Tuberculosis vaccine composition containing an immune-activating site fusion protein
A tuberculosis vaccine composition using a fusion protein of Rv2299c and ESAT6, potentially with BCG-CWS, addresses purification challenges and enhances immune response, offering improved prevention and treatment efficacy.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- MYCO RAPHA INC
- Filing Date
- 2023-06-14
- Publication Date
- 2026-07-23
AI Technical Summary
Current tuberculosis vaccines, such as Mycobacterium bovis Bacillus Calmette-Guérin (BCG), have varying effectiveness and do not prevent latent tuberculosis reactivation or adult tuberculosis, and existing fusion protein-based vaccines face challenges in standardizing purification due to large molecular weights and denaturation issues.
A tuberculosis vaccine composition is developed using a fusion protein of the immune-active site of Rv2299c and ESAT6, optionally combined with BCG cell wall skeleton (BCG-CWS) and other Mycobacterium tuberculosis-derived antigens, to enhance immune response and simplify purification by identifying and removing unnecessary protein sites.
The vaccine composition effectively activates the immune system, providing superior protective efficacy against tuberculosis and facilitating standardization of the purification process, contributing to both prevention and treatment of the disease.
Smart Images

Figure 0007894169000009 
Figure 0007894169000010 
Figure 0007894169000011
Abstract
Description
[Technical Field]
[0001] The present invention relates to a tuberculosis vaccine composition comprising an immunoactive site fusion protein. [Background technology]
[0002] Tuberculosis is an infectious disease caused by Mycobacterium tuberculosis (Mtb), and to date it is one of the deadliest infectious diseases in human history. In 2019, 1.4 million people died from tuberculosis worldwide, and in 2020, the mortality rate increased even further due to factors such as restrictions on access to medical care caused by COVID-19. Among OECD member countries, South Korea is one of the countries with the most serious tuberculosis problems.
[0003] The most important thing needed to solve this tuberculosis problem is a safe and highly effective vaccine. However, the only vaccine for tuberculosis, Mycobacterium bovis Bacillus Calmette-Gurin (BCG), has been the subject of much debate, with its preventative effect varying from 0% to 80% depending on the reporter, and it has been reported to have no effect on preventing latent tuberculosis reactivation or adult tuberculosis. Nevertheless, it is administered in many countries because it is effective in preventing severe tuberculosis in children, but a vaccine with superior efficacy compared to BCG has yet to be developed.
[0004] The World Health Organization's (WHO) End TB strategy aims to reduce tuberculosis incidence by 90% and mortality by 95% by 2035, compared to 2015 levels. South Korea has also established its 2030 Tuberculosis Eradication Plan, aiming for a tuberculosis incidence rate of less than 10 cases per 100,000 people. To create such a tuberculosis-free world, the development of a game-changer tuberculosis vaccine is essential.
[0005] The three tuberculosis vaccine development goals set by the WHO are as follows: (1) an affordable tuberculosis vaccine for infants and young children that is comparable in effectiveness and safety to BCG; (2) a safe, effective, and affordable tuberculosis vaccine for adolescents and adults; and (3) a therapeutic vaccine to increase the effectiveness of tuberculosis treatment.
[0006] Currently, 14 types of tuberculosis vaccines are undergoing clinical trials worldwide. When categorized by function, they include (1) live-cell-based vaccines to replace the prime vaccine BCG, (2) BCG booster vaccines that incorporate immune enhancers or viral vectors, and (3) other immunotherapy vaccines based on bacterial extracts or dead non-tuberculous mycobacterial species, aimed at shortening treatment duration or suppressing relapse. However, none of these vaccines yet come close to meeting the goals of tuberculosis vaccine development.
[0007] Development of live-cell-based vaccines as BCG replacements primarily involves genetically modified BCG strains and tuberculosis strains with simultaneous deletions of two genes. These live-cell-based vaccines contain more antigens than subunit vaccines and induce diverse immune responses, so high protective efficacy cannot be expected. However, the development of recombinant or gene-deficient strains is lengthy due to issues such as the removal of antimicrobial resistance markers and safety certification, and even after development, strict quality control is required during the manufacturing process of the vaccine strain. Due to these limitations, BCG replacement vaccine development has focused on the development of protein-based subunit vaccines. However, such subunit vaccines have limitations in replacing BCG and are mainly developed as BCG booster vaccines.
[0008] On the other hand, in recent years, the incidence of tuberculosis has been increasing due to the reactivation of latent tuberculosis caused by factors such as the aging population, the increase in immunosuppressant drug treatment, and the rise in HIV infection. Furthermore, the emergence of drug-resistant tuberculosis has made treatment difficult, making the development of a type of therapeutic vaccine that can assist treatment an important issue. Currently, most vaccines under development as therapeutic vaccines are nontuberculous mycobacteria (NTMs), but since they use bacterial cell extracts, it would be ideal to develop a therapeutic vaccine based on fusion proteins composed of several proteins.
[0009] As prior art, Patent Document 1 (Korean Registered Patent No. 1749165) disclosed a composition for promoting dendritic cell maturation containing a protein fused with Rv2299c or Rv2299c and ESAT6, and presented a method for differentiating immature dendritic cells into dendritic cells. Furthermore, Patent Document 2 (Korean Registered Patent No. 2193304) disclosed a BCG vaccine booster composition of Rv2299c-ESAT6-HspX-RipA fusion protein, Patent Document 3 (Korean Published Patent No. 2021-0157659) disclosed a composition for tuberculosis immunotherapy containing a Rv2882c-Rv2005c fusion protein, and Patent Document 4 (Korean Registered Patent No. 1452983) disclosed a composition for inducing dendritic cell maturation containing the Rv2005c protein of Mycobacterium tuberculosis as an active ingredient. However, as described above, the problem of the large molecular weight of the fused protein has made it difficult to standardize the purification process. Therefore, it is necessary to develop a vaccine composition that maximizes immune activity while reducing the molecular weight of the protein. [Prior art documents] [Patent Documents]
[0010] [Patent Document 1] Korean Registered Patent No. 1749165 [Patent Document 2] Korean Registered Patent No. 2193304 [Patent Document 3] Korean Published Patent No. 2021-0157659 [Patent Document 4] Korean Registered Patent No. 1452983 [Overview of the project] [Problems that the invention aims to solve]
[0011] The object of the present invention is to provide a tuberculosis vaccine composition containing an immune-active site fusion protein. Another object of the present invention is to provide a vaccine for the prevention of tuberculosis or a vaccine for the treatment of tuberculosis that contains the immunoactive site fusion protein. [Means for solving the problem]
[0012] The present invention provides a tuberculosis vaccine composition comprising a fusion protein of the immune active site of Rv2299c and ESAT6.
[0013] The immunoactive site of Rv2299c may consist of a single amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 5. Alternatively, the immunoactive site of Rv2299c may be domain 2 (D2) composed of the amino acid sequence of SEQ ID NO: 3, domain 3 (D3) composed of the amino acid sequence of SEQ ID NO: 4, or a combination of domain 2 and domain 3 (D2D3) composed of the amino acid sequence of SEQ ID NO: 5.
[0014] The present invention provides a tuberculosis vaccine composition comprising a fusion protein of the immune-active site of Rv2299c and ESAT6.
[0015] The immunoactive site of Rv2299c may consist of a single amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 5. Alternatively, the immunoactive site of Rv2299c may be domain 2 (D2) composed of the amino acid sequence of SEQ ID NO: 3, domain 3 (D3) composed of the amino acid sequence of SEQ ID NO: 4, or a combination of domain 2 and domain 3 (D2D3) composed of the amino acid sequence of SEQ ID NO: 5.
[0016] The present invention provides a composition for a tuberculosis vaccine, characterized in that BCG cell wall skeleton (Bacillus Calmette-Gu rin-Cell Wall Skeleton, BCG-CWS) is bound to the immunologically active site of Rv2299c and the end of the fusion protein with ESAT6.
[0017] All the compositions for tuberculosis vaccines provided by the present invention may be a vaccine for tuberculosis prevention or a vaccine for tuberculosis treatment.
[0018] The end of the fusion protein of the immunologically active site of Rv2299c and ESAT6 according to the present invention may further contain one or more Mycobacterium tuberculosis-derived antigens or their immunologically active sites selected from the group consisting of RpfE, Rv3463, Rv2005c, Rv2882c, Rv2145c, Rv1605, Rv2220 and Rv0869c. At this time, the Mycobacterium tuberculosis-derived antigen or its immunologically active site may be an antigen or its immunologically active site composed of one or more amino acid sequences selected from the group consisting of SEQ ID NOs: 1 to 22.
[0019] More specifically, the present invention comprises an amino acid sequence formed by sequentially linking and fusing the amino acid sequences of RpfED1, which consists of the amino acid sequence of SEQ ID NO: 8, Rv3463, which consists of the amino acid sequence of SEQ ID NO: 19, and the amino acid sequences of SEQ ID NO: 18 and SEQ ID NO: 19, to the terminal of the fusion protein of the immunoactive site of Rv2299c and ESAT6, and Rv2005cD3-Rv3463, which consists of the amino acid sequences of SEQ ID NO: 12, SEQ ID NO: 18 and SEQ ID NO: 21. The amino acid sequences of Rv2882cD2-Rv2005cD3-Rv3463D2, SEQ ID NO: 18, SEQ ID NO: 22, and SEQ ID NO: 21 are sequentially linked and fused to form an amino acid sequence, Rv2005cD3-Rv1605-Rv3463D2, SEQ ID NO: 21, and SEQ ID NO: 12 are sequentially linked and fused to form an amino acid sequence, Rv3463D2-Rv2882cD2, SEQ ID NO: 21, SEQ ID NO: 12, and SEQ ID NO: 15 are sequentially linked and fused to form an amino acid sequence, Rv3463D2-Rv2882cD2-Rv2145cD2, Rv3463D2-Rv2882cD2-RpfED1, Rv3463D2-Rv2882cD2-RpfED1-Rv214, Rv3463D2-Rv2882cD2-RpfED1-Rv214, Rv3463D2-Rv2882cD2-RpfED1-Rv214, Rv3463D2-Rv2882cD2-RpfED1-Rv214 The present invention provides a tuberculosis vaccine composition characterized by further comprising one Mycobacterium tuberculosis-derived antigen or its immunoactive site selected from the group consisting of Rv3463D2-Rv2005cD3, which is composed of an amino acid sequence formed by sequentially linking and fusing the amino acid sequences of 5cD2, SEQ ID NO: 21, and SEQ ID NO: 18, and Rv3463D2-Rv2005cD3-RpfED1, which is composed of an amino acid sequence formed by sequentially linking and fusing the amino acid sequences of SEQ ID NO: 21, SEQ ID NO: 18, and SEQ ID NO: 8.
[0020] In the present invention, the fusion protein designated as Rv2299cD2D3-ESAT6 means a polypeptide composed of an amino acid sequence in which the amino acid sequences of SEQ ID NO: 5 and SEQ ID NO: 6 are sequentially linked and fused, and refers to a polypeptide in which the terminal of Rv2299cD2D3 is linked to the other end of ESAT6. The production of the Rv2299cD2D3-ESAT6 fusion protein is carried out by the recombinant protein production method using pET-22b(+)_Rv2299cD2D3-ESAT6 in Example 1.2 below.
[0021] Hereinafter, in the present invention, a fusion protein containing two or more Mycobacterium tuberculosis-derived antigens or their immunologically active sites means a polypeptide composed of an amino acid sequence in which each amino acid sequence of the Mycobacterium tuberculosis-derived antigen or its immunologically active site sequence is sequentially linked and fused with or without a linker.
[0022] In the present invention, a prophylactic vaccine refers to a vaccine that is inoculated in advance before exposure to a pathogenic bacterium, and even if the pathogenic bacterium subsequently invades the body, it activates the immune system to prevent disease. A therapeutic vaccine refers to a vaccine that has a preventive function for most of it but is made for the purpose of treating patients who have already been infected. The prophylactic vaccine for tuberculosis includes a priming vaccine and a boosting vaccine. The priming vaccine is administered in infancy for the purpose of early exposure to M. tuberculosis. The boosting vaccine is administered to adolescents or adults and is used for the purpose of inducing an increase in the immune response after the priming vaccine or latent tuberculosis infection. The therapeutic vaccine is a method of directly administering drugs in a short period.
[0023] The fusion protein containing the Mycobacterium tuberculosis-derived antigen or its immunologically active site according to the present invention can increase its immunological activity by further binding BCG cell wall skeleton (BCG-Cell Wall Skeleton, BCG-CWS) to its terminal.
[0024] Furthermore, the present invention relates to Rv2882c-Rv2005c-Rv3463, which is composed of an amino acid sequence formed by sequentially linking and fusing the amino acid sequences of SEQ ID NOs. 10, 16, and 19; Rv2882c-Rv2005cD3-ESAT6-Rv3463, which is composed of an amino acid sequence formed by sequentially linking and fusing the amino acid sequences of SEQ ID NOs. 10, 16, 6, and 19; and SEQ ID NOs. 23 or 24 , Rv2220-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2, Rv0869c-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2, Rv1605-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2, Rv1605-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2, Rv23, Rv6 and Sequence ID No. 19 The present invention provides a tuberculosis vaccine composition characterized by containing one fusion protein selected from the group consisting of Rv2220-ESAT6-Rv3463, which is composed of an amino acid sequence formed by sequentially linking and fusing amino acid sequences; Rv0869c-ESAT6-Rv2005cD3-Rv3463, which is composed of an amino acid sequence formed by sequentially linking and fusing the amino acid sequences of SEQ ID NOs. 24, 6, 18, and 19; and Rv1605-ESAT6-Rv2005cD3-Rv3463, which is composed of an amino acid sequence formed by sequentially linking and fusing the amino acid sequences of SEQ ID NOs. 22, 6, 18, and 19.
[0025] Furthermore, the BCG cell wall skeleton (BCG-CWS) can be bound to the terminal end of the fusion protein to increase immune activity, and the tuberculosis vaccine composition may be a vaccine for the prevention of tuberculosis or a vaccine for the treatment of tuberculosis.
[0026] The fusion protein contained in the tuberculosis vaccine composition according to the present invention may be produced by known methods known in the art. For example, it may be produced by recombinant or synthesis using an automated polypeptide synthesizer, or it may be inserted into a vector by known methods and produced by transforming Escherichia coli or the like and mass-culturing. The fusion protein or antigen may include a suitable purification tag (or affinity tag) that allows purification from an unpurified biological source (e.g., a recombinant expression system). Purification tags include, but are not limited to, His-tags, chitin-binding proteins (CBPs), maltose-binding proteins (MBPs), and glutathione-S-transferases (GSTs). [Effects of the Invention]
[0027] The present invention provides a fusion protein vaccine composition in which an immunoactive domain (site or segment) in the Rv2299c protein is identified, unnecessary sites are removed, or only the necessary parts are selected and linked to other immunoactive proteins or sites. This effectively activates the immune response in tuberculosis patients and can make a groundbreaking contribution to the prevention and treatment of tuberculosis. [Brief explanation of the drawing]
[0028] [Figure 1] This shows the results of Rv2299c domain production and the degree of immune cell activation of each domain. (A) Rv2299c domain production. (B) Confirmation of dendritic cell activity of the produced Rv2299c domain. (C) Schematic diagram of the anti-tuberculosis activity measurement method. (D) Measurement of the anti-tuberculosis activity of the Rv2299c domain. (E) T cell activity of the Rv2299c domain is measured by ELISA using cytokines produced under condition D.
[0029] [Figure 2]This graph compares the anti-tuberculosis activity and T-cell activity (IFN-γ and IL-2 production) of Rv2299c domains D2 and D3 selected in the primary screening process.
[0030] [Figure 3] This is the result of creating Rv2299c D2, D3, and D2+D3 fusion domains and confirming their anti-tuberculosis activity. (A) Purification of Rv2299c domains and fusion domains. (B) Graph showing the number of Mycobacterium tuberculosis cells after dendritic cells were activated with each stimulus for 24 hours, co-cultured with T cells for 72 hours, and then co-cultured with Mycobacterium tuberculosis-infected macrophages for 72 hours.
[0031] [Figure 4] This is the result of evaluating the anti-tuberculosis activity using RpfE domain generation and T cell activity. (A, B) RpfE domain generation. (C) Graph showing the analysis of dendritic cell activity using ELISA after activating dendritic cells with each stimulus for 24 hours. (D) Graph showing the number of Mycobacterium tuberculosis after activating dendritic cells with each stimulus for 24 hours, co-culturing with T cells for 72 hours, and then co-culturing activated T cells with macrophages infected with Mycobacterium tuberculosis for 72 hours. (E) Measurement of cytokines produced by T cells under the conditions of D.
[0032] [Figure 5] This graph evaluates the degree of T cell differentiation mediated by RpfE, D1, and D2 domains. The results were obtained by activating dendritic cells with each stimulus for 24 hours, then co-culturing them with T cells isolated from the spleen of mice infected with BCG or Mtb H37Ra for 72 hours, and finally measuring the production of IFN-γ, IL-17, and IL-2 in the T cells using ELISA.
[0033] [Figure 6]This study shows the effects of Rv2882c and D1 and D2 domains on Mtb growth under co-culture conditions with T cells. (A) The Rv2882c protein was composed of an N-terminal portion (1-100; Rv2882c D1) and a C-terminal portion (86-185; Rv2882c D2), and each cleaved protein was expressed in E. coli, but only Rv2882c D1 was confirmed to be expressed by SDS-PAGE. (B) After infecting Mtb with BMDM for 4 hours (Mtb, MOI: 1), treating with full-length Rv2882c and Rv2882c D1 for 24 hours, and then co-culturing spleen cells in a 1:5-10 ratio for 72 hours, intracellular Mtb growth was confirmed.
[0034] [Figure 7] This shows the effects of the Rv2005c, D1, and D3 domains on Mtb growth. (A) The Rv2005c protein is composed of D1 (1-105), D2 (91-198), and D3 (197-294) regions, respectively. Each cleaved protein was expressed in E. coli, but only Rv2005c D1 and D3 were confirmed to be expressed. (B) After infecting BMDM with Mtb for 4 hours (Mtb, MOI: 1) and culturing full-length Rv2005c and Rv2005c D1 and D3 for 24 hours, spleen cells were co-cultured in a 1:5-10 ratio for 72 hours, and intracellular Mtb growth was confirmed.
[0035] [Figure 8] The Rv3463 N-terminal region is the domain that regulates Mtb growth. (A) The Rv3463 protein is separated into an N-terminal region (1-138; Rv3463 D1) and a C-terminal region (139-285; Rv3463 D2). Each cleaved protein was expressed in E. coli, but only Rv3463 D2 was confirmed to be expressed. The Rv3463 D2 region that was confirmed to be expressed was purified and analyzed by SDS-PAGE. (B) BMDM was infected for 4 hours (Mtb, MOI: 1), and full-length Rv3463c and Rv3463 D2 were cultured for 72 hours. Intracellular Mtb growth was confirmed after 72 hours.
[0036] [Figure 9](A) is a schematic diagram of ESAT6 and the structure of each domain fusion protein, and (B) is a photograph of the purified fusion protein.
[0037] [Figure 10] This is the result of measuring the degree of LPS contamination of purified fusion proteins. After pretreatment of dendritic cells with the LPS inhibitor PMB, they were activated with each stimulus for 24 hours, and then the activity of the dendritic cells (TNF-α, IL-1β) was analyzed using ELISA.
[0038] [Figure 11] The following are the results of evaluating the anti-tuberculosis activity and T cell activity of the purified fusion protein. (A) After activating dendritic cells with each stimulus for 24 hours, they were co-cultured with T cells for 72 hours, and then the number of Mycobacterium tuberculosis was measured after co-culturing activated T cells with macrophages infected with Mycobacterium tuberculosis for 72 hours. (B) After activating dendritic cells with each stimulus for 24 hours, they were co-cultured with T cells for 72 hours, and then T cell activity (IL-2, IL-17, INF-γ) was analyzed using ELISA.
[0039] [Figure 12] This report evaluates the dendritic cell activity in response to purified fusion proteins. After activating dendritic cells with each stimulus for 24 hours, dendritic cell activity (IL-1β, TNF-α, IL-12, IL-23) was analyzed using ELISA.
[0040] [Figure 13] This shows the results of evaluating the proliferative capacity of unsensitized T cells in dendritic cells activated by a fusion protein. (A) Schematic diagram of the method for evaluating the proliferative capacity of unsensitized T cells. (B) After treating dendritic cells with the fusion protein and ovalbumin (OVA) peptide for 24 hours, OVA peptide-specific T cells were pre-treated with CFSE, co-cultured with activated dendritic cells for 24 hours, and then analyzed by FACS. (C) Analysis of T cell activity (INF-γ, IL-17, IL-2, TNF-α).
[0041] [Figure 14]This is the result of evaluating the anti-tuberculosis activity of T cells activated by fusion proteins. (A) After activating dendritic cells with each stimulus for 24 hours, they were co-cultured with T cells for 72 hours, and then the number of Mycobacterium tuberculosis was measured after co-culturing activated T cells with macrophages infected with Mycobacterium tuberculosis for 72 hours. (B) After activating dendritic cells with each stimulus for 24 hours, they were co-cultured with T cells for 72 hours, and then the activity of T cells (INF-γ, IL-17, IL-2) was analyzed using ELISA.
[0042] [Figure 15] This is a study of the efficacy evaluation of tuberculosis vaccines using non-pathogenic Mycobacterium tuberculosis in mice, using Rv2299c-ESAT6 and a BCG-CWS conjugate. (A) Schematic diagram of the vaccine efficacy evaluation experiment. (B) Bacterial burden in the lungs of each group 6 or 18 weeks after tuberculosis infection.
[0043] [Figure 16] This is a report on the efficacy evaluation of the Rv2299cD2D3-BCG-CWS conjugate tuberculosis vaccine using pathogenic Mycobacterium tuberculosis in mice. (A) Schematic diagram of the vaccine efficacy evaluation experiment. (B) Bacterial burden in the lungs of each group 6 or 28 weeks after pathogenic tuberculosis infection. (C) Pathological lesions of pulmonary nodules in each group 28 weeks after tuberculosis infection.
[0044] [Figure 17] This shows the results of cytokine analysis of the fusion protein antigen according to the present invention in the lungs of mice 6 weeks after infection with pathogenic Mycobacterium tuberculosis.
[0045] [Figure 18] This shows the results of cytokine analysis of the fusion protein antigen according to the present invention in the spleen of mice 6 weeks after infection with pathogenic Mycobacterium tuberculosis.
[0046] [Figure 19]This is the result of an efficacy evaluation of the Rv2299c-ESAT6 therapeutic vaccine using a latent infection model. (A) Efficacy evaluation strategy schedule using the Mtb H37Ra latent infection model. (B) Bacterial burden in the lungs of each group according to the evaluation schedule after tuberculosis infection.
[0047] [Figure 20] This is the result of efficacy evaluation of the Rv2299c-ESAT6-Rv3463 therapeutic vaccine using a latent infection model. (A) Efficacy evaluation strategy schedule using the Mtb H37Ra latent infection model. (B), (C) Bacterial burden in the lungs of each group by repeated evaluation after tuberculosis infection.
[0048] [Figure 21] This is the efficacy evaluation result of the Rv2299cD2D3-ESAT6 backbone structure vaccine candidate group. (A) Rv2299cD2D3-ESAT6 backbone structure vaccine candidate group. (B) Efficacy evaluation strategy schedule using the Mtb H37Ra latent infection model. (C) Bacterial burden in the lungs of each candidate group 20 weeks after tuberculosis infection.
[0049] [Figure 22] This is the efficacy evaluation result of the Rv2299cD2D3-ESAT6-Rv3463 backbone structure vaccine candidate group. (A) Rv2299cD2D3-ESAT6-Rv3463 backbone structure vaccine candidate group. (B) Efficacy evaluation strategy schedule using the Mtb H37Ra latent infection model. (C) Bacterial burden in the lungs of each candidate group 20 weeks after tuberculosis infection.
[0050] [Figure 23] This is the efficacy evaluation result of a therapeutic vaccine combining a new antigen with an ESAT6-conjugated backbone fusion protein. (A) Candidate vaccine group combining a new antigen with an ESAT6-conjugated backbone structure. (B) Efficacy evaluation strategy schedule utilizing an Mtb H37Ra latent infection model. (C) Bacterial burden in the lungs of each candidate group 20 weeks after tuberculosis infection. [Modes for carrying out the invention]
[0051] The inventors have been conducting research to develop a fusion protein-based BCG substitute, BCG booster, and therapeutic vaccine that offers superior protective efficacy and significant safety advantages. In particular, the inventors' group has strived to develop a vaccine with superior protective efficacy that overcomes the shortcomings of the tuberculosis vaccine using Rv2299c-ESAT6, as presented in the prior patent, Patent Document 1: Korean Patent Registration No. 1749165. When fusing proteins with high immune activity, even if the vaccine efficacy is good, there are many difficulties in standardizing the purification method during the commercialization process. Specifically, the fused protein has a large molecular weight, making purification difficult, and it is prone to denaturation during the purification process. In the process of overcoming this, it was confirmed that protein-based vaccines are more advantageous in terms of standardization of the purification process the smaller the molecular weight, and that further efficiency can be achieved by linking other proteins in a complex manner.
[0052] Therefore, we conducted research based on the assumption that identifying the immunoactive domain (site or segment) in the Rv2299c protein and constructing a fusion protein by removing unnecessary sites or selecting only the necessary parts would result in a vaccine with superior efficacy compared to existing fusion proteins, ultimately leading to the completion of the present invention.
[0053] Preferred embodiments of the present invention will be described in detail below. However, the present invention is not limited to the embodiments described herein and may be embodied in other forms. The following embodiments are provided rather to thoroughly and completely convey the ideas of the present invention to those skilled in the art.
[0054] <Experimental materials and methods>
[0055] 1. Cloning, production, and purification of recombinant proteins.
[0056] 1.1 Cloning for Recombinant Protein Production by Protein Domain
[0057] To generate each recombinant protein required for the experiment, the relevant gene was amplified by PCR using the primers shown in Table 1, which use genomic DNA from Mycobacterium tuberculosis (Mtb) H37Rv (ATCC 27294) as a template. The generated PCR product was inserted into a pET-22b(+) vector (Novagen, Madison, WI, USA) using the inserted restriction enzyme sequence, and the resulting plasmid was sequenced for confirmation.
[0058] [Table 1]
[0059] 1.2 Cloning for the production of a fusion protein (1) pET-22b(+)_Rv2299cD2D3-ESAT6
[0060] Using the genomic DNA of Mycobacterium tuberculosis (Mtb) H37Rv (ATCC 27294) as a template, Rv2299c DNA and ESAT6 DNA were obtained by PCR. Using the overlapping PCR method, Rv2299c D2D3-ESAT6 DNA fragments were constructed with NdeI at the 5' end and HindIII restriction enzyme at the 3' end, and these were inserted into the pET22b vector. The primers used are as follows.
[0061] D2D3-ESAT6_NdeI_F:AAGGAGATATACATATGtcgatgaaggcgctgtgg
[0062] D2D3-ESAT6_HindIII_R:GTGCGGCCGCAAGCTTtgcgaacatcccagtgacg
[0063] D2D3-ESAT6_intP:aagaaggtgctgtccacg
[0064] (2) pET-22b(+)_Rv2299cD3-ESAT6
[0065] Using the same method as described above, Rv2299c and ESAT6 DNA were combined using overlapping PCR to produce Rv2299c D3-ESAT6 DNA fragments with NdeI at the 5' end and HindIII restriction enzyme at the 3' end, which were then inserted into the pET22b vector. The primers used were as follows:
[0066] D3-ESAT6_NdeI_F:AAGGAGATATACATATGctcggtatttcttcgtttgtctc
[0067] D3-ESAT6_HindIII_R:GTGCGGCCGCAAGCTTtgcgaacatcccagtgac
[0068] (3)pET-22b(+)_Rv2299cD2D3-ESAT6-RpfE D1
[0069] Using the same method as described above, RpfE DNA and Rv2299c D2D3-ESAT6 DNA were obtained as templates, and Rv2299c D2D3-ESAT6-RpfE D1 DNA fragments were prepared by overlapping PCR, with NdeI restriction enzymes inserted at the 5' end and XhoI restriction enzymes at the 3' end. These fragments were then inserted into the pET22b vector. The primers used were as follows.
[0070] Rv2299c(D2D3)+ESAT6_NdeI_F:
[0071] AAGGAGATATACATATGTCGATGAAGGCGCT
[0072] Rv2299c(D2D3)+ESAT6_R:TGCGAACATCCCAGTGAC
[0073] RpfEdomain1_F:GTCACTGGGATGTTCGCAGCCGACGACGCGGGCTTG
[0074] RpfEdomain1_XhoI_R:
[0075] GGTGGTGGTGGTGGTGCTCGAGGTTGTAGGCCACGGGCAC
[0076] (4)pET-22b(+)_Rv2299c-Rv3463-ESAT6
[0077] Using the same method as described above, Rv2299c, Rv3463, and ESAT6 DNA were obtained as templates, and Rv2299c-Rv3463-ESAT6 DNA fragments were ultimately prepared by PCR, with NdeI restriction enzymes inserted at the 5' end and XhoI restriction enzymes at the 3' end. These fragments were then inserted into the pET22b vector. The primers used were as follows.
[0078] Rv2299c-Nde-F:CATATGAACGCCCATGTCGAGCAGTTG
[0079] Rv2299c-EcoR-R:GAATTCGGCAAGGTACGCGCGAGACGTTC
[0080] Rv3463-EcoR-F:GAATTCGATGACCAATTGTGCCGCC
[0081] Rv3463-Hind-R:AAGCTTAGTCAGTCGGAGCGGCTT
[0082] ESAT6-Hind-F:AAGCTTATGACAGAGCAGCAGTGGAAT
[0083] ESAT6-Xho-R:CTCGAGTGCGAACATCCCAGTGACGTT
[0084] (5)pET-22b(+)_Rv2299c-ESAT6-Rv3463
[0085] Using the same method as described above, Rv2299c, ESAT6, and Rv3463 DNA were obtained as templates and, by PCR, Rv2299c-ESAT6-Rv3463 DNA fragments were prepared with NdeI restriction enzymes inserted at the 5' end and NotI restriction enzymes at the 3' end. These fragments were then inserted into the pET22b vector. The primers used were as follows.
[0086] Rv2299c-Nde-F:CATATGAACGCCCATGTCGAGCAGTTG
[0087] Rv2299c-EcoR-R:GAATTCGGCAAGGTACGCGCGAGACGTTC
[0088] ESAT6-EcoR-F:GAATTCGATGACAGAGCAGCAGTGGAAT
[0089] ESAT6-Hind-R:AAGCTTTGCGAACATCCCAGTGACGTT
[0090] Rv3463-Hind-F:AAGCTTATGACCAATTGTGCCGCC
[0091] Rv3463-Not-R:GCGGCCGCAGTCAGTCGGAGCGGCTT
[0092] (6)pET-22b(+)_Rv2299cD2D3-ESAT6-Rv3463
[0093] Using the same method as described above, Rv2299c D2D3, ESAT6, and Rv3463 DNA were obtained as templates and the Rv2299c D2D3-ESAT6-Rv3463 DNA fragment was ultimately prepared by overlapping PCR, with NdeI restriction enzymes inserted at the 5' end and NotI restriction enzymes at the 3' end, and then inserted into the pET22b vector. The primers used at this time are as follows.
[0094] Rv2299c_D2D3_NdeI_F:AAGGAGATATACATATGTCGATGAAGGCGCTG
[0095] Rv2299c_D2D3_R:CAAGGTACGCGCGAGACG
[0096] ESAT-6_F:
[0097] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG
[0098] ESAT-6_R:TGCGAACATCCCAGTGAC
[0099] Rv3463_F:
[0100] GTCACTGGGATGTTCGCAAAGCTTATGACCAATTGTGCCGCC
[0101] Rv3463_NotI_R:TGCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT
[0102] (7)pET-22b(+)_Rv2299cD2D3-ESAT6-Rv2005cD3-Rv3463
[0103] Using the same method as described above, Rv2299c D2D3, ESAT6, Rv2005cD3, and Rv3463 DNA were obtained as templates and the Rv2299c D2D3-ESAT6-Rv3463 DNA fragment, in which NdeI restriction enzymes were finally inserted at the 5' end and NotI restriction enzymes at the 3' end, was prepared by overlapping PCR and inserted into the pET22b vector. The primers used at this time are as follows.
[0104] Rv2299c_D2D3_NdeI_F:AAGGAGATATACATATGTCGATGAAGGCGCTG
[0105] Rv2299c_D2D3_R:CAAGGTACGCGCGAGACG
[0106] ESAT-6_F:
[0107] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG
[0108] ESAT-6_R:TGCGAACATCCCAGTGAC
[0109] Rv2005c_D3_HindIII_F:
[0110] GATGTTCGCAAAGCTTATGTGGAGTGACGTCGAAG
[0111] Rv2005c_R:CGACTGCCGTGCCACGAT
[0112] Rv3463(NheI)_F:GCACGGCAGTCGGCTAGCATGACCAATTGTGCCGCC
[0113] Rv3463_NotI_R:TGCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT
[0114] (8)pET-22b(+)_Rv2299cD2D3-ESAT6-Rv2882cD2-Rv2005cD3-Rv3463D2
[0115] Using the same method as described above, Rv2299cD2D3, ESAT6, Rv2882cD2, Rv2005cD3, and Rv3463 D2 DNA were obtained as templates, and the Rv2299cD2D3-ESAT6-Rv2882cD2-Rv2005cD3-Rv3463D2 DNA fragment was prepared by overlapping PCR, with NdeI restriction enzymes inserted at the 5' end and NotI restriction enzymes at the 3' end. This fragment was then inserted into the pET22b vector. The primers used are as follows.
[0116] Rv2299c_D2D3_NdeI_F:AAGGAGATATACATATGTCGATGAAGGCGCTG
[0117] Rv2299c_D2D3_R:CAAGGTACGCGCGAGACG
[0118] ESAT-6_F:
[0119] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG
[0120] ESAT-6_R:TGCGAACATCCCAGTGAC
[0121] Rv2882c_D2_HindIII_F:
[0122] GATGTTCGCAAAGCTTATGGACGGCGCCCTTATTC
[0123] Rv2882c_D2_R:GACCTCCAGCAGCTCGC
[0124] Rv2005c_D3_F:
[0125] GCGAGCTGCTGGAGGTCTCTAGAATGTGGAGTGACGTCGAAG
[0126] Rv2005c_D3_R1:GCTAGCCGACTGCCGTGCCACGAT
[0127] Rv3463_D2_F1:GCACGGCAGTCGGCTAGCATGGCACTGGGCCCCCG
[0128] Rv3463_NotI_R:TGCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT
[0129] (9)pET-22b(+)_Rv2299cD2D3-ESAT6-Rv2005cD3-Rv1605-Rv3463D2
[0130] Using the same method as described above, Rv2299c D2D3, ESAT6, Rv1605, Rv2005cD3, and Rv3463 D2 DNA were obtained as templates, and the Rv2299cD2D3-ESAT6-Rv2005cD3-Rv1605-Rv3463D2 DNA fragment was prepared by overlapping PCR, with NdeI restriction enzymes inserted at the 5' end and NotI restriction enzymes at the 3' end. This fragment was then inserted into the pET22b vector. The primers used are as follows.
[0131] Rv2299c_D2D3_NdeI_F:AAGGAGATATACATATGTCGATGAAGGCGCTG
[0132] Rv2299c_D2D3_R:CAAGGTACGCGCGAGACG
[0133] ESAT-6_F:
[0134] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG
[0135] ESAT-6_R:TGCGAACATCCCAGTGAC
[0136] Rv2005c_D3_HindIII_F:
[0137] GATGTTCGCAAAGCTTATGTGGAGTGACGTCGAAG
[0138] Rv2005c_D3_R2:TCTAGACGACTGCCGTGCCACGAT
[0139] Rv1605_F:GCACGGCAGTCGTCTAGAATGTATGCCGACCGTGAC
[0140] Rv1605_R:GCTAGCTCGCACGGTGATTCCTTC
[0141] Rv3463_D2_F2:ATCACCGTGCGAGCTAGCATGGCACTGGGCCCCG
[0142] Rv3463_NotI_R:TGCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT
[0143] (10)pET-22b(+)_Rv2299cD2D3-ESAT6-Rv3463 D2-Rv2882cD2-RpfED1-Rv2145cD2
[0144] Using the same method as described above, Rv2299c D2D3, ESAT6, Rv3463D2, Rv2882cD2, RpfED1, and Rv2145cD2 DNA were obtained as templates. Overlapping PCR was then used to create Rv2299cD2D3-ESAT6-Rv3463D2-Rv2882cD2-RpfED1-Rv2145cD2 DNA fragments, in which NdeI restriction enzymes were inserted at the 5' end and XhoI restriction enzymes at the 3' end. These fragments were then inserted into the pET22b vector. The primers used were as follows.
[0145] Rv2299c D2+D3_NdeI_F:
[0146] GAAGGAGATATACATATGAACCTGGGTCAAGAAATACTCC
[0147] Rv2299c-EcoR-R:GAATTCGGCAAGGTACGCGCGAGACGTTC
[0148] ESAT6-EcoR-F:GAATTCGATGACAGAGCAGCAGTGGAAT
[0149] ESAT6_R:GGGGCCCAGTGCCATAAGCTTTGCGAACATCCCAGTGACGT
[0150] Rv3463 D2_F:ATGGCACTGGGCCCCCGG
[0151] Rv3463_D2_R:TGCGGCCGCAGTCAGTCGGAGCG
[0152] Rv2882c_D2_F:CTGACTGCGGCCCGCAATGGACGGCGCCCTTATTCG
[0153] Rv2882c_D2_XhoI_R:
[0154] GTGGTGGTGGTGCTCGAGGACCTCCAGCAGCTCGCC
[0155] RpfE_D1_Rv2882D2_F:
[0156] GAGCTGCTGGAGGTCATGGCCGACGACGCGGGCTTGGAC
[0157] RpfE_D1_R:GTTGTAGGCCACGGGCAC
[0158] Rv2145c_D2_RpfED1_F:CCCGTGGCCTACAACATGGTCTCGGCGGGGATG
[0159] Rv2145c_D2_XhoI_R:
[0160] GTGGTGGTGGTGCTCGAGGTTTTTGCCCCGGTTGAATTGATC
[0161] (11)pET-22b(+)_Rv2299cD2D3-ESAT6-Rv3463 D2-Rv2005cD3
[0162] Using the same method as described above, Rv2299c D2D3, ESAT6, Rv3463 D2, and Rv2005cD3 DNA were obtained as templates. Overlapping PCR was then used to construct Rv2299cD2D3-ESAT6-Rv3463D2-Rv2005cD3 DNA fragments, in which NdeI restriction enzymes were inserted at the 5' end and XhoI restriction enzymes at the 3' end. These fragments were then inserted into the pET22b vector. The primers used were as follows.
[0163] Rv2299c D2+D3_NdeI_F:
[0164] GAAGGAGATATACATATGAACCTGGTCAAGAAATACTCC
[0165] Rv2299c-EcoR-R:GAATTCGGCAAGGTACGCGCGAGACGTTC
[0166] ESAT6-EcoR-F:GAATTCGATGACAGAGCAGCAGTGGAAT
[0167] ESAT6_R:GGGGCCCAGTGCCATAAGCTTTGCGAACATCCCAGTGACGT
[0168] Rv3463 D2_F:ATGGCACTGGGCCCCCGG
[0169] Rv3463_D2_R:TGCGGCCGCAGTCAGTCGGAGCG
[0170] Rv2005c_D3_F:CTGACTGCGGCCGCAATGTGGAGTGACGTCGAAGT
[0171] Rv2005c_D3_XhoI_R:
[0172] GGTGGTGGTGGTGCTCGAGCGACTGCCGTGCCACGATCAC
[0173] (12)pET-22b(+)_Rv2299cD2D3-ESAT6-Rv3463 D2-Rv2005cD3-RpfED1
[0174] Using the same method as described above, Rv2299c D2D3, ESAT6, Rv3463 D2, Rv2005cD3, and RpfED1 DNA were obtained as templates. Overlapping PCR was then used to construct the Rv2299cD2D3-ESAT6-Rv3463D2-Rv2005cD3-RpfED1 DNA fragment, in which NdeI restriction enzymes were inserted at the 5' end and XhoI restriction enzymes at the 3' end. This fragment was then inserted into the pET22b vector. The primers used were as follows.
[0175] Rv2299c D2+D3_NdeI_F:
[0176] GAAGGAGATATACATATGAACCTGGTCAAGAAATACTCC
[0177] Rv2299c-EcoR-R:GAATTCGGCAAGGTACGCGCGAGACGTTC
[0178] ESAT6-EcoR-F:GAATTCGATGACAGAGCAGCAGTGGAAT
[0179] ESAT6_R:GGGGCCCAGTGCCATAAGCTTTGCGAACATCCCAGTGACGT
[0180] Rv3463 D2_F:ATGGCACTGGGCCCCCGG
[0181] Rv3463_D2_R:TGCGGCCGCAGTCAGTCGGAGCG
[0182] Rv2005c_D3_F:CTGACTGCGGCCGCAATGTGGAGTGACGTCGAAGT
[0183] Rv2005c_D3_R:CGACTGCCGTGCCACGATCAC
[0184] RpfE_D2_Rv2005cD3_F:
[0185] GTGGCACGGCAGTCGATGGCCGACGACGCGGGCTTGGAC
[0186] RpfE_D1_XhoI_R:GTGGTGGTGGTGCTCGAGGTTGTAGGCCACGGGCAC
[0187] (13)pET-22b(+)_Rv2299cD2D3-ESAT6-Rv3463 D2
[0188] Using the same method as described above, Rv2299cD2D3, ESAT6, and Rv3463D2 DNA were obtained as templates, and the Rv2299cD2D3-ESAT6-Rv3463D2 DNA fragment, in which NdeI restriction enzymes were finally inserted at the 5' end and NotI restriction enzymes at the 3' end, was prepared by overlapping PCR and inserted into the pET22b vector. The primers used at this time are as follows.
[0189] Rv2299c D2+D3_NdeI_F:
[0190] GAAGGAGATATACATATGAACCTGGTCAAGAAATACTCC
[0191] Rv2299c-EcoR-R:GAATTCGGCAAGGTACGCGCGAGACGTTC
[0192] ESAT6-EcoR-F:GAATTCGATGACAGAGCAGCAGTGGAAT
[0193] ESAT6_R:GGGGCCCAGTGCCATAAGCTTTGCGAACATCCCAGTGACGT
[0194] Rv3463 D2_F:ATGGCACTGGGCCCCCGG
[0195] Rv3463 D2_NotI_R:
[0196] TGGTGCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTTC
[0197] (14)pET-22b(+)_Rv2299cD2D3-ESAT6-Rv3463 D2-Rv2882cD2
[0198] Using the same method as described above, Rv2299cD2D3, ESAT6, Rv3463 D2, and Rv2882cD2 DNA were obtained as templates. Overlapping PCR was then used to construct Rv2299cD2D3-ESAT6-Rv3463 D2-Rv2882cD2 DNA fragments, in which NdeI restriction enzymes were inserted at the 5' end and XhoI restriction enzymes at the 3' end. These fragments were then inserted into the pET22b vector. The primers used were as follows.
[0199] Rv2299c D2+D3_NdeI_F:
[0200] GAAGGAGATATACATATGAACCTGGTCAAGAAATACTCC
[0201] Rv2299c-EcoR-R:GAATTCGGCAAGGTACGCGCGAGACGTTC
[0202] ESAT6-EcoR-F:GAATTCGATGACAGAGCAGCAGTGGAAT
[0203] ESAT6_R:GGGGCCCAGTGCCATAAGCTTTGCGAACATCCCAGTGACGT
[0204] Rv3463 D2_F:ATGGCACTGGGCCCCCGG
[0205] Rv3463_D2_R:TGCGGCCGCAGTCAGTCGGAGCG
[0206] Rv2882c_D2_F:CTGACTGCGGCCGCAATGGACGGCGCCCTTATTCG
[0207] Rv2882c_D2_XhoI_R:
[0208] GTGGTGGTGGTGCTCGAGGACCTCCAGCAGCTCGCC
[0209] (15)pET-22b(+)_Rv2299cD2D3-ESAT6-Rv3463 D2-Rv2882cD2-Rv2145cD2
[0210] Using the same method as described above, Rv2299cD2D3, ESAT6, Rv3463 D2, Rv2882cD2, and Rv2145cD2 DNA were obtained as templates. Overlapping PCR was then used to create Rv2299cD2D3-ESAT6-Rv3463 D2-Rv2882cD2-Rv2145cD2 DNA fragments, in which NdeI restriction enzymes were inserted at the 5' end and XhoI restriction enzymes at the 3' end. These fragments were then inserted into the pET22b vector. The primers used were as follows.
[0211] Rv2299c D2+D3_NdeI_F:
[0212] GAAGGAGATATACATATGAACCTGGGTCAAGAAATACTCC
[0213] Rv2299c-EcoR-R:GAATTCGGCAAGGTACGCGCGAGACGTTC
[0214] ESAT6-EcoR-F:GAATTCGATGACAGAGCAGCAGTGGAAT
[0215] ESAT6_R:GGGGCCCAGTGCCATAAGCTTTGCGAACATCCCAGTGACGT
[0216] Rv3463 D2_F:ATGGCACTGGGCCCCCGG
[0217] Rv3463_D2_R:TGCGGCCGCAGTCAGTCGGAGCG
[0218] Rv2882c_D2_F:CTGACTGCGGCCCGCAATGGACGGCGCCCTTATTCG
[0219] Rv2882c_D2_R:GACCTCCAGCAGCTCGCC
[0220] Rv2145c_D2_Rv2882cD2_F:
[0221] GAGCTGCTGGAGGTCATGGTCTCGGCGGGGATG
[0222] Rv2145c_D2_XhoI_R:
[0223] GTGGTGGTGGTGCTCGAGGTTTTTGCCCCGGTTGAATTGATC
[0224] (16)pET-22b(+)_Rv2299cD2D3-ESAT6-Rv3463 D2-Rv2882cD2-RpfED1
[0225] Using the same method as described above, Rv2299cD2D3, ESAT6, Rv3463 D2, Rv2882cD2, and RpfED1 DNA were obtained as templates. Overlapping PCR was then used to construct the Rv2299cD2D3-ESAT6-Rv3463 D2-Rv2882cD2-RpfED1 DNA fragment, in which NdeI restriction enzymes were inserted at the 5' end and XhoI restriction enzymes at the 3' end. This fragment was then inserted into the pET22b vector. The primers used were as follows.
[0226] Rv2299c D2+D3_NdeI_F:
[0227] GAAGGAGATATACATATGAACCTGGTCAAGAAATACTCC
[0228] Rv2299c-EcoR-R:GAATTCGGCAAGGTACGCGCGAGACGTTC
[0229] ESAT6-EcoR-F:GAATTCGATGACAGAGCAGCAGTGGAAT
[0230] ESAT6_R:GGGGCCCAGTGCCATAAGCTTTGCGAACATCCCAGTGACGT
[0231] Rv3463 D2_F:ATGGCACTGGGCCCCCGG
[0232] Rv3463_D2_R:TGCGGCCGCAGTCAGTCGGAGCG
[0233] Rv2882c_D2_F:CTGACTGCGGCCGCAATGGACGGCGCCCTTATTCG
[0234] Rv2882c_D2_R:GACCTCCAGCAGCTCGCC
[0235] RpfE_D1_Rv2882D2_F:
[0236] GAGCTGCTGGAGGTCATGGCCGACGACGCGGGCTTGGAC
[0237] RpfE_D1_XhoI_R:GTGGTGGTGGTGCTCGAGGTTGTAGGCCACGGGCAC
[0238] (17)pET-22b(+)_Rv2882c-Rv2005c-Rv3463
[0239] Using the same method as described above, Rv2882c, Rv2005c, and Rv3463 DNA were obtained as templates, and Rv2882c-Rv2005c-Rv3463 DNA fragments were ultimately prepared by overlapping PCR, with NdeI at the 5' end and NotI restriction enzymes at the 3' end inserted. These fragments were then inserted into the pET22b vector. The primers used are as follows.
[0240] Rv2882c_NdeI_F:AAGGAGATATACATATGATTGATGAGGCTCTCTTCG
[0241] Rv2882c_D2_R:GACCTCCAGCAGCTCGC
[0242] Rv2005c_F:GCGAGCTGCTGGAGGTCGAATTCATGTCTAAACCCCGCAAG
[0243] Rv2005c(HindIII)_R:AAGCTTCGACTGCCGTGCCACGAT
[0244] Rv3463(HindIII)_F:GCACGGCAGTCGAAGCTTATGACCAATTGTGCCGCC
[0245] Rv3463_NotI_R:TGCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT
[0246] (18)pET-22b(+)_Rv2882c-Rv2005cD3-ESAT6-Rv3463
[0247] Using the same method as described above, Rv2882c, Rv2005cD3, ESAT6, and Rv3463 DNA were obtained as templates, and Rv2882c-Rv2005cD3-ESAT6-Rv3463 DNA fragments were prepared by overlapping PCR, with NdeI restriction enzymes inserted at the 5' end and NotI restriction enzymes at the 3' end. These fragments were then inserted into the pET22b vector. The primers used were as follows.
[0248] Rv2882c_NdeI_F:AAGGAGATATACATATGATTGATGAGGCTCTCTTCG
[0249] Rv2882c_D2_R:GACCTCCAGCAGCTCGC
[0250] Rv2005c_D3_F:
[0251] GCGAGCTGCTGGAGGTCTCTAGAATGTGGAGTGACGTCGAAG
[0252] Rv2005c_D3_EcoRI_R:GCTCTGTCATGAATTCCGACTGCCGTGCCACGAT
[0253] ESAT-6_F:
[0254] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG
[0255] ESAT-6_R:TGCGAACATCCCAGTGAC
[0256] Rv3463(HindIII)_F:GCACGGCAGTCGAAGCTTATGACCAATTGTGCCGCC
[0257] Rv3463_NotI_R:GCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT
[0258] (19)pET-22b(+)_Rv2220-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2
[0259] Using the same method as described above, Rv2220, Rv2882cD2, Rv2005cD3, ESAT6, and Rv3463D2 DNA were obtained as templates. Overlapping PCR was then used to create Rv2220-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2 DNA fragments, in which NdeI restriction enzymes were inserted at the 5' end and NotI restriction enzymes at the 3' end. These fragments were then inserted into the pET22b vector. The primers used were as follows.
[0260] Rv2220_NdeI_F:AAGGAGATATACATATGACGGAAAAGACGCCC
[0261] Rv2220_R:AACGTCGTAGTACAGCGC
[0262] Rv2882c_D2_F:
[0263] GCGCTGTACTACGACGTTGCTAGCATGGACGGCGCCCTTATTC
[0264] Rv2882c_D2_R:GACCTCCAGCAGCTCGC
[0265] Rv2005c_D3_F:
[0266] GCGAGCTGCTGGAGGTCTCTAGAATGTGGAGTGACGTCGAAG
[0267] Rv2005c_D3_EcoRI_R:GCTCTGTCATGAATTCCGACTGCCGTGCCACGAT
[0268] ESAT-6_F:
[0269] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG
[0270] ESAT-6_R:TGCGAACATCCCAGTGAC
[0271] Rv3463_D2_F3:
[0272] GTCACTGGGATGTTCGCAAAGCTTATGGCACTGGGCCCCCG
[0273] Rv3463_NotI_R:GCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT
[0274] (20)pET-22b(+)_Rv0869c-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2
[0275] Using the same method as described above, Rv0869c, Rv2882cD2, Rv2005cD3, ESAT6, and Rv3463D2 DNA obtained were used as templates, and an Rv0869c-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463 D2 DNA fragment with NdeI inserted at the 5'-end and NotI restriction enzyme inserted at the 3'-end was finally prepared by overlapping PCR method and inserted into the pET22b vector. At this time, the primers used were as follows.
[0276] Rv0869c_NdeI_F:AAGGAGATATACATATGACACTGACCGCGCTGGG
[0277] Rv0869c_NheI_R:CGCCGTCCATGCTAGCGCCACCGATCGCGCTCA
[0278] GCGCTGTACTACGACGTTGCTAGCATGGACGGGCCCTTATTC
[0280] Rv2882c_D2_R:GACCTCCAGCAGCTCGC
[0281] Rv2005c_D3_F:
[0282] GCGAGCTGCTGGAGGTCTCTAGAATGTGGGAGTGACGTCGAAG
[0283] Rv2005c_D3_EcoRI_R:GCTCTGTCATGAATTCCGACTGCGTGCCACGAT
[0284] ESAT-6_F:
[0285] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG
[0286] ESAT-6_R:TGCGAACATCCCAGTGAC
[0287] Rv3463_D2_F3:
[0288] GTCACTGGGATTGTTCGCAAAGCTTATGGCACTGGGCCCCG
[0289] Rv3463_NotI_R:GCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT
[0290] (21)pET-22b(+)_Rv1605-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2
[0291] Using the same method as described above, Rv1605, Rv2882cD2, Rv2005cD3, ESAT6, and Rv3463D2 DNA obtained were used as templates, and finally, an Rv1605-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2 DNA fragment with NdeI at the 5'-end and NotI restriction enzyme inserted at the 3'-end was prepared by overlapping PCR method and inserted into the pET22b vector. At this time, the primers used were as follows.
[0292] Rv1605_NdeI_F:AAGGAGATATACATATGTATGCCGACCGTGACCTTC
[0293] Rv1605_NheI_R:CGCCGTCCATGCTAGCTCGCACGGTGATTCCTTC
[0294] Rv2882c_D2_F: <00,00976> GCGCTGTACTACGACGTTGCTAGCATGGACGGCGCCCTTATTC
[0296] Rv2882c_D2_R:GACCTCCAGCAGCTCGC
[0297] Rv2005c_D3_F:
[0298] GCGAGCTGCTGGAGGTCTCTAGAATGTGGAGTGACGTCGAAG
[0299] Rv2005c_D3_EcoRI_R:GCTCTGTCATGAATTCCGACTGCCGTGCCACGAT
[0300] ESAT-6_F:[[ID=3,7]] <,
[0301] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG
[0302] ESAT-6_R:TGCGAACATCCCAGTGAC
[0303] Rv3463_D2_F3:
[0304] GTCACTGGGATGTTCGCAAAGCTTATGGCACTGGGCCCCG
[0305] Rv3463_NotI_R:GCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT
[0306] (22)pET-22b(+)_Rv2220-ESAT6-Rv3463
[0307] Using the same method as described above, Rv2220, ESAT6, and Rv3463 DNA were obtained as templates, and Rv2220-ESAT6-Rv3463 DNA fragments were ultimately prepared by overlapping PCR, with NdeI at the 5' end and NotI restriction enzymes at the 3' end inserted. These fragments were then inserted into the pET22b vector. The primers used were as follows.
[0308] Rv2220_NdeI_F:AAGGAGATATACATATGACGGAAAAGACGCCC
[0309] Rv2220_EcoRI_R:GCTCTGTCATGAATTCAACGTCGTAGTACAGCGC
[0310] ESAT-6_F:
[0311] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG
[0312] ESAT-6_R:TGCGAACATCCCAGTGAC
[0313] Rv3463_F:GTCACTGGGATGTTCGCAAAGCTTATGACCAATTGTGCCGCC
[0314] Rv3463_NotI_R:TGCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT
[0315] (24)pET-22b(+)_Rv0869c-ESAT6-Rv2005cD3-Rv3463
[0316] Using the same method as described above, Rv0869c, ESAT6, Rv2005cD3, and Rv3463 DNA were obtained as templates, and Rv0869c-ESAT6-Rv2005cD3-Rv3463 DNA fragments were prepared by overlapping PCR, with NdeI restriction enzymes inserted at the 5' end and NotI restriction enzymes at the 3' end. These fragments were then inserted into the pET22b vector. The primers used were as follows.
[0317] Rv0869c_NdeI_F:AAGGAGATATACATATGACACTGACCGCGCTGGG
[0318] Rv0869c_EcoRI_R:GCTCTGTCATGAATTCGCCACCGATCGCGCTCAT
[0319] ESAT-6_F:
[0320] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG
[0321] ESAT-6_R:TGCGAACATCCCAGTGAC
[0322] Rv2005c_D3_HindIII_F:
[0323] GATGTTCGCAAAGCTTATGTGGAGTGACGTCGAAG
[0324] Rv2005c_R:CGACTGCCGTGCCACGAT
[0325] Rv3463(NheI)_F:GCACGGCAGTCGGCTAGCATGACCAATTGTGCCGCC
[0326] Rv3463_NotI_R:TGCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT
[0327] (25)pET-22b(+)_Rv1605-ESAT6-Rv2005cD3-Rv3463
[0328] Using the same method as described above, Rv1605, ESAT6, Rv2005cD3, and Rv3463 were obtained as templates, and the Rv1605-ESAT6-Rv2005cD3-Rv3463 DNA fragment, in which NdeI restriction enzymes were finally inserted at the 5' end and NotI restriction enzymes at the 3' end, was prepared by overlapping PCR and inserted into the pET22b vector. The primers used at this time are as follows.
[0329] Rv1605_NdeI_F:AAGGAGATATACATATGTATGCCGACCGTGACCTTC
[0330] Rv1605_EcoRI_R:GCTCTGTCATGAATTCTCGACGGTGATTCCTTC
[0331] ESAT-6_F:
[0332] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG
[0333] ESAT-6_R:TGCGAACATCCCAGTGAC
[0334] Rv2005c_D3_HindIII_F:
[0335] GATGTTCGCAAAGCTTATGTGGAGTGACGTCGAAG
[0336] Rv2005c_R:CGACTGCCGTGCCACGAT
[0337] Rv3463(NheI)_F:GCACGGCAGTCGGCTAGCATGACCAATTGTGCCGCC
[0338] Rv3463_NotI_R:TGCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT
[0339] (26)pET-22b(+)_Rv2220-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2
[0340] Using the same method as described above, Rv2220, Rv2882cD2, Rv2005cD3, ESAT6, and Rv3463D2 DNA were obtained as templates. Overlapping PCR was then used to create Rv2220-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2 DNA fragments, in which NdeI restriction enzymes were inserted at the 5' end and NotI restriction enzymes at the 3' end. These fragments were then inserted into the pET22b vector. The primers used were as follows.
[0341] Rv2220_NdeI_F:AAGGAGATATACATATGACGGAAAAGACGCCC
[0342] Rv2220_R:AACGTCGTAGTACAGCGC
[0343] Rv2882c_D2_F:
[0344] GCGCTGTACTACGACGTTGCTAGCATGGACGGCGCCCTTATTC
[0345] Rv2882c_D2_R:GACCTCCAGCAGCTCGC
[0346] Rv2005c_D3_F:
[0347] GCGAGCTGCTGGAGGTCTCTAGAATGTGGAGTGACGTCGAAG
[0348] Rv2005c_D3_EcoRI_R:GCTCTGTCATGAATTCCGACTGCCGTGCCACGAT
[0349] ESAT-6_F:
[0350] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG
[0351] ESAT-6_R:TGCGAACATCCCAGTGAC
[0352] Rv3463_D2_F3:
[0353] GTCACTGGGATGTTCGCAAAGCTTATGGCACTGGGCCCCG
[0354] Rv3463_NotI_R:GCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT
[0355] (27)pET-22b(+)_Rv0869c-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2
[0356] Using the same method as described above, Rv0869c, Rv2882cD2, Rv2005cD3, ESAT6, and Rv3463D2 DNA were obtained as templates. Overlapping PCR was then used to create Rv0869c-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463 D2 DNA fragments, in which NdeI restriction enzymes were inserted at the 5' end and NotI restriction enzymes at the 3' end. These fragments were then inserted into the pET22b vector. The primers used were as follows.
[0357] Rv0869c_NdeI_F:AAGGAGATATACATATGACACTGACCGCGCTGGG
[0358] Rv0869c_NheI_R:CGCCGTCCATGCTAGCGCCACCGATCGCGCTCA
[0359] Rv2882c_D2_F:
[0360] GCGCTGTACTACGACGTTGCTAGCATGGACGGGCCCTTATTC
[0361] Rv2882c_D2_R:GACCTCCAGCAGCTCGC
[0362] Rv2005c_D3_F:
[0363] GCGAGCTGCTGGAGGTCTCTAGAATGTGGGAGTGACGTCGAAG
[0364] Rv2005c_D3_EcoRI_R:GCTCTGTCATGAATTCCGACTGCGTGCCACGAT
[0365] ESAT-6_F:
[0366] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG
[0367] ESAT-6_R:TGCGAACATCCCAGTGAC
[0368] Rv3463_D2_F3:
[0369] GTCACTGGGATTGTTCGCAAAGCTTATGGCACTGGGCCCCG
[0370] Rv3463_NotI_R:GCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT
[0371] (28)pET-22b(+)_Rv1605-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2
[0372] Using the same method as described above, Rv1605, Rv2882cD2, Rv2005cD3, ESAT6, and Rv3463D2 DNA were obtained as templates. Overlapping PCR was then used to construct Rv1605-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2 DNA fragments, in which NdeI restriction enzymes were inserted at the 5' end and NotI restriction enzymes at the 3' end. These fragments were then inserted into the pET22b vector. The primers used were as follows.
[0373] Rv1605_NdeI_F:AAGGAGATATACATATGTATGCCGACCGTGACCTTC
[0374] Rv1605_NheI_R:CGCCGTCCATGCTAGCTCGCACGGTGATTCCTTC
[0375] Rv2882c_D2_F:
[0376] GCGCTGTACTACGACGTTGCTAGCATGGACGGCGCCCTTATTC
[0377] Rv2882c_D2_R:GACCTCCAGCAGCTCGC
[0378] Rv2005c_D3_F:
[0379] GCGAGCTGCTGGAGGTCTCTAGAATGTGGAGTGACGTCGAAG
[0380] Rv2005c_D3_EcoRI_R:GCTCTGTCATGAATTCCGACTGCCGTGCCACGAT
[0381] ESAT-6_F:
[0382] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG
[0383] ESAT-6_R:TGCGAACATCCCAGTGAC
[0384] Rv3463_D2_F3:
[0385] GTCACTGGGATGTTCGCAAAGCTTATGGCACTGGGCCCCG
[0386] Rv3463_NotI_R:GCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT
[0387] (29)pET-22b(+)_ Rv1605-Rv2220-ESAT6-Rv3463
[0388] Using the same method as described above, Rv1605, Rv2220, ESAT6, and Rv3463 DNA were obtained as templates, and the Rv1605-Rv2220-ESAT6-Rv3463 DNA fragment, in which NdeI restriction enzymes were finally inserted at the 5' end and NotI restriction enzymes at the 3' end, was prepared by overlapping PCR and inserted into the pET22b vector. The primers used at this time are as follows.
[0389] Rv2220_NdeI_F:AAGGAGATATACATATGACGGAAAAGACGCCC
[0390] Rv2220_EcoRI_R:GCTCTGTCATGAATTCAACGTCGTAGTACAGCGC
[0391] ESAT-6_F:
[0392] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG
[0393] ESAT-6_R:TGCGAACATCCCAGTGAC
[0394] Rv3463_F:GTCACTGGGATGTTCGCAAAGCTTATGACCAATTGTGCCGCC
[0395] Rv3463_NotI_R:TGCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT
[0396] (30)pET-22b(+)_Rv0869c-ESAT6-Rv2005cD3-Rv3463
[0397] Using the same method as described above, Rv0869c, ESAT6, Rv2005cD3, and Rv3463 DNA were obtained as templates, and Rv0869c-ESAT6-Rv2005cD3-Rv3463 DNA fragments were prepared by overlapping PCR, with NdeI restriction enzymes inserted at the 5' end and NotI restriction enzymes at the 3' end. These fragments were then inserted into the pET22b vector. The primers used were as follows.
[0398] Rv0869c_NdeI_F:AAGGAGATATACATATGACACTGACCGCGCTGGG
[0399] Rv0869c_EcoRI_R:GCTCTGTCATGAATTCGCCACCGATCGCGCTCAT
[0400] ESAT-6_F:
[0401] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG
[0402] ESAT-6_R:TGCGAACATCCCAGTGAC
[0403] Rv2005c_D3_HindIII_F:
[0404] GATGTTCGCAAAGCTTATGTGGAGTGACGTCGAAG
[0405] Rv2005c_R:CGACTGCCGTGCCACGAT
[0406] Rv3463(NheI)_F:GCACGGCAGTCGGCTAGCATGACCAATTGTGCCGCC
[0407] Rv3463_NotI_R:TGCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT
[0408] (31)pET-22b(+)_Rv1605-ESAT6-Rv2005cD3-Rv3463
[0409] Using the same method as described above, Rv1605, ESAT6, Rv2005cD3, and Rv3463 were obtained as templates, and the Rv1605-ESAT6-Rv2005cD3-Rv3463 DNA fragment, in which NdeI restriction enzymes were finally inserted at the 5' end and NotI restriction enzymes at the 3' end, was prepared by overlapping PCR and inserted into the pET22b vector. The primers used at this time are as follows.
[0410] Rv1605_NdeI_F:AAGGAGATATACATATGTATGCCGACCGTGACCTTC
[0411] Rv1605_EcoRI_R:GCTCTGTCATGAATTCTCGACGGTGATTCCTTC
[0412] ESAT-6_F:
[0413] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG
[0414] ESAT-6_R:TGCGAACATCCCAGTGAC
[0415] Rv2005c_D3_HindIII_F:
[0416] GATGTTCGCAAAGCTTATGTGGAGTGACGTCGAAG
[0417] Rv2005c_R:CGACTGCCGTGCCACGAT
[0418] Rv3463(NheI)_F:GCACGGCAGTCGGCTAGCATGACCAATTGTGCCGCC
[0419] Rv3463_NotI_R:TGCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT
[0420] 1.3 Production of Recombinant Proteins
[0421] All recombinant plasmids prepared as described above were used to transform E. coli BL21 cells. E. coli cells containing the recombinant plasmids were grown in a 37°C shaking incubator. When the optical density (OD) reached 600 nm, isopropyl-D-thiogalactopyranoside (IPTG; Daejeong, Korea, ELPIS-Biotech) was added at a concentration of 1 mM. After 4–6 hours, the bacterial cells were harvested by centrifugation and suspended in 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 5 mM imidazole, 6 M urea, and 1 mM phenylmethylsulfonyl fluoride (Sigma). For the purification of single proteins, the same composition was used except for urea. After lysis by sonication, the recombinant proteins were purified by nickel-nitrilotriacetic acid (Ni-NTA) agarose chromatography according to the manufacturer's instructions (Qiagen, Chatsworth, CA, USA). Each purification step was analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) with coomaci brilliant blue (CB) staining and Western blot (WB) analysis using anti-His antibody (Santa Cruz). The purified proteins were concentrated and dialyzed with phosphate-buffered saline (PBS, pH 7.4). PBS was used for dialyzing all single proteins. To remove endotoxins, the dialyzed proteins were cultured with polymyxin B-agarose (PMB, Sigma) at 4°C for 2 hours. Finally, the purified, endotoxin-free recombinant proteins were filter-sterilized and frozen at -70°C. Protein concentrations were calculated using a bicinchoninic acid (BCA) protein analysis kit (Pierce, Rockford, IL) with bovine serum albumin (BSA) as the standard. The purity of all proteins was evaluated by Coomassie Blue (CB) staining using an anti-histidine antibody and by Western blotting (WB).
[0422] 2. Culture of mouse bone marrow-derived dendritic cells (BMDCs)
[0423] Bone marrow-derived dendritic cells (BMDCs) were cultured at 37°C and 5% CO2 using RPMI 1640 medium (Rosswell Park Memorial Institute) supplemented with 10% FBS, 1% antibiotic (Welgene, Korea), and 0.1% 2-mercaptoethanol. They were treated with 5 mM HEPES buffer, 1% MEM solution, 20 ng / ml granulocyte-macrophagocytic colony-stimulating factor (GM-CSF), and 2 ng / ml IL-4. Non-adherent cells and loosely attached proliferating DC aggregates were harvested on day 7 or 8 and used for further experiments.
[0424] 3. Culture of mouse bone marrow-derived macrophages (BMDMs)
[0425] BMDM obtained from the femur and pelvis were cultured in a cell incubator at 5% CO2 and 37°C using DMEM (Dulbecco's modified Eagle's medium) medium containing 10% FBS (fetal bovine serum), 50 ng / μl M-CSF (macrophage colony stimulating factor) (R&D System, USA), and 1% antibiotic (Welgene, South Korea).
[0426] 4.Mtb strain preparation
[0427] Mtb H37Rv (Mtb H37Rv, ATCC 27294) and H37Ra (Mtb H37Ra, ATCC 25177) were cultured in 7H9 medium containing 0.5% glycerol, 0.05% Twin-80, 10% oleic acid, albumin, dextrose, and catalase.
[0428] 5. Animal preparation
[0429] Female C57BL / 6 mice, 5-6 weeks old and free from specific pathogens, were reared in the Biological Hazard Animal Laboratory at Chungnam National University College of Medicine. The mice were reared under 12-hour day / 12-hour night conditions and fed a sterilized, standard diet. The mice were monitored daily, and no clinical symptoms or diseases developed in any of them during the experiment.
[0430] 6. Cell infection experiments and intracellular Mycobacterium tuberculosis growth tests
[0431] BMDM 1 x 10 per well 5 After dispensing the samples onto plates to form individual cells and culturing them, the cells were treated with Mtb H37Rv (MOI=1) for 4 hours to induce infection. Subsequently, to remove any Mycobacterium tuberculosis remaining outside the BMDM without infection, the cells were treated with the antibacterial agent amikacin at a concentration of 200 μg / ml for 2 hours and then washed with PBS. A specific antigen was added, and the cells were cultured for 3 or 5 days, after which the number of Mycobacterium tuberculosis cells in the cells was measured.
[0432] Alternatively, BMDCs stimulated by each antigen were cultured with spleen cells or T cells isolated from spleen cells in a 1:10 ratio for 3 days to activate lymphocytes. These activated lymphocytes were then co-cultured with BMDMs infected with Mycobacterium tuberculosis for 3 or 5 days, and the number of Mycobacterium tuberculosis cells inside the cells was measured.
[0433] For intracellular bacterial count measurement, BMDMs were collected and treated with distilled water for 30 minutes to lyse the cells, and the lysate was obtained. After successive dilutions of the obtained lysate, it was spread on 7H10 solid medium and cultured at 37°C. After culturing, the number of colonies (colony forming units, CFU) formed on the solid medium was analyzed.
[0434] 7. In vitro T cell proliferation analysis
[0435] Responder T cells participating in the naive T cell response were isolated from total mononuclear cells extracted from BALB / c mice using a MACS column (Miltenyi Biotec). Responder OVA-specific CD4 +Each T cell was obtained from the spleen cells of OT-2 mice. These T cells were stained with 1 μM CFSE (Invitrogen). DCs treated with OVA peptide were then subjected to 24 hours in the presence of 10 μg / ml tuberculosis antigen (2 × 10⁶ cells per well). 5 CD4 cells stained with CFSE + T cells (2×10 6 ) and DC:T cells were co-cultured at a DC:T cell ratio of 1:10. On day 3 or 4 of co-culture, each T cell batch was converted to PerCP-Cy5.5-conjugated anti-CD4 cells. + The cells were stained with monoclonal Ab and analyzed by fluid cell analysis. The supernatant was collected, and the levels of IFN-γ, IL-2, and IL-4 were analyzed by ELISA.
[0436] 8. Enzyme-linked immunosorbent assay (ELISA)
[0437] Cytokines generated after BMDMs or BMDCs were stimulated with antigens, as well as cytokines generated under various conditions, were detected in culture medium using sandwich enzyme-coupled immunosorbent assay (SMAD). TNF-α, IL-1β, IFN-γ, IL-2, IL-4, and IL-12p70 were detected. Cytokine analysis in culture medium was performed according to the manufacturer's recommendations (eBioscience and BD Biosciences). The levels of cytokines released into the culture medium were determined by measuring absorbance at a wavelength of 450 nm using a microplate reader. Cytokine concentrations were calculated using standard curves for recombinant cytokines, and the results are shown as pictograms per milliliter.
[0438] 9. Preparation of the BCG cell wall skeleton (BCG-CWS) and covalent bonding with proteins.
[0439] BCG-CWS was prepared by first killing cultured BCG strains by autoclaving, and then following the method of Baik et al. (PMID; 20937311). The final prepared CWS was suspended in 2-propanol (100%) and stored in a freezer. Covalent bonding with protein was performed according to the method of Baik et al. (PLOS One, 2019, PMID 30849108). The CWS was suspended in coupling buffer [20mM EDC and 50mM NHS / 100% 2-propanol; NHS (N-hydroxysulfosulfinimide), EDC (1-ethyl-3-(3-dimethlyaminopropyl)carbodiimide hydrochloride)], a certain amount of protein was added, and the mixture was reacted overnight in a refrigerator. Unbound proteins were removed by washing three times with suspension buffer (0.02% Twin 80 and 1% ethanol / PBS), and the final product was suspended in suspension buffer to measure protein concentration and used as a vaccine antigen.
[0440] 10. Mixture of protein and DDA / MPL
[0441] The mixture of protein, dimethyl dioctadecylammonium bromide (DDA), and monophosphoryl lipid A (MPL) was prepared according to the method of Andersen et al. (PMID; 10639447). 5 μg of protein, 250 μg of DDA, and 25 μg of MPL were mixed, and then 0.2% triethylamine was added to bring the final volume to 200 μl. The mixture was then heated in a 70°C water bath for 30 seconds, followed by sonication for 30 seconds. This process was repeated 2 to 3 times. The protein, DDA, and MPL mixtures were all prepared immediately before use.
[0442] 11. Vaccine experiments
[0443] In the preventive vaccine experiment, mice were first immunized subcutaneously three times with the immunotherapy vaccine composition to be tested, then challenged with Mtb (H37Ra or H37Rv) after 4 or 6 weeks, and the bacterial count was measured from the organs of the mice after a certain period.
[0444] For the therapeutic vaccine experiment, mice were first anesthetized with 1.2% 2,2,2-tribromoethanol (Aveltin), and after exposing the trachea through a small interstitial incision, Mtb in 50 μl of saline was inoculated intratracheally (IT). Three weeks after infection with "short-term" chemotherapy, isoniazid (INH, 0.1 g / L) and rifampin (RIF, 0.1 g / L) were administered, and free access to drinking water was provided for four weeks. The vaccine composition was administered three times at regular intervals after the start of treatment, and the bacterial count was measured from the lungs after a certain period of time. Bacterial count measurement in the lungs was performed by ingesting CO2 from the mice. 2 The animals were euthanized, their lungs were removed and homogenized, and the lung homogenized solution was plated onto Middlebrook 7H10 agar (Difco Laboratories, Detroit, MI) supplemented with 10% OADC (Difco Laboratories), amphotericin (Sigma-Aldrich, St. Louis), and 2 μg / ml 2-thiophene carboxylic acid hydrazide (Sigma-Aldrich). After incubation at 37°C for 4 weeks, the colonies were counted and measured. Data for CFU and evaluation of pneumonia were recorded in log 10 The measurement was performed using CFU ± interquartile range (IQR).
[0445] 12.Statistical analysis
[0446] All experiments were repeated at least three times. The significance level for inter-sample comparisons was determined using Tukey's multiple comparison test distribution with statistical software (GraphPad Prism Software, version 4.03; GraphPad Software, San Diego, CA). Graph data are presented as mean ± SEM, and differences from each value were considered statistically significant if * p < 0.05, ** p < 0.01, or *** p < 0.001.
[0447] <Example 1. Identification of active sites using domain-specific immunoassay of Mtb antigen>
[0448] To create a highly effective tuberculosis vaccine, it is advantageous to fuse multiple proteins with high immune activity. However, fusing multiple proteins increases the molecular weight, making purification difficult and prone to denaturation during the purification process. Even if a vaccine with a large molecular weight is highly effective, there are many difficulties in standardizing purification methods during the commercialization process. In fact, the challenges of recombinant protein production prolong vaccine development periods and increase the likelihood of failure. To achieve efficient vaccine production, it is necessary to develop vaccines with high efficacy but small molecular weights.
[0449] The inventors have previously reported that a protein fused with the dendritic cell-activating protein Rv2299c (molecular weight 72 kDa) and the T-cell-activating protein ESAT6 (molecular weight 10 kDa) is a tuberculosis vaccine exhibiting very high BCG booster efficacy (Ref, Oncotarget.PMID:28193909). However, since the Rv2299c-ESAT6 fusion protein basically has a large molecular weight of about 80 kDa, the inventors investigated the possibility of fusion by reducing the molecular weight while maintaining the same protective effect and adding a new immune-activating protein. Therefore, the inventors conducted research to identify highly immune-activating sites from the proteins they have developed to date and to develop a vaccine composed of these active sites.
[0450] 1.1. Identification of the active site of the Rv2299c protein using domain-specific immunoassay.
[0451] First, the dendritic cell-activating protein Rv2299c was divided into three sites as shown in Figure 1A to identify the active domain, and each recombinant protein was expressed in E. coli and purified. When C57BL / 6 mouse bone marrow-derived dendritic cells (BMDCs) were treated with each domain, as shown in Figure 1B, the D2 and D3 sites induced IL-1β and IL-12 production, but the D1 site did not produce IL-1β or IL-12. Furthermore, as shown in Figure 1C, BMDCs activated by each protein were co-cultured for 3 days with naive T cells isolated from the spleen of C57BL / 6 mice, and then added to bone marrow-derived macrophages (BMDMs) infected with Mycobacterium tuberculosis. After 3 or 5 days, the degree of Mycobacterium tuberculosis growth in the BMDMs was measured by CFU (colony forming unit), and is shown in Figure 1D. As shown in Figure 1D, T cells activated by BMDCs stimulated at the entire Rv2299c protein, D2, and D3 regions significantly suppressed intracellular bacterial growth, but the D1 region did not. Furthermore, as shown in Figure 1E, the production of IFN-γ and IL-17 at this time increased in proportion to the suppression of bacterial growth.
[0452] Based on the above results, the anti-tuberculosis activity of the Rv2299c protein at the D2 and D3 sites, which were confirmed to have excellent inhibitory activity against Mtb growth, was re-measured and is shown in Figure 2. As seen in Figure 2, T cells activated by BMDCs stimulated at the D3 site showed significantly higher inhibition of intracellular Mycobacterium tuberculosis growth than those stimulated at the D2 site, and in addition, it induced high IFN-γ production. On the other hand, the D2 site was observed to specifically and significantly increase IL-2 production.
[0453] Based on the above results, recombinant proteins were created by fusing the D2 and D3 sites of Rv2299c as shown in Figure 3A. Then, T cells activated by BMDCs stimulated with each protein were added to BMDMs infected with Mycobacterium tuberculosis and cultured for 3 days. As shown in Figure 3B, it was confirmed that the entire Rv2299c protein, the D3 site, and the D2+D3 site all exhibited high anti-tuberculosis activity. These results mean that the same vaccine efficacy can be induced even when using only the D2+D3 or D3 domains other than the D1 portion, instead of the entire Rv2299c protein.
[0454] The total protein of Rv2299c and the amino acid sequences of D1, D2, D3, D2+D3, and ESAT6 are shown in Table 2 below.
[0455] [Table 2]
[0456] 1.2. Identification of the immunoactive domain of the RpfE protein The dendritic cell-activating protein RpfE was divided into D1 and D2 regions as shown in Figure 4A, and recombinant proteins for each domain were produced and purified in E. coli as shown in Figure 4B. The cytokines produced by stimulating BMDCs with each produced domain were measured and are shown in Figure 4C. As a result, when IL-1β and IL-12 were stimulated with the D1 and D2 domains of the RpfE protein, they were similar, but IL-23 was expressed at a very low concentration when the D2 region was stimulated. Next, the anti-tuberculosis activity of T cells stimulated by BMDCs activated with each purified domain was measured and is shown in Figure 4D. As can be seen in Figure 4D, the whole RpfE protein and the D1 region of RpfE showed similar anti-tuberculosis activity. The concentrations of the cytokines IFN-γ, IL-2, and IL-17 produced at this time were measured and are shown in Figure 4E. As shown in Figure 4E, the RpfE, D1, and D2 domains all showed similar effects, but IL-17 production was significantly lower with the D2 domain. Furthermore, when mature BMDCs from each domain were co-cultured with T cells isolated from spleen cells isolated from mice infected with BCG or Mtb H37Ra strain, cytokine production was measured. As shown in Figure 5, there was no significant difference in IFN-γ production, but IL-2 and IL-17 production was significantly lower when treated with the D2 domain. These results suggest that sufficient vaccine efficacy can be induced even by using only the D1 site of RpfE.
[0457] The complete RpfE protein and the D1 and D2 amino acid sequences are shown in Table 3 below.
[0458] [Table 3]
[0459] 1.3. Identification of the immunoactive domain of the Rv2882c protein
[0460] The macrophageous cell-activating protein Rv2882c was also cloned into expression vectors by separating it into the D1 and D2 sites, as shown in Figure 6A, and recombinant protein was produced in E. coli. However, the D2 site was not expressed during this process (Figure 6A). When BMDMs infected with Mycobacterium tuberculosis were stimulated with the whole Rv2882c protein and the D1 site, there was no significant inhibitory effect on intracellular bacterial growth, as seen in Figure 6B. When mouse spleen cells were added, Mycobacterium tuberculosis growth in BMDMs stimulated with the whole Rv2882c protein was maximally suppressed, but when spleen cells were added after stimulation with the D1 site, there was no difference in Mycobacterium tuberculosis growth in BMDMs compared to when no treatment was performed. This suggests that the D2 domain of the Rv2882c protein is the site with anti-tuberculosis efficacy.
[0461] The complete Rv2882c protein and the D1 and D2 amino acid sequences are shown in Table 4 below.
[0462] [Table 4]
[0463] 1.4. Identification of the immunoactive domain of the Rv2145c protein The inventors have previously reported that the Rv2145c macrophageous cell-activating protein is a protein that induces IL-10 production and increases the proliferation of Mycobacterium tuberculosis, rather than having an anti-tuberculosis activity effect (Ref, Front Microbiol, PMID:34017340). Furthermore, measurements of the Rv2145c anti-tuberculosis activity region confirmed that the D2 portion from amino acids 91 to 260 at the C-terminus is the active domain. In the tuberculosis vaccine composition, pathogenicity-related domains were added in addition to the immune-active site, and the Rv2145c protein was selected to analyze vaccine efficacy.
[0464] The complete Rv2145c protein and the D1 and D2 amino acid sequences are shown in Table 5 below.
[0465] [Table 5]
[0466] 1.5. Identification of the immunoactive domain of the Rv2005c protein The Rv2005C protein is associated with inducing the reactivation of Mycobacterium tuberculosis and is a protein that activates BMDCs (Ref. Vaccine 2020, PMID:32664238). To identify the active site of Rv2005c, recombinant protein was produced by dividing it into three domains as shown in Figure 7A, but the D2 site was not expressed and therefore could not be produced. When BMDMs infected with Mycobacterium tuberculosis were stimulated with the whole Rv2005c protein, the D1 region, and the D3 region, or when mouse splenocytes were added to these, the inhibitory effect on intracellular bacterial growth was measured after 72 hours, and the D3 domain showed the highest anti-tuberculosis activity (Figure 7B).
[0467] The complete protein and D1 and D2 amino acid sequences of Rv2005C are shown in Table 6 below.
[0468] [Table 6]
[0469] 1.6. Identification of the immunoactive domain of the Rv3463 protein The macrophageous cell-activating protein Rv3463 was cloned into expression vectors, separating it into its D1 and D2 sites. Recombinant proteins were then produced in E. coli, but the D1 site was not expressed (Figure 8A). BMDMs infected with Mycobacterium tuberculosis were stimulated with both the whole Rv3463 protein and the D2 site, and intracellular Mycobacterium tuberculosis growth was measured 72 hours later. Both the whole Rv3463 protein and the D2 site suppressed intracellular bacterial growth identically (Figure 8B). In this case, bacterial growth was suppressed by protein treatment alone, without the addition of T cells. These results suggest that the D2 domain of Rv3463 alone has sufficient anti-tuberculosis activity.
[0470] The complete protein and D1 and D2 amino acid sequences of Rv3463 are shown in Table 7 below.
[0471] [Table 7]
[0472] Table 8 shows the amino acid sequences of the Mycobacterium tuberculosis-derived antigens used in this invention.
[0473] [Table 8]
[0474] <Example 2. In vitro immunoactivity of a fusion protein of the Rv2299c protein domain, ESAT6, and RpfE active domain>
[0475] Based on the results of Example 1 described above, the immunoactivity of each domain or fusion domain of Rv2299c and the fusion protein of ESAT6 was investigated.
[0476] As shown in Figure 9, in order to produce Rv2299cD2D3-ESAT6 and Rv2299cD3-ESAT6, which are created by fusing ESAT6 to D2 and D3 of Rv2299c excluding D1, and Rv2299cD2D3-ESAT6-RpfE1D1, which is created by fusing the D1 site, the active region of RpfE1, the respective genes were cloned into expression vectors, and the plasmids were transformed into E. coli to produce and purify recombinant proteins.
[0477] In the present invention, the Rv2299cD2D3-ESAT6 fusion protein refers to a polypeptide composed of an amino acid sequence formed by sequentially linking and fusing the amino acid sequences of SEQ ID NO: 5 and SEQ ID NO: 6, and specifically refers to a polypeptide in which the terminal end of Rv2299cD2D3 is linked to the other end of ESAT6. The Rv2299cD2D3-ESAT6 fusion protein was produced using the recombinant protein production method using pET-22b(+)_Rv2299cD2D3-ESAT6 described in Example 1.2.
[0478] In the present invention, a fusion protein containing two or more Mycobacterium tuberculosis-derived antigens or their immunoactive sites means a polypeptide composed of an amino acid sequence in which each amino acid sequence of the Mycobacterium tuberculosis-derived antigen or its immunoactive site is sequentially linked and fused.
[0479] Since the recombinant protein was purified using E. coli, we first confirmed that LPS, a component of E. coli cells, was not contaminated by the protein, as shown in Figure 10. As can be seen in Figure 10, even with treatment at 100 ng / ml of LPS, the concentrations of TNF-α and IL-1β were not significantly different from the control group. Treatment with Rv2299cD3-ESAT6(D3-E6), Rv2299cD2D3-ESAT6(D2D3-E6), and Rv2299cD2D3-ESAT6-RpfE1D1(D2D3-E6-RpfED1) increased the concentrations of TNF-α and IL-1β, confirming that there was no contamination by LPS.
[0480] Therefore, the anti-tuberculosis activity of three types of fusion proteins, Rv2299c-ESAT6, Rv2299cD2D3-ESAT6, and Rv2299cD3-ESAT6, was measured and the results are shown in Figure 11. First, T cells activated by BMDCs matured with each protein were added to BMDMs infected with Mycobacterium tuberculosis, and the number of Mycobacterium tuberculosis was measured after 72 hours of co-culture, and the results are shown in Figure 11A. As can be seen in Figure 11A, all three types of fusion proteins, Rv2299c-ESAT6, Rv2299cD2D3-ESAT6, and Rv2299cD3-ESAT6, showed similar anti-tuberculosis activity. In addition, the IL-2, IL-17, and IFN-γ produced at this time were measured and are shown in Figure 11B. As shown in Figure 11B, IL-2 and IL-17 were similarly increased by three different fusion proteins: Rv2299c-ESAT6, Rv2299cD2D3-ESAT6, and Rv2299cD3-ESAT6. In the case of IFN-γ, production was most significantly increased by Rv2299c-ESAT6. Rv2299cD2D3-ESAT6 and Rv2299cD3-ESAT6 were confirmed to effectively increase IFN-γ production, although to a lesser extent than Rv2299c-ESAT6.
[0481] Subsequently, the anti-tuberculosis activity of proteins in which the D1 active site of the RpfE protein, which is associated with inducing reactivation of Mycobacterium tuberculosis, was fused to Rv2299cD2D3-ESAT6 was measured. Dendritic cells were stimulated for 24 hours using three types of fusion proteins: Rv2299c-ESAT6, Rv2299cD2D3-ESAT6, and Rv2299cD2D3-ESAT6-RpfED1. IL-1β, TNF-α, IL-12, and IL-23 production in mouse dendritic cells (BMDCs) was measured using ELISA, as shown in Figure 12. As shown in Figure 12, all three fusion proteins significantly induced the production of IL-1β, TNF-α, and IL-12, and IL-23 production was highest in the Rv2299cD2D3-ESAT6-RpfED1 treatment group.
[0482] Furthermore, as shown in Figure 13A, the T cell activation response by BMDCs matured by each fusion protein was measured using ovalbumin (OVA) peptide-specific transgenic T cells. Figure 13B shows the results after treating dendritic cells with each fusion protein (Rv2299c-ESAT6, Rv2299D3-ESAT6, Rv2299cD2D3-ESAT6, and Rv2299cD2D3-ESAT6-RpfED1) and OVA peptide for 24 hours, and then co-culturing OVA peptide-specific T cells with dendritic cells activated after pre-treatment with CFSE (5,6-carboxyfluorescein diacetate succinimidyl ester) for 24 hours, followed by analysis using a fluorescence-activated cell sorting (FACS) analyzer. As shown in Figure 13B, mature BMDCs treated with each of the four fusion proteins—Rv2299c-ESAT6, Rv2299D3-ESAT6, Rv2299cD2D3-ESAT6, and Rv2299cD2D3-ESAT6-RpfED1—induced T cell proliferation and Th1 response. The cytokines produced during this process were also measured and are shown in Figure 13C. As shown in Figure 13C, all four proteins promoted the production of IFN-γ, IL-17, IL-2, and TNF-α, with Rv2299cD2D3-ESAT6-RpfED1 treatment showing a particularly significant increase in the production of IFN-γ, IL-17, and TNF-α.
[0483] To confirm the inhibitory effect of Rv2299c-ESAT6, Rv2299D3-ESAT6, Rv2299cD2D3-ESAT6, and Rv2299cD2D3-ESAT6-RpfED1 on intracellular bacterial growth, T cells activated by BMDCs matured with each of the four fusion proteins were added to BMDMs infected with Mycobacterium tuberculosis. As shown in Figure 14A, an inhibitory effect on Mycobacterium tuberculosis growth was confirmed for all four proteins, with Rv2299cD2D3-ESAT6 and Rv2299cD2D3-ESAT6-RpfED1 showing the most significant inhibitory effect on intracellular bacterial growth. In particular, with respect to the Rv2299cD2D3-ESAT6-RpfED1 protein, it was confirmed that Mycobacterium tuberculosis was almost completely removed from the infected BMDMs. The cytokine concentrations produced at this time were confirmed and are shown in Figure 14B. As shown in Figure 14B, IFN-γ, IL-17, and IL-2 cytokine production increased in all four fusion protein treatment groups. In particular, the Rv2299cD2D3-ESAT6-RpfED1 protein produced the highest levels of cytokines IFN-γ, IL-17, and IL-2, which was consistent with the results of Mycobacterium tuberculosis removal.
[0484] <Example 3. Evaluation of vaccine efficacy of Rv2299c protein domain, ESAT6, RpfE, and BCG cell wall skeleton (BCG-CWS) binding antigen>
[0485] The BCG cell wall skeleton (BCG-CWS) has been reported as a signaling molecule capable of inducing the Th1 response in experiments using OVA (Ref Vaccine, 2010, PMID:20937311). In a previous study, the inventors reported that when Ag85B, a Mycobacterium tuberculosis protein, was conjugated to BCG-CWS and administered to mice as a rabbit to challenge them with Mycobacterium tuberculosis, it showed a protective effect similar to BCG at 6 weeks, and sustained protective efficacy was maintained at 32 weeks (3.2 log Bacillus I was measured in the lungs and spleen), while BCG alone showed no protective effect at 32 weeks (Ref PLOS One, 2019, PMID 30849108). Therefore, the efficacy of a tuberculosis vaccine in which BCG-CWS was conjugated to the fusion protein confirmed in the above example was investigated.
[0486] 3.1. Vaccine efficacy of Rv2299c-ESAT6 and BCG-CWS binding antigen
[0487] A vaccine obtained by covalently bonding a vaccine in which the aforementioned immunologically active protein or active domain is fused to BCG-CWS was used to evaluate the efficacy of the tuberculosis vaccine. Rv2299c-ESAT6 (Ref, Oncotarget 2017, PMID: 28193909), which has been reported to have a BCG booster effect, was used. Figure 15A shows a schematic diagram of the preventive effect evaluation experiment of the aforementioned vaccine. C57BL / 6 mice were divided into seven groups as follows (G1: Mycobacterium tuberculosis infection control group, G2: Antigen control group BCG-CWS (10 μg), G3: Antigen control group BCG-CWS / DDA (dimethyldioctadecylammonium) (10 μg / 250 μg), G4: Rv2299c-ESAT6-BCG-CWS (7.5 μg / 10 μg), G5: Rv2299c-ESAT6-BCG-CWS / DDA (7.5 μg / 10 μg / 250 μg), G6: Immunopotentiator control group DDA / MPL (Monophosphoryl lipid A) (250 μg / 25 μg), G7: Rv2299c-ESAT6 / DDA / MPL (5 μg / 250 μg / 25 μg)). Groups G2 to G7 were immunized subcutaneously three times (8, 6, and 4 weeks before) before Mycobacterium tuberculosis inoculation. Four weeks after the last immunization, 1×10 6 CFU of the non-pathogenic Mycobacterium tuberculosis strain H37Ra strain (M. tuberculosis H37Ra) was inoculated into the airways of all groups. The mice were sacrificed 6 and 18 weeks after Mycobacterium tuberculosis inoculation, and the number of bacteria in the lungs was measured and shown in Figure 15B. As seen in Figure 15B, when DDA was mixed with BCG-CWS, the protective effect appeared 18 weeks later rather than 6 weeks later. In addition, Rv2299c-ESAT6 antigen (G5) mixed with DDA / MPL, which is often used when immunizing animals with a subunit vaccine, a protein antigen, had no vaccine efficacy. The most interesting fact is that Rv2299c-ESAT6-CWS (G4) showed the highest vaccine efficacy 6 weeks later compared to other conditions and induced a reaction in which the bacteria were completely removed from the lungs 18 weeks later. This demonstrated that in the field of tuberculosis vaccines, when BCG-CWS is used by covalently bonding it to an antigen, it shows a better protective effect than when using DDA / MPL, an immunopotentiator whose efficacy has been proven.
[0488] 3.2. Vaccine efficacy of segmented domains of Rv2299c and RpfE, ESAT6 fusion protein, and BCG-CWS binding antigen.
[0489] Based on the results shown in Figure 15, the vaccine efficacy of a conjugated antigen, in which BCG-CWS was covalently bound to the segmental domains of Rv2299c and RpfE, and the ESAT6 fusion protein, was confirmed in a state of infection with the pathogenic strain H37Rv, as shown in Figure 16A. C57BL / 6 mice were divided into six groups as follows: G1: Tuberculosis infection control group (Infection control), G2: Antigen control group (BCG 1×10⁶). 5 The subjects were divided into groups (CFU), G3: antigen control group BCG-CWS (10 μg / μg), G4: Rv2299c-ESAT6-BCG-CWS (5 μg / 10 μg), G5: Rv2299cD2D3-ESAT6-BCG-CWS (5 μg / 10 μg), and G6: Rv2299cD2D3-ESAT6-RpfED1-BCG-CWS (5 μg / 10 μg). The G2-G6 groups were subjected to subcutaneous rabbit play three times (10, 8, and 6 weeks prior) before inoculation with Mycobacterium tuberculosis. Six weeks after the final immunization, 1 × 10⁶ of the pathogenic Mycobacterium tuberculosis strain H37Rv (M. tuberculosis H37Rv) was administered. 3CFU was inoculated into the airways of all groups. Mice were sacrificed 6 and 28 weeks after inoculation with Mycobacterium tuberculosis, and bacterial counts were measured from the lungs, as shown in Figure 16B. As can be seen in Figure 16B, at 6 weeks after inoculation with Mycobacterium tuberculosis, Rv2299c-ESAT6-CWS(G4), Rv2299cD2D3-ESAT6-CWS(G5), and Rv2299cD2D3-ESAT6-RpfED1-CWS(G6) all significantly suppressed bacterial growth in the lungs. In particular, Rv2299cD2D3-ESAT6-RpfED1-CWS showed the most significant suppression of growth, with no bacterial growth at all in 5 out of 6 mice. After 28 weeks, neither the mice immunized with Rv2299cD2D3-ESAT6-CWS(G5) nor the mice immunized with Rv2299cD2D3-ESAT6-RpfED1-CWS(G6) showed bacterial growth in their lungs. Furthermore, gross pathology of the lungs revealed a significantly lower number of granulomas in the groups vaccinated with these vaccines (Figure 16C). Removing the D1 portion of Rv2299c from Rv2299c-ESAT6 actually increased the protective effect. Live BCG (G2) showed some effect at 6 weeks, but no protective effect at 28 weeks. Generally, the protective effect of BCG is reported to decrease sharply after 10 weeks of immunization. In contrast, the Rv2299c-ESAT6-CWS(G5), Rv2299cD2D3-ESAT6-CWS(G5), and Rv2299cD2D3-ESAT6-RpfED1-CWS(G6) of the present invention induced a nearly perfect bacterial removal response. This represents a significantly superior vaccine efficacy compared to subunit vaccines or live bacterial vaccines reported to date.
[0490] Six weeks after inoculation with Mycobacterium tuberculosis, each mouse was sacrificed, and lung and spleen cells were isolated. These cells were stimulated with purified protein derivatives (PPDs), ESAT6, Rv2299c-ESAT6, Rv2299cD2D3-ESAT6, and Rv2299cD2D3-ESAT6-RpfED1 antigens, and cytokines in the cell culture medium were measured, as shown in Figures 17 and 18. As seen in Figures 17 and 18, in the groups vaccinated with the three vaccines that demonstrated superior efficacy in eliminating Mycobacterium tuberculosis from the lungs, cytokines including IFN-γ were not produced in the antigen-stimulated lung cells. However, in spleen cells, IFN-γ, IL-2, and IL-17 increased more in the antigen-vaccinated group. In particular, in the group immunized with Rv2299cD2D3-ESAT6-RpfED1-CWS (G6), which showed the best protective effect, no cytokines other than IFN-γ were produced in the spleen cells. It is thought that, as with the mice in groups 5 (G5) and 6 (G6), the immune response returned to normal in the lungs after the bacteria were removed, resulting in a significant reduction in the immune response.
[0491] To date, no vaccine containing protein-based subunit vaccines / immune enhancers has demonstrated vaccine efficacy comparable to BCG on its own; therefore, protein-based subunit vaccines have been developed for use as BCG-prime booster vaccines. However, summarizing the results in Figures 16-19, the antigen conjugated with the fusion protein according to the present invention surprisingly completely eliminated the bacteria after three doses of the vaccine, inducing an immune response significantly superior to that of BCG. Therefore, the fusion protein vaccine composition of the present invention, which induces an immune response that completely eliminates the bacteria, is expected to be able to replace BCG and to be highly effective as both a BCG booster and a therapeutic vaccine.
[0492] <Example 4. Evaluation of therapeutic vaccine efficacy of Rv2299c protein domain, ESAT6, RpfE, and BCG cell wall skeleton (BCG-CWS) binding antigen>
[0493] Therapeutic vaccines are being developed to improve tuberculosis treatment outcomes, with objectives such as (1) suppressing recurrence after completion of combination therapy, (2) increasing the protective effect against tuberculosis in cured patients, (3) reducing the duration of post-infection treatment or the number of drugs used in treatment, and (4) suppressing the reactivation of latent tuberculosis. Therefore, the therapeutic efficacy of the fusion protein antigen according to the present invention was evaluated.
[0494] 4.1. Evaluation of the therapeutic vaccine potential of the Rv2299c-ESAT6 fusion protein.
[0495] To select a therapeutic vaccine composed of a highly active fusion protein, the inventors constructed an experiment as shown in Figure 19A to measure the therapeutic vaccine efficacy of the Rv2299c-ESAT6 fusion protein, a vaccine candidate fusion protein that had already been developed, using a latent infection model. First, C57BL / 6 mice were infected with Mycobacterium tuberculosis into their tracheas and treated with isoniazid and rifampin for 4 weeks starting 3 weeks after the maximum bacterial growth in the lungs (chemotherapy, C), and then discontinued. Initially, no bacteria were detected in the lungs after discontinuation of treatment, but the bacteria began to grow again over time. At this time, a vaccine candidate substance, which was a mixture of the fusion protein and the immunostimulant DDA / MPL (Adjuvant), was subcutaneously administered at 4 weeks, 7 weeks, and 10 weeks after treatment (1 week after the initial administration), and the effect of suppressing bacterial regrowth was confirmed and shown in Figure 19B. As shown in Figure 19B, in the control group of mice administered only the immunostimulant (DDA / MPL), no bacteria were detected in the lungs at 7 weeks of infection, when treatment was discontinued. However, at 16 weeks of infection, the bacterial count was the same as that of infected control mice that were only infected without treatment. However, in the group immunized with Rv2299c-ESAT6 / DDA / MPL, no bacteria were detected in the lungs at 7 weeks of infection, and at 16 weeks of infection, the bacterial count in the lungs was significantly lower than that of the control group.
[0496] 4.2. Vaccine efficacy evaluation of the Rv2299c-ESAT6-Rv3463 fusion protein
[0497] Based on the results in Figure 19B, the vaccine efficacy of the Rv2299c-Rv3463 and Rv2299c-Rv3463-ESAT6 fusion proteins was analyzed. While conducting the experiment using the same method as in Figure 19A, bacterial counts were measured from the lungs at 12 and 20 weeks after infection, as shown in Figure 20A, and are shown in Figure 20B. As seen in Figure 20B, at 20 weeks after infection, bacterial regrowth was better suppressed in mice immunized with Rv2299c-Rv3463-ESAT6 than with Rv2299c-Rv3463. Subsequently, the vaccine composition order was changed to prepare fusion proteins with Rv2299c-ESAT6 and Rv2299c-ESAT6-Rv3463, and the experiment was conducted using the same method as above. The results are shown in Figure 20C. As shown in Figure 20C, at 12 weeks post-infection, bacterial regrowth was completely suppressed in mice immunized with Rv2299c-ESAT6-Rv3463. However, at 20 weeks, the difference between the two vaccine groups, Rv2299c-ESAT6 and Rv2299c-ESAT6-Rv3463, disappeared. Nevertheless, both vaccine groups were found to significantly suppress bacterial regrowth compared to the control group. In summary, the fusion proteins Rv2299c-ESAT6, Rv2299c-ESAT6-Rv3463, and Rv2299c-Rv3463-ESAT6 showed superior therapeutic vaccine efficacy. In particular, when evaluated using 12 weeks post-infection as the baseline, the Rv2299c-ESAT6-Rv3463 fusion protein showed the most superior therapeutic vaccine efficacy.
[0498] 4.3. Evaluation of vaccine efficacy of proteins in which multiple active proteins or domains are fused to the D2D3 region of Rv2299c.
[0499] The Rv2299cD2D3-ESAT6 fusion protein, obtained by removing the D1 portion of Rv2299c from the existing vaccine with superior efficacy, has a reduced molecular weight, allowing for the fusion of multiple active domains. Therefore, a multiple fusion protein was constructed based on the Rv2299cD2D3-ESAT6 fusion protein as shown in Figure 21A, cloned, and produced as a recombinant protein in E. coli. As shown in Figure 21B, C57BL / 6 mice infected with Mycobacterium tuberculosis were treated and fed, and the bacterial count was measured from the lungs 20 weeks after infection, as shown in Figure 21C. As shown in Figure 20, the Rv2299c-ESAT6-Rv3463 fusion protein showed excellent therapeutic vaccine efficacy. Therefore, we used mice immunized with Rv2299cD2D3-ESAT6-Rv3463, which is obtained by removing the D1 site of Rv2299c from this fusion protein, as a baseline to select vaccine candidates with superior efficacy. As a result, as shown in Figure 21C, Rv2299cD2D3-ESAT6-Rv3463D2-Rv2882cD2-RpfED1-Rv2145cD2(G7), Rv2299cD2D3-ESAT6-Rv3463D2-Rv2005cD3(G8), and Rv2299cD2D3-ESAT6-Rv3463D2-Rv2005cD3-RpfED1(G9) showed excellent vaccine efficacy.
[0500] Furthermore, additional recombinant proteins were constructed using Rv2299cD2D3-ESAT6 as the backbone, as shown in Figure 22A, and vaccine efficacy was evaluated using the same method as described above, as shown in Figure 22B. The results are shown in Figure 22C. As shown in Figure 22C, multiple fusion proteins formed a 0.5 log 10 It was observed that bacterial growth was suppressed to a certain extent, and interestingly, Rv2299cD2D3-ESAT6, the most basic backbone fusion protein, showed the best vaccine efficacy and significantly suppressed bacterial regrowth compared to proteins with additional active sites fused to the backbone fusion protein.
[0501] 4.4. Evaluation of vaccine efficacy of proteins fused with multiple active proteins or domains.
[0502] Various proteins were constructed and produced as shown in Figure 23A, and their therapeutic vaccine efficacy was analyzed using the method shown in Figure 23B, as shown in Figure 23C. In this process, fusion proteins exhibiting superior efficacy compared to Rv2299cD2D3-ESAT6-Rv3463(G11) were searched for. Rv2882c-Rv2005c-Rv3463, Rv2882c-Rv2005cD3-ESAT6-Rv3463, Rv2220-Rv2882cD2-Rv2005cD3-ESAT6-Rv34 63D2, Rv0869c-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2, Rv1605-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2, R The vaccine efficacy of fusion proteins composed of v2220-ESAT6-Rv3463, Rv0869c-ESAT6-Rv2005cD3-Rv3463, and Rv1605-ESAT6-Rv2005cD3-Rv3463 was evaluated, and as shown in Figure 23C, Rv0869c-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2(G6) showed the best vaccine efficacy.
Claims
1. It contains a fusion protein of the immunoactive site of Rv2299c and ESAT6. The aforementioned fusion protein is a fusion protein of the immunoactive site of Rv2299c, which is composed of one amino acid sequence selected from the group consisting of SEQ ID NOs: 3 to 5, and ESAT6, which is composed of the amino acid sequence of SEQ ID NO:
6. A composition for tuberculosis vaccine characterized by the following features.
2. The BCG cell wall skeleton (BCG-CWS) is bound to the terminal end of the aforementioned fusion protein. The tuberculosis vaccine composition according to claim 1.
3. It is a vaccine for the prevention of tuberculosis or a vaccine for the treatment of tuberculosis. The tuberculosis vaccine composition according to claim 1 or 2.
4. The terminus of the fusion protein further contains one or more Mycobacterium tuberculosis-derived antigens or their immunoactive sites selected from the group consisting of RpfE, Rv3463, Rv2005c, Rv2882c, Rv2145c, Rv1605, Rv2220, and Rv0869c The tuberculosis vaccine composition according to claim 1.
5. At the end of the aforementioned fusion protein, RpfED1, composed of the amino acid sequence of SEQ ID NO: 8, Rv3463, composed of the amino acid sequence of SEQ ID NO: 19, Rv2005cD3-Rv3463, composed of an amino acid sequence formed by sequentially linking and fusing the amino acid sequences of SEQ ID NO: 18 and SEQ ID NO: 19, Rv2882cD2-Rv2005cD3-Rv3463D2, composed of an amino acid sequence formed by sequentially linking and fusing the amino acid sequences of SEQ ID NO: 12, SEQ ID NO: 18 and SEQ ID NO: 21, Rv2005cD3-Rv1605-Rv3463D2, composed of an amino acid sequence formed by sequentially linking and fusing the amino acid sequences of SEQ ID NO: 18, SEQ ID NO: 22 and SEQ ID NO: 21, Rv3463D2-Rv2882cD2, and the amino acid sequences of SEQ ID NO: 21, SEQ ID NO: 12 and SEQ ID NO: 15 are sequentially linked and fusing Rv3463D2-Rv2882cD2-Rv2145cD2, composed of amino acid sequences, Rv3463D2-Rv2882cD2-RpfED1, composed of amino acid sequences formed by sequentially linking and fusing the amino acid sequences of SEQ ID NOs. 21, SEQ ID NOs. 12, and SEQ ID NOs. 8, and Rv3463D2-Rv2882cD2-Rp It further comprises one Mycobacterium tuberculosis-derived antigen or its immunoactive site selected from the group consisting of Rv3463D2-Rv2005cD3, which is composed of an amino acid sequence formed by sequentially linking and fusing the amino acid sequences of fED1-Rv2145cD2, SEQ ID NO: 21, and SEQ ID NO: 18, and Rv3463D2-Rv2005cD3-RpfED1, which is composed of an amino acid sequence formed by sequentially linking and fusing the amino acid sequences of SEQ ID NO: 21, SEQ ID NO: 18, and SEQ ID NO:
8. The tuberculosis vaccine composition according to claim 1.
6. The BCG cell wall skeleton (BCG-CWS) is bound to the terminal end of the aforementioned fusion protein. The tuberculosis vaccine composition according to claim 4.
7. The BCG cell wall skeleton (BCG-CWS) is bound to the terminal end of the aforementioned fusion protein. The tuberculosis vaccine composition according to claim 5.
8. It is a vaccine for the prevention of tuberculosis or a vaccine for the treatment of tuberculosis. The tuberculosis vaccine composition according to claim 6 or 7.