A type II collagen production promoter in chondrocytes

Glycylproline and Bacopa monnieri synergistically enhance type II collagen production in chondrocytes, addressing the need for a safe and effective promoter to prevent and improve joint pain and osteoarthritis.

JP7894184B1Active Publication Date: 2026-07-23NIPPON MENARD COSMETIC CO
View PDF 13 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
NIPPON MENARD COSMETIC CO
Filing Date
2025-11-28
Publication Date
2026-07-23

AI Technical Summary

Technical Problem

Existing technologies lack a safe and effective means to promote type II collagen production in chondrocytes, which is crucial for preventing joint pain and osteoarthritis, with glycylproline and Bacopa monnieri's combination effects being unknown.

Method used

A combination of glycylproline and Bacopa monnieri is used to enhance type II collagen production in chondrocytes, utilizing glycylproline's dipeptide structure and Bacopa monnieri's traditional medicinal properties.

Benefits of technology

The combination significantly promotes type II collagen production, effectively reducing joint pain and osteoarthritis symptoms by enhancing chondrocyte differentiation and gene expression.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007894184000001
    Figure 0007894184000001
  • Figure 0007894184000002
    Figure 0007894184000002
  • Figure 0007894184000003
    Figure 0007894184000003
Patent Text Reader

Abstract

The objective of the present invention is to provide an effective and safe type II collagen production promoter in chondrocytes that can be taken on a daily basis. [Solution] The present invention provides a type II collagen production promoter in chondrocytes characterized by containing glycylproline, and another type II collagen production promoter in chondrocytes characterized by containing glycylproline and Bacopa monnieri. Because the type II collagen production promoter in chondrocytes of the present invention exhibits excellent type II collagen production promoting effects, it can be used as a food, quasi-drug, or pharmaceutical product that exerts preventive / ameliorative effects against various symptoms and diseases related to a decrease in type II collagen in the body.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to an agent for promoting the production of type II collagen in chondrocytes, which is characterized by containing glycylproline, and an agent for promoting the production of type II collagen in chondrocytes, which is characterized by containing glycylproline and Bacopa monnieri.

Background Art

[0002] Chondrocytes are cells that form cartilage tissue. Chondrocytes produce extracellular matrices such as collagen fibers (especially type II collagen) and proteoglycans. The extracellular matrix creates the elasticity and strength of cartilage and serves as a cushion that absorbs smooth movement and impacts of joints.

[0003] Chondrocytes are formed by the differentiation of mesenchymal cells. The differentiation process is strictly controlled by various molecules such as SRY-BOX transcription factor 9 (SOX9), bone morphogenetic protein (BMP), and transforming growth factor-β (TGF-β) signal. In this differentiation, when the TGF-β signal is transmitted into the cell, a transmission pathway via a factor called Sma·Mad related protein (Smad) is activated. Specifically, phosphorylation of a dimer of Smad2 and Smad3 (hereinafter referred to as Smad2 / 3) occurs, and further a complex with Smad4 is formed. This Smad complex translocates into the nucleus and binds to the promoter region of the type II collagen (COL2A1) gene, thereby promoting the transcription of the type II collagen gene.

[0004] Thus, along with the differentiation of chondrocytes, the gene expression of type II collagen and the production of type II collagen protein are promoted. In articular cartilage, type II collagen is a major component and plays an important role in the smooth movement of joints. Type II collagen in cartilage forms a network structure and maintains cushioning properties and reduces the burden on joints by retaining water and proteoglycans. When the type II collagen in cartilage decreases, it causes wear and degeneration of articular cartilage and leads to joint pain and osteoarthritis.

[0005] Therefore, if it is possible to promote the differentiation of chondrocytes and the production of type II collagen, it is thought to be useful in preventing / improving joint pain and osteoarthritis. To date, hyaluronic acid or its salt (Patent Document 1) has been disclosed as a food material that promotes chondrocyte differentiation, and extracts of Cimicifuga simplex (Patent Document 2) and lotus germ extract (Patent Document 3) have been disclosed as food materials that promote type II collagen production. Given this situation, there is a need for the development of a type II collagen production promoter in chondrocytes that is highly safe, can be taken for a long period of time, and is even more effective.

[0006] Here, glycylproline is a dipeptide in which glycine and proline are linked by an amide bond, and its molecular formula is C7H12N2O3. Glycylproline can be obtained by hydrolyzing collagen peptides with enzymes, etc. In recent years, research on glycylproline has progressed, and it has been found to promote the production of specific types of collagen (Patent Documents 4-6). Patent Document 4 discloses the effect of glycylproline on promoting the expression of type 12 collagen in human dermal fibroblasts, with the aim of preventing skin aging. Patent Document 5 discloses the effect of glycylproline on promoting the gene expression of type 3 collagen in human dermal fibroblasts. Patent Document 6 discloses the effect of glycylproline on promoting the gene expression of type 17 collagen in human epidermal keratinocytes. Furthermore, Patent Document 7 discloses the effect of glycylproline on promoting galectin 9 production in human dermal fibroblasts. However, the effect of glycylproline on promoting the production of type 2 collagen in chondrocytes has not been reported.

[0007] Bacopa monnieri, also known as Otomeazena, is a perennial aquatic plant distributed in tropical and subtropical regions. In Ayurveda, the traditional Indian system of medicine, it has been used to improve various symptoms, including anxiety. Conventional technologies related to Bacopa monnieri include its anticonvulsant, antidepressant / anxiety, and antibacterial effects (Non-Patent Document 1). Furthermore, Patent Document 8 discloses a beverage containing glycylproline-containing collagen peptide, Bacopa monnieri, and N-acetylglucosamine. However, the effect of the combination of glycylproline and Bacopa monnieri on promoting type II collagen production in chondrocytes is completely unknown. [Prior art documents] [Patent Documents]

[0008] [Patent Document 1] Japanese Patent Application Publication No. 11-60609 [Patent Document 2] Patent No. 5566752 [Patent Document 3] Patent No. 5992691 [Patent Document 4] Patent No. 5611570 [Patent Document 5] Patent No. 6606378 [Patent Document 6] Patent Application No. 2024-144388 [Patent Document 7] Patent No. 7224583 [Patent Document 8] Patent No. 7389529 [Non-patent literature]

[0009] [Non-Patent Document 1] Brain Sci. Vol.10(12) 964(2020) [Overview of the project] [Problems that the invention aims to solve]

[0010] The present invention relates to a type II collagen production promoter in chondrocytes characterized by containing glycylproline, and a type II collagen production promoter in chondrocytes characterized by containing glycylproline and Bacopa monnieri. [Means for solving the problem]

[0011] The inventors, through diligent research, have discovered that glycylproline has an excellent effect in promoting type II collagen production in chondrocytes. Furthermore, they have found that combining glycylproline with Bacopa monnieri significantly enhances the effect of promoting type II collagen production in chondrocytes.

[0012] The glycylproline used in this invention is a dipeptide in which glycine and proline are linked by an amide bond, and its molecular formula is C7H12N2O3. Glycylproline can be obtained by chemical synthesis or by hydrolysis of proteins such as collagen with acids, alkalis, or enzymes. Alternatively, commercially available reagents can also be used.

[0013] The glycylproline used in this invention may be used as is or in salt form. Examples of salts that are formulation-acceptable include acid addition salts and base addition salts. Specifically, examples of acid addition salts include inorganic salts such as hydrochloric acid, sulfuric acid, and phosphoric acid, and organic salts such as acetic acid, propionic acid, succinic acid, malic acid, tartaric acid, and citric acid. Examples of base addition salts include metal salts such as sodium salts, potassium salts, and calcium salts, and amine salts such as ammonium and ethanolamine.

[0014] The glycylproline used in the present invention can be purified as needed by using well-known purification methods, such as gel filtration or reverse-phase chromatography, either alone or in combination.

[0015] The dosage of glycylproline used in this invention can be appropriately adjusted depending on the form of administration, purpose of use, age, body weight, etc., and is preferably 0.1 to 5,000 mg per day, with the range of 1 to 500 mg being most preferred. In some cases, a smaller amount than the above dosage range may be sufficient, and in other cases, it may be necessary to take an amount exceeding this range. Furthermore, regarding the method of adding the pharmacoactive ingredient in formulation, it may be added in advance or added during manufacturing, and the appropriate method should be chosen considering workability.

[0016] The Bacopa monnieri used in this invention can be Bacopa monnieri, a member of the Plantaginaceae family. Bacopa monnieri, also known as Otomeazena, is a perennial aquatic plant distributed in tropical and subtropical regions. In Ayurveda, the traditional Indian system of medicine, it has been used to improve various symptoms, including anxiety. While there are no particular limitations on the part of the Bacopa monnieri used in this invention, it is preferable to use the whole plant, especially the leaves.

[0017] The Bacopa monnieri used in this invention can be used as is, or, if necessary, processed by juicing, drying, grinding, or shredding can be used. Examples of solvents for extraction include water, lower alcohols (methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.), liquid polyhydric alcohols (1,3-butylene glycol, propylene glycol, glycerin, etc.), ketones (acetone, methyl ethyl ketone, etc.), acetonitrile, esters (ethyl acetate, butyl acetate, etc.), hydrocarbons (hexane, heptane, petroleum ether, etc.), and ethers (ethyl ether, tetrahydrofuran, propyl ether, etc.). These solvents may be used individually or in mixtures of two or more. Extraction of Bacopa monnieri used in this invention is preferably done with polar solvents such as water and lower alcohols, and ethanol extraction is particularly preferred.

[0018] The above extract may be used as the extracted liquid as it is, or may be used after being subjected to treatments such as concentration, dilution, filtration, decolorization with activated carbon or the like, deodorization, ethanol precipitation, fermentation, etc. as necessary. Furthermore, the extracted solution may be subjected to treatments such as concentration to dryness, spray drying, freeze drying, etc., and used as a dried product.

[0019] The dosage of Bacopa monnieri used in the present invention can be appropriately adjusted according to the dosage form, purpose of use, age, body weight, etc., and can be orally administered once to several times a day in the range of 0.05 to 2,000 mg, preferably 0.5 to 100 mg per day as the Bacopa monnieri extract. There may be cases where a sufficient amount can be obtained with an amount less than the above dosage range, and there may also be cases where it is necessary to ingest beyond the range. Also, regarding the method of adding the active ingredient in formulation, it may be added in advance or during the manufacturing process, and it may be appropriately selected considering workability.

[0020] The promoter for promoting the production of type II collagen in chondrocytes of the present invention can be used as a food, quasi-drug, or pharmaceutical. As a food, it can be used as tablets, soft capsules, hard capsules, granules, tablets, gummies, beverages, jelly, etc. Also, in quasi-drugs and pharmaceuticals, it can be used as oral capsules, powders, granules, tablets, sugar-coated tablets, syrups, pills, suspensions, solutions, emulsions, etc., and parenteral injections, etc. In order to achieve the object of the present invention, ingestion by oral administration is more preferable.

[0021] The promoter for promoting the production of type II collagen in chondrocytes of the present invention can also contain components such as excipients, stabilizers, lubricants, preservatives, binders, disintegrants, hydrocarbons, fatty acids, alcohols, esters, pH adjusters, antiseptics, fragrances, etc. that are usually used in foods, quasi-drugs, or pharmaceuticals within a range that does not impair the effect, as necessary. Furthermore, it can also contain components such as plant materials, polyphenols, vitamins, saccharides, proteins, peptides, amino acids, oils and fats, etc.

Effects of the Invention

[0022] The present invention provides a type II collagen production promoter for chondrocytes characterized by containing glycylproline, and another type II collagen production promoter for chondrocytes characterized by containing glycylproline and Bacopa monnieri, both of which exhibit excellent type II collagen production-promoting effects. The present invention's type II collagen production promoter for chondrocytes is considered useful for preventing and improving various symptoms associated with a decrease in type II collagen in the body, such as joint pain and osteoarthritis. [Modes for carrying out the invention]

[0023] The following examples are illustrative and not limited to these examples. The percentages of content shown in the examples are by weight. [Examples]

[0024] Manufacturing Example 1: Bacopa monnieri hot water extract 100g of Bacopa monnieri was mixed with 2kg of purified water and heated for extraction. The extract was then concentrated and dried to obtain 9.5g of solids.

[0025] Manufacturing Example 2: Bacopa monnieri 50% Ethanol Extract 100g of Bacopa monnieri was added to 2kg of 50% ethanol and extracted at room temperature for 7 days. The extract was then concentrated and dried to obtain 5.6g of solid matter.

[0026] Manufacturing Example 3: Bacopa monnieri ethanol extract 100 g of Bacopa monnieri was mixed with 2 kg of ethanol and extracted at room temperature for 7 days. The extract was then concentrated and dried to obtain 3.5 g of solid matter.

[0027] Next, we will give examples of formulations using glycylproline and bacopa monnieri, but the present invention is not limited thereto. [Examples]

[0028] Prescription Example 1: Beverages <Prescription> Component Content (%) 1. Glycylproline 0.2 2. Maltitol 5.0 3. Malic acid 1.0 4.Fragrance 0.5 5.Purified water 93.3 <Manufacturing method> Dissolve components 1-4 in a portion of component 5 by stirring. Then, add the remaining component 5 and mix, heat to 90°C, and fill into 50mL glass bottles. <Usage> Take one bottle (50mL) per day.

[0029] Prescription Example 2: Beverages <Prescription> Component Content (%) 1. Glycylproline 0.2 2. Bacopa monnieri ethanol extract (Production Example 3) 0.1 3. Maltitol 5.0 4. Malic acid 1.0 5.Fragrance 0.5 6.Purified water 93.2 <Manufacturing method> Dissolve components 1-5 in a portion of component 6 by stirring. Then, add the remaining component 6 and mix, heat to 90°C, and fill into 50mL glass bottles. <Usage> Take one bottle (50mL) per day.

[0030] Prescription example 3: Tablets <Prescription> Component Content (%) 1. Glycylproline 1.0 2. Maltitol 91.0 3. Cellulose 5.0 4. Sucrose fatty acid ester 3.0 <Manufacturing method> Components 1-3 were mixed, 10% water was added as a binder, and the mixture was granulated in a fluid bed. Component 4 was added to the formed granules and mixed, and then compressed into tablets to obtain 300 mg tablets. <Usage> Take 3 tablets per day.

[0031] Prescription Example 4: Hard Capsules <Prescription> Component Content (%) 1. Glycylproline 6.0 2. Bacopa monnieri hot water extract (Production Example 1) 6.0 3. Sucrose fatty acid ester 3.0 4. Cornstarch 85.0 <Manufacturing method> Components 1-4 were mixed and filled into No. 2 hard capsules with 250 mg each to obtain hard capsules. <Usage> Take 4 tablets per day.

[0032] Comparative Example 1: Conventional Beverage In the beverage of Prescription Example 1, the one in which glycylproline was replaced with water was considered the conventional beverage.

[0033] Comparative Example 2: Beverage containing Bacopa monnieri In the beverage of Prescription Example 2, glycylproline was replaced with water to create a beverage containing Bacopa monnieri. [Examples]

[0034] Test Example 1: Promoting type II collagen production by glycylproline Human bone marrow-derived mesenchymal stem cells (UE7T) were cultured in DMEM containing 10% fetal bovine serum. Next, in a culture medium for chondrogenic differentiation, glycylproline (final concentrations 0.3, 1, 3 mM), Bacopa monnieri hot water extract, Bacopa monnieri 50% ethanol extract, and Bacopa monnieri ethanol extract (final concentrations 10 μg / mL each) were added and the cells were cultured for 7 days. Cells were then harvested and gene expression analysis was performed. Insulin-like growth factor 1 (IGF-1), which has been reported to promote chondrogenesis, was used as a comparative sample. Gene expression for COL2A1 and SOX9 was evaluated by real-time PCR. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the internal standard. Gene expression in the unadded cells was set to 1, and the gene expression ratio was calculated.

[0035] Primer set for COL2A1 CACTCAAGTCCCTCAACAACC (Sequence 1) AATCCAGTAGTCTCCACTCTTCC (Sequence 2) Primer set for SOX9 GGTGCTGCTGGGAAACATT (array 3) TGCAGTGAACAAGCAAAGG (array 4) Primer set for GAPDH TGCACCACCAACTGCTTAGC (Sequence 5) TCTTCTGGGTGGCAGTGATG (sequence 6)

[0036] The results of Test Example 1 are shown in Table 1. Glycylproline promoted COL2A1 and SOX9 gene expression in a concentration-dependent manner, thus demonstrating the type II collagen production-promoting effect of glycylproline. Furthermore, compared to the addition of glycylproline or Bacopa monnieri alone, the simultaneous addition of glycylproline and Bacopa monnieri significantly increased COL2A1 and SOX9 gene expression. Therefore, it was revealed that the combination of glycylproline and Bacopa monnieri has an even superior type II collagen production-promoting effect.

[0037] [Table 1]

[0038] Test Example 2: TGF-β signaling effect of glycylproline Human bone marrow-derived mesenchymal stem cells (UE7T) were cultured in DMEM containing 10% fetal bovine serum. Next, they were cultured for 7 days in a chondrocyte differentiation induction medium with the addition of glycylproline (final concentrations 0.3, 1, and 3 mM), Bacopa monnieri hot water extract, Bacopa monnieri 50% ethanol extract, and Bacopa monnieri ethanol extract (final concentrations 10 μg / mL each). TGF-β signaling, which plays a crucial role in chondrocyte differentiation and type II collagen production, can be evaluated by examining the nuclear translocation of the Smad complex (a complex of Smad2 / 3 and Smad4). Therefore, in this experiment, immunofluorescence staining of phosphorylated Smad2 / 3 was performed, and its nuclear translocation was used as an indicator. Using the image processing software ImageJ, the fluorescence intensity of phosphorylated Smad2 / 3 in the nucleus and cytoplasm per cell was measured for each field of view of each sample. The degree of nuclear translocation of phosphorylated Smad2 / 3 was quantified by calculating the ratio of these two fluorescence intensities. The calculated value without the sample was set to 1, and the ratio with the sample added was calculated. As with Test Example 1, IGF-1, which has a cartilage formation promoting effect, was used as the comparative sample.

[0039] The results of Test Example 2 are shown in Table 2. Since glycylproline promoted the nuclear translocation of phosphorylated Smad2 / 3 in a concentration-dependent manner, the TGF-β signaling effect of glycylproline was clearly demonstrated. Furthermore, compared to the addition of glycylproline or bacopa monnieri alone, the simultaneous addition of glycylproline and bacopa monnieri significantly increased the nuclear translocation of phosphorylated Smad2 / 3. Therefore, it was revealed that the combination of glycylproline and bacopa monnieri exhibits an extremely excellent TGF-β signaling effect.

[0040] [Table 2]

[0041] Test Example 3: Arthritis-improving effect of glycylproline Forty men and women (ages 45-69) experiencing knee joint discomfort or pain in their daily lives were divided into four groups of 10. Each group was given one of the following beverages for three months: one containing glycylproline (Formulation Example 1), one containing glycylproline and Bacopa monnieri (Formulation Example 2), one a conventional beverage (Comparative Example 1), and one containing Bacopa monnieri (Comparative Example 2). Participants consumed 50 mL once daily for three months. Before and after consumption, the degree of knee joint discomfort and pain upon waking and when going up and down stairs were assessed using the Visual Analogue Scale (VAS). In the VAS method, a 10.0 cm line was used, with the left end representing no discomfort or pain (0.0 cm) and the right end representing the maximum imaginable pain (10.0 cm). Participants marked the position corresponding to their current condition, and the distance from the left end was measured to quantify the degree of discomfort or pain. A higher numerical value indicates a greater degree of pain.

[0042] The results of Test Example 3 are shown in Tables 3 and 4. As a result, compared to the groups that consumed the conventional beverage (Comparative Example 1) or the beverage containing Bacopa monnieri (Comparative Example 2), the group that consumed the beverage containing glycylproline (Formulation Example 1) showed a decrease in VAS values, i.e., an improvement in the degree of discomfort and pain upon waking and when going up and down stairs. Furthermore, the group that consumed the beverage containing both glycylproline and Bacopa monnieri (Formulation Example 2) showed a significantly greater improvement in the degree of discomfort and pain upon waking and when going up and down stairs compared to the other groups. Therefore, it became clear that the combination of glycylproline and Bacopa monnieri exhibits an even superior arthritis-improving effect.

[0043] [Table 3]

[0044] [Table 4] [Industrial applicability]

[0045] The present invention can be used as a type II collagen production promoter in chondrocytes containing glycylproline, and as a type II collagen production promoter in chondrocytes characterized by containing glycylproline and Bacopa monnieri. The type II collagen production promoter in chondrocytes of the present invention is useful for preventing / improving various symptoms associated with a decrease in type II collagen in the body, such as joint pain and osteoarthritis.

Claims

1. A type II collagen production promoter in chondrocytes, characterized by containing glycylproline.

2. The agent according to claim 1, further characterized by containing a combination of Bacopa monnieri.

3. A food composition for promoting type II collagen production in chondrocytes, characterized by containing the agent described in any one of Claims 1 to 2.