Methods to reduce APOCIII expression

Abstract

Provided herein are methods for administering ISIS 678354 to improve familial hyperchylomicronemia syndrome (FCS), familial partial lipodystrophy (FPL), severe hypertriglyceridemia (SHTG), reduce APOCIII RNA, or reduce APOCIII protein in a human subject in need thereof. In certain instances, the methods are useful for improving at least one symptom of FCS, FPL, or SHTG. Such symptoms of FCS include, but are not limited to, severely elevated chylomicrons and extremely elevated TG levels (consistently well above 1000 mg / dL, and not uncommonly higher than 10,000 mg / dL) accompanied by episodes of abdominal pain, physical fatigue, difficulty thinking, diarrhea, recurrent acute pancreatitis, eruptive skin xanthomas, and hepatosplenomegaly.

Description

[Technical Field]

[0001] Sequence List This application is filed electronically along with a sequence listing. The sequence listing is provided as a file titled BIOL0406WOSEQ_ST25.txt, created on September 23, 2021, with a size of 8KB. The electronic information of the sequence listing is incorporated herein by reference in its entirety.

[0002] This specification provides a method of administering ISIS678354 to reduce APOCIII RNA or APOCIII protein in human subjects in need of it, to improve familial hyperchylomicronemia syndrome (FCS), familial partial lipodystrophy (FPL), and severe hypertriglyceridemia (SHTG). In certain cases, the method is useful in improving at least one symptom of FCS, FPL, or SHTG. Such symptoms of FCS include, but are not limited to, severe elevation of chylomicrons (severe hyperchylomicronemia) and extremely elevated TG levels (always well above 1,000 mg / dL, and not uncommonly rising above 10,000 mg / dL; severe hypertriglyceridemia), accompanied by the onset of abdominal pain, physical fatigue, difficulty thinking, diarrhea, recurrent acute pancreatitis, eruptive xanthomas, retinal lipidemia, and hepatosplenomegaly. [Background technology]

[0003] Familial hyperchylomicronemia syndrome (FCS) is a genetic disorder characterized by severe hypertriglyceridemia and hyperchylomicronemia. It is a rare autosomal recessive disorder that can be diagnosed in either childhood or adulthood. FCS is characterized by frequent and severe abdominal pain, recurrent colic, and recurrent episodes of potentially fatal acute pancreatitis, which can impair healthy growth in children (Familial Lipoprotein Lipase Deficiency. In GeneReviews. edited by Adam MP Pagon RA, Bird TD, et al. 1999-2011. Seattle, WA: University of Washington, Seattle; Etiology and risk of lactescent plasma and severe hypertriglyceridemia. J Clin Lipidol 2011;5:37-44). Physical examination frequently reveals eruptive xanthomas, retinal lipidemia, and hepatosplenomegaly, and plasma from patients appears emulsion-like, interfering with the determination of other laboratory parameters. Fasting plasma triglyceride levels in FCS patients are typically 10 to 100 times higher than normal (1,500 to 15,000 mg / dL) despite extreme dietary fat restriction (20 g or approximately 15-20% of daily calorie intake). Patients with FCS often present with recurrent episodes of abdominal pain or pancreatitis, eruptive xanthomas, or hepatomegaly in infancy or childhood. The diagnosis of FCS is then established by genotyping or confirmation of extremely low or absent lipoprotein lipase (LPL) enzyme activity in post-heparinized plasma. Patients with FCS or other familial disorders, such as familial partial steatosis (FPL), may present with severe hypertriglyceridemia.

[0004] Apolipoprotein C-III (also known as APOC3, APOC-III, ApoCIII, and APO C-III) is a component of lipoproteins that are rich in HDL and triglycerides (TG). Elevated ApoCIII levels are associated with elevated TG levels and diseases such as cardiovascular disease, metabolic syndrome, obesity, and diabetes (Chan et al., Int J Clin Pract, 2008, 62:799-809; Onat et al., Atherosclerosis, 2003, 168:81-89; Mendivil et al., Circulation, 2011, 124:2065-2072; Mauger et al., J. Lipid Res, 2006. 47:1212-1218; Chan et al., Clin. Chem, 2002. 278-283; Ooi et al., Clin. Sci, 2008. 114:611-624; Davidsson et al., J. Lipid Res. 2005. 46:1999-2006; Sacks et al. al., Circulation, 2000.102:1886-1892; Lee et al., Arterioscler Thromb Vasc Biol, 2003.23:853-858). ApoCIII inhibits lipolysis by inhibiting lipoprotein lipase (LPL) and interfering with the binding of lipoproteins to the cell surface glycosaminoglycan matrix, thereby delaying the clearance of TG-rich lipoproteins (Shachter, Curr. Opin. Lipidol, 2001, 12, 297-304).

[0005] Antisense technologies have emerged as an effective means of reducing the expression of specific gene products and can demonstrate unparalleled usefulness in regulating ApoCIII in several therapeutic, diagnostic, and research applications. Antisense compounds targeting ApoCIII and related methods for inhibiting ApoCIII have been previously disclosed (see, for example, U.S. Patents 7,598,227, 7,750,141, PCT Publications WO2004 / 093783, PCT Publications WO2012 / 149495, PCT / US14 / 016546, and WO2014 / 179626 (all incorporated herein by reference)). [Overview of the Initiative]

[0006] This specification provides methods for improving familial hyperchylomicronemia syndrome (FCS), familial partial lipodystrophy (FPL), or severe hypertriglyceridemia (SHTG) in human subjects requiring such treatment, as well as methods for reducing APOCIII RNA and / or APOCIII protein. In certain embodiments, the method comprises administering a therapeutically effective amount of a modified oligonucleotide. In certain embodiments, the modified oligonucleotide is ISIS678354. In certain embodiments, the therapeutically effective amount is in the range of about 40 mg to about 100 mg. In certain embodiments, the therapeutically effective amount is about 50 mg. In certain embodiments, the therapeutically effective amount is about 80 mg. In certain embodiments, the therapeutically effective amount is administered once every four weeks. [Modes for carrying out the invention]

[0007] Please understand that the above summary and the following detailed explanation are illustrative and descriptive only, and not limiting. In this specification, the use of the singular includes the plural unless otherwise explicitly stated. Where used herein, the use of "or" means "and / or" unless otherwise explicitly stated. Furthermore, the use of the term "contains," as well as other forms such as "contains" and "includes," is not limiting. Also, terms such as "element" or "component" include both elements and components containing one unit, and elements and components containing two or more subunits, unless otherwise explicitly stated.

[0008] The headings of sections used herein are for structural purposes only and should not be construed as limiting the subject matter described herein. All documents or parts of documents cited herein, including but not limited to patents, patent applications, articles, books, and papers, are expressly incorporated herein by reference, both in part and in whole, of the documents discussed herein.

[0009] definition Unless otherwise specified, the nomenclature, procedures, and techniques used in relation to analytical chemistry, synthetic organic chemistry, and pharmaceutical and drug discovery chemistry described herein are well known and commonly used in the art. Where permitted, all patents, patent applications, patent application publications, and other publications and data referenced throughout this disclosure are incorporated herein by reference in their entirety.

[0010] Unless otherwise specified, the following terms have the meanings set forth below.

[0011] As used herein, “2'-deoxyribonucleoside” means a nucleoside containing a 2'-H(H)deoxyribosyl sugar moiety. In certain embodiments, the 2'-deoxyribonucleoside is a 2'-β-Ddeoxyribonucleoside, which contains a 2'-β-D-deoxyribosyl sugar moiety having a β-D configuration as found in naturally occurring deoxyribonucleic acid (DNA). In certain embodiments, the 2'-deoxyribonucleoside may contain a modified nucleic acid base or an RNA nucleic acid base (uracil).

[0012] As used herein, "2'-MOE" refers to a 2'-OCH2CH2OCH3 group instead of the 2'-OH group of the ribosyl sugar moiety. "2'-MOE sugar moiety" is a sugar moiety having a 2'-OCH2CH2OCH3 group instead of the 2'-OH group of the ribosyl sugar moiety. Unless otherwise indicated, the 2'-MOE sugar moiety is in a β-D configuration. "MOE" refers to O-methoxyethyl.

[0013] As used herein, "2'-MOE nucleoside" means a nucleoside containing a 2'-MOE sugar moiety.

[0014] As used herein, "5-methylcytosine" refers to cytosine modified with a methyl group attached at the 5-position. 5-methylcytosine is a modified nucleic acid base.

[0015] As used herein, "approximately" means plus or minus 7% of the given value.

[0016] As used herein, “administer” means to provide a pharmaceutical agent to a human subject.

[0017] As used herein, “improvement” in relation to a treatment means that at least one symptom is improved compared to the same symptom without the treatment. In certain embodiments, improvement is a reduction in the severity or frequency of a symptom, a delay in the onset of a symptom, or a slowing of the progression of the severity or frequency of a symptom.

[0018] As used herein, “confirmed pancreatitis event” refers to a formally confirmed event of pancreatitis. Confirmed pancreatitis events may be further classified as acute, chronic, or of unknown type (i.e., unconfirmed: an event that may meet the definition of pancreatitis but could not be classified as either acute or chronic).

[0019] As used herein, “adverse event” or “AE” may be any undesirable and unintended sign (including, for example, an abnormal laboratory finding), symptom, or disease that is temporally related to the use of a pharmaceutical (investigational) product, regardless of whether the AE is considered to be related to the pharmaceutical (investigational) product. In certain embodiments, the pharmaceutical (investigational) product is ISIS678354.

[0020] As used herein, "APOCIII RNA" refers to the RNA expression product of the human gene APOCIII.

[0021] As used herein, "APOCIII protein" refers to the protein expression product of APOCIII RNA.

[0022] As used herein, “ApoCIII,” “apolipoprotein C-III,” or “ApoC3” means any nucleic acid or protein sequence encoding ApoCIII. For example, in certain embodiments, ApoCIII includes a DNA sequence encoding ApoCIII, an RNA sequence transcribed from DNA encoding ApoCIII (including genomic DNA with introns and exons), an mRNA sequence encoding ApoCIII, or a peptide sequence encoding ApoCIII.

[0023] As used herein, “ApoCIII nucleic acid” means any nucleic acid that codes for ApoCIII. For example, in a particular embodiment, ApoCIII nucleic acid includes a DNA sequence that codes for ApoCIII, an RNA sequence transcribed from DNA that codes for ApoCIII (including genomic DNA that includes introns and exons), and an mRNA sequence that codes for ApoCIII.

[0024] As used herein, “baseline” is defined as the average of all pre-medication measurements and / or evaluations. In certain embodiments, “baseline” is defined as the last evaluation before the first dose of the drug. In certain embodiments, the drug is ISIS678354.

[0025] As used herein, “diabetes mellitus” or “diabetes” is a syndrome characterized by metabolic disorders and abnormally high blood glucose levels (hyperglycemia) resulting from insufficient levels of insulin or decreased insulin sensitivity. Characteristic symptoms include excessive urine production (polyuria) due to high blood glucose levels, excessive thirst and increased fluid intake to compensate for increased urination (hyperthria), blurred vision due to the effects of hyperglycemia on vision, unexplained weight loss, and lethargy.

[0026] As used herein, “diabetic dyslipidemia” or “type 2 diabetes with dyslipidemia” means a condition characterized by type 2 diabetes, decreased HDL-C, increased triglycerides (TG), and increased small, dense LDL particles.

[0027] As used herein, “dosage” means the amount of the medicinal agent being administered.

[0028] As used herein, “dyslipidemia” refers to a disorder of lipid and / or lipoprotein metabolism, including the overproduction or deficiency of lipids and / or lipoproteins. Dyslipidemia may be manifested by increased levels of lipids such as chylomicrons, cholesterol, and triglycerides, as well as lipoproteins such as low-density lipoprotein (LDL) cholesterol.

[0029] As used herein, “hypercholesterolemia” means a condition characterized by elevated cholesterol or circulating (plasma) cholesterol, LDL-cholesterol, and VLDL-cholesterol, as defined in the Expert Panel Report of the National Cholesterol Educational Program (NCEP) of Detection, Evaluation of Treatment of high cholesterol in adults (see Arch.Int.Med. (1988) 148, 36-39).

[0030] As used herein, "hyperlipidemia" or "hyperlipidemia" refers to a condition characterized by elevated serum lipids or circulating (plasma) lipids. This condition is characterized by abnormally high lipid concentrations. The lipid fractions in circulating blood are cholesterol, low-density lipoproteins, very low-density lipoproteins, chylomicrons, and triglycerides.

[0031] As used herein, “hypertriglyceridemia” means a condition characterized by elevated triglyceride levels. Hypertriglyceridemia is the result of increased production and / or decreased or delayed catabolism of triglyceride (TG)-rich lipoproteins, namely very low-lipid cholesterol (VLDL) and, to a lesser extent, chylomicrons (CM).

[0032] As used herein, the term “nucleoside bond” refers to a covalent bond between consecutive nucleosides in an oligonucleotide. As used herein, “modified nucleoside bond” means any nucleoside bond other than a phosphodiester nucleoside bond. A “phosphorothioate nucleoside bond” is a modified nucleoside bond in which one of the non-bridged oxygen atoms of a phosphodiester nucleoside bond is replaced by a sulfur atom.

[0033] As used herein, “loading dose” means the therapeutically effective amount of a drug administered during the initial dosing phase in which a steady-state concentration of the drug is achieved. “Initial loading dose” means the first loading dose administered. “Last loading dose” means the most recent loading dose administered before the first maintenance dose is administered.

[0034] As used herein, “maintenance dose” means the therapeutically effective amount of the drug administered during the drug-dosing phase after a steady-state concentration of the drug has been achieved.

[0035] As used herein, “nucleic acid base” means an unmodified or modified nucleic acid base. “Unmodified nucleic acid base” is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). “Modified nucleic acid base” is a group of atoms other than unmodified A, T, C, U, or G that can pair with at least one unmodified nucleic acid base. “5-methylcytosine” is a modified nucleic acid base. As used herein, “nucleic acid base sequence” means a sequence of consecutive nucleic acid bases in a target nucleic acid or oligonucleotide, independent of any sugar or nucleoside-linking modifications.

[0036] As used herein, “nucleoside” means a compound comprising a nucleic acid base and a sugar moiety. The nucleic acid base and sugar moiety are, independently, either unmodified or modified. As used herein, “modified nucleoside” means a nucleoside comprising a modified nucleic acid base and / or a modified sugar moiety. “Bound nucleoside” is a nucleoside linked in a continuous sequence (i.e., there are no additional nucleosides between bound nucleosides). As used herein, “oligonucleotide” means a chain of bound nucleosides linked via nucleoside bonds, where each nucleoside and nucleoside bond may be modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 8 to 50 bound nucleosides. As used herein, “modified oligonucleotide” means an oligonucleotide in which at least one nucleoside or nucleoside bond is modified.

[0037] As used herein, “pharmaceutically acceptable carrier or diluent” means any substance suitable for use in administration to a human subject. Certain such carriers enable the pharmaceutical composition to be formulated, for example, as tablets, pills, sugar-coated tablets, capsules, liquids, gels, syrups, slurries, suspensions, and lozenges for oral administration by a human subject. In certain embodiments, the pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solution, or sterile artificial cerebrospinal fluid.

[0038] As used herein, “pharmaceutically acceptable salt” means a physiologically and pharmaceutically acceptable salt of a compound. A pharmaceutically acceptable salt retains the desired biological activity of the parent compound and does not impart any undesirable toxicological effects to the parent compound.

[0039] As used herein, “potassium salt” means a salt of a modified oligonucleotide in which the cation of the salt is potassium.

[0040] As used herein, “RNA” means RNA transcripts, and unless otherwise specified, includes pre-mRNA and mature mRNA.

[0041] As used herein, “sodium salt” means a salt of a modified oligonucleotide in which the cation of the salt is sodium.

[0042] As used herein, “Subject” means human or non-human animal. In certain embodiments, the subject is a human subject. “Subject requiring it” is a subject that would benefit from administration of the modified oligonucleotide disclosed herein. In certain embodiments, the subject requiring it has a FCS.

[0043] As used herein, “sugar moiety” means an unmodified sugar moiety or a modified sugar moiety. “Unmodified sugar moiety” means a 2'-OH(H)β-D-ribosyl moiety found in RNA (“unmodified RNA sugar moiety”) or a 2'-H(H)β-D-deoxyribosyl moiety found in DNA (“unmodified DNA sugar moiety”). An unmodified sugar moiety has one hydrogen at each of the 1', 3', and 4' positions, an oxygen at the 3' position, and two hydrogens at the 5' position. “Modified sugar moiety” or “modified sugar” means a modified furanosyl sugar moiety or sugar surrogate.

[0044] As used herein, “symptoms” means any physical characteristics or examination results indicating the presence or degree of a disease or disorder. In certain embodiments, symptoms are evident to the subject or to a medical professional examining or testing the subject.

[0045] As used herein, “therapeutic effective dose” means the amount of a pharmaceutical agent that provides a therapeutic benefit to a human subject. For example, a therapeutic effective dose improves the symptoms of a disease.

[0046] As used herein, "week" means seven days.

[0047] certain specific embodiments Embodiment 1. A method for improving familial hyperchylomicronemia syndrome (FCS) in a human subject who needs it, said method comprising administering to said human subject a therapeutically effective amount of a modified oligonucleotide having the following chemical structure:

Chemical formula

[0048] Embodiment 2. The modified oligonucleotide according to Embodiment 1, which is a sodium salt or a potassium salt.

[0049] Embodiment 3. A method for improving FCS in a human subject who needs it, said method comprising administering to said human subject a therapeutically effective amount of a modified oligonucleotide having the following chemical structure:

Chemical formula

[0050] Embodiment 4. A method for improving FCS in a human subject who needs it, said method comprising administering to said human subject a therapeutically effective amount of a modified oligonucleotide, said modified oligonucleotide having the following chemical notation (5' to 3'): A es G es m C es T es T es m C ds T ds T ds G ds T ds m C ds m C ds A ds G ds m C ds T es T es Tes A es T e (Sequence No. 3) (In the formula, A = adenine nucleic acid base, mC=5-methylcytosine nucleic acid base, G = guanine nucleic acid base, T=thymine nucleobase, e=2'-MOE sugar moiety, d=2'-β-D-deoxyribosyl sugar moiety, and (s = phosphorothioate nucleoside interbonding) The modified oligonucleotide has the following structure: 5'-trishexylamino-(THA)-C6GalNAc3 terminal cap (wherein the formula the phosphate group is bonded to the 5'-oxygen atom of the 5'-nucleoside): [ka] The method comprising the above.

[0051] Embodiment 5. The method according to any one of Embodiments 1 to 4, wherein at least one symptom of FCS is improved.

[0052] Embodiment 6. The method according to Embodiment 5, wherein the at least one symptom includes severe hyperchylomicronemia, severe hypertriglyceridemia (always well above 1,000 mg / dL, and not uncommonly rising to over 10,000 mg / dL), frequent and severe abdominal pain, recurrent colic, physical fatigue, difficulty thinking, diarrhea, recurrent acute pancreatitis, exanthematous xanthomas, retinal lipidemia, and hepatosplenomegaly or a combination thereof.

[0053] Embodiment 7. A method for reducing APOCIII RNA in a human subject requiring such reduction, wherein the method comprises a therapeutically effective amount of the following chemically modified oligonucleotide: [ka] The method comprising administering (SEQ ID NO: 3), or a salt thereof, to the human subject.

[0054] Embodiment 8. The modified oligonucleotide according to Embodiment 7, which is a sodium salt or a potassium salt.

[0055] Embodiment 9. A method for reducing APOCIII RNA in a human subject requiring such reduction, wherein the method comprises a therapeutically effective amount of the following chemically modified oligonucleotide: [ka] The method comprising administering (SEQ ID NO: 3) to the human subject.

[0056] Embodiment 10. A method for reducing APOCIII RNA in a human subject requiring such reduction, the method comprising administering a therapeutically effective amount of a modified oligonucleotide to the human subject, wherein the modified oligonucleotide is chemically represented as follows (5' to 3'): A es G es m C es T es T es m C ds T ds T ds G ds T ds m C ds m C ds A ds G ds m C ds T es T es T es A es T e (Sequence No. 3) (In the formula, A = adenine nucleic acid base, mC=5-methylcytosine nucleic acid base, G = guanine nucleic acid base, T=thymine nucleobase, e=2'-MOE sugar moiety, d=2'-β-D-deoxyribosyl sugar moiety, and (s = phosphorothioate nucleoside interbonding) The modified oligonucleotide has the following structure: 5'-trishexylamino-(THA)-C6GalNAc3 terminal cap (wherein the formula the phosphate group is bonded to the 5'-oxygen atom of the 5'-nucleoside): [ka] The method comprising the above.

[0057] Embodiment 11. The method according to any one of Embodiments 1 to 10, wherein the therapeutically effective dose is 50 mg.

[0058] Embodiment 12. The method according to any one of Embodiments 1 to 10, wherein the therapeutically effective dose is 60 mg.

[0059] Embodiment 13. The method according to any one of Embodiments 1 to 10, wherein the therapeutically effective dose is 70 mg.

[0060] Embodiment 14. The method according to any one of Embodiments 1 to 10, wherein the therapeutically effective dose is 80 mg.

[0061] Embodiment 15. The method according to any one of Embodiments 1 to 10, wherein the therapeutically effective dose is any of 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, and 100 mg.

[0062] Embodiment 16. The method according to any one of Embodiments 1 to 10, wherein the therapeutically effective dose is any of approximately 40 mg, approximately 45 mg, approximately 50 mg, approximately 55 mg, approximately 60 mg, approximately 65 mg, approximately 70 mg, approximately 75 mg, approximately 80 mg, approximately 85 mg, approximately 90 mg, approximately 95 mg, and approximately 100 mg.

[0063] Embodiment 17. The therapeutically effective doses are 40.0 mg, 40.1 mg, 40.2 mg, 40.3 mg, 40.4 mg, 40.5 mg, 40.6 mg, 40.7 mg, 40.8 mg, 40.9 mg, 41.0 mg, 41.1 mg, 41.2 mg, 41.3 mg, 41.4 mg, 41.5 mg, 41.6 mg, 41.7 mg, 41.8 mg, 41.9 mg, 42.0 mg, 42.1 mg, 42.2 mg, 42.3 mg, 42.4 mg, 42.5 mg, 42.6 mg, 42.7 mg, 42.8 mg, 42.9 mg, 43.0 mg, 43.1 mg, 43.2 mg, 43 .3mg, 43.4mg, 43.5mg, 43.6mg, 43.7mg, 43.8mg, 43.9mg, 44.0mg, 44.1mg, 44.2mg, 44.3mg, 44.4mg, 44.5mg, 44.6mg, 44.7mg, 44.8mg, 44.9mg, 45.0mg, 4 5.1mg, 45.2mg, 45.3mg, 45.4mg, 45.5mg, 45.6mg, 45.7mg, 45.8mg, 45.9mg, 46.0mg, 46.1mg, 46.2mg, 46.3mg, 46.4mg, 46.5mg, 46.6mg, 46.7mg, 46.8mg, 46.9mg, 47.0mg, 47.1mg, 47.2mg, 47.3mg, 47.4mg, 47.5mg, 47.6mg, 47.7mg, 47.8mg, 47.9mg, 48.0mg, 48.1mg, 48.2mg, 48.3mg, 48.4mg, 48.5mg, 48.6mg , 48.7mg, 48.8mg, 48.9mg, 49.0mg, 49.1mg, 49.2mg, 49.3mg, 49.4mg, 49.5mg, 49.6mg, 49.7mg, 49.8mg, 49.9mg, 50.0mg, 50.1mg, 50.2mg, 50.3mg, 50.4m g, 50.5mg, 50.6mg, 50.7mg, 50.8mg, 50.9mg, 51.0mg, 51.1mg, 51.2mg, 51.3mg, 51.4mg, 51.5mg, 51.6mg, 51.7mg, 51.8mg, 51.9mg, 52.0mg, 52.1mg, 52.2 mg, 52.3mg, 52.4mg, 52.5mg, 52.6mg, 52.7mg, 52.8mg, 52.9mg, 53.0mg, 53.1mg, 53.2mg, 53.3mg, 53.4mg, 53.5mg, 53.6mg, 53.7mg, 53.8mg, 53.9mg, 54.0mg、54.1mg、54.2mg、54.3mg、54.4mg、54.5mg、54.6mg、54.7mg、54.8mg、54.9mg、55.0mg、50.0mg、50.1mg、50.2mg、50.3mg、50.4mg、50.5mg、50.6mg、50.7mg、50.8mg、50.9mg、51.0mg、51.1mg、51.2mg、51.3mg、51.4mg、51.5mg、51.6mg、51.7mg、51.8mg、51.9mg、52.0mg、52.1mg、52.2mg、52.3mg、52.4mg、52.5mg、52.6mg、52.7mg、52.8mg、52.9mg、53.0mg、53.1mg、53.2mg、53.3mg、53.4mg、53.5mg、53.6mg、53.7mg、53.8mg、53.9mg、54.0mg、54.1mg、54.2mg、54.3mg、54.4mg、54.5mg、54.6mg、54.7mg、54.8mg、54.9mg、55.0mg、55.1mg、55.2mg、55.3mg、55.4mg、55.5mg、55.6mg、55.7mg、55.8mg、55.9mg、55.0mg、55.1mg、55.2mg、55.3mg、55.4mg、55.5mg、55.6mg、55.7mg、55.8mg、55.9mg、56.0mg、56.1mg、56.2mg、56.3mg、56.4mg、56.5mg、56.6mg、56.7mg、56.8mg、56.9mg、57.0mg、57.1mg、57.2mg、57.3mg、57.4mg、57.5mg、57.6mg、57.7mg、57.8mg、57.9mg、58.0mg、58.1mg、58.2mg、58.3mg、58.4mg、58.5mg、58.6mg、58.7mg、58.8mg、58.9mg、59.0mg、59.1mg、59.2mg、59.3mg、59.4mg、59.5mg、59.6mg、59.7mg、59.8mg、59.9mg、60.0mg、60.1mg、60.2mg、60.3mg、60.4mg、60.5mg、60.6mg、60.7mg、60.8mg、60.9mg、61.0mg、61.1mg、61.2mg、61.3mg、61.4mg、61.5mg、61.6mg、61.7mg、61.8mg、61.9mg、62.0mg、62.1mg、62.2mg、62.3mg、62.4mg、62.5mg、62.6mg、62.7mg、62.8mg、62.9mg、63.0mg、63.1mg、63.2mg、63.3mg、63.4mg、63.5mg、63.6mg、63.7mg、63.8mg、63.9mg、64.0mg、64.1mg、64.2mg、64.3mg、64.4mg、64.5mg、64.6mg、64.7mg、64.8mg、64.9mg、65.0mg、65.1mg、65.2mg、65.3mg、65.4mg、65.5mg、65.6mg、65.7mg、65.8mg、65.9mg、66.0mg、66.1mg、66.2mg、66.3mg、66.4mg、66.5mg、66.6mg、66.7mg、66.8mg、66.9mg、67.0mg、67.1mg、67.2mg、67.3mg、67.4mg、67.5mg、67.6mg、67.7mg、67.8mg、67.9mg、68.0mg、68.1mg、68.2mg、68.3mg、68.4mg、68.5mg、68.6mg、68.7mg、68.8mg、68.9mg、69.0mg、69.1mg、69.2mg、69.3mg、69.4mg、69.5mg、69.6mg、69.7mg、69.8mg、69.9mg、70.0mg、70.1mg、70.2mg、70.3mg、70.4mg、70.5mg、70.6mg、70.7mg、70.8mg、70.9mg、71.0mg、71.1mg、71.2mg、71.3mg、71.4mg、71.5mg、71.6mg、71.7mg、71.8mg、71.9mg、72.0mg、72.1mg、72.2mg、72.3mg、72.4mg、72.5mg、72.6mg、72.7mg、72.8mg、72.9mg、73.0mg、73.1mg、73.2mg、73.3mg、73.4mg、73.5mg、73.6mg、73.7mg、73.8mg、73.9mg、74.0mg、74.1mg、74.2mg、74.3mg、74.4mg、74.5mg、74.6mg、74.7mg、74.8mg、74.9mg、75.0mg、75.1mg、75.2mg、75.3mg、75.4mg、75.5mg、75.6mg、75.7mg、75.8mg、75.9mg、76.0mg、76.1mg、76.2mg、76.3mg、76.4mg、76.5mg、76.6mg、76.7mg、76.8mg、76.9mg、77.0mg、77.1mg、77.2mg、77.3mg、77.4mg、77.5mg、77.6mg、77.7mg、77.8mg、77.9mg、78.0mg、78.1mg、78.2mg、78.3mg、78.4mg、78.5mg、78.6mg、78.7mg、78.8mg、78.9mg、79.0mg、79.1mg、79.2mg、79.3mg、79.4mg、79.5mg、79.6mg、79.7mg、79.8mg、79.9mg、80.0mg、80.1mg、80.2mg、80.3mg、80.4mg、80.5mg、80.6mg、80.7mg、80.8mg、80.9mg、81.0mg、81.1mg、81.2mg、81.3mg、81.4mg、81.5mg、81.6mg、81.7mg、81.8mg、81.9mg、82.0mg、82.0mg、82.1mg、82.2mg、82.3mg、82.4mg、82.5mg、82.6mg、82.7mg、82.8mg、82.9mg、83.0mg、83.1mg、83.2mg、83.3mg、83.4mg、83.5mg、83.6mg、83.7mg、83.8mg、83.9mg、84.0mg、84.1mg、84.2mg、84.3mg、84.4mg、84.5mg、84.6mg、84.7mg、84.8mg、84.9mg、85.0mg、85.0mg、85.1mg、85.2mg、85.3mg、85.4mg、85.5mg、85.6mg、85.7mg、85.8mg、85.9mg、86.0mg、86.1mg、86.2mg、86.3mg、86.4mg、86.5mg、86.6mg、86.7mg、86.8mg、86.9mg、87.0mg、87.1mg、87.2mg、87.3mg、87.4mg、87.5mg、87.6mg、87.7mg、87.8mg、87.9mg、88.0mg、88.1mg、88.2mg、88.3mg、88.4mg、88.5mg、88.6mg、88.7mg、88.8mg、88.9mg、89.0mg、89.0mg、89.1mg、89.2mg、89.3mg、89.4mg、89.5mg、89.6mg、89.7mg、89.8mg、89.9mg、90.0mg、90.1mg、90.2mg、90.3mg、90.4mg、90.5mg, 90.6mg, 90.7mg, 90.8mg, 90.9mg, 91.0mg, 91.1mg, 91.2mg, 91.3mg, 91.4mg, 91.5mg, 91.6mg, 91.7mg, 91.8mg, 91.9mg, 92.0mg, 92.0mg, 92.1mg, 92.2mg, 92.3mg, 92.4mg, 92.5mg, 92.6mg, 92.7mg, 92.8mg, 92.9m g, 93.0mg, 93.1mg, 93.2mg, 93.3mg, 93.4mg, 93.5mg, 93.6mg, 93.7mg, 93.8mg, 93.9mg, 94.0mg, 94.1mg, 94 .2mg, 94.3mg, 94.4mg, 94.5mg, 94.6mg, 94.7mg, 94.8mg, 94.9mg, 95.0mg, 95.1mg, 95.2mg, 95.3mg, 95.4mg, 95.5mg, 95.6mg, 95.7mg, 95.8mg, 95.9mg, 96.0mg, 96.1mg, 96.2mg, 96.3mg, 96.4mg, 96.5mg, 96.6mg, 96.7 mg, 96.8mg, 96.9mg, 97.0mg, 97.1mg, 97.2mg, 97.3mg, 97.4mg, 97.5mg, 97.6mg, 97.7mg, 97.8mg, 97.9mg, 98 The method according to any one of Embodiments 1 to 10, wherein the amount is any of 0.0 mg, 98.1 mg, 98.2 mg, 98.3 mg, 98.4 mg, 98.5 mg, 98.6 mg, 98.7 mg, 98.8 mg, 98.9 mg, 99.0 mg, 99.1 mg, 99.2 mg, 99.3 mg, 99.4 mg, 99.5 mg, 99.6 mg, 99.7 mg, 99.8 mg, 99.9 mg, and 100.0 mg.

[0064] Embodiment 18. The therapeutically effective doses are approximately 40.0 mg, approximately 40.1 mg, approximately 40.2 mg, approximately 40.3 mg, approximately 40.4 mg, approximately 40.5 mg, approximately 40.6 mg, approximately 40.7 mg, approximately 40.8 mg, approximately 40.9 mg, approximately 41.0 mg, approximately 41.1 mg, approximately 41.2 mg, approximately 41.3 mg, approximately 41.4 mg, approximately 41.5 mg, approximately 41.6 mg, approximately 41.7 mg, approximately 41.8 mg, approximately 41.9 mg, approximately 42.0 mg, approximately 42.1 mg, approximately 42.2 mg, approximately 42.3 mg, approximately 42.4 mg, approximately 42.5 mg, approximately 42.6 mg, approximately 42.7 mg, approximately 42.8 mg, Approximately 42.9mg, approximately 43.0mg, approximately 43.1mg, approximately 43.2mg, approximately 43.3mg, approximately 43.4mg, approximately 43.5mg, approximately 43.6mg, approximately 43.7mg, approximately 43.8mg, approximately 43.9mg, approximately 44.0mg, approximately 44.1mg, approximately 44.2mg, approximately 44.3mg, approximately 44.4mg, approximately 44.5mg, approximately 44.6mg, approximately 44.7mg, approximately 44.8mg, approximately 44.9mg, approximately 45.0mg, approximately 45.1mg, approximately 45.2mg, approximately 45.3mg, approximately 45.4mg, approximately 45.5mg, approximately 45.6mg, approximately 45.7mg, approximately 45.8mg, approximately 45.9mg, approximately 46.0mg, approximately 46.1mg, approximately 46.2mg, approximately 46.3mg, approximately 46.4mg, approximately 46.5mg, approximately 46.6mg, approximately 46.7mg, approximately 46.8mg, approximately 46.9mg, approximately 47.0mg, approximately 47.1mg, approximately 47.2mg, approximately 47.3mg, approximately 47.4mg, approximately 47.5mg, approximately 47.6mg, approximately 47.7mg, approximately 47.8mg, approximately 47.9mg, approximately 48.0mg, approximately 48.1mg, approximately 48.2mg, approximately 48.3mg, approximately 48.4mg, approximately 48.5mg, approximately 48.6mg, approximately 48.7mg, approximately 48.8mg, approximately 48.9mg, approximately 49.0mg, approximately 4 9.1mg, approximately 49.2mg, approximately 49.3mg, approximately 49.4mg, approximately 49.5mg, approximately 49.6mg, approximately 49.7mg, approximately 49.8mg, approximately 49.9mg, approximately 50.0mg, approximately 50.1mg, approximately 50.2mg, approximately 50.3mg, approximately 50.4mg, approximately 50.5mg, approximately 50.6mg, approximately 50.7mg, approximately 50.8mg, approximately 50.9mg, approximately 51.0mg, approximately 51.1mg, approximately 51.2mg, approximately 51.3mg, approximately 51.4mg, approximately 51.5mg, approximately 51.6mg, approximately 51.7mg, approximately 51.8mg, approximately 51.9mg, approximately 52.0mg, approximately 52.1mg, approximately 52.2mg, approximately 52.3mg, approximately 52.4mg, approximately 52.5mg, approximately 52.6mg, approximately 52.7mg, approximately 52.8mg, approximately 52.9mg, approximately 53.0mg, approximately 53.1mg, approximately 53.2mg, approximately 53.3mg. Approximately 53.4mg, approximately 53.5mg, approximately 53.6mg, approximately 53.7mg, approximately 53.8mg, approximately 53.9mg, approximately 54.0mg, approximately 54.1mg, approximately 54.2mg, approximately 54.3mg, approximately 54.4mg, approximately 54.5mg, approximately 54.6mg, approximately 54.7mg, approximately 54.8mg, approximately 54.9mg, approximately 55.0mg, approximately 55.1mg, approximately 55.2mg, approximately 55.3mg. Approximately 55.4mg, 55.5mg, 55.6mg, 55.7mg, 55.8mg, 55.9mg, 55.0mg, 55.1mg, 55.2mg, 55.3mg, 55.4mg, 55.5mg, 55.6mg, 55.7mg, 55.8mg, 55.9mg, 56.0mg, 56.1mg, 56.2mg, 56.3mg. Approximately 56.4mg, 56.5mg, 56.6mg, 56.7mg, 56.8mg, 56.9mg, 57.0mg, 57.1mg, 57.2mg, 57.3mg, 57.4mg, 57.5mg, 57.6mg, 57.7mg, 57.8mg, 57.9mg, 58.0mg, 58.1mg, 58.2mg, 58.3mg. Approximately 58.4mg, approximately 58.5mg, approximately 58.6mg, approximately 58.7mg, approximately 58.8mg, approximately 58.9mg, approximately 59.0mg, approximately 59.1mg, approximately 59.2mg, approximately 59.3mg, approximately 59.4mg, approximately 59.5mg, approximately 59.6mg, approximately 59.7mg, approximately 59.8mg, approximately 59.9mg, approximately 60.0mg, approximately 60.1mg, approximately 60.2mg, approximately 60.3mg, approximately 60.4mg, approximately 60.5mg, approximately 60.6mg, approximately 60.7mg, approximately 60.8mg, approximately 60.9mg, approximately 61.0mg g, about 61.1mg, about 61.2mg, about 61.3mg, about 61.4mg, about 61.5mg, about 61.6mg, about 61.7mg, about 61.8mg, about 61.9mg, about 62.0mg, about 62.1mg, about 62.2mg, about 62.3mg, about 62.4mg, about 62.5mg, about 62.6mg, about 62.7mg, about 62.8mg, about 62.9mg, about 63.0mg, about 63.1mg, about 63.2mg, about 63.3mg, about 63.4mg, about 63.5mg, about 63.6mg, about 63.7mg, approximately 63.8mg, approximately 63.9mg, approximately 64.0mg, approximately 64.1mg, approximately 64.2mg, approximately 64.3mg, approximately 64.4mg, approximately 64.5mg, approximately 64.6mg, approximately 64.7mg, approximately 64.8mg, approximately 64.9mg, approximately 65.0mg, approximately 65.1mg, approximately 65.2mg, approximately 65.3mg, approximately 65.4mg, approximately 65.5mg, approximately 65.6mg, approximately 65.7mg, approximately 65.8mg, approximately 65.9mg, approximately 66.0mg, approximately 66.1mg, approximately 66.2mg, approximately 66.3mg, approximately 66.4mg, approximately 66.5mg, approximately 66.6mg, approximately 66.7mg, approximately 66.8mg g, approx. 66.9 mg, approx. 67.0 mg, approx. 67.1 mg, approx. 67.2 mg, approx. 67.3 mg, approx. 67.4 mg, approx. 67.5 mg, approx. 67.6 mg, approx. 67.7 mg, approx. 67.8 mg, approx. .4mg, about 68.5mg, about 68.6mg, about 68.7mg, about 68.8mg, about 68.9mg, about 69.0mg, about 69.1mg, about 69.2mg, about 69.3mg, about 69.4mg, about 69.5mg, about 69.6mg, about 69.7mg, about 69.8mg, about 69.9mg, Approximately 70.0mg, approximately 70.1mg, approximately 70.2mg, approximately 70.3mg, approximately 70.4mg, approximately 70.5mg, approximately 70.6mg, approximately 70.7mg, approximately 70.8mg, approximately 70.9mg, approximately 71.0mg, approximately 71.1mg, approximately 71.2mg, approximately 71.3mg, approximately 71.4mg, approximately 71.5mg, approximately 71.6mg, approximately 71.7mg, approximately 71.8mg, approximately 71.9mg, approximately 72.0mg, approximately 72.1mg, approximately 72.2mg, approximately 72.3mg, approximately 72.4mg, approximately 72.5mg, approximately 72.6mg, approximately 72.7mg, approximately 72.8mg, approximately 72.9mg, approximately 73.0mg, approximately 7 3.1mg, approximately 73.2mg, approximately 73.3mg, approximately 73.4mg, approximately 73.5mg, approximately 73.6mg, approximately 73.7mg, approximately 73.8mg, approximately 73.9mg, approximately 74.0mg, approximately 74.1mg, approximately 74.2mg, approximately 74.3mg, approximately 74.4mg, approximately 74.5mg, approximately 74.6mg, approximately 74.7mg, approximately 74.8mg, approximately 74.9mg, approximately 75.0mg, approximately 75.1mg, approximately 75.2mg, approximately 75.3mg, approximately 75.4mg, approximately 75.5mg, approximately 75.6mg, approximately 75.7mg, approximately 75.8mg, approximately 75.9mg, approximately 76.0mg, approximately 76.1mg, approximately 76.2mg, about 76.3mg, about 76.4mg, about 76.5mg, about 76.6mg, about 76.7mg, about 76.8mg, about 76.9mg, about 77.0mg, about 77.1mg, about 77.2mg, about 77.3mg, about 77.4mg, about 77.5mg, about 77.6mg, about 77.7mg, about 77.8mg, about 77.9mg, about 78.0mg, about 78.1mg, about 78.2mg, about 78.3mg, about 78.4mg, about 78.5mg, about 78.6mg, about 78.7mg, about 78.8mg, about 78.9mg, about 79.0mg, about 79.1mg, about 79.2mg, about 79.3m g, approx. 79.4 mg, approx. 79.5 mg, approx. 79.6 mg, approx. 79.7 mg, approx. 79.8 mg, approx. 79.9 mg, approx. 80.0 mg, approx. 80.1 mg, approx. .9mg, about 81.0mg, about 81.1mg, about 81.2mg, about 81.3mg, about 81.4mg, about 81.5mg, about 81.6mg, about 81.7mg, about 81.8mg, about 81.9mg, about 82.0mg, about 82.0mg, about 82.1mg, about 82.2mg, about 82.3mg, Approximately 82.4mg, approximately 82.5mg, approximately 82.6mg, approximately 82.7mg, approximately 82.8mg, approximately 82.9mg, approximately 83.0mg, approximately 83.1mg, approximately 83.2mg, approximately 83.3mg, approximately 83.4mg, approximately 83.5mg, approximately 83.6mg, approximately 83.7mg, approximately 83.8mg, approximately 83.9mg, approximately 84.0mg, approximately 84.1mg, approximately 84.2mg, approximately 84.3mg, approximately 84.4mg, approximately 84.5mg, approximately 84.6mg, approximately 84.7mg, approximately 84.8mg, approximately 84.9mg, approximately 85.0mg, approximately 85.1mg, approximately 85.2mg, approximately 85.3mg, approximately 85.4mg, approximately 8 5.5mg, approximately 85.6mg, approximately 85.7mg, approximately 85.8mg, approximately 85.9mg, approximately 86.0mg, approximately 86.1mg, approximately 86.2mg, approximately 86.3mg, approximately 86.4mg, approximately 86.5mg, approximately 86.6mg, approximately 86.7mg, approximately 86.8mg, approximately 86.9mg, approximately 87.0mg, approximately 87.1mg, approximately 87.2mg, approximately 87.3mg, approximately 87.4mg, approximately 87.5mg, approximately 87.6mg, approximately 87.7mg, approximately 87.8mg, approximately 87.9mg, approximately 88.0mg, approximately 88.1mg, approximately 88.2mg, approximately 88.3mg, approximately 88.4mg, approximately 88.5mg, approximately 88.6mg, approximately 88.7mg, approximately 88.8mg, approximately 88.9mg, approximately 89.0mg, approximately 89.1mg, approximately 89.2mg, approximately 89.3mg, approximately 89.4mg, approximately 89.5mg, approximately 89.6mg, approximately 89.7mg, approximately 89.8mg, approximately 89.9mg, approximately 90.0mg, approximately 90.1mg, approximately 90.2mg, approximately 90.3mg, approximately 90.4mg, approximately 90.5mg, approximately 90.6mg, approximately 90.7mg, approximately 90.8mg, approximately 90.9mg, approximately 91.0mg, approximately 91.1mg, approximately 91.2mg, approximately 91.3mg, approximately 91.4mg, approximately 91.5mg, approximately 91.6mg, approximately 91.7mg, approximately 91.8mg, approximately 91.9mg, approximately 92.0mg, approximately 92.1mg, approximately 92.2mg, approximately 92.3mg, approximately 92.4mg, approximately 92.5mg, approximately 92.6mg, approximately 92.7mg, approximately 92.8mg, approximately 92.9mg, approximately 93.0mg, approximately 93.1mg, approximately 93.2mg, approximately 93.3mg, approximately 93.4mg, approximately 93.5mg, approximately 93.6mg, approximately 93.7mg, approximately 93.8mg, approximately 93.9mg, approximately 94.0mg, approximately 94.1mg, approximately 94.2mg, approximately 94.3mg, approximately 94.4mg, approximately 94.5mg g, about 94.6 mg, about 94.7 mg, about 94.8 mg, about 94.9 mg, about 95.0 mg, about 95.1 mg, about 95.2 mg, about 95.3 mg, about 95.4 mg, about 95.5 mg, about 95.6 mg, about 95.7 mg, about 95.8 mg, about 95.9 mg, about 96. 0mg, about 96.1mg, about 96.2mg, about 96.3mg, about 96.4mg, about 96.5mg, about 96.6mg, about 96.7mg, about 96.8mg, about 96.9mg, about 97.0mg, about 97.1mg, about 97.2mg, about 97.3mg, about 97.4mg, about 97 The method according to any one of Embodiments 1 to 10, wherein the amount is 0.5 mg, approximately 97.6 mg, approximately 97.7 mg, approximately 97.8 mg, approximately 97.9 mg, approximately 98.0 mg, approximately 98.1 mg, approximately 98.2 mg, approximately 98.3 mg, approximately 98.4 mg, approximately 98.5 mg, approximately 98.6 mg, approximately 98.7 mg, approximately 98.8 mg, approximately 98.9 mg, approximately 99.0 mg, approximately 99.1 mg, approximately 99.2 mg, approximately 99.3 mg, approximately 99.4 mg, approximately 99.5 mg, approximately 99.6 mg, approximately 99.7 mg, approximately 99.8 mg, approximately 99.9 mg, and approximately 100.0 mg.

[0065] Embodiment 19. The method according to any one of Embodiments 1 to 10, wherein the therapeutically effective amount is within the range of 40 mg to 100 mg, 40 mg to 80 mg, 40 mg to 70 mg, 40 mg to 60 mg, 40 mg to 50 mg, 50 mg to 100 mg, 50 mg to 80 mg, 50 mg to 70 mg, 50 mg to 60 mg, 60 mg to 100 mg, 60 mg to 80 mg, 60 mg to 70 mg, 70 mg to 100 mg, 70 mg to 80 mg, 80 mg to 100 mg, 80 mg to 90 mg, and 90 mg to 100 mg.

[0066] Embodiment 20. The method according to any one of Embodiments 1 to 10, wherein the therapeutically effective dose is any of less than 100 mg, less than 95 mg, less than 90 mg, less than 85 mg, less than 80 mg, less than 75 mg, less than 70 mg, less than 65 mg, less than 60 mg, less than 55 mg, less than 50 mg, less than 45 mg, and less than 40 mg.

[0067] Embodiment 21. The method according to any one of Embodiments 1 to 10, wherein the therapeutically effective dose is any of the following: less than about 100 mg, less than about 95 mg, less than about 90 mg, less than about 85 mg, less than about 80 mg, less than about 75 mg, less than about 70 mg, less than about 65 mg, less than about 60 mg, less than about 55 mg, less than about 50 mg, less than about 45 mg, and less than about 40 mg.

[0068] Embodiment 22. The method according to any one of Embodiments 1 to 10, wherein the therapeutically effective dose is at least 40 mg, at least 45 mg, at least 50 mg, at least 55 mg, at least 60 mg, at least 65 mg, at least 70 mg, at least 75 mg, at least 80 mg, at least 85 mg, at least 90 mg, at least 95 mg, and at least about 100 mg.

[0069] Embodiment 23. The method according to any one of Embodiments 1 to 10, wherein the therapeutically effective dose is at least about 40 mg, at least about 45 mg, at least about 50 mg, at least about 55 mg, at least about 60 mg, at least about 65 mg, at least about 70 mg, at least about 75 mg, at least about 80 mg, at least about 85 mg, at least about 90 mg, at least about 95 mg, and at least about 100 mg.

[0070] Embodiment 24. The method according to any one of Embodiments 1 to 23, comprising administering the modified oligonucleotide once every four weeks.

[0071] Embodiment 25. The method according to any one of Embodiments 1 to 23, comprising administering the modified oligonucleotide once every 8 weeks.

[0072] Embodiment 26. The method according to any one of Embodiments 1 to 23, comprising administering the modified oligonucleotide once every 12 weeks.

[0073] Embodiment 27. The method according to any one of Embodiments 1 to 23, comprising administering the modified oligonucleotide once every 16 weeks.

[0074] Embodiment 28. The method according to any one of Embodiments 1 to 23, comprising administering the modified oligonucleotide once every 20 weeks.

[0075] Embodiment 29. The method according to any one of Embodiments 1 to 23, comprising administering the modified oligonucleotide approximately once every four weeks.

[0076] Embodiment 30. The method according to any one of Embodiments 1 to 23, comprising administering the modified oligonucleotide approximately once every 8 weeks.

[0077] Embodiment 31. The method according to any one of Embodiments 1 to 23, comprising administering the modified oligonucleotide approximately once every 12 weeks.

[0078] Embodiment 32. The method according to any one of Embodiments 1 to 23, comprising administering the modified oligonucleotide approximately once every 16 weeks.

[0079] Embodiment 33. The method according to any one of Embodiments 1 to 23, comprising administering the modified oligonucleotide approximately once every 20 weeks.

[0080] Embodiment 34. The method according to any one of Embodiments 1 to 23, comprising administering the modified oligonucleotide once every 1 week, once every 2 weeks, once every 3 weeks, once every 4 weeks, once every 5 weeks, once every 6 weeks, once every 7 weeks, once every 8 weeks, once every 9 weeks, once every 10 weeks, once every 11 weeks, once every 12 weeks, once every 13 weeks, once every 14 weeks, once every 15 weeks, once every 16 weeks, once every 17 weeks, once every 18 weeks, once every 19 weeks, and once every 20 weeks.

[0081] Embodiment 35. The method according to any one of Embodiments 1 to 23, comprising administering the modified oligonucleotide at any of the following intervals: once every approximately 1 week, once every approximately 2 weeks, once every approximately 3 weeks, once every approximately 4 weeks, once every approximately 5 weeks, once every approximately 6 weeks, once every approximately 7 weeks, once every approximately 8 weeks, once every approximately 9 weeks, once every approximately 10 weeks, once every approximately 11 weeks, once every approximately 12 weeks, once every approximately 13 weeks, once every approximately 14 weeks, once every approximately 15 weeks, once every approximately 16 weeks, once every approximately 17 weeks, once every approximately 18 weeks, once every approximately 19 weeks, and once every approximately 20 weeks.

[0082] Embodiment 36. A method for improving FCS, reducing APOCIII RNA, or reducing APOCIII protein in a human subject requiring such improvement, wherein the method comprises a therapeutically effective dose of 50 mg or about 50 mg of the following chemically modified oligonucleotide: [ka] The method comprising subcutaneously administering (SEQ ID NO: 3) or a salt thereof to the human subject.

[0083] Embodiment 37. A method for improving FCS, reducing APOCIII RNA, or reducing APOCIII protein in a human subject requiring such improvement, wherein the method comprises a therapeutically effective dose of 80 mg or about 80 mg of the following chemically modified oligonucleotides: [ka] The method comprising subcutaneously administering (SEQ ID NO: 3) or a salt thereof to the human subject.

[0084] Embodiment 38. A modified oligonucleotide according to Embodiment 36 or Embodiment 37, which is a sodium salt or a potassium salt.

[0085] Embodiment 39. A method for improving FCS, reducing APOCIII RNA, or reducing APOCIII protein in a human subject requiring such improvement, wherein the method comprises a therapeutically effective dose of 50 mg or about 50 mg of the following chemically modified oligonucleotide: [ka] The method comprising intrathecal administration of (Sequence ID 3) to the human subject.

[0086] Embodiment 40. A method for improving FCS, reducing APOCIII RNA, or reducing APOCIII protein in a human subject requiring such improvement, wherein the method comprises a therapeutically effective dose of 80 mg or about 80 mg of the following chemically modified oligonucleotides: [ka] The method comprising subcutaneously administering (SEQ ID NO: 3) to the human subject.

[0087] Embodiment 41. A method for improving FCS, reducing APOCIII RNA, or reducing APOCIII protein in a human subject requiring such improvement, the method comprising subcutaneously administering a therapeutically effective dose of 50 mg or about 50 mg of a modified oligonucleotide to the human subject, wherein the modified oligonucleotide is chemically represented as follows (5' to 3'): A es G es m C es T es T es m C ds T ds T ds G ds T ds m C ds m C ds A ds G ds m C ds T es T es T es A es T e (Sequence No. 3) (In the formula, A = adenine nucleic acid base, mC=5-methylcytosine nucleic acid base, G = guanine nucleic acid base, T=thymine nucleobase, e=2'-MOE sugar moiety, d=2'-β-D-deoxyribosyl sugar moiety, and (s = phosphorothioate nucleoside interbonding) The modified oligonucleotide has the following structure: 5'-trishexylamino-(THA)-C6GalNAc3 terminal cap (wherein the formula the phosphate group is bonded to the 5'-oxygen atom of the 5'-nucleoside): [ka] The method comprising the above.

[0088] Method for effecting improvement of FCS, reduction of APOCIII RNA, or reduction of APOCIII protein in a human subject who needs it, said method comprising subcutaneously administering to said human subject a therapeutically effective amount of 80 mg or about 80 mg of a modified oligonucleotide, said modified oligonucleotide having the following chemical notation (5' to 3'): A es G es m C es T es T es m C ds T ds T ds G ds T ds m C ds m C ds A ds G ds m C ds T es T es T<000…A es T e (SEQ ID NO: 3) (wherein<000050…A = adenine nucleobase, mC = 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, e = 2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, and s = phosphorothioate internucleoside linkage) and said modified oligonucleotide has a 5'-trishexylamino-(THA)-C6GalNAc3 terminal cap represented by the following structure (wherein the phosphate group is attached to the 5'-oxygen atom of the 5'-nucleoside):

Chemical formula

[0089] Embodiment 43. The method according to any one of Embodiments 36 to 42, comprising administering the modified oligonucleotide approximately once every four weeks.

[0090] Embodiment 44. The method according to any one of Embodiments 36 to 42, comprising administering the modified oligonucleotide approximately once every 8 weeks.

[0091] Embodiment 45. The method according to any one of Embodiments 36 to 42, comprising administering the modified oligonucleotide approximately once every 16 weeks.

[0092] Embodiment 46. The method according to any one of Embodiments 36 to 45, wherein at least one symptom of FCS is improved.

[0093] Embodiment 47. The method according to Embodiment 46, wherein the at least one symptom includes severe hyperchylomicronemia, severe hypertriglyceridemia (always well above 1,000 mg / dL, and not uncommonly rising to over 10,000 mg / dL), frequent and severe abdominal pain, recurrent colic, physical fatigue, difficulty thinking, diarrhea, recurrent acute pancreatitis, exanthematous xanthomas, retinal lipidemia, and hepatosplenomegaly or a combination thereof.

[0094] Embodiment 48. The method according to any one of Embodiments 1 to 47, wherein APOCIII RNA is reduced.

[0095] Embodiment 49. The method according to any one of Embodiments 1 to 47, wherein APOCIII protein is reduced.

[0096] Embodiment 50. The method according to any one of Embodiments 1 to 49, comprising detecting fasting triglyceride levels in a biological sample from the human subject.

[0097] Embodiment 51: The method according to any one of Embodiments 1 to 49, comprising detecting fasting apoB-48 levels in a biological sample from the human subject.

[0098] Embodiment 52. The method according to any one of Embodiments 50 and 51, wherein the biological sample is plasma.

[0099] Embodiment 53: The method according to any one of Embodiments 1 to 49, comprising recording the determined acute pancreatitis event rate in the human subject.

[0100] Embodiment 54. The detection is performed before the administration, according to any one of Embodiments 50 to 52.

[0101] Embodiment 55. The detection is performed after the administration, according to any one of Embodiments 50 to 52.

[0102] Embodiment 56. The method according to any one of Embodiments 50 to 52, wherein the detection is performed before and after the administration.

[0103] Embodiment 57. The method according to any one of Embodiments 50 to 56, comprising adjusting the initial therapeutically effective dose administered after detecting the amount of APOCIII RNA, APOCIII protein, or a combination thereof.

[0104] Embodiment 58. The method according to Embodiment 57, wherein the dose is at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 90%, or at least about 100% more than the therapeutically effective dose.

[0105] Embodiment 59. The method according to any one of Embodiments 50 to 58, wherein the therapeutically effective dose is approximately 50 mg or 80 mg.

[0106] Embodiment 60. A method for improving familial hyperchylomicronemia syndrome (FCS), severe hypertriglyceridemia (SHTG), or familial partial lipodystrophy (FPL) in a human subject in need thereof, wherein the method comprises a therapeutically effective amount of a compound having the following chemical structure: [ka] The method comprising administering (SEQ ID NO: 3), or a salt thereof, to the human subject.

[0107] Embodiment 61. The compound according to Embodiment 1, which is a sodium salt or a potassium salt.

[0108] Embodiment 62. A method for improving familial hyperchylomicronemia syndrome (FCS), severe hypertriglyceridemia (SHTG), or familial partial lipodystrophy (FPL) in a human subject in need thereof, wherein the method comprises a therapeutically effective amount of a compound having the following chemical structure: [ka] The method comprising administering (SEQ ID NO: 3) to the human subject.

[0109] Embodiment 63. A method for improving familial hyperchylomicronemia syndrome (FCS), severe hypertriglyceridemia (SHTG), or familial partial lipodystrophy (FPL) in a human subject in need thereof, the method comprising a therapeutically effective amount of a modified oligonucleotide having the following chemical notation (5' to 3'): A es G es m C es T es T es m C ds T ds T ds G ds T ds m C ds m C ds A ds G ds m C ds T es T es T es A es T e (Sequence No. 3) (In the formula, A = adenine nucleic acid base, mC=5-methylcytosine nucleic acid base, G = guanine nucleic acid base, T=thymine nucleobase, e=2'-OCH2CH2OCH3 modified ribosyl sugar moiety, d=2'-β-D-deoxyribosyl sugar moiety, and (s = phosphorothioate nucleoside interbonding) The process involves administering a compound containing to the human subject, wherein the modified oligonucleotide is represented by the following structure: 5'-trishexylamino-(THA)-C6GalNAc3 terminal cap (wherein the formula the phosphate group is bonded to the 5'-oxygen atom of the 5'-nucleoside): [ka] The method comprising the above.

[0110] Embodiment 64. The method according to any one of Embodiments 60 to 63, which improves at least one symptom of familial hyperchylomicronemia syndrome (FCS), severe hypertriglyceridemia (SHTG), or familial partial lipodystrophy (FPL).

[0111] Embodiment 65. The method according to Embodiment 64, wherein at least one symptom of the FCS is hyperchylomicronemia, hypertriglyceridemia of at least 1000 mg / dL of triglycerides, abdominal pain, colic, physical fatigue, difficulty thinking, diarrhea, acute pancreatitis, exanthematous xanthomas, retinal lipidemia, and hepatosplenomegaly, or a combination thereof.

[0112] Embodiment 66. The method according to Embodiment 64, wherein at least one symptom of SHTG is hyperchylomicronemia, abdominal pain, colic, physical fatigue, difficulty thinking, diarrhea, acute pancreatitis, exanthematous xanthomas, retinal lipidemia, and hepatosplenomegaly, or a combination thereof.

[0113] Embodiment 67. The method according to Embodiment 64, wherein at least one symptom of FPL is hyperchylomicronemia, abdominal pain, colic, physical fatigue, difficulty thinking, diarrhea, acute pancreatitis, exanthematous xanthomas, retinal lipidemia, and hepatosplenomegaly, or a combination thereof.

[0114] Embodiment 68. The method according to any one of Embodiments 60 to 67, wherein the therapeutically effective dose is 50 mg.

[0115] Embodiment 69. The method according to any one of Embodiments 60 to 67, wherein the therapeutically effective dose is 60 mg.

[0116] Embodiment 70. The method according to any one of Embodiments 60 to 67, wherein the therapeutically effective dose is 70 mg.

[0117] Embodiment 71. The method according to any one of Embodiments 60 to 67, wherein the therapeutically effective dose is 80 mg.

[0118] Embodiment 72. The method according to any one of Embodiments 60 to 67, wherein the therapeutically effective dose is any of 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, and 100 mg.

[0119] Embodiment 73. The method according to any one of Embodiments 60 to 67, wherein the therapeutically effective dose is any of approximately 40 mg, approximately 45 mg, approximately 50 mg, approximately 55 mg, approximately 60 mg, approximately 65 mg, approximately 70 mg, approximately 75 mg, approximately 80 mg, approximately 85 mg, approximately 90 mg, approximately 95 mg, and approximately 100 mg.

[0120] Embodiment 74. The therapeutically effective doses are 40.0 mg, 40.1 mg, 40.2 mg, 40.3 mg, 40.4 mg, 40.5 mg, 40.6 mg, 40.7 mg, 40.8 mg, 40.9 mg, 41.0 mg, 41.1 mg, 41.2 mg, 41.3 mg, 41.4 mg, 41.5 mg, 41.6 mg, 41.7 mg, 41.8 mg, 41.9 mg, 42.0 mg, 42.1 mg, 42.2 mg, 42.3 mg, 42.4 mg, 42.5 mg, 42.6 mg, 42.7 mg, 42.8 mg, 42.9 mg, 43.0 mg, 43.1 mg, 43.2 mg, 43 .3mg, 43.4mg, 43.5mg, 43.6mg, 43.7mg, 43.8mg, 43.9mg, 44.0mg, 44.1mg, 44.2mg, 44.3mg, 44.4mg, 44.5mg, 44.6mg, 44.7mg, 44.8mg, 44.9mg, 45.0mg, 4 5.1mg, 45.2mg, 45.3mg, 45.4mg, 45.5mg, 45.6mg, 45.7mg, 45.8mg, 45.9mg, 46.0mg, 46.1mg, 46.2mg, 46.3mg, 46.4mg, 46.5mg, 46.6mg, 46.7mg, 46.8mg, 46.9mg, 47.0mg, 47.1mg, 47.2mg, 47.3mg, 47.4mg, 47.5mg, 47.6mg, 47.7mg, 47.8mg, 47.9mg, 48.0mg, 48.1mg, 48.2mg, 48.3mg, 48.4mg, 48.5mg, 48.6mg , 48.7mg, 48.8mg, 48.9mg, 49.0mg, 49.1mg, 49.2mg, 49.3mg, 49.4mg, 49.5mg, 49.6mg, 49.7mg, 49.8mg, 49.9mg, 50.0mg, 50.1mg, 50.2mg, 50.3mg, 50.4m g, 50.5mg, 50.6mg, 50.7mg, 50.8mg, 50.9mg, 51.0mg, 51.1mg, 51.2mg, 51.3mg, 51.4mg, 51.5mg, 51.6mg, 51.7mg, 51.8mg, 51.9mg, 52.0mg, 52.1mg, 52.2 mg, 52.3mg, 52.4mg, 52.5mg, 52.6mg, 52.7mg, 52.8mg, 52.9mg, 53.0mg, 53.1mg, 53.2mg, 53.3mg, 53.4mg, 53.5mg, 53.6mg, 53.7mg, 53.8mg, 53.9mg, 54.0mg、54.1mg、54.2mg、54.3mg、54.4mg、54.5mg、54.6mg、54.7mg、54.8mg、54.9mg、55.0mg、50.0mg、50.1mg、50.2mg、50.3mg、50.4mg、50.5mg、50.6mg、50.7mg、50.8mg、50.9mg、51.0mg、51.1mg、51.2mg、51.3mg、51.4mg、51.5mg、51.6mg、51.7mg、51.8mg、51.9mg、52.0mg、52.1mg、52.2mg、52.3mg、52.4mg、52.5mg、52.6mg、52.7mg、52.8mg、52.9mg、53.0mg、53.1mg、53.2mg、53.3mg、53.4mg、53.5mg、53.6mg、53.7mg、53.8mg、53.9mg、54.0mg、54.1mg、54.2mg、54.3mg、54.4mg、54.5mg、54.6mg、54.7mg、54.8mg、54.9mg、55.0mg、55.1mg、55.2mg、55.3mg、55.4mg、55.5mg、55.6mg、55.7mg、55.8mg、55.9mg、55.0mg、55.1mg、55.2mg、55.3mg、55.4mg、55.5mg、55.6mg、55.7mg、55.8mg、55.9mg、56.0mg、56.1mg、56.2mg、56.3mg、56.4mg、56.5mg、56.6mg、56.7mg、56.8mg、56.9mg、57.0mg、57.1mg、57.2mg、57.3mg、57.4mg、57.5mg、57.6mg、57.7mg、57.8mg、57.9mg、58.0mg、58.1mg、58.2mg、58.3mg、58.4mg、58.5mg、58.6mg、58.7mg、58.8mg、58.9mg、59.0mg、59.1mg、59.2mg、59.3mg、59.4mg、59.5mg、59.6mg、59.7mg、59.8mg、59.9mg、60.0mg、60.1mg、60.2mg、60.3mg、60.4mg、60.5mg、60.6mg、60.7mg、60.8mg、60.9mg、61.0mg、61.1mg、61.2mg、61.3mg、61.4mg、61.5mg、61.6mg、61.7mg、61.8mg、61.9mg、62.0mg、62.1mg、62.2mg、62.3mg、62.4mg、62.5mg、62.6mg、62.7mg、62.8mg、62.9mg、63.0mg、63.1mg、63.2mg、63.3mg、63.4mg、63.5mg、63.6mg、63.7mg、63.8mg、63.9mg、64.0mg、64.1mg、64.2mg、64.3mg、64.4mg、64.5mg、64.6mg、64.7mg、64.8mg、64.9mg、65.0mg、65.1mg、65.2mg、65.3mg、65.4mg、65.5mg、65.6mg、65.7mg、65.8mg、65.9mg、66.0mg、66.1mg、66.2mg、66.3mg、66.4mg、66.5mg、66.6mg、66.7mg、66.8mg、66.9mg、67.0mg、67.1mg、67.2mg、67.3mg、67.4mg、67.5mg、67.6mg、67.7mg、67.8mg、67.9mg、68.0mg、68.1mg、68.2mg、68.3mg、68.4mg、68.5mg、68.6mg、68.7mg、68.8mg、68.9mg、69.0mg、69.1mg、69.2mg、69.3mg、69.4mg、69.5mg、69.6mg、69.7mg、69.8mg、69.9mg、70.0mg、70.1mg、70.2mg、70.3mg、70.4mg、70.5mg、70.6mg、70.7mg、70.8mg、70.9mg、71.0mg、71.1mg、71.2mg、71.3mg、71.4mg、71.5mg、71.6mg、71.7mg、71.8mg、71.9mg、72.0mg、72.1mg、72.2mg、72.3mg、72.4mg、72.5mg、72.6mg、72.7mg、72.8mg、72.9mg、73.0mg、73.1mg、73.2mg、73.3mg、73.4mg、73.5mg、73.6mg、73.7mg、73.8mg、73.9mg、74.0mg、74.1mg、74.2mg、74.3mg、74.4mg、74.5mg、74.6mg、74.7mg、74.8mg、74.9mg、75.0mg、75.1mg、75.2mg、75.3mg、75.4mg、75.5mg、75.6mg、75.7mg、75.8mg、75.9mg、76.0mg、76.1mg、76.2mg、76.3mg、76.4mg、76.5mg、76.6mg、76.7mg、76.8mg、76.9mg、77.0mg、77.1mg、77.2mg、77.3mg、77.4mg、77.5mg、77.6mg、77.7mg、77.8mg、77.9mg、78.0mg、78.1mg、78.2mg、78.3mg、78.4mg、78.5mg、78.6mg、78.7mg、78.8mg、78.9mg、79.0mg、79.1mg、79.2mg、79.3mg、79.4mg、79.5mg、79.6mg、79.7mg、79.8mg、79.9mg、80.0mg、80.1mg、80.2mg、80.3mg、80.4mg、80.5mg、80.6mg、80.7mg、80.8mg、80.9mg、81.0mg、81.1mg、81.2mg、81.3mg、81.4mg、81.5mg、81.6mg、81.7mg、81.8mg、81.9mg、82.0mg、82.0mg、82.1mg、82.2mg、82.3mg、82.4mg、82.5mg、82.6mg、82.7mg、82.8mg、82.9mg、83.0mg、83.1mg、83.2mg、83.3mg、83.4mg、83.5mg、83.6mg、83.7mg、83.8mg、83.9mg、84.0mg、84.1mg、84.2mg、84.3mg、84.4mg、84.5mg、84.6mg、84.7mg、84.8mg、84.9mg、85.0mg、85.0mg、85.1mg、85.2mg、85.3mg、85.4mg、85.5mg、85.6mg、85.7mg、85.8mg、85.9mg、86.0mg、86.1mg、86.2mg、86.3mg、86.4mg、86.5mg、86.6mg、86.7mg、86.8mg、86.9mg、87.0mg、87.1mg、87.2mg、87.3mg、87.4mg、87.5mg、87.6mg、87.7mg、87.8mg、87.9mg、88.0mg、88.1mg、88.2mg、88.3mg、88.4mg、88.5mg、88.6mg、88.7mg、88.8mg、88.9mg、89.0mg、89.0mg、89.1mg、89.2mg、89.3mg、89.4mg、89.5mg、89.6mg、89.7mg、89.8mg、89.9mg、90.0mg、90.1mg、90.2mg、90.3mg、90.4mg、90.5mg, 90.6mg, 90.7mg, 90.8mg, 90.9mg, 91.0mg, 91.1mg, 91.2mg, 91.3mg, 91.4mg, 91.5mg, 91.6mg, 91.7mg, 91.8mg, 91.9mg, 92.0mg, 92.0mg, 92.1mg, 92.2mg, 92.3mg, 92.4mg, 92.5mg, 92.6mg, 92.7mg, 92.8mg, 92.9m g, 93.0mg, 93.1mg, 93.2mg, 93.3mg, 93.4mg, 93.5mg, 93.6mg, 93.7mg, 93.8mg, 93.9mg, 94.0mg, 94.1mg, 94. 2mg, 94.3mg, 94.4mg, 94.5mg, 94.6mg, 94.7mg, 94.8mg, 94.9mg, 95.0mg, 95.1mg, 95.2mg, 95.3mg, 95.4mg, 9 5.5mg, 95.6mg, 95.7mg, 95.8mg, 95.9mg, 96.0mg, 96.1mg, 96.2mg, 96.3mg, 96.4mg, 96.5mg, 96.6mg, 96.7m g, 96.8mg, 96.9mg, 97.0mg, 97.1mg, 97.2mg, 97.3mg, 97.4mg, 97.5mg, 97.6mg, 97.7mg, 97.8mg, 97.9mg, 98. The method according to any one of Embodiments 60 to 67, wherein the amount is any of 0 mg, 98.1 mg, 98.2 mg, 98.3 mg, 98.4 mg, 98.5 mg, 98.6 mg, 98.7 mg, 98.8 mg, 98.9 mg, 99.0 mg, 99.1 mg, 99.2 mg, 99.3 mg, 99.4 mg, 99.5 mg, 99.6 mg, 99.7 mg, 99.8 mg, 99.9 mg, and 100.0 mg.

[0121] Embodiment 75. The therapeutically effective doses are approximately 40.0 mg, approximately 40.1 mg, approximately 40.2 mg, approximately 40.3 mg, approximately 40.4 mg, approximately 40.5 mg, approximately 40.6 mg, approximately 40.7 mg, approximately 40.8 mg, approximately 40.9 mg, approximately 41.0 mg, approximately 41.1 mg, approximately 41.2 mg, approximately 41.3 mg, approximately 41.4 mg, approximately 41.5 mg, approximately 41.6 mg, approximately 41.7 mg, approximately 41.8 mg, approximately 41.9 mg, approximately 42.0 mg, approximately 42.1 mg, approximately 42.2 mg, approximately 42.3 mg, approximately 42.4 mg, approximately 42.5 mg, approximately 42.6 mg, approximately 42.7 mg, approximately 42.8 mg, Approximately 42.9mg, approximately 43.0mg, approximately 43.1mg, approximately 43.2mg, approximately 43.3mg, approximately 43.4mg, approximately 43.5mg, approximately 43.6mg, approximately 43.7mg, approximately 43.8mg, approximately 43.9mg, approximately 44.0mg, approximately 44.1mg, approximately 44.2mg, approximately 44.3mg, approximately 44.4mg, approximately 44.5mg, approximately 44.6mg, approximately 44.7mg, approximately 44.8mg, approximately 44.9mg, approximately 45.0mg, approximately 45.1mg, approximately 45.2mg, approximately 45.3mg, approximately 45.4mg, approximately 45.5mg, approximately 45.6mg, approximately 45.7mg, approximately 45.8mg, approximately 45.9mg, approximately 46.0mg, approximately 46.1mg, approximately 46.2mg, approximately 46.3mg, approximately 46.4mg, approximately 46.5mg, approximately 46.6mg, approximately 46.7mg, approximately 46.8mg, approximately 46.9mg, approximately 47.0mg, approximately 47.1mg, approximately 47.2mg, approximately 47.3mg, approximately 47.4mg, approximately 47.5mg, approximately 47.6mg, approximately 47.7mg, approximately 47.8mg, approximately 47.9mg, approximately 48.0mg, approximately 48.1mg, approximately 48.2mg, approximately 48.3mg, approximately 48.4mg, approximately 48.5mg, approximately 48.6mg, approximately 48.7mg, approximately 48.8mg, approximately 48.9mg, approximately 49.0mg, approximately 4 9.1mg, approximately 49.2mg, approximately 49.3mg, approximately 49.4mg, approximately 49.5mg, approximately 49.6mg, approximately 49.7mg, approximately 49.8mg, approximately 49.9mg, approximately 50.0mg, approximately 50.1mg, approximately 50.2mg, approximately 50.3mg, approximately 50.4mg, approximately 50.5mg, approximately 50.6mg, approximately 50.7mg, approximately 50.8mg, approximately 50.9mg, approximately 51.0mg, approximately 51.1mg, approximately 51.2mg, approximately 51.3mg, approximately 51.4mg, approximately 51.5mg, approximately 51.6mg, approximately 51.7mg, approximately 51.8mg, approximately 51.9mg, approximately 52.0mg, approximately 52.1mg, approximately 52.2mg, approximately 52.3mg, approximately 52.4mg, approximately 52.5mg, approximately 52.6mg, approximately 52.7mg, approximately 52.8mg, approximately 52.9mg, approximately 53.0mg, approximately 53.1mg, approximately 53.2mg, approximately 53.3mg. Approximately 53.4mg, approximately 53.5mg, approximately 53.6mg, approximately 53.7mg, approximately 53.8mg, approximately 53.9mg, approximately 54.0mg, approximately 54.1mg, approximately 54.2mg, approximately 54.3mg, approximately 54.4mg, approximately 54.5mg, approximately 54.6mg, approximately 54.7mg, approximately 54.8mg, approximately 54.9mg, approximately 55.0mg, approximately 55.1mg, approximately 55.2mg, approximately 55.3mg. Approximately 55.4mg, 55.5mg, 55.6mg, 55.7mg, 55.8mg, 55.9mg, 55.0mg, 55.1mg, 55.2mg, 55.3mg, 55.4mg, 55.5mg, 55.6mg, 55.7mg, 55.8mg, 55.9mg, 56.0mg, 56.1mg, 56.2mg, 56.3mg. Approximately 56.4mg, 56.5mg, 56.6mg, 56.7mg, 56.8mg, 56.9mg, 57.0mg, 57.1mg, 57.2mg, 57.3mg, 57.4mg, 57.5mg, 57.6mg, 57.7mg, 57.8mg, 57.9mg, 58.0mg, 58.1mg, 58.2mg, 58.3mg. Approximately 58.4mg, approximately 58.5mg, approximately 58.6mg, approximately 58.7mg, approximately 58.8mg, approximately 58.9mg, approximately 59.0mg, approximately 59.1mg, approximately 59.2mg, approximately 59.3mg, approximately 59.4mg, approximately 59.5mg, approximately 59.6mg, approximately 59.7mg, approximately 59.8mg, approximately 59.9mg, approximately 60.0mg, approximately 60.1mg, approximately 60.2mg, approximately 60.3mg, approximately 60.4mg, approximately 60.5mg, approximately 60.6mg, approximately 60.7mg, approximately 60.8mg, approximately 60.9mg, approximately 61.0mg g, about 61.1mg, about 61.2mg, about 61.3mg, about 61.4mg, about 61.5mg, about 61.6mg, about 61.7mg, about 61.8mg, about 61.9mg, about 62.0mg, about 62.1mg, about 62.2mg, about 62.3mg, about 62.4mg, about 62.5mg, about 62.6mg, about 62.7mg, about 62.8mg, about 62.9mg, about 63.0mg, about 63.1mg, about 63.2mg, about 63.3mg, about 63.4mg, about 63.5mg, about 63.6mg, about 63.7mg, approximately 63.8mg, approximately 63.9mg, approximately 64.0mg, approximately 64.1mg, approximately 64.2mg, approximately 64.3mg, approximately 64.4mg, approximately 64.5mg, approximately 64.6mg, approximately 64.7mg, approximately 64.8mg, approximately 64.9mg, approximately 65.0mg, approximately 65.1mg, approximately 65.2mg, approximately 65.3mg, approximately 65.4mg, approximately 65.5mg, approximately 65.6mg, approximately 65.7mg, approximately 65.8mg, approximately 65.9mg, approximately 66.0mg, approximately 66.1mg, approximately 66.2mg, approximately 66.3mg, approximately 66.4mg, approximately 66.5mg, approximately 66.6mg, approximately 66.7mg, approximately 66.8mg g, approx. 66.9 mg, approx. 67.0 mg, approx. 67.1 mg, approx. 67.2 mg, approx. 67.3 mg, approx. 67.4 mg, approx. 67.5 mg, approx. 67.6 mg, approx. 67.7 mg, approx. 67.8 mg, approx. .4mg, about 68.5mg, about 68.6mg, about 68.7mg, about 68.8mg, about 68.9mg, about 69.0mg, about 69.1mg, about 69.2mg, about 69.3mg, about 69.4mg, about 69.5mg, about 69.6mg, about 69.7mg, about 69.8mg, about 69.9mg, Approximately 70.0mg, approximately 70.1mg, approximately 70.2mg, approximately 70.3mg, approximately 70.4mg, approximately 70.5mg, approximately 70.6mg, approximately 70.7mg, approximately 70.8mg, approximately 70.9mg, approximately 71.0mg, approximately 71.1mg, approximately 71.2mg, approximately 71.3mg, approximately 71.4mg, approximately 71.5mg, approximately 71.6mg, approximately 71.7mg, approximately 71.8mg, approximately 71.9mg, approximately 72.0mg, approximately 72.1mg, approximately 72.2mg, approximately 72.3mg, approximately 72.4mg, approximately 72.5mg, approximately 72.6mg, approximately 72.7mg, approximately 72.8mg, approximately 72.9mg, approximately 73.0mg, approximately 7 3.1mg, approximately 73.2mg, approximately 73.3mg, approximately 73.4mg, approximately 73.5mg, approximately 73.6mg, approximately 73.7mg, approximately 73.8mg, approximately 73.9mg, approximately 74.0mg, approximately 74.1mg, approximately 74.2mg, approximately 74.3mg, approximately 74.4mg, approximately 74.5mg, approximately 74.6mg, approximately 74.7mg, approximately 74.8mg, approximately 74.9mg, approximately 75.0mg, approximately 75.1mg, approximately 75.2mg, approximately 75.3mg, approximately 75.4mg, approximately 75.5mg, approximately 75.6mg, approximately 75.7mg, approximately 75.8mg, approximately 75.9mg, approximately 76.0mg, approximately 76.1mg, approximately 76.2mg, about 76.3mg, about 76.4mg, about 76.5mg, about 76.6mg, about 76.7mg, about 76.8mg, about 76.9mg, about 77.0mg, about 77.1mg, about 77.2mg, about 77.3mg, about 77.4mg, about 77.5mg, about 77.6mg, about 77.7mg, about 77.8mg, about 77.9mg, about 78.0mg, about 78.1mg, about 78.2mg, about 78.3mg, about 78.4mg, about 78.5mg, about 78.6mg, about 78.7mg, about 78.8mg, about 78.9mg, about 79.0mg, about 79.1mg, about 79.2mg, about 79.3m g, approx. 79.4 mg, approx. 79.5 mg, approx. 79.6 mg, approx. 79.7 mg, approx. 79.8 mg, approx. 79.9 mg, approx. 80.0 mg, approx. 80.1 mg, approx. .9mg, about 81.0mg, about 81.1mg, about 81.2mg, about 81.3mg, about 81.4mg, about 81.5mg, about 81.6mg, about 81.7mg, about 81.8mg, about 81.9mg, about 82.0mg, about 82.0mg, about 82.1mg, about 82.2mg, about 82.3mg, Approximately 82.4mg, approximately 82.5mg, approximately 82.6mg, approximately 82.7mg, approximately 82.8mg, approximately 82.9mg, approximately 83.0mg, approximately 83.1mg, approximately 83.2mg, approximately 83.3mg, approximately 83.4mg, approximately 83.5mg, approximately 83.6mg, approximately 83.7mg, approximately 83.8mg, approximately 83.9mg, approximately 84.0mg, approximately 84.1mg, approximately 84.2mg, approximately 84.3mg, approximately 84.4mg, approximately 84.5mg, approximately 84.6mg, approximately 84.7mg, approximately 84.8mg, approximately 84.9mg, approximately 85.0mg, approximately 85.1mg, approximately 85.2mg, approximately 85.3mg, approximately 85.4mg, approximately 8 5.5mg, approximately 85.6mg, approximately 85.7mg, approximately 85.8mg, approximately 85.9mg, approximately 86.0mg, approximately 86.1mg, approximately 86.2mg, approximately 86.3mg, approximately 86.4mg, approximately 86.5mg, approximately 86.6mg, approximately 86.7mg, approximately 86.8mg, approximately 86.9mg, approximately 87.0mg, approximately 87.1mg, approximately 87.2mg, approximately 87.3mg, approximately 87.4mg, approximately 87.5mg, approximately 87.6mg, approximately 87.7mg, approximately 87.8mg, approximately 87.9mg, approximately 88.0mg, approximately 88.1mg, approximately 88.2mg, approximately 88.3mg, approximately 88.4mg, approximately 88.5mg, approximately 88.6mg, approximately 88.7mg, approximately 88.8mg, approximately 88.9mg, approximately 89.0mg, approximately 89.1mg, approximately 89.2mg, approximately 89.3mg, approximately 89.4mg, approximately 89.5mg, approximately 89.6mg, approximately 89.7mg, approximately 89.8mg, approximately 89.9mg, approximately 90.0mg, approximately 90.1mg, approximately 90.2mg, approximately 90.3mg, approximately 90.4mg, approximately 90.5mg, approximately 90.6mg, approximately 90.7mg, approximately 90.8mg, approximately 90.9mg, approximately 91.0mg, approximately 91.1mg, approximately 91.2mg, approximately 91.3mg, approximately 91.4mg, approximately 91.5mg, approximately 91.6mg, approximately 91.7mg, approximately 91.8mg, approximately 91.9mg, approximately 92.0mg, approximately 92.1mg, approximately 92.2mg, approximately 92.3mg, approximately 92.4mg, approximately 92.5mg, approximately 92.6mg, approximately 92.7mg, approximately 92.8mg, approximately 92.9mg, approximately 93.0mg, approximately 93.1mg, approximately 93.2mg, approximately 93.3mg, approximately 93.4mg, approximately 93.5mg, approximately 93.6mg, approximately 93.7mg, approximately 93.8mg, approximately 93.9mg, approximately 94.0mg, approximately 94.1mg, approximately 94.2mg, approximately 94.3mg, approximately 94.4mg, approximately 94.5mg Approximately 94.6mg, 94.7mg, 94.8mg, 94.9mg, 95.0mg, 95.1mg, 95.2mg, 95.3mg, 95.4mg, 95.5mg, 95.6mg, 95.7mg, 95.8mg, 95.9mg, 96.0mg, 96.1mg, 96.2mg, 96.3mg, 96.4mg, 96.5mg, 96.6mg, 96.7mg, 96.8mg, 96.9mg, 97.0mg, 97.1mg, 97.2mg, 97.3mg, 97.4mg, 97. The method according to any one of Embodiments 60 to 67, wherein the amount is 5 mg, approximately 97.6 mg, approximately 97.7 mg, approximately 97.8 mg, approximately 97.9 mg, approximately 98.0 mg, approximately 98.1 mg, approximately 98.2 mg, approximately 98.3 mg, approximately 98.4 mg, approximately 98.5 mg, approximately 98.6 mg, approximately 98.7 mg, approximately 98.8 mg, approximately 98.9 mg, approximately 99.0 mg, approximately 99.1 mg, approximately 99.2 mg, approximately 99.3 mg, approximately 99.4 mg, approximately 99.5 mg, approximately 99.6 mg, approximately 99.7 mg, approximately 99.8 mg, approximately 99.9 mg, and approximately 100.0 mg.

[0122] Embodiment 76. The method according to any one of Embodiments 60 to 67, wherein the therapeutically effective amount is within the range of 40 mg to 100 mg, 40 mg to 80 mg, 40 mg to 70 mg, 40 mg to 60 mg, 40 mg to 50 mg, 50 mg to 100 mg, 50 mg to 80 mg, 50 mg to 70 mg, 50 mg to 60 mg, 60 mg to 100 mg, 60 mg to 80 mg, 60 mg to 70 mg, 70 mg to 100 mg, 70 mg to 80 mg, 80 mg to 100 mg, 80 mg to 90 mg, and 90 mg to 100 mg.

[0123] Embodiment 77. The method according to any one of Embodiments 60 to 67, wherein the therapeutically effective dose is any of less than 100 mg, less than 95 mg, less than 90 mg, less than 85 mg, less than 80 mg, less than 75 mg, less than 70 mg, less than 65 mg, less than 60 mg, less than 55 mg, less than 50 mg, less than 45 mg, and less than 40 mg.

[0124] Embodiment 78. The method according to any one of Embodiments 60 to 67, wherein the therapeutically effective dose is any of less than about 100 mg, less than about 95 mg, less than about 90 mg, less than about 85 mg, less than about 80 mg, less than about 75 mg, less than about 70 mg, less than about 65 mg, less than about 60 mg, less than about 55 mg, less than about 50 mg, less than about 45 mg, and less than about 40 mg.

[0125] Embodiment 79. The method according to any one of Embodiments 60 to 67, wherein the therapeutically effective dose is at least 40 mg, at least 45 mg, at least 50 mg, at least 55 mg, at least 60 mg, at least 65 mg, at least 70 mg, at least 75 mg, at least 80 mg, at least 85 mg, at least 90 mg, at least 95 mg, and at least about 100 mg.

[0126] Embodiment 80. The method according to any one of Embodiments 60 to 67, wherein the therapeutically effective dose is at least about 40 mg, at least about 45 mg, at least about 50 mg, at least about 55 mg, at least about 60 mg, at least about 65 mg, at least about 70 mg, at least about 75 mg, at least about 80 mg, at least about 85 mg, at least about 90 mg, at least about 95 mg, and at least about 100 mg.

[0127] Embodiment 81. The method according to any one of Embodiments 60 to 80, comprising administering the modified oligonucleotide once every four weeks.

[0128] Embodiment 82. The method according to any one of Embodiments 60 to 80, comprising administering the modified oligonucleotide once every 8 weeks.

[0129] Embodiment 83. The method according to any one of Embodiments 60 to 80, comprising administering the modified oligonucleotide once every 12 weeks.

[0130] Embodiment 84. The method according to any one of Embodiments 60 to 80, comprising administering the modified oligonucleotide once every 16 weeks.

[0131] Embodiment 85. The method according to any one of Embodiments 60 to 80, comprising administering the modified oligonucleotide once every 20 weeks.

[0132] Embodiment 86. The method according to any one of Embodiments 60 to 80, comprising administering the modified oligonucleotide approximately once every four weeks.

[0133] Embodiment 87. The method according to any one of Embodiments 60 to 80, comprising administering the modified oligonucleotide approximately once every 8 weeks.

[0134] Embodiment 88. The method according to any one of Embodiments 60 to 80, comprising administering the modified oligonucleotide approximately once every 12 weeks.

[0135] Embodiment 89. The method according to any one of Embodiments 60 to 80, comprising administering the modified oligonucleotide approximately once every 16 weeks.

[0136] Embodiment 90. The method according to any one of Embodiments 60 to 80, comprising administering the modified oligonucleotide approximately once every 20 weeks.

[0137] Embodiment 91. The method according to any one of Embodiments 60 to 80, comprising administering the modified oligonucleotide once every 1 week, once every 2 weeks, once every 3 weeks, once every 4 weeks, once every 5 weeks, once every 6 weeks, once every 7 weeks, once every 8 weeks, once every 9 weeks, once every 10 weeks, once every 11 weeks, once every 12 weeks, once every 13 weeks, once every 14 weeks, once every 15 weeks, once every 16 weeks, once every 17 weeks, once every 18 weeks, once every 19 weeks, and once every 20 weeks.

[0138] Embodiment 92. The method according to any one of Embodiments 60 to 80, comprising administering the modified oligonucleotide at any of the following intervals: once every approximately 1 week, once every approximately 2 weeks, once every approximately 3 weeks, once every approximately 4 weeks, once every approximately 5 weeks, once every approximately 6 weeks, once every approximately 7 weeks, once every approximately 8 weeks, once every approximately 9 weeks, once every approximately 10 weeks, once every approximately 11 weeks, once every approximately 12 weeks, once every approximately 13 weeks, once every approximately 14 weeks, once every approximately 15 weeks, once every approximately 16 weeks, once every approximately 17 weeks, once every approximately 18 weeks, once every approximately 19 weeks, and once every approximately 20 weeks.

[0139] Embodiment 93. The method according to any one of Embodiments 60 to 92, wherein the subject has an FCS.

[0140] Embodiment 94. The method according to any one of Embodiments 60 to 92, wherein the subject has an FPL.

[0141] Embodiment 95. The method according to any one of Embodiments 60 to 94, wherein the subject has STHG.

[0142] I. APOCIII In certain embodiments, this specification describes a method for reducing APOCIII RNA and / or APOCIII protein in cells or biological fluids of interest. APOCIII RNA is encoded by the human APOCIII gene. APOCIII protein is the protein expression product of APOCIII RNA. A representative nucleic acid sequence for the human APOCIII gene is provided in GENBANK accession number NT_035088.1, cleaved from nucleic acid bases 6238608 to 6242565, which is incorporated herein by SEQ ID NO: 1. A representative nucleic acid sequence for human APOCIII RNA is provided in GENBANK accession number NM_000040.2, which is incorporated herein by SEQ ID NO: 2.

[0143] II.ISIS678354 In certain embodiments, this specification describes a method for administering the modified oligonucleotide ISIS678354 to a subject requiring it. In certain embodiments, ISIS678354 is characterized by a 5-10-5 MOE gapmer covalently bonded at the 5' end to triantenary N-acetylgalactosamine (GalNAc3), a high-affinity ligand for hepatocyte-specific asialoglycoprotein receptor (ASGPR) (Prakash TP, Graham MJ, Yu J, et al Nucleic Acids Res 2014;42:8796-8807). ISIS678354 has the sequence (5' to 3')AGCTTCTTGTCCAGCTTTAT (incorporated herein as SEQ ID NO: 3), where each of nucleosides 1-5 and 16-20 (5' to 3') is a 2'-MOE nucleoside, each of nucleosides 6-15 is a 2'-β-D deoxyribonucleoside, the internucleoside bond is a phosphorothioate internucleoside bond, and each cytosine is 5-methylcytosine. ISIS678354 is represented by the following structure: 5'-trishexylamino-(THA)-C6GalNAc3 terminal cap (wherein the formula the phosphate group is bonded to the 5'-oxygen atom of the 5'-nucleoside): [ka] It has.

[0144] In certain embodiments, ISIS678354 is represented by the following chemical notation (5' to 3'): THA-C6-GalNAc3A es G es m C es T es T es m C ds T ds T ds G ds T ds m C ds m C ds A ds G dsm C ds T es T es T es A es T e (Sequence No. 3) (In the formula, A = adenine nucleic acid base, mC=5-methylcytosine nucleic acid base, G = guanine nucleic acid base, T=thymine nucleobase, e=2'-MOE sugar moiety, d=2'-β-D-deoxyribosyl sugar moiety, and (s = phosphorothioate nucleoside interbonding) It is represented by [this].

[0145] In a particular embodiment, ISIS678354 has the following chemical structure: [ka] Represented by (Sequence ID 3) or a salt thereof.

[0146] In a particular embodiment, the sodium salt of ISIS678354 has the following chemical structure: [ka] This is represented by (Sequence ID 3).

[0147] Prior clinical trials Phase 1 ISIS678354-CS1 was a phase 1, double-blind, placebo-controlled dose-escalation study designed to evaluate the safety, tolerability, and pharmacokinetics of single and multiple doses of ISIS678354 administered by subcutaneous (SC) injection to healthy subjects (18–65 years of age). The single dose escalation (SAD) portion of the study evaluated five dose levels (10, 30, 60, 90, and 120 mg) sequentially. The multiple dose escalation (MAD) portion evaluated two dose levels (15 and 30 mg) over six weeks with weekly dosing, and one dose level (60 mg) over three months with four-week dosing. The SAD and weekly MAD dose levels were studied in a cohort of eight subjects, with six randomized to receive effective treatment with ISIS678354 and two randomized to placebo. In the MAD cohort, conducted every four weeks, 10 subjects were studied (6 receiving the active ingredient and 4 receiving placebo). In all 90 and 120 mg SAD and MAD cohorts, the pharmacodynamic effect of ISIS678354 versus placebo was tested in healthy subjects with elevated triglyceride levels (TG > 200 mg / dL and ≤ 500 mg / dL).

[0148] Results from the SAD portion of the Phase 1 study showed a significant dose-dependent sustained decrease in fasting total apoC-III and TG levels. Significant dose-dependent decreases of up to approximately -30% in apoB and increases of up to approximately 100% in HDL-C were also observed. No significant increases in LDL-C were observed in any dose group. The effects persisted for at least 4 weeks after the last dose, consistent with the drug's long-term elimination half-life. Overall, ISIS678354 was well-tolerated and there were no safety concerns.

[0149] Phase 2 The Phase II study was a multicenter, randomized, double-blind, placebo-controlled dose-range study. A total of 114 patients with established cardiovascular disease (CVD) or at risk of CVD, with fasting TG levels of ≥200 mg / dL and ≤500 mg / dL, and receiving standard care prophylactic therapy for those known CVD risk factors, were randomly assigned to one of four parallel dosing cohorts, each cohort receiving SC injections for up to 12 months in a 4:1 ratio of ISIS678354 or a matched volume of placebo. The study evaluated three different doses of ISIS678354: 10, 15, and 50 mg, as well as three different dosing regimens: weekly, every 2 weeks, and every 4 weeks (Q4W). The dosing range encompassed equivalent monthly drug exposure from 10 mg to 50 mg. Treatment duration was 6 to 12 months. The treatment portion of the study was completed when the last patient reached 6 months of exposure. Next, all patients entered a 13-week post-procedure follow-up period.

[0150] The primary efficacy analysis for the primary endpoint was a paired comparison of the percentage change in fasting triglycerides (TG) from baseline to the primary analysis time between the ISIS678354 treatment group and the pooled placebo group. The primary efficacy analysis time was week 25 for patients receiving medication every four weeks and week 27 for patients receiving medication every two weeks or weekly.

[0151] Compared to placebo, a significant reduction in fasting TG levels from baseline to the primary analysis time was observed in all ISIS678354 treatment groups. The highest dose group (50 mg Q4W) achieved a mean 62% reduction from baseline in fasting TG levels and a mean 74% reduction from baseline in apoC-III levels compared to placebo. The proportion of patients achieving normal fasting TG levels <150 mg / dL showed a significant dose-dependent increase in all ISIS678354 treatment groups, exceeding 90% (20 / 22) in patients treated with the highest dose of 50 mg Q4W, compared to only 4.2% (1 / 24) in placebo patients who achieved this threshold. ISIS678354 was well tolerated, and no safety concerns were raised.

[0152] III. Certain Pharmaceutical Compositions In certain embodiments, this specification describes a method comprising administering a pharmaceutical composition containing the modified oligonucleotide ISIS678354 to a subject. In certain embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutical composition comprises or essentially consists of sterile saline solution and the modified oligonucleotide ISIS678354. In certain embodiments, the sterile saline is pharmaceutical-grade saline. In certain embodiments, the pharmaceutical composition comprises or essentially consists of sterile water and the modified oligonucleotide ISIS678354. In certain embodiments, the sterile water is pharmaceutical-grade water. In certain embodiments, the pharmaceutically acceptable diluent or carrier is water or saline. Water may be water for injection (WFI). Saline may be phosphate-buffered saline.

[0153] In certain embodiments, the pharmaceutical composition comprises one or more excipients and a modified oligonucleotide ISIS678354. In certain embodiments, the excipients are selected from water, salt solutions, alcohols, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, and polyvinylpyrrolidone.

[0154] In certain embodiments, a pharmaceutical composition comprising modified oligonucleotide ISIS678354 includes any pharmaceutically acceptable salt of modified oligonucleotide ISIS678354, an ester of modified oligonucleotide ISIS678354, or a salt of such an ester. In certain embodiments, a pharmaceutical composition comprising modified oligonucleotide ISIS678354 can provide (directly or indirectly) a biologically active metabolite or its residue upon administration to a human subject. Thus, for example, this disclosure also covers pharmaceutically acceptable salts of modified oligonucleotide ISIS678354, prodrugs of modified oligonucleotide ISIS678354, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Preferred pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.

[0155] In certain embodiments, the pharmaceutical composition comprises one or more lipid moieties and a modified oligonucleotide ISIS678354. In certain embodiments, the lipid moieties are used to increase the distribution of ISIS678354 to specific cells or tissues. In certain such methods, the modified oligonucleotide ISIS678354 is introduced into a pre-formed liposome or lipoplex made from a mixture of cationic and neutral lipids. In certain methods, a DNA complex with mono- or polycationic lipids is formed without the presence of neutral lipids.

[0156] In certain embodiments, the pharmaceutical compositions disclosed herein include a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing pharmaceutical compositions that include hydrophobic compounds. In certain embodiments, certain organic solvents, such as dimethyl sulfoxide, are used.

[0157] In certain embodiments, the pharmaceutical composition comprises one or more tissue-specific delivery molecules designed to deliver the modified oligonucleotides described herein to a specific tissue or cell type. For example, in certain embodiments, the pharmaceutical composition comprises liposomes coated with tissue-specific antibodies.

[0158] In certain embodiments, the pharmaceutical composition includes a cosolvent system. Certain such cosolvent systems include, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such a cosolvent system is used for hydrophobic compounds. A non-limiting example of such a cosolvent system is the VPD cosolvent system, which is a solution of anhydrous ethanol containing 3% w / v benzyl alcohol, 8% w / v nonpolar surfactant Polysorbate 80™, and 65% w / v polyethylene glycol 300. The proportions of such cosolvent systems can vary considerably without significantly altering their solubility and toxicity properties. Furthermore, the identity of the cosolvent components may vary; for example, other surfactants may be used instead of Polysorbate 80™, the fraction size of polyethylene glycol may vary, other biocompatible polymers may replace polyethylene glycol, such as polyvinylpyrrolidone, and other sugars or polysaccharides may substitute for dextrose.

[0159] In certain embodiments, the pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intraventricular (ICV)). In certain such embodiments, the pharmaceutical composition comprises a carrier and is formulated in an aqueous solution such as aCSF, water, or a physiologically compatible buffer such as Hanks' solution, Ringer's solution, or saline buffer. In certain embodiments, other components are included (e.g., components that aid solubility or serve as preservatives). In certain embodiments, the injectable suspension is prepared using a suitable liquid carrier, suspension, etc. Specific pharmaceutical compositions for injection are provided in unit dosage forms, for example, in ampoules or in multi-dose containers. Specific pharmaceutical compositions for injection are suspensions, solutions, or emulsions in an oily or aqueous vehicle and may include formulations such as suspensions, stabilizers, and / or dispersants. Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents such as sesame oil, fatty oils, synthetic fatty acid esters such as ethyl oleate or triglycerides, and liposomes.

[0160] Under certain conditions, the modified oligonucleotide ISIS678354 acts as an acid. ISIS678354 may be described or depicted in a protonated (free acid) form or in an ionized (salt) form associated with a cation, but aqueous solutions of ISIS678354 exist in equilibrium among such forms. For example, the phosphate bond of ISIS678354 in aqueous solution is in equilibrium between the free acid, anionic, and salt forms. Unless otherwise indicated, the term "ISIS678354" is intended to include all such forms. Furthermore, ISIS678354 has several such bonds, each of which is in equilibrium. Thus, in solution, ISIS678354 exists as a collection of forms, all in equilibrium at multiple positions. The term "ISIS678354" is intended to include all such forms. Illustrated structures necessarily depict a single form. Nevertheless, unless otherwise indicated, such drawings are also intended to include the corresponding forms. In this specification, structures showing the free acid of ISIS678354, followed by the term "or its salt," explicitly include all such forms that may be fully or partially protonated / deprotonated / associated with cations. In certain examples, one or more specific cations are identified.

[0161] In certain embodiments, ISIS678354 is in an aqueous solution containing sodium. In certain embodiments, ISIS678354 is in an aqueous solution containing potassium. In certain embodiments, ISIS678354 is in PBS. In certain embodiments, ISIS678354 is in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and / or HCl to achieve the desired pH.

[0162] In this specification, specific doses are described. For clarity, the dose of ISIS678354 in milligrams represents the mass of ISIS678354 in its free acid form. As mentioned above, in aqueous solution, the free acid is in equilibrium with its anionic and salt forms. However, for the purpose of calculating doses, it is assumed that ISIS678354 exists as a solvent-free, sodium acetate-free, anhydrous, free acid. For example, if ISIS678354 is in a sodium-containing solution (e.g., physiological saline), ISIS678354 may be partially or completely deprotonated and associate with Na+ ions. However, the mass of the proton is nevertheless counted in the weight of the dose, while the mass of the Na+ ion is not counted in the weight of the dose. Thus, for example, a dose of 80 mg of ISIS678354 is equal to the number of fully protonated molecules weighing 80 mg.

[0163] In certain embodiments, administration is subcutaneous.

[0164] IV. A specific dosage In certain embodiments, this specification describes a method comprising administering a therapeutically effective amount of modified oligonucleotide ISIS678354 to a subject. The amount may be therapeutically effective in treating or improving a human subject having one of the diseases or conditions described herein, such as familial hyperchylomicronemia syndrome (FCS), severe hypertriglyceridemia (SHTG), or familial partial lipodystrophy (FPL). In certain embodiments, the amount is therapeutically effective when treating familial hyperchylomicronemia syndrome (FCS). In certain embodiments, the therapeutically effective amount is 50 mg. In certain embodiments, the therapeutically effective amount is 60 mg. In certain embodiments, the therapeutically effective amount is 70 mg. In certain embodiments, the therapeutically effective amount is 80 mg.

[0165] In a particular embodiment, the therapeutically effective dose is any of 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, and 100 mg.

[0166] In a particular embodiment, the therapeutically effective dose is one of approximately 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, and 100 mg.

[0167] In a particular embodiment, the therapeutically effective doses are 40.0 mg, 40.1 mg, 40.2 mg, 40.3 mg, 40.4 mg, 40.5 mg, 40.6 mg, 40.7 mg, 40.8 mg, 40.9 mg, 41.0 mg, 41.1 mg, 41.2 mg, 41.3 mg, 41.4 mg, 41.5 mg, 41.6 mg, 41.7 mg, 41.8 mg, 41.9 mg, 42.0 mg, 42.1 mg, 42.2 mg, 42.3 mg, 42.4 mg, 42.5 mg, 42.6 mg, 42.7 mg, 42.8 mg, 42.9 mg, 43.0 mg, 43.1 mg, 43.2 mg g, 43.3mg, 43.4mg, 43.5mg, 43.6mg, 43.7mg, 43.8mg, 43.9mg, 44.0mg, 44.1mg, 44.2mg, 44.3mg, 44.4mg, 44.5mg, 44.6mg, 44.7mg, 44.8mg, 44.9mg, 45. 0mg, 45.1mg, 45.2mg, 45.3mg, 45.4mg, 45.5mg, 45.6mg, 45.7mg, 45.8mg, 45.9mg, 46.0mg, 46.1mg, 46.2mg, 46.3mg, 46.4mg, 46.5mg, 46.6mg, 46.7mg, 46 .8mg, 46.9mg, 47.0mg, 47.1mg, 47.2mg, 47.3mg, 47.4mg, 47.5mg, 47.6mg, 47.7mg, 47.8mg, 47.9mg, 48.0mg, 48.1mg, 48.2mg, 48.3mg, 48.4mg, 48.5mg, 48.6mg, 48.7mg, 48.8mg, 48.9mg, 49.0mg, 49.1mg, 49.2mg, 49.3mg, 49.4mg, 49.5mg, 49.6mg, 49.7mg, 49.8mg, 49.9mg, 50.0mg, 50.1mg, 50.2mg, 50.3mg , 50.4mg, 50.5mg, 50.6mg, 50.7mg, 50.8mg, 50.9mg, 51.0mg, 51.1mg, 51.2mg, 51.3mg, 51.4mg, 51.5mg, 51.6mg, 51.7mg, 51.8mg, 51.9mg, 52.0mg, 52.1 mg, 52.2mg, 52.3mg, 52.4mg, 52.5mg, 52.6mg, 52.7mg, 52.8mg, 52.9mg, 53.0mg, 53.1mg, 53.2mg, 53.3mg, 53.4mg, 53.5mg, 53.6mg, 53.7mg, 53.8mg, 53.9mg、54.0mg、54.1mg、54.2mg、54.3mg、54.4mg、54.5mg、54.6mg、54.7mg、54.8mg、54.9mg、55.0mg、50.0mg、50.1mg、50.2mg、50.3mg、50.4mg、50.5mg、50.6mg、50.7mg、50.8mg、50.9mg、51.0mg、51.1mg、51.2mg、51.3mg、51.4mg、51.5mg、51.6mg、51.7mg、51.8mg、51.9mg、52.0mg、52.1mg、52.2mg、52.3mg、52.4mg、52.5mg、52.6mg、52.7mg、52.8mg、52.9mg、53.0mg、53.1mg、53.2mg、53.3mg、53.4mg、53.5mg、53.6mg、53.7mg、53.8mg、53.9mg、54.0mg、54.1mg、54.2mg、54.3mg、54.4mg、54.5mg、54.6mg、54.7mg、54.8mg、54.9mg、55.0mg、55.1mg、55.2mg、55.3mg、55.4mg、55.5mg、55.6mg、55.7mg、55.8mg、55.9mg、55.0mg、55.1mg、55.2mg、55.3mg、55.4mg、55.5mg、55.6mg、55.7mg、55.8mg、55.9mg、56.0mg、56.1mg、56.2mg、56.3mg、56.4mg、56.5mg、56.6mg、56.7mg、56.8mg、56.9mg、57.0mg、57.1mg、57.2mg、57.3mg、57.4mg、57.5mg、57.6mg、57.7mg、57.8mg、57.9mg、58.0mg、58.1mg、58.2mg、58.3mg、58.4mg、58.5mg、58.6mg、58.7mg、58.8mg、58.9mg、59.0mg、59.1mg、59.2mg、59.3mg、59.4mg、59.5mg、59.6mg、59.7mg、59.8mg、59.9mg、60.0mg、60.1mg、60.2mg、60.3mg、60.4mg、60.5mg、60.6mg、60.7mg、60.8mg、60.9mg、61.0mg、61.1mg、61.2mg、61.3mg、61.4mg、61.5mg、61.6mg、61.7mg、61.8mg、61.9mg、62.0mg、62.1mg、62.2mg、62.3mg、62.4mg、62.5mg、62.6mg、62.7mg、62.8mg、62.9mg、63.0mg、63.1mg、63.2mg、63.3mg、63.4mg、63.5mg、63.6mg、63.7mg、63.8mg、63.9mg、64.0mg、64.1mg、64.2mg、64.3mg、64.4mg、64.5mg、64.6mg、64.7mg、64.8mg、64.9mg、65.0mg、65.1mg、65.2mg、65.3mg、65.4mg、65.5mg、65.6mg、65.7mg、65.8mg、65.9mg、66.0mg、66.1mg、66.2mg、66.3mg、66.4mg、66.5mg、66.6mg、66.7mg、66.8mg、66.9mg、67.0mg、67.1mg、67.2mg、67.3mg、67.4mg、67.5mg、67.6mg、67.7mg、67.8mg、67.9mg、68.0mg、68.1mg、68.2mg、68.3mg、68.4mg、68.5mg、68.6mg、68.7mg、68.8mg、68.9mg、69.0mg、69.1mg、69.2mg、69.3mg、69.4mg、69.5mg、69.6mg、69.7mg、69.8mg、69.9mg、70.0mg、70.1mg、70.2mg、70.3mg、70.4mg、70.5mg、70.6mg、70.7mg、70.8mg、70.9mg、71.0mg、71.1mg、71.2mg、71.3mg、71.4mg、71.5mg、71.6mg、71.7mg、71.8mg、71.9mg、72.0mg、72.1mg、72.2mg、72.3mg、72.4mg、72.5mg、72.6mg、72.7mg、72.8mg、72.9mg、73.0mg、73.1mg、73.2mg、73.3mg、73.4mg、73.5mg、73.6mg、73.7mg、73.8mg、73.9mg、74.0mg、74.1mg、74.2mg、74.3mg、74.4mg、74.5mg、74.6mg、74.7mg、74.8mg、74.9mg、75.0mg、75.1mg、75.2mg、75.3mg、75.4mg、75.5mg、75.6mg、75.7mg、75.8mg、75.9mg、76.0mg、76.1mg、76.2mg、76.3mg、76.4mg、76.5mg、76.6mg、76.7mg、76.8mg、76.9mg、77.0mg、77.1mg、77.2mg、77.3mg、77.4mg、77.5mg、77.6mg、77.7mg、77.8mg、77.9mg、78.0mg、78.1mg、78.2mg、78.3mg、78.4mg、78.5mg、78.6mg、78.7mg、78.8mg、78.9mg、79.0mg、79.1mg、79.2mg、79.3mg、79.4mg、79.5mg、79.6mg、79.7mg、79.8mg、79.9mg、80.0mg、80.1mg、80.2mg、80.3mg、80.4mg、80.5mg、80.6mg、80.7mg、80.8mg、80.9mg、81.0mg、81.1mg、81.2mg、81.3mg、81.4mg、81.5mg、81.6mg、81.7mg、81.8mg、81.9mg、82.0mg、82.0mg、82.1mg、82.2mg、82.3mg、82.4mg、82.5mg、82.6mg、82.7mg、82.8mg、82.9mg、83.0mg、83.1mg、83.2mg、83.3mg、83.4mg、83.5mg、83.6mg、83.7mg、83.8mg、83.9mg、84.0mg、84.1mg、84.2mg、84.3mg、84.4mg、84.5mg、84.6mg、84.7mg、84.8mg、84.9mg、85.0mg、85.0mg、85.1mg、85.2mg、85.3mg、85.4mg、85.5mg、85.6mg、85.7mg、85.8mg、85.9mg、86.0mg、86.1mg、86.2mg、86.3mg、86.4mg、86.5mg、86.6mg、86.7mg、86.8mg、86.9mg、87.0mg、87.1mg、87.2mg、87.3mg、87.4mg、87.5mg、87.6mg、87.7mg、87.8mg、87.9mg、88.0mg、88.1mg、88.2mg、88.3mg、88.4mg、88.5mg、88.6mg、88.7mg、88.8mg、88.9mg、89.0mg、89.0mg、89.1mg、89.2mg、89.3mg、89.4mg、89.5mg、89.6mg、89.7mg、89.8mg、89.9mg、90.0mg、90.1mg、90.2mg、90.3mg、90.4mg, 90.5mg, 90.6mg, 90.7mg, 90.8mg, 90.9mg, 91.0mg, 91.1mg, 91.2mg, 91.3mg, 91.4mg, 91.5mg, 91.6m g, 91.7mg, 91.8mg, 91.9mg, 92.0mg, 92.0mg, 92.1mg, 92.2mg, 92.3mg, 92.4mg, 92.5mg, 92.6mg, 92.7mg, 9 2.8mg, 92.9mg, 93.0mg, 93.1mg, 93.2mg, 93.3mg, 93.4mg, 93.5mg, 93.6mg, 93.7mg, 93.8mg, 93.9mg, 94.0 mg, 94.1mg, 94.2mg, 94.3mg, 94.4mg, 94.5mg, 94.6mg, 94.7mg, 94.8mg, 94.9mg, 95.0mg, 95.1mg, 95.2mg, 95.3mg, 95.4mg, 95.5mg, 95.6mg, 95.7mg, 95.8mg, 95.9mg, 96.0mg, 96.1mg, 96.2mg, 96.3mg, 96.4mg, 96 .5mg, 96.6mg, 96.7mg, 96.8mg, 96.9mg, 97.0mg, 97.1mg, 97.2mg, 97.3mg, 97.4mg, 97.5mg, 97.6mg, 97.7m The dosage is one of the following: g, 97.8 mg, 97.9 mg, 98.0 mg, 98.1 mg, 98.2 mg, 98.3 mg, 98.4 mg, 98.5 mg, 98.6 mg, 98.7 mg, 98.8 mg, 98.9 mg, 99.0 mg, 99.1 mg, 99.2 mg, 99.3 mg, 99.4 mg, 99.5 mg, 99.6 mg, 99.7 mg, 99.8 mg, 99.9 mg, or 100.0 mg.

[0168] In a particular embodiment, the therapeutically effective dose is approximately 40.0 mg, 40.1 mg, 40.2 mg, 40.3 mg, 40.4 mg, 40.5 mg, 40.6 mg, 40.7 mg, 40.8 mg, 40.9 mg, 41.0 mg, 41.1 mg, 41.2 mg, 41.3 mg, 41.4 mg, 41.5 mg, 41.6 mg, 41.7 mg, 41.8 mg, 41.9 mg, 42.0 mg, 42.1 mg, 42.2 mg, 42.3 mg, 42.4 mg, 42.5 mg, 42.6 mg, 42.7 mg, and 42.8 mg. g, approx. 42.9 mg, approx. 43.0 mg, approx. 43.1 mg, approx. 43.2 mg, approx. 43.3 mg, approx. 43.4 mg, approx. 43.5 mg, approx. 43.6 mg, approx. .4mg, about 44.5mg, about 44.6mg, about 44.7mg, about 44.8mg, about 44.9mg, about 45.0mg, about 45.1mg, about 45.2mg, about 45.3mg, about 45.4mg, about 45.5mg, about 45.6mg, about 45.7mg, about 45.8mg, about 45.9mg, Approximately 46.0mg, approximately 46.1mg, approximately 46.2mg, approximately 46.3mg, approximately 46.4mg, approximately 46.5mg, approximately 46.6mg, approximately 46.7mg, approximately 46.8mg, approximately 46.9mg, approximately 47.0mg, approximately 47.1mg, approximately 47.2mg, approximately 47.3mg, approximately 47.4mg, approximately 47.5mg, approximately 47.6mg, approximately 47.7mg, approximately 47.8mg, approximately 47.9mg, approximately 48.0mg, approximately 48.1mg, approximately 48.2mg, approximately 48.3mg, approximately 48.4mg, approximately 48.5mg, approximately 48.6mg, approximately 48.7mg, approximately 48.8mg, approximately 48.9mg, approximately 49.0mg, approximately 4 9.1mg, approximately 49.2mg, approximately 49.3mg, approximately 49.4mg, approximately 49.5mg, approximately 49.6mg, approximately 49.7mg, approximately 49.8mg, approximately 49.9mg, approximately 50.0mg, approximately 50.1mg, approximately 50.2mg, approximately 50.3mg, approximately 50.4mg, approximately 50.5mg, approximately 50.6mg, approximately 50.7mg, approximately 50.8mg, approximately 50.9mg, approximately 51.0mg, approximately 51.1mg, approximately 51.2mg, approximately 51.3mg, approximately 51.4mg, approximately 51.5mg, approximately 51.6mg, approximately 51.7mg, approximately 51.8mg, approximately 51.9mg, approximately 52.0mg, approximately 52.1mg, approximately 52.2mg, approximately 52.3mg, approximately 52.4mg, approximately 52.5mg, approximately 52.6mg, approximately 52.7mg, approximately 52.8mg, approximately 52.9mg, approximately 53.0mg, approximately 53.1mg, approximately 53.2mg, approximately 53.3mg. Approximately 53.4mg, approximately 53.5mg, approximately 53.6mg, approximately 53.7mg, approximately 53.8mg, approximately 53.9mg, approximately 54.0mg, approximately 54.1mg, approximately 54.2mg, approximately 54.3mg, approximately 54.4mg, approximately 54.5mg, approximately 54.6mg, approximately 54.7mg, approximately 54.8mg, approximately 54.9mg, approximately 55.0mg, approximately 55.1mg, approximately 55.2mg, approximately 55.3mg. Approximately 55.4mg, 55.5mg, 55.6mg, 55.7mg, 55.8mg, 55.9mg, 55.0mg, 55.1mg, 55.2mg, 55.3mg, 55.4mg, 55.5mg, 55.6mg, 55.7mg, 55.8mg, 55.9mg, 56.0mg, 56.1mg, 56.2mg, 56.3mg. Approximately 56.4mg, 56.5mg, 56.6mg, 56.7mg, 56.8mg, 56.9mg, 57.0mg, 57.1mg, 57.2mg, 57.3mg, 57.4mg, 57.5mg, 57.6mg, 57.7mg, 57.8mg, 57.9mg, 58.0mg, 58.1mg, 58.2mg, 58.3mg. Approximately 58.4mg, approximately 58.5mg, approximately 58.6mg, approximately 58.7mg, approximately 58.8mg, approximately 58.9mg, approximately 59.0mg, approximately 59.1mg, approximately 59.2mg, approximately 59.3mg, approximately 59.4mg, approximately 59.5mg, approximately 59.6mg, approximately 59.7mg, approximately 59.8mg, approximately 59.9mg, approximately 60.0mg, approximately 60.1mg, approximately 60.2mg, approximately 60.3mg, approximately 60.4mg, approximately 60.5mg, approximately 60.6mg, approximately 60.7mg, approximately 60.8mg, approximately 60.9mg, approximately 61.0mg g, about 61.1mg, about 61.2mg, about 61.3mg, about 61.4mg, about 61.5mg, about 61.6mg, about 61.7mg, about 61.8mg, about 61.9mg, about 62.0mg, about 62.1mg, about 62.2mg, about 62.3mg, about 62.4mg, about 62.5mg, about 62.6mg, about 62.7mg, about 62.8mg, about 62.9mg, about 63.0mg, about 63.1mg, about 63.2mg, about 63.3mg, about 63.4mg, about 63.5mg, about 63.6mg, about 63.7mg, approximately 63.8mg, approximately 63.9mg, approximately 64.0mg, approximately 64.1mg, approximately 64.2mg, approximately 64.3mg, approximately 64.4mg, approximately 64.5mg, approximately 64.6mg, approximately 64.7mg, approximately 64.8mg, approximately 64.9mg, approximately 65.0mg, approximately 65.1mg, approximately 65.2mg, approximately 65.3mg, approximately 65.4mg, approximately 65.5mg, approximately 65.6mg, approximately 65.7mg, approximately 65.8mg, approximately 65.9mg, approximately 66.0mg, approximately 66.1mg, approximately 66.2mg, approximately 66.3mg, approximately 66.4mg, approximately 66.5mg, approximately 66.6mg, approximately 66.7mg, approximately 66.8mg g, approx. 66.9 mg, approx. 67.0 mg, approx. 67.1 mg, approx. 67.2 mg, approx. 67.3 mg, approx. 67.4 mg, approx. 67.5 mg, approx. 67.6 mg, approx. 67.7 mg, approx. 67.8 mg, approx. .4mg, about 68.5mg, about 68.6mg, about 68.7mg, about 68.8mg, about 68.9mg, about 69.0mg, about 69.1mg, about 69.2mg, about 69.3mg, about 69.4mg, about 69.5mg, about 69.6mg, about 69.7mg, about 69.8mg, about 69.9mg, Approximately 70.0mg, approximately 70.1mg, approximately 70.2mg, approximately 70.3mg, approximately 70.4mg, approximately 70.5mg, approximately 70.6mg, approximately 70.7mg, approximately 70.8mg, approximately 70.9mg, approximately 71.0mg, approximately 71.1mg, approximately 71.2mg, approximately 71.3mg, approximately 71.4mg, approximately 71.5mg, approximately 71.6mg, approximately 71.7mg, approximately 71.8mg, approximately 71.9mg, approximately 72.0mg, approximately 72.1mg, approximately 72.2mg, approximately 72.3mg, approximately 72.4mg, approximately 72.5mg, approximately 72.6mg, approximately 72.7mg, approximately 72.8mg, approximately 72.9mg, approximately 73.0mg, approximately 7 3.1mg, approximately 73.2mg, approximately 73.3mg, approximately 73.4mg, approximately 73.5mg, approximately 73.6mg, approximately 73.7mg, approximately 73.8mg, approximately 73.9mg, approximately 74.0mg, approximately 74.1mg, approximately 74.2mg, approximately 74.3mg, approximately 74.4mg, approximately 74.5mg, approximately 74.6mg, approximately 74.7mg, approximately 74.8mg, approximately 74.9mg, approximately 75.0mg, approximately 75.1mg, approximately 75.2mg, approximately 75.3mg, approximately 75.4mg, approximately 75.5mg, approximately 75.6mg, approximately 75.7mg, approximately 75.8mg, approximately 75.9mg, approximately 76.0mg, approximately 76.1mg, approximately 76.2mg, about 76.3mg, about 76.4mg, about 76.5mg, about 76.6mg, about 76.7mg, about 76.8mg, about 76.9mg, about 77.0mg, about 77.1mg, about 77.2mg, about 77.3mg, about 77.4mg, about 77.5mg, about 77.6mg, about 77.7mg, about 77.8mg, about 77.9mg, about 78.0mg, about 78.1mg, about 78.2mg, about 78.3mg, about 78.4mg, about 78.5mg, about 78.6mg, about 78.7mg, about 78.8mg, about 78.9mg, about 79.0mg, about 79.1mg, about 79.2mg, about 79.3m g, approx. 79.4 mg, approx. 79.5 mg, approx. 79.6 mg, approx. 79.7 mg, approx. 79.8 mg, approx. 79.9 mg, approx. 80.0 mg, approx. 80.1 mg, approx. .9mg, about 81.0mg, about 81.1mg, about 81.2mg, about 81.3mg, about 81.4mg, about 81.5mg, about 81.6mg, about 81.7mg, about 81.8mg, about 81.9mg, about 82.0mg, about 82.0mg, about 82.1mg, about 82.2mg, about 82.3mg, Approximately 82.4mg, approximately 82.5mg, approximately 82.6mg, approximately 82.7mg, approximately 82.8mg, approximately 82.9mg, approximately 83.0mg, approximately 83.1mg, approximately 83.2mg, approximately 83.3mg, approximately 83.4mg, approximately 83.5mg, approximately 83.6mg, approximately 83.7mg, approximately 83.8mg, approximately 83.9mg, approximately 84.0mg, approximately 84.1mg, approximately 84.2mg, approximately 84.3mg, approximately 84.4mg, approximately 84.5mg, approximately 84.6mg, approximately 84.7mg, approximately 84.8mg, approximately 84.9mg, approximately 85.0mg, approximately 85.1mg, approximately 85.2mg, approximately 85.3mg, approximately 85.4mg, approximately 8 5.5mg, approximately 85.6mg, approximately 85.7mg, approximately 85.8mg, approximately 85.9mg, approximately 86.0mg, approximately 86.1mg, approximately 86.2mg, approximately 86.3mg, approximately 86.4mg, approximately 86.5mg, approximately 86.6mg, approximately 86.7mg, approximately 86.8mg, approximately 86.9mg, approximately 87.0mg, approximately 87.1mg, approximately 87.2mg, approximately 87.3mg, approximately 87.4mg, approximately 87.5mg, approximately 87.6mg, approximately 87.7mg, approximately 87.8mg, approximately 87.9mg, approximately 88.0mg, approximately 88.1mg, approximately 88.2mg, approximately 88.3mg, approximately 88.4mg, approximately 88.5mg, approximately 88.6mg, approximately 88.7mg, approximately 88.8mg, approximately 88.9mg, approximately 89.0mg, approximately 89.1mg, approximately 89.2mg, approximately 89.3mg, approximately 89.4mg, approximately 89.5mg, approximately 89.6mg, approximately 89.7mg, approximately 89.8mg, approximately 89.9mg, approximately 90.0mg, approximately 90.1mg, approximately 90.2mg, approximately 90.3mg, approximately 90.4mg, approximately 90.5mg, approximately 90.6mg, approximately 90.7mg, approximately 90.8mg, approximately 90.9mg, approximately 91.0mg, approximately 91.1mg, approximately 91.2mg, approximately 91.3mg, approximately 91.4mg, approximately 91 0.5mg, approx. 91.6mg, approx. 91.7mg, approx. 91.8mg, approx. 91.9mg, approx. 92.0mg, approx. 92.1mg, approx. 92.2mg, approx. 92.3mg, approx. 92.4mg, approx. 92.5mg, approx. 92.6mg, approx. 92.7mg, approx. 92.8mg, approx. 92.9mg, approx. 93.0mg, approx. 93.1mg, approx. 93.2mg, approx. 93.3mg, approx. 93.4mg, approx. 93.5mg, approx. 93.6mg, approx. 93.7mg, approx. 93.8mg, approx. 93.9mg, approx. 94.0mg, approx. 94.1mg, approx. 94.2mg, approx. 94.3mg, approx. 94 0.4mg, approx. 94.5mg, approx. 94.6mg, approx. 94.7mg, approx. 94.8mg, approx. 94.9mg, approx. 95.0mg, approx. 95.1mg, approx. 95.2mg, approx. 95.3mg, approx. 95.4mg, approx. 95.5mg, approx. 95.6mg, approx. 95.7mg, approx. 95.8mg, approx. 95.9mg, approx. 96.0mg, approx. 96.1mg, approx. 96.2mg, approx. 96.3mg, approx. 96.4mg, approx. 96.5mg, approx. 96.6mg, approx. 96.7mg, approx. 96.8mg, approx. 96.9mg, approx. 97.0mg, approx. 97.1mg, approx. 97.2mg, approx. 97 The dosage is one of the following: 0.3 mg, approximately 97.4 mg, approximately 97.5 mg, approximately 97.6 mg, approximately 97.7 mg, approximately 97.8 mg, approximately 97.9 mg, approximately 98.0 mg, approximately 98.1 mg, approximately 98.2 mg, approximately 98.3 mg, approximately 98.4 mg, approximately 98.5 mg, approximately 98.6 mg, approximately 98.7 mg, approximately 98.8 mg, approximately 98.9 mg, approximately 99.0 mg, approximately 99.1 mg, approximately 99.2 mg, approximately 99.3 mg, approximately 99.4 mg, approximately 99.5 mg, approximately 99.6 mg, approximately 99.7 mg, approximately 99.8 mg, approximately 99.9 mg, or approximately 100.0 mg.

[0169] In certain embodiments, the therapeutically effective dose is any of the following: 40mg-100mg, 40mg-80mg, 40mg-70mg, 40mg-60mg, 40mg-50mg, 50mg-100mg, 50mg-80mg, 50mg-70mg, 50mg-60mg, 60mg-100mg, 60mg-80mg, 60mg-70mg, 70mg-100mg, 70mg-80mg, 80mg-100mg, 80mg-90mg, and 90mg-100mg.

[0170] In certain embodiments, the therapeutically effective dose is any of the following: less than 100 mg, less than 95 mg, less than 90 mg, less than 85 mg, less than 80 mg, less than 75 mg, less than 70 mg, less than 65 mg, less than 60 mg, less than 55 mg, and less than 50 mg.

[0171] In certain embodiments, the therapeutically effective dose is one of the following: less than approximately 100 mg, less than approximately 95 mg, less than approximately 90 mg, less than approximately 85 mg, less than approximately 80 mg, less than approximately 75 mg, less than approximately 70 mg, less than approximately 65 mg, less than approximately 60 mg, less than approximately 55 mg, and less than approximately 50 mg.

[0172] In a particular embodiment, the therapeutically effective dose is any of the following: at least 40 mg, at least 45 mg, at least 50 mg, at least 55 mg, at least 60 mg, at least 65 mg, at least 70 mg, at least 75 mg, at least 80 mg, at least 85 mg, at least 90 mg, at least 95 mg, and at least 100 mg.

[0173] In a particular embodiment, the therapeutically effective dose is any of the following: at least about 40 mg, at least about 45 mg, at least about 50 mg, at least about 55 mg, at least about 60 mg, at least about 65 mg, at least about 70 mg, at least about 75 mg, at least about 80 mg, at least about 85 mg, at least about 90 mg, at least about 95 mg, and at least about 100 mg.

[0174] In certain embodiments, the therapeutically effective dose is approximately 10–25 mg per week, administered to the subject once every four weeks, once every three weeks, once every two weeks, or once weekly. In certain embodiments, the therapeutically effective dose is approximately 12.5–20 mg per week. In certain embodiments, the therapeutically effective dose is approximately 12.5 mg per week. In certain embodiments, the therapeutically effective dose is approximately 20 mg per week.

[0175] V. A specific medication regimen In certain embodiments, this specification describes a method for administering a therapeutically effective amount of modified oligonucleotide ISIS678354 to a subject one or more times. In certain embodiments, the method comprises administering the therapeutically effective amount at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 times. In certain embodiments, the method comprises administering the therapeutically effective amount once every two weeks. In certain embodiments, the method comprises administering the therapeutically effective amount once every four weeks. In certain embodiments, the method comprises administering the therapeutically effective amount once every eight weeks. In certain embodiments, the method comprises administering the therapeutically effective amount once every sixteen weeks.

[0176] In certain embodiments, the method includes administering a therapeutically effective dose approximately every 1 week, every 2 weeks, every 3 weeks, every 4 weeks, every 5 weeks, every 6 weeks, every 7 weeks, every 8 weeks, every 9 weeks, every 10 weeks, every 11 weeks, every 12 weeks, every 13 weeks, every 14 weeks, every 15 weeks, every 16 weeks, every 17 weeks, every 18 weeks, every 19 weeks, or every 20 weeks.

[0177] In a particular embodiment, the method includes administering a therapeutically effective dose for at least about 1 month, at least about 2 months, at least about 3 months, at least about 4 months, at least about 5 months, at least about 6 months, at least about 7 months, at least about 8 months, at least about 9 months, at least about 10 months, at least about 11 months, or at least about 12 months.

[0178] VI. Efficacy and Effectiveness In certain embodiments, this specification describes a method for reducing APOCIII RNA and / or APOCIII protein in cells or biological fluids of a human subject, the method comprising administering a therapeutically effective amount of ISIS678354 to the subject. For example, whether the method reduces APOCIII RNA and / or APOCIII protein can be determined by detecting / quantifying a first amount of APOCIII RNA or APOCIII protein in a first biological sample obtained before administration and a second amount of APOCIII RNA or APOCIII protein in a second biological sample obtained after administration, and by detecting or quantifying the decrease in APOCIII RNA or APOCIII protein by comparing the first amount with the second amount.

[0179] In certain embodiments, the method includes reducing APOCIII RNA and / or APOCIII protein by 1 to 100%, or any two of these values. In certain embodiments, the method includes APOCIII RNA and / or APOCIII protein in 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, This includes reducing by 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%.

[0180] In certain embodiments, the method includes reducing APOCIII RNA or APOCIII protein by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95%. In certain embodiments, the reduction in APOCIII RNA or APOCIII protein is relative to the pre-treatment level.

[0181] In certain embodiments, the method involves reducing APOCIII RNA or APOCIII protein by about 5% to about 10%, about 10% to about 15%, about 15% to about 20%, about 20% to about 25%, about 25% to about 30%, about 30% to about 35%, about 35% to about 40%, about 40% to about 45%, about 45% to about 50%, about 50% to about 55%, about 55% to about 60%, about 60% to about 65%, about 65% to about 70%, about 70% to about 75%, about 75% to about 80%, about 80% to about 85%, about 85% to about 90%, about 90% to about 95%, or about 95% to 100%. In certain embodiments, the reduction in APOCIII RNA or APOCIII protein is relative to the pre-treatment level.

[0182] In certain embodiments, the method includes reducing triglycerides by about 5% to about 10%, about 10% to about 15%, about 15% to about 20%, about 20% to about 25%, about 25% to about 30%, about 30% to about 35%, about 35% to about 40%, about 40% to about 45%, about 45% to about 50%, about 50% to about 55%, about 55% to about 60%, about 60% to about 65%, about 65% to about 70%, about 70% to about 75%, about 75% to about 80%, about 80% to about 85%, about 85% to about 90%, about 90% to about 95%, or about 95% to 100% compared to pre-treatment levels.

[0183] In certain embodiments, the method includes reducing triglycerides to approximately 50 mg / dL, approximately 100 mg / dL, approximately 150 mg / dL, approximately 200 mg / dL, approximately 250 mg / dL, approximately 300 mg / dL, approximately 400 mg / dL, or approximately 500 mg / dL or less. The triglyceride level may be the fasting level.

[0184] In certain embodiments, the subject has at least 500 mg / dL of triglycerides. In certain embodiments, the subject has at least 880 mg / dL of triglycerides. In certain embodiments, the subject has at least 1000 mg / dL of triglycerides.

[0185] The diseases and conditions described herein, such as FCS, SHTG, and FPL, may be monitored by one or more biomarkers. These biomarkers may be, for example, one or more markers related to liver enzymes and / or inflammation (e.g., vasculitis), vascular injury, lipid and lipoprotein metabolism, and monocyte and / or macrophage migration and infiltration. Such biomarkers include hsCRP, IL6, IL10, IL1b, TNFa, IL8, INFg, ICAM1, OxPL-apoB, MCP1, LpPLA2 activity, and fibrinogen. In certain embodiments, improvement in FCS, SHTG, or FPL is determined by changes in one or more biomarkers after administration of ISIS678354.

[0186] The diseases and conditions described herein, such as FCS, SHTG, and FPL, may be monitored by one or more symptoms. These symptoms may include hyperchylomicronemia, abdominal pain, recurrent colic, physical fatigue, difficulty thinking, diarrhea, recurrent acute pancreatitis, exanthematous xanthomas, retinal lipidemia, or hepatosplenomegaly, or a combination thereof. In certain embodiments, improvement in FCS, SHTG, or FPL is indicated by a change in one or more symptoms.

[0187] In certain embodiments, the method includes administering ISIS678354 to a target and detecting or quantifying the amount of APOCIII RNA or APOCIII protein in the target cells or biological fluid. In certain embodiments, the method includes detecting / quantifying a first amount of APOCIII RNA or APOCIII protein in a first biological sample obtained before administration and detecting / quantifying a second amount of APOCIII RNA or APOCIII protein in a second biological sample obtained after administration, and detecting or quantifying a decrease in APOCIII RNA or APOCIII protein by comparing the first amount with the second amount. In certain embodiments, the second biological sample is obtained less than approximately 24 hours after administration. In certain embodiments, the second biological sample is obtained less than approximately 1 week after administration. In certain embodiments, the second biological sample is obtained approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 weeks after administration. In certain embodiments, the method includes increasing or decreasing the dose after comparing the first dose to the second dose. In certain embodiments, the method includes administering the first dose more frequently or less frequently after comparing the first dose to the second dose.

[0188] Overview of Familial Hyperchylomicronemia Syndrome Familial hyperchylomicronemia syndrome (FCS) is a genetic disorder characterized by severe hypertriglyceridemia and hyperchylomicronemia. It is a rare autosomal recessive disorder that can be diagnosed in either childhood or adulthood.

[0189] FCS is characterized by frequent and severe abdominal pain, recurrent colic, and recurrent episodes of potentially fatal acute pancreatitis, which can impair healthy growth in children (Brunzell JD. Familial Lipoprotein Lipase Deficiency. In GeneReviews edited by Adam MP Pagon RA, Bird TD, et al. 1999-2011. Seattle, WA: University of Washington, Seattle; Tremblay K, Methot J, Brisson D, et al. J Clin Lipidol 2011;5:37-44). Physical examination frequently reveals eruptive xanthomas, retinal lipidemia, and hepatosplenomegaly, and plasma from patients appears emulsion-like, interfering with the determination of other laboratory parameters. Fasting plasma triglyceride (TG) levels in FCS patients are typically 10 to 100 times higher than normal (1,500 to 15,000 mg / dL), despite extreme dietary fat restriction (20 g or approximately 15-20% of daily calorie intake).

[0190] Patients with FCS often present with recurrent episodes of abdominal pain or pancreatitis, exanthematous xanthomas, or hepatomegaly in infancy or childhood. The diagnosis of FCS is then established by genotyping or confirmation of extremely low or absent lipoprotein lipase (LPL) enzyme activity in post-heparinized plasma.

[0191] Patients with FCS have a heavy burden of medical complications, the most severe of which is the extreme risk of recurrent and potentially fatal pancreatitis. Due to the recurrent onset of acute pancreatitis, these patients may also develop signs of chronic pancreatitis and exocrine or endocrine pancreatic insufficiency (including diabetes mellitus) (Gaudet D, Methot J, Dery S, et al. Gene Ther 2013;20:361-369). The pathophysiology underlying chylomicron-associated pancreatitis is not fully understood, but one hypothesis is that large chylomicrons stored in pancreatic capillaries are exposed to pancreatic lipase, leading to the release of free fatty acids via hydrolysis of chylomicron-associated triglycerides. High concentrations of free fatty acids are thought to damage pancreatic cells and lead to sudden pancreatitis (Yang F, Wang Y, Sternfeld L, et al. Acta Physiol (Oxf) 2009; 195: 13-28.; Berglund L, Brunzell JD, Goldberg AC, et al. J Clin Endocrinol Metab 2012; 97: 2969-2989).

[0192] FCS significantly impacts patients' HRQoL. Swelling, generalized abdominal pain, asthenia, potential pain attacks, and general health anxiety, difficulty concentrating, and "brain fog" are commonly reported symptoms of FCS. The psychosocial burden of FCS is also increased by dietary fat restriction and overall interference with social interaction and the ability to work (Davidson M, Stevenson M, Hsieh A, et al. Expert Rev Cardiovasc Ther 2017;15:415-423; Gelrud A, Williams KR, Hsieh A, et al. Expert Rev Cardiovasc Ther 2017;15:879-887; Davidson M, Stevenson M, Hsieh A, et al. J Clin Lipidol 2018;12:898-907.e892; Fox RS, Peipert JD, Llonch MV, et al. Expert Rev Cardiovasc Ther 2020:1-8).

[0193] The pathogenesis of extreme hypertriglyceridemia in FCS is thought to be ineffective TG clearance due to extremely low levels of LPL activity. LPL normally functions to hydrolyze TG in chylomicrons along the luminal surface of capillaries, primarily in the heart, skeletal muscle, and adipose tissue, thereby promoting TG clearance from the blood circulation. LPL is regulated by numerous key genes, and loss-of-function mutations in one of these genes or in the LPL gene itself lead to FCS (Surendran RP, Visser ME, Heemelaar S, et al. J Intern Med 2012;272:185-196). In addition to loss-of-function, null, and nonsense mutations in the LPL gene, other genes currently identified in FCS patients that are known to directly affect LPL activity include apolipoprotein C-II (APOC2) (Schuster KB, Wilfert W, Evans D, et al. Clin Chim Acta 2011;412:240-244), a cofactor for LPL; apolipoprotein AV (APOA5) (Schaap FG, Rensen PC, Voshol PJ, et al. J Biol Chem 2004;279:27941-27947); and lipase maturation factor 1 (LMF1) (Doolittle MH, Neher SB, Ben-Zeev O, et al. J Biol Chem), a transmembrane protein involved in LPL maturation. This includes glycosylphosphotidylinositol-immobilized HDL-binding protein 1 (GP1HBP1) (Beigneux AP, Davies BS, Gin P, et al. Cell Metab 2007;5:279-291), a capillary endothelial cell protein that provides a platform for LPL-mediated processing of chylomicrons.

[0194] Overview of Familial Partial Lipid Dysplasia Familial partial lipodystrophy (FPL) refers to a familial disorder characterized by the selective, progressive loss of body fat (adipose tissue) from various parts of the body. Individuals with FPL often have reduced subcutaneous fat in the arms and legs, and the head and torso may or may not have fat loss. Conversely, affected individuals may also have excess subcutaneous fat accumulation in other body parts, particularly the neck, face, and abdominal region. In many cases, adipose tissue loss begins during puberty. FPL can be associated with a variety of metabolic abnormalities. FPL is associated with certain metabolic complications. These complications may include impaired glucose metabolism, elevated triglyceride levels, and diabetes mellitus. Six distinct subtypes of FPL have been identified. Each subtype is caused by mutations in different genes. Four forms of FPL are inherited as autosomal dominant traits; one form is inherited as an autosomal recessive trait. The Kobberling type, the mode of inheritance of FPL, is unknown.

[0195] FPL types include FPL2 (Dunnigan type), FPL1 (Kobberling type), FPL3 (PPARG mutation), FPL4 (PLIN1 mutation), FPL5 (AKT2 mutation), and autosomal recessive FPL (type 6, CIDEC mutation).

[0196] Overview of severe hypertriglyceridemia As used herein, severe hypertriglyceridemia (SHTG) refers to a condition in which a subject has triglycerides at levels where chylomicrons appear in the blood. In certain embodiments, the subject has at least 500 mg / dL of triglycerides. SHTG can be acquired or familial. For example, a subject having FCS or FPL can also be diagnosed as having SHTG. In certain embodiments, the subject has at least 880 mg / dL of triglycerides. In certain embodiments, the subject has at least 1000 mg / dL of triglycerides. SHTG can occur in subjects having obesity, a history of alcohol abuse, and / or diabetes. SHTG can result from a combination of weak genetic factors combined with secondary factors, such as certain pharmaceuticals (e.g., oral estrogen, glucocorticosteroids, protease inhibitors, some antihypertensive pharmaceuticals such as hydrochlorothiazide, and non-selective beta blockers, retinoic acid (isotretinoin), tamoxifen, raloxifene, cyclosporine, sirolimus, bile acid binding resins, and antipsychotic pharmaceuticals including clozapine and olanzapine) or metabolic disorders (e.g., obesity, diabetes, hypothyroidism, or kidney disease), or can result from genetic factors alone. Subjects having SHTG are at risk of acute pancreatitis. See, e.g., Cybulska, B. et al., Kardiologia Polska 2013;71,10:1007-1012.

[0197] Evaluation of the efficacy of ISIS678354 In certain embodiments, the methods described herein are sufficiently effective to improve at least one symptom of FCS in a human subject. In certain embodiments, the at least one symptom is a severe elevation of chylomicrons. In certain embodiments, the at least one symptom is an extremely elevated TG level (always well above 1000 mg / dL and not infrequently rising as high as 10,000 mg / dL or more). In certain embodiments, the at least one symptom is the onset of abdominal pain. In certain embodiments, the at least one symptom is recurrent acute pancreatitis. In certain embodiments, the at least one symptom is recurrent colic. In certain embodiments, the at least one symptom is eruptive xanthoma. In certain embodiments, the at least one symptom is hepatosplenomegaly. In certain embodiments, the at least one symptom is physical fatigue. In certain embodiments, the at least one symptom is difficulty thinking. In certain embodiments, the at least one symptom is diarrhea. In certain embodiments, the at least one symptom is difficulty thinking. In certain embodiments, the at least one symptom is recurrent acute pancreatitis. In certain embodiments, the at least one symptom is retinal lipidemia. In certain embodiments, the at least one symptom is any combination of severe hyperchylomicronemia, severe hypertriglyceridemia, frequent and severe abdominal pain, recurrent colic, physical fatigue, difficulty thinking, diarrhea, recurrent acute pancreatitis, eruptive xanthoma, retinal lipidemia, and hepatosplenomegaly.

[0198] In certain embodiments, the methods described herein are sufficiently effective to improve any one of severe hyperchylomicronemia, severe hypertriglyceridemia, frequent and severe abdominal pain, recurrent colic, physical fatigue, difficulty thinking, diarrhea, recurrent acute pancreatitis, eruptive xanthoma, retinal lipidemia, and hepatosplenomegaly.

[0199] In certain embodiments, the methods described herein are sufficiently effective to improve at least one symptom of FCS in human subjects when assessed by a clinically relevant test, score, or scale. In certain embodiments, the clinically relevant scale is the Patient Global Impression of Severity (PGIS) Scale. In certain embodiments, the clinically relevant scale is the Patient Global Impression of Change (PGIC) Scale. In certain embodiments, the clinically relevant test is fasting triglyceride levels. In certain embodiments, the clinically relevant test is fasting apoB-48 levels. In certain embodiments, the clinically relevant test is the reduction in the determined pancreatitis event rate in patients who have had two or more events in the five years prior to enrollment. In certain embodiments, the clinically relevant tests, scores, or scales are the number of emergency room (ER) visits, the incidence of hospitalization for all causes, and the total length of hospital stay. In certain embodiments, health-related quality of life is measured by the PROMIS 29+2 Profile vs. 2.1 questionnaire.

[0200] In certain embodiments, the methods described herein are well tolerable in safety and tolerability evaluations, including independently determined event rates for adverse events, clinical tests, ECG, concomitant medication use, and major cardiovascular events (MACE) for ISIS678354 compared to placebo.

[0201] VII. Certain combination therapies In certain embodiments, the method includes co-administering ISIS678354 with at least one other pharmaceutical agent. In certain embodiments, the at least one other pharmaceutical agent improves HD or its symptoms. In certain embodiments, ISIS678354 is co-administered with at least one other pharmaceutical agent to produce a synergistic effect. In certain embodiments, ISIS678354 is co-administered with at least one other pharmaceutical agent to produce a synergistic effect.

[0202] In certain embodiments, ISIS678354 and at least one other pharmaceutical agent are administered simultaneously. In certain embodiments, ISIS678354 and at least one other pharmaceutical agent are administered at different times. In certain embodiments, ISIS678354 and at least one other pharmaceutical agent are prepared together in a single formulation. In certain embodiments, the administered ISIS678354 and at least one other pharmaceutical agent are prepared separately.

[0203] [Examples]

[0204] The following examples illustrate, but do not limit, certain embodiments of the present disclosure. Furthermore, where specific embodiments are provided, the inventors intend for those specific embodiments to be generally applicable. For example, the disclosure of an oligonucleotide having a particular motif provides reasonable support for further oligonucleotides having that motif or a similar motif. Similarly, for example, where a particular high-affinity modification is found at a particular position, other high-affinity modifications at the same position are also considered appropriate unless otherwise shown.

[0205] Example 1: Clinical protocol including medication parameters, efficacy endpoints, and safety endpoints A randomized, double-blind, placebo-controlled phase 3 study will be conducted using compound number 678354, administered subcutaneously to patients with familial hyperchylomicronemia syndrome (FCS).

[0206] Cohort A (approximately n=30) will be randomized in a 2:1 ratio to receive either 50 mg of compound number 678354 or a matching volume of placebo (0.5 mL) subcutaneously every 4 weeks from weeks 1 to 25. Starting at week 29, Cohort A will receive an increased dose of 80 mg of compound number 678354 or continue with a matching volume of placebo (0.8 mL) every 4 weeks from weeks 29 to 49, for a total of 13 doses. Cohort B (approximately n=30) will be randomized in a 2:1 ratio to receive either 80 mg of compound number 678354 or a matching volume of placebo (0.8 mL) subcutaneously every 4 weeks from weeks 1 to 49, for a total of 13 doses.

[0207] Regular blood chemistry and urine samples will be collected after 10–12 hours of fasting. Efficacy parameters to be tested include the percentage change in fasting triglycerides (TG) from baseline (defined as the mean of the pre-treatment assessment on day 1 and the last measurement before day 1) at 6 months (mean at weeks 23, 25, and 27) compared to placebo, and at 12 months (mean at weeks 51 and 53) compared to placebo. Patient selection criteria include a fasting triglyceride level of ≥880 mg / dL (10 mmol / L) before treatment. Post-treatment evaluations will include determining the proportion of patients achieving a ≥40% reduction in fasting TG from baseline, the proportion achieving a fasting TG ≤750 mg / dL (8.4 mmol / L), the proportion achieving a ≥70% reduction in fasting TG from baseline, and the proportion achieving a fasting TG ≤500 mg / dL (5.7 mmol / L). Furthermore, the evaluation criteria include determining the percentage change in fasting ApoB-48 from baseline, as well as the rate of determined acute pancreatitis events. Pharmacokinetic analysis also includes determining trough (pre-administration) and post-treatment plasma concentrations of compound number 678354 in all patients receiving the modified oligonucleotide.

[0208] Safety parameters tested include platelet count, renal function tests, and hepatic function tests. All patients will have their liver function monitored every 14 days (±2 days) for the first three months of the treatment period, and then monthly thereafter. Liver function tests include monitoring for signs of liver injury (jaundice, fatigue, nausea, vomiting, right upper quadrant pain or tenderness, fever, rash, abnormal bleeding or bruising, or eosinophilia > ULN) and assessment of liver enzymes and bilirubin in the event of subsequent signs of liver injury. All patients will have their renal function tests monitored every 14 days (±2 days) for the first three months of the treatment period, and then monthly thereafter. Renal function monitoring includes serum creatinine and urinalysis including UACR (urinary albumin / creatinine ratio), UPCR (urinary protein / creatinine ratio), and urinary red blood cell count (RBC). All patients will have their platelet counts monitored at least every 14 days (±2 days) throughout the study treatment period, and at all post-treatment follow-up visits. All patients will be continuously evaluated for bleeding events from the start of the treatment (day 1) until the end of the follow-up period.

[0209] Following a 53-week treatment and evaluation period, there is a 13-week post-treatment evaluation period during which patients may choose to enroll in an OLE (Open Label Continued) study, subject to research approval by the IRB / IEC and the appropriate regulatory authorities. The treatment is therapeutically effective in improving or treating FCS (observed by improvement in one or more symptoms or by changes in one or more biomarkers).

[0210] Example 2: Clinical protocol including medication parameters, efficacy endpoints, and safety endpoints A randomized, double-blind, placebo-controlled study will be conducted using compound number 678354, administered subcutaneously to patients with familial partial lipodystrophy (FPL).

[0211] Cohort A (approximately n=30) will be randomized in a 2:1 ratio to receive either 50 mg of compound number 678354 or a matching volume of placebo (0.5 mL) subcutaneously every 4 weeks from weeks 1 to 25. Starting at week 29, Cohort A will receive an increased dose of 80 mg of compound number 678354 or continue with a matching volume of placebo (0.8 mL) every 4 weeks from weeks 29 to 49, for a total of 13 doses. Cohort B (approximately n=30) will be randomized in a 2:1 ratio to receive either 80 mg of compound number 678354 or a matching volume of placebo (0.8 mL) subcutaneously every 4 weeks from weeks 1 to 49, for a total of 13 doses.

[0212] Regular blood chemistry and urine samples will be collected after 10–12 hours of fasting. Efficacy parameters to be tested include the percentage change in fasting triglycerides (TG) from baseline (defined as the mean of the pre-treatment assessment on day 1 and the last measurement before day 1) at 6 months (mean at weeks 23, 25, and 27) compared to placebo, and at 12 months (mean at weeks 51 and 53) compared to placebo. Patient selection criteria include a fasting triglyceride level of ≥880 mg / dL (10 mmol / L) before treatment. Post-treatment evaluations will include determining the proportion of patients achieving a ≥40% reduction in fasting TG from baseline, the proportion achieving a fasting TG ≤750 mg / dL (8.4 mmol / L), the proportion achieving a ≥70% reduction in fasting TG from baseline, and the proportion achieving a fasting TG ≤500 mg / dL (5.7 mmol / L). Furthermore, the evaluation criteria include determining the percentage change in fasting ApoB-48 from baseline, as well as the rate of determined acute pancreatitis events. Pharmacokinetic analysis also includes determining trough (pre-administration) and post-treatment plasma concentrations of compound number 678354 in all patients receiving the modified oligonucleotide.

[0213] Safety parameters tested include platelet count, renal function tests, and hepatic function tests. All patients will have their liver function monitored every 14 days (±2 days) for the first three months of the treatment period, and then monthly thereafter. Liver function tests include monitoring for signs of liver injury (jaundice, fatigue, nausea, vomiting, right upper quadrant pain or tenderness, fever, rash, abnormal bleeding or bruising, or eosinophilia > ULN) and assessment of liver enzymes and bilirubin in the event of subsequent signs of liver injury. All patients will have their renal function tests monitored every 14 days (±2 days) for the first three months of the treatment period, and then monthly thereafter. Renal function monitoring includes serum creatinine and urinalysis including UACR (urinary albumin / creatinine ratio), UPCR (urinary protein / creatinine ratio), and urinary red blood cell count (RBC). All patients will have their platelet counts monitored at least every 14 days (±2 days) throughout the study treatment period, and at all post-treatment follow-up visits. All patients will be continuously evaluated for bleeding events from the start of the treatment (day 1) until the end of the follow-up period.

[0214] After a 53-week treatment and evaluation period, there is a 13-week post-treatment evaluation period.

[0215] The treatment is therapeutically effective in improving or treating FPL (observed by improvement in one or more symptoms or by changes in one or more biomarkers).

[0216] Example 3: Clinical protocol including medication parameters, efficacy endpoints, and safety endpoints A randomized, double-blind, placebo-controlled study will be conducted using compound number 678354, administered subcutaneously to patients with severe hypertriglyceridemia (SHTG).

[0217] Cohort A (consisting of approximately n = 30) is randomized 2:1 and administered subcutaneously with 50 mg of Compound No. 678354 or a matching volume of placebo (0.5 mL) every 4 weeks from Weeks 1 to 25. Starting from Week 29, Cohort A is administered escalating doses of 80 mg of Compound No. 678354 at 4-week intervals for a total of 13 doses from Weeks 29 to 49, or continues with a matching volume of placebo (0.8 mL). Cohort B (consisting of approximately n = 30) is randomized 2:1 and administered subcutaneously with 80 mg of Compound No. 678354 or a matching volume of placebo (0.8 mL) at 4-week intervals for a total of 13 doses from Weeks 1 to 49.

[0218] Collect regular blood chemistry samples and urine samples after a 10 - 12 hour fast. The efficacy parameters to be tested include the change rate of fasting triglycerides (TG) from baseline (defined as the average of the pre-dose evaluation on Day 1 and the last measurement before Day 1) at 6 months (average of Weeks 23, 25, and 27) and 12 months (average of Weeks 51 and 53) compared to placebo. The patient selection criteria include a fasting triglyceride level of ≥500 mg / dL before treatment. The post-treatment evaluations include determining the percentage of patients achieving a ≥40% decrease in fasting TG from baseline, the percentage of patients achieving a fasting TG ≤500 mg / dL, the percentage of patients achieving a ≥70% decrease in fasting TG from baseline, and the percentage of patients achieving a fasting TG ≤135 mg / dL. Also, the evaluation criteria include determining the change rate of fasting ApoB - 48 from baseline and the determined rate of acute pancreatitis events. Additionally, the pharmacokinetic analysis includes determining the trough (pre-dose) and post-treatment plasma concentrations of Compound No. 678354 in all patients who receive the modified oligonucleotide.

[0219] Safety parameters tested include platelet count, renal function tests, and hepatic function tests. All patients will have their liver function monitored every 14 days (±2 days) for the first three months of the treatment period, and then monthly thereafter. Liver function tests include monitoring for signs of liver injury (jaundice, fatigue, nausea, vomiting, right upper quadrant pain or tenderness, fever, rash, abnormal bleeding or bruising, or eosinophilia > ULN) and assessment of liver enzymes and bilirubin in the event of subsequent signs of liver injury. All patients will have their renal function tests monitored every 14 days (±2 days) for the first three months of the treatment period, and then monthly thereafter. Renal function monitoring includes serum creatinine and urinalysis including UACR (urinary albumin / creatinine ratio), UPCR (urinary protein / creatinine ratio), and urinary red blood cell count (RBC). All patients will have their platelet counts monitored at least every 14 days (±2 days) throughout the study treatment period, and at all post-treatment follow-up visits. All patients will be continuously evaluated for bleeding events from the start of the treatment (day 1) until the end of the follow-up period.

[0220] After a 53-week treatment and evaluation period, there is a 13-week post-treatment evaluation period.

[0221] The treatment is therapeutically effective in improving or treating SHTG (observed by improvement in one or more symptoms or by changes in one or more biomarkers).

Claims

1. The following chemical structure: 【Chemistry 1】 A pharmaceutical composition comprising (SEQ ID NO: 3), or a compound of its salt, Herein, 80 mg or about 80 mg of the compound in the pharmaceutical composition is administered subcutaneously once every four weeks for the treatment of FCS. The aforementioned pharmaceutical composition.

2. The pharmaceutical composition according to claim 1, wherein the compound is a sodium salt or a potassium salt.

3. The following chemical structure: 【Chemistry 2】 A pharmaceutical composition comprising the compound of (SEQ ID NO: 3), Herein, 80 mg or about 80 mg of the compound in the pharmaceutical composition is administered subcutaneously once every four weeks for the treatment of FCS. The aforementioned pharmaceutical composition.

4. A pharmaceutical composition comprising a compound containing a modified oligonucleotide, Herein, 80 mg or about 80 mg of the compound in the pharmaceutical composition is administered subcutaneously once every four weeks for the treatment of FCS. Here, the modified oligonucleotide has the following chemical notation (5' to 3'): A ｅｓ G ｅｓ ｍ C ｅｓ T ｅｓ T ｅｓ ｍ C ｄｓ T ｄｓ T ｄｓ G ｄｓ T ｄｓ ｍ C ｄｓ ｍ C ｄｓ A ｄｓ G ｄｓ ｍ C ｄｓ T ｅｓ T ｅｓ T ｅｓ A ｅｓ T ｅ (SEQ ID NO: 3) (In the formula, A = adenine nucleic acid base, mC = 5-methylcytosine nucleic acid base, G = guanine nucleic acid base, T = thymine nucleobase, e = 2' - OCH ２ CH ２ OCH ３ modified ribosyl sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, and (s = phosphorothioate nucleoside interbonding) It has, The modified oligonucleotide is represented by the following structure: 5'-trishexyl Sylamino-(THA)-C ６ GalNAc ３ Terminal cap (wherein the formula, the phosphate group is bonded to the 5'-oxygen atom of the 5'-nucleoside): 【Transformation 3】 Having, The aforementioned pharmaceutical composition.

5. The pharmaceutical composition according to any one of claims 1 to 4, wherein the compound improves at least one symptom of FCS, selected from elevated chylomicrons, elevated TG levels, onset of abdominal pain, physical fatigue, difficulty thinking, diarrhea, recurrent acute pancreatitis, exanthorrhoidal xanthomas, and hepatosplenomegaly, or a combination thereof.

6. The following chemical structure: 【Chemistry 4】 The use of (SEQ ID NO: 3), or compounds of its salts, in the preparation of pharmaceuticals for the treatment of FCS, In this case, 80 mg or approximately 80 mg of the compound in the pharmaceutical is administered subcutaneously once every four weeks. The aforementioned use.

7. The use according to claim 6, wherein the compound is a sodium salt or a potassium salt.

8. The following chemical structure: 【Transformation 5】 The use of the compound of (SEQ ID NO: 3) in the preparation of a pharmacopoeia for the treatment of FCS, In this case, 80 mg or approximately 80 mg of the compound in the pharmaceutical is administered subcutaneously once every four weeks. The aforementioned use.

9. The use of compounds containing modified oligonucleotides in the preparation of pharmaceuticals for the treatment of FCS, In this case, 80 mg or approximately 80 mg of the compound in the pharmaceutical is administered subcutaneously once every four weeks. Herein, the modified oligonucleotide is referred to by the following chemical notation (5' to 3'): A ｅｓ G ｅｓ ｍ C ｅｓ T ｅｓ T ｅｓ ｍ C ｄｓ T ｄｓ T ｄｓ G ｄｓ T ｄｓ ｍ C ｄｓ ｍ C ｄｓ A ｄｓ G ｄｓ ｍ C ｄｓ T ｅｓ T ｅｓ T ｅｓ A ｅｓ T ｅ (Sequence No. 3) (In the formula, A = adenine nucleic acid base, mC = 5-methylcytosine nucleic acid base, G = guanine nucleic acid base, T = thymine nucleobase, e = 2' - OCH ２ CH ２ OCH ３ modified ribosyl sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, and (s = phosphorothioate nucleoside interbonding) It has, The modified oligonucleotide is represented by the following structure: 5'-trishexylamino-(THA)-C ６ GalNAc ３ Terminal cap (wherein the formula, the phosphate group is bonded to the 5'-oxygen atom of the 5'-nucleoside): 【Transformation 6】 Having, The aforementioned use.

10. The use according to any one of claims 6 to 9, wherein the compound improves at least one symptom of FCS, selected from elevated chylomicrons, elevated TG levels, onset of abdominal pain, physical fatigue, difficulty thinking, diarrhea, recurrent acute pancreatitis, exanthorrhoidal xanthomas, and hepatosplenomegaly, or a combination thereof.

Images