FGFR agonist VHH and composition containing FGFR agonist VHH

A humanized VHH-Fc conjugate targeting FGFRs provides a cure for fibrosis and suppresses cancer metastasis by stimulating FGFR signaling, addressing the limitations of current treatments with improved stability and reduced side effects.

JP7894198B2Active Publication Date: 2026-07-23EPSILON MOLECULAR ENG INC
View PDF 3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
EPSILON MOLECULAR ENG INC
Filing Date
2026-04-20
Publication Date
2026-07-23

Smart Images

  • Figure 0007894198000009
    Figure 0007894198000009
  • Figure 0007894198000010
    Figure 0007894198000010
  • Figure 0007894198000011
    Figure 0007894198000011
Patent Text Reader

Abstract

The present invention provides a humanized FGFR agonist VHH and a composition comprising humanized FGFR agonist VHH. [Solution] A humanized FGFR agonist VHH is used, comprising CDR1, CDR2, and CDR3 selected from the group consisting of (1) CDR1, CDR2, and CDR3 containing the amino acid sequences of SEQ ID NOs. 32, 33, and 1 respectively, (2) CDR1, CDR2, and CDR3 containing the amino acid sequences of SEQ ID NOs. 34, 35, and 2 respectively, (3) CDR1, CDR2, and CDR3 containing the amino acid sequences of SEQ ID NOs. 36, 37, and 3 respectively, and (4) CDR1, CDR2, and CDR3 containing the amino acid sequences of SEQ ID NOs. 38, 39, and 4 respectively. This VHH is an FGFR agonist VHH. Compositions containing this VHH can be used as cell culture medium compositions, cosmetic compositions, pharmaceutical compositions, and especially pharmaceutical compositions for the treatment and prevention of fibrosis in various organs and for suppressing cancer metastasis.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to a humanized FGFR agonist VHH and a composition comprising humanized FGFR agonist VHH. [Background technology]

[0002] Animal bodies have the ability to heal damaged tissue. Tissue healing is achieved through the differentiation of fibroblasts and mesenchymal cells into myofibroblasts, which close the wound and synthesize and deposit extracellular matrix such as type I collagen. After healing, myofibroblasts undergo apoptosis and disappear. However, due to persistent damage such as inflammation, myofibroblasts may remain without undergoing apoptosis. In this case, the synthesis of extracellular matrix continues indefinitely, leading to an abnormal increase in extracellular matrix and tissue fibrosis. Diseases in which tissues lose elasticity due to such abnormal accumulation of extracellular matrix are generally called fibrosis. Such tissue fibrosis can occur in all organs except nerve tissue (e.g., heart, lungs, pancreas, liver, kidneys, etc.) (Non-patent Literature 1).

[0003] Fibrosis causes organ rigidity and ultimately leads to organ failure, making its treatment crucial. For example, idiopathic pulmonary fibrosis, a type of pulmonary fibrosis, is a disease in which patients experience respiratory distress due to lung rigidity and eventually die, with an average life expectancy of 3-5 years. In Japan, approximately 15 million people suffer from nonalcoholic fatty liver disease (NAFLD), a liver disease. Nonalcoholic fatty liver disease is called NAFL, and nonalcoholic steatohepatitis, a more advanced stage of NAFLD, is called NASH. It is estimated that 10% of NAFLD patients progress further from NASH, following a course that includes liver fibrosis, cirrhosis, and liver cancer. The number of patients following this course is even higher in the United States, where NAFLD affects 25-35% of the population (approximately 100 million people), and about 20% of those progress to NASH.

[0004] Furthermore, COVID-19 caused by SARS-CoV-2 is known to induce various respiratory illnesses. While many COVID-19 patients go into remission, some are known to suffer from sequelae such as palpitations, shortness of breath, and difficulty breathing. A follow-up study of patients with sequelae using CT scans showed that 44.1% had ground glass opacity in their lungs, and 33.9% had fibrous stripes (Non-Patent Literature 2). Pathological analysis of lung tissue from patients who recovered from COVID-19 also revealed fibrosis in the areas where pneumonia had occurred (Non-Patent Literature 3). In severe acute respiratory syndrome (SARS), caused by the same coronavirus as SARS-CoV-2, fibrosis of lung tissue has been confirmed by CT scans even 7 years after the onset of symptoms. Therefore, it is expected that, similarly, some patients with COVID-19 will suffer from long-term sequelae due to fibrosis.

[0005] Given the large number of fibrosis patients and the severity of its symptoms, treatment for fibrosis has been highly desired. However, until now, fibrosis was considered an irreversible phenomenon and therefore incurable. In recent years, however, research into fibrosis has advanced, and some aspects of its pathogenesis have been elucidated. It has been known that endothelial cells and immune cells present at the site of injury secrete various cytokines (Non-Patent Literature 4). Currently, fibrosis is thought to occur through a dynamic process in which these cytokines act on immune cells and myofibroblasts, thereby promoting or suppressing fibrosis. However, the detailed mechanism remains unknown.

[0006] Fibroblast growth factor (hereinafter sometimes abbreviated as "FGF") is a cell growth factor discovered in 1973 and forms a family. In humans, 22 or 23 different members have been identified. This difference stems from whether or not human FGF15 and FGF19 are considered separate species, given that human FGF19 is a mouse homologous molecular species. All FGFs identified to date are signaling molecules with structural similarities and are known to be multifunctional proteins exhibiting a wide range of effects.

[0007] FGF generally acts as a cell division promoter, but it is known to exhibit other effects and is sometimes called a "promiscuous growth factor." Here, "promiscuity" in fields such as biochemistry refers to the concept of how many different molecules can bind to and react with a single receptor or enzyme. In the case of FGF, four receptor subtypes are activated by more than 20 different FGF ligands. FGF is known to have many functions, including involvement in mesoderm induction, anterior-posterior axis pattern formation, limb formation, nervous system induction and neurogenesis during development, and involvement in angiogenesis, keratinocyte organization, and wound healing in mature tissues. Various compositions, such as cosmetics, have been developed based on the cell proliferation effects of FGF.

[0008] FGF1 through 10 are known to bind to all fibroblast growth factor receptors (hereinafter sometimes referred to as "FGFRs"). Of these, FGF1 is known as acidic FGF (sometimes called "aFGF"), and FGF2 is known as basic FGF (sometimes called "bFGF"). FGF11 through 14 are also known as FGF homologous factors 1 through 4 (hereinafter sometimes referred to as "FHF1 through 4"), and despite exhibiting considerable sequence identity with other FGFs, they do not bind to FGFRs. Furthermore, because they are involved in intracellular processes that other FGFs do not participate in, they are also called "intracellular FGFs," and their functions are said to be different from other FGFs.

[0009] Furthermore, FGF has a subfamily that includes FGF19, FGF21, and FGF23 as members. While other members of the FGF family exhibit local effects, the members of the above subfamily are known to act as metabolic regulators, i.e., exhibit systemic effects. Among these, FGF21 is known to specifically bind to FGFR1, FGFR2, and FGFR3, and together with the membrane-bound coreceptor β-Klotho, improve insulin resistance and type 2 diabetes via these receptors. It has also been reported as a potential disease modifier that reverses obesity, obesity-induced fatty liver, and hyperglycemia. Anti-FGFR1 agonist antibodies have also been proposed as candidate drugs for the treatment of diabetes (see Patent Document 1, hereinafter referred to as "Prior Art 1").

[0010] There are four types of FGFRs (FGFR1-4), and structurally, each has three immunoglobulin-like loop domains (domains 1-3) extracellularly and a tyrosine kinase domain intracellularly, forming the receptor tyrosine kinase family. When a ligand binds to the extracellular domain, the intracellular tyrosine kinase domain plays a role in positively inducing cell proliferation, and its activity is usually strictly controlled. However, in cancer cells, it is known that by fusing with EML4-ALK or other proteins, or by causing mutations in the tyrosine kinase gene sequence, it can become constantly activated, like the activated EGF receptor, and induce "carcinogenesis."

[0011] Patent Document 2 describes a single-domain antibody (VHH antibody) that is a tyrosine kinase agonist against human FGFR1-4. This VHH antibody is obtained from a cell-free system using a peptide obtained from a library and has cell proliferation activity. Furthermore, Patent Document 1 discloses that this agonist VHH antibody can be used in cell culture media for the proliferation and maintenance of undifferentiated cells such as fibroblasts, mesenchymal stem cells, and iPS cells.

[0012] Tumor tissue contains various types of cells, including not only cancer cells but also tumor blood vessels and cancer-associated fibroblasts (CAFs), forming the tumor microenvironment. CAFs are fibroblasts that make up the cancer stroma and are known to produce various growth factors that promote the proliferation of cancer cells. CAFs are further classified into cancer-promoting CAFs and non-myofibroblasts, and it is known that non-myofibroblasts include tumor-suppressing CAFs that inhibit tumor formation. In particular, intractable cancers such as pancreatic cancer are characterized by severe fibrosis in the stroma. CAFs play a central role in this fibrosis. Collagen fibers formed by extracellular matrix such as collagen produced by CAFs and lysyl oxidase (LOX) induce hardening of cancer tissue, increased internal pressure, and collapse of blood vessels. Especially in the case of intractable cancers, it is thought that fibrosis inhibits the penetration of anticancer drugs, preventing the drugs from reaching cancer cells and thus rendering them ineffective.

[0013] Patent Document 3 describes a method for treating gastric cancer, which includes administering an anti-fibroblast growth factor receptor 2IIIb (anti-FGFR2-IIIb) antibody and modified FOLFOX6 (mFOLFOX6) chemotherapy. This anti-FGFR2-IIIb antibody is an antibody that inhibits the binding of FGF2 or FGF7 to human FGFR2, thereby blocking the binding of FGF ligands to FGFR2.

[0014] Metastasis is the process by which cancer cells migrate from their original site (primary tumor) to form tumors in distant locations. In cancer treatment, the cure rate has improved when cancer is confined to the primary tumor before metastasis. However, the prognosis for advanced cases after metastasis remains poor, making early detection and suppression of metastasis crucial for cancer treatment. However, drugs that effectively suppress cancer metastasis are not yet well known.

[0015] Furthermore, from the perspective of addressing environmental impact and animal ethics, the production of cultured meat obtained by culturing animal cells outside the body has attracted attention in recent years. Cultured meat is thought to reduce the environmental impact by reducing land use, water pollution, methane emissions, and carbon dioxide emissions compared to conventional livestock farming and the aquaculture of crustaceans and fish. In addition, from the perspective of animal ethics, it is expected to enable the supply of meat without factory farming or slaughterhouses.

[0016] However, cultured meat is more expensive than conventional livestock farming and aquaculture, which is hindering its widespread adoption. Most of the manufacturing costs are due to the high cost of growth factors and other components contained in the culture medium. For example, fetal bovine serum (FBS) is sometimes used as a cell culture medium, but from the perspective of avoiding the use of animal-derived products and animal ethics, the use of serum-free media is desirable. Currently, Essential 8™, a serum-free medium containing eight components developed for human pluripotent stem cells (PSCs) and fibroblasts, can culture bovine myoblasts and is expected to be applied to cultured meat. However, since FGF2 and TGFβ account for 96% of the cost of Essential 8's eight components, the manufacturing cost of growth factors is a major challenge in reducing costs. [Prior art documents] [Patent Documents]

[0017] [Patent Document 1] Japanese Patent Publication No. 2020-125299 [Patent Document 2] International Publication No. 2022 / 270518 [Patent Document 3] Japanese Patent Publication No. 2020-520903 [Non-patent literature]

[0018] [Non-Patent Document 1] Zhao , M. , Wang , L. , Wang , M. et al. Targeting fibrosis: mechanisms and clinical trials. Sig Transduct Target Ther 7, 206 (2022). https: / / doi.org / 10.1038 / s41392-022-01070-3

Outdoor Tool2

Outdoor Tools3

Outdoor Tools 4

Direct Environment 5

[0019] In recent years, research and development on the treatment of fibrosis have been actively conducted. In Japan, drugs for the treatment of pulmonary fibrosis such as pirfenidone in 2008 and nintedanib in 2015 have been approved. Pirfenidone inhibits the production of TGF-β involved in the differentiation from lung epithelial cells to fibroblasts, inhibits the production of inflammatory cytokines (TNF-α, IL-1, IL-6, etc.) and enhances the production of anti-inflammatory cytokine (IL-10), suppresses the decrease in IFN-γ that leads to the correction of the Th1 / 2 balance, and inhibits the production of growth factors (FGF2, PDGF) involved in fibrosis formation. Nintedanib is a tyrosine kinase inhibitor and is said to inhibit the recruitment of lymphocytes and fibroblasts and suppress the differentiation into fibroblasts by inhibiting PDGFRs, EGFRs, and FGFRs.

[0020] While these drugs are effective in slowing the progression of fibrosis, they cannot cure fibrosis, nor can they completely halt the progression of the disease. Furthermore, pirfenidone can cause liver dysfunction in some patients and photosensitivity in more than half of patients, making it unsuitable for patients with impaired liver function. Patients taking this drug must constantly take precautions such as wearing sunscreen, long sleeves, and sun protection. Nintedanib can cause diarrhea in more than half of patients, including severe cases. These side effects are thought to be due to pirfenidone and nintedanib having multiple targets.

[0021] Despite having side effects that significantly reduce the quality of life for patients, these drugs only suppress the progression of fibrosis and do not provide a fundamental cure. Therefore, there was a need for a drug with fewer side effects that could fundamentally treat fibrosis or more effectively suppress the progression of the disease. Furthermore, no drug has yet been developed that is considered effective against NASH, a type of liver fibrosis.

[0022] As mentioned above, it is thought that cytokines derived from immune cells at the site of injury act on myofibroblasts, thereby promoting fibrosis. Therefore, it is thought that controlling these factors may cure fibrosis, but the detailed relationship between cytokines and fibrosis has not been elucidated, so it is unknown which cytokines are effective targets. For example, FGF21 is involved in hepatic lipid metabolism, so it is expected to be useful in the treatment of NASH, and research is underway. However, BMS-986036, a PEGylated NASH treatment drug, did not yield effective results in Phase II clinical trials as of September 9, 2022 (https: / / clinicaltrials.gov / ct2 / history / NCT03486912?V_35&embedded=true). Therefore, there is a need for a treatment drug that targets cytokines that have not been targeted so far and has an effect of fundamentally curing fibrosis rather than just suppressing its progression. Alternatively, there is a need for a treatment drug that more effectively suppresses the progression of fibrosis. Furthermore, there is also a need for the development of an effective treatment drug that suppresses cancer metastasis.

[0023] Furthermore, cytokines, which are endogenous substances in the body, are known to be unsuitable as drugs because they have a short half-life in the bloodstream when administered. Therefore, there is a need for alternative drugs that can replace cytokines, have a long half-life in the bloodstream, are highly stable for long-term storage, and can be easily manufactured. [Means for solving the problem]

[0024] Under the circumstances described above, the inventor of the present invention diligently conducted research and completed the present invention. In other words, one aspect of the present invention is a VHH-Fc conjugate (hereinafter sometimes simply referred to as "VHH-Fc") comprising a humanized VHH that binds to the extracellular domain of fibroblast growth factor receptor (FGFR) 1 and the Fc sequence of a human antibody. Preferably, the VHH contains one of the CDR3s selected from the group consisting of amino acid sequences represented by sequence numbers 1 to 4 in the sequence listing. Furthermore, it is more preferable that the binding activity of the VHH is in the order of FGFR2, FGFR4, FGFR3, FGFR1, FGFR1, FGFR4, FGFR3 and does not bind to FGFR2, FGFR2, FGFR4, FGFR1 and does not bind to FGFR3, or FGFR4, FGFR2, FGFR1 and does not bind to FGFR3.

[0025] Furthermore, the VHH-Fc conjugate may be a dimer. In that case, each VHH contained in the conjugate may contain the same CDR3 sequence, or it may contain different CDR3 sequences. Another aspect of the present invention is a pharmaceutical composition for the treatment of fibrosis, comprising the humanized VHH-Fc conjugate as an active ingredient. The dissociation constant of the VHH with respect to the extracellular domain of the FGFR1 is 10 -8 It is preferable that the M value is less than M. Furthermore, it is preferable that the humanized VHH has one of the CDR3 sequences selected from the group consisting of amino acid sequences represented by SEQ ID NOs. 1 to 4 in the sequence listing, and it is more preferable that the full-length amino acid sequence is one of the sequences selected from the group consisting of amino acid sequences represented by SEQ ID NOs. 5 to 8 in the sequence listing.

[0026] Here, VHH (variable domain of heavy chain of heavy chain antibody) refers to an antibody composed solely of the variable domain of a single-chain antibody consisting only of heavy chains, such as those found in llamas and alpacas. Compared to antibodies found in humans, VHH has a simpler structure, resulting in excellent thermal stability. It can also be easily and efficiently produced in large quantities using non-human cells such as E. coli, making it preferable for use as a drug. Furthermore, the VHH of this invention possesses a specific CDR3, resulting in high target specificity and fewer side effects as a drug, making it superior in this respect.

[0027] The VHH of the present invention is conjugated with an Fc sequence derived from a human antibody, which is preferable in that it efficiently dimerizes the target receptor and transmits signals through the receptor. Furthermore, the pharmaceutical composition for treating fibrosis of the present invention is characterized in that the affected organ of fibrosis is an organ other than the brain. Moreover, it is preferable that the affected organ of fibrosis is the liver. Another aspect of the present invention is a pharmaceutical preparation containing the pharmaceutical composition for treating fibrosis.

[0028] Another aspect of the present invention is a VHH-Fc conjugate comprising a VHH having any amino acid sequence selected from the group consisting of CDR3 amino acid sequences represented by sequence numbers 1 to 4 in the sequence listing, and a human Fc amino acid sequence. Preferably, the VHH is any VHH selected from the group consisting of VHH having amino acid sequences represented by sequence numbers 5 to 8 in the sequence listing, and more preferably, the amino acid sequence of the conjugate has at least 90%, 95%, or 98% identity with any of the amino acid sequences selected from the group consisting of amino acid sequences represented by sequence numbers 11 to 14 in the sequence listing, or with any of the amino acid sequences represented by sequence numbers 11 to 14. [Effects of the Invention]

[0029] According to the present invention, it is possible to provide a pharmaceutical composition that can provide a fundamental treatment for fibrosis in various organs and has few side effects. Examples of fibrotic organs include the heart, lungs, pancreas, liver, and kidneys. In particular, examples include the heart with myocardial fibrosis, the lungs with idiopathic pulmonary fibrosis (IPF), the pancreas with cystic fibrosis, the liver with NAFLD including NASH, and the kidneys with nephrosclerosis. [Brief explanation of the drawing]

[0030] [Figure 1] Figure 1 shows the scheme for hit compound screening using the cDNA display method. [Figure 2] Figure 2 shows the structure of a linker used in the cDNA display method. [Figure 3] Figure 3 is a graph showing the results of a single-point binding assay performed using Octet on screening products obtained by targeting the extracellular domain of human FGFR1. The vertical axis represents Response (nm), and the horizontal axis represents each clone's VHH. A thick solid line indicates a Response of 0.1.

[0031] [Figure 4] Figure 4 is a graph showing the results of a single-point binding assay performed using Octet on screening products obtained with the extracellular domain II of human FGFR1 as the target protein. The vertical axis represents Response (nm), and the horizontal axis represents each clone's VHH. A thick solid line indicates a Response of 0.1. [Figure 5] Figure 5 is a graph showing the results of affinity measurements of VHH clones to the target molecule FGFR1. Figure 5(A) shows the affinity measurement results for VM46, and Figure 5(B) shows the affinity measurement results for VM1637. The vertical axis represents Response, and the horizontal axis represents time (seconds). The numbers in the graph indicate the concentration of the analyte used.

[0032] [Figure 6]Figure 6 is a graph showing the results of affinity measurements for each VHH clone against the target molecule. The vertical axis is the same as in Figure 5. Figure 6(A) shows the results of affinity measurements against the target molecule FGFR1(IIIb). Figure 6(B) shows the results of affinity measurements against the target molecule FGFR1(IIIc). Figure 6(C) shows the results of affinity measurements against the target molecule FGFR2(IIIb). Figure 6(D) shows the results of affinity measurements against the target molecule FGFR2(IIIc). [Figure 7] Figure 7 is a graph showing the results of affinity measurements for each VHH clone against the target molecule. The vertical axis is the same as in Figure 5. Figure 7(A) shows the results of affinity measurements against the target molecule FGFR3(IIIb). Figure 7(B) shows the results of affinity measurements against the target molecule FGFR3(IIIc). Figure 7(C) shows the results of affinity measurements against the target molecule FGFR4. [Figure 8] Figure 8 is a graph showing the results of affinity measurements for each VHH clone against the target molecule. The vertical axis is the same as in Figure 5. Figure 8(A) shows the results of affinity measurements against the target molecule FGFR1(IIIb). Figure 8(B) shows the results of affinity measurements against the target molecule FGFR1(IIIc). Figure 8(C) shows the results of affinity measurements against the target molecule FGFR2(IIIb). Figure 8(D) shows the results of affinity measurements against the target molecule FGFR2(IIIc).

[0033] [Figure 9] Figure 9 is a graph showing the affinity measurements of each VHH clone to the target molecule. The vertical axis is the same as in Figure 5. Figure 9(A) shows the affinity measurement results for the target molecule FGFR3(IIIb). Figure 9(B) shows the affinity measurement results for the target molecule FGFR3(IIIc). Figure 9(C) shows the affinity measurement results for the target molecule FGFR4. [Figure 10] Figure 10 shows the electrophoretic image of the results of SDS-PAGE performed after purification of VHH-Fc. Outside the figure, the numbers on the left represent the molecular weight. VF151, VF152, VF155, and VF156 indicate the numbers of the VHH-Fc conjugates used, respectively.

[0034] [Figure 11] Figure 11 is a graph showing the results of affinity measurements of VHH-Fc clones to the target molecule FGFR1. Figure 11(A) shows the affinity measurement results for VF151, Figure 11(B) for VF152, Figure 11(C) for VF155, and Figure 11(D) for VF156. The vertical axis represents Response, and the horizontal axis represents time (seconds). The numbers in the figure indicate the concentration of the analyte used. [Figure 12] Figure 12 shows a graph quantifying cell proliferation when cultured cells were stimulated with VHH-Fc, and the EC50 values ​​calculated based on that graph. The vertical axis of the graph represents relative fluorescence intensity (RLU), and the horizontal axis represents the concentration (mg / mL) of the sample and target substance used. Figure 12(A) shows the proliferation curve and EC50 value for FGF, and Figures 12(B) to (F) show the proliferation curve and EC50 value for VF151 to VF156, respectively. [Figure 13] Figure 13 is a graph showing the results of quantitative PCR analysis of gene expression levels. Figure 13(A) shows the relative expression levels of ACTA2, and Figure 13(B) shows the relative expression levels of COL1A1. [Figure 14] Figure 14 is a graph showing the thermal stability of each VHH-Fc. Figure 14(A) is the raw data obtained when analyzing thermal stability using UNcle. The vertical axis of the graph shows the scattered light intensity (SLS) at 266 nm. Figure 14(B) shows the thermal stability of each VHH-Fc (VF151~VF154) and the target FGF2 calculated from the measured data.

[0035] [Figure 15] These are photographs showing observations of cancer metastasis to the liver on days 7 and 14 after organoid transplantation. [Figure 16] This is a photograph showing fluorescence microscopy images of a liver and its sections obtained 14 days after organoid transplantation. [Figure 17] This image shows a fluorescence microscope image of a liver section obtained 14 days after organoid transplantation, and a graph showing the percentage of the liver section occupied by metastatic tumors relative to the entire liver. [Figure 18] These are photographs of liver sections obtained 14 days after organoid transplantation, showing immunohistochemical staining with hematoxylin and eosin (H&E) (top), anti-αSMA antibody (middle), and anti-transgelin antibody (bottom). [Modes for carrying out the invention]

[0036] The present invention will be described in more detail below using embodiments. The present invention relates to a humanized agonist VHH for the treatment of fibrosis. Furthermore, it may have a human antibody Fc site at its C-terminus. The VHH has the property of binding to FGFR as an agonist. The Fc site may be bound to the VHH via a linker.

[0037] An "agonist" is a drug that acts on receptor molecules in the body to exhibit functions similar to those of neurotransmitters and hormones. Substances that actually function in the body are called ligands to distinguish them. When an agonist acts on only one specific receptor out of several, and does not act on the others, it is called a selective agonist. An example of such a selective agonist is NMDA, which binds to only one of the four receptors for glutamate, the major excitatory neurotransmitter in the central nervous system.

[0038] Furthermore, agonists that have a lower activation level and weaker effect compared to biomolecules are called partial agonists or partial agonists. Examples of partial agonists include dopamine D2 receptors such as beta-blockers, opioids, benzodiazepine hypnotics, aripiprazole (Abilify), and phencyclidine (PCP anesthetic), and these are actually used in the medical field.

[0039] Furthermore, "VHH" refers to an antibody fragment consisting of a single domain of approximately 15 kDa, contained in IgG which is composed solely of heavy chains found in camelid animals. In this specification, "single-domain antibody" refers to a molecule that has the same effect as the smallest antibody whose diagnostic or therapeutic usefulness has been proven, and is a heavy chain antibody (V) from camelid animals. H H) or IgNAR (V) of cartilaginous fish NAR VHH refers to "an antibody fragment obtained from a single monomeric variable domain of )". VHH is about one-tenth the molecular weight of a normal antibody, possesses excellent stability, affinity, and tissue permeability, and has faster blood clearance compared to antibody molecules.

[0040] Furthermore, "antibody" refers to a substance produced in the body in response to an antigen and that specifically binds to the antigen, as well as artificially modified versions thereof. Examples of antibodies include immunoglobulin G (IgG), as well as artificially modified IgG, such as those in which the framework sequence of non-human IgG (hereinafter sometimes referred to as "FR") is partially or completely replaced with the FR of human IgG, or those partially bound to an artificial framework. "Antibody fragment" refers to a part of an antibody, for example, one containing one of the multiple domains that make up the heavy chain.

[0041] A "fibroblast growth factor receptor" (FGFR) is a receptor to which fibroblast growth factor (FGF) binds. Here, it is preferable that the FGFR is one of the receptors selected from the group consisting of fibroblast growth factor receptor 1 (hereinafter sometimes referred to as "FGFR1"), fibroblast growth factor receptor 2 (FGFR2), fibroblast growth factor receptor 3 (FGFR3), and fibroblast growth factor receptor 4 (FGFR4).

[0042] FGFRs 1-4 share a common structure: they possess three immunoglobulin loops (I, II, III) in their extracellular domain and a tyrosine kinase domain within their intracellular domain. Immunoglobulin loop I is said to have little impact on signal transduction even if it is deficient. Loop II is highly conserved in FGFRs 1-4 and is considered an essential site for ligand binding. Ligand binding promotes dimerization of FGFRs. This brings the tyrosine kinase domains into physical proximity, and the tyrosine residues within the kinase domains are mutually phosphorylated. Then, effector molecules bind to the activated kinase domains, and the tyrosine residues of those effector molecules are phosphorylated and activated. In this way, various proteins within the cell are successively activated.

[0043] The Fc site refers to the portion of an antibody obtained when it is digested with papain, excluding the variable region. Fc sites have the property of binding to each other and contributing to protein dimerization. The Fc site of an antibody bound to an antigen is recognized by Fc receptors on phagocytic cells such as leukocytes and macrophages, promoting phagocytosis by these cells (opsonization). It also has effects such as complement activation and antibody-dependent cell-mediated cytotoxicity (ADCC). In this context, the Fc site-adding agonist VHH of the present invention is preferred because it can efficiently dimerize at least FGFR and activate intracellular signal transduction.

[0044] Furthermore, while chemical linkers can generally be used as linkers to connect VHH and the Fc site, it is preferable to use peptide linkers when using production systems that utilize cells. In particular, when adding an Fc sequence, it is preferable to use the hinge of the antibody from which the Fc is derived as the linker, and this may be modified as appropriate, such as by introducing mutations to stabilize the VHH-Fc dimer. For example, as a peptide linker, it is preferable to use the one specified by Sequence ID No. 10 in the sequence listing, in terms of the flexibility of the linker that ensures the movement of VHH.

[0045] VHH sequences like those in the present invention can be obtained by immunizing animals with heavy chain antibodies, such as camels and llamas, or by screening artificial VHH libraries using methods such as phage display, mRNA display, or cDNA display. From the viewpoint of ease of acquisition and diversity, the cDNA display method is preferred.

[0046] 1. Creation of cDNA display molecules In the cDNA display method described above, a linker having the structure shown in Figure 2 is used to form a display molecule having mRNA, a peptide encoded by that mRNA, and a cDNA encoding that peptide. As shown in Figure 2, the cDNA display linker consists of a main chain and side chains. The main chain is provided with an mRNA binding site for binding mRNA, a photocrosslinking site for linking the mRNA to the main chain, a solid-phase binding site for binding to the solid phase after mRNA has bound, a solid-phase cleavage site for releasing the cDNA molecule from the solid phase, a side-chain binding site for linking the side chains, and a reverse transcription site for synthesizing the cDNA corresponding to the peptide corresponding to the mRNA.

[0047] Here, it is preferable that the photocrosslinking site is composed of a photocrosslinking base that forms a crosslink with long-wavelength light, as this causes less damage to the linked mRNA. Examples of such photocrosslinking bases include 3-cyanovinylcarbazole (hereinafter sometimes abbreviated as "cnvK") and analogs of cnvK. Examples of solid-phase binding sites include biotin and streptavidin.

[0048] The solid-phase cleavage sites are preferably composed of nucleotides that can be specifically cleaved by enzymes, etc. For example, it is preferable that they be composed of ribonucleotides having a guanine base (hereinafter sometimes abbreviated as "rG") or nucleotides having a modified base, because they can be site-specifically cleaved by a specific enzyme. The photocrosslinking site is located between the solid-phase binding site and the side-chain binding site, and the reverse transcription site is located near the 5' end of the main chain. The solid-phase binding site is located near the 3' end of the main chain, and the solid-phase cleavage site is located between the solid-phase binding site and the mRNA binding site.

[0049] Furthermore, the side chain is bound to the side chain binding site of the main chain at one end, and a peptide display site is provided at the free end for displaying the peptide translated from the mRNA. Fluorescein, FITC, or other fluorescent molecules can be linked between the peptide display site and the side chain binding site to facilitate detection.

[0050] In the cDNA display method, first, the sequence of the mRNA binding site on the main chain is designed based on the nucleotide sequence of the target peptide, and the cDNA display linker is constructed. mRNA from the desired library is bound to the mRNA binding site, and then light is irradiated to link the mRNA and the main chain at the photocrosslinking site. By adding the mRNA-cDNA display linker conjugate to a cell-free translation system solution, the mRNA bound to the main chain is translated into a peptide, which is then presented at the peptide presentation site of the cDNA display linker, thereby creating an mRNA display molecule in which mRNA and a peptide with a corresponding sequence are linked to the cDNA display linker. The peptide presented here can have a desired sequence. In this invention, by making this the target VHH, a peptide having FGFR agonist activity can be obtained.

[0051] Next, the mRNA display molecule is bound to the solid phase at the solid-phase binding site, and cDNA is synthesized on the cDNA display linker using reverse transcriptase to form a cDNA display molecule. In the cDNA display molecule, mRNA and cDNA form a double helix (see Figure 1). The solid phase is not particularly limited and can be any material that can bind to the solid-phase binding site. For example, if the solid-phase binding site is composed of biotin, it is preferable that the solid phase surface is coated with streptavidin. The solid phase may be in the form of a plate or beads, but it is preferable to use beads for ease of handling in selection and other processes described later. The synthesized cDNA display molecule is then cleaved from the solid phase using an enzyme to release it as a free molecule. For example, an endonuclease can be used as the enzyme here, and if the solid-phase cleavage site is composed of rG, it is preferable to use endonuclease V (hereinafter sometimes referred to as "EndoV") because it can cleave specifically at the solid-phase cleavage site.

[0052] A selection step is performed to select display molecules that present peptides that bind to the target molecule from among the various cDNA display molecules formed as described above. The process of removing display molecules other than those that present peptides that bind to the target molecule, thereby increasing the content of display molecules that bind to the target molecule, is called "concentration."

[0053] In the selection step, the target molecule bound to the solid phase is brought into contact with the cDNA display molecule obtained as described above, and only the cDNA display molecule bound to the target molecule is recovered, thereby obtaining a molecule that binds to the target molecule from among the cDNA display molecules. If streptavidin-coated beads (hereinafter sometimes referred to as "SA beads") are used as the solid phase, the target molecule can be immobilized on the SA beads by binding the target molecule to biotin, and then used for selection.

[0054] The library composed of cDNA from the cDNA display molecules obtained in the selection process described above is called the 1st library. By repeating the same procedure as described above, the peptides that bind to the target molecule contained in the library are enriched. At this time, the library obtained on the Nth iteration is called the Nth library. It is preferable to repeat the library enrichment operation for a desired number of times, for example, 3 to 5 times. This is because enrichment is insufficient after only 2 repetitions, while no improvement in enrichment rate can be expected even if it is repeated 6 or more times.

[0055] 2. Analysis of screening products using NGS The concentrated library, which is the screening product obtained above, is analyzed using a next-generation sequencer (hereinafter sometimes abbreviated as "NGS"). First, the concentrated library is subjected to PCR and amplified under the following conditions to obtain the PCR product. The reaction mixture consisted of approximately 2.5 to 10 μL of PrimeSTAR MAX, approximately 0.5 to 2 μL of the concentrated screening product, and approximately 1 to 4 pmol each of primers, PL_prRd-N4_NL_FW (SEQ ID NO: 15) and PL_prRd-N4_Ytag_RV (SEQ ID NO: 16), placed in tubes and adjusted to approximately 5 to 20 μL with ultrapure water. The sequences of these two primers are shown below.

[0056] 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNATGGAAGTACAATTAGTTGAATCTGGTGGTGGGCTTG -3' (Sequence ID 15) 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGNNNNTGAAGAGACTGTCACCAACGTGCCTTG -3' (Sequence ID 16)

[0057] The PCR program is performed for approximately 10 to 14 cycles with an annealing temperature of approximately 60 to 64°C and an extension time of approximately 10 to 20 seconds to obtain the PCR product. The obtained PCR product is purified, and the purified product is used as a template for Index PCR. The reaction mixture for Index PCR consists of approximately 10 to 15 μL of PrimeSTAR MAX, approximately 0.5 to 2 μL of the purified product, approximately 0.25 to 1 μL of approximately 2.5 to 10 μM forward / reverse primer (Nextera XT Index 1 Primers (N7XX), Nextera XT Index 2 Primers (S5XX)), and approximately 5 to 20 μL of ultrapure water.

[0058] The PCR program is performed in the same manner as above, except that the annealing temperature is set to approximately 50-54°C and the extension time to approximately 10-20 seconds, for approximately 7-9 cycles to obtain the PCR product. The Index PCR product is purified to obtain the purified product, and the DNA concentration of this purified product is measured using NanoPad DS-11. The Index PCR purified product is diluted with RNase-free water to approximately 8-12 nM, and then each product is collected and mixed in approximately 4-6 μL portions in a single tube. Subsequently, the NGS sample library is prepared according to the instructions for MiSeq (Illumina), and analysis is performed using MiSeq Reagent Nano Kit v2 (500 Cycles) (Illumina). The DNA sequence obtained from NGS is translated into amino acid sequence to obtain the VHH sequence that binds to each target molecule.

[0059] 3. Production of VHH (monomer) The VHH clones obtained as described above are expressed in an expression system. For such an expression system, it is preferable that the culture supernatant contains very little of the producing bacterium's own secreted protein, HCP (Host Cell Protein). This ensures that the target protein secreted into the culture supernatant is present in the supernatant with very high purity. Furthermore, it is preferable to use a bacterium that secretes the target protein with the correct higher-order structure.

[0060] By using these bacteria, there is no need to lysate the bacteria, and protease activity in the culture supernatant is hardly detectable. This has the advantage of virtually eliminating the degradation of the secreted target protein, which is a major problem in many protein secretion production systems.

[0061] Examples of such amino acid-producing bacteria include Corynebacterium glutamicum (hereinafter sometimes referred to as "C. glutamicum"). C. glutamicum has a wealth of experience and a proven track record, having been used as an industrial amino acid production bacterium for 60 years, and a method for culturing high cell counts using inexpensive and simple culture media has been established. In addition, the C. glutamicum strain itself is highly safe. That is, C. glutamicum does not produce toxic substances and is not pathogenic. The following explanation will use the use of C. glutamicum as an example.

[0062] 3-1. Plasmid construction for VHH (monomer) expression Using the enriched library as a template, sequences for restriction enzyme treatment are added by PCR in the usual manner to obtain the PCR product. The primers should be capable of adding restriction enzyme recognition sequences not included in the plasmid vector or enriched library.

[0063] The PCR product and the C. glutamicum expression plasmid vector are each treated with a restriction enzyme that recognizes one insertion site for approximately 1 hour at the optimal temperature of that restriction enzyme, and then treated with a restriction enzyme that recognizes the other insertion end for approximately 1 hour at the optimal temperature of that restriction enzyme. The reaction mixture derived from the PCR product that will become the insert DNA is purified. The reaction product derived from the plasmid vector is subjected to 1% agarose gel electrophoresis at approximately 80 to 120 V for approximately 25 to 35 minutes, and the product is excised from the gel after electrophoresis and purified to obtain the purified product.

[0064] The purified plasmid vector DNA is dephosphorylated using a dephosphorylation enzyme at approximately 35-39°C for about 1 hour. Then, the Insert DNA and plasmid vector DNA are mixed in a molar ratio of approximately 1:10, and a ligation reaction is performed overnight at approximately 16°C using a ligation enzyme, such as Ligation High (Toyobo Co., Ltd.), to obtain a plasmid library into which the selected VHH library has been introduced.

[0065] 3-2. Expression of VHH (monomer) using producing bacteria The plasmids obtained in 3-1 above are then processed by electroporation, for example, using C. glutamicum as the producing organism. First, transformants are prepared by introducing the plasmids into C. glutamicum. These transformants are inoculated into a desired medium, such as CM2G medium, and pre-cultured overnight at approximately 28-32°C. Subsequently, the pre-culture solution is subcultured in PM1S medium in each well of a 96-deep-well plate, for example, and cultured at approximately 20-30°C for approximately 60-84 hours. Since VHH (monomers) are secreted into the culture supernatant, after the culture is complete, the plate is centrifuged at approximately 3,000-5,000xg for approximately 15-45 minutes at approximately 20°C, and the supernatant is collected. This supernatant is passed through a 0.22 μm filter to remove the bacterial cells from the supernatant, and the supernatant is frozen and stored as stock at -80°C.

[0066] 4. Single-point binding assay using Octet The binding activity of the VHH clones obtained as described above to each target molecule is measured using biolayer interferometry. For example, OctetRED384 (Fortebio) can be used for this, and an example is shown below. The concentration of the ligand, for example a part of FGFR1, is adjusted to approximately 100 to 400 nM, and approximately 60 to 80 μL of the measurement solution is added to a 384-well plate to measure the binding of the VHH clones immobilized on the well plate to each target molecule. Before measurement, the tip of the Dip and Read(registered trademark) His1K Biosensors (Fortebio) is immersed in approximately 200 μL of PBS-T (PBS containing 0.05% Tween20 may be referred to as "PBS-T" below, pH approximately 7.4) for approximately 5 to 15 minutes to hydrate the sensor tip.

[0067] The conditions for the measurement order for each run measurement are as follows: 1) Baseline step: Measurement in PBS-T for approximately 30 seconds. 2) Loading step: Measure VHH diluted approximately 50 times with PBS-T for approximately 60 seconds. 3) Baseline step: Measurement in PBS-T for approximately 30 seconds. 4) Association step: Measurement for approximately 100 seconds with each target molecule prepared by diluting with PBS-T. 5) Dissociation step: Measurement in PBS-T for approximately 100 seconds. 6) Regeneration step: Measurements were taken for 5 seconds in Glycine-HCl (pH approximately 2.2) and for approximately 30 seconds in PBS-T. Repeat the above steps at least three times. The obtained data can be processed using Octet software (Molecular Devices) to obtain the results of a single-point binding assay. Here, for example, clones showing a binding response of approximately 0.1 nm or greater can be designated as hit clones.

[0068] 5. Sequence analysis of hit clones Each VHH gene in the above hit clone is identified by sequence analysis. The transformants, which are the above hit clones, are cultured overnight at approximately 37°C, and colony PCR is performed on the culture medium. The obtained PCR product is purified using AMPure XP, and then each DNA sequence of the purified DNA is analyzed using a sequencer. Among the obtained hit clones, those with duplicate sequences are counted as one, and the resulting clone sequence is designated as the unique VHH clone.

[0069] 6. Multi-point binding assay using Octet The interaction between purified VHH clones and target proteins was analyzed using biolayer interferometry. This can be done, for example, using OctetRED384 (Fortebio). Purified VHH is immobilized on a His1K sensor tip (Fortebio), and the target protein, prepared at approximately 100-200 nM and diluted 2-fold, is bound to it for measurement. Before measurement, the tip of the Dip and Read SA Biosensors is immersed in approximately 200 μL of PBS-T (PBS containing 0.05% Tween 20, pH approximately 7.4) for approximately 10 minutes to hydrate the sensor tip. Then, approximately 40-80 μL of each measurement solution is added to a 384-well plate, and the measurement can be performed in the steps 1) to 6) shown below.

[0070] 1) Baseline step: Measurement in PBS-T for approximately 60 seconds. 2) Loading step: Measure for approximately 120 seconds using purified VHH diluted approximately 100 times with PBS-T. 3) Baseline step: Measurement in PBS-T for approximately 60 seconds. 4) Association step: Measurement for approximately 120 seconds using FGFR1 extracellular domains prepared by diluting with PBS-T. 5) Dissociation step: Measurement in PBS-T for approximately 120 seconds. 6) Regeneration step: Repeat the measurement process at least three times, first in Glycine-HCl (pH approximately 2.2) for about 5 seconds, and then in PBS-T for about 5 seconds. After the measurement is complete, the Reference value (PBS-T only) is subtracted from the measured value, and global fitting is performed using Octet software with a 1:1 binding model to calculate affinity.

[0071] 8. Adjustment of VHH-Fc The Fc sequence of a human antibody is added to the unique VHH clone obtained above, according to a standard procedure. 8-1. Construction of a plasmid for VHH-Fc expression A VHH-Fc expression plasmid can be prepared, for example, by having a human Fc sequence synthesized by a gene synthesis service and inserting it into a plasmid containing a VHH clone sequence. Alternatively, if an Fc expression plasmid is already available, it can be prepared by inserting the VHH nucleotide sequence into that plasmid. This insertion can be performed, for example, by the restriction enzyme method described above, or by a system utilizing homologous recombination such as Gibson Assembly (New England Biolabs). In these cases, the restriction enzyme recognition sequence or homologous recombination sequence may be added by PCR according to conventional methods before insertion.

[0072] Competent cells, such as E. coli JM109, are transformed using the obtained VHH-Fc expression plasmid. The transformed E. coli are seeded onto an agar plate and cultured overnight at approximately 36-38°C. Colonies that appear are picked and cultured overnight under the same conditions to extract the VHH-Fc expression plasmid, which can then be further purified. For this procedure, for example, the FastGene Plasmid Mini Kit (Nippon Genetics Co., Ltd.) may be used. The DNA of the extracted plasmid is then sequenced.

[0073] 8-2. Expression of VHH-Fc VHH-Fc can be obtained by introducing the prepared VHH-Fc expression plasmid into suitable cultured cells, such as Expi293F cells (Thermo Fisher Scientific), and allowing them to secrete into the culture medium. Plasmid introduction can be performed using a general chemical transfection method, such as Expifectamine® 293 (Thermo Fisher Scientific) and Opti-MEM (Gibco), according to the attached manual. The cells are seeded in a flask and cultured at approximately 35-39°C and in an environment of approximately 6-10% CO2. The transfected cells are cultured for approximately 84-108 hours, after which the culture supernatant is collected. The cells can be removed from the culture supernatant by passing it through a 0.22 μm filter or the like. The culture supernatant obtained after the above treatment may hereafter be simply referred to as "supernatant".

[0074] 8-2. Purification of VHH-Fc The supernatant is purified of VHH-Fc via Protein A. For this purification, a column packed with Amsphere A3 (JSR Corporation, hereinafter referred to as "carrier") can be used, for example. The supernatant is applied to a column packed with approximately 400 to 600 μL of carrier. The carrier is washed by adding approximately 4 to 6 mL of PBS, approximately 4 to 6 mL of high-salt PBS (PBS containing approximately 1 M NaCl), and approximately 4 to 6 mL of PBS in this order. Then, the supernatant is eluted with approximately 4 to 6 mL of approximately 100 mM Glycine-HCl pH approximately 2.2 (Fujifilm Wako Pure Chemical Industries, Ltd.), and neutralized with approximately 400 to 600 μL of approximately 1 M Tris-HCl buffer (pH approximately 8.5). The eluted VHH-Fc is transferred to, for example, Amicon Ultra, 10 kDa (Millipore), and centrifuged at approximately 3,000 to 4,000 xg for approximately 25 to 35 minutes at approximately 4°C to concentrate the VHH-Fc. Then, approximately 3 to 5 mL of PBS is added, and centrifugation is performed under the same conditions as above to replace the solvent in the eluate with PBS. This PBS replacement procedure is repeated at least three times. The purity of the VHH-Fc purified in this manner can be confirmed by SDS-PAGE. Using bovine serum albumin as a standard protein, the concentration of the purified VHH-Fc can be quantified by the BCA method using, for example, the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific). VHH-Fc can be obtained in this manner.

[0075] While VHH-Fc obtained by the method described above is thought to be secreted into the culture supernatant as a homodimer, heterodimeric VHH-Fc can also be obtained by simultaneously transfecting with the two different VHH-Fc expression plasmids created above.

[0076] Composition containing the FGFR1 agonist VHH The present invention also relates to pharmaceutical and cosmetic compositions containing the FGFR1 agonist VHH. The term "cosmetic composition" as used herein includes pharmaceuticals and medicinal drugs. Furthermore, the term "cosmetic composition" as used herein also includes quasi-drugs.

[0077] The excipients disclosed herein may include, but are not limited to, water, glycerol, physiological saline, vegetable oils, fruit oils, flower extracts, mineral oils, synthetic oils, sugar compounds, silicates, calcium salts, magnesium salts, sodium chloride, potassium chloride, lactic acid, starch, sugar alcohols, cellulose, activated carbon, glycerin, butter, amino acids, paraffin, honey, wax, beeswax, agar, calcium carbonate, citric acid, tartaric acid, stearic acid, xanthan gum, benzoic acid, polyethylene glycol, silicone, its derivatives, its salts, or any combination thereof. The cosmetic composition may further include fillers, binders, disintegrants, coatings, adsorbents, anti-adhesion agents, lubricants, flow enhancers, antioxidants, surfactants, flavor and odor modifiers, solvents, buffers, chelating agents, viscosity modifiers, surfactants, wetting agents, or any combination thereof.

[0078] The composition of the present invention can be administered by various routes, including direct application to the skin, oral, intra-arterial, parenteral, intranasal, intravenous, intramuscular, intracardiac, intraventricular, intratracheal, oral cavity, rectal, intraperitoneal, intradermal, topical, transdermal, and intrathecal, or by implantation or inhalation, etc., and can be arbitrarily changed depending on the location of the lesion, etc., and is not particularly limited. The FGFR1 agonist VHH can be in the form of a solid, semi-solid, gel, liquid, or gaseous composition. Specific dosage forms include, but are not particularly limited, capsules, powders, granules, ointments, solutions, suppositories, enemas, injections, inhalants, liposomes, and aerosols. In another embodiment, the nucleic acid molecule encoding the FGFR1 agonist VHH can be supported in liposomes or on microparticles and delivered to the skin, organs, tissues, etc.

[0079] Pharmaceutical composition containing FGFR agonist VHH The pharmaceutical composition comprising the FGFR agonist VHH of the present invention is effective against diseases that are therapeutically mediated by FGF, particularly FGF2. For example, the pharmaceutical composition comprising the FGFR agonist VHH of the present invention can be used for the treatment and prevention of fibrosis, particularly pulmonary fibrosis. "Treatment" means a therapeutic measure that reduces the severity of a target disease or disorder, slows its progression, or stops its progression. In particular, in the present invention, "treatment" includes shrinking or stopping the growth of lesions, slowing their growth, delaying the progression of symptoms, suppressing or stopping their progression, delaying the progression of the disease, suppressing symptoms, completely or partially alleviating symptoms, or reducing the severity. "Treatment" also includes enhancing the effects of other drugs used in combination.

[0080] "Subjects" include, but are not limited to, humans and other mammals, laboratory mammals, domestic mammals, athletic mammals, and pet mammals. For example, patients suffering from fibrosis can be cited as subjects.

[0081] "Therapeutic dose" refers to the amount of an active substance effective in treating a disease or disorder in a subject. In this invention, for example, it refers to the amount of FGFR agonist VHH effective in slowing the progression of fibrosis in a subject. The therapeutic dose of FGFR agonist VHH in this invention may vary depending on the subject's condition, age, sex and weight, the amount and type of other drugs used in combination, and the activity of FGFR agonist VHH that elicits the desired response in the subject. The therapeutic dose also includes cases where the beneficial effect of the treatment exceeds the amount of undesirable effects that may occur due to FGFR agonist VHH.

[0082] The dosage and frequency of administration of FGFR agonist VHH can be appropriately adjusted according to the patient's condition. Examples of FGFR agonist VHH dosages include approximately 0.3 to 1.7 mg / kg, preferably approximately 0.5 to 1.5 mg / kg, and more preferably approximately 0.7 to 1.3 mg / kg. Examples of FGFR agonist VHH administration frequencies include once every approximately 6 to 7 days, once every approximately 8 to 9 days, once every approximately 10 to 12 days, and once every approximately 12 to 14 days.

[0083] Cosmetics containing FGFR agonist VHH The FGFR agonist VHH of the present invention can also be incorporated into cosmetics. For example, by including 0.1 ppm or more of FGFR agonist VHH in cosmetics, skin firmness can be improved and wrinkles caused by aging and ultraviolet rays can be reduced.

[0084] Culture medium composition containing FGFR agonist VHH FGFR agonist VHH can be used as a substitute for FGF2, or added to FGF2, to create a culture medium composition. In particular, FGFR agonist VHH can be used in a culture medium composition for cultured meat. The culture medium of the present invention is especially useful as a culture medium for cultured meat. While FGF added to culture media as a growth factor is very expensive, the FGFR1 agonist VHH of this invention has biological activity equivalent to that of natural FGF2 ligands, promotes the proliferation and differentiation of pluripotent stem cells (PSCs) for regenerative medicine and human mesenchymal stem cells, and can also maintain the characteristics of PSCs. Furthermore, it exhibits excellent thermal stability because its aggregation onset temperature (Tagg) is approximately 20°C higher than that of FGF2. Therefore, the FGFR1 agonist VHH antibody of the present invention has the potential to be used as a cost-effective substitute for FGF2 with excellent thermal stability in the cell preparation of stem cells in regenerative medicine and the production of cultured meat.

[0085] Suppression of cancer metastasis "Cancer" refers to a group of cells that proliferate independently, outside the body's autonomous control. Specifically, it refers to malignant tumors, which invade and metastasize to surrounding tissues, including epithelial carcinomas and non-epithelial sarcomas. A primary tumor and primary lesion refer to a lesion that originates in the primary site or tissue, and is not caused by progression, recurrence, or metastasis from another site. A metastatic tumor and metastatic lesion refer to a lesion that has spread from the primary site.

[0086] "Treatment" refers to therapeutic procedures that reduce the severity of a targeted disease or disorder, slow its progression, or halt its progression. In particular, in the present invention, "treatment" includes shrinking or stopping the growth of cancer or tumor lesions, slowing their growth, delaying the progression of cancer or tumors, inhibiting or stopping their progression, delaying metastasis, inhibiting or stopping metastasis, completely or partially alleviating symptoms, or reducing the severity of the disease. "Treatment" also includes enhancing the effects of other anticancer agents used in combination.

[0087] "Metastasis" of cancer refers to the process where cancer cells from the primary tumor travel through the blood or lymphatic system to other organs or tissues, establish themselves there, and then proliferate again to form a tumor. While not bound by any specific theory, in this invention, it is believed that the FGFR1 agonist VHH inhibits fibrosis in metastatic lesions, thereby inhibiting the establishment of cancer cells in other organs and thus preventing metastasis.

[0088] "Subjects" include, but are not limited to, humans and other mammals, rodents, monkeys, cats, dogs, horses, cattle, pigs, sheep, goats, laboratory mammals, domestic mammals, athletic mammals, and pet mammals. Examples of subjects include patients with cancer who are at risk of metastasis, and patients with cancer who already have metastatic lesions.

[0089] "Suppressing cancer metastasis" means delaying or preventing the re-formation of tumors in distant sites by slowing or blocking the migration, invasion, or attachment of tumor cells from the primary tumor or existing metastatic lesions, compared to when FGFR1 agonist VHH is not administered. While not bound by any specific theory, it is thought that FGFR1 agonist VHH inhibits fibrosis of cancer lesions, thereby inhibiting the establishment of cancer cells in distant sites, and / or, when used in combination with anticancer drugs, the anticancer drugs more effectively prevent the attachment of cancer cells in distant sites. In one embodiment, cancer metastasis is suppressed by at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90% compared to not administering the FGFR1 agonist VHH.

[0090] When administering the FGFR1 agonist VHH in combination with one or more other anticancer drugs, this includes cases where the FGFR1 agonist VHH and the anticancer drug are administered simultaneously and cases where they are administered sequentially. In the case of sequential administration, the administration of the FGFR1 agonist VHH and the anticancer drug can be carried out in any order, and this refers to cases where the anticancer drug is administered after the FGFR1 agonist VHH, or where the anticancer drug is administered before the FGFR1 agonist VHH. Furthermore, simultaneous or sequential administration of the anticancer drug and the FGFR1 agonist VHH can be carried out multiple times in succession.

[0091] "Pharmacologically acceptable carriers" refer to molecules and compositions that, when administered, are physiologically acceptable and do not normally cause harmful reactions. This includes non-toxic solid, semi-solid, gel-like, or liquid excipients, diluents, formulation aids, encapsulation materials, etc.

[0092] In one embodiment, the pharmaceutical composition of the present invention is effective against esophageal cancer, gastric cancer, liver cancer, biliary tract cancer, pancreatic cancer, colorectal cancer, breast cancer, lung cancer, various bone and soft tissue tumors, bone metastases, prostate cancer, bladder cancer, testicular cancer, kidney cancer, renal pelvis and ureteral cancer, penile cancer, retroperitoneal tumors, adrenal cancer, head and neck cancer, thyroid cancer, cervical cancer, uterine cancer, ovarian cancer, or skin cancer, and in particular, it suppresses metastasis from pancreatic cancer. For example, the pharmaceutical composition of the present invention suppresses liver metastasis from pancreatic cancer. Furthermore, the cancer is primary, locally advanced, unresectable, or metastatic cancer.

[0093] In this invention, any type of anticancer agent can be used in combination. Examples of anticancer agents include paclitaxel, actinomycin, cetuximab, bevacizumab, irinotecan, epirubicin, etoposide, oxaliplatin, asparaginase, alectinib, pemetrexed, ifosphamide, gefitinib, oxaliplatin, cyclophosphamide, nivolumab, carboplatin, cabazitaxel, imatinib, and Pecitabine, Amrubicin, Trastuzumab, Gemcitabine, Crizotinib, Cisplatin, Afatinib, Regorafenib, Capecitabine, Ramucirumab, Cytarabine, Gemcitabine, Sunitinib, Lapatinib, Erlotinib, Docetaxel, Degafur-uracil, Temozolomide, Liposomal Doxorubicin, Dacarbazine, Dasatinib, Paclitaxel Cell, tegafur / gimeracil / oteracil potassium, doxorubicin, vinorelbine, nimustine, nedaplatin, sorafinib, nogitecan, paclitaxel, eribulin, bertuzumab, vincristine, bleomycin, trastuzumab, vinorelbine, vinblastine, fluorouracil, panitumumab, mitomycin, melphalan, methotrexate, ramucirumab, levofolinate, trifluridine / tipiracil, rituximab, lenvatinib, anastrozole, exemestane, enzalutamide, goserelin, degalelis, bicalutamide, leuprorelin, abiraterone, ethinyl, chlormazine, tamoxifen, toremifene, flutamide, and trozole can be listed.

[0094] "Therapeutic effective dose" refers to the amount of an active substance effective in treating a disease or disorder in a subject. In this invention, it refers to the amount of FGFR1 agonist VHH effective in suppressing cancer metastasis in a subject. The therapeutic effective dose of FGFR1 agonist VHH in this invention may vary depending on the subject's condition, age, sex, and weight, the amount and type of anticancer drugs used in combination, and the activity of FGFR1 agonist VHH that elicits the desired response in the subject. The therapeutic effective dose also includes cases where the beneficial effect of the treatment exceeds the undesirable effects that may occur due to FGFR1 agonist VHH.

[0095] The dosage and frequency of administration of the FGFR1 agonist VHH can be appropriately adjusted according to the patient's condition and the state of the cancerous lesion. Examples of FGFR1 agonist VHH dosages include approximately 0.3 to 1.7 mg / kg, preferably approximately 0.5 to 1.5 mg / kg, and more preferably approximately 0.7 to 1.3 mg / kg. Examples of FGFR1 agonist VHH administration frequencies include once every approximately 6 to 7 days, once every approximately 8 to 9 days, once every approximately 10 to 12 days, and once every approximately 12 to 14 days.

[0096] FGFR1 agonist VHH can be administered by various routes, including but not limited to oral, intra-arterial, parenteral, intranasal, intravenous, intramuscular, intracardiac, intraventricular, intratracheal, oral cavity, rectal, intraperitoneal, intradermal, topical, percutaneous, and intrathecal, or by implantation or inhalation, and can be arbitrarily changed depending on the location of the lesion. FGFR1 agonist VHH can be in the form of solid, semi-solid, liquid, or gas formulations. Specific dosage forms include, but are not limited to, capsules, powders, granules, ointments, solutions, suppositories, enemas, injections, inhalants, liposomal formulations, and aerosols. In another embodiment, nucleic acid molecules encoding FGFR1 agonist VHH can be supported in liposomes or on microparticles and delivered to the lesion.

[0097] Examples of embodiments of the present invention are listed below. [1] A fibroblast growth factor receptor (FGFR) agonist VHH, wherein the VHH is (1) CDR1, CDR2, and CDR3, each containing the amino acid sequences of SEQ ID NOs. 32, 33, and 1, respectively (2) CDR1, CDR2, and CDR3, each containing the amino acid sequences of SEQ ID NOs. 34, 35, and 2, respectively (3) CDR1, CDR2 and CDR3, each containing the amino acid sequences of SEQ ID NOs. 36, 37 and 3, respectively, and (4) CDR1, CDR2, and CDR3 containing the amino acid sequences of SEQ ID NOs. 38, 39, and 4, respectively. A humanized FGFR agonist VHH comprising CDR1, CDR2, and CDR3 selected from the group consisting of the following. [2] An FGFR agonist VHH as described in item [1], comprising the amino acid sequence described in any one of SEQ ID NOs. 5 to 8, or an amino acid sequence having at least 90% identity with the amino acid sequence described in any one of SEQ ID NOs. 5 to 8. [3] A VHH-Fc obtained by adding the Fc sequence of a human antibody, which is an FGFR agonist VHH as described in item [1] or [2]. [4] A dimer of FGFR agonist VHH as described in any of items [1] to [3]. [5] A composition comprising the FGFR agonist VHH described in any of items [1] to [4]. [6] A pharmaceutical composition comprising the FGFR agonist VHH described in any of items [1] to [5]. [7] Pharmaceutical compositions as described in item [6] for the treatment of fibrosis. [8] The pharmaceutical composition described in item [7], wherein the fibrosis is hepatic fibrosis. [9] A pharmaceutical composition according to any of items [1] to [5], used to suppress the metastasis of cancer.

[10] The pharmaceutical composition described in item [9], wherein the metastasis is liver metastasis.

[0098]

[11] FGFR agonist VHH as described in any of items [1] to [5] for use as a medicine.

[12] FGFR agonist VHH as described in item

[11] for use in the treatment of fibrosis.

[13] FGFR agonist VHH as described in item

[12] , where fibrosis is hepatic fibrosis.

[14] FGFR agonists VHH as described in any of items [1] to [5], for use in suppressing cancer metastasis.

[15] FGFR agonist VHH as described in item

[14] , where the metastasis is liver metastasis.

[0099]

[16] Use of any of the FGFR agonists VHH described in items [1] to [5] for the manufacture of pharmaceuticals.

[17] Use of the FGFR agonist VHH described in item

[16] for the manufacture of pharmaceuticals for the treatment of fibrosis.

[18] Use of item

[17] Fibrosis is hepatic fibrosis.

[19] Use of FGFR agonists VHH as described in any of items [1] to [5] for the manufacture of pharmaceuticals for the suppression of cancer metastasis.

[20] Use as described in item

[19] when the metastasis is liver metastasis.

[0100]

[21] A method for treating fibrosis in a patient, comprising the step of administering a VHH FGFR agonist described in any of items [1] to [5] to a patient with fibrosis.

[22] The method described in item

[21] , wherein fibrosis is hepatic fibrosis.

[23] A method for suppressing cancer metastasis in a patient, comprising the step of administering a VHH FGFR agonist described in any of items [1] to [5] to a patient with cancer.

[24] The method described in item

[23] , wherein the metastasis is liver metastasis. [Examples]

[0101] The present invention will be further described below using examples, but the scope of the present invention is not limited to the following examples.

[0102] (Example 1) Synthesis of cDNA display using PharmaLogical (PL) library The synthesis of cDNA displays using the PharmaLogical (PL) library was carried out in the following steps, similar to the scheme in Figure 1. (1) cnv Preparation of the K rG Linker (hereinafter sometimes simply referred to as "cnvK linker") The cnvK linker has a main chain and side chains, and the base sequence of the biotin fragment that forms the main chain is 3'-AAgAATTTCCAKGCCGCCCCCCGVCCT-3' (SEQ ID NO: 17). Here, BioTEG is bound to the 5' end of the main chain. In the base sequence, g represents guanosine, V represents Amino C6-dT, and K represents 3-cyanovinylcarbazole. Furthermore, the puromycin segment that forms the side chain of the cnvK linker has the structure 5'-(5S)TCTFZZCCP-3'. The free end P in the above side chain sequence represents puromycin as a protein binding site. (5S) represents 5' Thiol C6, F represents FITC-dT, and Z represents SpaceR18. The chemical synthesis of the above main chain and side chain was outsourced to Tsukuba Oligo Service Co., Ltd. (Ushiku City, Ibaraki Prefecture).

[0103] First, 15 nmol of biotin fragment (final concentration 150 μM) and EMCS (Dojin Chemical Laboratories, final concentration 16.7 mM) were added to 0.2 M sodium phosphate buffer (pH 7.2), and incubated at 37 °C for 30 minutes. Subsequently, ethanol precipitation was performed using Quick-Precip Plus Solution (Edge BioSystems). Next, 37.5 nmol of the puromycin segment was dissolved in 1 M disodium hydrogen phosphate aqueous solution containing 50 mM DTT to a final concentration of 417 μM, and the mixture was stirred at room temperature for 1 hour using a shaker. Then, the buffer was replaced with 0.02 M sodium phosphate buffer (pH 7.0) containing 0.03 M NaCl using an NAP5 column (GE Healthcare Biosciences).

[0104] The buffer-exchanged reduced puromycin segment solution was mixed with the ethanol precipitate of the EMCS-modified biotin fragment and left overnight at 4°C. Subsequently, DTT was added to the reaction mixture to a final concentration of 50 mM, and the mixture was stirred at room temperature for 30 minutes. Ethanol precipitation was then performed using Quick-Precip Plus Solution (Edge BioSystems). The ethanol precipitate was dissolved in 100 μL of Nuclease-free water (Nacalai Tesque).

[0105] The lysate was separated by 12% polyacrylamide gel electrophoresis, and the cnvK linker fraction was excised. The excised gel was crushed using a Biomassher II set (Nippi), 500 μL of nuclear-free water was added, and the mixture was stirred overnight at 4°C to extract the cnvK linker. The stirred solution was transferred to a Costar® Spin-X® centrifuge tube filter and 0.22 μm cellulose acetate (corning), and then centrifuged at 16,000 xg for 15 minutes to separate the gel from the extracted liquid. Subsequently, ethanol precipitation was performed using Quick-Precip Plus Solution to obtain the target cnvK linker (Figure 2). The obtained cnvK linker was dissolved in nuclear-free water and stored at -20°C.

[0106] (2) Preparation of cDNA for VHH-presented cDNA display (2-1) Transcription The applicant's PharmaLogical DNA library (manufactured by Epsilon Molecular Engineering, Inc., full-length VHH encoding DNA library) was transcribed to mRNA using the T7 RiboMAX Express Large Scale RNA Production System (Promega) according to the attached manual. The amount of DNA used was 6.6 μg. Subsequent selections were performed using 0.1 to 1 μg of DNA from the second round onward. The resulting transcripts were purified using RNAClean XP (Beckman Coulter) according to the attached manual to obtain purified products. The concentration of the purified products was quantified using NanoPad DS-11 FX (DeNovix).

[0107] (2-2) Ligation 20 pmol of purified mRNA and 20 pmol of cnvK linker were mixed with NaCl (final concentration 0.2 M) and Tris-HCl buffer (pH 7.5, final concentration 50 mM) and incubated at 90°C for 1 minute. The mixture was then cooled to 70°C at a rate of 0.1°C / second and incubated at 70°C for 1 minute. Next, the mixture was cooled to 25°C at a rate of 0.1°C / second, followed by a further cooling to 10°C at a rate of 2°C / second to hybridize the cnvK linker to the 3' end of the mRNA. Finally, UVP CRossLinker (catalog number CL-3000, 365 nm, 100-115V (Analytik Jena)) was used to apply 4,060 μJ / cm² of 365 nm UV light. 2 Irradiation was performed to photocrosslink the cnvK linker and mRNA, thereby obtaining an mRNA-linker complex.

[0108] (2-3) Preparation of mRNA display Using a 50 μL cell-free translation system (PUREfrex® 1.0, Gene Frontier), 20 pmol of mRNA-linker complexes were incubated in tubes at 37°C for 30 minutes. MgCl2 and KCl were then added to the tubes to final concentrations of 75 mM and 900 mM, respectively, and incubated at 37°C for 1 hour to display the mRNA-corresponding peptides on the puromycin in the mRNA-linker conjugates. Next, EDTA (pH 8.0) was added to these tubes to a final concentration of 70 mM, and incubated at 4°C for 5 minutes to prepare the mRNA display.

[0109] (2-4) Preparation of cDNA display 60 μL of Dynabeads Myone streptavidin C1 (Thermo Fisher Scientific) was transferred to a new tube and washed with 200 μL of binding buffer. Then, the mRNA display prepared by the methods described in (2-1)-(2-3) above was added and stirred at 25°C for 30 minutes. 200 μL of binding buffer was added and washed again. The mixture was then incubated in a reaction solution with the composition shown in Table 1 below at 42°C for 30 minutes to perform a reverse transcription reaction and prepare mRNA / cDNA-VHH conjugates.

[0110] [Table 1]

[0111] After the reverse transcription reaction was complete, 200 μL of binding buffer was added for washing, and then 39 μL of His tag binding / washing buffer and 1 μL of 1,000 U / μL RNase T1 were added and the mixture was stirred at 37°C for 15 minutes to elute the mRNA / cDNA-VHH conjugate (hereinafter sometimes referred to as "cDNA display molecule") from Dynabeads Myone streptavidin C1.

[0112] (Example 2) Selection of VHH for the extracellular domain of FGFR1 and analysis of its sequence (1) Biotinylation of the extracellular domain of FGFR1 30 μL of PBS containing 300 pmol of Recombinant Human FGFR1 protein (hereinafter sometimes abbreviated as "FGFR1," manufactured by abcam) was mixed with 1.5 nmol of biotinylation reagent (EZ-Link® Sulfo-NHS-LC-Biotin, manufactured by Thermo Fisher Scientific) and reacted at room temperature for 30 minutes. 0.5 mL of PBS-T was replaced with Zeba® Spin Desalting Columns, 7K MWCO, (manufactured by Thermo Fisher Scientific) according to the instructions, and the reaction mixture obtained as described above was added. The mixture was centrifuged at 1,500 xg for 2 minutes, and the buffer in the reaction mixture was replaced with PBS-T to remove unreacted biotinylation reagent and obtain biotinylated FGFR1.

[0113] (2) Selection based on FGFR Selection was performed using the cDNA display prepared in (1) above. Selection was carried out in rounds 1 to 5. The synthesis scale of the VHH-presented cDNA display library used in each selection round is shown in Table 2. Round 1 shown in Table 2 below is sometimes referred to as "R1".

[0114] [Table 2]

[0115] (3) Screening procedure for Selection Cycle 1 (R (Round) 1) 50 pmol of biotinylated FGFR1 prepared in (1) above was added to a tube containing 100 μL of Dynabeads Myone streptavidin C1, and the mixture was inverted and mixed at 4°C for 30 minutes to prepare biotinylated FGFR1 solid-phase beads.

[0116] The cDNA display molecules prepared according to the synthesis scale in Table 2 above were diluted to 100 μL with PBS-T. This dilution was added to a tube containing biotinylated FGFR1 immobilized beads, and the mixture was inverted and mixed at 25°C for 30 minutes. The tube was allowed to stand, the supernatant was collected, and the beads were washed four times with PBS-T.

[0117] The supernatant collected above and 50 pmol of biotinylated FGFR1 were mixed in a new tube and inverted and mixed at 25°C for 30 minutes to obtain a mixture. Then, this mixture was added to a tube containing 100 μL of Dynabeads Myone streptavidin C1 and inverted and mixed at 25°C for 30 minutes to immobilize the biotinylated FGFR1 containing the cDNA display-biotinylated FGFR1 complex onto the beads. The tube containing the beads was washed with PBS-T. This washing procedure was performed four times. Next, the beads were added to this tube, and all the beads were combined into one tube.

[0118] Subsequently, the cDNA display molecules bound to the beads were recovered and purified using AMpure XP (Beckman Coulter) according to the attached manual. The purified solution was amplified by PCR using cnvK NewYtag for poly A (SEQ ID NO: 18: 5'-TTTCCACGCCGCCCCCCGTCCT-3') and PL_T7pro (SEQ ID NO: 19: 5'-GATCCCGCGAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTC -3') as primers on PrimeSTAR Max (Takara Bio) under the conditions shown in Table 3 below to obtain PCR product 1.

[0119] [Table 3]

[0120] Subsequently, the obtained PCR products were analyzed by 4% denatured PAGE. After purifying the PCR products using AMpure XP according to the attached manual, the resulting purified material was used as the R1 library for the second round of selection.

[0121] (4) Screening procedure for selection cycle 2 (R2) 10 pmol of biotinylated FGFR1 was added to a tube containing 10 μL of Dynabeads Myone streptavidin C1, and the mixture was inverted and mixed at 4°C for 30 minutes to prepare biotinylated FGFR1 solid-phase beads.

[0122] A cDNA display library was prepared from the R1 library obtained in (3) above using the same method as described above, according to the synthesis scale shown in Table 2. This library was diluted to 100 μL with PBS-T containing 2.5 μL of 200 mg / mL heparin solution, and 50 μL was added to a tube containing biotinylated FGFR1 immobilized beads. The mixture was then inverted and mixed at 25°C for 30 minutes.

[0123] Next, the remaining 50 μL of supernatant was added to a tube containing 10 pmol of biotinylated FGFR1 and mixed. The mixture was then inverted and mixed at 25°C for 30 minutes to obtain a mixed solution. This mixture was added to a new tube containing 20 μL of Dynabeads Myone streptavidin C1 and inverted and mixed at 25°C for 30 minutes to immobilize the biotinylated FGFR1, including the cDNA display-biotinylated FGFR1 complex, onto the beads. All of these beads were then placed in a single tube and washed with 200 μL of PBS-T containing 0.2% BSA. This washing procedure was repeated three times.

[0124] Subsequently, the beads were washed with 20 μL of PBS-T containing 0.2% BSA by inverting and mixing at room temperature for 15 minutes. The cDNA display molecules bound to the beads were recovered and purified using AMpure XP according to the accompanying manual to obtain a purified solution. This purified solution was subjected to PCR under conditions equivalent to R1, except that the number of cycles was set to 20, to obtain PCR product 2. PCR product 2 was purified using AMpureXP according to the accompanying manual to obtain the R2 library.

[0125] (5) Screening procedure for Selection Cycle 3 (R3) Using the same method as described above, the cDNA display library was placed in a tube from the R2 library and prepared according to the synthesis scale shown in Table 2. PBS-T containing 0.05% BSA was added to this tube to dilute it to 100 μL, which was used as the diluent. Then, 20 μL of this diluent was added to Dynabeads Myone streptavidin T1, and the mixture was inverted and mixed at 4°C for 30 minutes to obtain the mixture. After mixing, the mixture was allowed to stand, and the supernatant was collected. This collected supernatant was mixed with 10 pmol of biotinylated FGFR1, and the mixture was inverted and mixed at 4°C for 30 minutes to obtain the mixture. This mixture was added to a tube containing 20 μL of Dynabeads Myone streptavidin T1, and the mixture was inverted and mixed at 4°C for 30 minutes to immobilize the biotinylated FGFR1, including the cDNA display-biotinylated FGFR1 complex, onto beads.

[0126] The tube containing the beads was washed with 200 μL of PBS-T containing 0.05% BSA. This washing procedure was repeated three times. Then, 20 μL of PBS-T containing 0.05% BSA was added to the tube containing the beads, and the tube was washed again by inverting and mixing at room temperature for 15 minutes. The cDNA display molecules bound to the beads were collected and purified using AMpure XP according to the attached manual to obtain a purified solution. This purified solution was amplified by PCR under the same conditions as R1, except that the number of cycles was set to 22, to obtain PCR product 3. PCR product 3 was purified using AMpureXP according to the attached manual to obtain the R3 library.

[0127] (6) Screening procedure for Selection Cycle 4 (R4) Using the same method as described above, cDNA was transferred from the R3 library into cDNA display library tubes and prepared according to the synthesis scale shown in Table 2. Subsequently, the enriched library (R4 library) was obtained by performing the same procedure as for R3, except that Dynabeads Myone streptavidin C1 was used instead of Dynabeads Myone streptavidin T1 and the number of PCR cycles was 12.

[0128] (7) Analysis of screening products by NGS The concentrated library, which is the screening product obtained in the procedure described in (6) above, was subjected to the following processing in order to be analyzed by a next-generation sequencer (hereinafter sometimes abbreviated as "NGS"). First, the concentrated library described above was subjected to PCR and amplified under the following conditions to obtain the PCR product. The reaction mixture consisted of 5 μL of PrimeSTAR MAX, 1 μL of the concentrated screening product, 2 pmol each of primers, PL_prRd-N4_NL_FW (sequence number 15 in the sequence listing) and PL_prRd-N4_Ytag_RV (sequence number 16 in the sequence listing), placed in a tube and adjusted to 10 μL with ultrapure water.

[0129] The PCR program was performed under the same conditions as in Table 3, except that the annealing temperature was 62°C and the number of cycles including denaturation was 12, and PCR products were obtained. The obtained PCR products were purified using AMPure XP, and Index PCR was performed using purified product 4 as a template. The reaction mixture for Index PCR consisted of 12.5 μL of PrimeSTAR MAX, 1 μL of the purified product 4, 0.5 μL of 5 μM forward / reverse primers (Nextera XT Index 1 Primers (N7XX), Nextera XT Index 2 Primers (S5XX)), and 10.5 μL of ultrapure water.

[0130] The PCR program was performed under the same conditions as in Table 3, except that the annealing temperature was set to 52°C and the number of cycles including denaturation was set to 8, and PCR products were obtained. The Index PCR product was purified using AMPure XP in the same manner to obtain purified product 5, and the DNA concentration of purified product 5 was measured using NanoPad DS-11. After diluting the Index PCR purified product to 10 nM with RNase-free water, each product was collected in 5 μL portions in a single tube and mixed. Subsequently, an NGS sample library was prepared according to the instructions for MiSeq (Illumina), and analysis was performed using MiSeq Reagent Nano Kit v2 (500 Cycles) (Illumina). The DNA sequences obtained from NGS were translated into amino acid sequences to obtain VHH sequences that bind to each target molecule.

[0131] (8) Evaluation of primary binding of VHH (8-1) Construction of a VHH expression plasmid library To evaluate the primary binding of VHH, a VHH expression plasmid library was prepared as follows. The DNA libraries encoding VHH selected by the above screening were cloned into plasmid vectors for VHH expression. First, sequences for restriction enzyme treatment were added to the DNA libraries obtained by screening using PCR according to a standard method, and PCR products were obtained. The reaction mixture consisted of 25 μL of PrimeSTAR MAX, 1 μL of the screening product, 10 pmol each of primers, PL_VHH_SfiI-NcoI_FW (SEQ ID NO: 20) and PL_VHH_BamHI-NotI_RV (SEQ ID NO: 21), added to a tube and adjusted to 50 μL with ultrapure water. The sequences of the two primers are shown below.

[0132] 5'-ccggcCatggccACTGCggccGAAGTACAATTAGTTGAATCTGGTGGTGGGCTTG-3' (Sequence ID 20) 5'-AAAAgcggccgcggatccTGAAGAGACTGTCACCAACGTGCC-3' (Sequence ID 21)

[0133] The PCR program was the same as in Table 3, except that the annealing temperature was set to 55°C and the number of cycles including denaturation was set to 25, and PCR products were obtained. These PCR products and the C. glutamicum expression plasmid vector were treated with the restriction enzyme BamHI at 37°C for 1 hour, and then with the restriction enzyme SfiI at 50°C for 1 hour. The reaction mixture derived from the PCR product to be used as insert DNA was purified with AMPureXP, and the reaction product derived from the plasmid vector was subjected to 1% agarose gel electrophoresis at 100V for 30 minutes. After electrophoresis, the product was excised from the gel and purified to obtain the purified product.

[0134] The purified plasmid vector DNA was dephosphorylated using the dephosphorylation enzyme Fast AP Thermosensitive Alkaline Phosphatase (Thermo Scientific) at 37°C for 1 hour. Subsequently, the Insert DNA and plasmid vector DNA were mixed in a molar ratio of 1:10, and a ligation reaction was performed overnight at 16°C using Ligation High (Toyobo Co., Ltd.) to obtain a plasmid library into which the selected VHH library had been introduced.

[0135] (8-2) Production of VHH (culture supernatant) Each plasmid obtained in (8-1) above was introduced into C. glutamicum by electroporation to obtain transformants. The obtained transformants were inoculated into CM2G medium and pre-cultured overnight at 30°C. Subsequently, the transformants contained in the CM2G culture medium were subcultured into PM1S medium for VHH expression and cultured at 25°C for 72 hours to induce secretory expression of VHH in the culture supernatant. The culture supernatant was centrifuged at 4,000xg for 30 minutes, and the culture supernatant was collected. This culture supernatant was then passed through a 0.22 μm filter to remove bacterial cells and obtain VHH clones.

[0136] (8-3) Octet single-point binding assay Using OctetRED384 (Fortebio), the VHH clones obtained as described above were immobilized on a His1K sensor tip, and their binding activity to FGFR1(IIIc)-Fc (R&D) was measured. As an analyte, the concentration of FGFR1(IIIc)-Fc (R&D) was prepared to 200 nM, and 70 μL of the measurement solution was added to a 384-well plate to measure the binding to the VHH clones. Before measurement, the tip of the Dip and Read® His1K Biosensors (Fortebio) was immersed in 200 μL of PBS-T (PBS containing 0.05% Tween20, pH 7.4) for 10 minutes to hydrate the sensor tip.

[0137] The conditions for the measurement order for each run were as follows: 1) Baseline step: Measurement in PBS-T for 30 seconds. 2) Loading step: Measure VHH diluted 50-fold with PBS-T for 60 seconds. 3) Baseline step: Measurement in PBS-T for 30 seconds. 4) Association step: Measure FGFR1(IIIc)-Fc diluted with PBS-T for 100 seconds. 5) Dissociation step: Measurement in PBS-T for 100 seconds. 6) Regeneration step: Measurements were taken for 5 seconds in Glycine-HCl (pH 2.2) and for 30 seconds in PBS-T. The above process was repeated three times. The obtained data was processed using Octet software version (1.2.1.5) (Molecular Devices). Figure 3 shows the binding response of each clone VHH to FGFR1(IIIc)-Fc obtained from the Octet single-point binding assay. 35 clones showing a binding response of 0.1 nm or greater were obtained and designated as hit clones.

[0138] (8-4) Sequence analysis of hit clones Each VHH gene in the hit clone was identified by sequence analysis. The transformants that were hit clones were cultured overnight at 37°C, and colony PCR was performed on the culture medium. The obtained PCR products were purified using AMPure XP, and then the DNA was sent to Eurofins Genomics for analysis. Only one copy of each hit clone with a duplicate sequence was counted, and these obtained clones were designated as unique VHH clones.

[0139] (Example 3) Selection of VHH for FGFR1 domain II and sequence analysis thereof (1) Biotinylation of FGFR1 domain II 40 μL of PBS containing 400 pmol of Human FGFR1 domain II-FC protein (hereinafter sometimes abbreviated as "FGFR1 domain II-Fc") was mixed with 20 nmol of biotinylation reagent (EZ-Link® Sulfo-NHS-LC-Biotin, Thermo Fisher Scientific) and reacted at room temperature for 30 minutes. 0.5 mL of PBS-T was replaced with Zeba® Spin Desalting Columns, 7K MWCO, (Thermo Fisher Scientific) according to the instructions, and the reaction mixture obtained as described above was added. The mixture was centrifuged at 1,500 xg for 2 minutes, the buffer in the reaction mixture was replaced with PBS-T, and unreacted biotinylation reagent was removed to obtain biotinylated FGFR1 domain II-Fc.

[0140] (2) Selection for FGFR1 domain II Selection was performed using the cDNA display prepared in (1) above. Selection was carried out in rounds 1 to 4. The synthesis scale of the VHH-presented cDNA display library used in each selection round is shown in Table 2 above.

[0141] (3) Screening procedure for Selection Cycle 1 (R (Round) 1) 50 pmol of biotinylated FGFR1 domain II-Fc prepared in (1) above was added to a tube containing 50 μL of Dynabeads Myone streptavidin C1, and the mixture was inverted and mixed at 25°C for 30 minutes to prepare biotinylated FGFR1 domain II-Fc solid-phase beads.

[0142] The cDNA display molecules prepared according to the synthesis scale shown in Table 2 were diluted to 100 μL with PBS-T and added to a tube containing biotinylated FGFR1 domain II-Fc immobilized beads. The mixture was then inverted and mixed at 25°C for 30 minutes. The tube was allowed to stand, the supernatant was collected, and the beads were washed four times with PBS-T.

[0143] The supernatant collected above and 100 pmol of biotinylated FGFR1 domain II-Fc were mixed in a new tube and inverted and mixed at 25°C for 30 minutes to obtain a mixture. Then, this mixture was added to a tube containing 200 μL of Dynabeads Myone streptavidin C1 and inverted and mixed at 4°C for 30 minutes to immobilize the biotinylated FGFR1 domain II-Fc, which contains the cDNA display-biotinylated FGFR1 domain II-Fc complex, onto the beads. The tube containing the beads was washed with PBS-T. This washing procedure was performed four times. Next, the beads were added to this tube, and all the beads were combined into one tube.

[0144] Subsequently, the cDNA display molecules bound to the beads were recovered and purified using AMpure XP (Beckman Coulter) according to the attached manual. The purified solution was amplified by PCR using cnvK NewYtag for poly A (SEQ ID NO: 18) and PL_T7pro (SEQ ID NO: 19) as primers on PrimeSTAR Max (Takara Bio) under the conditions described in Table 3 to obtain PCR product 1.

[0145] Subsequently, the obtained PCR products were analyzed by 4% denatured PAGE. After purifying the PCR products using AMpure XP according to the attached manual, the resulting purified material was used as the R1 library for the second round of selection.

[0146] (4) Screening procedure for selection cycle 2 (R2) A cDNA display library was prepared from the R1 library obtained in (3) above using the same method as described above, according to the synthesis scale shown in Table 2, diluted to 100 μL with PBS-T, and then added to a tube containing 20 μL of Dynabeads Myone streptavidin C1, and mixed by inversion at 25°C for 30 minutes.

[0147] After mixing was complete, the tube was allowed to stand, the supernatant was collected, and diluted to 1000 μL with PBS-T containing 10 pmol of biotinylated FGFR1 domain II-Fc, 0.4% Block Ace (KAC), and 100 pmol of IgG1 Protein (Human, Recombinant). The mixture was inverted and mixed at 25°C for 30 minutes to obtain a mixture. This mixture was added to a new tube containing 20 μL of Dynabeads Myone streptavidin C1, and the mixture was inverted and mixed at 25°C for 30 minutes to immobilize the biotinylated FGFR1 domain II-Fc, including the cDNA display-biotinylated FGFR1 domain II-Fc complex, onto the beads. All of these beads were placed into a single tube, and then washed with 200 μL of PBS-T. This washing procedure was performed three times.

[0148] Subsequently, the beads were washed with 40 μL of PBS-T by inversion mixing at room temperature for 15 minutes. The cDNA display molecules bound to the beads were recovered and purified using AMpure XP according to the attached manual to obtain a purified solution. This purified solution was amplified by PCR under conditions equivalent to R1, except that the number of cycles was set to 20, to obtain PCR product 2. PCR product 2 obtained was purified using AMpureXP according to the attached manual and prepared as the R2 library.

[0149] (5) Screening procedure for Selection Cycle 3 (R3) Using the same method as described above, the cDNA display library was placed in a tube from the R2 library and prepared according to the synthesis scale shown in Table 2. This was then diluted to 100 μL with PBS-T to prepare a diluent. This diluent was then added to a tube containing 20 μL of Dynabeads Myone streptavidin C1, and the mixture was inverted and mixed at 25°C for 30 minutes.

[0150] After mixing was complete, the tube was allowed to stand, the supernatant was collected, and diluted to 1000 μL with PBS-T containing 10 pmol of biotinylated FGFR1 domain II-Fc, 0.4% Block Ace (KAC), and 100 pmol of IgG1 Protein (Human, Recombinant). The mixture was inverted and mixed at 25°C for 30 minutes to obtain a mixture. This mixture was added to a new tube containing 20 μL of Dynabeads Myone streptavidin C1, and the mixture was inverted and mixed at 25°C for 30 minutes to immobilize the biotinylated FGFR1 domain II-Fc, including the cDNA display-biotinylated FGFR1 domain II-Fc complex, onto the beads. All of these beads were placed into a single tube, and then washed with 200 μL of PBS-T. This washing procedure was performed three times.

[0151] Subsequently, the beads were washed with 20 μL of PBS-T by inverting and mixing for 15 minutes at room temperature. The cDNA display molecules bound to the beads were recovered and purified using AMpure XP according to the attached manual to obtain a purified solution. This purified solution was subjected to PCR under conditions equivalent to R1, except that the number of cycles was set to 20, to obtain PCR product 3. PCR product 3 was purified using AMpureXP according to the attached manual to obtain the R3 library.

[0152] (6) Screening procedure for Selection Cycle 4 (R4) Using the same method as described above, cDNA was transferred from the R3 library into a cDNA display library tube and prepared according to the synthesis scale shown in Table 2. This was then diluted to 100 μL with PBS-T, and added to a tube containing 20 μL of Dynabeads Myone streptavidin C1. The mixture was inverted and mixed at 25°C for 30 minutes. Subsequently, this diluted solution was added to a tube containing 20 μL of Dynabeads Myone streptavidin C1, and the mixture was inverted and mixed at 4°C for 30 minutes to obtain a mixture. After that, the procedure was the same as for R3, except that Dynabeads Myone streptavidin C1 was used instead of the original Dynabeads Myone streptavidin C1 and the number of PCR cycles was set to 15, to obtain a concentrated library (R4 library).

[0153] (7) Screening procedure for Selection Cycle 5 (R5) Using the same method as described above, cDNA was transferred from the R4 library into a cDNA display library tube and prepared according to the synthesis scale shown in Table 2. This was then diluted to 100 μL with PBS-T, and added to a tube containing 20 μL of Dynabeads Myone streptavidin C1. The mixture was inverted and mixed at 25°C for 30 minutes. Subsequently, this diluted solution was added to a tube containing 20 μL of Dynabeads Myone streptavidin C1, and the mixture was inverted and mixed at 4°C for 30 minutes to obtain a mixture. After that, the procedure was the same as for R4, except that Dynabeads Myone streptavidin C1 was used instead of the original Dynabeads Myone streptavidin C1 and the number of PCR cycles was set to 12, to obtain a concentrated library (R5 library).

[0154] (8) Analysis of screening products by NGS The concentrated library, which is the screening product obtained in the procedure described in (7) above, was subjected to the following processing in order to be analyzed by NGS. First, the concentrated library described above was subjected to PCR and amplified under the following conditions to obtain the PCR product. The reaction mixture consisted of 5 μL of PrimeSTAR MAX, 1 μL of the concentrated screening product, 2 pmol each of primers, PL_prRd-N4_NL_FW (SEQ ID NO: 15) and PL_prRd-N4_Ytag_RV (SEQ ID NO: 16), placed in a tube and adjusted to 10 μL with ultrapure water.

[0155] The PCR program was performed in the same manner as in Table 3 above, except that the annealing temperature was set to 62°C and the number of cycles including denaturation was set to 12 cycles, and PCR products were obtained. The obtained PCR products were purified using AMPure XP, and Index PCR was performed using purified product 4 as a template. The reaction mixture for Index PCR consisted of 12.5 μL of PrimeSTAR MAX, 1 μL of the purified product 4, 0.5 μL of 5 μM forward / reverse primers (Nextera XT Index 1 Primers (N7XX), Nextera XT Index 2 Primers (S5XX)), and 10.5 μL of ultrapure water.

[0156] The PCR program was performed in the same manner as in Table 3 above, except that the annealing temperature was set to 52°C and the number of cycles including denaturation was set to 8, and PCR products were obtained. The Index PCR product was purified using AMPure XP in the same manner to obtain purified product 5, and the DNA concentration of purified product 5 was measured using NanoPad DS-11. After diluting the Index PCR purified product to 10 nM with RNase-free water, each product was collected in 5 μL portions in a single tube and mixed. Subsequently, an NGS sample library was prepared according to the instructions for MiSeq (Illumina), and analysis was performed using MiSeq Reagent Nano Kit v2 (500 Cycles) (Illumina). The DNA sequences obtained from NGS were translated into amino acid sequences to obtain VHH sequences that bind to each target molecule.

[0157] (9) Evaluation of primary binding of VHH (9-1) Construction of a VHH expression plasmid library To evaluate the primary binding of VHH, a VHH expression plasmid library was prepared as follows. The DNA libraries encoding VHH selected by the above screening were cloned into plasmid vectors for VHH expression. First, sequences for restriction enzyme treatment were added to the DNA libraries obtained by screening using the standard PCR method to obtain PCR products. The reaction mixture consisted of 25 μL of PrimeSTAR MAX, 1 μL of the screening product, 10 pmol each of primers, PL_VHH_SfiI-NcoI_FW (SEQ ID NO: 20) and PL_VHH_BamHI-NotI_RV (SEQ ID NO: 21), added to a tube and adjusted to 50 μL with ultrapure water.

[0158] The PCR program was performed in the same manner as in Table 3, except that the annealing temperature was set to 55°C and the number of cycles including denaturation was 25, and PCR products were obtained. These PCR products and the C. glutamicum expression plasmid vector were treated with the restriction enzyme BamHI at 37°C for 1 hour, and then with the restriction enzyme SfiI at 50°C for 1 hour. The reaction mixture derived from the PCR product to be used as insert DNA was purified with AMPureXP, and the reaction product derived from the plasmid vector was subjected to 1% agarose gel electrophoresis at 100 V for 30 minutes. After electrophoresis, the product was excised from the gel and purified to obtain the purified product.

[0159] The purified plasmid vector DNA was dephosphorylated using the dephosphorylation enzyme Fast AP Thermosensitive Alkaline Phosphatase (Thermo Scientific) at 37°C for 1 hour. Subsequently, the Insert DNA and plasmid vector DNA were mixed in a molar ratio of 1:10, and a ligation reaction was performed overnight at 16°C using Ligation High (Toyobo Co., Ltd.) to obtain a plasmid library into which the selected VHH library had been introduced.

[0160] (9-2) Production of VHH (culture supernatant) Each plasmid obtained in (9-1) above was introduced into C. glutamicum by electroporation to obtain transformants. The obtained transformants were inoculated into CM2G medium and pre-cultured overnight at 30°C. Subsequently, the transformants contained in the CM2G culture medium were subcultured into PM1S medium for VHH expression and cultured at 25°C for 72 hours to induce secretory expression of VHH in the culture supernatant. The culture supernatant was centrifuged at 4,000xg for 30 minutes and the supernatant was collected. This supernatant was then passed through a 0.22 μm filter to remove bacterial cells and obtain VHH clones.

[0161] (9-3) Octet single-point binding assay Using OctetRED384 (Fortebio), the VHH clones obtained as described above were immobilized on a His1K sensor tip, and their binding activity to FGFR1 domain II-Fc was measured. As an analyte, the concentration of FGFR1 domain II-Fc was prepared to 100 nM, and 70 μL of the measurement solution was added to a 384-well plate to measure binding to the VHH clones. Before measurement, the tip of the Dip and Read® His1K Biosensors (Fortebio) was immersed in 200 μL of PBS-T (0.05% Tween20, pH 7.4) for 10 minutes to hydrate the sensor tip.

[0162] The conditions for the measurement order for each run were as follows: 1) Baseline step: Measurement in PBS-T for 30 seconds. 2) Loading step: Measure VHH diluted 50-fold with PBS-T for 60 seconds. 3) Baseline step: Measurement in PBS-T for 30 seconds. 4) Association step: Measurement for 100 seconds using FGFR1 domain II-Fc prepared by dilution with PBS-T. 5) Dissociation step: Measurement in PBS-T for 100 seconds. 6) Regeneration step: Measurements were taken for 5 seconds in Glycine-HCl (pH 2.2) and for 30 seconds in PBS-T. The above procedure was repeated three times. The obtained data was processed using Octet software version (1.2.1.5) (Molecular Devices). Figure 4 shows the binding response of each clone VHH to the FGFR1 domain II protein obtained from the Octet single-point binding assay. Here, 39 clones were obtained that showed a binding response of 0.1 nm or greater.

[0163] (9-4) Sequence analysis of hit clones The VHH genes of the hit clones obtained as described above were identified by gene sequence analysis. The transformants that were hit clones were cultured overnight at 37°C using the same medium as described above, and colony PCR was performed on the resulting culture medium to obtain PCR products. To each of the obtained PCR products, 10 units of Exonuclease I (E. coli) and 0.5 units of Shrimp Alkaline Phosphatase (rSAP) (both from New England Biolabs) were added, and the reaction was carried out at 37°C for 45 minutes. After that, the enzymes were inactivated by treatment at 80°C for 15 minutes. DNA sequencing analysis of each reaction solution after this enzyme inactivation treatment was commissioned to Eurofins genomics. Only one clone with a duplicate sequence was counted among the obtained hit clones, and these clones were designated as Unique VHH clones.

[0164] (Example 4) Acquisition of each Unique VHH clone (1) Obtaining purified VHH For each unique VHH clone identified by sequence analysis in Examples 2 and 3 above, transformed C. glutamicum was pre-cultured overnight in CM2G medium at 30°C. This pre-culture was then subcultured in PM1S medium for VHH expression and cultured at 25°C for 72 hours to secrete and express VHH in the culture supernatant. The culture supernatant was centrifuged at 4,000 xg, and the supernatant was collected. Next, the sample was purified using His Multi Trap HP (Cytiva) according to the product instructions. 100 μL of elution buffer (300 mM NaCl, 500 mM imidazole-containing 50 mM Tris-HCl buffer (pH 7.5)) was added to the sample well, and the well was centrifuged at 500 xg for 2 minutes at 4°C. The eluate was collected and used as the purified VHH clone sample.

[0165] (2) Multi-point binding assay using Octet Interaction analysis of purified VHH clones and the FGFR1 extracellular domain was performed using Octet RED384. Purified VHH was immobilized on a His1K sensor chip (Fortebio), and measured by binding to an FGFR1 extracellular domain prepared at a 2-fold dilution from 200 nM or an FGFR1 extracellular domain II prepared at a 2-fold dilution from 100 nM. Before measurement, the tip of the Dip and Read SA Biosensors was immersed in 200 μL of PBS-T (PBS containing 0.05% Tween 20, pH 7.4) for 10 minutes to hydrate the sensor chip. Then, 70 μL of each measurement solution was added to a 384-well plate, and measurements were performed in the steps 1) to 6) shown below.

[0166] 1) Baseline step: Measurement in PBS-T for 60 seconds. 2) Loading step: Measure for 120 seconds using purified VHH diluted 100-fold with PBS-T. 3) Baseline step: Measurement in PBS-T for 60 seconds. 4) Association step: Measurement for 120 seconds using FGFR1 extracellular domains prepared by diluting with PBS-T. 5) Dissociation step: Measurement in PBS-T for 120 seconds. 6) Regeneration step: Repeat the measurement process three times: 5 seconds in Glycine-HCl (pH 2.2) and 5 seconds in PBS-T.

[0167] After the above measurements were completed, the Reference (PBS-T only) was subtracted from the measured values, and affinity was measured by performing a global fitting using a 1:1 binding model with Octet software. The measurement results for representative clones from each VHH are shown in Figure 5, and a list of affinity levels is shown in Tables 4 and 5.

[0168] [Table 4]

[0169] [Table 5]

[0170] (Example 5) Single-point binding assay for each FGFR extracellular domain using Octet Interaction analysis of purified VHH clones with the extracellular domains of FGFR1(IIIb), FGFR1(IIIc), FGFR2(IIIb), FGFR2(IIIc), FGFR3(IIIb), FGFR3(IIIc), or FGFR4 was performed using Octet RED384. IIIb and IIIc of each receptor represent splicing variants of the receptor extracellular domain III (all from R&D). Purified VHH was immobilized onto a His1K sensor chip (Fortebio), and each FGFR extracellular domain was prepared to 100 nM. 70 μL of the measurement solution was added to a 384-well plate to measure binding to the VHH clones. Before measurement, the tip of the Dip and Read SA Biosensors was immersed in 200 μL of PBS-T (PBS containing 0.05% Tween 20, pH 7.4) for 10 minutes to hydrate the sensor tip.

[0171] The conditions for the measurement order for each run were as follows: 1) Baseline step: Measurement in PBS-T for 30 seconds. 2) Loading step: Measure for 120 seconds using purified VHH diluted 100-fold with PBS-T. 3) Baseline step: Measurement in PBS-T for 30 seconds. 4) Association step: Measurement for 120 seconds with each FGFR extracellular domain prepared by dilution with PBS-T. 5) Dissociation step: Measurement in PBS-T for 120 seconds. 6) Regeneration step: Repeat the measurement process three times: 5 seconds in Glycine-HCl (pH 2.2) and 5 seconds in PBS-T.

[0172] After the above measurements were completed, the responses of each VHH clone to the extracellular domain of FGFR were graphed, and receptor specificity was analyzed. The results are shown in Figures 6 to 9. Since the extracellular domains of each receptor have similar structures resembling Ig, it was found that even products screened using FGFR1 can bind to other receptors. Furthermore, it was found that each VHH clone binds more strongly to different receptors.

[0173] (Example 6) Preparation of VHH-Fc compound The VHH-Fc isomer was prepared as follows. (1) Construction of expression plasmid VHH, VM44, VM46, VM1637, and VM1640, selected based on a multi-point binding assay using Octet, were cloned into plasmid vectors for Fc expression. The dissociation constants (in M) for each FGFR of each VHH clone obtained from Example 5 are shown in Table 6.

[0174] [Table 6]

[0175] First, sequences for homologous recombination were added to a glycerol stock of a unique VHH clone of C. glutamicum using the standard PCR method, and PCR products were obtained. The reaction mixture consisted of 1 U of KOD FX Neo, 25 μL of 2x PCR Buffer for KOD FX Neo, 0.4 mM dNTPs, a small amount of glycerol stock, and two primers, PL_to_pcDNA_FW (SEQ ID NO: 22) and PL_to_pcDNA_RV (SEQ ID NO: 23), each at a final concentration of 0.3 μM, added to a tube and adjusted to 50 μL with ultrapure water. The sequences of the two primers are shown below.

[0176] 5'- AAGGGCGTGCAGTGCGAAGTACAATTAGTTGAATCTGGTGGTG -3' (Sequence ID 22) 5'- gctgctcttgggctcTGAAGAGACTGTCACCAACGTG -3' (Sequence ID 23)

[0177] The PCR program used a two-step method, with a denaturation temperature of 98°C for 10 seconds and a denaturation and extension temperature of 68°C for 30 seconds. 30 cycles were performed to obtain the PCR product. The obtained PCR product was purified as Insert DNA using the Gel / PCR Extraction Kit (Nippon Genetics) according to the attached instructions. The Fc-expression plasmid vector was treated with restriction enzymes EcoRI and BamHI at 37°C for 1 hour, followed by 1% agarose gel electrophoresis at 100 V for 30 minutes. After electrophoresis, the gel was excised and purified using the Gel / PCR Extraction Kit (Nippon Genetics) according to the attached instructions to obtain the purified product.

[0178] Insert DNA and plasmid vector DNA were mixed in a molar ratio of 1:3, and a plasmid was obtained by a SLiCE reaction at 37°C for 15 minutes. The obtained plasmid was used to transform E. coli JM109, which was then seeded onto agar plates and incubated overnight at 37°C. Colonies that appeared on the agar plate were picked and incubated overnight at 37°C. Plasmids were extracted using the FastGene Plasmid Mini Kit (Genetics Japan) according to the instructions provided. The DNA sequence of the extracted plasmids was sent to Eurofins Genomics for sequencing analysis.

[0179] (2) Expression of VHH-Fc using Expi293F cells Expi293F cells (Thermo Fisher Scientific) were subcultured in Expi293 Expression Medium (Thermo Fisher Scientific). Expi293F cells were seeded in T25 flasks (Sarstedt) and cultured at 37°C under 8% CO2 conditions. The Fc expression plasmid, ExpiFectamine® 293 (Thermo Fisher Scientific), was suspended in Opti-MEME (Gibco) and allowed to stand at room temperature for 15 minutes. This was then added to Expi293F cells cultured overnight, and after 96 hours of incubation, the culture supernatant was collected. The collected culture supernatant was filtered through a 0.22 μm filter to remove cells from the supernatant.

[0180] (3) Purification of VHH-Fc The culture supernatant was passed through a column packed with 500 μL of Amsphere® A3 (JSR Corporation, hereinafter referred to as "carrier"). The carrier was washed by sequentially adding 5 mL of PBS, 5 mL of high-salt PBS (PBS containing 1 M NaCl), and 5 mL of PBS. Then, it was eluted with 5 mL of 100 mM Glycine-HCl pH 2.2 (Fujifilm Wako Pure Chemical Industries, Ltd.) and neutralized with 500 μL of 1 M Tris-HCl pH 8.5. The eluted VHH-Fc was transferred to Amicon Ultra, 10 kDa (Millipore Corporation) and concentrated by centrifugation at 3,500 xg for 30 minutes at 4°C. Next, 4 mL of PBS was added and centrifugation was performed under the same conditions, and this PBS substitution procedure was repeated three times. The purity of the purified VHH-Fc was confirmed by SDS-PAGE (Figure 10). SDS-PAGE was performed on a 4% concentrated, 10% separated gel. After adding 5 μL of sample to each well, electrophoresis was performed at 150 V for 1 hour. Precision Plus Protein Standard (BioRad) was used as the molecular weight marker. Using bovine serum albumin as the standard protein, the concentration of VHH-Fc was quantified by the BCA method using the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific). The resulting Fc forms of VM44, VM46, VM1637, and VM1640 were designated as VF151, VF152, VF155, and VF156 (SEQ ID NOs. 11-14, respectively). The sequences of VF151, VF152, VF155, and VF156, as well as the human Fc sequence and the Hinge sequence between VHH and Fc, are as follows.

[0181] Full amino acid sequence of VF151 EVQLVESGGG LVQPGGSLRL SCAASGSISS INIMGWFRQA PGKGREFVAA ISRIGSSTAY ADSVKGRFTI SRDNAKNTVY LQMNSLRAED TAVYYCAASI HFLGQSYADY WGQGTLVTVS SEPKSSDKTH TCPPCPAPEL LGGPSVFLFP PKPKDTLMIS RTPEVTCVVV DVSHEDPEVK FNWYVDGVEV HNAKTKPREE QYNSTYRVVS VLTVLHQDWL NGKEYKCKVS NKALPAPIEK TISKAKGQPR EPQVYTLPPS RDELTKNQVS LTCLVKGFYP SDIAVEWESN GQPENNYKTT PPVLDSDGSF FLYSKLTVDK SRWQQGNVFS CSVMHEALHN HYTQKSLSLS PGK (Sequence ID 11)

[0182] Amino acid sequence of VHH (VM44) in VF151 EVQLVESGGG LVQPGGSLRL SCAASGSISS INIMGWFRQA PGKGREFVAA ISRIGSSTAY ADSVKGRFTI SRDNAKNTVY LQMNSLRAED TAVYYCAASI HFLGQSYADY WGQGTLVTVS S (Sequence ID 5)

[0183] Amino acid sequence of CDR1 in VF151 (VM44) GSISSINIMG (Sequence ID 32) Amino acid sequence of CDR2 in VF151 (VM44) AISRIGSSTA YADSVKG (Sequence No. 33) Amino acid sequence of CDR3 in VF151 (VM44) SIHFLGQSYA DY (Sequence ID 1)

[0184] Full amino acid sequence of VF152 EVQLVESGGG LVQPGGSLRL SCAASGQTFS SYNMGWFRQA PGKGREFVAS ISRSGGLTYY ADSVKGRFTI SRDNAKNTLY LQMNSLRAED TAVYYCAADY VLDLKRYRTQ HNYWGQGTLV TVSSEPKSSD KTHTCPPCPA PELLGGPSVF LFPPKPKDTL MISRTPEVTC VVVDVSHEDP EVKFNWYVDG VEVHNAKTKP REEQYNSTYR VVSVLTVLHQ DWLNGKEYKC KVSNKALPAP IEKTISKAKG QPREPQVYTL PPSRDELTKN QVSLTCLVKG FYPSDIAVEW ESNGQPENNY KTTPPVLDSD GSFFLYSKLT VDKSRWQQGN VFSCSVMHEA LHNHYTQKSL SLSPGK (Sequence ID 12)

[0185] Amino acid sequence of VHH (VM46) of VF152 EVQLVESGGG LVQPGGSLRL SCAASGQTFS SYNMGWFRQA PGKGREFVAS ISRSGGLTYY ADSVKGRFTI SRDNAKNTLY LQMNSLRAED TAVYYCAADY VLDLKRYRTQ HNYWGQGTLV TVSS (Sequence ID 6)

[0186] Amino acid sequence of CDR1 in VF152 (VM46) GQTFSSYNMG (Sequence ID 34) Amino acid sequence of CDR2 in VF152 (VM46) SISRSGGLTY YADSVKG (Sequence ID 35) Amino acid sequence of CDR3 in VF152 (VM46) DYVLDLKRYR TQHNY (Sequence ID 2)

[0187] Full amino acid sequence of VF155 EVQLVESGGG LVQPGGSLRL SCAASGFTFS RYDMSWYRQA PGKGLEWVAA ITIGGSTNYA ASVKGRFTIS RDNAKNTLYL QMNSLRAEDT AVYYCNAWQH SWHGKDKDYW GQGTLVTVSS EPKSSDKTHT CPPCPAPELL GGPSVFLFPP KPKDTLMISR TPEVTCVVVD VSHEDPEVKF NWYVDGVEVH NAKTKPREEQ YNSTYRVVSV LTVLHQDWLN GKEYKCKVSN KALPAPIEKT ISKAKGQPRE PQVYTLPPSR DELTKNQVSL TCLVKGFYPS DIAVEWESNG QPENNYKTTP PVLDSDGSFF LYSKLTVDKS RWQQGNVFSC SVMHEALHNH YTQKSLSLSP GK (Sequence ID 13)

[0188] Amino acid sequence of VHH (VM1637) of VF155 EVQLVESGGG LVQPGGSLRL SCAASGFTFS RYDMSWYRQA PGKGLEWVAA ITIGGSTNYA ASVKGRFTIS RDNAKNTLYL QMNSLRAEDT AVYYCNAWQH SWHGKDKDYW GQGTLVTVSS (Sequence ID 7)

[0189] Amino acid sequence of CDR1 in VF155 (VM1637) GFTFSRYDMS (Sequence ID 36) Amino acid sequence of VF155 CDR2 AITIGGSTNY AASVKG (Sequence ID 37) Amino acid sequence of CDR3 in VF155 (VM1637) WQHSWHGKDK DY (Sequence ID 3)

[0190] Full-length amino acid sequence of VF156 EVQLVESGGG LVQPGGSLRL SCAASGFTFS RYDMSWYRQA PGKGLEWVAT ITSGGSTNYA DSVKGRFTIS RDNAKNTLYL QMNSLRAEDT AVYYCNAYHH SWHDVDADYW GQGTLVTVSS EPKSSDKTHT CPPCPAPELL GGPSVFLFPP KPKDTLMISR TPEVTCVVVD VSHEDPEVKF NWYVDGVEVH NAKTKPREEQ YNSTYRVVSV LTVLHQDWLN GKEYKCKVSN KALPAPIEKT ISKAKGQPRE PQVYTLPPSR DELTKNQVSL TCLVKGFYPS DIAVEWESNG QPENNYKTTP PVLDSDGSFF LYSKLTVDKS RWQQGNVFSC SVMHEALHNH YTQKSLSLSP GK (SEQ ID NO: ɪ4)

[0191] Amino acid sequence of VHH (VM1640) of VF156 EVQLVESGGG LVQPGGSLRL SCAASGFTFS RYDMSWYRQA PGKGLEWVAT ITSGGSTNYA DSVKGRFTIS RDNAKNTLYL QMNSLRAEDT AVYYCNAYHH SWHDVDADYW GQGTLVTVSS (SEQ ID NO: 8)

[0192] Amino acid sequence of CDR1 of VF156 (VM1640) GFTFSRYDMS (SEQ ID NO: 38) Amino acid sequence of CDR2 of VF156 (VM1640) TITSGGSTNY ADSVKG (SEQ ID NO: 39) Amino acid sequence of CDR3 in VF156 (VM1640) YHHSWHDVDA DY (Sequence ID 4)

[0193] Human Fc sequence SVFLFPPKPK DTLMISRTPE VTCVVVDVSH EDPEVKFNWY VDGVEVHNAK TKPREEQYNS TYRVVSVLTV LHQDWLNGKE YKCKVSNKAL PAPIEKTISK AKGQPREPQV YTLPPSRDEL TKNQVSLTCL VKGFYPSDIA VEWESNGQPE NNYKTTPPVL DSDGSFFLYS KLTVDKSRWQ QGNVFSCSVM HEALHNHYTQ KSLSLSPGK (Sequence ID 9) Hinge sequence between VHH and Fc EPKSSDKTHT CPPCPAPELL GGP (Sequence ID 10)

[0194] (4) Multipoint binding assay using Octet The affinity of VHH-Fc obtained as described above for FGFR1(IIIc)-Fc was measured using OctetRED384 (Fortebio). FGFR1(IIIc)-Fc-Avi (R&D) was immobilized on an SA sensor tip and bound to VHH-Fc prepared at a 2-fold dilution starting from 25 nM for measurement. Before measurement, the tip of the Dip and Read® SA Biosensors (Fortebio) was immersed in 200 μL of 0.05% Tween20-containing PBS (hereinafter sometimes referred to as "PBS-T") for 10 minutes to hydrate the sensor tip. Then, 70 μL of each measurement solution was added to a 384-well plate, and the measurement was performed in the steps 1) to 6) shown below.

[0195] 1) Baseline step: Measurement in PBS-T for 30 seconds. 2) Loading step: Measurement of FGFR1(IIIc)-Fc-Avi in ​​PBS-T for 300 seconds. 3) Baseline step: Measurement in PBS-T for 30 seconds. 4) Association step: Measurement for 120 seconds using VHH-Fc prepared by diluting with PBS-T. 5) Dissociation step: Measurement in PBS-T for 120 seconds. 6) Regeneration step: Repeat the measurement process three times: 5 seconds in Glycine-HCl (pH 2.2) and 5 seconds in PBS-T. After the above measurements were completed, the reference (PBS-T only) was subtracted from the measured values, and global fitting was performed using Octet software with a 1:1 binding model to calculate affinity (Figure 11). The affinity of VHH-Fc is shown in Table 7. It was found that the binding affinity tended to improve with the addition of the Fc sequence.

[0196] [Table 7]

[0197] (Example 7) Evaluation of VHH-Fc agonist activity using NIH3T3 cells The agonist activity of VHH-Fc was evaluated using mouse embryonic fibroblasts NIH3T3 (ATCC) as follows.

[0198] (1)Cell culture Mouse embryonic fibroblasts NIH3T3 were subcultured in DMEM (High glucose) (Sigma, hereinafter simply referred to as "DMEM") containing 10% Fatal Calf Serum (Biowest, hereinafter referred to as "CS") and 1% Penicillin-Streptomycin Mixed Solution (containing 100 units / mL penicillin G and 100 μg / mL streptomycin sulfate) (Nacalai Tesque, hereinafter referred to as "PS(+)").

[0199] (2) Cell plan assay Place 100 μL of the solution into each 96-well white cell culture plate (Thermo Fisher Scientific) to a final concentration of 2.5 × 10⁶. 3 Cells were seeded to a density of cells / well and cultured overnight at 37°C in a 5% CO2 environment. The culture medium was removed from each well and replaced with DMEM containing various test substances, 1% CS, and 1% PS(+), and cultured for a further 72 hours. After leaving the 96-well plate at room temperature for 5 minutes, the number of viable cells was measured using the Cell Titer Glo® 2.0 Cell Viability Assay (Promega) according to the attached instructions. Four measurements were taken at each concentration of the test substance, and nine 3-fold dilution series starting from 500 nM were prepared and used for measurement. The measurement data were analyzed using 4-parameter logistic curve analysis with GraphPad Prism 9, and the EC was calculated from the resulting sigmoid curve. 50 The mean and standard error were calculated (Figure 12). Since all VHH-Fc cells exhibited cell proliferation activity, it was shown that VHH-Fc cells with agonist activity could be created.

[0200] (Example 8) Evaluation of VHH-Fc antifibrotic activity using HHSC cells Human hepatic stellate cells (HHSCs) are known to be activated by TGFβ and promote fibrosis by secreting collagen fibers and other substances. Therefore, the anti-fibrotic activity of VHH-Fc was evaluated using human hepatic stellate cells as follows.

[0201] (1) Cell culture Human hepatic stellate cells (HHSC, manufactured by Cell Applications) were cultured in a human hepatic stellate cell growth medium (basic medium + additives) (manufactured by Cell Applications, hereinafter referred to as "HSCM") containing fetal bovine serum (FBS) at 37 °C in a 5% CO2 environment, and subcultured using a subculture reagent set.

[0202] (2) Evaluation of anti-fibrotic activity In a 6-well cell culture plate (manufactured by Falcon), 2 mL each was seeded at a final concentration of 5×10 5 cells / well and cultured at 37 °C in a 5% CO2 environment. After confirming cell adhesion, the medium was removed from each well and replaced with HSCM basic medium without FBS, and cultured overnight. Then, only TGFβ (manufactured by Acrobyosystems) or TGFβ and VHH-Fc were added to the medium, and further cultured for 24 hours. TGFβ was diluted to a final concentration of 50 ng / mL, and VHH-Fc was diluted to 1 μM.

[0203] (3) Analysis of gene expression level The cells were collected in a 1.5 mL tube, and RNA was purified using the RNeasy mini Kit (manufactured by QIAGEN) according to the instructions. 30 μL of RNase-Free water was added to the column to elute the RNA.

[0204] RNA concentration was measured using NanoDrop 2000 (Thermo Scientific). After denaturing the RNA at 65°C for 5 minutes, reverse transcription was performed using 1 μg of RNA and the ReverTra Ace® qPCR RT Kit (TOYOBO) according to the instructions provided. Subsequently, quantitative PCR was performed using KOD SYBR qPCR Mix (TOYOBO) and the Applied Biosystems® StepOnePlus® Real-Time PCR System (Applied Biosystems) according to the instructions provided, and relative quantification was performed using the ΔΔCt method with r28S expression levels. Quantitative PCR was performed targeting ACTA2 (protein name: Actin, aortic smooth muscle, also known as αSMA) and COL1A1 (protein name: Collagen alpha-1(I) chain) using the primers shown in Table 8 below.

[0205] [Table 8]

[0206] The results of quantitative PCR are shown in Figure 13. In the group stimulated with TGFβ alone, the expression levels of ACTA2 and COL1A1 were elevated. Since these genes indicate the degree of fibrosis in hepatic stellate cells and the amount of fibrous protein produced, respectively, it can be seen that TGFβ promotes fibrosis in hepatic stellate cells. On the other hand, the expression levels of each gene decreased when VF156 was added simultaneously. In other words, it was found that VF156 suppressed TGFβ-dependent fibrosis in hepatic stellate cells. The results above indicate that VF156 can be used to treat fibrosis or to suppress the progression of the disease. Furthermore, VF151, VF152, and VF155, which have similar agonist activity, are thought to have similar effects.

[0207] (Example 9) Measurement of thermal stability The thermal stability of VHH-Fc and FGF2 was measured using UNcle (Unchained Labs). VHH-Fc was prepared in PBS at a concentration of 0.5 mg / mL, and FGF2 (R&D) at a concentration of 1 mg / mL. A temperature gradient of 1°C / min was observed from 25°C to 95°C for dynamic light scattering (DLS) and sexual light scattering (SLS). SLS was measured at 266 nm and 473 nm. DLS was measured at the start and end of the temperature gradient. Tm, Tag, and DLS measurements were calculated and analyzed using UNcle analysis software. SLS at 266 nm and Tag against the temperature gradient are shown in Figure 14. As shown in Figure 14, VHH-Fc was shown to have higher thermal stability than FGF2. Based on the above, a VHH-Fc variant can be obtained by adding the Fc sequence of a human antibody to humanized VHH that binds to the extracellular domain of fibroblast growth factor receptor (FGFR)1 of the present invention.

[0208] (Example 10) Example of a culture medium composition for meat containing the FGFR agonist VHH Prepare a culture medium containing the FGFR agonist VHH, particularly a culture medium composition for cultured meat. This is done by adding the FGFR agonist VHH to the culture medium instead of the FGF2 typically added to conventional culture media. Alternatively, the amount of FGF2 added can be reduced, and the same amount of FGFR agonist VHH can be added to create the culture medium composition. Because VHH has an aggregation initiation temperature (Tagg) approximately 20°C higher than FGF2, it exhibits superior thermal stability, and therefore the culture medium composition of the present invention has excellent thermal stability. The cell culture medium of the present invention has the potential to be used as a cost-effective alternative to FGF2, particularly in the preparation of stem cells for regenerative medicine and the production of cultured meat, due to its superior thermal stability.

[0209] (Example 11) Example 1 of a cosmetic composition containing the FGFR agonist VHH The cosmetic composition contains the FGFR1 agonist VHH. The concentration of the FGFR1 agonist VHH is, for example, 0.1 ppm or higher. The cosmetic composition further contains excipients acceptable for cosmetic use, such as water, glycerol, lipids, antioxidants, and preservatives. The cosmetic composition may be a low-viscosity liquid, or it may be a highly viscous liquid or cream with the addition of other excipients. The cosmetic composition is applied to the face, neck, and limbs to prevent wrinkles caused by aging and UV radiation, and to slow the progression of wrinkles.

[0210] (Example 12) Example 2 of a cosmetic composition containing the FGFR1 agonist VHH As a variation of Example 4, a liposome carrier containing the FGFR1 agonist VHH can be used. By encapsulating VHH in such a liposome carrier, absorption into the skin is enhanced. Alternatively, the composition can be prepared by creating an injectable solution with excipients such as physiological saline and injecting it into the skin using a delivery device such as a syringe.

[0211] (Example 13) <Suppression of metastasis by the FGFR1 agonist VHH in a mouse model of cancer metastasis> The Fc forms of VF151 and VF156 were used to investigate their effect in suppressing cancer metastasis. Evaluation of VHH-Fc in a mouse model of cancer with liver metastasis, transplanted with mouse-derived colorectal cancer organoids. Activation of fibroblasts at the metastatic site is crucial for cancer metastasis. To investigate whether the Fc form of the FGFR1 agonist VHH has an effect in suppressing cancer metastasis, a non-clinical study was conducted using a mouse model of liver metastasis of cancer transplanted with mouse-derived colorectal cancer organoids. The liver is known to be a common site of metastasis from various primary tumors, along with lymph nodes and the abdominal cavity, and pancreatic cancer, in particular, is known to metastasize to the liver.

[0212] (1) Culture of organoids 1C9 cells established by introducing mutations into four driver genes were used for mouse-derived colorectal cancer cells. Cells (hereinafter referred to as "AKTP cells") into which mutations of four driver genes, ApcD716 (A), Kras+ / LSL-G12D (K), Tgfbr2flox / flox (T), and Trp53+ / LSL-R270H (P) were introduced were used for organoids. AKTP cells were subcultured in Advanced DMEM / F12 (Gibco) containing 10% Fetal Bovine Serum (hereinafter referred to as "FBS"), 10 μM Y-27632 (manufactured by Fujifilm Wako Pure Chemical Corporation), 500 nM A-8301 (manufactured by Sigma), and 5 μM CHIR99021 (manufactured by Sigma).

[0213] (2) Transplantation of organoids into mice and administration of VHH-Fc NSG mice were purchased from the Central Institute for Experimental Animals. 3×10 5 organoid cells / 50 μL PBS of AKTP cells were transplanted into the spleen of NSG mice under anesthesia. The test mice were grouped into three groups by a weight-stratified random extraction method so that the average body weight of each group was equal on the day before the administration of the organoids. For the administration of VHH-Fc, PBS was used as a vehicle, and the administration route was intraperitoneal administration. The administration was carried out at a dose of 1 mg / kg on the third day after the transplantation of the organoids. Administration of only the vehicle without VHH-Fc was also carried out as a negative control for the drug. In addition, VF151 and the vehicle were administered a second time on the ninth day after the transplantation of the organoids.

[0214] (3) Observation of liver metastasis of colorectal cancer by IVIS imaging Cancer metastasis to the liver was observed using IVIS Lumina LT on days 7 and 14 after organoid transplantation. D-Luciferin Potassium Salt (Fujifilm Wako Pure Chemical Industries, Ltd.) was administered intraperitoneally to anesthetized mice at a dose of 150 mg / kg. After administration, the luminescence of luciferase introduced into cancer cells was observed by IVIS imaging. The results are shown in Figure 15. Luciferase luminescence intensity values ​​were significantly lower in the VF151 and VF156 administration groups compared to the vehicle group. This result suggests that the FGFR1 agonist VHH-Fc may have an effect of suppressing cancer metastasis to the liver.

[0215] (4) Observation of the liver using a fluorescence microscope On day 14 after organoid transplantation, the mice were dissected and their livers were obtained. The obtained livers were observed using a fluorescence microscope. The results are shown in Figure 16. Venus fluorescence was significantly reduced in the VF151-administered and VF156-administered groups compared to the vehicle group. This result suggests that the FGFR1 agonist VHH-Fc may have an effect in suppressing cancer metastasis to the liver.

[0216] (5) Preparation of pathological tissue specimens The liver was immersed in fixative solution and fixed at room temperature for 24 hours, then embedded in paraffin. The paraffin block was sectioned into 4 μm thick sections using a rotary microtome. The paraffin sections were spread out, mounted on glass slides, and dried using a hot plate. The paraffin sections were then subjected to hematoxylin-eosin staining and immunohistochemical staining.

[0217] (6) Hematoxylin-eosin staining and calculation of tumor percentage Paraffin sections were deparaffinized and hydrophilized with xylene, 100%-70% alcohol series, and RO water, and then immersed in Lilly-Meyer hematoxylin solution for 10 minutes. After washing with RO water and saturating under running water for 10 minutes, the sections were immersed in 1% eosin Y ethanol aqueous solution for 5 minutes and then immersed in RO water. The stained sections were dehydrated and cleared with 70%-100% alcohol series and xylene, then mounted in Enteran Nu and prepared for observation. The specimens were observed using a bright-field microscope. The area of ​​metastatic tumors relative to the entire liver was calculated (Figure 17). The percentage of metastatic tumors was significantly reduced in the VF151 and VF156 groups compared to the vehicle group, with VF151 showing particularly significant resistance. These results suggest that the FGFR1 agonist VHH may have an effect in suppressing cancer metastasis to the liver.

[0218] (7) Immunostaining with anti-αSMA antibody and anti-Transgelin antibody Paraffin sections were deparaffinized and hydrophilized with xylene, 100%-70% alcohol series, and RO water, and then permeated with a solution containing anti-αSMA antibody or anti-Transgelin antibody. αSMA is a marker of CAF involved in cancer malignancy, and Transgelin is thought to be a protein involved in metastasis in many different cancers. After washing the paraffin sections, they were permeated with a solution containing Alexa 594 or Alexa 488 labeled secondary antibody, and immunohistochemical staining was performed. The resulting stained images are shown in Figure 18. Expression of αSMA and Transgelin was observed in the Vehicle group. On the other hand, in the FGFR1 agonist VHH group, the expression of αSMA and Transgelin was relatively suppressed, and in particular, αSMA expression was not observed in the VF151 group. This result suggests that the FGFR1 agonist VHH may have the effect of suppressing fibroblast activation and inhibiting cancer metastasis to the liver. [Sequence Listing Free Text]

[0219] SEQ ID NO: VF151 CDR3 amino acid sequence Sequence ID 2: Amino acid sequence of VF152 CDR3 SEQ ID NO: VF155 CDR3 amino acid sequence SEQ ID NO: VF156 CDR3 amino acid sequence SEQ ID NO: VM44 amino acid sequence

[0220] SEQ ID NO: VM46 amino acid sequence Amino acid sequence of SEQ ID NO: VM1637 Amino acid sequence of SEQ ID NO: VM1640 Sequence ID 9: Human Fc sequence Sequence ID 10: Amino acid sequence of Hinge between VHH and Fc

[0221] Amino acid sequence of Sequence ID No. 11:VF151 Amino acid sequence of SEQ ID NO: 12:VF152 SEQ ID NO: 13: Amino acid sequence of VF155 Amino acid sequence of SEQ ID NO: 14:VF156 Sequence ID 15: Nucleotide sequence of the primer

[0222] Sequence ID 16: Nucleotide sequence of the primer Sequence ID 17: Backbone of cDNA display linker Sequence ID 18: Nucleotide sequence of the primer Sequence ID 19: Nucleotide sequence of the primer Sequence ID 20: Nucleotide sequence of the primer

[0223] Sequence ID 21: Nucleotide sequence of the primer Sequence ID 22: Nucleotide sequence of the primer Sequence ID 23: Nucleotide sequence of the primer Sequence ID 24: Nucleotide sequence of primer for quantitative PCR Sequence ID 25: Nucleotide sequence of primer for quantitative PCR

[0224] Sequence ID 26: Nucleotide sequence of primer for quantitative PCR Sequence ID 27: Nucleotide sequence of primer for quantitative PCR Sequence ID 28: Nucleotide sequence of primer for quantitative PCR Sequence ID 29: Nucleotide sequence of primer for quantitative PCR

[0225] SEQ ID NO: 32: Amino acid sequence of CDR1 in VF151 SEQ ID NO: 33: Amino acid sequence of CDR2 in VF151 Amino acid sequence of CDR1 in SEQ ID NO: 34:VF152 SEQ ID NO: 35: Amino acid sequence of CDR2 in VF152

[0226] SEQ ID NO: 36: Amino acid sequence of CDR1 in VF155 SEQ ID NO: 37: Amino acid sequence of CDR2 in VF155 SEQ ID NO: 38: Amino acid sequence of CDR1 in VF156 Amino acid sequence of CDR2 in SEQ ID NO: 39:VF156

Claims

1. A culture medium additive containing the fibroblast growth factor receptor (FGFR) agonist VHH, wherein the VHH is (1) CDR1, CDR2, and CDR3, each containing the amino acid sequences of SEQ ID NOs. 32, 33, and 1, (2) CDR1, CDR2, and CDR3, each containing the amino acid sequences of SEQ ID NOs: 34, 35, and 2, (3) CDR1, CDR2 and CDR3, each containing the amino acid sequences of SEQ ID NOs. 36, 37 and 3, respectively, (4) CDR1, CDR2, and CDR3 containing the amino acid sequences of SEQ ID NOs. 38, 39, and 4, respectively. A culture medium additive that is a humanized FFFR agonist VHH, comprising CDR1, CDR2, and CDR3 selected from the group consisting of the following.

2. The culture medium additive according to Claim 1, wherein the FGFR agonist VHH comprises the amino acid sequence described in any one of SEQ ID NOs. 5 to 8, or an amino acid sequence having at least 90% identity with the amino acid sequence described in any one of SEQ ID NOs. 5 to 8.

3. The culture medium additive according to claim 1, wherein the FFFR agonist VHH is VHH-Fc, to which the Fc sequence of a human antibody has been added.

4. The culture medium additive according to claim 1, wherein the FGFR agonist VHH is a dimer.

5. A cell culture medium comprising the culture medium additive according to any one of Claims 1 to 4.

6. The cell culture medium according to claim 5, which is a culture medium for cultured meat.

7. The cell culture medium according to claim 5, which is a culture medium for pluripotent stem cells (PSCs) or human mesenchymal stem cells for regenerative medicine.