3' stabilizing region. [Figure 29A] This plot shows the expression levels of immune checkpoint proteins in the liver of mice 72 hours after administration of mRNA constructs with and without a 3' stabilizing region. [Figure 29B]This plot shows the expression levels of immune checkpoint proteins in the liver of mice 120 hours after administration of mRNA constructs with and without a 3' stabilizing region. [Figure 29C] This plot shows the expression levels of immune checkpoint proteins in the spleen of mice 72 hours after administration of mRNA constructs with and without a 3' stabilizing region. [Figure 29D] This plot shows the expression levels of immune checkpoint proteins in the spleen of mice 120 hours after administration of mRNA constructs with and without a 3' stabilizing region. [Figure 30A] This plot shows the expression levels of immune checkpoint proteins in rat hepatocytes. The target protein constructs are encoded by mRNA having different stop codons: C1, C5, and C7, and possessing and lacking a 3' stabilizing region, respectively. [Figure 30B] This plot shows the expression levels of immune checkpoint proteins in cynomolgus monkey hepatocytes. The target protein constructs are encoded by mRNA having different stop codons: C1, C5, and C7, with and without a 3' stabilizing region, respectively. [Figure 30C] This plot shows the expression levels of immune checkpoint proteins in human hepatocytes. The target protein constructs are encoded by mRNA having different stop codons: C1, C5, and C7, with and without a 3' stabilizing region, respectively. [Figure 31A] This plot shows the expression levels of immune checkpoint proteins in dendritic cells derived from individual donors. The target protein construct is encoded by mRNA having a 3' stabilizing region and different stop codons: C1, C5, and C7. [Figure 31B] This plot shows the expression levels of immune checkpoint proteins in dendritic cells derived from individual donors. The target protein construct is encoded by mRNA having a 3' stabilizing region and different stop codons: C1, C5, and C7. [Figure 31C] This plot shows the expression levels of immune checkpoint proteins in dendritic cells derived from individual donors. The target protein construct is encoded by mRNA having a 3' stabilizing region and different stop codons: C1, C5, and C7. [Figure 32A] This plot shows the expression levels of the target protein in mice. The target protein construct is encoded by mRNA having different 5'UTR and stop codon pairs: A11 / C1, A1 / C1, A11 / C8, and A1 / C8. [Figure 32B] This plot shows the expression level of a target protein over time in mice. The target protein construct is encoded by mRNA having different 5'UTR and stop codon pairs: A11 / C1, A1 / C1, A3 / C1, A11 / C8, A1 / C8, and A3 / C8. [Figure 32C] This plot shows the expression levels of the target protein in mouse hepatocytes. The target protein construct is encoded by mRNA having different 5'UTR and stop codon pairs: A11 / C1, A1 / C1, A11 / C8, and A1 / C8. [Figure 32D] This plot shows the expression levels of the target protein in mouse spleen cells. The target protein construct is encoded by mRNA having different 5'UTR and stop codon pairs: A11 / C1, A1 / C1, A11 / C8, and A1 / C8. [Figure 32E] This plot shows the expression levels of the target protein in mice. The target protein construct is encoded by mRNA having different 5'UTR and stop codon pairs: A11 / C1, A1 / C1, A11 / C8, and A1 / C8. [Figure 32F] This plot shows the expression level of a target protein over time in mice. The target protein construct is encoded by mRNA having different 5'UTR and stop codon pairs: A11 / C1, A1 / C1, A3 / C1, A11 / C8, A1 / C8, and A3 / C8. [Figure 33A]This plot shows the protein expression levels of green fluorescent protein in HeLa cells. The target protein construct is encoded by mRNA having different 3'UTR:B10 and B18. Target protein levels were evaluated over 60 hours. [Figure 33B] This plot shows the protein expression levels of green fluorescent protein in HeLa cells. The target protein construct is encoded by mRNA having different 3'UTR:B10 and B18. Target protein levels were evaluated over 60 hours. [Figure 33C] This plot shows the protein expression levels of green fluorescent protein in HeLa cells. The target protein construct is encoded by mRNA having different 3'UTR:B10 and B18. Target protein levels were evaluated over 60 hours. [Figure 33D] This plot shows the protein expression levels of green fluorescent protein in HeLa cells. The target protein construct is encoded by mRNA having different 3'UTR:B10 and B18. Target protein levels were evaluated over 60 hours. [Figure 34] Plots A and B represent the protein expression levels of the target protein in mice. The target protein construct is encoded by mRNA having different 3'UTR:B10 and B18. Target protein levels were assessed over 72 hours. [Figure 35] A and B are plots showing the expression levels of the target protein in mice over 120 hours. The target protein construct is encoded by mRNA having different 5'UTRs: A12, A14, A15, A18, A20, A26, A27, and A11 (reference). [Figure 36A] This plot shows the expression levels of the target protein in mice two days after administration of the mRNA construct. The target protein construct is encoded by mRNA having different 5'UTR:A12, A14, A20, A26, A27, A15, and A11. [Figure 36B] This plot shows the expression levels of the target protein in mice 4 days after administration of the mRNA construct. The target protein construct is encoded by mRNA having different 5'UTR:A12, A14, A20, A26, A27, A15, and A11. [Figure 36C] This plot shows the expression levels of the target protein in hepatocytes isolated from mice 5 days after administration of the mRNA construct. The target protein construct is encoded by mRNA having different 5'UTRs: A12, A14, A20, A26, A27, A15, and A11. [Figure 36D] This plot shows the expression levels of the target protein in spleen cells isolated from mice 5 days after administration of the mRNA construct. The target protein construct is encoded by mRNA having different 5'UTR:A12, A14, A20, A26, A27, A15, and A11. [Modes for carrying out the invention]

[0655] The potency and persistence of mRNA can be optimized by (1) ensuring that the mRNA delivered to the cytoplasm properly and productively associates with ribosomes; and (2) maximizing the time that the mRNA spends actively producing the desired protein product. The mRNA sequence is a key determinant of its capabilities across these aspects.

[0656] This specification discloses, in particular, the finding that the sequences of the 5' untranslated region (UTR), 3'UTR, and / or stop element of mRNA can be optimized to increase the potency and / or persistence of the mRNA. In some embodiments, this disclosure provides polynucleotide and LNP compositions comprising optimized 5'UTR, 3'UTR, and / or stop element that can increase the potency (e.g., level and / or activity) of mRNA or polypeptide encoded by the mRNA.

[0657] Exemplary effects on the expression of proteins encoded by mRNA and / or mRNA constructs disclosed herein are provided in Examples 1-13 and 14-18. Examples 1-8 demonstrate increased levels and / or activity (e.g., increased protein expression, increased activity, and / or duration of protein expression) of target proteins encoded by mRNA having A1 5'UTR or its variant (A2 5'UTR or A3 5'UTR). Example 9 discloses the discovery and use of B1 3'UTR to extend the half-life of the mRNA construct. Examples 10-13 demonstrate increased levels and / or activity (e.g., increased protein expression, increased activity, and / or duration of protein expression) of target proteins encoded by mRNA having a stop element selected from stop elements C2-C11. In vivo effects of mRNA constructs having combinations of 5'UTR, 3'UTR and / or stop elements disclosed herein are provided in Examples 15-18. Increased levels and / or activity of target proteins are observed across cell types, species, and target proteins as a whole.

[0658] Accordingly, this specification discloses polynucleotides encoding polypeptides, comprising a coding region including (a) a 5'UTR (e.g., as described herein), (b) a stop element (e.g., as described herein), and (c) a 3'UTR (e.g., as described herein), as well as LNP compositions comprising them. In one embodiment, the coding region comprises a polynucleotide sequence (e.g., mRNA) encoding a payload (e.g., a therapeutic payload or a preventive payload). In one embodiment, the level and / or activity (e.g., expression level or half-life) of the polynucleotide (e.g., mRNA) or the polypeptide encoded by the polynucleotide is increased. In one embodiment, the level and / or activity of the polynucleotide (e.g., mRNA) is increased. In one embodiment, the level and / or activity, or duration of expression of the polypeptide encoded by the polynucleotide is increased. Also disclosed herein are methods of using LNP compositions comprising the polynucleotides disclosed herein to treat a disease or disorder in a subject or to promote a desired biological effect.

[0659] definition Polyuridine tract: The terms "polyuridine tract" and "polyuracil tract" are used interchangeably herein and refer to a contiguous interval in a nucleic acid sequence containing two or more uridine or uracil molecules. A polyuridine tract can be present at any position or section of a nucleic acid sequence. In one embodiment, the polyuridine tract is present at the 5'UTR of the nucleic acid sequence. In one embodiment, the polyuridine tract contains at least two, three, four, five, six, seven, eight, nine, ten, eleven, or twelve contiguous uridine molecules. In one embodiment, the nucleic acid sequence may contain more than one polyuridine tract. In one embodiment, these more than one polyuridine tracts may be arranged adjacent to one another or separated by one or more nucleotides.

[0660] Uridine content: The terms "uridine content" and "uracil content" are interchangeable and refer to the amount of uracil or uridine present in a particular nucleic acid sequence. Uridine content or uracil content can be expressed as an absolute value (the total number of uridine or uracil in the sequence) or a relative value (the percentage of uridine or uracil relative to the total number of nucleic acid bases in the sequence).

[0661] Stop element: As used herein, the term “stop element” refers to a nucleic acid sequence containing a stop codon. The stop codon may be selected from TGA, TAA, and TAG in the case of DNA, or from UGA, UAA, and UAG in the case of RNA. In one embodiment, the stop element comprises two consecutive stop codons. In one embodiment, the stop element comprises three consecutive stop codons. In one embodiment, the stop element comprises four consecutive stop codons. In one embodiment, the stop element comprises five consecutive stop codons. In one embodiment, the stop element further comprises at least one, two, three, four, five, six, seven, eight, nine, ten, eleven, or twelve nucleotides upstream and / or downstream of one or more stop codons.

[0662] 3' stabilizing region: As used herein, the term “3' stabilizing region” refers to a region that is stabilized or will be stabilized. The 3' stabilizing region may be located at the 3' end of a nucleic acid sequence. In one embodiment, the 3' stabilizing region comprises a poly(A) tail (e.g., as described herein). In one embodiment, the 3' stabilizing region comprises an alternative nucleoside (e.g., an inverted thymidine).

[0663] Sequence Identity: The calculation of sequence identity between sequences can be performed as follows: To determine the percentage of identity between two nucleotide sequences, the sequences are aligned for optimal comparison purposes (for example, gaps may be introduced in one or both of the first and second nucleotide sequences for optimal alignment). In some embodiments, the length of the reference sequence aligned for comparison purposes is at least 50% (e.g., at least 60%, 70%, 80%, 90%, or 100%) of the length of the reference sequence. Nucleotides at corresponding nucleotide positions are compared. If a position in the first sequence is occupied by the same nucleotide as the nucleotide at the corresponding position in the second sequence, then the molecules are identical at that position. The percentage of identity between two sequences is a function of the number of identical positions shared between the sequences, taking into account the number of gaps that need to be introduced for optimal alignment of the two sequences and the length of each gap. The percentage of identity usually refers to the ratio of the number of matching residues to the total length of the alignment. The comparison between sequences and the determination of the percentage of identity between two sequences can be achieved using mathematical algorithms. In some embodiments, the degree of identity between two nucleotide sequences is determined using a pairwise sequence alignment program or a multiple sequence alignment program. Exemplary sequence alignment programs include, but are not limited to, the lalign program (embnet.vital-it.ch; Huang and Miller, (1991) Adv. Appl. Math. 12:337-357) and the Clustal Omega program (www.ebi.ac.uk; Sievers et al. (2011) Mol. Syst. Biol. 7:539). In some embodiments, the default parameters of the program are used. Nucleotide sequences described herein may be used, for example, as "query sequences" for searching public databases to identify other family members or related sequences.Such searches can be performed using the BLAST® program (blast.ncbi.nlm.nhi.gov; Altschul, et al. (1990) J.Mol.Biol.215:403-10). For example, a BLAST nucleotide search can be performed using the blastn program to obtain nucleotide sequences identical or similar to those described herein. In some embodiments, the default parameters of the program are used.

[0664] Alternative Nucleosides: When the term “alternative nucleosides” is used herein with respect to nucleotides, nucleosides, or polynucleotides (such as the polynucleotides of the present invention, e.g., mRNA molecules), it refers to modifications to A, G, U, or C ribonucleotides. Generally, these terms are not intended herein to refer to modifications of ribonucleotides at the naturally occurring 5' terminal mRNA cap site. Such modifications may be a variety of different modifications. In some embodiments, if the polynucleotide is mRNA, the coding region, adjacent regions, and / or terminal regions (e.g., the 3' stabilizing region) may contain one, two, or more (arbitrarily different) nucleoside or nucleotide modifications. In some embodiments, alternative polynucleotides introduced into cells may exhibit reduced degradation within the cell compared to unmodified polynucleotides.

[0665] Administration: As used herein, “administration” refers to the method of delivering the composition to a subject or patient. The method of administration may be selected to deliver targeted (e.g., specifically) to a particular area or system of the body. For example, administration may be parenteral (e.g., subcutaneous, intradermal, intravenous, intraperitoneal, intramuscular, intra-articular, intra-arterial, intra-arterial, intra-articular, intra-articular, intrasternal, intrathecal, intrafocal, or intracranial injection, and any preferred infusion technique), oral, transdermal or intradermal, interdermal, rectal, vaginal, topical (e.g., by powder, ointment, cream, gel, lotion, and / or drops), mucous membrane, nose, cheek, enteral, vitreous, intratumoral, sublingual, intranasal; by intratracheal infusion, bronchial infusion, and / or inhalation; as oral spray and / or powder, nasal spray, and / or aerosol, and / or via portal vein catheter. Preferred means of administration are intravenous or subcutaneous.

[0666] Antibody molecules: In one embodiment, antibody molecules may be used for targeting a desired cell type. As used herein, “antibody molecule” refers to naturally occurring antibodies, engineered antibodies, or fragments thereof, e.g., the antigen-binding portion of a naturally occurring or engineered antibody. Examples of antibody molecules include antibodies or their antigen-binding fragments (e.g., Fab, Fab', F(ab')2, Fv fragment, scFv antibody fragment, disulfide-linked Fv(sdFv), Fd fragment consisting of VH and CH1 domains, linear antibodies, single-domain antibodies such as sdAb (either VL or VH), nanobodies, or camelid VHH domains), antigen-binding fibronectin type III (Fn3) scaffolds such as fibronectin polypeptide minibodies, ligands, cytokines, chemokines, or T cell receptors (TCRs). Examples of antibody molecules include humanized antibody molecules, intact IgA, IgG, IgE, or IgM antibodies; bi- or multispecific antibodies (e.g., Zybodies®); antibody fragments such as Fab fragments, Fab' fragments, F(ab')2 fragments, Fd' fragments, Fd fragments, and isolated CDRs or sets thereof; single-chain Fv; polypeptide-Fc fusions; single-domain antibodies (e.g., shark single-domain antibodies such as IgNAR or fragments thereof); camelid antibodies; masked antibodies (e.g., Probody®); and small modular antibodies. Examples include, but are not limited to, ImmunoPharmaceutical ("SMIP"); single-chain or tandem diabody (TandAb)); VHH; Anticalin (registered trademark); Nanobody (registered trademark); Minibody; BiTE (registered trademark); Ankyrin repeat protein or DARPIN (registered trademark); Avimer (registered trademark); DART; TCR-like antibody; Adnectin (registered trademark); Affilin (registered trademark); Trans-body (registered trademark); Affibody (registered trademark); TrimerX (registered trademark); MicroProtein; Fynomer (registered trademark); Centyrin (registered trademark); and KALBITOR (registered trademark).

[0667] Approximately, about: As used herein, the terms “approximately” or “about” refer to a value that is similar to the given reference value when applied to the value of one or more subjects. In certain embodiments, unless otherwise stated or evident from the context (unless such a number exceeds 100% of the possible values), the terms “approximately” or “about” refer to a range of values ​​that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) the given reference value. For example, when used in the context of a given amount of compound in the lipid component of an LNP, “about” may mean + / - 5% of the listed value. For example, an LNP containing a lipid component having about 40% of a given compound may contain 30–50% of the compound.

[0668] Conjugated: As used herein, the term “conjugated” means, when used in relation to two or more parts, that the parts physically associate or link together, either directly or through one or more additional parts acting as linkers, to form a sufficiently stable structure, which remains physically associated under the conditions under which the structure is used, for example, under physiological conditions. In some embodiments, the two or more parts may be conjugated by direct covalent chemical bonds. In other embodiments, the two or more parts may be conjugated by ionic bonds or hydrogen bonds.

[0669] Contact: As used herein, the term “contact” means to establish a physical connection between two or more entities. For example, contacting a cell with an mRNA or lipid nanoparticle composition means to establish a physical connection between the cell and the mRNA or lipid nanoparticles. Methods for contacting cells with external entities in vivo, in vitro, and ex vivo are well known in the field of biology. In exemplary embodiments of this disclosure, the step of contacting mammalian cells with a composition (e.g., nanoparticles of this disclosure, or pharmaceutical composition) is performed in vivo. For example, contact between a lipid nanoparticle composition and cells that may be placed within an organism (e.g., a mammal) (e.g., mammalian cells) may be performed by any preferred route of administration (e.g., parenteral administration to the organism, including intravenous, intramuscular, intradermal, and subcutaneous administration). In cells present in vitro, the composition (e.g., lipid nanoparticles) and the cells may be contacted, for example, by adding the composition to the culture medium of the cells, which may involve or result in transfection. Furthermore, two or more cells may be contacted with the nanoparticle composition.

[0670] Delivery: As used herein, the term “delivery” means providing an entity to a recipient. For example, delivery to a target of a therapeutic and / or prophylactic agent may require administration of the LNP containing the therapeutic and / or prophylactic agent to the target (e.g., via intravenous, intramuscular, intradermal, pulmonary, or subcutaneous routes). Administration of LNP to a mammal or mammalian cell may require contact of one or more cells with lipid nanoparticles.

[0671] Encapsulation: As used herein, the term “encapsulate” means to enclose, surround, or encase. In some embodiments, a compound, polynucleotide (e.g., mRNA), or other composition may be fully encapsulated, partially encapsulated, or substantially encapsulated. For example, in some embodiments, the mRNA of this disclosure may be encapsulated in lipid nanoparticles (e.g., liposomes).

[0672] Encapsulation efficiency: As used herein, “encapsulation efficiency” refers to the amount of therapeutic and / or prophylactic agent that becomes part of the LNP relative to the initial total amount of therapeutic and / or prophylactic agent used in the preparation of the LNP. For example, if 97 mg of therapeutic and / or prophylactic agent out of a total of 100 mg initially provided to the composition is encapsulated in the LNP, the encapsulation efficiency may be 97%. As used herein, “encapsulation” may refer to complete, substantial, or partial enclosure, confinement, surrounding, or encasement.

[0673] Effective Dose: As used herein, the term “effective dose” of a drug means an amount sufficient to produce a beneficial or desired outcome, e.g., a clinical outcome, and therefore, the “effective dose” depends on the context in which it is applied. For example, in terms of the amount of target cell delivery-enhanced lipids in the lipid composition (e.g., LNP) of this disclosure, the effective dose of the target cell delivery-enhanced lipids is sufficient to produce a beneficial or desired outcome compared to a lipid composition (e.g., LNP) lacking the target cell delivery-enhanced lipids. Non-limiting examples of beneficial or desired outcomes produced by a lipid composition (e.g., LNP) include an increase in the percentage of transfected cells and / or an increase in the expression level of proteins encoded by nucleic acids associated with / encapsulated with the lipid composition (e.g., LNP). In terms of administering target cell delivery-enhanced lipid-containing lipid nanoparticles so that an effective amount of lipid nanoparticles is taken up by target cells of interest, the effective dose of target cell delivery-enhanced lipid-containing LNP is sufficient to produce a beneficial or desired outcome compared to LNP lacking the target cell delivery-enhanced lipids. Non-limiting examples of beneficial or desired outcomes in a subject include an increased percentage of transfected cells compared to LNPs lacking target cell delivery-enhancing lipids, increased expression levels of proteins encoded by nucleic acids associated with / encapsulated with target cell delivery-enhancing lipid-containing LNPs, and / or increased in vivo prophylactic or therapeutic effects of nucleic acids associated with / encapsulated with target cell delivery-enhancing lipid-containing LNPs or the proteins they encode. In some embodiments, a therapeutically effective amount of target cell delivery-enhancing lipid-containing LNPs is sufficient to treat, improve, diagnose, prevent, and / or delay the onset of symptoms of an infection, disease, disorder, and / or condition when administered to a subject suffering from or susceptible to such an infection, disease, disorder, and / or condition. In another embodiment, an effective amount of lipid nanoparticles is sufficient to result in the expression of a desired protein in at least about 5%, 10%, 15%, 20%, 25% or more of target cells.For example, an effective dose of target cell delivery-enhancing lipid-containing LNP may be an amount that results in the transfection of at least 5%, 10%, 15%, 20%, 25%, 30%, or 35% of target cells after a single intravenous injection.

[0674] Expression: As used herein, “expression” of a nucleic acid sequence means one or more of the following events: (1) generation of an RNA template from a DNA sequence (e.g., by transcription), (2) processing of an RNA transcript (e.g., by splicing, editing, 5' cap formation, and / or 3' end processing), (3) translation of RNA into a polypeptide or protein, and (4) post-translational modification of a polypeptide or protein.

[0675] Ex-vivo: As used herein, the term “ex-vivo” refers to an event occurring outside of a living organism (e.g., an animal, plant, or microorganism, or its cells or tissues). Ex-vivo events can occur in environments minimally altered from their natural (e.g., in-vivo) environment.

[0676] Fragment: As used herein, “fragment” means a portion. For example, a protein fragment may include a polypeptide obtained by digesting a full-length protein isolated from cultured cells or by recombinant DNA technology. A protein fragment may be, for example, a portion of a protein that contains one or more functional domains such that the protein fragment retains the functional activity of the protein.

[0677] GC-rich: As used herein, the term "GC-rich" refers to a nucleic acid base component of a polynucleotide (e.g., mRNA) or any portion thereof (e.g., RNA element) that includes guanine (G) and / or cytosine (C) nucleic acid bases, or derivatives or analogs thereof, and has a GC content greater than about 50%. The term "GC-rich" refers to all or part of a polynucleotide, including but not limited to genes, non-coding regions, 5'UTR, 3'UTR, open reading frames, RNA elements, sequence motifs, or any individual sequence, fragment, or segment thereof, with a GC content of about 50%. In some embodiments of this disclosure, a GC-rich polynucleotide, or any portion thereof, consists solely of guanine (G) and / or cytosine (C) nucleic acid bases.

[0678] GC Content: As used herein, the term “GC content” means the percentage of guanine (G) and cytosine (C) nucleic acid bases, or their derivatives or analogs, in a polynucleotide (e.g., mRNA) or a portion thereof (e.g., an RNA element) (in the total number of possible nucleic acid bases, including adenine (A) and thymine (T) or uracil (U) in DNA and RNA, and their derivatives or analogs). The term “GC content” means all or part of a polynucleotide, including but not limited to genes, non-coding regions, 5' or 3' UTRs, open reading frames, RNA elements, sequence motifs, or any individual sequence, fragment, or segment thereof.

[0679] Non-homologous: As used herein, “non-homologous” means that a sequence (e.g., an amino acid sequence or a polynucleotide encoding an amino acid sequence) is not normally present in a given polypeptide or polynucleotide. For example, an amino acid sequence corresponding to a domain or motif of one protein may be non-homologous to a second protein. Isolated: As used herein, the term “isolated” means a substance or entity that has been separated from at least some of the components to which it was associated (whether in nature or in a laboratory setting). Isolated substances may have varying levels of purity in relation to the substances to which they were associated. Isolated substances and / or entities may be separated from at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or more of the other components to which they were originally associated. In some embodiments, isolated agents are about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more than 99% pure. As used herein, a substance is “pure” if it is substantially free of other components.

[0680] Kozak Sequence: The term “Kozak sequence” (also known as “Kozak consensus sequence”) refers to a translation initiation enhancer element that enhances the expression of a gene or open reading frame, located at 5'UTR in eukaryotes. The Kozak consensus sequence was originally defined as the sequence GCCRCC (SEQ ID NO: 43) (R=purine) following an analysis of the effect of a single mutation around the start codon (AUG) in the translation of the preproinsulin gene (Kozak (1986) Cell 44:283-292). The polynucleotides disclosed herein include Kozak consensus sequences, or derivatives or modifications thereof. (For examples of translation enhancer compositions and methods of use thereof, see U.S. Patent No. 5,807,707 by Andrews et al., incorporated herein by reference as a whole; U.S. Patent No. 5,723,332 by Chernajovsky, incorporated herein by reference as a whole; and U.S. Patent No. 5,891,665 by Wilson, incorporated herein by reference as a whole.)

[0681] Scanning Miss: The phenomenon known as "scanning miss" can occur when the PIC bypasses the start codon and continues scanning downstream until an alternative or substitute start codon is recognized. Depending on the frequency of occurrence, this bypass of the start codon by the PIC can reduce translation efficiency. Furthermore, if translation from this downstream AUG codon occurs, it can produce undesirable abnormal translation products that may not induce the desired therapeutic response. In some cases, these abnormal translation products may actually cause adverse reactions (Kracht et al., (2017) Nat Med 23(4):501-507).

[0682] Liposome: As used herein, “liposome” means a structure comprising a lipid-containing membrane surrounding an aqueous interior. A liposome may have one or more lipid membranes. Examples of liposomes include single-layered liposomes (also known in the art as unilamellar liposomes) and multi-layered liposomes (also known in the art as multilamellar liposomes).

[0683] Modified: As used herein, “modified” means a change in state or structure of a molecule of the Disclosure (e.g., a change in the composition or structure of a polynucleotide (e.g., mRNA)). A molecule (e.g., a polynucleotide) can be modified in a variety of ways, for example, chemically, structurally, and / or functionally. For example, a molecule (e.g., a polynucleotide) may be structurally modified by the incorporation of one or more RNA elements, in which case the RNA elements include a sequence and / or secondary structure(s) of RNA that provides one or more functions (e.g., translational regulatory activity). Thus, a molecule (e.g., a polynucleotide) of the Disclosure may include one or more modifications (e.g., one or more chemical, structural, or functional modifications (including any combination thereof)). In one embodiment, a polynucleotide (e.g., an mRNA molecule) of the Disclosure is modified, for example, by the introduction of unnatural nucleosides and / or nucleotides relating to natural ribonucleotides A, U, G, and C. Non-standard nucleotides, such as those with cap structures, differ in chemical structure from A, C, G, and U ribonucleotides, but are not considered "modified."

[0684] mRNA: As used herein, “mRNA” refers to messenger ribonucleic acid. mRNA may be naturally occurring or not. For example, mRNA may contain one or more nucleic acid bases, nucleosides, nucleotides, or linkers, and / or components that are not naturally occurring. mRNA may contain a cap structure, a chain termination nucleoside, a stem-loop, a poly(A) sequence, and / or a polyadenylation signal. mRNA may have a nucleotide sequence that codes for a polypeptide. When mRNA is translated, for example, when mRNA is translated in vivo in a mammalian cell, polypeptides may be produced. Traditionally, the basic components of an mRNA molecule include at least one coding region, a 5' untranslated region (5'UTR), a 3'UTR, a 5' cap, and a poly(A) sequence. In one embodiment, the mRNA is circular mRNA.

[0685] Nanoparticles: As used herein, “nanoparticles” refers to particles having any one structural feature that exhibits novel properties when compared to a bulk sample of the same material, on a scale of less than about 1000 nm. Typically, nanoparticles have any one structural feature on a scale of less than about 500 nm, less than about 200 nm, or about 100 nm. Also typically, nanoparticles have any one structural feature on a scale of about 50 nm to about 500 nm, about 50 nm to about 200 nm, or about 70 to about 120 nm. In exemplary embodiments, nanoparticles are particles having one or more sizes on the order of about 1 to 1000 nm. In other exemplary embodiments, nanoparticles are particles having one or more sizes on the order of about 10 to 500 nm. In other exemplary embodiments, nanoparticles are particles having one or more sizes on the order of about 50 to 200 nm. Spherical nanoparticles, for example, would have a diameter of about 50 to 100 or 70 to 120 nanometers. Nanoparticles, in most cases, behave as a single unit in terms of their transport and properties. Novel properties that differentiate nanoparticles from their corresponding bulk materials typically occur at size scales of less than 1000 nm or around 100 nm, although it should be noted that nanoparticle sizes can be larger, for example, for elliptical or tubular particles. While the sizes of most molecules should fit the above outline, individual molecules are not usually referred to as nanoparticles.

[0686] Nucleic acids: As used herein, the term “nucleic acid” is used in its broadest sense and encompasses any compound and / or substance containing polymers of nucleotides. These polymers are often referred to as polynucleotides. Exemplary nucleic acids or polynucleotides of this disclosure include, but are not limited to, ribonucleic acid (RNA), deoxyribonucleic acid (DNA), DNA-RNA hybrids, RNAi inducers, RNAi agents, siRNA, shRNA, miRNA, antisense RNA, ribozymes, catalytic DNA, RNA that induces triple helix formation, threose nucleic acid (TNA), glycol nucleic acid (GNA), peptide nucleic acid (PNA), locked nucleic acid (LNA (LNA having a β-D-ribo configuration, α-LNA having an α-L-ribo configuration (a diastereomer of LNA), 2'-amino-LNA having a 2'-amino functional group, and 2'-amino-α-LNA having a 2'-amino functional group)), or hybrids thereof.

[0687] Nucleic acid structure: As used herein, the term “nucleic acid structure” (used interchangeably with “polynucleotide structure”) refers to the arrangement or organization of the atoms, chemical components, elements, motifs, and / or linked nucleotide sequences, or derivatives or analogues thereof, that constitute a nucleic acid (e.g., mRNA). The term also refers to the two-dimensional or three-dimensional state of a nucleic acid. Thus, the term “RNA structure” refers to the arrangement or organization of the atoms, chemical components, elements, motifs, and / or linked nucleotide sequences, or derivatives or analogues thereof, that constitute an RNA molecule (e.g., mRNA), and / or the two-dimensional and / or three-dimensional state of an RNA molecule. Nucleic acid structures can be further divided into four organizational categories, referred herein as “molecular structure,” “primary structure,” “secondary structure,” and “tertiary structure,” based on increasing complexity of organization.

[0688] Nucleic acid bases: As used herein, the term “nucleic acid base” (or “nucleotide base” or “nitrogen base”) refers to purine or pyrimidine heterocyclic compounds found in nucleic acids, including any naturally occurring derivatives or analogues of purines and pyrimidines that confer enhanced properties (e.g., binding affinity, nuclease resistance, chemical stability) to nucleic acids or parts or segments thereof. Adenine, cytosine, guanine, thymine, and uracil are primarily nucleic acid bases found in naturally occurring nucleic acids. Other natural, unnatural, and / or synthetic nucleic acid bases known in the art and / or described herein may be incorporated into nucleic acids.

[0689] Nucleoside / Nucleotide: As used herein, the term “nucleoside” refers to a compound that contains a sugar molecule (e.g., ribose in RNA or deoxyribose in DNA) or a derivative or analogue of a nucleic acid base (e.g., purine or pyrimidine) or its derivative or analogue (these are also referred herein as “nucleo acid bases”) covalently bonded to a nucleic acid base (e.g., purine or pyrimidine), but lacks an internucleoside linking group (e.g., a phosphate group). As used herein, the term “nucleotide” refers to a nucleoside covalently bonded to an internucleoside linking group (e.g., a phosphate group), or any derivative, analogue, or modification thereof that confers enhanced chemical and / or functional properties (e.g., binding affinity, nuclease resistance, chemical stability) to a nucleic acid or a portion or segment thereof.

[0690] Open Reading Frame: As used herein, the term “Open Reading Frame,” abbreviated as “ORF,” refers to a segment or region of an mRNA molecule that encodes a polypeptide. An ORF consists of a sequence of non-overlapping in-frame codons, beginning with a start codon and ending with a stop codon, and is translated by a ribosome.

[0691] Patient: As used herein, “patient” means a person who seeks or may require treatment, requests treatment, is receiving treatment, seeks treatment, or is being treated by a trained professional for a particular disease or condition. In certain embodiments, patient is a human patient. In some embodiments, patient is a person suffering from an autoimmune disease (e.g., those described herein).

[0692] Pharmacovigilant: The term "pharmacovigilant" is used herein to mean a compound, material, composition and / or dosage form that is suitable for use in contact with human and animal tissues without excessive toxicity, irritation, allergic reactions, or other problems or complications, within the bounds of safe medical judgment, and that is commensurate with a reasonable benefit / risk ratio.

[0693] Pharmaceutically acceptable excipients: The term "pharmaceutically acceptable excipients," as used herein, means any component other than the compounds described herein (e.g., a vehicle capable of suspending or dissolving the active compound) that is substantially nontoxic and non-inflammatory in the patient. Examples of excipients include antifouling agents, antioxidants, binders, coatings, compression aids, disintegrants, dyes (colorants), emollients, emulsifiers, fillers (diluents), film-forming agents or coatings, flavoring agents, fragrances, fluidizers (flow enhancers), lubricants, preservatives, printing inks, adsorbents, suspending agents or dispersants, sweeteners, and hydration water. Examples of excipients include, but are not limited to, butylated hydroxytoluene (BHT), calcium carbonate, dibasic calcium phosphate, calcium stearate, croscarmellose, cross-linked polyvinylpyrrolidone, citric acid, crospovidone, cysteine, ethylcellulose, gelatin, hydroxypropylcellulose, hydroxypropylmethylcellulose, lactose, magnesium stearate, maltitol, mannitol, methionine, methylcellulose, methylparaben, microcrystalline cellulose, polyethylene glycol, polyvinylpyrrolidone, povidone, pregelatinized starch, propylparaben, retinyl palmitate, shellac, silicon dioxide, sodium carboxymethylcellulose, sodium citrate, sodium starch glycolate, sorbitol, starch (corn), stearic acid, sucrose, talc, titanium dioxide, vitamin A, vitamin E, vitamin C, and xylitol.

[0694] pharmaceutically acceptable salts: As used herein, “pharmaceutically acceptable salts” means derivatives of the disclosed compounds in which the parent compound is modified by converting an existing acidic or base moiety to its salt form (for example, by reacting a free base group with a suitable organic acid). Examples of pharmaceutically acceptable salts include, but are not limited to, inorganic or organic acidic salts of basic residues such as amines, and alkali or organic salts of acidic residues such as carboxylic acids. Typical acid addition salts include acetate, acetate, adipine, alginate, ascorbate, aspartate, benzenesulfonate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphor sulfonate, citrate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethanesulfonate, fumarate, glucoheptone, glycerophosphate, hemisulfate, heptone, hexanoate, hydrobromide, hydrochloride, hydroiodide, and 2-hydroxy- Examples include tansulfonates, lactobionates, lactates, laurates, lauryl sulfates, malates, maleates, malons, methanesulfonates, 2-naphthalenesulfonates, nicotinates, nitrates, oleates, oxalates, palmitates, pamoates, pectins, persulfates, 3-phenylpropionates, phosphates, picrates, pivalates, propions, stearates, succinates, sulfates, tartrates, thiocyanates, toluenesulfonates, undecanoates, and valersates. Typical alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, etc., as well as non-toxic ammonium, quaternary ammonium, and amine cations, such as, but not limited to, ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, and ethylamine. The pharmaceutically acceptable salts of this disclosure include, for example, conventional non-toxic salts of parent compounds formed from non-toxic inorganic or organic acids. The pharmaceutically acceptable salts of this disclosure can be synthesized from parent compounds containing basic or acidic moieties by conventional chemical methods.Generally, such salts can be prepared by reacting the free acid or base form of these compounds with a stoichiometric amount of a suitable base or acid in water, an organic solvent, or a mixture of the two (generally, non-aqueous media such as ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are preferred). A list of suitable salts can be found in Remington's Pharmaceutical Sciences, 17th ed., Mack Publishing Company, Easton, Pa., 1985, p. 1418, Pharmaceutical Salts: Properties, Selection, and Use, PHStahl and CGWermuth (eds.), Wiley-VCH, 2008, and Berge et al., Journal of Pharmaceutical Science, 66, 1-19 (1977), each of which is incorporated herein by reference in whole.

[0695] Polypeptide: As used herein, the terms “polypeptide” or “polypeptide of interest” refer to polymers of amino acid residues typically linked by peptide bonds, which can be produced naturally (e.g., by isolation or purification) or synthetically.

[0696] RNA: As used herein, “RNA” means ribonucleic acid, which may or may not be naturally occurring. For example, RNA may include modified and / or naturally occurring components, such as one or more nucleic acid bases, nucleosides, nucleotides, or linkers. RNA may include a cap structure, a chain termination nucleoside, a stem-loop, a poly(A) sequence, and / or a polyadenylation signal. RNA may have a nucleotide sequence that codes for a polypeptide of interest. For example, RNA may be messenger RNA (mRNA). Translation of mRNA that codes for a particular polypeptide, such as in vivo intracellular mammalian translation of mRNA, may produce the coded polypeptide. RNA may be selected from an unrestricted group consisting of small interfering RNA (siRNA), asymmetric interfering RNA (aiRNA), microRNA (miRNA), dicer substrate RNA (dsRNA), small hairpin RNA (shRNA), mRNA, long non-coding RNA (lncRNA), and mixtures thereof.

[0697] RNA Elements: As used herein, the term “RNA element” refers to a portion, fragment, or segment of an RNA molecule that imparts a biological function and / or biological activity (e.g., translational regulatory activity). Modifying a polynucleotide by incorporating one or more RNA elements, such as those described herein, imparts one or more desirable functional properties to the modified polynucleotide. The RNA elements described herein may be naturally occurring, not naturally occurring, synthetic, manipulated, or any combination thereof. For example, naturally occurring RNA elements that impart regulatory activity include elements found throughout the transcriptomes of viruses, prokaryotes, and eukaryotes (e.g., humans). RNA elements in certain eukaryotic mRNAs and translated viral RNAs have been shown to be involved in mediating many functions in cells.Examples of natural RNA elements include translation initiation elements (e.g., intrasequence ribosome entry sites (IRES), see Kieft et al., (2001) RNA 7(2):194-206), translational enhancer elements (e.g., APP mRNA translational enhancer elements, see Rogers et al., (1999) J Biol Chem 274(10):6421-6431), mRNA stability elements (e.g., AU-rich elements (AREs), see Garneau et al., (2007) Nat Rev Mol Cell Biol 8(2):113-126), translational repressor elements (e.g., Blumer et al., (2002) Mech Dev 110(1-2):97-112), and protein-binding RNA elements (e.g., iron-responsive elements, see Selezneva et al., (2013) J Mol Biol Examples include, but are not limited to, cytoplasmic polyadenylated elements (see 425(18):3301-3310), cytoplasmic polyadenylated elements (Villalba et al., (2011) Curr Opin Genet Dev 21(4):452-457), and catalytic RNA elements (e.g., ribozymes; see Scott et al., (2009) Biochim Biophys Acta 1789(9-10):634-641).

[0698] Specific delivery: As used herein, the terms “specific delivery,” “deliver specifically,” or “deliver specifically” mean that a greater amount (e.g., at least 10% more, at least 20% more, at least 30% more, at least 40% more, at least 50% more, at least 1.5 times more, at least 2 times more, at least 3 times more, at least 4 times more, at least 5 times more, at least 6 times more, at least 7 times more, at least 8 times more, at least 9 times more, at least 10 times more) of a therapeutic and / or prophylactic agent is delivered by nanoparticles to target cells of interest (e.g., mammalian target cells) compared to off-target cells (e.g., non-target cells). The level of nanoparticle delivery to specific cells may be measured by comparing the amount of protein produced in target cells to that of non-target cells (e.g., by mean fluorescence intensity using flow cytometry), by comparing the percentage of target cells expressing the protein to that of non-target cells (e.g., by quantitative flow cytometry), by comparing the amount of protein produced in target cells to that of non-target cells to that of the total protein in target cells to that of the total protein in non-target cells, or by comparing the amount of therapeutic and / or prophylactic drugs in target cells to that of non-target cells to that of the total therapeutic and / or prophylactic drugs in target cells to that of the total therapeutic and / or prophylactic drugs in non-target cells. It will be understood that the ability of nanoparticles to specifically deliver to target cells does not need to be determined in the subject being treated, but may be determined in surrogates such as animal models (e.g., mouse models or NHP models).

[0699] Substantially: As used herein, the term “substantially” refers to a qualitative state in which the desired nature or characteristic is exhibited to a complete or near-complete degree or extent. Those skilled in the art of biology will understand that biological and chemical phenomena rarely, if not entirely, reach completion and / or progress to a complete state, or achieve or avoid absolute results. Thus, the term “substantially” is used herein to capture the potential lack of completeness inherent in many biological and chemical phenomena.

[0700] To suffer from: An individual who "suffers from" a disease, disorder, and / or medical condition is diagnosed with or exhibits one or more symptoms of the disease, disorder, and / or medical condition.

[0701] Targeting moiety: As used herein, “targeting moiety” is a compound or drug capable of targeting nanoparticles to specific cell types, tissue types, and / or organ types.

[0702] Therapeutic Agent: The term “therapeutic agent” refers to any agent that, when administered to a subject, has a therapeutic, diagnostic, and / or prophylactic effect and / or induces a desired biological and / or pharmacological effect. In some embodiments, the therapeutic agent includes or is a therapeutic payload. In some embodiments, the therapeutic agent includes or is a small molecule or biological substance (e.g., an antibody molecule).

[0703] Transfection: As used herein, the term “transfection” refers to a method of introducing a species (e.g., polynucleotides such as mRNA) into a cell.

[0704] Translational regulatory activity: As used herein, the term “translational regulatory activity” (used interchangeably with “translational regulatory function”) refers to a biological function, mechanism, or process that modulates (e.g., regulate, influence, control, or alter) the activity of the translation machinery, including the activity of PIC and / or ribosomes. In some embodiments, the desired translational regulatory activity increases and / or enhances the translation fidelity of mRNA translation. In some embodiments, the desired translational regulatory activity reduces and / or inhibits scanning leaks.

[0705] Subject: As used herein, the term “subject” means any organism to which the compositions according to this disclosure may be administered, for example, for experimental, diagnostic, prophylactic, and / or therapeutic purposes. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans) and / or plants. In some embodiments, the subject may be a patient.

[0706] Treatment: As used herein, the term “treatment” means to partially or completely reduce, improve, improve, alleviate, delay the onset of, inhibit the progression of, reduce the severity of, and / or reduce the incidence of one or more symptoms or characteristics of a particular infection, disease, disorder, and / or condition. For example, “treatment” of cancer may mean inhibiting the survival, growth, and / or spread of the tumor. Treatment may be applied to subjects that do not show signs of a disease, disorder, and / or condition, and / or subjects that show only early signs of a disease, disorder, and / or condition, for the purpose of reducing the risk of developing a condition associated with the disease, disorder, and / or condition.

[0707] Prevention: As used herein, the term “prevention” means partially or completely inhibiting the development of one or more symptoms or characteristics of a particular infectious disease, illness, disorder, and / or medical condition.

[0708] Unmodified: As used herein, “unmodified” refers to any substance, compound, or molecule before it is altered in any way. Unmodified may, but not always, refer to a wild-type or native biomolecule. A molecule may undergo a series of modifications, each of which can act as an “unmodified” starting molecule for subsequent modifications.

[0709] Uridine content: The terms "uridine content" and "uracil content" are interchangeable and refer to the amount of uracil or uridine present in a particular nucleic acid sequence. Uridine content or uracil content can be expressed as an absolute value (the total number of uridine or uracil in the sequence) or as a relative value (the percentage of uridine or uracil relative to the total number of nucleic acid bases in the sequence).

[0710] Uridine-modified sequences: The term “uridine-modified sequence” refers to nucleic acids (e.g., synthetic mRNA sequences) whose sequences have been optimized to have a globally or locally different uridine content (higher or lower uridine content), or to nucleic acids whose sequences have been optimized to have a different uridine pattern (e.g., a gradient distribution or clustering) relative to the uridine content and / or uridine pattern of a candidate nucleic acid sequence. In the context of this disclosure, the terms “uridine-modified sequence” and “uracil-modified sequence” are considered synonymous and interchangeable.

[0711] A "high-uridine codon" is defined as a codon containing two or three uridine molecules, a "low-uridine codon" is defined as a codon containing one uridine molecule, and a "uridine-free codon" is a codon that does not contain uridine. In some embodiments, uridine-modified sequences include substitution of high-uridine codons with low-uridine codons, substitution of high-uridine codons with non-uridine codons, substitution of low-uridine codons with high-uridine codons, substitution of low-uridine codons with non-uridine codons, substitution of non-uridine codons with low-uridine codons, substitution of non-uridine codons with high-uridine codons, and combinations thereof. In some embodiments, a high-uridine codon can be replaced with another high-uridine codon. In some embodiments, a low-uridine codon can be replaced with another low-uridine codon. In some embodiments, a non-uridine codon can be replaced with another non-uridine codon. Uridine-modified sequences may be uridine-enriched or uridine-diluted.

[0712] Uridine enrichment: As used herein, “uridine enrichment” and its grammatical variation refer to an increase in the uridine content (expressed as an absolute value or as a percentage) of a sequence-optimized nucleic acid (e.g., a synthetic mRNA sequence) relative to the uridine content of the corresponding candidate nucleic acid sequence. Uridine enrichment can be carried out by substituting codons in the candidate nucleic acid sequence with synonymous codons containing fewer uridine nucleic acid bases. Uridine enrichment may be whole (i.e., over the entire length of the candidate nucleic acid sequence) or local (i.e., over a subsequence or region of the candidate nucleic acid sequence).

[0713] Uridine Dilution: As used herein, “uridine dilution” and its grammatical variation refer to the reduction in the uridine content (expressed as an absolute value or as a percentage) of a sequence-optimized nucleic acid (e.g., a synthetic mRNA sequence) relative to the uridine content of the corresponding candidate nucleic acid sequence. Uridine dilution can be performed by substituting codons in the candidate nucleic acid sequence with synonymous codons containing fewer uridine nucleic acid bases. Uridine dilution can be whole (i.e., over the entire length of the candidate nucleic acid sequence) or local (i.e., over a subsequence or region of the candidate nucleic acid sequence).

[0714] Variant: As used herein, the term “variant” means a molecule that, when measured by assays recognized in the art, has at least 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the activity of the wild-type molecule, or has structural similarity to the wild-type molecule.

[0715] 5' UTR array The 5'UTR sequence is important for ribosome recruitment to mRNA and has been reported to play a role in translation (Hinnebusch A, et al., (2016) Science, 352:6292:1413-6).

[0716] This specification discloses polynucleotides encoding polypeptides, wherein the polynucleotide has a 5'UTR that confers an increased half-life, increased expression level, and / or increased activity of the polypeptide encoded by the polynucleotide, or the polynucleotide itself. In one embodiment, the polynucleotide disclosed herein comprises (a) a 5'UTR (e.g., one shown in Table 1 or a variant or fragment thereof), (b) a coding region containing a termination element (e.g., one described herein), and (c) a 3'UTR (e.g., one described herein), and an LNP composition comprising these. In one embodiment, the polynucleotide comprises a 5'UTR containing a sequence or a variant or fragment thereof (e.g., a functional variant or fragment thereof) shown in Table 1. It will be understood that such 5'UTRs are incorporated into constructs not found in nature (for example, such 5'UTRs are synthetic, have altered sequences of naturally occurring 5'UTRs, are cleaved or extended versions of naturally occurring ones, contain chemically modified bases, or are located at 5' of an ORF sequence different from those that may be found in nature).

[0717] In one embodiment, the sequence fragment shown in Table 1 lacks at least the first (i.e., the 5'-sidemost) 1, 2, 3, 4, 5, or 6 nucleotides of the sequence shown in Table 1. In one embodiment, the sequence fragment shown in Table 1 lacks the first nucleotide of the sequence shown in Table 1. In one embodiment, the sequence fragment shown in Table 1 lacks the first 2 nucleotides of the sequence shown in Table 1. In one embodiment, the sequence fragment shown in Table 1 lacks the first 3 nucleotides of the sequence shown in Table 1. In one embodiment, the sequence fragment shown in Table 1 lacks the first 4 nucleotides of the sequence shown in Table 1. In one embodiment, the sequence fragment shown in Table 1 lacks the first 5 nucleotides of the sequence shown in Table 1. In one embodiment, the sequence fragment shown in Table 1 lacks the first 6 nucleotides of the sequence shown in Table 1.

[0718] In one embodiment, the polynucleotide includes a 5'UTR containing a sequence that lacks at least the first 1, 2, 3, 4, 5, or 6 nucleotides of the sequence shown in Table 1, but is otherwise at least 50% (e.g., at least 60%, 70%, 80%, 90%, 95%, 96%, 98%, 99%, or 100%) identical to the sequence shown in Table 1. In one embodiment, the polynucleotide includes a 5'UTR containing a sequence that is otherwise at least 50% (e.g., at least 60%, 70%, 80%, 90%, 95%, 96%, 98%, 99%, or 100%) identical to the sequence shown in Table 1, but lacking the first two nucleotides of the sequence shown in Table 1. In one embodiment, the polynucleotide includes a 5'UTR containing a sequence that is otherwise at least 50% (e.g., at least 60%, 70%, 80%, 90%, 95%, 96%, 98%, 99%, or 100%) identical to the sequence shown in Table 1, but lacking the first three nucleotides of the sequence shown in Table 1. In one embodiment, the polynucleotide includes a 5'UTR containing a sequence that is otherwise at least 50% (e.g., at least 60%, 70%, 80%, 90%, 95%, 96%, 98%, 99%, or 100%) identical to the sequence shown in Table 1, but lacking the first four nucleotides of the sequence shown in Table 1. In one embodiment, the polynucleotide includes a 5'UTR containing a sequence that is otherwise at least 50% (e.g., at least 60%, 70%, 80%, 90%, 95%, 96%, 98%, 99%, or 100%) identical to the sequence shown in Table 1, but lacking the first five nucleotides of the sequence shown in Table 1.In one embodiment, the polynucleotide comprises a 5'UTR containing a sequence that lacks the first six nucleotides of the sequence shown in Table 1, but is otherwise at least 50% (e.g., at least 60%, 70%, 80%, 90%, 95%, 96%, 98%, 99%, or 100%) identical to the sequence shown in Table 1.

[0719] In one embodiment, the polynucleotide having the 5'UTR sequence or a variant or fragment thereof shown in Table 1 has an increased half-life (for example, an increase of about 1.5 to 20 times). In one embodiment, the increase in half-life is about 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 times or more. In one embodiment, the increase in half-life is about 1.5 times or more. In one embodiment, the increase in half-life is about 2 times or more. In one embodiment, the increase in half-life is about 3 times or more. In one embodiment, the increase in half-life is about 4 times or more. In one embodiment, the increase in half-life is about 5 times or more.

[0720] In one embodiment, the polynucleotide having the 5'UTR sequence or a variant or fragment thereof shown in Table 1 increases the level and / or activity (e.g., production) of the polypeptide encoded by the polynucleotide. In one embodiment, the 5'UTR increases the level and / or activity (e.g., production) of the polypeptide encoded by the polynucleotide by about 1.5 to 20 times. In one embodiment, the increase in level and / or activity is about 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 times or more. In one embodiment, the increase in level and / or activity is about 1.5 times or more. In one embodiment, the increase in level and / or activity is about 2 times or more. In one embodiment, the increase in level and / or activity is about 3 times or more. In one embodiment, the increase in level and / or activity is about 4 times or more. In one embodiment, the increase in the level and / or activity is about five times or more.

[0721] In one embodiment, the increase is compared to other similar polynucleotides that do not have a 5'UTR, have a different 5'UTR, or do not have the 5'UTR or its variants or fragments listed in Table 1.

[0722] In one embodiment, the increase in the half-life of the polynucleotide is measured according to an assay for measuring the half-life of the polynucleotide (for example, the assay described in any one of the examples disclosed herein).

[0723] In one embodiment, an increase in the level and / or activity (e.g., production) of the polypeptide encoded by the polynucleotide is measured according to an assay that measures the level and / or activity of the polypeptide (e.g., the assay described in any one of the examples disclosed herein).

[0724] In one embodiment, the 5'UTR includes a sequence shown in Table 1 or a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the 5'UTR sequence shown in Table 1, or a variant or fragment thereof (for example, a fragment lacking the first 1, 2, 3, 4, 5, or 6 nucleotides of the 5'UTR sequence shown in Table 1). In one embodiment, the 5'UTR includes sequences that are at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence numbers 1, 2, 3, 4, 5, 6, 8, 41, 42, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 88, 89, or 90.

[0725] In one embodiment, the 5'UTR includes a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a fragment of the 5'UTR sequence shown in Table 1 (for example, SEQ ID NOs. 1, 2, 3, 4, 5, 6, 8, 41, 42, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 88, 89, or 90), and the fragment is shown in Table 1. The 5'UTR sequence is missing at least the first 1, 2, 3, 4, 5, or 6 nucleotides (for example, missing nucleotide 1, nucleotide 1-2, nucleotide 1-3, nucleotide 1-4, or nucleotide 1-5 in any of the following sequences: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 88, SEQ ID NO: 89, or SEQ ID NO: 90).

[0726] In one embodiment, the 5'UTR includes a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 1, or a fragment thereof that lacks the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 1. In one embodiment, the 5'UTR includes a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 2, or a fragment thereof that lacks the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 2. In one embodiment, the 5'UTR includes a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 3, or a fragment thereof that lacks the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 3. In one embodiment, the 5'UTR includes a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 4, or a fragment thereof that lacks the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 4. In one embodiment, the 5'UTR includes a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 5, or a fragment thereof that lacks the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 5. In one embodiment, the 5'UTR includes a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 6, or a fragment thereof that lacks the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 6. In one embodiment, the 5'UTR includes a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 8, or a fragment thereof that lacks the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 8.In one embodiment, the 5'UTR includes a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 41, or a fragment thereof that lacks the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 41. In one embodiment, the 5'UTR includes a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 42, or a fragment thereof that lacks the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 42. In one embodiment, the 5'UTR includes a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 63, or a fragment thereof that lacks the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 63. In one embodiment, the 5'UTR includes a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 64, or a fragment thereof that lacks the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 64. In one embodiment, the 5'UTR includes a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 65, or a fragment thereof that lacks the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 65. In one embodiment, the 5'UTR includes a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 66, or a fragment thereof that lacks the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 66. In one embodiment, the 5'UTR includes a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 67, or a fragment thereof that lacks the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 67.In one embodiment, the 5'UTR includes a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 68, or a fragment thereof that lacks the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 68. In one embodiment, the 5'UTR includes a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 69, or a fragment thereof that lacks the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 69. In one embodiment, the 5'UTR includes a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 70, or a fragment thereof that lacks the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 70. In one embodiment, the 5'UTR includes a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 71, or a fragment thereof that lacks the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 71. In one embodiment, the 5'UTR includes a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 72, or a fragment thereof that lacks the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 72. In one embodiment, the 5'UTR includes a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 73, or a fragment thereof that lacks the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 73. In one embodiment, the 5'UTR includes a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 74, or a fragment thereof that lacks the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 74.In one embodiment, the 5'UTR includes a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 75, or a fragment thereof that lacks the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 75. In one embodiment, the 5'UTR includes a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 76, or a fragment thereof that lacks the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 76. In one embodiment, the 5'UTR includes a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 77, or a fragment thereof that lacks the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 77. In one embodiment, the 5'UTR includes a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 78, or a fragment thereof that lacks the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 78. In one embodiment, the 5'UTR includes a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 88, or a fragment thereof that lacks the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 88. In one embodiment, the 5'UTR includes a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 89, or a fragment thereof that lacks the first 1, 2, 3, 4, 5, 6, or more nucleotides of sequence number 89. In one embodiment, the 5'UTR includes a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence number 90, or a fragment thereof that lacks the first two, three, four, five, six, or more nucleotides of sequence number 90. [Table 1-1] [Table 1-2]

Table 1-3

[0727] In one embodiment, the 5'UTR contains the variant of SEQ ID NO: 1. In one embodiment, the variant of SEQ ID NO: 1 is the nucleic acid sequence of formula A: GGAAAUCGCAAAA(N2) X (N3) X CU(N4) X (N5) X contains CGCGUUAGAUUUCUUUUAGUUUUCUN6N7CAACUAGCAAGCUUUUUGUUCUCGCC(N8CC)x (SEQ ID NO: 46), wherein, (N2) x is uracil and x is an integer from 0 to 5 (for example, x = 3 or 4); (N3) x is guanine and x is an integer from 0 to 1; (N4) x is cytosine and x is an integer from 0 to 1; (N5) x is uracil and x is an integer from 0 to 5 (for example, x = 2 or 3); N6 is uracil or cytosine; N7 is uracil or guanine; N8 is adenine or guanine and x is an integer from 0 to 1.

[0728] In one embodiment, (N2) x is uracil and x is 0. In one embodiment, (N2) x is uracil and x is 1. In one embodiment, (N2) x is uracil and x is 2. In one embodiment, (N2) x is uracil and x is 3. In one embodiment, (N2) x is uracil and x is 4. In one embodiment, (N2) x is uracil and x is 5.

[0729] In one embodiment, (N3) x is guanine, and x is 0. In one embodiment, (N3) x x is guanine, and x is 1.

[0730] In one embodiment, (N4) x x is cytosine, and x is 0. In one embodiment, (N4) x x is cytosine, and x is 1.

[0731] In one embodiment, (N5) x is uracil, and x is 0. In one embodiment, (N5) x is uracil, and x is 1. In one embodiment, (N5) x is uracil, and x is 2. In one embodiment, (N5) x is uracil, and x is 3. In one embodiment, (N5) x is uracil, and x is 4. In one embodiment, (N5) x x is uracil, and x is 5.

[0732] In one embodiment, N6 is uracil. In another embodiment, N6 is cytosine.

[0733] In one embodiment, N7 is uracil. In another embodiment, N7 is guanine.

[0734] In one embodiment, N8 is adenine and x is 0. In another embodiment, N8 is adenine and x is 1.

[0735] In one embodiment, N8 is guanine and x is 0. In another embodiment, N8 is guanine and x is 1.

[0736] In one embodiment, the 5'UTR includes a variant of SEQ ID NO: 1. In one embodiment, the variant of SEQ ID NO: 1 includes a sequence or fragment that is at least 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 1. In one embodiment, the variant of SEQ ID NO: 1 includes a sequence or fragment that is at least 50% identical to SEQ ID NO: 1. In one embodiment, the variant of SEQ ID NO: 1 includes a sequence or fragment that is at least 60% identical to SEQ ID NO: 1. In one embodiment, the variant of SEQ ID NO: 1 includes a sequence or fragment th...

Claims

1. mRNA that codes for polypeptides, (a) 5'UTR containing the nucleotide sequence described in SEQ ID NO: 1, SEQ ID NO: 41, or SEQ ID NO: 42, (b) A code region that codes for the polypeptide, including a termination element, and (c) 3'UTR, including, The aforementioned mRNA.

2. The 5'UTR includes the nucleotide sequence described in Sequence ID No.

1. mRNA according to claim 1.

3. The 5'UTR includes the nucleotide sequence described in Sequence ID No.

41. mRNA according to claim 1.

4. The 5'UTR includes the nucleotide sequence described in Sequence ID No.

42. mRNA according to claim 1.

5. (i) The code region of (b) includes a termination element having any one sequence of sequence numbers 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 56, 57, 62, 93, or 96; (ii) The 3'UTR in (c) above includes one sequence of sequence numbers 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 45, 79, 80, 81, 82, 83, 84, 85, 86, 87, 94, or 95, mRNA according to any one of claims 1 to 4.

6. The aforementioned 3'UTR includes a microRNA (miRNA) binding site. mRNA according to any one of claims 1 to 5.

7. The binding site includes one of the sequences of sequence numbers 38 to 40. The mRNA according to claim 6.

8. The 3'UTR is the mRNA according to any one of claims 1 to 7, comprising a TENT recruitment sequence.

9. The mRNA according to claim 8, wherein the TENT recruitment sequence includes the sequence of sequence number 91 or 92.

10. The mRNA contains one of the sequences 47, 48, 49, 50, 122, 52, 53, 54, 55, 59, 60, 61, 126, 127, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, or 120. mRNA according to any one of claims 1 to 9.

11. The polypeptide is a secreted protein, a membrane-bound protein, or an intracellular protein. mRNA according to any one of claims 1 to 10.

12. The mRNA according to claim 11, wherein the polypeptide is a cytokine, antibody, vaccine, receptor, enzyme, hormone, transcription factor, ligand, membrane transporter, structural protein, nuclease, or a variant or biologically active fragment thereof.

13. Further comprising at least one 5' cap structure, mRNA according to any one of claims 1 to 12.

14. The aforementioned 5' cap structure is 【Chemistry 1】 The sequence includes the following, where the underlined italicized G is an inverted G nucleotide followed by a 5'-5'-triphosphate group. mRNA according to claim 13.

15. 3' Further including the stabilization region, mRNA according to any one of claims 1 to 14.

16. (a) The 3' stabilizing region comprises a poly A tail (SEQ ID NO: 123) containing 80 to 150 adenines; (b) The poly-A tail includes the UCUAG sequence (sequence number 44); (c) The 3' stabilizing region comprises at least one alternative nucleoside; and / or (d) The 3' stabilization region has the structure of formula VII: 【Chemistry 2】 or a salt thereof, where each X is independently O or S, A represents adenine, and T represents thymine. mRNA according to claim 15.

17. The aforementioned poly-A tail contains one or more non-adenosine residues. mRNA according to claim 16.

18. The aforementioned poly-A tail contains one or more guanosines, mRNA according to claim 17.

19. The mRNA according to any one of claims 16 to 18, wherein the poly-A tail contains 80 to 120 adenines upstream of sequence number 44.

20. The mRNA according to any one of claims 16 to 19, wherein the poly-A tail contains 1 to 40 adenines downstream of sequence number 44.

21. The mRNA according to any one of claims 16 to 20, wherein the substitute nucleoside is an inverted thymidine (idT).

22. The mRNA contains at least one chemical modification selected from the group consisting of pseudouridine, N1-methylpsoiduridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thio-l-methyl-1-deazalpsoiduridine, 2-thio-l-methylpsoiduridine, 2-thio-5-azauridine, 2-thio-dihydropsoiduridine, 2-thio-dihydrouridine, 2-thiopsoiduridine, 4-methoxy-2-thiopsoiduridine, 4-methoxypsoiduridine, 4-thio-l-methylpsoiduridine, 4-thiopsoiduridine, 5-azauridine, dihydropsoiduridine, 5-methyluridine, 5-methyluridine, 5-methoxyuridine, and 2'-O-methyluridine. mRNA according to any one of claims 1 to 21.

23. A lipid nanoparticle (LNP) composition comprising mRNA according to any one of claims 1 to 22.

24. A pharmaceutical composition comprising the LNP composition described in claim 23.

25. A cell comprising the LNP composition according to claim 23.

26. A method for delivering the LNP composition according to claim 23 to cells, A method comprising contacting the cells with the LNP composition in vitro or ex vivo.

27. An LNP composition according to claim 25 or a pharmaceutical composition according to claim 26 for use in a method for treating or preventing a disease or disorder, a method for preventing the symptoms thereof, or a method for modulating an immune response in a human subject, wherein the method comprises administering an effective amount of the LNP composition or the pharmaceutical composition to a human subject in need thereof. The LNP composition or the pharmaceutical composition.

28. The LNP composition according to claim 23, the pharmaceutical composition according to claim 24, the cells according to claim 25, or the LNP composition or pharmaceutical composition for use according to claim 27, The LNP composition comprises (i) an ionized lipid, (ii) a sterol or other structural lipid, (iii) a noncationic helper lipid or phospholipid, and (iv) a PEG lipid. The LNP composition, the pharmaceutical composition, the cells, or the LNP composition or pharmaceutical composition for use.

29. The LNP composition, pharmaceutical composition, cells, or LNP composition or pharmaceutical composition for use according to claim 28, The ionized lipids include amino lipids. The LNP composition, the pharmaceutical composition, the cells, or the LNP composition or pharmaceutical composition for use.

30. An LNP composition, pharmaceutical composition, cell, or LNP composition or pharmaceutical composition for use according to claim 28 or 29, (a) The ionized lipid is of formula (I): 【Transformation 3】 Compounds thereof, or their N-oxides, salts or isomers thereof [In the formula: R1 is selected from the group consisting of C5-30 alkyl, C5-20 alkenyl, -R*YR'', -YR'', and -R''M''R''; R2 and R3 are independently selected from the group consisting of H, C1-14 alkyl, C2-14 alkenyl, -R*YR'', -YR'', and -R*OR'', or R2 and R3, together with the atom to which they are bonded, form a heterocycle or a carbocycle; R4 is selected from the group consisting of hydrogen, C3-6 carbocyclic groups, -(CH2)nQ, -(CH2)nCHQR, -CHQR, -CQ(R)2, and unsubstituted C1-6 alkyl groups, where Q is a carbocyclic group, heterocyclic group, -OR, -O(CH2)nN(R)2, -C(O)OR, -OC(O)R, -CX3, -CX2H, -CXH2, -CN, -N(R)2, -C(O)N(R)2, -N(R)C(O)R, -N(R)S(O)2R, -N(R)C(O)N(R)2, -N(R)C(S)N(R)2, -N(R)R8 , -N(R)S(O) 2 R 8 , -O(CH 2 ) n OR, -N(R)C(=NR 9 )N(R) 2 , -N(R)C(=CHR 9 )N(R) 2 , -OC(O)N(R) 2 , -N(R)C(O)OR, -N(OR)C(O)R, -N(OR)S(O) 2 R, -N(OR)C(O)OR, -N(OR)C(O)N(R) 2 , -N(OR)C(S)N(R) 2 , -N(OR)C(=NR 9 )N(R) 2 , -N(OR)C(=CHR 9 )N(R) 2 , -C(=NR 9 )N(R) 2 , -C(=NR 9)R, -C(O)N(R)OR, and -C(R)N(R) 2C(O)OR, where each n is independently selected from 1, 2, 3, 4, and 5; Each R5 is independently selected from the group consisting of C1-3 alkyl, C2-3 alkenyl, and H; Each R 6 is independently selected from the group consisting of C1-3 alkyl, C2-3 alkenyl, and H; M and M' are independently selected from -C(O)O-, -OC(O)-, -OC(O)-M''-C(O)O-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)2-, -S-S-, aryl groups, and heteroaryl groups, where M'' is a bond, a C1-13 alkyl, or a C2-13 alkenyl; R7 is selected from the group consisting of C1-3 alkyl, C2-3 alkenyl, and H; R8 is selected from the group consisting of C3-6 carbon rings and heterocycles; R9 is selected from the group consisting of H, CN, NO2, C1-6 alkyl, -OR, -S(O)2R, -S(O)2N(R)2, C2-6 alkenyl, C3-6 carbon ring, and heterocycle; Each R is independently selected from the group consisting of C1-3 alkyl, C2-3 alkenyl, and H; Each R' is independently selected from the group consisting of C1-18 alkyl, C2-18 alkenyl, -R*YR'', -YR'', and H; Each R'' is independently selected from the group consisting of C3-15 alkyl and C3-15 alkenyl groups; Each R* is independently selected from the group consisting of C1-12 alkyl and C2-12 alkenyl groups; Each Y is independently a C3-6 carbon ring; Each X is independently selected from the group consisting of F, Cl, Br, and I; and m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13; where R4 is -(CH2)nQ, -(CH2)nCHQR, -CHQR, or -CQ(R)2, then (i) Q is not -N(R)2 when n is 1, 2, 3, 4, or 5, or (ii) Q is not a 5, 6, or 7-membered heterocycloalkyl when n is 1 or 2. including; (b) The noncationic helper lipid or phospholipid comprises a compound selected from the group consisting of DSPC, DPPC, or DOPC; (c) The phospholipid is DSPC or formula (IV): 【Chemistry 4】 or its salt [In the formula, Each R1 is independently an optionally substituted alkyl group, or optionally two R1 groups together with an intervening atom to form an optionally substituted monocyclic carbocycline or an optionally substituted monocyclic heterocycline, or optionally three R1 groups together with an intervening atom to form an optionally substituted bicyclic carbocycline or an optionally substituted bicyclic heterocycline; n is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; m is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; A is the formula: 【Transformation 5】 It belongs to; Each example of L2 is independently a bonded or optionally substituted C1-6 alkylene, where one methylene unit of the optionally substituted C1-6 alkylene is optionally replaced with O, N(RN), S, C(O), C(O)N(RN), NRNC(O), C(O)O, OC(O), OC(O)O, OC(O)N(RN), NRNC(O)O, or NRNC(O)N(RN); Each example of R2 is independently an optionally substituted C1-30 alkyl, optionally substituted C1-30 alkenyl, or optionally substituted C1-30 alkynyl, where optionally one or more methylene units of R2 are independently an optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(RN), O, S, C(O), C(O)N(RN), NRN C(O), NRN C(O)N(RN), C(O)O, OC(O), -OC(O)O, OC(O)N(RN), NRN C(O)O, C(O)S, SC(O), C(=NRN), C(=NRN)N(RN), NRN C(=NR N ), NR N C(=NR N )N(R N ), C(S), C(S)N(R N ), NR N C(S), NR N C(S)N(R N ), S(O), OS(O), S(O)O, -OS(O)O, OS(O) 2 , S(O) 2 O. ), N(R N )S(O) 2 N(R N ), can be replaced with OS(O) 2N(RN) or -N(RN)S(O) 2O; Each example of R N is independently a hydrogen, optionally substituted alkyl, or nitrogen protecting group; Ring B is an optionally substituted carbocyclyl, an optionally substituted heterocyclyl, an optionally substituted aryl, or an optionally substituted heteroaryl; and p is either 1 or 2, However, the compound is not of the following formula: 【Transformation 6】 In the formula, each example of R 2 is independently an unsubstituted alkyl, an unsubstituted alkenyl, or an unsubstituted alkynyl. It is; (d) The structural lipid is selected from alpha-tocopherol, β-sitosterol, or cholesterol; (e) The PEG lipid is selected from the group consisting of PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol, and mixtures thereof; (f) The PEG lipid is selected from the group consisting of PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, and PEG-DSPE lipids, or The aforementioned PEG lipid is given by formula (V): 【Transformation 7】 or its salt [In the formula, R3 is -OR O; R O is a hydrogen atom, an optionally substituted alkyl group, or an oxygen protecting group; r is an integer between 1 and 100 (including both ends); L1 is an optionally substituted C1-10 alkylene, where at least one methylene group of the optionally substituted C1-10 alkylene is independently replaced by an optionally substituted carbocyclene, an optionally substituted heterocyclene, an optionally substituted arylene, an optionally substituted heteroarylene, O, N(RN), S, C(O), C(O)N(RN), NRNC(O), C(O)O, OC(O), OC(O)O, OC(O)N(RN), NRNC(O)O, or NRNC(O)N(RN); D is either a portion obtained by click chemistry or a portion that can be cleaved under physiological conditions; m is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; A is the formula: 【Transformation 8】 It belongs to; Each example of L2 is independently a bonded or optionally substituted C1-6 alkylene, where one methylene unit of the optionally substituted C1-6 alkylene is optionally replaced with O, N(RN), S, C(O), C(O)N(RN), NRNC(O), C(O)O, OC(O), OC(O)O, OC(O)N(RN), NRNC(O)O, or NRNC(O)N(RN); Each example of R2 is independently an optionally substituted C1-30 alkyl, optionally substituted C1-30 alkenyl, or optionally substituted C1-30 alkynyl, where optionally one or more methylene units of R2 are independently an optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(RN), O, S, C(O), C(O)N(RN), NRN C(O), NRN C(O)N(RN), C(O)O, OC(O), -OC(O)O, OC(O)N(RN), NRN C(O)O, C(O)S, SC(O), C(=NRN), C(=NRN)N(RN), NRN C(=NR N ), NR N C(=NR N )N(R N ), C(S), C(S)N(R N ), NR N C(S), NR N C(S)N(R N ), S(O), OS(O), S(O)O, -OS(O)O, OS(O) 2 , S(O) 2 O. ), N(R N )S(O) 2 N(R N ), can be replaced with OS(O) 2N(RN) or -N(RN)S(O) 2O; Each example of R N is independently a hydrogen, optionally substituted alkyl, or nitrogen protecting group; Ring B is an optionally substituted carbocyclyl, an optionally substituted heterocyclyl, an optionally substituted aryl, or an optionally substituted heteroaryl; and p is either 1 or 2. It is a compound selected from; (g) The LNP is composed of 20-60% ionized lipids, 5-25% phospholipids, 25-55% cholesterol, and 0.5-15% PEG lipids in a molar ratio; and / or (h) The LNP is formulated for intravenous, subcutaneous, intramuscular, intranasal, intraocular, rectal, pulmonary, or oral delivery. The LNP composition, the pharmaceutical composition, the cells, or the LNP composition or pharmaceutical composition for use.

31. The method according to claim 26, The LNP composition comprises (i) an ionized lipid, (ii) a sterol or other structural lipid, (iii) a noncationic helper lipid or phospholipid, and (iv) a PEG lipid. The aforementioned method.

32. The method according to claim 31, The ionized lipids include amino lipids. The aforementioned method.

33. A method according to claim 31 or 32, (a) The ionized lipid is of formula (I): 【Chemistry 9】 Compounds thereof, or their N-oxides, salts or isomers thereof [In the formula: R1 is selected from the group consisting of C5-30 alkyl, C5-20 alkenyl, -R*YR'', -YR'', and -R''M''R''; R2 and R3 are independently selected from the group consisting of H, C1-14 alkyl, C2-14 alkenyl, -R*YR'', -YR'', and -R*OR'', or R2 and R3, together with the atom to which they are bonded, form a heterocycle or a carbocycle; R4 is selected from the group consisting of hydrogen, C3-6 carbocyclic groups, -(CH2)nQ, -(CH2)nCHQR, -CHQR, -CQ(R)2, and unsubstituted C1-6 alkyl groups, where Q is a carbocyclic group, heterocyclic group, -OR, -O(CH2)nN(R)2, -C(O)OR, -OC(O)R, -CX3, -CX2H, -CXH2, -CN, -N(R)2, -C(O)N(R)2, -N(R)C(O)R, -N(R)S(O)2R, -N(R)C(O)N(R)2, -N(R)C(S)N(R)2, -N(R)R8 , -N(R)S(O) 2 R 8 , -O(CH 2 ) n OR, -N(R)C(=NR 9 )N(R) 2 , -N(R)C(=CHR 9 )N(R) 2 , -OC(O)N(R) 2 , -N(R)C(O)OR, -N(OR)C(O)R, -N(OR)S(O) 2 R, -N(OR)C(O)OR, -N(OR)C(O)N(R) 2 , -N(OR)C(S)N(R) 2 , -N(OR)C(=NR 9 )N(R) 2 , -N(OR)C(=CHR 9 )N(R) 2 , -C(=NR 9 )N(R) 2 , -C(=NR 9)R, -C(O)N(R)OR, and -C(R)N(R) 2C(O)OR, where each n is independently selected from 1, 2, 3, 4, and 5; Each R5 is independently selected from the group consisting of C1-3 alkyl, C2-3 alkenyl, and H; Each R 6 is independently selected from the group consisting of C1-3 alkyl, C2-3 alkenyl, and H; M and M' are independently selected from -C(O)O-, -OC(O)-, -OC(O)-M''-C(O)O-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)2-, -S-S-, aryl groups, and heteroaryl groups, where M'' is a bond, a C1-13 alkyl, or a C2-13 alkenyl; R7 is selected from the group consisting of C1-3 alkyl, C2-3 alkenyl, and H; R8 is selected from the group consisting of C3-6 carbon rings and heterocycles; R9 is selected from the group consisting of H, CN, NO2, C1-6 alkyl, -OR, -S(O)2R, -S(O)2N(R)2, C2-6 alkenyl, C3-6 carbon ring, and heterocycle; Each R is independently selected from the group consisting of C1-3 alkyl, C2-3 alkenyl, and H; Each R' is independently selected from the group consisting of C1-18 alkyl, C2-18 alkenyl, -R*YR'', -YR'', and H; Each R'' is independently selected from the group consisting of C3-15 alkyl and C3-15 alkenyl groups; Each R* is independently selected from the group consisting of C1-12 alkyl and C2-12 alkenyl groups; Each Y is independently a C3-6 carbon ring; Each X is independently selected from the group consisting of F, Cl, Br, and I; and m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13; where R4 is -(CH2)nQ, -(CH2)nCHQR, -CHQR, or -CQ(R)2, then (i) Q is not -N(R)2 when n is 1, 2, 3, 4, or 5, or (ii) Q is not a 5, 6, or 7-membered heterocycloalkyl when n is 1 or 2. including; (b) The noncationic helper lipid or phospholipid comprises a compound selected from the group consisting of DSPC, DPPC, or DOPC; (c) The phospholipid is DSPC or formula (IV): 【Chemistry 10】 or its salt [In the formula, Each R1 is independently an optionally substituted alkyl group, or optionally two R1 groups together with an intervening atom to form an optionally substituted monocyclic carbocycline or an optionally substituted monocyclic heterocycline, or optionally three R1 groups together with an intervening atom to form an optionally substituted bicyclic carbocycline or an optionally substituted bicyclic heterocycline; n is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; m is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; A is the formula: 【Chemistry 11】 It belongs to; Each example of L2 is independently a bonded or optionally substituted C1-6 alkylene, where one methylene unit of the optionally substituted C1-6 alkylene is optionally replaced with O, N(RN), S, C(O), C(O)N(RN), NRNC(O), C(O)O, OC(O), OC(O)O, OC(O)N(RN), NRNC(O)O, or NRNC(O)N(RN); Each example of R2 is independently an optionally substituted C1-30 alkyl, optionally substituted C1-30 alkenyl, or optionally substituted C1-30 alkynyl, where optionally one or more methylene units of R2 are independently an optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(RN), O, S, C(O), C(O)N(RN), NRN C(O), NRN C(O)N(RN), C(O)O, OC(O), -OC(O)O, OC(O)N(RN), NRN C(O)O, C(O)S, SC(O), C(=NRN), C(=NRN)N(RN), NRN C(=NR N ), NR N C(=NR N )N(R N ), C(S), C(S)N(R N ), NR N C(S), NR N C(S)N(R N ), S(O), OS(O), S(O)O, -OS(O)O, OS(O) 2 , S(O) 2 O. ), N(R N )S(O) 2 N(R N ), can be replaced with OS(O) 2N(RN) or -N(RN)S(O) 2O; Each example of R N is independently a hydrogen, optionally substituted alkyl, or nitrogen protecting group; Ring B is an optionally substituted carbocyclyl, an optionally substituted heterocyclyl, an optionally substituted aryl, or an optionally substituted heteroaryl; and p is either 1 or 2, However, the compound is not of the following formula: 【Chemistry 12】 In the formula, each example of R 2 is independently an unsubstituted alkyl, an unsubstituted alkenyl, or an unsubstituted alkynyl. It is; (d) The structural lipid is selected from alpha-tocopherol, β-sitosterol, or cholesterol; (e) The PEG lipid is selected from the group consisting of PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol, and mixtures thereof; (f) The PEG lipid is selected from the group consisting of PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, and PEG-DSPE lipids, or The aforementioned PEG lipid is given by formula (V): 【Chemistry 13】 or its salt [In the formula, R3 is -OR O; R O is a hydrogen atom, an optionally substituted alkyl group, or an oxygen protecting group; r is an integer between 1 and 100 (including both ends); L1 is an optionally substituted C1-10 alkylene, where at least one methylene group of the optionally substituted C1-10 alkylene is independently replaced by an optionally substituted carbocyclene, an optionally substituted heterocyclene, an optionally substituted arylene, an optionally substituted heteroarylene, O, N(RN), S, C(O), C(O)N(RN), NRNC(O), C(O)O, OC(O), OC(O)O, OC(O)N(RN), NRNC(O)O, or NRNC(O)N(RN); D is either a portion obtained by click chemistry or a portion that can be cleaved under physiological conditions; m is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; A is the formula: 【Chemistry 14】 It belongs to; Each example of L2 is independently a bonded or optionally substituted C1-6 alkylene, where one methylene unit of the optionally substituted C1-6 alkylene is optionally replaced with O, N(RN), S, C(O), C(O)N(RN), NRNC(O), C(O)O, OC(O), OC(O)O, OC(O)N(RN), NRNC(O)O, or NRNC(O)N(RN); Each example of R2 is independently an optionally substituted C1-30 alkyl, optionally substituted C1-30 alkenyl, or optionally substituted C1-30 alkynyl, where optionally one or more methylene units of R2 are independently an optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(RN), O, S, C(O), C(O)N(RN), NRN C(O), NRN C(O)N(RN), C(O)O, OC(O), -OC(O)O, OC(O)N(RN), NRN C(O)O, C(O)S, SC(O), C(=NRN), C(=NRN)N(RN), NRN C(=NR N ), NR N C(=NR N )N(R N ), C(S), C(S)N(R N ), NR N C(S), NR N C(S)N(R N ), S(O), OS(O), S(O)O, -OS(O)O, OS(O) 2 , S(O) 2 O. ), N(R N )S(O) 2 N(R N ), can be replaced with OS(O) 2N(RN) or -N(RN)S(O) 2O; Each example of R N is independently a hydrogen, optionally substituted alkyl, or nitrogen protecting group; Ring B is an optionally substituted carbocyclyl, an optionally substituted heterocyclyl, an optionally substituted aryl, or an optionally substituted heteroaryl; and p is either 1 or 2. It is a compound selected from; (g) The LNP is composed of 20-60% ionized lipids, 5-25% phospholipids, 25-55% cholesterol, and 0.5-15% PEG lipids in a molar ratio; and / or (h) The LNP is formulated for intravenous, subcutaneous, intramuscular, intranasal, intraocular, rectal, pulmonary, or oral delivery. The aforementioned method.

Images