Treatment and / or prevention methods for diseases involving Regnase-1
Inhibiting the phosphorylation of Regnase-1 at specific residues addresses the challenge of treating inflammatory and autoimmune diseases by stabilizing the enzyme, reducing inflammation and fibrosis, and suppressing the expression of inflammatory factors.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- OSAKA UNIVERSITY
- Filing Date
- 2023-09-14
- Publication Date
- 2026-07-29
AI Technical Summary
Current methods are lacking in effectively treating or preventing inflammatory diseases, autoimmune diseases, and allergic diseases by inhibiting the phosphorylation of Regnase-1.
Inhibiting the phosphorylation of specific amino acid residues in Regnase-1, such as Ser 513, 494, 439, and 435, using kinases like TBK1, IKKi, Act-1, IKK, and IRAK, or employing Regnase-1 binding molecules to suppress inflammation and prevent diseases.
Suppresses inflammation, fibrosis, and autoimmune responses by stabilizing Regnase-1, reducing the expression of inflammatory factors like IL6, IL1a, CXCL1, CXCL2, HBEGF, CTGF, DDR1, and PDGFB, thereby treating conditions such as multiple sclerosis, psoriasis, and fibrosis.
Smart Images

Figure 0007896823000036 
Figure 0007896823000037 
Figure 0007896823000038
Abstract
Description
[Technical Field]
[0001] This invention relates to methods for treating and / or preventing diseases involving Regnase-1. [Background technology]
[0002] Regnase-1 (also known as "Zc3h12a" or "MCPIP-1," and may be referred to as such herein) is a nuclease belonging to the Regnase family, possessing a CCCH-type zinc finger domain and a PIN-like domain, that recognizes and degrades mRNA (Non-Patent Literature 1). Regnase-1 destabilizes interleukin (IL)-6 and IL-12p40 mRNA and is involved in their post-transcriptional regulation (Non-Patent Literature 2). It has been reported that Ser (serine) 435 and Ser 439 of mouse Regnase-1 are phosphorylation sites for IκB kinase (IKK) induced by IL-1β stimulation, that Regnase-1 in which these amino acid residues are substituted with Ala (alanine) is resistant to degradation by IL-1β stimulation, and that cells expressing the alanine-substituted Regnase-1 show suppressed IL-6 mRNA expression after IL-1β stimulation compared to cells expressing wild-type Regnase-1 (Non-Patent Literature 3). Regnase-1 heterozygous knockout mice have been reported to show exacerbation of the disease in experimental autoimmune encephalomyelitis and psoriasis models (Non-Patent Literature 4, 5). [Prior art documents] [Non-patent literature]
[0003] [Non-Patent Document 1] Akira, S. Regnase-1, a ribonuclease involved in the regulation of immune responses. Cold Spring Harbor symposia on quantitative biology 78, 51-60 (2013). [Non-Patent Document 2] Matsushita, K. et al. Zc3h12a is an RNase essential for controlling immune responses by regulating mRNA decay. Nature 458, 1185-1190 (2009). [Non-Patent Document 3] Iwasaki, H. et al. The IkappaB kinase complex regulates the stability of cytokine-encoding mRNA induced by TLR-IL-1R by controlling degradation of regnase-1. Nat Immunol 12, 1167-1175 (2011). [Non-Patent Document 4] Garg, AV et al. MCPIP1 Endoribonuclease Activity Negatively Regulates Interleukin-17-Mediated Signaling and Inflammation. Immunity 43, 475-487 (2015). [Non-Patent Document 5] L. Monin et al. MCPIP1 / Regnase-1 Restricts IL-17A- and IL-17C-Dependent Skin Inflammation. J. Immunol. 198, 767-775 (2017). [Overview of the Initiative] [Problems that the invention aims to solve]
[0004] However, no known method existed to treat or prevent inflammatory diseases, autoimmune diseases, allergic diseases, fibrotic diseases, etc., by inhibiting the phosphorylation of Regnase-1. In one aspect, the present invention aims to provide a method for treating diseases by inhibiting the phosphorylation of Regnase-1. [Means for solving the problem]
[0005] To solve the above problems, the inventors searched for kinases that can phosphorylate Regnase-1 and identified the amino acid residues of Regnase-1 that are phosphorylated by these kinases. They then found that inhibiting the phosphorylation of specific amino acid residues among these residues is effective in treating and / or preventing inflammatory diseases, autoimmune diseases, allergic diseases, fibrotic diseases, etc., and thus completed the present invention.
[0006] In a non-limiting specific embodiment, the present invention includes the following: [a1] A method for treating and / or preventing diseases involving Regnase-1 by selectively inhibiting the phosphorylation of Ser residues. [a2] A method for suppressing inflammation by selectively inhibiting the phosphorylation of Ser residues in Regnase-1. [a3] A method for suppressing fibrosis of cells, tissues, or organs; or epithelial hyperplasia, by selectively inhibiting phosphorylation of Ser residues with Regnase-1. [a4] A method for suppressing the destabilization and / or intracellular degradation of Regnase-1 by selectively inhibiting the phosphorylation of Ser residues. [a5] The method according to [a4], wherein the destabilization and / or intracellular degradation of Regnase-1 is downstream of a signaling pathway involving at least one molecule selected from the group consisting of IL-17, IL-1, IL-36, and TLR ligands. [a6] A method for suppressing the production of inflammatory factors by selectively inhibiting the phosphorylation of Ser residues in Regnase-1. [a7] A method for suppressing the expression of at least one mRNA selected from the group consisting of IL6, IL1a, CXCL1, CXCL2, HBEGF, CTGF, DDR1, and PDGFB by selectively inhibiting phosphorylation of Ser residues by Regnase-1. [a8] The method according to any one of [a1] to [a7], wherein the Ser residue is a Ser residue selected from the group consisting of positions corresponding to positions 513, 494, 439, and 435 of Sequence ID No. 1 in Regnase-1. [a9] The method according to any one of [a1] to [a8], wherein the positions corresponding to positions 513, 494, 439, and 435 of Sequence ID No. 1 are (i) positions 513, 494, 439, and 435 of Sequence ID No. 1; or (ii) positions 516, 497, 442, and 438 of Sequence ID No. 2. [a10] The method according to any one of [a1] to [a9], wherein the Ser residue is a Ser residue included in at least one amino acid sequence selected from the group consisting of YWSEP (SEQ ID NO: 3), HFSVP (SEQ ID NO: 4), and DSGIGS (SEQ ID NO: 5) included in the amino acid sequence of Regnase-1. [a11] The method according to any one of [a1] to [a10], wherein Regnase-1 is mammalian Regnase-1. [a12] The method according to any one of [a1] to [a11], wherein the Ser residue is one of the following Ser residues (i) and (ii): (i) Ser residues at either or both positions corresponding to positions 513 and 494 of SEQ ID NO: 1 in Regnase-1; and (ii) Either or both of the Ser residues at positions 439 and 435 of SEQ ID NO: 1 in Regnase-1.
[0007] Furthermore, the present invention encompasses the following in a non-limiting specific embodiment. [A1] A method for treating and / or preventing a disease involving Regnase-1 by inhibiting the binding of at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK to Regnase-1. A method for suppressing inflammation by inhibiting the binding of at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK to Regnase-1. A method for suppressing fibrosis of a cell, tissue or organ; or hyperplasia of an epithelium by inhibiting the binding of at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK to Regnase-1. A method for suppressing the destabilization and / or intracellular degradation of Regnase-1 by inhibiting the binding of at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK to Regnase-1. The method according to [A4], wherein the destabilization and / or intracellular degradation of the Regnase-1 is the destabilization and / or intracellular degradation of Regnase-1 downstream of signal transduction involving at least one molecule selected from the group consisting of IL-17, IL-1, IL-36, and TLR ligand. A method for suppressing the production of inflammatory factors by inhibiting the binding of at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK to Regnase-1. A method for suppressing the expression of at least one mRNA selected from the group consisting of IL6, IL1a, CXCL1, CXCL2, HBEGF, CTGF, DDR1, and PDGFB by inhibiting the binding of at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK to Regnase-1. The method according to any one of [A1] to [A7], which inhibits the phosphorylation of Ser residues at at least one position selected from the group consisting of positions corresponding to positions 513, 494, 439, and 435 of SEQ ID NO: 1 in Regnase-1. The method according to any one of [A1] to [A8], wherein at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK is at least one binding molecule selected from the group consisting of TBK1, IKKi, and Act-1. The method according to any one of [A1] to [A9], wherein the Regnase-1 is mammalian Regnase-1. The method according to any one of [A1] to [A10], wherein at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK is TBK1 and IKK.
[0008] The present invention also includes the following in one non-limiting specific embodiment. A composition for treating and / or preventing a disease involving Regnase-1, containing a Regnase-1 binding molecule that inhibits phosphorylation of the Ser residue at at least one position selected from the group consisting of the positions corresponding to positions 513, 494, 439, and 435 of SEQ ID NO: 1 in Regnase-1. A composition for treating and / or preventing a disease involving Regnase-1, containing a Regnase-1 binding molecule that inhibits phosphorylation of the Ser residue contained in at least one amino acid sequence selected from the group consisting of YWSEP (SEQ ID NO: 3), HFSVP (SEQ ID NO: 4), and DSGIGS (SEQ ID NO: 5) contained in the amino acid sequence of Regnase-1. A composition for treating and / or preventing a disease involving Regnase-1, containing a Regnase-1 binding molecule that inhibits the binding between at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK and Regnase-1. The composition according to [B3], which inhibits phosphorylation of the Ser residue at at least one position selected from the group consisting of the positions corresponding to positions 513, 494, 439, and 435 of SEQ ID NO: 1 in Regnase-1. [B5] The composition according to any one of [B1] to [B4], wherein the disease in which Regnase-1 is involved is at least one disease selected from the group consisting of inflammatory diseases, autoimmune diseases, allergic diseases, fibrotic diseases, and RNA virus infections. [B6] The composition according to any one of [B1] to [B5], wherein the disease in which Regnase-1 is involved is a disease in which at least one factor selected from the group consisting of IL6, IL1a, CXCL1, CXCL2, HBEGF, CTGF, DDR1, and PDGFB is involved in the formation, exacerbation, and / or continuation of the disease. [B7] The composition according to any one of [B1] to [B6], wherein the disease involving Regnase-1 is a disease in which at least one factor selected from the group consisting of IL-17, IL-1, IL-36, and TLR ligands is involved in the formation, exacerbation, and / or continuation of the disease. [B8] The composition according to any one of [B1] to [B7], wherein the disease in which Regnase-1 is involved is a disease in at least one tissue or organ selected from the group consisting of the kidneys, lungs, skin, blood vessels, eyes, brain, and nerves. [B9] The composition according to any one of [B1] to [B8], wherein the disease in which Regnase-1 is involved is a TH17 cell-related disease. [B10] The composition according to any one of [B1] to [B9], wherein the disease in which Regnase-1 is involved is at least one disease selected from the group consisting of multiple sclerosis, psoriasis, scleroderma, nephritis, uveitis, pulmonary fibrosis, renal fibrosis, vascular fibrosis, keloid, rheumatoid arthritis, systemic lupus erythematosus, Sjögren's syndrome, pneumonia, dermatitis, vasculitis, neuritis, arthritis, ocular inflammation, encephalomyelitis, and asthma. [B11] The composition according to any one of [B1] to [B10], wherein the disease in which Regnase-1 is involved is a disease accompanied by fibrosis of cells, tissues, or organs. [B12] The composition according to any one of [B1] to [B10], wherein the disease in which Regnase-1 is involved is a disease accompanied by epithelial hyperplasia. [B13] A composition according to any one of [B1] to [B12] for suppressing the expression of at least one mRNA selected from the group consisting of IL6, IL1a, CXCL1, CXCL2, HBEGF, CTGF, DDR1, and PDGFB. [B14] A composition according to any one of [B1] to [B13] for suppressing the production of inflammatory factors. [B15] A composition for suppressing inflammation, comprising a Regnase-1 binding molecule that inhibits phosphorylation of a Ser residue at at least one position selected from the group consisting of positions corresponding to positions 513, 494, 439, and 435 of SEQ ID NO: 1 in Regnase-1. [B16] A composition for suppressing fibrosis of cells, tissues, or organs, or epithelial hyperplasia, comprising a Regnase-1 binding molecule that inhibits phosphorylation of a Ser residue at at least one position selected from the group consisting of positions corresponding to positions 513, 494, 439, and 435 of SEQ ID NO: 1 in Regnase-1. [B17] A composition for suppressing the expression of at least one mRNA selected from the group consisting of IL6, IL1a, CXCL1, CXCL2, HBEGF, CTGF, DDR1, and PDGFB, which contains a Regnase-1 binding molecule that inhibits phosphorylation of a Ser residue at at least one position selected from the group consisting of positions corresponding to positions 513, 494, 439, and 435 of SEQ ID NO: 1 in Regnase-1. [B18] A composition for suppressing the production of inflammatory factors, comprising a Regnase-1 binding molecule that inhibits phosphorylation of a Ser residue at at least one position selected from the group consisting of positions corresponding to positions 513, 494, 439, and 435 of SEQ ID NO: 1 in Regnase-1. [B19] The composition according to any one of [B1] to [B18], wherein the positions corresponding to positions 513, 494, 439, and 435 of Sequence ID No. 1 are (i) positions 513, 494, 439, and 435 of Sequence ID No. 1; or (ii) positions 516, 497, 442, and 438 of Sequence ID No. 2. [B20] The composition according to any one of [B1] to [B19], comprising a Regnase-1 binding molecule that inhibits phosphorylation of a Ser residue at at least one position selected from the group consisting of positions corresponding to positions 513 and 494 of Sequence ID No. 1. [B21] The composition according to [B20], wherein the positions corresponding to positions 513 and 494 of Sequence ID No. 1 are (i) positions 513 and 494 of Sequence ID No. 1; or (ii) positions 516 and 497 of Sequence ID No. 2. [B22] The composition according to any one of [B3] to [B21], wherein at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK is at least one binding molecule selected from the group consisting of TBK1, IKKi, and Act-1. [B23] The composition according to any one of [B1] to [B22], wherein the Regnase-1 is mammalian Regnase-1. [B24] A composition according to any one of [B1] to [B23], wherein at least one Ser residue selected from the group consisting of positions corresponding to positions 513, 494, 439, and 435 of Sequence ID No. 1 in Regnase-1 is one of the Ser residues (i) and (ii) below: (i) Ser residues at either or both positions corresponding to positions 513 and 494 of SEQ ID NO: 1 in Regnase-1; and (ii) Either or both of the Ser residues at positions 439 and 435 of SEQ ID NO: 1 in Regnase-1. [B25] The composition according to any one of [B1] to [B24], wherein at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK is TBK1 and IKK. [B26] The composition according to any one of [B1] to [B25], wherein the Regnase-1 binding molecule is a Regnase-1 binding molecule according to any one of [H1] to [H24].
[0009] Furthermore, in a non-limiting specific embodiment, the present invention includes the following. [D1] A method for identifying substances that inhibit the phosphorylation of Regnase-1, using phosphorylation of a Ser residue at at least one position selected from the group consisting of positions corresponding to positions 513, 494, 439, and 435 of SEQ ID NO: 1 as an indicator. [D2] The method according to [D1], comprising the following steps (a) and (b): (a) A step of mixing Regnase-1 with a kinase capable of phosphorylating Regnase-1 in the presence of a test substance, and detecting the phosphorylation of Regnase-1 by the kinase; (b) A step of identifying a substance that inhibits the phosphorylation of Regnase-1 by the kinase compared to the absence of the test substance. [D3] The method according to [D1] or [D2], wherein the kinase is a kinase capable of phosphorylating a Ser residue at at least one position selected from the group consisting of positions corresponding to positions 513, 494, 439, and 435 of SEQ ID NO: 1. [D4] The method according to any one of [D1] to [D3], wherein the kinase is at least one kinase selected from the group consisting of TBK1, IKKi, IKK, and IRAK. [D5] The method according to any one of [D1] to [D4], wherein the detection of phosphorylation of Regnase-1 in step (a) is performed using an antibody capable of detecting phosphorylation of a Ser residue at at least one position selected from the group consisting of positions corresponding to positions 513, 494, 439, and 435 of SEQ ID NO: 1. [D6] The method according to any one of [D1] to [D5], wherein Regnase-1 is human Regnase-1, and the positions corresponding to positions 513, 494, 439, and 435 of Sequence ID No. 1 are positions 516, 497, 442, and 438 of Sequence ID No. 2. [D7] The method according to any of [D1] to [D6], which uses phosphorylation of a Ser residue at at least one position selected from the group consisting of positions corresponding to positions 513 and 494 of SEQ ID NO: 1 as an indicator. [D8] The method according to any one of [D2] to [D7], wherein the test substance is a Regnase-1 binding molecule.
[0010] Furthermore, in a non-limiting specific embodiment, the present invention includes the following. [E1] A composition for identifying a substance that inhibits the phosphorylation of Regnase-1, comprising a predetermined amount of kinase and Regnase-1. [E2] The composition according to [E1], wherein the kinase is at least one kinase selected from the group consisting of TBK1, IKKi, IKK, and IRAK. [E3] The composition according to [E1] or [E2], wherein the phosphorylation of Regnase-1 is phosphorylation of a Ser residue at at least one position selected from the group consisting of positions corresponding to positions 513, 494, 439, and 435 of SEQ ID NO: 1. [E4] The composition according to any one of [E1] to [E3], wherein Regnase-1 is human Regnase-1, and the positions corresponding to positions 513, 494, 439, and 435 of Sequence ID No. 1 are positions 516, 497, 442, and 438 of Sequence ID No. 2. [E5] The composition according to any one of [E1] to [E4], wherein the phosphorylation of Regnase-1 is phosphorylation of a Ser residue at at least one position selected from the group consisting of positions corresponding to positions 513 and 494 of SEQ ID NO: 1, respectively. [E6] The composition according to any one of [E1] to [E5], further comprising a Regnase-1 binding molecule.
[0011] Furthermore, in a non-limiting specific embodiment, the present invention includes the following. [F1] A method for identifying a substance that inhibits the binding of at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK to Regnase-1, comprising the following steps (a) and (b): (a) A step of mixing at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK with Regnase-1 in the presence of a test substance, and measuring the binding activity between the binding molecule and Regnase-1; (b) A step of identifying a substance that can reduce the binding activity between the binding molecule and Regnase-1 compared to the absence of the test substance. The method according to [F1], wherein [F2] at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK is at least one binding molecule selected from the group consisting of TBK1, IKKi, and Act-1. [F3] A composition for identifying a substance that inhibits the binding of at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK to Regnase-1, the composition comprising a predetermined amount of the binding molecule and Regnase-1. A method for identifying a substance that inhibits the binding of at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK to Regnase-1 and inhibits the phosphorylation of Regnase-1, comprising the method of any of [F4], [D1] to [D8] and the method of [F1] or [F2]. [F5] The method according to any one of [F1], [F2], and [F4], wherein the test substance is a Regnase-1 binding molecule.
[0012] Furthermore, in a non-limiting specific embodiment, the present invention includes the following. [G1] An antibody that specifically recognizes Regnase-1 in which at least one Ser residue selected from the group consisting of positions corresponding to positions 513, 494, 439, and 435 of SEQ ID NO: 1 is phosphorylated. [G2] An antibody that specifically recognizes Regnase-1 in which at least one Ser residue selected from the group consisting of positions corresponding to positions 513 and 494 of Sequence ID No. 1 is phosphorylated. [G3] An antibody that specifically recognizes Regnase-1 in which the Ser residue corresponding to position 513 of SEQ ID NO: 1 is phosphorylated. [G4] An antibody that specifically recognizes Regnase-1 in which at least one Ser residue selected from the group consisting of positions corresponding to positions 439 and 435 of Sequence ID No. 1 is phosphorylated. [G5] An antibody that specifically recognizes Regnase-1 in which the Ser residues at positions corresponding to positions 439 and 435 of SEQ ID NO: 1 are phosphorylated. [G6] An antibody that specifically recognizes human Regnase-1 in which at least one Ser residue selected from positions 516, 497, 442, and 438 of SEQ ID NO: 2 is phosphorylated. [G7] An antibody that specifically recognizes human Regnase-1 in which at least one Ser residue selected from positions 516 and 497 of SEQ ID NO: 2 is phosphorylated. [G8] An antibody that specifically recognizes human Regnase-1 in which the Ser residue at position 516 of SEQ ID NO: 2 is phosphorylated. [G9] An antibody that specifically recognizes human Regnase-1 in which at least one Ser residue selected from positions 442 and 438 of SEQ ID NO: 2 is phosphorylated. [G10] An antibody that specifically recognizes human Regnase-1 with phosphorylated Ser residues at positions 442 and 438 of SEQ ID NO: 2. [G11] An antibody described in any of [G1] to
[10] that can bind to either human Regnase-1 or mouse Regnase-1.
[0013] Furthermore, in a non-limiting specific embodiment, the present invention includes the following. A Regnase-1 binding molecule that inhibits phosphorylation of a Ser residue at at least one position selected from the group consisting of positions corresponding to positions 513, 494, 439, and 435 of SEQ ID NO: 1 in [H1] Regnase-1. Regarding binding to [H2]Regnase-1, the following PP1~PP25, PP7+tag, PP10+tag and PP23+tag: At least one compound selected from TIFF0007896823000001.tif244170TIFF0007896823000002.tif246170TIFF0007896823000003.tif249170TIFF0007896823000004.tif234170TIFF0007896823000005.tif68170TIFF0007896823000006.tif108170TIFF0007896823000007.tif88170TIFF0007896823000008.tif77170 competes with the following antibodies (i) Antibody (REA0023) comprising a heavy chain containing the amino acid sequence described in SEQ ID NO: 20 and a light chain containing the amino acid sequence described in SEQ ID NO: 21, (ii) An antibody (REA0027) comprising a heavy chain containing the amino acid sequence described in SEQ ID NO: 22 and a light chain containing the amino acid sequence described in SEQ ID NO: 23, (iii) Antibody (REB0007) comprising a heavy chain containing the amino acid sequence described in SEQ ID NO: 24 and a light chain containing the amino acid sequence described in SEQ ID NO: 25, (iv) Antibody (REB0014) comprising a heavy chain containing the amino acid sequence described in SEQ ID NO: 26 and a light chain containing the amino acid sequence described in SEQ ID NO: 27 and (v) Antibody (REB0022) containing a heavy chain with the amino acid sequence described in SEQ ID NO: 28 and a light chain with the amino acid sequence described in SEQ ID NO: 29 Competing with at least one more antibody, Regnase-1 binding molecule as described in [H1]. [H3] A Regnase-1 binding molecule described in [H1] or [H2] that competes with compound PP7 for binding to Regnase-1. [H4] A Regnase-1 binding molecule described in any of [H1] to [H3] that competes with compound PP23 for binding to Regnase-1. [H5] A Regnase-1 binding molecule described in any of [H1] to [H4] that competes with compound PP10 for binding to Regnase-1. A Regnase-1 binding molecule described as [H1], [H2], [H4], or [H5] that does not compete with compound PP7 for binding to [H6] Regnase-1. [H7] A Regnase-1 binding molecule described in any of [H1] to [H3], [H5], or [H6] that does not compete with compound PP23 for binding to Regnase-1. [H8] A Regnase-1 binding molecule described in any of [H1] to [H4], [H6], or [H7] that does not compete with compound PP10 for binding to Regnase-1. [H9] A Regnase-1 binding molecule described in any of [H1] to [H8] that specifically binds to Regnase-1. [H10] A Regnase-1 binding molecule according to any of [H1] to [H9], wherein the positions corresponding to positions 513, 494, 439, and 435 of Sequence ID No. 1 are (i) positions 513, 494, 439, and 435 of Sequence ID No. 1; or (ii) positions 516, 497, 442, and 438 of Sequence ID No. 2. Regnase-1 binding molecules described in any of [H1] to [H10] that inhibit the phosphorylation of the Ser residues in (i) and (ii) below: (i) Ser residues at either or both positions corresponding to positions 513 and 494 of SEQ ID NO: 1 in Regnase-1; and (ii) Either or both of the Ser residues at positions 439 and 435 of SEQ ID NO: 1 in Regnase-1. A Regnase-1 binding molecule according to any of [H1] to [H11], which inhibits the phosphorylation of a Ser residue at at least one position selected from the group consisting of positions corresponding to positions 513 and 494 of SEQ ID NO: 1 in Regnase-1. A Regnase-1 binding molecule described in any of [H1] to [H12] that inhibits the phosphorylation of a Ser residue at at least one position selected from the group consisting of positions corresponding to positions 439 and 435 of SEQ ID NO: 1. A Regnase-1 binding molecule described in any of [H1] to [H13], which binds to Regnase-1 at the same site as the binding site on Regnase-1 to which a compound selected from compounds PP1 to PP25, PP7+tag, PP10+tag, and PP23+tag, or an antibody selected from antibodies REA0023, REA0027, REB0007, REB0014, and REB0022 binds. [H15] A Regnase-1 binding molecule described in any of [H1] to [H14] that binds to Regnase-1 at the same site on Regnase-1 to which compound PP7 binds. [H16] A Regnase-1 binding molecule described in any of [H1] to [H15] that binds to Regnase-1 at the same site on Regnase-1 to which compound PP23 binds. [H17] A Regnase-1 binding molecule described in any of [H1] to [H16] that binds to Regnase-1 at the same site on Regnase-1 to which compound PP10 binds. [H18] A Regnase-1 binding molecule according to any one of [H1] to [H17], wherein the Ser residue is a Ser residue included in at least one amino acid sequence selected from the group consisting of YWSEP (SEQ ID NO: 3), HFSVP (SEQ ID NO: 4), and DSGIGS (SEQ ID NO: 5) included in the amino acid sequence of Regnase-1. [H19] A Regnase-1 binding molecule according to any of [H1] to [H18] that inhibits the binding of Regnase-1 to at least one molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK. [H20] A Regnase-1 binding molecule according to any one of [H1] to [H19], wherein the phosphorylation is induced by at least one molecule selected from the group consisting of IL-17 and IL-1. [H21] A Regnase-1 binding molecule that inhibits the binding of Regnase-1 to at least one molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK. A Regnase-1 binding molecule described in any of [H1] to [H21] that binds to amino acid residues in the amino acid sequence 544-596 shown in SEQ ID NO: 1, or the amino acid sequence 547-599 shown in SEQ ID NO: 2. [H23] A Regnase-1 binding molecule described in any of [H1] to [H22], which is a cyclic polypeptide. A Regnase-1 binding molecule described in any of the following categories: [H1] to [H22], which is an antibody of [H24].
[0014] Furthermore, in a non-limiting specific embodiment, the present invention includes the following. A method for treating and / or preventing a Regnase-1-related disease, comprising administering a composition described in any of [I1], [B1] to [B26], or a Regnase-1-binding molecule described in any of [H1] to [H24], to a subject in need thereof (where the subject in need thereof may be a subject suffering from or at risk of suffering from the Regnase-1-related disease). [I2] Use of the composition described in any of [B1] to [B26] or the Regnase-1 binding molecule described in any of [H1] to [H24] in the manufacture of a pharmaceutical product for the treatment and / or prevention of a disease involving Regnase-1. [I3] A composition according to any of [B1] to [B26] or a Regnase-1 binding molecule according to any of [H1] to [H24] for use in the treatment and / or prevention of diseases involving Regnase-1. [Brief explanation of the drawing]
[0015] [Figure 1-1] This shows a comparison of the amino acid sequences of mouse Regnase-1 (SEQ ID NO: 1) and human Regnase-1 (SEQ ID NO: 2). Q5D1E7 and Q5D1E8 represent Uniprot accession numbers. [Figure 1-2](A) This shows the method for generating Regnase-1 S435A / S439A amino acid substitution mutant (Regnase-1AA / AA) mice. A schematic diagram of the wild-type Regnase-1 gene (top), targeting vector (center), and putative mutant allele (bottom) is shown. The targeting vector contains the S435A and S439A mutations in exon 6. (B) This shows the sequencing results of Regnase-1 exon 6 in the Regnase-1AA / AA mouse genome. The sequence chromatogram shows that TCA and TCC at Ser435 and Ser439 are substituted with GCA and GCC, respectively. [Figure 1-3] (C) The results of immunoblot analysis of NFκB, phospho-NFκB, IκB, phospho-IκB, MAPK p38, phospho-MAPK p38, ERK1, phospho-ERK1, JNK, and phospho-JNK in wild-type and Regnase-1AA / AA macrophages stimulated with LPS (100 ng / ml) for 0 to 240 minutes are shown. [Figure 1-4] (D) Results of IL-6, IL-12, and TNF-α production by wild-type and Regnase-1AA / AA macrophages stimulated for 24 hours with low concentrations of LPS (10 ng / ml), CpG (0.1 μM), or Pam3Csk4 (10 ng / ml) are shown. Cytokine production in the cell supernatant was evaluated by ELISA. Error bars represent mean ± SEM. ***P < 0.005. [Figure 2-1](A) Shows EAE clinical scores for wild-type (black circles; n = 15) and Regnase-1AA / AA mice (black squares; n = 12). (B) Shows histological analysis results of CD4+ T cell infiltration into the spinal cord. Frozen sections were stained with hematoxylin-eosin (top row) and anti-CD3ε (bottom row). Arrows indicate inflammatory cell infiltration. Scale bar, 200 μm. (C) Shows the number of CD4+ T cells in spinal cord cells (1.0 x 10⁵ cells) 15 days after immunization. This is the result of analysis using flow cytometry. (D) Shows EAE clinical scores for chimeric mice produced by (i) intravenous injection of wild-type bone marrow cells into wild-type or Regnase-1AA / AA mice (n = 8 in each group), and (ii) intravenous injection of wild-type or Regnase-1AA / AA bone marrow cells into wild-type mice (n = 12 in each group). [Figure 2-2] (E and F) Histological analysis of endothelial cell inflammation in wild-type and Regnase-1AA / AA mice. Sections of the spleen (E) and fifth lumbar spinal cord (F) were prepared 12 hours after intravenous injection of pathogenic CD4+ T cells (1.5 x 10⁷ cells / mouse) and stained with anti-type IV collagen antibody and anti-phospho-STAT3 antibody. Black and white arrows indicate phospho-STAT3-positive and negative endothelial cells, respectively. Scale bar, 50 μm. (G and H) Relative number of anti-phospho-STAT3-positive cells in vascular endothelial cells (type IV collagen-positive) measured in the spleen (H) and fifth lumbar spinal cord (I). (I) qPCR analysis of IL-6, Regnase-1, CXCL-1, CXCL2, and CCL-20 mRNA in wild-type and Regnase-1AA / AA MEFs. These are the results of stimulating cells with TNF-α (20 ng / ml) and IL-17A (50 ng / ml) over a period of 0 to 24 hours. Error bars represent the mean ± SEM result. *P < 0.05, **P < 0.01, ***P < 0.005. [Figure 3-1](A) Flow cytometry analysis results of CD4+ T cell subsets (TH1, TH17, and iTreg) differentiated from naive CD4+ T cells under in vitro conditions are shown. (B) qPCR analysis of IL-6, TNF-α, CXCL-1, and CXCL2 mRNA in wild-type and Regnase-1AA / AA hepatic sinusoidal endothelial cells (LSEC) is shown. The results were obtained by stimulating cells with TNF-α (20 ng / ml) and IL-17A (50 ng / ml) for 0 to 24 hours. [Figure 3-2] (C) Shows the production of IL-6, CXCL-1, and CXCL-2 by mouse LSEC in response to 24-hour exposure to IL-6 (20 ng / ml), TNF-α (20 ng / ml), IL-17A (50 ng / ml), IL-6 + IL-17A, or TNF-α + IL-17A. The amount of protein produced in the cell supernatant was evaluated by ELISA. [Figure 4] (A) Thickness of the auricle application area in wild-type mice and Regnase-1 AA mutant mice in an imiquimod-induced psoriasis model (mean ± standard error; 5 mice in each group). (B) Macroscopic findings of the neck and back skin in wild-type mice and Regnase-1 AA mutant mice in an imiquimod-induced psoriasis model (mean ± standard error; 5 mice in each group). [Figure 5] (A) Histopathological findings of the auricle skin in wild-type mice and Regnase-1 AA mutant mice in an imiquimod-induced psoriasis model (hematoxylin-eosin stained specimens) (neutrophil infiltration (*); microabscesses (arrowheads)). (B) Epidermal thickness of the auricle in wild-type mice and Regnase-1 AA mutant mice in an imiquimod-induced psoriasis model (mean ± standard deviation; 5 cases in each group). [Figure 6] This shows the changes in gene expression levels in the auricle skin of wild-type mice and Regnase-1 AA mutant mice in an imiquimod-induced psoriasis model (normalized by B2m expression levels). [Figure 7](A) Serum creatinine levels and urinary total protein to creatinine ratio in wild-type mice and Regnase-1 AA mutant mice in an anti-glomerular basement membrane antibody-induced glomerulonephritis model (Mann-Whitney U test; ****: p<0.0001). (B) Hydroxyproline levels per kidney weight in wild-type mice and Regnase-1 AA mutant mice in an anti-glomerular basement membrane antibody-induced glomerulonephritis model (Mann-Whitney U test; ***: p<0.001). [Figure 8] (A) Changes in Col1a1 and Acta-2 expression levels in the kidneys of wild-type mice and Regnase-1 AA mutant mice in an anti-glomerular basement membrane antibody-induced glomerulonephritis model (normalized by GAPDH expression level, Mann-Whitney U test; **: p<0.01, ***: p<0.001). (B) Changes in the expression levels of various genes in the kidneys of wild-type mice and Regnase-1 AA mutant mice in an anti-glomerular basement membrane antibody-induced glomerulonephritis model (normalized by GAPDH expression level, Mann-Whitney U test; **: p<0.01, ***: p<0.001, ****: p<0.0001). (C) Changes in blood cell counts in wild-type mice and Regnase-1 AA mutant mice in an anti-glomerular basement membrane antibody-induced glomerulonephritis model (showing white blood cell count, neutrophil count, and monocyte count per 1 μL of blood) (Mann-Whitney U test; **: p<0.01, ****: p<0.0001). [Figure 9] (A) Histopathological images of the kidneys of wild-type mice and Regnase-1 AA mutant mice in an anti-glomerular basement membrane antibody-induced glomerulonephritis model (hematoxylin-eosin stained specimens). (B) The percentage of glomerular lesions in wild-type mice and Regnase-1 AA mutant mice in an anti-glomerular basement membrane antibody-induced glomerulonephritis model (mean and standard deviation; 15 cases in each group). (C) Histopathological images of the lungs of wild-type mice and Regnase-1 AA mutant mice in an anti-glomerular basement membrane antibody-induced glomerulonephritis model (hematoxylin-eosin stained specimens). [Figure 10](A) Hydroxyproline levels per unit of skin weight in wild-type mice and Regnase-1 AA mutant mice in a bleomycin-induced scleroderma model. (B) Histopathological images of the lungs of wild-type mice and Regnase-1 AA mutant mice in a bleomycin-induced scleroderma model (hematoxylin-eosin stained specimens). (C) Changes in Col1a1 expression levels in the lungs of wild-type mice and Regnase-1 AA mutant mice in a bleomycin-induced scleroderma model (normalized by GAPDH expression level, Mann-Whitney U test; **: p<0.01). [Figure 11-1] The results of the pathogenesis analysis in an experimental autoimmune uveitis model mouse are shown. In the figure, WTNC represents the results for non-inducible wild-type mice, WTDC represents the results for disease-inducible wild-type mice, AANC represents the results for non-inducible Regnase-1 AA mutant mice, and AADC represents the results for disease-inducible Regnase-1 AA mutant mice. (A) Shows the inflammation score of both eyes of mice under the condition of a peptide dose of 140 nmol. The horizontal axis of the graph represents the number of days after peptide administration, and the vertical axis represents the inflammation score (mean ± standard error). (B) Shows the inflammation score of both eyes of mice under the condition of a peptide dose of 280 nmol. The horizontal axis of the graph represents the number of days after peptide administration, and the vertical axis represents the inflammation score (mean ± standard error). [Figure 11-2] (C) This graph shows the structural impairment scores of both eyes of mice under the condition of a peptide dose of 140 nmol. The horizontal axis of the graph represents the number of days after peptide administration, and the vertical axis represents the structural impairment score (mean ± standard error). (D) This graph shows the structural impairment scores of both eyes of mice under the condition of a peptide dose of 280 nmol. The horizontal axis of the graph represents the number of days after peptide administration, and the vertical axis represents the structural impairment score (mean ± standard error). [Figure 12-1](A) Results of immunoblot analysis of Regnase-1 in IL-17 stimulated wild-type and Regnase-1AA / AA MEFs. The two arrows indicate the phosphorylated (top) and unphosphorylated (bottom) forms of Regnase-1. (B) Results of immunoblot analysis of Regnase-1 in IL-17 stimulated wild-type and individual molecule-deficient MEFs. (C) Results of immunoblot analysis of Regnase-1 in IL-17 stimulated wild-type MEFs in the presence of BX795 (50 μM). [Figure 12-2](D) This shows the phosphorylation of Regnase-1 by TBK1 and IKKi under in vitro conditions. Purified Regnase-1 obtained from Regnase-1-deficient MEFs expressing the FLAG-tagged Regnase-1 AA mutant was incubated with recombinant TBK1 and / or IKKi for 3 hours in the presence / absence of γ-phosphatase. Regnase-1 phosphorylation was analyzed by Western blotting (i) and [32P]-autoradiography (ii). Arrows indicate phosphorylated Regnase-1. (E) This shows the results of immunoblotting analysis of FLAG-tagged Regnase-1 in HEK293 cells transfected with FLAG Regnase-1, Myc-tagged Act-1, Myc-tagged Act-1 mutant (Myc-Act1 ΔSEFIR), HA-tagged TBK1, and HA-tagged IKKi. (F) Results of co-immunoprecipitation of full-length or N-terminal or C-terminal truncated Regnase-1 and Act1 are shown. FLAG-tagged Regnase-1 variants were co-immunoprecipitated with Myc-tagged Act1. Eluted proteins were subjected to immunoblotting analysis using anti-FLAG antibody and anti-Myc antibody. (G and H) Results of co-immunoprecipitation of FLAG-tagged Regnase-1, Myc-tagged Act-1 variants (full-length and C-terminal truncated), HA-tagged TBK1, and HA-tagged IKKi are shown. Cell lysates from HEK293 transfectants were mixed as described and co-immunoprecipitated with anti-Myc coated beads (G) or anti-FLAG M2 agarose beads (H). Eluted proteins were subjected to immunoblotting analysis using anti-FLAG antibody, anti-Myc antibody, anti-HA antibody, and anti-actin antibody. [Figure 12-3] (I) The results of immunoblot analysis of Regnase-1, IκB, phospho-IκB, NFκB, and phospho-NFκB expression in wild-type and Regnase-1AA / AA MEFs stimulated with IL-17A are shown. (J) The results of immunoblot analysis of Regnase-1 expression in wild-type, Regnase-1AA / AA, TBK1 / IKKi double deletion, Act1 deletion, and IRAK1 / IRAK2 double deletion MEFs stimulated with IL-1β are shown. [Figure 13-1] (A) A schematic diagram of the Regnase-1 domain and mapping of phosphorylation sites by IKK (IKKα and IKKβ) and TBK1 / IKKi are shown. (B) Immunoblot analysis results of Regnase-1 in HeLa cells transfected with Regnase-1 mutants (wild type, S494A, T505A / S508A, S513A, and S494A / S513A) are shown. Cells were stimulated with IL-1β (10 ng / ml) and IL-17A (50 ng / ml) for 1 hour. [Figure 13-2] (C)(i) A diagram of the construct of GST-fused Regnase-1 (440-598) is shown. (ii) Gel filtration results of wild-type and mutant (S494E / S513E or S494E / T505E / S508E / S513E) Regnase-1 (440-598) are shown. The molecular weight of each eluted peak was estimated using molecular weight standard markers and defined as a multimer (Mw:∞), hexamer (Mw:120 kDa), trimer (Mw:60 kDa), or monomer (Mw:20 kDa). (iii) The eluted fractions (multimer + hexamer, trimer, and monomer) were quantified as a percentage of the total eluted protein. [Figure 13-3] (D) Immunoblotting results for Regnase-1 are shown. Regnase-1 was obtained from Regnase-1-deficient MEFs expressing the FLAG-tagged Regnase-1 AA mutant, stimulated with IL-1β (10 ng / ml) and IL-17A (50 mg / ml) for 1 hour. Purified Regnase-1 was analyzed by undenatured PAGE and Western blotting. (E) Immunoblotting results for Regnase-1 phosphorylated with TBK1 and IKKi are shown. Purified Regnase-1 was incubated with GST-fused TBK1 and / or IKKi for 3 hours in the presence / absence of γ-phosphatase. Proteins were separated by undenatured PAGE and SDS-PAGE and analyzed by Western blotting of Regnase-1. [Figure 14-1](A and B) show the results of immunoblot analysis of intracellular organelle fractions. Regnase-1, ribosomal protein L7a (rpL7a; ER marker), and GAPDH (cytoplasmic marker) are analyzed in cell homogenates, soluble cytoplasmic fraction, microsomes, and rough ER membranes. Fractions were prepared from Regnase-1AA / AA MEFs stimulated with IL-1β (10 ng / ml) and IL-17A (50 ng / ml) for 1 hour each (A), and from Regnase-1AA / AA and Act1-deficient MEFs stimulated with TNF-α (20 ng / ml) and IL-17A (50 ng / ml) for 1 hour each (B). Arrows indicate the phosphorylated (top) and unphosphorylated (bottom) forms of Regnase-1. (C) The results of immunoblot analysis of Regnase-1 and rpL7a in rough ER membranes prepared from wild-type and Regnase-1AA / AA MEFs stimulated with IL-17A (50 ng / ml) for 0-8 hours are shown. [Figure 14-2] (D) FLAG-tagged Regnase-1 was immunoprecipitated from the cellular organelle fraction of Regnase-1-deficient MEFs expressing the FLAG-tagged Regnase-1 AA mutant, stimulated for 1 hour with or without IL-17A (50 ng / ml). The immunoprecipitates were subjected to immunoblot analysis for Regnase-1, TBK1, phospho-TBK1, IKKi, and phospho-IKKi. (E) The results of immunoblot analysis for Regnase-1, phospho-TBK1, phospho-IKKi, and rpL7a in the ER membrane fraction isolated from wild-type and Act1-deficient MEFs are shown. Cells were stimulated with IL-17A (50 ng / ml) for 0, 1, and 8 hours. [Figure 15-1](A) Results of immunoblotting and quantitative PCR (qPCR) analysis of wild-type MEFs stimulated with TNF-α for 2 hours, followed by IL-17A for 0-4 hours. (i) Cell lysates were analyzed by immunoblotting of Regnase-1. (ii) IL-6 mRNA expression in wild-type cells stimulated with the combination of TNF-α and IL-17A as described above is shown. (B) IL-6 mRNA expression in wild-type and Regnase-1AA / AA and TBK1 / IKKi double-deficient MEFs stimulated with TNF-α for 2 hours, followed by IL-17A for 0-4 hours is shown. [Figure 15-2] (C)(i) Autoradiography results of IL-6 (upper) and Actb (downper) mRNA levels in Tet-off HEK293 cells co-transfected with the pTRE-tight-IL6-CDS+3'UTR vector along with expression plasmids for control (Act1+IKKi), Regnase-1, or Regnase-1+Act1+IKKi. Total mRNA was prepared from cells after 0-4 hours of doxycycline treatment and then subjected to Northern blotting with a [32P] labeled probe. (ii) Relative IL-6 mRNA levels in Tet-off HEK293 cells during doxycycline treatment. (D) Immunoblot analysis results of Regnase-1 in Regnase-1AA / AA MEFs are shown. Cells were treated with IL-17A (50 ng / ml) for 1 hour, then incubated for 0–240 minutes in plain medium (control), medium containing cycloheximide (100 μM), or medium containing both cycloheximide and okadaic acid (0.5 μM). (E) The results of qPCR analysis of IL-6 and TNF mRNA levels in Regnase-1AA / AA MEF cells treated with TNF-α (20 ng / ml) and IL-17A (50 ng / ml) for 2 hours, then incubated for 0–180 minutes in medium containing either ActD (5 μg / ml) or ActD and okadaic acid (0.5 μM) are shown. qPCR data (A, B, and E) were collected from four independent experiments. Error bars represent mean ± SEM. ***P < 0.005. [Figure 16-1](A) This shows the results of immunoblotting analysis of lysates of Regnase-1-deficient MEFs that stably express FLAG-tagged Regnase-1ΔCTD / ΔCTD. Cells were stimulated for 1 hour with or without IL-17A and probed with anti-FLAG antibody. (B) This shows the results of immunoblotting analysis of Regnase-1 and β-actin in Regnase-1ΔCTD / ΔCTD MEFs stimulated with TNF-α, IL-17A, TNF-α+IL-17A, and IL-1β for 0-4 hours. Regnase-1 is indicated by an arrow. (C) This shows the results of co-expression of Act-1, TBK-1, and IKKi with FLAG-tagged wild-type Regnase-1 or Regnase-1ΔCTD in HEK293 cells. Cell lysates were subjected to immunoblotting analysis using anti-FLAG antibody. (D) Co-immunoprecipitation results of FLAG-tagged wild-type Regnase-1, Regnase-1ΔCTD, and Myc-tagged Act-1 are shown. Cell lysates from HEK293 transfectant were mixed as described and co-immunoprecipitated with anti-FLAG M2 agarose beads. Eluted proteins were subjected to immunoblotting analysis using anti-FLAG antibody, anti-Myc antibody, and anti-actin antibody. [Figure 16-2] (E) Immunoblot analysis results for Regnase-1, RpL7a, GAPDH, and phospho-TBK-1 in intracellular organelles (homogenates, cytosols, and microsomes) isolated from wild-type and Regnase-1ΔCTD / ΔCTD MEFs after stimulation with 50 ng / ml IL-17A for 0, 1, and 4 hours. (F and G) Immunoblot analysis results for polysome fractions are shown. (F) UV absorbance profile (at 260 nm) of the sucrose gradient fraction from MEF cell lysates is shown. (G) Immunoblot analysis results for Regnase-1 and RpL7a in the sucrose gradient fraction isolated from wild-type and Regnase-1ΔCTD / ΔCTD cell lysates are shown. RpL7a is indicated by an arrow. [Figure 16-3](H) Results of qPCR analysis of IL-6, TNF, LCN-2, and GM-CSF mRNA in wild-type, Regnase-1ΔCTD / +, and Regnase-1ΔCTD / ΔCTD MEFs are shown. Cells were stimulated with TNF-α (20 ng / ml) and IL-17A (50 ng / ml) for 0-24 hours. (I) EAE clinical scores of wild-type (black circles; n = 8) and Regnase-1ΔCTD / ΔCTD mice (black squares; n = 8) over 28 days are shown. (J and K) Results of flow cytometry analysis of spinal cord cells (1.0 × 10⁶ cells) 28 days after immunization are shown. (J) Populations of CD4+ T cells (upper) and F4 / 80+ macrophages (lower) in spinal cords from wild-type and Regnase-1ΔCTD / ΔCTD mice are shown. The cell counts of CD4+ T cells and F4 / 80 macrophages in (K)(I) are shown (n = 5 in each group). Error bars represent the mean ± SEM. *P < 0.05, **P < 0.01, and ***P < 0.005. [Figure 16-4] (L) Immunoblot analysis results for Regnase-1 and β-actin in Regnase-1 S513A MEF cells stimulated with IL-1β, IL-17A, or TNF-α for 0-4 hours are shown. (M) Immunoblot analysis results for Regnase-1 in wild-type, Regnase-1AA / AA, and Regnase-1 S513A MEF cells are shown. Cells were stimulated with TNF-α, IL-1β, LPS, or IL-17A for 0-120 minutes in the presence of the transcriptional repressor cycloheximide. [Figure 16-5] (N) This shows the quantitative results of Regnase-1 protein measured by immunoblotting and standardized with β-actin (control). It also shows the half-life of Regnase-1 protein calculated from these results. [Figure 17-1](A) Schematic diagrams of wild-type Regnase-1 (top) and 1bp deletion Regnase-1 (bottom). The CRISPR-Cas9 targeting site is located in the proline-rich region of Regnase-1. The frameshift mutation and the amino acid sequence introduced by the immature stop codon 146 bases downstream of the mutation are underlined. (B) Sequencing of Regnase-1 exon 6 in a mouse genome mutated by the CRISPR-Cas9 system. The sequence chromatogram shows a cytosine base deletion at Pro517 to initiate the frameshift mutation. (C) Schematic diagrams of wild-type Regnase-1 (top) and S513A mutation Regnase-1 (bottom). The CRISPR-Cas9 targeting site is located at Ser513 of Regnase-1. (D) Sequencing of Regnase-1 exon 6 in a mouse genome mutated by the CRISPR-Cas9 system. The sequence chromatograms show the substitution of TAC to TAT at Tyr511 (nonsense mutation) and the substitution of TCT to GCT at Ser513 (S513A mutation), respectively. [Figure 17-2] (C) qPCR analysis results for IL-6, TNF, CXCL-1, CXCL-2, CCL-5, CCL20, LCN-2, and GM-CSF expression in wild-type, Regnase-1ΔCTD mutant, and TBK1 / IKKi double-deficient MEFs are shown. Error bars represent mean ± SEM. *P < 0.05, **P < 0.01, and ***P < 0.005. [Figure 17-3] (D) Production of IL-6, CXCL-1, and CXCL-2 by wild-type and Regnase-1ΔCTD / ΔCTD MEF in response to 24-hour exposure to IL-6 (20 ng / ml), TNF-α (20 ng / ml), IL-17A (50 ng / ml), IL-6 + IL-17A, or TNF-α + IL-17A. Protein production in cell supernatant was evaluated by ELISA. Error bars represent mean ± SEM. *P < 0.05, **P < 0.01, and ***P < 0.005. [Figure 17-4](E) Results of qPCR analysis of IL-6, TNF, Regnase-1, and LCN-2 mRNA in wild-type, Regnase-1ΔCTD / ΔCTD, and Regnase-1 S513A MEFs are shown. Cells were stimulated with TNF-α and IL-17A for 0-24 hours. (F) Results of qPCR analysis of IL-6, TNF, CXCL-1, CXCL-2, CCL-5, CCL-20, LCN-2, and GM-CS mRNAF in wild-type, Regnase-1ΔCTD / ΔCTD, and TBK1 / IKKi double deletion MEFs are shown. Cells were stimulated with TNF-α (20 ng / ml) for 2 hours, followed by IL-17A (50 ng / ml) for 0-4 hours. [Figure 18] (A) Flow cytometry analysis results of CD4+ T cell subsets (TH1 and TH17) in (1) lymph node cells (1.0 × 10⁶ cells) and (2) splenocytes (1.0 × 10⁶ cells) from wild-type and Regnase-1ΔCTD / ΔCTD mice 28 days after EAE immunization. (B) Cell counts of TH1 and TH17 cells in (A) are shown (n = 5 in each group). Error bars represent mean ± SEM. *P < 0.05. [Figure 19-1] The results of luciferase assays for each target gene are shown. The measured firefly luciferase activity is shown standardized using the internal standard, sea urchin luciferase activity, and the pGL3-empty plasmid. Error bars represent two sets of standard deviations (SD). [Figure 19-2] This figure is a continuation of Figure 19-1. [Figure 19-3] This figure is a continuation of Figure 19-2. [Figure 19-4] This figure is a continuation of Figure 19-3. [Figure 19-5] This figure is a continuation of Figure 19-4. [Figure 20] The results of detecting phosphorylated Regnase-1 by Western blotting are shown. [Figure 21](A)(i) Immunoblot analysis of Regnase-1 in cell organelle fractions (cell homogenates, cytoplasmic fraction, and microsomes) prepared from the following mutant MEF cell lines: wild-type, Regnase-1 S513A (Ser513 substituted with Ala), and Regnase-1 ΔCTD (lacking C-terminal domain) stimulated with IL-1β (10 ng / ml) or IL-17A (50 mg / ml) for 1 hour. (ii) Protein levels of Regnase-1 bound to microsomes were evaluated as a percentage of the total cell homogenate. (B) qPCR analysis of IL-6 and TNF mRNA in wild-type, Regnase-1 S513A, and Regnase-1 ΔCTD MEF cells co-stimulated with TNF-α (20 ng / ml) and IL-17A (50 ng / ml) for 0–4 hours. [Figure 22] (A) Thickness of the auricle application area in wild-type mice and Regnase-1 S513A mutant mice in an imiquimod-induced psoriasis model (mean ± standard error; 6 mice in each group). (B) Total score of macroscopic findings of the neck and back skin in wild-type mice and Regnase-1 S513A mutant mice in an imiquimod-induced psoriasis model (mean ± standard error; 6 mice in each group). [Figure 23] The synthesis scheme for peptide compounds is shown. It mainly consists of five steps: (1) peptide extension reaction on resin, (2) peptide cleavage from resin, (3) peptide cyclization reaction, (4) deprotection of functional groups of peptide side chains, and (5) peptide purification. [Figure 24] The results of detecting phosphorylated Regnase-1 using AlphaScreen are shown. Regnase-1 was phosphorylated by reacting it with a kinase (IKKβ or TBK1) in the presence of ATP. After the above reaction, an antibody against phosphorylated Regnase-1 was reacted with the Regnase-1, and the amount of binding was measured using AlphaScreen. The left side of the figure shows the results when IKKβ was used, and the right side shows the results when TBK1 was used. [Figure 25-1]The results of phosphorylation inhibition of full-length Regnase-1 (FL_Reg1) by compounds are shown. After mixing FL_Reg1 with a compound (PP1, PP2, PP3, PP4, PP5, or PP6), Regnase-1 was phosphorylated with TBK1, and the resulting phosphorylated Regnase-1 was measured by AlphaScreen. [Figure 25-2] The results of phosphorylation inhibition of full-length Regnase-1 (FL_Reg1) by compounds are shown. After mixing FL_Reg1 with a compound (PP1, PP2, PP3, PP4, PP5, or PP6), Regnase-1 was phosphorylated using IKKβ, and the resulting phosphorylated Regnase-1 was measured by AlphaScreen. [Figure 26-1] The results of phosphorylation inhibition of C-terminal domain-deficient Regnase-1 (ΔCTD_Reg1) by compounds are shown. After mixing ΔCTD_Reg1 with a compound (PP1, PP2, PP3, PP4, PP5, or PP6), Regnase-1 was phosphorylated with TBK1, and the resulting phosphorylated Regnase-1 was measured by AlphaScreen. [Figure 26-2] The results of phosphorylation inhibition of C-terminal domain-deficient Regnase-1 (ΔCTD_Reg1) by compounds are shown. After mixing ΔCTD_Reg1 with a compound (PP1, PP2, PP3, PP4, PP5, or PP6), Regnase-1 was phosphorylated with IKKβ, and the resulting phosphorylated Regnase-1 was measured by AlphaScreen. [Figure 27-1] The results of inhibitory inhibition of kinase-Regnase-1 binding by compounds are shown. After mixing full-length Regnase-1 (FL_Reg1) with a compound (PP1, PP2, PP3, PP4, PP5, or PP6), TBK1 was added, and the binding of TBK1 to Regnase-1 was measured by AlphaScreen. [Figure 27-2]The results of inhibition of kinase-Regnase-1 binding by compounds are shown. After mixing full-length Regnase-1 (FL_Reg1) with a compound (PP1, PP2, PP3, PP4, PP5, or PP6), IKKβ was added, and the binding of IKKβ to Regnase-1 was measured by AlphaScreen. [Figure 28] This study demonstrates the effect of compounds on the RNA degradation activity of wild-type Regnase-1. A mixture of RNA and wild-type Regnase-1 was reacted with a compound (PP1, PP2, PP3, PP4, PP5, or PP6), and the RNA concentration in the reaction mixture was measured. [Figure 29] This study demonstrates the effect of compounds on the RNA degradation activity of mutant Regnase-1 (D141N). A mixture of RNA and mutant Regnase-1 (D141N) was reacted with a compound (PP1, PP2, PP3, PP4, PP5, or PP6), and the RNA concentration in the reaction mixture was measured. [Figure 30] This study demonstrates the effect of compounds on the RNA degradation activity of wild-type Regnase-1. Compounds (PP7-PP25) were added to a mixture of RNA and wild-type Regnase-1, and the RNA concentration in the reaction mixture was measured. [Figure 31] This study demonstrates the effect of compounds on the RNA degradation activity of mutant Regnase-1 (D226N, D244N). Compounds (compounds PP7-PP25) were added to a mixture of RNA and mutant Regnase-1 (D226N, D244N) and reacted. The RNA concentration in the reaction mixture was then measured. [Figure 32] This figure shows the binding of anti-Regnase-1 antibodies to human Regnase-1 peptide and human full-length Regnase-1. REA0023, REA0027, REB0007, REB0014, and REB0022 were used as anti-Regnase-1 antibodies. Peptide 1 (CLDSGIGSLESQMSELWGVRGG) and Peptide 2 (AFPPREYWSEPYPLPPPTC-NH2) in the figure are both partial peptides of human Regnase-1. FL_Reg1 represents human full-length Regnase-1. [Figure 33] The following shows the results of evaluating the Regnase-1 phosphorylation inhibitory activity of anti-Regnase-1 antibodies. (A) Results of detecting Regnase-1 phosphorylation by each kinase (IKKβ or TBK1) by Western blotting. (B) Inhibitory activity of anti-Regnase-1 antibodies (REA0023, REA0027) against IKKβ-mediated Regnase-1 phosphorylation. Both final concentrations of 16.7 μg / ml and 5.0 μg / ml of anti-Regnase-1 antibodies were evaluated. (C) Inhibitory activity of anti-Regnase-1 antibodies (REB0007, REB0014, REB0022) against TBK1-mediated Regnase-1 phosphorylation. Both final concentrations of 16.7 μg / ml and 5.0 μg / ml of anti-Regnase-1 antibodies were evaluated. [Figure 34] This study demonstrates the effect of anti-Regnase-1 antibodies on the RNA degradation activity of wild-type Regnase-1. Anti-Regnase-1 antibodies (REA0023, REA0027, REB0007, REB0014, REB0022) were added to a mixture of RNA and wild-type Regnase-1 and reacted. The RNA concentration in the reaction mixture was then measured. [Figure 35] This study demonstrates the effect of anti-Regnase-1 antibodies on the RNA degradation activity of mutant Regnase-1 (D226N, D244N). Anti-Regnase-1 antibodies (REA0023, REA0027, REB0007, REB0014, REB0022) were added to a mixture of RNA and mutant Regnase-1 (D226N, D244N) and reacted. The RNA concentration in the reaction mixture was then measured. [Figure 36] The results of the pathological analysis of wild-type mice and Regnase-1 AA mutant mice in an experimental autoimmune uveitis T cell transfer model are shown. (A) Inflammation scores (mean ± standard error; 7 cases in each group) from fundus examination are shown. Statistical analysis was performed by calculating the AUC for each individual and using the Mann-Whitney U test (***: P<0.001). (B) Structural damage scores from histopathological analysis are shown. Statistical analysis was performed using the Mann-Whitney U test (*: P<0.05). [Figure 37]This figure shows changes in various gene expression in the auricle skin of wild-type mice and S513A mutant mice in an imiquimod-induced psoriasis model (normalized by B2m expression levels, mean ± standard error). "Non-disease" in the figure indicates mice that did not exhibit disease. [Figure 38] The EAE clinical scores for wild-type (black circles; n = 10) and Regnase-1 S513A mutant mice (black squares; n = 10) are shown. [Figure 39] The synthesis scheme for compounds in which a GG-TFPI-tag is attached to the C-terminus of a cyclic polypeptide is shown. [Figure 40] The synthesis scheme for Fmoc-Asp(O-Trt(2-Cl)-resin)-bMeAla-OAllyl (compound RS3) is shown. [Figure 41] This shows the process of synthesizing cyclized product B from cyclized product A. [Figure 42] This shows the process for synthesizing the cyclized compound +GG-TFPI-tag compound from cyclized compound B. [Figure 43] The structural information of the cyclized compound +GG-TFPI-tag is shown. [Modes for carrying out the invention]
[0016] 1.Definition As used herein, the term “Regnase-1” (also known as Zc3h12a or MCPIP-1) refers to any native Regnase-1 from any vertebrate source, including mammals such as primates (e.g., humans) and rodents (e.g., mice and rats), unless otherwise specified. This term encompasses both Regnase-1 that has not undergone “full-length” processing and Regnase-1 that results from processing in cells. The amino acid sequence of an exemplary mouse Regnase-1 is published under Uniprot accession number Q5D1E7 (Sequence ID: 1), and the amino acid sequence of an exemplary human Regnase-1 is published under Uniprot accession number Q5D1E8 (Sequence ID: 2). References describing Regnase-1 include, for example, WO2010 / 098429; Nature immunology, Vol.12, NUMBER 12, DECEMBER 2011, p.1167-1175; Nature 458, 2009, p.1185-1190; Cold Spring Harbor Symposia on Quantitative Biology, Volume LXXVIII, 2013, p.51-60; Biochimica et Biophysica Acta 1823, 2012, p.1905-1913. In this specification, Regnase-1 is preferably mammalian Regnase-1.
[0017] As used herein, “Regnase-1-related disease” means a disease in which Regnase-1 is involved in the formation, exacerbation, and / or continuation of the disease. “Diseases involved in the formation, exacerbation, and / or continuation” include not only diseases in which Regnase-1 is directly involved, but also diseases in which it is indirectly involved. “Regnase-1-related disease” may also mean, for example, a disease in which the destabilization and / or intracellular degradation of Regnase-1 is involved in the formation, exacerbation, and / or continuation of the disease. “Regnase-1-related disease” includes inflammatory diseases, autoimmune diseases, allergic diseases, fibrotic diseases, and RNA virus infections. “Regnase-1-related disease” may also be TH17 cell-related disease.
[0018] As used herein, “inflammatory disease” refers to a disease or illness resulting from the overactivation of an individual’s immune system. Inflammatory diseases may, but are not limited to, be caused by inflammatory pathological stages, typically involving leukocyte influx and / or neutrophil chemotaxis. Examples of such diseases include inflammatory skin diseases (including psoriasis and atopic dermatitis); systemic sclerosis; nephritis; reactions associated with inflammatory bowel disease (Crohn's disease and ulcerative colitis); ischemic perfusion diseases including surgical tissue reperfusion injury, myocardial ischemia such as myocardial failure, heart failure, perfusion after cardiac surgery and percutaneous transcatheter coronary artery replacement, seizures, and abdominal aortic aneurysms; post-seizure edema; cranial trauma; hypovolemic shock; respiratory arrest; adult respiratory distress syndrome; acute lung injury; Behçet's disease; dermatomyositis; polymyositis; multiple sclerosis; dermatitis; meningitis; encephalitis; uveitis; ocular inflammation; diabetic retinopathy; diabetic macular edema; osteoarthritis; Lubus nephritis; diabetic nephropathy; and Autoimmune diseases such as rheumatoid arthritis, Sjögren's syndrome, and vasculitis; spondyloarthritis (including ankylosing spondylitis and psoriatic arthritis); diseases including leukocytosis; inflammatory diseases of the central nervous system (CNS), sepsis, or multiple organ injury following trauma; alcoholic hepatitis; bacterial pneumonia; antigen-antibody complex-mediated diseases including glomerulonephritis; sepsis; sarcoidosis; graft rejection after tissue / organ transplantation; graft-versus-host disease; age-related macular degeneration; Kawasaki disease; eosinophilia; neuritis; and inflammation of the lung, including pleurisy, alveolitis, pneumonia, chronic bronchitis, bronchiectasis, diffuse panbronchiolitis, hypersensitivity pneumonitis, idiopathic pulmonary fibrosis (IPF), and cystic fibrosis. Favorable symptoms include acute lung injury, adult respiratory distress syndrome, ischemic perfusion (including surgical tissue perfusion injury, myocardial ischemia, and acute myocardial failure), hypovolemic shock, asthma, bacterial pneumonia, and inflammatory bowel diseases such as ulcerative colitis. Inflammatory diseases partially overlap with other classifications of diseases, such as autoimmune diseases, allergic diseases, and fibrotic diseases, and vice versa.
[0019] As used herein, “autoimmune disease” means a disease or disorder that originates from and is directed toward the tissues of an individual. In this specification, autoimmune disease explicitly excludes malignant or cancerous diseases or conditions, particularly B-cell lymphoma, acute lymphoblastic leukemia (ALL), chronic lymphocytic leukemia (CLL), hairy cell leukemia, and chronic myeloblastic leukemia.Examples of autoimmune diseases or disorders include, but are not limited to, the following: inflammatory reactions such as inflammatory skin diseases including psoriasis and dermatitis (e.g., atopic dermatitis); systemic scleroderma and sclerosis; reactions associated with inflammatory bowel disease (e.g., Crohn's disease and ulcerative colitis); respiratory distress syndromes (including adult respiratory distress syndrome: ARDS); dermatitis; meningitis; encephalitis; uveitis; ocular inflammation; colitis; glomerulonephritis; allergic conditions such as eczema and asthma and other conditions with T-cell infiltration and chronic inflammatory reactions; atherosclerosis; leukocyte adhesion deficiency; rheumatoid arthritis; and systemic lupus erythematosus (SLE). (Including but not limited to lupus nephritis and cutaneous lupus); diabetes mellitus (e.g., type 1 diabetes or insulin-dependent diabetes mellitus); multiple sclerosis; Raynaud's syndrome; autoimmune thyroiditis; Hashimoto's thyroiditis; allergic encephalomyelitis; autoimmune encephalomyelitis; Sjögren's syndrome; juvenile-onset diabetes mellitus; and immune responses associated with acute and delayed hypersensitivity mediated by cytokines and T lymphocytes, typically seen in tuberculosis, sarcoidosis, polymyositis, granulomatosis, and vasculitis; pernicious anemia (Addison's disease); diseases involving leukocyte leakage; central nervous system (CNS) Inflammatory disorders; multiple organ injury syndromes; hemolytic anemia (including, but not limited to, cryoglobulinemia or Coombs-positive anemia); myasthenia gravis; antigen-antibody complex-mediated diseases; anti-glomerular basement membrane diseases; antiphospholipid syndromes; allergic neuritis; Graves' disease; Lambert-Eaton myasthenic syndrome; bullous pemphigoid; pemphigus; autoimmune polyglandular endocrine disorders; Reiter's disease; Stiffman syndrome; Behçet's disease; giant cell arteritis; immune complex nephritis; IgA nephropathy; IgM polyneuropathy; immune thrombocytopenic purpura (ITP) or autoimmune thrombocytopenia. Autoimmune diseases partially overlap with other classifications of diseases, such as inflammatory diseases, allergic diseases, and fibrotic diseases, and vice versa.
[0020] As used herein, “allergic disease” means any symptoms, tissue damage, or loss of tissue function resulting from an allergy. Allergic diseases include hypersensitivity, which is classified into immediate and delayed types, or allergic diseases, which are classified into types I through IV. Examples of such diseases include, but are not limited to, type I allergies (e.g., systemic anaphylaxis, bronchial asthma, and hay fever), type II allergies (e.g., hemolysis in blood type incompatibility transfusions and autoimmune hemolytic anemia), type III allergies (e.g., serum sickness, glomerulonephritis, and rheumatoid arthritis), and type IV allergies (e.g., contact dermatitis, granuloma, and transplant rejection). Examples of allergic diseases include asthma; allergic encephalomyelitis; autoimmune encephalomyelitis; allergic neuritis; contact hypersensitivity; delayed hypersensitivity; airway hypersensitivity; atopic dermatitis; antigen-specific allergies, including hay fever; allergic rhinitis; and urticaria. Allergic diseases partially overlap with other classifications of diseases, such as autoimmune diseases, inflammatory diseases, and fibrotic diseases, and vice versa.
[0021] As used herein, “TH17 cell-related disease” refers to a disease in which TH17 cells play a certain role in the development, exacerbation, and / or continuation of the disease. Examples of such diseases include inflammatory diseases, autoimmune diseases, and allergic diseases in which TH17 cells are associated with the development, exacerbation, and / or continuation of the disease, among others, multiple sclerosis, rheumatoid arthritis, scleroderma, psoriasis, nephritis (e.g., glomerulonephritis), asthma, contact hypersensitivity, delayed-type hypersensitivity, and airway hypersensitivity.
[0022] As used herein, “fibrotic disorder” refers to a condition characterized by the abnormal or excessive formation of fibrous connective tissue in cells, organs, or tissues. Fibrotic disorders can occur, for example, as part of a recovery or response process in cells, tissues, or organs resulting from physical injury, inflammation, infection, etc. In this specification, the term “fibrotic disorder” may be used interchangeably with the terms “fibrosis,” “fibrotic disorder,” and “fibrotic symptoms.”
[0023] Examples of fibrotic diseases include, but are not limited to, the following: vascular fibrosis, pulmonary fibrosis (e.g., idiopathic pulmonary fibrosis), cutaneous fibrosis (e.g., scleroderma, post-traumatic, surgically scarred skin, keloids, and keloid formation of the skin), scleroderma, systemic scleroderma, hepatic fibrosis (e.g., post-hepatitis C virus infection or post-liver transplantation), renal fibrosis (e.g., interstitial fibrosis and nephrogenic systemic fibrosis in focal segmental glomerulosclerosis), and musculoskeletal fibrosis. Fibrosis is associated with various conditions including cardiac fibrosis (e.g., endocardial fibrosis, idiopathic cardiomyopathy), splenic fibrosis, ocular fibrosis (e.g., sclerosis of the eye, glaucoma, conjunctival and corneal scarring, and pterygium), progressive systemic sclerosis (PSS), chronic transplant-versus-host disease, Peyronie's disease, connective tissue disease, post-cystoscopy urethral stricture, mediastinal fibrosis, idiopathic and pharmacologically induced posterior peritoneal fibrosis, progressive severe fibrosis, proliferative fibrosis, neoplastic fibrosis, and fibrosis resulting from surgical implantation of artificial organs. Other diseases, disorders, and conditions associated with fibrosis include, for example, cirrhosis which can lead to hepatic fibrosis, diffuse lung disease, postvasectomy pain syndrome, tuberculosis which can lead to pulmonary fibrosis, sickle cell anemia which can lead to splenomegaly and ultimately fibrosis, rheumatoid arthritis, and Crohn's disease which can cause recurrent inflammation and healing of intestinal tissue which can lead to intestinal wall fibrosis. Fibrotic diseases can also occur as a result of viral hepatitis, alcoholism, complications of hemoglobin disorders, Wilson's disease, schistosomiasis, biliary disorders, exposure to toxins, and metabolic disorders. Fibrotic diseases partially overlap with other classifications of diseases, such as autoimmune diseases, allergic diseases, and inflammatory diseases, and vice versa.
[0024] As used herein, “RNA virus” means a virus having an RNA genome. RNA viruses include single-stranded RNA viruses (including positive-sense and negative-sense RNA viruses) and double-stranded RNA viruses. The term “RNA virus infection” means any disorder caused by the invasion of an RNA virus into the surface, local, or systemic area of a host. The host may be any individual as used herein.
[0025] As used herein, “treatment” (and its grammatical derivatives, e.g., “to treat,” “to treat,” etc.) means a clinical intervention intended to modify the natural course of the individual being treated, and may be carried out for preventive purposes or during the course of a clinical condition. Desired effects of treatment include, but are not limited to, prevention of disease onset or recurrence, symptom reduction, attenuation of any direct or indirect pathological effects of the disease, prevention of metastasis, reduction of the rate of disease progression, recovery or mitigation of the disease state, and remission or improved prognosis. In some embodiments, the Regnase-1 binding molecules of the present invention are used to delay the onset of disease or to slow the progression of disease.
[0026] In this specification, "inhibiting the phosphorylation" of a molecule means reducing the degree to which that molecule is phosphorylated, or preventing that molecule from being phosphorylated at all.
[0027] In this specification, "selectively inhibiting phosphorylation of Regnase-1" means inhibiting the phosphorylation of Regnase-1 while not inhibiting the phosphorylation of other molecules, or inhibiting the phosphorylation of molecules other than Regnase-1 to a smaller degree than inhibiting the phosphorylation of Regnase-1 (for example, 50% or less, 40% or less, 30% or less, 20% or less, or 10% or less). In one embodiment, though not limited to this, selective inhibition of Regnase-1 phosphorylation may be achieved by inhibiting the phosphorylation of Regnase-1 using a Regnase-1 binding molecule. Note that an embodiment in which the phosphorylation of a kinase that phosphorylates Regnase-1 is non-selectively inhibited by inhibiting the activity of the kinase itself, thereby inhibiting the phosphorylation of the kinase's substrates (including molecules other than Regnase-1), is not included in "selectively inhibiting phosphorylation of Regnase-1".
[0028] In this specification, "corresponding position" can be used to characterize amino acid residues in the amino acid sequences of Regnase-1 or processed Regnase-1 from different origins (shared sources) by reference to mouse Regnase-1 (SEQ ID NO: 1). Alignment for determining corresponding positions can be achieved by using various methods within the scope of the art, such as publicly available computer software, including BLAST, BLAST-2, ALIGN, Megalign (DNASTAR) software, or GENETYX® (Genetics Co., Ltd.). Those skilled in the art can determine appropriate parameters for sequence alignment, including any algorithm necessary to achieve the greatest possible alignment over the entire length of the sequences being compared.
[0029] Figure 1-1 shows the amino acid sequence alignment of mouse and human Regnase-1 created using GENETYX®. Table 1 shows the corresponding amino acid residues in human Regnase-1 for each of the amino acid residues in mouse Regnase-1.
[0030] [Table 1]
[0031] In this specification, "suppressing inflammation" may mean that inflammation does not occur, inflammation progresses more slowly compared to an untreated control group, existing inflammation is reduced, or the extent of inflammation is decreased. While not limited to these measures, suppression of inflammatory factor production may be used as one indicator of inflammation suppression.
[0032] In this specification, “inflammatory factors” include inflammatory cytokines and leukocyte migratory factors. Examples of inflammatory factors are disclosed herein.
[0033] In this specification, "targeted" or "targeted" by Regnase-1 means that a molecule can be degraded by the RNase activity of Regnase-1, and whether a particular mRNA can be targeted by Regnase-1 can be confirmed, for example, by the method described in the "Activity Measurement Method" section of this specification.
[0034] In this specification, "suppressing fibrosis" means reducing or eliminating fibrotic lesions in tissue where fibrosis has occurred, or delaying or preventing further progression of fibrosis (suppressing the enlargement of fibrotic lesions).
[0035] In this specification, “epithelial hyperplasia” refers to a condition in which the number of normally arranged normal cells in epithelial tissue is abnormally increased. Epithelial hyperplasia is known to be a characteristic of many disorders, including psoriasis. In this specification, “suppressing epithelial hyperplasia” means reducing the number of increased normal cells in epithelial tissue, or delaying or preventing further proliferation.
[0036] In this specification, "inhibition of keratinocyte proliferation" means reducing the number of keratinocytes or delaying or preventing further proliferation. Whether a substance inhibits keratinocyte proliferation can be verified, for example, by histological examination.
[0037] In this specification, "intracellular degradation of Regnase-1" means a decrease in the amount of Regnase-1 protein within a cell, or the disappearance of Regnase-1 from the cell, and includes degradation via the ubiquitin-proteasome system. For example, if the amount of Regnase-1 protein is higher in cells treated with the test substance compared to cells not treated with the test substance, it can be considered that intracellular degradation of Regnase-1 is suppressed by the treatment with the test substance.
[0038] In this specification, "destabilization of Regnase-1" means a decrease in the RNase activity of Regnase-1 compared to a control (for example, non-phosphorylated Regnase-1 can be used). For example, if Regnase-1 is present but has lost its ability to degrade target mRNA, that Regnase-1 is described as destabilized. Destabilization of Regnase-1 can be confirmed by the methods described herein (for example, see the section on activity measurement methods), and IL-6 mRNA may be used as the target, for example. Regnase-1 with such reduced RNase activity is sometimes referred to as "inactive."
[0039] In this specification, "suppressing the destabilization of Regnase-1" may mean suppressing the destabilization of Regnase-1 or suppressing the generation of an inactive form of Regnase-1.
[0040] In this specification, "inhibition of Regnase-1 oligomer dissociation" means suppressing or inhibiting the dissociation of Regnase-1 oligomers in vitro or in vivo to form aggregates or monomers with fewer oligomers. Examples include suppressing or inhibiting the dissociation of Regnase-1 hexamers or larger aggregates to form trimers or monomers.
[0041] In this specification, "inhibition of Regnase-1 release from the endoplasmic reticulum" means suppressing or inhibiting the release of Regnase-1 from the endoplasmic reticulum in vitro or in vivo. "Endoplasmic reticulum" may be abbreviated as "ER". In this specification, "endoplasmic reticulum" preferably means the rough endoplasmic reticulum.
[0042] In this specification, "methods for identifying substances that inhibit phosphorylation" include, but are not limited to, methods for screening for substances that inhibit phosphorylation and methods for confirming that a certain substance inhibits phosphorylation.
[0043] In this specification, "binding molecule" means a molecule that can bind to another molecule. For example, if A can bind to B, then A is described as a binding molecule of B.
[0044] In this specification, "Regnase-1 binding molecule" means a molecule capable of binding to Regnase-1. Examples include, but are not limited to, synthetic small molecule compounds, peptides, polypeptides, proteins, antibodies, carbohydrates, nucleic acids, and their derivatives. A "Regnase-1 binding molecule" may be any molecule capable of specifically binding to Regnase-1.
[0045] In this specification, "polypeptide" means a substance in which four or more amino acids and / or amino acid analogs are linked by amide bonds and / or ester bonds. This may include natural polypeptides, synthetic polypeptides, recombinant polypeptides, etc. Polypeptides include antibodies and cyclic polypeptides.
[0046] The term "antibody" is used in its broadest sense and is not limited to those that exhibit the desired antigen-binding activity, but encompasses a variety of antibody structures, including monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), modified antibodies, and antibody fragments.
[0047] The term "modified antibody" refers to an antibody that has been modified from an unmodified parent antibody in terms of amino acid or glycosylation status, etc. Examples of modifications include those aimed at increasing affinity to an antigen, extending the half-life in the blood, altering C1q binding or complement-dependent cell-mediated cytotoxicity (CDC), and improving the antibody's ability to move into cells. In this specification, antibody derivatives to which non-protein portions (e.g., drugs, polyethylene glycol (PEG), or nucleic acids) have been added are also included in the definition of modified antibodies.
[0048] The term "antibody fragment" refers to a molecule other than the complete antibody, containing a portion of the complete antibody that binds to the antigen to which the complete antibody binds. Examples of antibody fragments, but not limited to these, include Fv, Fab, Fab', Fab'-SH, F(ab')2; diabodies; linear antibodies; single-chain antibody molecules (e.g., scFv); and multispecific antibodies formed from antibody fragments.
[0049] The terms "full-length antibody," "complete antibody," and "whole antibody" are used interchangeably in this specification and refer to antibodies that have a structure substantially similar to that of a natural antibody, or that have a heavy chain containing an Fc region.
[0050] The term "cyclic polypeptide" refers to a polypeptide containing a cyclic structure formed by four or more amino acids and / or amino acid analogs. A cyclic polypeptide may have a linear portion in addition to the cyclic portion. The bonding mode of the cyclization portion is not particularly limited and may be a bond other than an amide bond or ester bond. Preferred examples of bonding modes of the cyclization portion include covalent bonds such as amide bonds, carbon-carbon bonds, disulfide bonds, ester bonds, thioester bonds, thioether bonds, lactam bonds, bonds via an azoline skeleton, bonds via a triazole structure, and bonds via a fluorophore structure. The position of functional groups such as carboxyl groups and amino groups used in cyclization may be on the main chain or on the side chain, and is not particularly limited as long as they are in a position where cyclization is possible. In this specification, "bonding mode of the cyclization portion" refers to the bonding mode of the site where cyclization is formed by the cyclization reaction.
[0051] In this specification, "amino acids" include natural amino acids and non-natural amino acids. In this specification, "natural amino acids" refer to Gly (glycine), Ala (alanine), Ser (serine), Thr (threonine), Val (valine), Leu (leucine), Ile (isoleucine), Phe (phenylalanine), Tyr (tyrosine), Trp (tryptophan), His (histidine), Glu (glutamic acid), Asp (aspartic acid), Gln (glutamine), Asn (asparagine), Cys (cysteine), Met (methionine), Lys (lysine), Arg (arginine), and Pro (proline). Non-natural amino acids are not particularly limited, but examples include β-amino acids, γ-amino acids, D-type amino acids, N-substituted amino acids, α,α-disubstituted amino acids, and amino acids with side chains different from those of natural amino acids. In this specification, any stereochemistry is permitted for amino acids. There are no particular restrictions on the selection of amino acid side chains. In this specification, amino acids in which the main chain amino group is substituted are referred to as "N-substituted amino acids." Although not intended as a limitation, N-substituted amino acids include N-alkyl amino acids, among which N-methyl amino acids are preferably exemplified. In this specification, "amino acid analogs" preferably means hydroxycarboxylic acids, more preferably α-hydroxycarboxylic acids. The side chains of α-hydroxycarboxylic acids are not particularly limited, similar to amino acids.
[0052] In this specification, amino acids that constitute proteins, polypeptides, and peptides may be referred to as amino acid residues. Serine residues may be referred to as "Ser residues," and threonine residues as "Thr residues." For example, the 513th serine residue in a given amino acid sequence may be written as S513 or Ser513, and the substitution of the same serine residue with alanine may be written as S513A or Ser513Ala.
[0053] The term "affinity" refers to the strength of the combined non-covalent interactions between one binding site of a molecule (e.g., an antibody) and its binding partner (e.g., an antigen). Unless otherwise specified, "binding affinity" as used herein refers to the intrinsic binding affinity that reflects the 1:1 interaction between members of a binding pair (e.g., an antibody and an antigen). The affinity of molecule X to its partner Y can generally be expressed by its dissociation constant (KD). Affinity can be measured by conventional methods known in the art. Specific examples and exemplary embodiments for measuring binding affinity are described below.
[0054] The terms "molecule that can specifically bind to Regnase-1" and "molecule that can specifically recognize Regnase-1" are interchangeable and refer to molecules that can specifically bind to Regnase-1 with sufficient affinity, and as a result, are useful as diagnostic and / or therapeutic agents when they target Regnase-1. In one embodiment, the degree of binding of a "molecule that can specifically bind to Regnase-1" to unrelated non-Regnase-1 proteins is less than approximately 10% of the binding to Regnase-1, as measured by, for example, surface plasmon resonance assay, radioimmunoassay (RIA), or enzyme immunoassay. In a particular embodiment, a "molecule that can specifically bind to Regnase-1" can have concentrations of 1 μM or less, 100 nM or less, 10 nM or less, 1 nM or less, 0.1 nM or less, 0.01 nM or less, or 0.001 nM or less (e.g., 10 -8 M or less, for example, 10 -8 M~10 -13 M, for example, 10 -9 M~10 -13It has a dissociation constant (KD) of M). In one embodiment, the degree of binding of the “Regnase-1 specific binding molecule” to an unrelated non-Regnase-1 protein is less than 10% of the binding to Regnase-1, as measured, for example, by surface plasmon resonance assay using the method described herein. In certain embodiments, the “Regnase-1 specific binding molecule” binds to Regnase-1 epitopes that are conserved among Regnase-1 from different species, but is not limited thereto. In certain embodiments, the “Regnase-1 specific binding molecule” binds to mouse and human Regnase-1, but is not limited thereto.
[0055] In this specification, the molecules that can specifically bind to phosphorylated Regnase-1 at a specific site and the molecules that can specifically recognize phosphorylated Regnase-1 are interchangeable, and in one embodiment, the degree of binding to Regnase-1 that is not phosphorylated at a specific site may be less than approximately 10% of the binding to Regnase-1 that is phosphorylated at a specific site, as measured by methods such as surface plasmon resonance assay, radioimmunoassay (RIA), and Western blotting.
[0056] In this specification, "molecules that can specifically bind to Regnase-1" include, but are not limited to, antibodies and polypeptides such as cyclic polypeptides.
[0057] As used herein, “Toll-like receptor (TLR) ligand” includes, but is not limited to, TLR1 ligand, TLR2 ligand, TLR7 ligand, or TLR4 ligand (lipopolysaccharide (LPS)).
[0058] The “effective dose” of a drug (for example, a pharmaceutical formulation) refers to the amount in the required dosage and over the required period of time that is effective in achieving the desired therapeutic or prophylactic outcome.
[0059] The terms “host cell,” “host cell line,” and “host cell culture” refer to cells (including their offspring) that are interchangeably used and into which foreign nucleic acids have been introduced. Host cells include “transformed organisms” and “transformed cells,” which include primary transformed cells and their offspring, regardless of passage number. Offspring do not have to be completely identical to the parent cells in terms of nucleic acid content and may contain mutations. Mutant offspring that have the same function or biological activity as those used when the original transformed cells were screened or selected are also included herein.
[0060] The terms “individual” or “subject” refer to mammals. Mammals include, but are not limited to, domesticated animals (e.g., cattle, sheep, cats, dogs, horses), primates (e.g., humans, and non-human primates such as monkeys), rabbits, and rodents (e.g., mice and rats). In certain embodiments, the individual or subject is a human.
[0061] The term "monoclonal antibody" refers to an antibody obtained from a substantially homogeneous population of antibodies. That is, the individual antibodies constituting that population are identical and / or bind to the same epitope, except for any possible mutant antibodies (e.g., mutant antibodies containing naturally occurring mutations, or mutant antibodies that occur during the production of the monoclonal antibody preparation; such variants are usually present in small amounts). In contrast to polyclonal antibody preparations, which typically contain different antibodies against different determinants (epitopes), each monoclonal antibody in a monoclonal antibody preparation is against a single determinant on an antigen. Therefore, the modifier "monoclonal" indicates a characteristic of the antibody that it is obtained from a substantially homogeneous population of antibodies, and should not be interpreted as requiring the production of the antibody by any particular method. For example, monoclonal antibodies used in accordance with the present invention may be prepared by a variety of methods, including, but are not limited to, hybridoma methods, recombinant DNA methods, phage display methods, and methods utilizing transgenic animals containing all or part of the human immunoglobulin locus.
[0062] The term "polyclonal antibody" refers to a group of antibodies that typically contain different antibodies against different determinants (epitopes). The modifier "polyclonal" describes a characteristic of the antibody and should not be interpreted as requiring the production of the antibody by any specific method.
[0063] The term "TBK1" refers to a serine / threonine kinase also known as TANK-binding kinase 1. Examples of amino acid sequences for human and mouse TBK1 are available from Uniprot accessions Q9UHD2 and Q9WUN2, respectively.
[0064] The term "IKKi" refers to a kinase also known as inducible IκB kinase or IKK-E. Examples of amino acid sequences for human IKKi and mouse IKKi are available from Uniprot accessions Q14164 and Q9R0T8, respectively.
[0065] The term "Act-1" refers to an adapter molecule also known as TRAF3IP2, CIKS, or Nuclear factor NF-kappa-B activator 1. An example of the amino acid sequence of human Act-1 is available from Uniprot accession number 043734.
[0066] The term "IKK" is used synonymously with IκB kinase, and IKK includes IKKα and / or IKKβ. In this specification, IKKβ is preferred as an example of IKK.
[0067] The term "IRAK" is used synonymously with IL-1 receptor-associated kinase (IL-1R-associated kinase), and IRAK includes IRAK1 and IRAK2. In this specification, IRAK1 and IRAK2 are preferred examples of IRAK.
[0068] The term "pharmaceutical preparation" refers to a preparation in which the biological activity of the active ingredient contained therein can exert its effect, and which does not contain additional elements that are toxic to an extent unacceptable to the subject to which the preparation is administered.
[0069] A "pharmaceutically acceptable carrier" refers to a component in a pharmaceutical preparation other than the active ingredient that is non-toxic to the subject. Pharmaceutically acceptable carriers include, but are not limited to, buffers, excipients, stabilizers, or preservatives.
[0070] As used herein, the term "vector" refers to a nucleic acid molecule capable of amplifying another nucleic acid to which it is ligated. This term includes vectors as self-replicating nucleic acid structures, and vectors incorporated into the genome of a host cell into which they are introduced. Some vectors can result in the expression of the nucleic acid to which they are operationally ligated. Such vectors are also referred to herein as "expression vectors."
[0071] 2. Treatment methods and therapeutic compositions, etc. In this section, "treatment and / or preventive methods" may be simply referred to as "treatment methods." Similarly, "compositions for treatment and / or preventive purposes" may be simply referred to as "therapeutic compositions."
[0072] In one aspect, the present invention is based on the finding that inhibiting phosphorylation at a specific site of Regnase-1 is effective in treating and / or preventing inflammatory diseases, autoimmune diseases, allergic diseases, fibrotic diseases, RNA virus infections, TH17 cell-related diseases, and the like. In one aspect, the present invention is based on the finding that inhibiting phosphorylation of a specific site of Regnase-1 is effective in at least one selected from the group consisting of (i) to (xi) below: (i) treatment and / or prevention of diseases involving Regnase-1; (ii) suppression of inflammation; (iii) suppression of fibrosis of cells, tissues or organs; (iv) suppression of epithelial hyperplasia; (v) suppression of the expression of at least one mRNA selected from the group consisting of IL6, IL1a, CXCL1, CXCL2, HBEGF, CTGF, DDR1 and PDGFB; (vi) suppression of destabilization of Regnase-1; (vii) suppression of the production of inflammatory factors; (viii) suppression of intracellular degradation of Regnase-1; (ix) inhibition of the release of Regnase-1 from the endoplasmic reticulum; (x) inhibition of the dissociation of Regnase-1 oligomers; (xi) inhibition of keratinocyte proliferation. In one aspect, the present invention is based on the discovery that (a) TBK1 or IKKi and (b) Act-1 are involved in the phosphorylation of Regnase-1 by IL-17 stimulation.
[0073] Despite the rapid induction of its mRNA, Regnase-1 is present in various cells, such as macrophages and fibroblasts, even when unstimulated, and is thought to play a role in suppressing unnecessary inflammatory responses (Nature immunology, Vol.12, NUMBER 12, DECEMBER 2011, p.1167-1175). On the other hand, in response to external stimuli mediated by MyD88, such as Toll-like receptor (TLR) ligands and the IL-1 family, Regnase-1 is thought to be phosphorylated by IκB kinase (IKK) and undergo ubiquitin-dependent degradation (Nature immunology, Vol.12, NUMBER 12, DECEMBER 2011, p.1167-1175). In parallel, IκB phosphorylated by IKK is similarly degraded, and as a result of the release of NF-κB, NF-κB translocates to the nucleus, inducing various inflammation-related genes, including Regnase-1. It is thought that Regnase-1, induced in this way, degrades target mRNA and controls the biological response through a negative feedback mechanism that suppresses the persistence of excessive inflammation.
[0074] While not intending to be bound by any particular theory, the inventors considered the following: Specifically, the results disclosed herein suggest that while mouse Regnase-1 with S435A and S439A mutations undergoes phosphorylation and becomes inactive, its degradation is suppressed. Subsequently, it is thought that some Regnase-1 is dephosphorylated, resulting in the production of an active Regnase-1 with RNase activity. Experiments in which various diseases were induced in animals expressing such Regnase-1 mutants (EAE, a model of multiple sclerosis, as well as models of psoriasis, glomerulonephritis, and scleroderma) demonstrated the therapeutic usefulness of suppressing the destabilization and / or intracellular degradation of Regnase-1. On the other hand, since Regnase-1 with S435A and S439A mutations also undergoes phosphorylation and becomes inactive, it was considered that suppressing this process could lead to a stronger therapeutic effect. Although the following shows the results of studies using IL-17 and IL-1 stimulation, as will be discussed later, LPS (known as a ligand for TLR4) stimulation also shows a similar phosphorylation pattern to IL-17 and IL-1 stimulation. Furthermore, Pam3-Csk4 (known as a ligand for TLR1 and TLR2) stimulation of Regnase-1AA / AA cells reduces the production of IL-6 and IL-12, which are targets of Regnase-1. Additionally, imiquimod, which was used to induce a psoriasis model, is known to be a TLR7 agonist. Therefore, it was considered that suppressing the destabilization and / or intracellular degradation of Regnase-1 is effective in diseases involving TLR ligands.
[0075] Based on these findings, the inventors have found that, in one aspect, inhibiting the phosphorylation of Regnase-1 at the site where it is phosphorylated by IKK (Ser residues corresponding to positions 435 and 439 of SEQ ID NO: 1) is effective in at least one of the following groups: (i) treatment and / or prevention of diseases involving Regnase-1; (ii) suppression of inflammation; (iii) suppression of fibrosis of cells, tissues, or organs; (iv) suppression of epithelial hyperplasia; (v) suppression of the expression of at least one mRNA selected from the group consisting of IL6, IL1a, CXCL1, CXCL2, HBEGF, CTGF, DDR1, and PDGFB; (vi) suppression of the production of inflammatory factors; (vii) suppression of intracellular degradation of Regnase-1; and (viii) suppression of keratinocyte proliferation.
[0076] While not intending to be bound by any particular theory, the inventors considered the following (1) to (4).
[0077] (1) The inventors focused on Ser494, Thr505, Ser508, and Ser513 of SEQ ID NO: 1 among the amino acid residues of mouse Regnase-1, which have been confirmed to be phosphorylated by IL-17 and IL-1 stimulation. With the aim of verifying the effect of phosphorylation of each amino acid residue on the destabilization of Regnase-1, Regnase-1 mutants were created in which each of these four residues was replaced with alanine (Ala) to inhibit phosphorylation of Regnase-1. Using these Regnase-1 mutants, the phosphorylation of Regnase-1 after IL-17 and IL-1 stimulation was verified by Western blotting. The results showed that a band shift indicating phosphorylation was detected in Regnase-1 with the T505A / S508A mutation, but no such band shift was detected in Regnase-1 with the S494A, S513A, and S494A and S513A mutations. From this, it was considered that the phosphorylation of the Ser residue at positions corresponding to 494 and / or 513 of SEQ ID NO: 1 in Regnase-1 contributed to the aforementioned band shift.
[0078] (2) The inventors have shown through experiments targeting IL-6 mRNA that phosphorylated Regnase-1 corresponding to the shifted bands produced by IL-17 and IL-1 stimulation is an inactive form with reduced ability to degrade target mRNA. Therefore, it was considered that inhibiting the phosphorylation of Ser494 and Ser513 of Regnase-1 could suppress the production of inactive phosphorylated Regnase-1 (suppress the destabilization of Regnase-1) and maintain the activity of Regnase-1.
[0079] (3) Based on research results disclosed herein for the first time, the inventors have considered the intracellular roles of Ser494 and Ser513 as follows: Regnase-1 exists in oligomeric form in the endoplasmic reticulum, a ribosome-containing organelle. Phosphorylation of Regnase-1 induced by cellular stimulation dissociates the Regnase-1 oligomer, promoting its release from the endoplasmic reticulum and subsequent translocation to the cytoplasm. Furthermore, phosphorylated Regnase-1 loses its RNase activity. Phosphorylated Regnase-1 is then degraded by the proteasome in the cytoplasm. By inhibiting the phosphorylation of the Ser residues corresponding to positions 494 and / or 513 in SEQ ID NO: 1, which are amino acid residues that play a central role in the phosphorylation of Regnase-1 induced by IL-17 and / or IL-1 stimulation, it is possible to suppress the dissociation of Regnase-1 oligomers induced by cellular stimulation, inhibit their release from the endoplasmic reticulum, and suppress the degradation of Regnase-1. Regnase-1 degrades target mRNA in the endoplasmic reticulum. Therefore, inhibiting the phosphorylation of the Ser residue at positions 494 and / or 513 in SEQ ID NO: 1, and thereby inhibiting the release of Regnase-1 from the endoplasmic reticulum (and its subsequent translocation to the cytoplasm), allows Regnase-1 to continue its target mRNA degradation activity even after stimulation (suppressing the destabilization of Regnase-1).
[0080] (4) Furthermore, based on the findings disclosed herein that TBK1 and IKKi are kinases that phosphorylate Ser494 and Ser513, the inventors conducted research using animals expressing Regnase-1ΔCTD that was not phosphorylated by TBK1 and IKKi. As a result, it was shown that inhibiting the phosphorylation of Ser513 and Ser494 had a strong effect on treating and / or preventing diseases involving Regnase-1. This therapeutic and / or preventive effect was greater than the effect when phosphorylation of Ser435 and Ser439 was inhibited by substituting these residues with Ala. In addition, it was shown that Act-1 contributes to the phosphorylation of Regnase-1 via TBK1 and IKKi. Furthermore, IRAK was hypothesized to be the kinase that phosphorylates Ser494 and Ser513 upon IL-1 stimulation.
[0081] From these findings, the inventors have found that, in one aspect, inhibiting the phosphorylation of a Ser residue at at least one position selected from the group consisting of positions corresponding to positions 513 and 494 of Sequence ID No. 1 in Regnase-1, and / or inhibiting the interaction between Regnase-1 and at least one selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK, is effective for at least one of the following (i) to (ix): (i) treatment and / or prevention of diseases involving Regnase-1; (ii) suppression of inflammation; (iii) suppression of fibrosis of cells, tissues, or organs; (iv) suppression of epithelial hyperplasia; (v) suppression of the expression of at least one mRNA selected from the group consisting of IL6, IL1a, CXCL1, CXCL2, HBEGF, CTGF, DDR1, and PDGFB; (vi) suppression of the production of inflammatory factors; (vii) suppression of destabilization of Regnase-1; (viii) (ix) Inhibition of intracellular degradation of Regnase-1; (ix) Inhibition of keratinocyte proliferation.
[0082] While not intending to be bound by any particular theory, the inventors also consider the following: The signaling induced by IL-36 stimulation utilizes a MyD88-mediated pathway, similar to stimulation by IL-1 and TLR ligands. The destabilization and degradation of Regnase-1 induced by IL-1 and TLR ligand stimulation is thought to proceed via the activation of IKK and IRAK via MyD88, followed by phosphorylation of Regnase-1 by these kinases. Therefore, it is thought that phosphorylation of Regnase-1 via the activation of IKK and IRAK also occurs with IL-36 stimulation, leading to destabilization and / or degradation of Regnase-1. Indeed, it has been reported that Regnase-1 is degraded by IL-36 stimulation, and the association between IL-36-related diseases and Regnase-1 has also been demonstrated (Journal of Investigative Dermatology (2018) 138, 1439-1442). Therefore, it is thought that inhibiting the destabilization and / or intracellular degradation of Regnase-1 may be effective against diseases involving IL-36, and thus, inhibition of Regnase-1 phosphorylation could be a promising approach.
[0083] While not intending to be bound by any particular theory, the inventors believe the following: Regnase-1 has been reported to exhibit anti-RNA virus activity (J Immunol 2014; 193:4159-4168; Proc Natl Acad Sci USA 2013; 110: 19083-19088; Nucleic Acids Res 2013; 41:3314-3326; Nature 2009; 461: 399-401). In one embodiment, the present invention can suppress the destabilization and / or intracellular degradation of Regnase-1, thereby maintaining the RNase activity of Regnase-1 and making it effective against RNA virus infections.
[0084] In some embodiments, the method of the present invention may be a method by selectively inhibiting the phosphorylation of a Ser residue with Regnase-1. Alternatively, the method of the present invention may include a step of selectively inhibiting the phosphorylation of a Ser residue with Regnase-1.
[0085] In some embodiments, the compositions of the present invention may inhibit the phosphorylation of the Ser residue of Regnase-1, and in one embodiment, they may selectively inhibit the phosphorylation of Regnase-1. In some embodiments, the compositions of the present invention may contain a Regnase-1 binding molecule that inhibits the phosphorylation of the Ser residue of Regnase-1.
[0086] In some embodiments, the methods or compositions of the present invention may inhibit the binding of Regnase-1 to at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK (hereinafter, these molecules are also referred to as "Regnase-1 active molecules"), and in one embodiment, the methods or compositions of the present invention may inhibit the binding of Regnase-1 to any of the following binding molecules: (i) at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, and IKK; (ii) at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, and IRAK; (iii) At least one binding molecule selected from the group consisting of TBK1, IKKi, and Act-1; (iv) TBK1 and IKKi; (v) Act-1; (vi) TBK1, IKKi, and Act-1; (vii) TBK1; (viii) IKKi; (ix) IRAK; (x) IKK; (xi) TBK1 and IKK. Although not limited, IKKβ is an example of IKK in (i) to (xi) above.
[0087] In some embodiments, the compositions of the present invention may contain a Regnase-1 binding molecule that inhibits the binding of at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK to Regnase-1.
[0088] In some embodiments, the methods or compositions of the present invention may be methods or compositions for at least one selected from the group consisting of (i) to (xi): (i) for treating and / or preventing diseases involving Regnase-1; (ii) for suppressing inflammation; (iii) for suppressing fibrosis of cells, tissues or organs; (iv) for suppressing epithelial hyperplasia; (v) for suppressing the expression of at least one mRNA selected from the group consisting of IL6, IL1a, CXCL1, CXCL2, HBEGF, CTGF, DDR1 and PDGFB; (vi) for suppressing destabilization of Regnase-1; (vii) for suppressing the production of inflammatory factors; (viii) for suppressing intracellular degradation of Regnase-1; (ix) for inhibiting the release of Regnase-1 from the endoplasmic reticulum; (x) for inhibiting the dissociation of Regnase-1 oligomers; (xi) for suppressing keratinocyte proliferation.
[0089] In some embodiments, the method or composition of the present invention may be a method or composition for two or more, three or more, four or more, or five or more selected from (i) to (xi) above.
[0090] Whether a substance or composition inhibits the release of Regnase-1 from the endoplasmic reticulum can be confirmed, for example, by the method described in the Examples (a method of isolating intracellular compartments and analyzing their protein distribution using Western blotting). Whether a substance inhibits the dissociation of Regnase-1 oligomers can be confirmed, for example, by using the non-denaturing PAGE analysis described in the Examples.
[0091] In some embodiments, the Ser residue in the present invention may be a Ser residue at at least one position or two or more positions selected from the group consisting of positions corresponding to positions 513, 494, 439, and 435 of Sequence ID No. 1 in Regnase-1, and may be (i) positions 513, 494, 439, and 435 of Sequence ID No. 1; or (ii) at least one position or two or more positions selected from the group consisting of positions 516, 497, 442, and 438 of Sequence ID No. 2.
[0092] In some embodiments, the Ser residue in the present invention may be a Ser residue at at least one position selected from the group consisting of positions corresponding to positions 513 and 494 of SEQ ID NO: 1 in Regnase-1, or at least one position selected from the group consisting of positions 516 and 497 of SEQ ID NO: 2, or at least one position selected from the group consisting of positions 516 and 497, or at least one position selected from the group consisting of positions 516 and 497 of SEQ ID NO: 2.
[0093] In some embodiments, the Ser residue in the present invention may be the Ser residue corresponding to position 513 of SEQ ID NO: 1 in Regnase-1, and may be (i) position 513 of SEQ ID NO: 1; or (ii) the Ser residue at position 516 of SEQ ID NO: 2.
[0094] In some embodiments, the Ser residue in the present invention may be a Ser residue at at least one position selected from the group consisting of positions corresponding to positions 439 and 435 of Sequence ID No. 1 in Regnase-1, or at least one position selected from the group consisting of positions 442 and 438 of Sequence ID No. 2, or at least one position selected from the group consisting of positions 442 and 438, or at least one position selected from the group consisting of positions 442 and 438 of Sequence ID No. 2.
[0095] In some embodiments, the Ser residue in the present invention may be both of the following Ser residues: (i) Either or both of the Ser residues at positions 513 and 494, respectively, in Regnase-1; (ii) Either or both of the Ser residues at positions corresponding to 439 and 435 of SEQ ID NO: 1 in Regnase-1. While not intended to be bound by any particular theory, the effects of the present invention may be more strongly exerted by suppressing the phosphorylation of both Ser residues in Regnase-1 that are phosphorylated by TBK1 and IKKi, and those that are phosphorylated by IKKi. For example, greater efficacy can be obtained in the treatment and / or prevention of inflammatory diseases, autoimmune diseases, allergic diseases, fibrotic diseases, RNA virus infections, TH17 cell-related diseases, etc.
[0096] In some embodiments, the Ser residue in the present invention may be a Ser residue included in at least one or more amino acid sequences selected from the group consisting of YWSEP (SEQ ID NO: 3), HFSVP (SEQ ID NO: 4), and DSGIGS (SEQ ID NO: 5) included in the amino acid sequence of Regnase-1.
[0097] In some embodiments, a substance capable of inhibiting the phosphorylation of a Ser residue in the present invention may be at least one compound (cyclic polypeptide) selected from PP1 to PP25 described herein. PP1 to PP25 have the amino acid sequences described in SEQ ID NOs: 11 to 16 and 30 to 48, respectively. In some embodiments, the substance capable of inhibiting the phosphorylation of the Ser residue in the present invention may be at least one compound (a cyclic polypeptide having a linear portion) selected from PP7+tag, PP10+tag, and PP23+tag as described herein. PP7+tag, PP10+tag, and PP23+tag have the amino acid sequences described in SEQ ID NOs: 57 to 59, respectively.
[0098] In some embodiments, the substance capable of inhibiting the phosphorylation of the Ser residue in the present invention is an antibody. The antibody can be selected from, for example, anti-Regnase-1 antibodies containing the amino acid sequences described below. REA0023 comprises a heavy chain containing the amino acid sequence described in SEQ ID NO: 20 and a light chain containing the amino acid sequence described in SEQ ID NO: 21. REA0027, comprising a heavy chain containing the amino acid sequence described in SEQ ID NO: 22 and a light chain containing the amino acid sequence described in SEQ ID NO: 23. REB0007 comprises a heavy chain containing the amino acid sequence described in SEQ ID NO: 24 and a light chain containing the amino acid sequence described in SEQ ID NO: 25. REB0014 comprises a heavy chain containing the amino acid sequence described in SEQ ID NO: 26 and a light chain containing the amino acid sequence described in SEQ ID NO: 27. REB0022 comprises a heavy chain containing the amino acid sequence described in SEQ ID NO: 28 and a light chain containing the amino acid sequence described in SEQ ID NO: 29.
[0099] In some embodiments, the phosphorylation in the present invention may be phosphorylation induced by at least one molecule selected from the group consisting of IL-17, IL-1, IL-36, and TLR ligands; or, more preferably, at least one molecule selected from the group consisting of IL-17, IL-1, and TLR ligands, and more preferably, phosphorylation induced by IL-17. In one embodiment, however, the IL-17; IL-1; IL-36; and TLR ligands may be, independently, IL-17A; IL-1β; IL-36α; and ligands for TLR1, TLR2, TLR4, TLR7, or LPS. The cells stimulated by the aforementioned molecules are not particularly limited, but may be non-hematopoietic cells, including macrophages, fibroblasts (for example, experimentally mouse fetal fibroblasts (MEFs) can be used), and endothelial cells (for example, experimentally hepatic sinusoidal endothelial cells (LSECs) can be used).
[0100] In another embodiment, phosphorylation in the present invention may be phosphorylation by at least one kinase selected from the group consisting of TBK1 (TANK-binding kinase 1), IKKi (inducible IκB kinase), IRAK (IL-1R-associated kinase) 1, IRAK2, and IKK (IκB kinase), or it may be phosphorylation by at least one kinase selected from the group consisting of TBK1, IKKi, and IKK, or it may be phosphorylation by IKK, or it may be phosphorylation by IRAK, or it may be phosphorylation by TBK1 and / or IKKi.
[0101] The degree of inhibition of Regnase-1 phosphorylation in the present invention is not particularly limited. If the degree of phosphorylation of Regnase-1 when the test substance is added is reduced compared to a negative control without the test substance, then phosphorylation may be considered inhibited. For example, the degree of phosphorylation may be reduced to 50% or less, 40% or less, 30% or less, 20% or less, or 10% or less.
[0102] In the present invention, the degree of inhibition of binding between Regnase-1 and at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK is not particularly limited. If the degree of binding between the binding molecule and Regnase-1 is reduced when the test substance is added compared to a negative control without the test substance, it can be considered that the binding between the binding molecule and Regnase-1 is inhibited. For example, the reduction may be 50% or less, 40% or less, 30% or less, 20% or less, or 10% or less.
[0103] The test substance in this invention is not particularly limited and includes, for example, peptides, proteins, non-peptide compounds, synthetic compounds, fermentation products, cell extracts, and preferably antibodies and cyclic polypeptides.
[0104] In some embodiments, the methods and / or compositions of the present invention may be for treating and / or preventing diseases involving Regnase-1.
[0105] "Diseases involving Regnase-1" may be at least one disease selected from the group consisting of inflammatory diseases, autoimmune diseases, allergic diseases, fibrotic diseases, RNA virus infections, and TH17 cell-related diseases. In one embodiment, "Diseases involving Regnase-1" may be at least one disease selected from the group consisting of inflammatory diseases with fibrosis and / or epithelial hyperplasia; autoimmune diseases; allergic diseases; RNA virus infections; and TH17 cell-related diseases. By applying the methods and / or compositions of the present invention to such diseases, anti-inflammatory effects, as well as fibrosis inhibitory effects and epithelial hyperplasia inhibitory effects, can be exerted. Diseases involving Regnase-1 include, but are not limited to, multiple sclerosis, psoriasis, scleroderma, nephritis (glomerulonephritis is an example), uveitis, pulmonary fibrosis, renal fibrosis, vascular fibrosis, keloids, rheumatoid arthritis, systemic lupus erythematosus, Sjögren's syndrome, pneumonia, dermatitis, vasculitis, neuritis, arthritis, ocular inflammation, encephalomyelitis, and asthma.
[0106] In one embodiment, “Regnase-1-related disease” may be a disease in the following tissues or organs: kidneys, lungs, skin, liver, heart, pancreas, bone marrow, blood vessels (including vascular endothelial cells), nerves, eyes, uterus, brain, and prostate. Examples include, but are not limited to, at least one tissue or organ selected from the group consisting of kidneys, skin, lungs, blood vessels, eyes, brain, and nerves.
[0107] While not limited to these, in one aspect, a “Regnase-1-related disease” may be at least one disease selected from the following group: (i) a disease in which the expression of mRNA that can be targeted by Regnase-1 is involved in the formation, exacerbation, and / or continuation of the disease; (ii) a disease in which TH17 cells are involved in the formation, exacerbation, and / or continuation of the disease; (iii) a disease in which at least one selected from the group consisting of IL-17, IL-1, and TLR ligands is involved in the formation, exacerbation, and / or continuation of the disease; (iv) a disease in which at least one selected from the group consisting of IL-17 and IL-1 is involved in the formation, exacerbation, and / or continuation of the disease; (v) a disease involving fibrosis of cells, tissues, or organs; (vi) a disease involving epithelial hyperplasia; (vii) (viii) A disease in which at least one molecule selected from the group consisting of IL6, IL1a, CXCL1, CXCL2, HBEGF, CTGF, DDR1, and PDGFB is involved in the formation, exacerbation, and / or continuation of the disease; (viii) A disease in which at least one molecule selected from the group consisting of IL-17, IL-1, IL-36, and TLR ligands is involved in the formation, exacerbation, and / or continuation of the disease. In one embodiment, however, the IL-17, IL-1, IL-36, and TLR ligands may be, independently, IL-17A; IL-1β; IL-36α; and ligands for TLR1, TLR2, TLR4, TLR7, or LPS.
[0108] The "mRNAs that can be targeted by Regnase-1" in (i) above are not limited as long as they can be degraded by Regnase-1. Examples of mRNAs that can be degraded by Regnase-1 include: FABP5, ACKR3, CTGF, ADAMTS1, ATF2, CD80, CYR61, DDR1, DUOX, DUSP6, CSF3, HBEGF, ID3, IL19, MAP3K8, IL1a, MCOLN3, MITF, ORC1, PDGFB, PTGS1, SESN1, PTGER4, SHQ1, SULF1, TNFRSF9, ZC3H12C, RARB and TMEM9 (see examples); CXCL1, CXCL2, CXCL3, NFKIBZ, NFKBID, PTGS2, ID1, MAFK, ZC3H12A, TM2D3 and IL6 (Cell. 2015 May 21;161(5):1058-1073);REL, TNFRSF4, IL2, ICOS, CD44, TNFRSF1B, IL1b, and NFATC1 (Cell. 2013 May 23;153(5):1036-49);GATA3 (J Allergy Clin Immunol. 2017 Oct 27. pii: S0091-6749(17)31654-8);CEBPB (PLoS One. 2017 Mar 22;12(3):e0174381.);FURIN, IL12RB1, RC3H1, RC3H2, and IL18R1 (J Immunol. 2017 Dec 15;199(12):4066-4077.);BCL2L1, RELB, BIRC3, and BCL3 (Cancer Res. IL12b, and CALCR (Nature. 2009 Apr 30;458(7242):1185-90); TFRC, and EGLN3 (Cell Rep. 2017 May 23;19(8):1614-1630). "Regnase-1 target mRNAs" may be at least one selected from the group consisting of IL6, IL12b, IL1a, CXCL1, CXCL2, HBEGF, CTGF, DDR1, and PDGFB. Information on the proteins corresponding to these mRNAs can be obtained from the database Uniprot.Whether or not an mRNA can be targeted by Regnase-1 can be confirmed using known methods described in the literature cited above or the methods described herein. In one embodiment, the "mRNA that can be targeted by Regnase-1" may be mRNA of a molecule produced from non-hematopoietic cells. In this specification, the names of mRNAs may be written without regard to uppercase or lowercase letters (for example, "HBEFG" and "Hbefg" represent the same mRNA).
[0109] While not intended to be limiting, mRNAs that can be degraded by Regnase-1 may include IL6, IL1a, IL1b, IL12b, CXCL1, CXCL2, and CXCL3 (inflammatory factors); CTGF, DDR1, and PDGFB (organ fibrosis-related factors); and IL2 and HBEGF (cell growth factors), with IL6 and IL1a; CXCL1 and CXCL2; HBEGF; and CTGF, DDR1, and PDGFB being preferred examples. The correspondence between the aforementioned mRNAs and the proteins they produce is as follows: IL6 (IL-6), IL1a (IL-1α), IL1b (IL-1β), IL12b (IL-12 subunit β), CXCL1 (CXCL-1), CXCL2 (CXCL-2), CXCL3 (CXCL-3); CTGF (Connective tissue growth factor), DDR1 (Epithelial discoidin domain-containing receptor 1), PDGFB (Platelet-derived growth factor subunit B (PDGF-2)); IL2 (IL-2), HBEGF (Proheparin-binding EGF-like growth factor).
[0110] In some embodiments, the present invention may degrade the target mRNA described in any of (i) to (iii) below. In one embodiment, the target mRNA described in any of (i) to (iii) below may be degraded by inhibiting the phosphorylation of Regnase-1; and / or by inhibiting the binding of Regnase-1 to at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK.
[0111] (i) Factors related to fibrosis Examples include CTGF, DDR1, and PDGFB. The inventors were the first to discover that CTGF, DDR1, and PDGFB, which are indicators of organ fibrosis, can be targets of Regnase-1. In addition, in animal models, they found that inhibition of Regnase-1 phosphorylation suppresses the expression of these factors and inhibits organ fibrosis. In one aspect, the present invention is based on these findings and provides a method or composition for suppressing the expression of at least one, two or more, or all mRNAs selected from the group consisting of CTGF, DDR1, and PDGFB. In another aspect, the present invention provides a method or composition for suppressing fibrosis of cells, tissues, or organs by suppressing the expression of at least one, two or more, or all mRNAs selected from the group consisting of CTGF, DDR1, and PDGFB.
[0112] (ii) inflammatory factors; Examples include IL2, IL6, IL12b, IL12p40, IL1a, IL1b, CXCL1, CXCL2, CXCL3, CCL5, CCL30, GMCSF, PTGS2, NFKBIZ, NFKBID, ICOS, OX40, c-Rel, NFATC1, Gata3, C / EBPb, IL-18R, CXL2L1, RELB, Ackr3, Adamts1, Atf2, CD80, Cyr61, Duox, Dusp6, Csf3, ID3, IL19, Map3k8, Ptgs1, Ptger4, Tnfrsf9, and zc3h12c. Among these, IL6, IL1a, IL1b, IL2, IL12b, CXCL1, CXCL2, and CXCL3 are preferred examples. The inventors have for the first time discovered that Ackr3, Adamts1, Atf2, CD80, Cyr61, Duox, Dusp6, Csf3, ID3, IL19, Map3k8, Ptgs1, Ptger4, Tnfrsf9, and zc3h12c can be targets of Regnase-1. Furthermore, in animal models, they have found that inhibition of Regnase-1 phosphorylation suppresses the expression of IL6, IL1a, CXCL1, and CXCL2, and also suppresses inflammation. In one aspect, the present invention is based on these findings and provides a method or composition for suppressing the expression of at least one or more mRNAs selected from the group consisting of IL6, IL1a, IL1b, IL2, IL12b, CXCL1, CXCL2, and CXCL3; or the group consisting of IL6, IL1a, CXCL1, and CXCL2. In another context, a method or composition for suppressing inflammation is provided, which involves suppressing the expression of at least one or more mRNAs selected from the group consisting of IL6, IL1a, IL1b, IL2, IL12b, CXCL1, CXCL2, and CXCL3, or from the group consisting of IL6, IL1a, CXCL1, and CXCL2.
[0113] (iii) Cell growth factors Examples include ID1, TM2D3, CD44, BIRC3, BCL3, Fabp5, Hbefg, mcoln3, Mitf, Orc1, Sesn1, Sulf1, Rarb, and Tmem9. The inventors were the first to discover that the cell growth factors ID1, TM2D3, CD44, BIRC3, BCL3, Fabp5, Hbefg, mcoln3, Mitf, Orc1, Sesn1, Sulf1, Rarb, and Tmem9 can be targets of Regnase-1. In addition, in animal models, they found that inhibition of Regnase-1 phosphorylation suppresses HBEFG expression and inhibits keratinocyte proliferation. In one aspect, the present invention is based on these findings and provides a method or composition for suppressing HBEGF mRNA expression. In another aspect, the present invention provides a method or composition for suppressing epithelial hyperplasia by suppressing HBEGF mRNA expression. The protein corresponding to HBEGF mRNA is known as Proheparin-binding EGF-like growth factor (HB-EGF).
[0114] In some embodiments, but not limited to, the methods and / or compositions of the present invention may suppress the expression of mRNAs that may be targets of Regnase-1. In one embodiment, the expression of at least one mRNA selected from the group consisting of molecules listed as “mRNAs that may be targets of Regnase-1” may be suppressed, in particular the expression of at least one mRNA selected from the group consisting of inflammatory factors; cell growth factors; and fibrosis-related factors. In one embodiment, such molecules may be molecules produced from non-hematopoietic cells.
[0115] In some embodiments, but not limited to, the methods and / or compositions of the present invention may suppress the expression of at least one mRNA selected from the group consisting of IL6, IL12b, IL1a, CXCL1, CXCL2, CCL5, CCL20, LCN2, GMCSF, HBEGF, SPRR2I, KERATIN 6A, COL1A1, ACTA2, CTGF, DDR1, and PDGFB, or the expression of at least one mRNA selected from the group consisting of IL6, IL12b, IL1a, CXCL1, CXCL2, HBEGF, CTGF, DDR1, and PDGFB.
[0116] In some embodiments, the methods and / or compositions of the present invention may have at least one feature selected from the group consisting of (i) to (iv) below: (i) suppression of the production of inflammatory factors; (ii) suppression of the production of cell growth factors; (iii) suppression of the production of fibrosis-related factors; (iv) inhibition of STAT-3 activation.
[0117] As used herein, “inflammatory cells” include, but are not limited to, T cells and neutrophils.
[0118] In some embodiments, the methods and / or compositions of the present invention may be used to treat and / or prevent symptoms in the following tissues or organs: kidneys, lungs, skin, liver, heart, pancreas, bone marrow, blood vessels (including vascular endothelial cells), nerves, eyes, uterus, brain, and prostate. Exemplary examples include, but are not limited to, at least one tissue or organ selected from the group consisting of kidneys, skin, lungs, blood vessels, eyes, brain, and nerves. Examples of such symptoms include, but are not limited to, inflammation, autoimmune reactions, fibrosis, and epithelial hyperplasia.
[0119] In some embodiments, the destabilization and / or intracellular degradation of Regnase-1 in the present invention may be the destabilization and / or intracellular degradation of Regnase-1 downstream of at least one signal selected from any of the following groups: IL-17, IL-1, IL-36, and TLR ligands; IL-17, IL-1, and TLR ligands; or IL-17 and IL-1. In one embodiment, however, the IL-17; IL-1; IL-36; and TLR ligands may be, independently, IL-17A; IL-1β; IL-36α; and ligands for TLR1, TLR2, TLR4, TLR7, or LPS.
[0120] In some embodiments, the composition of the present invention may be administered to a mammal in an effective amount, the preferred mammal being a human.
[0121] Any of the Regnase-1 binding molecules of the present invention may be used in therapeutic and / or prophylactic methods. In one aspect, a Regnase-1 binding molecule for use as a pharmaceutical is provided. In one aspect, the Regnase-1 binding molecule of the present invention may inhibit the phosphorylation of the Ser residue of Regnase-1. In one aspect, the Regnase-1 binding molecule of the present invention may inhibit the binding of Regnase-1 to at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK. In a further aspect, a Regnase-1 binding molecule for use in the treatment and / or prevention of diseases involving Regnase-1 is provided. In a particular embodiment, a Regnase-1 binding molecule of the present invention for use in therapeutic and / or prophylactic methods is provided. In certain embodiments, the present invention provides a Regnase-1 binding molecule for use in a method for treating an individual having a Regnase-1-related disease and / or preventing an individual from developing a Regnase-1-related disease, the method comprising the step of administering an effective amount of the Regnase-1 binding molecule of the present invention to the individual. In one such embodiment, the method further comprises the step of administering an effective amount of at least one additional therapeutic agent (for example, as described below) to the individual. In further embodiments, the present invention provides a Regnase-1 binding molecule of the present invention for use in (i) inhibition of fibrosis, (ii) inhibition of epithelial hyperplasia, and / or (iii) inhibition of inflammation. In certain embodiments, the present invention provides a Regnase-1 binding molecule for use in a method of (i), (ii) and / or (iii) in an individual, the method comprising the step of administering an effective amount of the Regnase-1 binding molecule of the present invention to the individual for (i), (ii) and / or (iii). The "individual" in any of the above embodiments is preferably a human being.
[0122] In a further aspect, the present invention provides the use of the Regnase-1 binding molecule in the manufacture or preparation of pharmaceuticals. In one embodiment, the pharmaceutical is for the treatment and / or prevention of a disease involving Regnase-1. In a further embodiment, the pharmaceutical is for use in a method for treating a disease involving Regnase-1, the method comprising the step of administering an effective amount of the pharmaceutical to an individual having the disease. In one such embodiment, the method further comprises the step of administering an effective amount of at least one additional therapeutic agent (for example, as described below) to the individual. In a further embodiment, the pharmaceutical is for (i) the inhibition of fibrosis, (ii) the inhibition of epithelial hyperplasia, and / or (iii) the inhibition of inflammation. In a further embodiment, the pharmaceutical is for use in a method of (i), (ii) and / or (iii) in an individual, the method comprising the step of administering an effective amount of the pharmaceutical to the individual for (i), (ii) and / or (iii). The “individual” in any of the above embodiments may be a human.
[0123] In a further aspect, the present invention provides a method for treating and / or preventing diseases involving Regnase-1. In one embodiment, the method comprises administering an effective amount of the Regnase-1 binding molecule of the present invention to an individual having or potentially having such a Regnase-1-related disease. In one such embodiment, the method further comprises administering an effective amount of at least one additional therapeutic agent (as described below) to the individual. The “individual” in any of the above embodiments may be a mammal, preferably a human.
[0124] In a further aspect, the present invention provides a method for (i) inhibiting fibrosis, (ii) inhibiting epithelial hyperplasia, and / or (iii) inhibiting inflammation in an individual. In one embodiment, the method comprises administering to the individual an effective amount of the Regnase-1 binding molecule of the present invention for (i), (ii), and / or (iii). In one embodiment, “individual” is a mammal, preferably a human.
[0125] In a further aspect, the present invention provides pharmaceutical compositions comprising any Regnase-1 binding molecule in the present invention (for use, for example, in any of the therapeutic and / or prophylactic methods described above). In one embodiment, the Regnase-1 binding molecule of the present invention can inhibit the phosphorylation of the Ser residue of Regnase-1. In another embodiment, the Regnase-1 binding molecule of the present invention can inhibit the binding of Regnase-1 to at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK. In one embodiment, the pharmaceutical composition comprises any Regnase-1 binding molecule in the present invention and a pharmaceutically acceptable carrier. In another embodiment, the pharmaceutical composition comprises any Regnase-1 binding molecule in the present invention and at least one additional therapeutic agent (for example, as described below).
[0126] The Regnase-1 binding molecule of the present invention can be used in therapy either alone or in combination with other agents. For example, the Regnase-1 binding molecule of the present invention may be administered concurrently with at least one additional therapeutic agent.
[0127] The Regnase-1 binding molecule (and any additional therapeutic agents) of the present invention may be administered by any preferred means, including oral administration, parenteral administration, intrapulmonary administration, and nasal administration, and, if desired for local treatment, intralesional administration. Parenteral administration includes intramuscular, intravenous, intra-arterial, intraperitoneal, or subcutaneous administration. Dosage may be made by any preferred route, such as injection, including intravenous or subcutaneous injection, depending in part whether the administration is short-term or long-term. Various dosing schedules, including single doses, repeated doses over various time points, bolus administration, and pulse infusion, are within consideration herein, but are not limited to these.
[0128] (Pharmaceutical composition) The present invention provides a pharmaceutical composition containing the Regnase-1 binding molecule of the present invention. The pharmaceutical composition of the present invention can be formulated by introducing a pharmaceutically acceptable carrier in addition to the Regnase-1 binding molecule of the present invention and using known methods. For formulation, commonly used excipients, binders, lubricants, colorants, flavoring agents, and, if necessary, stabilizers, emulsifiers, absorption enhancers, surfactants, pH adjusters, preservatives, antioxidants, etc., can be used, and the formulation is carried out by conventional methods by combining components that are generally used as raw materials for pharmaceutical formulations. For example, to produce an oral formulation, the compound according to the present invention or a pharmaceutically acceptable salt thereof and an excipient, and further, if necessary, binders, disintegrants, lubricants, colorants, flavoring agents, etc., are added, and then the formulation is carried out by conventional methods to produce a powder, fine granules, granules, tablets, coated tablets, capsules, etc.
[0129] Examples of these components include animal and vegetable oils such as soybean oil, beef tallow, and synthetic glycerides; hydrocarbons such as liquid paraffin, squalane, and solid paraffin; ester oils such as octyldodecyl myristate and isopropyl myristate; higher alcohols such as cetostearyl alcohol and behenyl alcohol; silicone resins; silicone oils; surfactants such as polyoxyethylene fatty acid esters, sorbitan fatty acid esters, glycerin fatty acid esters, polyoxyethylene sorbitan fatty acid esters, polyoxyethylene hydrogenated castor oil, and polyoxyethylene polyoxypropylene block copolymers; water-soluble polymers such as hydroxyethylcellulose, polyacrylic acid, carboxyvinyl polymer, polyethylene glycol, polyvinylpyrrolidone, and methylcellulose; lower alcohols such as ethanol and isopropanol; polyhydric alcohols such as glycerin, propylene glycol, dipropylene glycol, and sorbitol; sugars such as glucose and sucrose; inorganic powders such as anhydrous silicic acid, aluminum magnesium silicate, and aluminum silicate, and purified water.
[0130] Examples of excipients include lactose, corn starch, sucrose, glucose, mannitol, sorbitol, crystalline cellulose, and silicon dioxide.
[0131] Examples of binders include polyvinyl alcohol, polyvinyl ether, methylcellulose, ethylcellulose, gum arabic, tragacanth, gelatin, shellac, hydroxypropyl methylcellulose, hydroxypropylcellulose, polyvinylpyrrolidone, polypropylene glycol / polyoxyethylene block polymer, and meglumine.
[0132] Examples of disintegrants include starch, agar, gelatin powder, crystalline cellulose, calcium carbonate, sodium bicarbonate, calcium citrate, dextrin, pectin, and carboxymethylcellulose calcium.
[0133] Examples of lubricants include magnesium stearate, talc, polyethylene glycol, silica, and hydrogenated vegetable oil.
[0134] As coloring agents, those permitted for addition to pharmaceuticals are used, while as flavoring and deodorizing agents, cocoa powder, peppermint, aromatic powders, peppermint oil, borneol, cinnamon powder, etc., are used.
[0135] These tablets and granules may, of course, be coated with sugar or other coatings as needed. Furthermore, when manufacturing liquid preparations such as syrups and injectable preparations, the compound according to the present invention or a pharmaceutically acceptable salt thereof may be compounded by conventional methods by adding pH adjusters, solvents, isotonic agents, and, if necessary, solubilizers and stabilizers.
[0136] For example, it can be used parenterally in the form of an injectable sterile solution or suspension with water or other pharmaceutically acceptable liquid. For example, it can be formulated by mixing it with a pharmacologically acceptable carrier or medium, specifically sterile water, physiological saline, vegetable oil, emulsifier, suspension agent, surfactant, stabilizer, flavoring agent, excipient, vehicle, preservative, binder, etc., in a unit dose form generally accepted for pharmaceutical practice. Specifically, examples of carriers include light anhydrous silicic acid, lactose, crystalline cellulose, mannitol, starch, carmellose calcium, carmellose sodium, hydroxypropyl cellulose, hydroxypropyl methylcellulose, polyvinyl acetal diethylaminoacetate, polyvinylpyrrolidone, gelatin, medium-chain triglycerides, polyoxyethylene hydrogenated castor oil 60, sucrose, carboxymethylcellulose, corn starch, and inorganic salts. The amount of active ingredient in these formulations should be such that an appropriate volume within the indicated range is obtained. Sterile compositions for injection can be formulated using a vehicle such as distilled water for injection, following standard formulation procedures.
[0137] Examples of aqueous solutions for injection or bases for eye drops include physiological saline, isotonic solutions containing glucose or other adjuvants such as D-sorbitol, D-mannose, D-mannitol, and sodium chloride, and may be used in combination with a suitable solubilizer, such as alcohol, specifically ethanol, polyalcohol, such as propylene glycol and polyethylene glycol, and nonionic surfactant, such as polysorbate 80® and HCO-50.
[0138] Examples of oily liquids include sesame oil and soybean oil, and may be used in combination with benzyl benzoate or benzyl alcohol as solubilizers. It may also be combined with buffers such as phosphate buffer or sodium acetate buffer, analgesics such as procaine hydrochloride, stabilizers such as benzyl alcohol or phenol, and antioxidants. The prepared injection solution is usually filled into appropriate ampoules.
[0139] Administration is preferably by oral administration, but the method of administration is not limited to oral administration. Parenteral administration methods include, specifically, injection, nasal administration, pulmonary administration, transdermal administration, and eye drops. Examples of injection formulations include systemic or local administration by intravenous injection, intramuscular injection, intraperitoneal injection, subcutaneous injection, and intravitreous injection.
[0140] Furthermore, the administration method can be appropriately selected depending on the patient's age and symptoms. The dosage of the pharmaceutical composition containing the peptide compound produced by the method of the present invention can be selected, for example, in the range of 0.0001 mg to 1000 mg per kg of body weight per dose. Alternatively, the dosage can be selected in the range of 0.001 to 100,000 mg / body per patient, but is not necessarily limited to these values. As eye drops, it can be administered, for example, at a concentration of 0.0001% to 10% (w / v), preferably 0.01% to 5% (w / v), once to several times a day, or at intervals of several days, but is not limited to these. The dosage and administration method will vary depending on the patient's weight, age, symptoms, etc., but can be appropriately selected by those skilled in the art.
[0141] 3.Regnase-1 binding molecule In one aspect, the present invention is partly based on the finding that inhibition of Regnase-1 phosphorylation and / or inhibition of the binding of TBK1, IKKi, Act-1, IKK, and IRAK to Regnase-1 is effective in treating and / or preventing certain diseases. In some embodiments, Regnase-1 binding molecules that inhibit the phosphorylation of Regnase-1 are provided. In one embodiment, a Regnase-1 binding molecule is provided that inhibits the binding of Regnase-1 to at least one binding molecule (Regnase-1 active molecule) selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK. The Regnase-1 binding molecules of the present invention are useful, for example, for treating and / or preventing diseases involving Regnase-1.
[0142] While not intended to be bound by any particular theory, in one respect, the present invention is based on the inventors' discovery that Regnase-1 interacts with TBK1, IKKi, and Act-1, and further, that inhibiting the phosphorylation of Regnase-1 through these interactions plays a crucial role in the exertion of effects such as anti-inflammatory, fibrotic inhibition, and epithelial hyperplasia inhibition through the degradation of target mRNA by Regnase-1. In addition, experiments using Regnase-1 with S513A and / or S494A mutations suggested that the phosphorylation sites that lead to the inactive state of Regnase-1 (Ser513 and Ser494 in SEQ ID NO: 1) are common to both IL-17 and IL-1 stimulation. Therefore, it can be understood that inhibiting the phosphorylation of Regnase-1 through interaction with IRAK, which functions as a kinase that phosphorylates Regnase-1 downstream of IL-1, produces the same effects as described above. Therefore, any method, molecule, or composition capable of inhibiting the interaction between Regnase-1 and at least one molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK may be included in aspects of the present invention. Those skilled in the art can identify and produce substances capable of inhibiting the interaction between Regnase-1 and at least one molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK, based on the disclosure herein. Exemplarily, a substance of interest can be identified and produced by analyzing the interaction between Regnase-1 and TBK1, IKKi, or Act-1 in a system containing a substance capable of binding to Regnase-1 using known techniques such as surface plasmon resonance (SPR).
[0143] While not intended to be bound by any particular theory, in one aspect, the present invention relates to the inventors selecting at least one specific Ser residue of Regnase-1 (selected from the group consisting of positions corresponding to positions 513, 494, 439, and 435 of SEQ ID NO: 1; preferably at least one selected from the group consisting of positions corresponding to positions 513 and 494; preferably both of (i) and (ii) below): (i) Either or both of the positions corresponding to positions 513 and 494 of sequence number 1; and (ii) Either or both of the positions corresponding to positions 439 and 435 of Sequence ID No. 1.) This is based on the discovery that inhibiting the phosphorylation of these residues plays an important role in the exertion of effects such as anti-inflammatory, fibrotic inhibition, and epithelial hyperplasia inhibition by Regnase-1 degradation of target mRNA. Therefore, any method, molecule, or composition that can inhibit the phosphorylation of the Ser residue may be included in aspects of the present invention. Those skilled in the art can identify and produce substances that can inhibit the phosphorylation of the Ser residue based on the disclosure herein. Exemplarily, a substance of interest can be identified and produced by analyzing the inhibition of Regnase-1 phosphorylation by TBK1 or IKKi using the methods disclosed herein or known techniques in a system to which a substance capable of binding to Regnase-1 has been added.
[0144] In one aspect, the present invention provides a Regnase-1 binding molecule that inhibits the phosphorylation of Regnase-1. In another aspect, the present invention provides a Regnase-1 binding molecule that inhibits the binding of at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK to Regnase-1.
[0145] In some embodiments, the Regnase-1 binding molecule of the present invention may inhibit the phosphorylation of a Ser residue or a Thr residue contained in Regnase-1, and it is preferable to inhibit the phosphorylation of a Ser residue.
[0146] In some embodiments, the amino acid residues of Regnase-1 whose phosphorylation can be inhibited by the Regnase-1 binding molecule of the present invention may be at least one, two or more, or three or more amino acid residues selected from the group consisting of positions corresponding to Ser28, Ser124, Thr115, Ser288, Ser494, Ser508, Ser513, Thr109, Ser404, Ser435, Ser454, Ser470, Ser482, Thr498, Thr505, Ser592, Ser21, Ser268, Ser386, Ser439, and Ser474 in Sequence ID No. 1 (mouse Regnase-1). In some embodiments, if there are multiple amino acid residues of Regnase-1 whose phosphorylation can be inhibited by the Regnase-1 binding molecule of the present invention, such amino acid residues may be either or both of the amino acid residues corresponding to positions Ser513 and Ser494, respectively, and either or both of the amino acid residues corresponding to positions Ser439 and Ser435, respectively, in Sequence ID No. 1 (mouse Regnase-1).
[0147] In some embodiments, the Regnase-1 binding molecule of the present invention may inhibit the phosphorylation of a Ser residue of Regnase-1. In some embodiments, the Ser residue may be one of the Ser residues described in the present invention. In some embodiments, the phosphorylation may be one of the phosphorylations described in the present invention.
[0148] In some embodiments, the Ser residue of Regnase-1 whose phosphorylation is inhibited by the Regnase-1 binding molecule of the present invention may be a Ser residue included in at least one amino acid sequence selected from the group consisting of YWSEP (SEQ ID NO: 3), HFSVP (SEQ ID NO: 4), and DSGIGS (SEQ ID NO: 5) included in the amino acid sequence of Regnase-1.
[0149] In some embodiments, the Regnase-1 binding molecule of the present invention may be a compound that competes for binding to Regnase-1 with at least one compound selected from PP1 to PP25 described herein, for example, at least one compound selected from the group consisting of PP7, PP23, and PP10. In some embodiments, the Regnase-1 binding molecule of the present invention may be a compound that does not compete with at least one compound selected from the group consisting of PP7, PP23, and PP10. In some embodiments, the Regnase-1 binding molecule of the present invention may be a compound that competes with PP7 and PP23 but does not compete with PP10. Such Regnase-1 binding molecules are preferably molecules that specifically bind to Regnase-1, and are preferably molecules that bind to Regnase-1 at the same site as Regnase-1 to which a compound selected from PP1 to PP25, for example, at least one compound selected from the group consisting of PP7, PP23, and PP10, binds. Furthermore, the Regnase-1 binding molecules in the present invention also include compounds that compete with at least one compound selected from the PP7+tag, PP10+tag, and PP23+tag described herein for binding to Regnase-1.
[0150] In some embodiments, the Regnase-1 binding molecule of the present invention may be a compound that competes for binding to Regnase-1 with at least one antibody selected from REA0023, REA0027, REB0007, REB0014, and REB0022 as described herein. Such Regnase-1 binding molecules are preferably molecules that specifically bind to Regnase-1, and preferably molecules that bind to Regnase-1 at the same site as the site to which the antibody selected from REA0023, REA0027, REB0007, REB0014, and REB0022 binds.
[0151] Regarding binding to Regnase-1, whether a particular Regnase-1 binding molecule competes with other Regnase-1 binding molecules can be confirmed, for example, by the competition assay described in section "B. Binding assays and other assays" of "9. Assays" in this specification.
[0152] In some embodiments, the Regnase-1 binding molecule of the present invention binds to amino acid residues included in the amino acid sequence 544-596 shown in SEQ ID NO: 1, or the amino acid sequence 547-599 shown in SEQ ID NO: 2.
[0153] In some embodiments, the Regnase-1 binding molecule of the present invention binds to amino acid residues included in the amino acid sequence 1 to 543 shown in SEQ ID NO: 1, or the amino acid sequence 1 to 546 shown in SEQ ID NO: 2.
[0154] In some embodiments, the Regnase-1 binding molecule of the present invention binds to amino acid residues included in the amino acid sequence 301-596 shown in SEQ ID NO: 1, or the amino acid sequence 301-599 shown in SEQ ID NO: 2.
[0155] In some embodiments, the Regnase-1 binding molecule of the present invention binds to amino acid residues included in the amino acid sequence 1 to 300 shown in SEQ ID NO: 1, or the amino acid sequence 1 to 300 shown in SEQ ID NO: 2.
[0156] In some embodiments, the Regnase-1 binding molecule of the present invention does not substantially inhibit or reduce the RNase activity of Regnase-1. In certain embodiments, in the presence of the Regnase-1 binding molecule of the present invention, the RNase activity of Regnase-1 remains at 50%, 60%, or 70% or higher compared to the absence of the molecule. In further embodiments, in the presence of the Regnase-1 binding molecule of the present invention, the RNase activity of Regnase-1 remains at 80%, 85%, 90%, or 95% or higher compared to the absence of the molecule. RNase activity can be measured, for example, according to the method described in section "C. Activity Measurement Methods" of "9. Measurement Methods (Assays)" in this specification.
[0157] In some embodiments, the Regnase-1 binding molecule of the present invention may inhibit the binding of any of the following binding molecules (i) to (xi) to Regnase-1: (i) at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, and IKK; (ii) at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, and IRAK; (iii) at least one binding molecule selected from the group consisting of TBK1, IKKi, and Act-1; (iv) TBK1 and IKKi; (vii) Act-1; (vi) TBK1, IKKi, and Act-1; (vii) TBK1; (viii) IKKi; (ix) IRAK; (x) IKK; (xi) TBK1 and IKK. IKK in (i) to (xi) may be IKKβ.
[0158] In some embodiments, the Regnase-1 binding molecule of the present invention may have the property of being effective in at least one selected from the group consisting of (i) to (xi) below: (i) treatment and / or prevention of diseases involving Regnase-1; (ii) suppression of inflammation; (iii) suppression of fibrosis of cells, tissues or organs; (iv) suppression of epithelial hyperplasia; (v) suppression of the expression of at least one mRNA selected from the group consisting of IL6, IL1a, CXCL1, CXCL2, HBEGF, CTGF, DDR1 and PDGFB; (vi) suppression of destabilization of Regnase-1; (vii) suppression of the production of inflammatory factors; (viii) suppression of intracellular degradation of Regnase-1; (ix) inhibition of the release of Regnase-1 from the endoplasmic reticulum; (x) inhibition of the dissociation of Regnase-1 oligomers; (xi) inhibition of keratinocyte proliferation.
[0159] Without intending to limit the scope, in some embodiments, the Regnase-1 binding molecule in the present invention may be a polypeptide, and the polypeptide may be a cyclic polypeptide. In some embodiments, the molecular weight of the cyclic polypeptide in the present invention may be 500 to 4000, 500 to 3000, or 500 to 2000.
[0160] In some embodiments, the cyclic polypeptide in the present invention may include at least one selected from the group consisting of natural amino acids, unnatural amino acids, and amino acid analogs. The ratio of these amino acids is not particularly limited.
[0161] In some embodiments, the total number of amino acids and amino acid analogs contained in the cyclic polypeptide of the present invention may be 4 to 20, 4 to 15, 6 to 15, 8 to 15, 9 to 13, or 10 to 13. In some embodiments, the total number of amino acids and amino acid analogs contained in the cyclic portion of the cyclic polypeptide of the present invention may be 5 to 15, 7 to 12, 10 to 13, or 9 to 11.
[0162] In some embodiments, when the cyclic polypeptide in the present invention has a linear portion, the number of amino acids and / or amino acid analogs in the linear portion is preferably 0 to 17, more preferably 0 to 8, even more preferably 0 to 5, and particularly preferably 0 to 3. In one non-limiting embodiment, the term "linear portion" as used herein may include natural amino acids and non-natural amino acids (including chemically modified or reconstructed amino acids).
[0163] In one embodiment, the linear portion of the cyclic polypeptide of the present invention may be a linear portion composed of a tag and a linker. The tag in the present invention may include, for example, at least one, two, three, or four amino acid residues selected from Thr, MePhe, Pro, and Ile. Examples of such tags include, but are not limited to, a tag containing one, two, or three or more sequences consisting of Thr-MePhe-Pro-Ile (SEQ ID NO: 61), and even more preferably a tag also referred to herein as a "TFIP tag." In the present invention, in addition to the FLAG tag, GST tag, HA tag, and Myc tag described herein, various tags known to those skilled in the art can be suitably used. Examples of linkers constituting the linear portion of the present invention include, but are not limited to, Gly-Gly linkers, linkers composed of Gly and Ser (for example, Gly-Gly-Gly-Ser (SEQ ID NO: 62) repeated 1 to 3 times), and linkers composed of Thr and Gly (for example, Thr-Gly repeated 1 to 3 times). The linear portion in the present invention may have its C-terminal amino acid residue protected by a protecting group.
[0164] In some aspects, the polypeptides of the present invention may be modified to enhance their ability to move into cells. Such modifications are not particularly limited as known methods can be used, but examples include methods of attaching cell membrane-permeable peptides. As cell membrane-permeable peptides, known sequences can be used, but examples include the Tat peptide derived from the HIV Tat protein (GRKKRRQRRRPPQ [SEQ ID NO: 10]) (Brooks, H. et al. Advanced Drug Delivery Reviews, Vol 57, Issue 4, 2005, p.559-577), or polyarginine consisting of 6 to 12 arginine residues (Nakase, I. et al. Advanced Drug Delivery Reviews, Vol 60, 2008, p.598-607). Furthermore, it has been reported that linking fatty acids or stilbene derivatives allows peptides to access the cytoplasm (Covic, L. et al. (2002) Nat Med. 8:1161; Endres, PJ et al. (2006) Molecular Imaging 4:485; and Goubaeva, F. et al. J. Biol. Chem. 278:19634). Using such methods, polypeptides can be transferred into cells.
[0165] In some embodiments, the cyclic polypeptide in the present invention may be at least one compound selected from PP1 to PP25 described herein. In some embodiments, the cyclic polypeptide in the present invention may be at least one compound (a cyclic polypeptide having a linear portion) selected from PP7+tag, PP10+tag, and PP23+tag as described herein.
[0166] Without intending to limit it, in some embodiments the polypeptide in the present invention may be an antibody (anti-Regnase-1 antibody). That is, in some embodiments the antibody of the present invention may be at least one antibody selected from the antibodies REA0023, REA0027, REB0007, REB0014, and REB0022 described herein.
[0167] In a further aspect of the present invention, the anti-Regnase-1 antibody is a monoclonal antibody comprising a chimeric, humanized, or human antibody. In one embodiment, the anti-Regnase-1 antibody is an antibody fragment, such as Fv, Fab, Fab', scFv, diabody, or F(ab')2 fragment. In another embodiment, the antibody is a full-length antibody, such as an IgG antibody or another antibody class or isotype. In yet another embodiment, the antibody is a multispecific antibody (e.g., a bispecific antibody).
[0168] (Drug delivery to intracellular targets) A particular aspect of the present invention provides an antibody or its antigen-binding fragment that can target intracellular Regnase-1. By modifying or otherwise altering the antibody using methods known to those skilled in the art, an antibody that inhibits the phosphorylation of Regnase-1 can be delivered into the cell. In one aspect, the antibody of the present invention can be expressed intracellularly as an intrabody (intracellularly expressed antibody). As used herein, the term “intrabody” means an antibody or its antigen-binding fragment that is expressed intracellularly and can selectively bind to a target molecule, as described, for example, in Marasco, Gene Therapy 4: 11-15 (1997); Kontermann, Methods 34: 163-170 (2004); U.S. Patent Nos. 6,004,940 and 6,329,173; U.S. Patent Application Publication No. 2003 / 0104402; and PCT Publication WO2003 / 077945. See also, for example, WO96 / 007321, published March 14, 1996, concerning the use of gene therapy to generate intracellular antibodies.
[0169] Intrabody expression can be achieved by introducing a nucleic acid encoding a desired antibody or its antigen-binding fragment (which typically lacks the wild-type leader sequence and secretory signal associated with the gene encoding the antibody or antigen-binding fragment) into target cells. One or more nucleic acids encoding all or part of the antibody of the present invention can be delivered to target cells so that one or more intrabodyes capable of binding to an intracellular target polypeptide and modulating the activity of the target polypeptide are expressed. Any standard method for introducing nucleic acids into cells may be used, including (but not limited to) microinjection, ballistic injection, electroporation, calcium phosphate precipitation, liposomes, and transfection using retroviruses, adenoviruses, adeno-associated viruses, and vaccinia vectors that hold the nucleic acid of interest.
[0170] In certain embodiments, nucleic acids (optionally contained in the vector) can be introduced into a patient's cells by in vivo and ex vivo methods. In one example of in vivo delivery, the nucleic acid is injected directly into the patient, for example, at a site where therapeutic intervention is needed. In further examples of in vivo delivery, the nucleic acid is introduced into cells using transfection with viral vectors (e.g., adenovirus, herpes simplex virus type I, or adeno-associated virus) and lipid-based systems (lipids useful for lipid-mediated gene transfer are, for example, DOTMA, DOPE, and DC-Chol). For a review of specific gene marking and gene therapy protocols, see Anderson et al., Science 256:808-813 (1992) and WO93 / 25673 and the references cited therein. In ex vivo treatments, patient cells are extracted, nucleic acids are introduced into these isolated cells, and the modified cells are either administered directly to the patient or encapsulated in a porous membrane that is implanted in the patient (see, for example, U.S. Patents 4,892,538 and 5,283,187). Retroviral vectors are commonly used in ex vivo delivery of nucleic acids.
[0171] In another embodiment, internalized antibodies are provided. Antibodies can be equipped with or can be modified to have certain features that improve the delivery of the antibody to cells. Techniques for achieving this are known in the art. For example, antibodies in the complete immunoglobulin form (cytotransmab) having a single domain of humanized light chain variable region (VL) that can penetrate into the interior of cells and distribute into the cytoplasm are known (see, for example, WO2016 / 013870). By using a heavy chain variable region (VH) library to select heavy chain variable regions (VHs) that have specific binding ability to Regnase-1, and replacing the VHs of antibodies in the complete immunoglobulin form that penetrate into the cell and distribute in the cytoplasm with these VHs, it is possible to produce complete immunoglobulin anti-Regnase-1 antibodies (iMab: internalizing & interfering monoclonal antibody) that can penetrate into the cell and specifically bind to Regnase-1 in the cytoplasm (see, for example, WO2016 / 013870). Furthermore, it is known that intracellular delivery of antibodies can be made possible by, for example, attaching a phosphorothioate nucleic acid or a phosphorothioate polymer backbone to the antibody (see, for example, WO2015 / 031837). Antibodies that can penetrate into the cell and specifically bind to Regnase-1 in the cytoplasm can be produced by covalently or noncovalently attaching a phosphorothioate nucleic acid or a phosphorothioate polymer backbone to an antibody against Regnase-1. Furthermore, for example, antibody cationization is known to promote its uptake into cells (see, for example, U.S. Patent No. 6,703,019). Lipofection or liposomes can also be used to deliver antibodies into cells. When using antibody fragments, the smallest inhibitory fragment that specifically binds to the target protein may be used. For example, based on the variable region sequence of an antibody, peptide molecules that retain the ability to bind to the target protein sequence can be designed. Such peptides can be chemically synthesized and / or produced by recombinant DNA technology.See, for example, Marasco et al., Proc. Natl. Acad. Sci. USA 90: 7889-7893 (1993). Alternatively, antibodies can be produced by treating them with enzymes such as papain or pepsin to generate antibody fragments, or by constructing DNA encoding these antibody fragments or small-molecule antibodies, introducing this into an expression vector, and then expressing it in a suitable host cell (e.g., Co, MS et al., J. Immunol. (1994) 152, 2968-2976; Better, M. and Horwitz, AH, Methods Enzymol. (1989) 178, 476-496; Pluckthun, A. and Skerra, A., Methods Enzymol. (1989) 178, 497-515; Lamoyi, E., Methods Enzymol. (1986) 121, 652-663; Rousseaux, J. et al., Methods Enzymol. (1986) 121, 663-669; Bird, RE and Walker, BW, Trends Biotechnol. (1991) 9, 132-137).
[0172] The entry of antibodies into target cells can be enhanced by other methods known in the art. For example, certain sequences, such as those derived from HIV Tat or Antennapedia homeodomain proteins, can lead to efficient uptake of heterologous proteins across the cell membrane. See, for example, Chen et al., Proc. Natl. Acad. Sci. USA 96:4325-4329 (1999).
[0173] In some embodiments, the Regnase-1 binding molecule of the present invention may be a dominant-negative derivative of at least one molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK. Such a dominant-negative derivative is not particularly limited as long as it binds to Regnase-1 but lacks the ability to phosphorylate Regnase-1. For example, a dominant-negative derivative of TBK1 or IKKi may lack kinase activity, and a dominant-negative derivative of Act-1 may lack the ability to bind to TBK1 and / or IKKi.
[0174] 4. Method for identifying substances that inhibit the phosphorylation of Regnase-1 As described above, our diligent research has revealed that inhibiting the phosphorylation of Regnase-1 is effective in treating and / or preventing certain diseases. In particular, it is thought that phosphorylation of the Ser residue corresponding to positions 513 and / or 494 in SEQ ID NO: 1 induces the dissociation (e.g., monomerization) of the Regnase-1 oligomer, its release from the endoplasmic reticulum, the formation of an inactive Regnase-1 (destabilization of Regnase-1), and subsequent degradation of Regnase-1.
[0175] In some embodiments, the method for identifying the present invention may be a method for identifying a substance that inhibits the phosphorylation of Regnase-1, using phosphorylation of a Ser residue at at least one position selected from the group consisting of positions corresponding to 513, 494, 439, and 435 of SEQ ID NO: 1 as an indicator. In one embodiment, the method for identifying a substance that inhibits phosphorylation of the present invention may be using phosphorylation of a Ser residue at at least one position selected from the group consisting of positions corresponding to 513 and 494 of SEQ ID NO: 1 as an indicator.
[0176] In one embodiment, a method for identifying substances that inhibit phosphorylation according to the present invention may use the phosphorylation of both of the following Ser residues (i) and (ii) as indicators. (i) Either or both of the Ser residues at positions 513 and 494, respectively, in Regnase-1; (ii) Either or both of the Ser residues at positions corresponding to 439 and 435 of SEQ ID NO: 1 in Regnase-1.
[0177] In some embodiments, a method for identifying substances that inhibit phosphorylation according to the present invention may include the following steps (a) and (b): (a) A step of mixing Regnase-1 with a kinase capable of phosphorylating Regnase-1 in the presence of a test substance, and detecting the phosphorylation of Regnase-1 by the kinase; (b) A step of identifying a substance that inhibits the phosphorylation of Regnase-1 by the kinase compared to the absence of the test substance.
[0178] Alternatively, in some embodiments, a method for identifying substances that inhibit phosphorylation according to the present invention may include the following steps (a) and (b): (a) A step of contacting Regnase-1 with a test substance under conditions that enable phosphorylation of Regnase-1, and detecting the phosphorylation of Regnase-1. (b) A step to identify a substance that inhibits the phosphorylation of Regnase-1 compared to the absence of the test substance.
[0179] In some embodiments, a method for identifying substances that inhibit phosphorylation according to the present invention may be performed by comparing the degree of phosphorylation of a specific amino acid residue in Regnase-1 in the presence and absence of the test substance, and selecting the test substance that reduces the degree of phosphorylation.
[0180] In some embodiments, the test substance in the method for identifying substances that inhibit phosphorylation according to the present invention may be a Regnase-1 binding molecule.
[0181] In some embodiments, the method for identifying a substance that inhibits phosphorylation of the present invention may include a method for screening a substance having a specific binding ability to Regnase-1.
[0182] Whether a substance inhibits phosphorylation of Ser residues corresponding to positions 513, 494, 439 or 435 of SEQ ID NO: 1 in Regnase-1 can be confirmed using, for example, an antibody that recognizes the phosphorylated Ser residue, by the method disclosed herein.
[0183] In some embodiments, the method for identifying a substance that inhibits phosphorylation of the present invention may be performed using an antibody capable of detecting phosphorylation of Ser residues at at least one position selected from the group consisting of positions corresponding to positions 513, 494, 439 and 435 of SEQ ID NO: 1.
[0184] In some embodiments, the method for identifying a substance that inhibits phosphorylation of the present invention may be a method for identifying a substance that inhibits phosphorylation of human Regnase-1. In one embodiment, the method for identification of the present invention may be a method for identifying a substance that inhibits phosphorylation of Regnase-1, using phosphorylation of Ser residues at positions 516, 497, 442 and 438 of SEQ ID NO: 2 as an indicator.
[0185] In some embodiments, the above-mentioned "substance that inhibits phosphorylation of Regnase-1" may be a Regnase-1 binding molecule. Therefore, as one embodiment of the method for identification of the present invention, it may further include a step of measuring the binding activity of a test substance to Regnase-1, and / or a step of identifying or selecting a test substance having a binding activity to Regnase-1.
[0186] [[ID= In some embodiments, the antibody of the present invention may be an antibody that recognizes Regnase-1 with a phosphorylated Ser residue, and may be an antibody that specifically recognizes Regnase-1 with a phosphorylated Ser residue at at least one position selected from the group consisting of positions corresponding to positions 513, 494, 439, and 435 of SEQ ID NO: 1.
[0188] In one embodiment, the antibody of the present invention may be an antibody that can bind to phosphorylated human Regnase-1, or an antibody that can bind to either phosphorylated mouse Regnase-1 or phosphorylated human Regnase-1.
[0189] In one aspect, the present invention provides a composition for identifying a substance that inhibits the phosphorylation of Regnase-1. Such a composition may contain a predetermined amount of kinase and / or a predetermined amount of Regnase-1.
[0190] In some embodiments, the kinase used in the method for identifying the present invention, or the kinase included in the composition of the present invention, may be a kinase capable of phosphorylating a Ser residue at at least one position selected from the group consisting of positions corresponding to positions 513, 494, 439, and 435 of SEQ ID NO: 1 in Regnase-1. Examples of such kinases include at least one kinase selected from the group consisting of TBK1, IKKi, IRAK, and IKK, and may be at least one kinase selected from the group consisting of TBK1, IKKi, and IKK; the group consisting of TBK1, IKKi, and IRAK; or the group consisting of TBK1 and IKKi.
[0191] In some embodiments, the phosphorylation in the present invention may be phosphorylation of at least one Ser residue selected from the group consisting of positions corresponding to positions 513, 494, 439, and 435 of SEQ ID NO: 1, phosphorylation of at least one Ser residue selected from the group consisting of positions corresponding to positions 513 and 494 of SEQ ID NO: 1, phosphorylation of at least one Ser residue selected from the group consisting of positions 516, 497, 442, and 438 of SEQ ID NO: 2, phosphorylation of at least one Ser residue selected from the group consisting of positions 516 and 497 of SEQ ID NO: 2, phosphorylation of the Ser residue at position 516 of SEQ ID NO: 2, or phosphorylation of at least one Ser residue selected from the group consisting of positions 442 and 438 of SEQ ID NO: 2.
[0192] In some embodiments, the compositions of the present invention may contain a Regnase-1 binding molecule, or a predetermined amount of Regnase-1 binding molecule.
[0193] In some embodiments, Regnase-1 in the present invention may be human Regnase-1.
[0194] In some embodiments, the compositions of the present invention may contain a predetermined amount of kinase and a predetermined amount of Regnase-1. In some embodiments, the Regnase-1 contained in the compositions of the present invention may be dephosphorylated Regnase-1 or dephosphorylated Regnase-1.
[0195] The "predetermined amount" in this invention is not particularly limited and may be an amount determined before performing the assay.
[0196] 5. Method for identifying substances that inhibit the binding of binding molecules to Regnase-1. As a result of diligent research by the present inventors, it has been found that inhibiting the binding of TBK1 and IKKi, or Act-1, to Regnase-1 is effective in treating and / or preventing certain diseases. In one aspect, the present invention provides a method for identifying a substance that inhibits the binding of at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK to Regnase-1.
[0197] In some embodiments, a method for identifying substances that inhibit the binding of the present invention may include the following steps (a) and (b): (a) A step of mixing at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK with Regnase-1 in the presence of a test substance, and measuring the binding activity between the binding molecule and Regnase-1; (b) A step of identifying a substance that can reduce the binding activity between the binding molecule and Regnase-1 compared to the absence of the test substance.
[0198] The binding activity in this invention can be measured by the method described later.
[0199] In this specification, “inhibit binding” means reducing the binding activity between the first molecule and the second molecule, or preventing the two molecules from binding.
[0200] In some embodiments, the "substance that inhibits the binding of Regnase-1 to at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK" may be a Regnase-1 binding molecule. Accordingly, in one embodiment, the method for identification of the present invention may further include the steps of measuring the binding activity of a test substance to Regnase-1, and / or identifying or selecting a test substance having binding activity to Regnase-1.
[0201] Alternatively, in some embodiments, the "substance that inhibits the binding of at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK to Regnase-1" may be a substance that inhibits the phosphorylation of Regnase-1. Therefore, in one embodiment, the method for identification of the present invention may further include the steps of measuring the phosphorylation activity of Regnase-1 of a test substance and / or identifying or selecting a test substance having said activity. Alternatively, in one embodiment, the method for identifying a substance that inhibits the binding of at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK to Regnase-1 may be used in combination with the method for identifying a substance that inhibits the phosphorylation of Regnase-1.
[0202] In one aspect, the present invention provides a composition for identifying a substance that inhibits the binding of at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK to Regnase-1. In one embodiment, the composition of the present invention may contain a predetermined amount of the binding molecule and Regnase-1, or a predetermined amount of the binding molecule and a predetermined amount of Regnase-1.
[0203] In some embodiments, the method for identifying the present invention may be a method for identifying a substance that inhibits the binding of any one of the following (i) to (x) to Regnase-1, and the composition of the present invention may include a binding molecule of any one of the following (i) to (x) and Regnase-1: (i) at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, and IKK; (ii) at least one binding molecule selected from the group consisting of TBK1, IKKi, Act-1, and IRAK; (iii) at least one binding molecule selected from the group consisting of TBK1, IKKi, and Act-1; (iv) TBK1 and IKKi; (v) Act-1; (vi) TBK1, IKKi, and Act-1; (vii) TBK1; (viii) IKKi; (ix) IRAK; (x) IKK; (xi) TBK1 and IKK. The IKK in the above (i) to (xi) may be IKKβ.
[0204] In some embodiments, the Regnase-1 used in the method for identifying the present invention, or the Regnase-1 included in the composition of the present invention, may be dephosphorylated Regnase-1, or Regnase-1 that has been dephosphorylated.
[0205] 6. Method for identifying substances that compete with reference substances for binding to Regnase-1 7. Method for identifying a substance that binds to the same site on Regnase-1 as a reference substance. In one aspect, the present invention relates to a method for identifying a test substance that competes with a reference substance for binding to Regnase-1. In one aspect, the present invention relates to a method for identifying a test substance that binds to the same site on Regnase-1 as the site to which the reference substance binds. By using this method, a Regnase-1 binding molecule that inhibits the phosphorylation of the Ser residue of Regnase-1 can be obtained. Such a molecule can be used in the treatment and / or prevention of diseases in which Regnase-1 is involved.
[0206] To identify such substances, for example, a competitive assay may be used. That is, a method for identifying substances that compete with a reference substance for binding to Regnase-1 in the present invention may, exemplary, include performing a competitive assay as described in section B. Binding assays and other assays of section 9. assays (assays) of this specification. The amount of reference substance that binds to Regnase-1 is indirectly correlated with the binding ability of candidate competitors (test substances) that compete with the reference substance for binding to Regnase-1, more specifically, with the binding ability of candidate competitors (test substances) that compete for binding to the site on Regnase-1 where the reference substance binds. In other words, the greater the amount and affinity of the test substance that binds to the same site on Regnase-1 where the reference substance binds, the less the amount of reference substance that binds to Regnase-1 decreases, and the more the amount of test substance that binds to Regnase-1 increases. Specifically, a reference substance with an appropriate label and the test substance to be evaluated are added to Regnase-1 simultaneously, and the bound reference substance is detected using the label. The amount of reference substance bound to Regnase-1 can be easily measured by pre-labeling the substance. This labeling is not particularly limited, but a labeling method should be selected according to the method. Specific labeling methods include fluorescent labeling, radioactive labeling, and enzyme labeling.
[0207] Alternatively, in the present invention, a substance that binds to the same site on Regnase-1 to which the reference substance binds can also be obtained by known epitope mapping methods (see also section "B. Binding Measurement Methods and Other Measurement Methods" in "9. Measurement Methods (Assays)" of this specification for epitope mapping). Specifically, a substance that binds to the same site on Regnase-1 to which the reference substance binds can be obtained by analyzing the site (epitope) on Regnase-1 to which the reference substance binds using an epitope mapping method using Regnase-1 or a partial peptide thereof, and then preparing a substance that binds to it using a peptide containing the identified epitope. Therefore, a method for identifying a substance that binds to the same site on Regnase-1 to which the reference substance binds in the present invention can, exemplary, include performing an epitope mapping method.
[0208] The substances obtained in this manner are expected to exhibit similar inhibitory activity to the compounds PP1-PP25, PP7+tag, PP10+tag, PP23+tag, or antibodies REA0023, REA0027, REB0007, REB0014, and REB0022 obtained in the examples, in terms of inhibitory activity against the phosphorylation of the Ser residue of Regnase-1. Thus, substances that compete with the compounds PP1-PP25, PP7+tag, PP10+tag, PP23+tag or antibodies REA0023, REA0027, REB0007, REB0014, REB0022 isolated in the examples for binding to Regnase-1, and that have phosphorylation inhibitory activity of the Ser residue of Regnase-1, or substances that bind to substantially the same site on Regnase-1 to which the compounds PP1-PP25, PP7+tag, PP10+tag, PP23+tag or antibodies REA0023, REA0027, REB0007, REB0014, REB0022 obtained in the examples bind, and that have phosphorylation inhibitory activity of the Ser residue of Regnase-1, can be suitably used as Regnase-1 binding molecules in the present invention.
[0209] The test substance in this invention is not particularly limited and includes, for example, peptides, proteins, non-peptide compounds, synthetic compounds, fermentation products, cell extracts, and preferably antibodies and cyclic polypeptides.
[0210] In one non-limiting embodiment, the site on Regnase-1 to which the Regnase-1 binding molecule and / or reference substance binds may include the amino acid sequence 544-596 shown in SEQ ID NO: 1, or the amino acid sequence 547-599 shown in SEQ ID NO: 2, or at least one amino acid residue contained in these amino acid sequences.
[0211] In one non-limiting embodiment, the site on Regnase-1 to which the Regnase-1 binding molecule and / or reference substance binds may include the amino acid sequence 1-543 shown in SEQ ID NO: 1, or the amino acid sequence 1-546 shown in SEQ ID NO: 2, or at least one amino acid residue contained in these amino acid sequences.
[0212] In one non-limiting embodiment, the site on Regnase-1 to which the Regnase-1 binding molecule and / or reference substance binds may include the amino acid sequence 301-596 shown in SEQ ID NO: 1, or the amino acid sequence 301-599 shown in SEQ ID NO: 2, or at least one amino acid residue contained in these amino acid sequences.
[0213] In one non-limiting embodiment, the site on Regnase-1 to which the Regnase-1 binding molecule and / or reference substance binds may include the amino acid sequence from 1 to 300 shown in SEQ ID NO: 1, or the amino acid sequence from 1 to 300 shown in SEQ ID NO: 2, or at least one amino acid residue contained in these amino acid sequences.
[0214] The reference substance in this invention is not particularly limited as long as it can bind to Regnase-1 and inhibit phosphorylation. In one non-limiting embodiment, at least one compound selected from the following PP1 to PP25, PP7+tag, PP10+tag, PP23+tag or at least one antibody selected from REA0023, REA0027, REB0007, REB0014, REB0022 as described herein can be used as the reference substance.
[0215] The present invention may further include the steps of measuring the phosphorylation activity of at least one binding molecule (Regnase-1 active molecule) selected from the group consisting of TBK1, IKKi, Act-1, IKK, and IRAK by the test substance selected by the above competitive assay, and selecting the test substance that inhibited or reduced the phosphorylation activity. The measurement of phosphorylation activity can be carried out, for example, according to the method described in section "A. Method for detecting phosphorylation inhibition" of "9. Measurement method (assay)" in this specification. Alternatively, the present invention may further include the steps of measuring the RNase activity of Regnase-1 by the test substance selected by the competitive assay described above, and selecting a test substance that does not inhibit or reduce RNase activity. The measurement of RNase activity can be carried out, for example, according to the method described in section "C. Activity Measurement Method" of "9. Measurement Method (Assay)" in this specification.
[0216] The test substance in this invention is not particularly limited and includes, for example, peptides, proteins, non-peptide compounds, synthetic compounds, fermentation products, cell extracts, and preferably antibodies and cyclic polypeptides.
[0217] 8. Method for producing the Regnase-1 binding molecule of the present invention The method for producing the Regnase-1 binding molecule of the present invention is not particularly limited, but for example, a polypeptide chemical synthesis method or a recombinant polypeptide expression method using cells, as described later, can be used. In one embodiment, the production method may also include a method for identifying a substance that inhibits the phosphorylation of Regnase-1 in the present invention, and exemplary this can be used to produce a Regnase-1 binding molecule that inhibits the phosphorylation of Regnase-1. In one embodiment, the production method may also include a method for identifying a substance that competes with a reference substance (for example, any of the above-mentioned compounds PP1 to PP25, PP7+tag, PP10+tag, PP23+tag, or antibodies REA0023, REA0027, REB0007, REB0014, REB0022) for binding to Regnase-1 in the present invention.
[0218] The method for producing the Regnase-1 binding molecule of the present invention may include a method for identifying the Regnase-1 binding molecule. Methods known to those skilled in the art can be used for identifying the Regnase-1 binding molecule. For example, an animal may be immunized with Regnase-1 or a peptide fragment thereof, and an antibody that binds to Regnase-1 may be identified. These methods are also described herein. Alternatively, a peptide library may be used to identify peptides that bind to Regnase-1. Such identification methods are known, for example, in WO2013 / 100132 and WO2012 / 033154.
[0219] A. Chemical synthesis method of polypeptides Examples of chemical synthesis methods for polypeptides bound to Regnase-1 in the present invention include liquid-phase synthesis, solid-phase synthesis using Fmoc or Boc, and combinations thereof. In Fmoc synthesis, the main chain amino group is protected by an Fmoc group, the side chain functional group is protected by a protecting group that cannot be cleaved by a basic such as piperidine as needed, and the main chain carboxylic acid is not protected, with the amino acid being used as the basic unit. The basic unit is not particularly limited as long as it is a combination of an Fmoc-protected amino group and a carboxylic acid group. For example, a dipeptide may be used as the basic unit. The basic unit to be placed at the N-terminus may be something other than an Fmoc amino acid. For example, it may be a Boc amino acid, or a carboxylic acid analog that does not have an amino group. The main chain carboxylic acid group is supported on the solid phase by a chemical reaction with the functional group of the solid phase support. Subsequently, the Fmoc group is deprotected with a base such as piperidine or DBU, and a peptide bond is generated by a condensation reaction between the newly generated amino group and the subsequently added protected amino acid having a carboxylic acid as the basic unit. In condensation reactions, various combinations are possible, such as DIC and HOBt, DIC and HOAt, and HATU and DIPEA. By repeatedly removing the Fmoc group and subsequently forming peptide bonds, the desired peptide sequence can be generated. After obtaining the desired sequence, cleavage from the solid phase and, if necessary, deprotection of the protecting group of the introduced side-chain functional group are performed. It is also possible to perform structural transformation or cyclization of the peptide before cleavage from the solid phase. Cleavage from the solid phase and deprotection can be performed under the same conditions, for example, 90:10 TFA / H2O, or deprotection can be performed under different conditions as needed. For cleavage from the solid phase, some peptides can be cleaved with a weak acid such as 1% TFA, or the orthogonality of the chemical reaction between the two can be utilized by using a protecting group such as Pd. Cyclization and other steps can be performed during or at the end of these steps. For example, the side-chain carboxylic acid can be condensed with the N-terminal main chain amino group, or the side-chain amino group can be condensed with the C-terminal main chain carboxylic acid.In this process, orthogonality of the reaction is required between the C-terminal carboxylic acid and the side-chain carboxylic acid to be cyclized, or between the N-terminal main-chain amino group or hydroxyl group and the side-chain amino group to be cyclized. As mentioned above, the protecting group is selected considering the orthogonality of the protecting group. Furthermore, by positioning a chloroacetyl group at the N-terminus, cyclization with the thiol group on the side chain of the cysteine residue is also possible. The reaction product obtained in this way can be purified using a reversed-phase column or molecular sieve column. Details of these procedures are described, for example, in the Solid-Phase Synthesis Handbook published by Merck KGaA on May 1, 2002.
[0220] B. Recombinant polypeptide expression method using cells Polypeptides that bind to Regnase-1 can be produced using recombinant methods or compositions. In one embodiment, if the polypeptide is an antibody, an isolated nucleic acid encoding an anti-Regnase-1 antibody as described herein is provided, for example, as described in U.S. Patent No. 4,816,567. Such nucleic acid may encode an amino acid sequence containing the VL and / or VH of the antibody (e.g., the light chain and / or heavy chain of the antibody). In a further embodiment, one or more vectors (e.g., expression vectors) containing such nucleic acid are provided. In a further embodiment, a host cell containing such nucleic acid is provided. In one such embodiment, the host cell comprises (1) a vector containing nucleic acid encoding an amino acid sequence containing the VL of the antibody and an amino acid sequence containing the VH of the antibody, or (2) a first vector containing nucleic acid encoding an amino acid sequence containing the VL of the antibody and a second vector containing nucleic acid encoding an amino acid sequence containing the VH of the antibody (e.g., transformed). In one embodiment, the host cells are eukaryotic (e.g., Chinese hamster ovary (CHO) cells) or lymphoid cells (e.g., Y0, NS0, Sp2 / 0 cells). In one embodiment, a method is provided for producing an anti-Regnase-1 antibody, comprising culturing host cells containing the nucleic acid encoding the antibody as described above under conditions suitable for the expression of the anti-Regnase-1 antibody, and optionally recovering the antibody from the host cells (or host cell culture medium).
[0221] For the recombinant production of anti-Regnase-1 antibodies, nucleic acids encoding the antibody (e.g., those described above) are isolated and inserted into one or more vectors for further cloning and / or expression in host cells. Such nucleic acids will be readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that can specifically bind to the genes encoding the heavy and light chains of the antibody).
[0222] Suitable host cells for cloning or expressing antibody-encoding vectors include prokaryotic or eukaryotic cells as described herein. For example, antibodies may be produced in bacteria, especially when glycosylation and Fc effector function are not required. For the expression of antibody fragments and polypeptides in bacteria, see, for example, U.S. Patents 5,648,237, 5,789,199, and 5,840,523. (See also Charlton, Methods in Molecular Biology, Vol. 248 (BKC Lo, ed., Humana Press, Totowa, NJ, 2003), pp. 245-254, for the expression of antibody fragments in Escherichia coli.) After expression, antibodies may be isolated from bacterial cell paste into soluble fractions and further purified.
[0223] In addition to prokaryotes, eukaryotic microorganisms such as filamentous fungi or yeasts, including strains of fungi and yeasts whose glycosylation pathways have been "humanized" to produce antibodies with partial or complete human glycosylation patterns, are suitable cloning or expression hosts for antibody-coding vectors. See Gerngross, Nat. Biotech. 22:1409-1414 (2004) and Li et al., Nat. Biotech. 24:210-215 (2006).
[0224] Vertebrate cells can also be used as hosts. For example, mammalian cell lines adapted to grow in a suspension state would be useful. Other examples of useful mammalian host cell lines include SV40-transformed monkey kidney CV1 cell line (COS-7); human embryonic kidney cell line (293 or 293 cells as described in Graham et al., J. Gen Virol. 36:59 (1977), etc.); baby hamster kidney cells (BHK); mouse Sertoli cells (TM4 cells as described in Mather, Biol. Reprod. 23:243-251 (1980), etc.); monkey kidney cells (CV1); African green monkey kidney cells (VERO-76); human cervical cancer cells (HELA); canine kidney cells (MDCK); Buffalo rat hepatocytes (BRL 3A); human lung cells (W138); human hepatocytes (Hep G2); mouse mammary cancer cells (MMT 060562); and TRI cells (e.g., Mather et al., Annals NY Acad. Sci. 383:44-68 (1982)). These include MRC5 cells and FS4 cells, as described in [reference]. Other useful mammalian host cell lines include Chinese hamster ovary (CHO) cells, including DHFR-CHO cells (Urlaub et al., Proc. Natl. Acad. Sci. USA 77:4216 (1980)), and myeloma cell lines such as Y0, NS0, and Sp2 / 0. For a review of specific mammalian host cell lines suitable for antibody production, see, for example, Yazaki and Wu, Methods in Molecular Biology, Vol. 248 (BKC Lo, ed., Humana Press, Totowa, NJ), pp. 255-268 (2003).
[0225] 9. Measurement method (assay) The Regnase-1 binding molecules in the present invention may be identified, screened, or have their physical / chemical properties and / or biological activity elucidated by various measurement methods known in the art.
[0226] In the assay of the present invention, tagged Regnase-1 or tagged kinase may be used as appropriate. Examples of such tags include, but are not limited to, FLAG, GST, HA, and Myc.
[0227] A. Method for detecting phosphorylation inhibition The method for detecting whether a substance inhibits the phosphorylation of Regnase-1 is not particularly limited, but examples include methods using radioisotope-labeled ATP and methods using antibodies that specifically recognize phosphorylated Regnase-1. Methods using cells, methods using cell lysates, and cell-free assays are also applicable. Examples of kinases that can be used in experiments include TBK1, IKKi, IKK, IRAK1, and IRAK2.
[0228] One method using radioactive isotope-labeled ATP is [γ- 32 One example is a method in which Regnase-1 is phosphorylated using a certain kinase with [P]ATP, and then the phosphorylated Regnase-1 is visualized by autoradiography. More specifically, the method described in the examples below is an example.
[0229] Furthermore, by using an antibody that specifically recognizes phosphorylated Regnase-1, it is possible to detect whether or not phosphorylation of a specific amino acid residue of Regnase-1 is inhibited. For example, by using an antibody that specifically recognizes human Regnase-1 in which the Ser at position 516 of SEQ ID NO: 2 is phosphorylated, the phosphorylation of Ser 516 can be detected by Western blotting or the like. More specifically, the method described in the examples below is an example.
[0230] In some embodiments, the antibody that specifically recognizes phosphorylated Regnase-1 provided by the present invention may be an antibody that binds to phosphorylated Regnase-1 but not to unphosphorylated Regnase-1, or an antibody that binds more strongly to phosphorylated Regnase-1 than to unphosphorylated Regnase-1. The antibody may be a polyclonal antibody or a monoclonal antibody. In some embodiments, the antibody may be an antibody that specifically recognizes at least one Regnase-1 selected from the group consisting of (i) to (viii): (i) Mouse Regnase-1 in which Ser435 and / or Ser439 of SEQ ID NO: 1 are phosphorylated; (ii) Mouse Regnase-1 with Ser494 of Sequence ID No. 1 phosphorylated; (iii) Mouse Regnase-1 with Ser513 of Sequence ID No. 1 phosphorylated; (iv) Human Regnase-1 with Ser438 and / or Ser442 phosphorylated in SEQ ID NO: 2; (v) Human Regnase-1 with Ser437 of Sequence ID No. 2 phosphorylated; (vi) Human Regnase-1 with Ser516 of Sequence ID No. 2 phosphorylated; (vii) Mouse Regnase-1 with phosphorylated Ser435, Ser439, Ser494 and Ser513 of SEQ ID NO: 1; (viii) Mouse Regnase-1 with phosphorylated Ser438, Ser442, Ser437 and Ser516 of SEQ ID NO: 2.
[0231] In some embodiments, the antibody of the present invention may be an antibody capable of detecting phosphorylation of human Regnase-1, an antibody capable of detecting phosphorylation of either mouse Regnase-1 or human Regnase-1, and an antibody that specifically recognizes Regnase-1 as described in (i) and (iv); (ii) and (v); (iii) and (iv); or (vii) and (viii).
[0232] Antibodies that specifically recognize phosphorylated Regnase-1 can be produced by known methods using Regnase-1, preferably a partial peptide, in which specific amino acid residues are phosphorylated as the antigen. For example, antibodies can be obtained from the serum of animals such as rabbits by immunizing them with the antigen using conventional methods, but the method is not limited to this. More specifically, the method described in the examples below is an example.
[0233] Whether the antibody obtained by the above method specifically recognizes phosphorylated Regnase-1 can be confirmed by evaluating its binding activity to phosphorylated Regnase-1 and unphosphorylated Regnase-1 using methods such as Western blotting.
[0234] In one aspect, the present invention provides an antibody that specifically recognizes phosphorylated Regnase-1 as described above.
[0235] B. Combined measurement methods and other measurement methods In one aspect, the Regnase-1 binding molecule of the present invention is tested for its Regnase-1 binding activity by known methods such as ELISA, Western blotting, and surface plasmon resonance assay.
[0236] In another context, competitive assays may be used to identify Regnase-1 binding molecules that compete with a reference substance for binding to Regnase-1. In certain embodiments, such competitive molecules bind to the same site on Regnase-1 (epitope, e.g., linear or structural epitope) to which the reference substance binds. Detailed exemplary methods for mapping the epitopes to which polypeptides bind are provided in Morris (1996) “Epitope Mapping Protocols,” in Methods in Molecular Biology vol. 66 (Humana Press, Totowa, NJ).
[0237] As such reference materials, for example, at least one compound selected from PP1 to PP25, PP7+tag, PP10+tag, and PP23+tag as described herein, or at least one antibody selected from REA0023, REA0027, REB0007, REB0014, and REB0022 as described herein, may be used, but are not limited to these. As reference materials, for example, at least one compound selected from the group consisting of PP7, PP23, and PP10 as described herein may be used.
[0238] In an exemplary competition assay, immobilized Regnase-1 is incubated in a solution containing a first labeled substance that binds to Regnase-1 and a second unlabeled Regnase-1 binding molecule to be tested for its ability to compete with the first substance for binding to Regnase-1. As a control, immobilized Regnase-1 is incubated in a solution containing the first labeled substance but without the second unlabeled Regnase-1 binding molecule. After incubation under conditions that allow the first substance to bind to Regnase-1, any excess unbound substance is removed and the amount of label bound to the immobilized Regnase-1 is measured. If the amount of label bound to the immobilized Regnase-1 is substantially reduced in the test sample compared to the control sample, it indicates that the second molecule is competing with the first substance for binding to Regnase-1. See Harlow and Lane (1988) Antibodies: A Laboratory Manual ch.14 (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY).
[0239] In another exemplary competitive assay, BIACORE® analysis is used to determine the ability of the test substance to compete for binding to Regnase-1 by a second (reference) substance. In a further stage of operating a BIACORE® instrument (e.g., BIACORE® 3000) according to the manufacturer's recommendations, Regnase-1 is captured on a CM5 BIACORE® chip using standard techniques known in the art, creating a Regnase-1 coated surface. Typically, 200–800 resonance units of Regnase-1 are bound to the chip (an amount that yields a readily measurable level of binding but is readily saturable at the concentration of the test substance used). The two substances to be evaluated for their ability to compete with each other (i.e., the test substance and the reference substance) are mixed in a suitable buffer in a molar ratio of binding sites of 1:1 to produce a mixture. When calculating the concentration based on binding sites, the molecular weight of the test substance or reference substance is taken as the total molecular weight of the corresponding substance divided by the number of Regnase-1 binding sites on the substance. The concentration of each substance in the mixture (i.e., the test substance and the reference substance) must be high enough to easily saturate the binding site of the substance on the Regnase-1 molecule captured on the BIACORE® tip. The test substance and the reference substance in the mixture are at the same molar concentration (based on binding), typically 1.00 to 1.5 micromoles (based on binding site). Separate solutions containing only the test substance and only the reference substance are also prepared. The test substance and reference substance in these solutions are in the same buffer as the mixture and can be at the same concentration and conditions. The mixture containing the test substance and the reference substance is passed over a BIACORE® tip coated with Regnase-1 to record the total amount of binding. The tip is then treated to remove the bound test substance or reference substance without damaging the Regnase-1 bound to the tip. Typically, this is done by treating the tip with 30 mM HCl for 60 seconds. Subsequently, a solution of only the test substance is passed over the Regnase-1 coated surface to record the amount of binding.The chip is then treated again to remove all the bound substances without damaging Regnase-1. The amount of binding is then recorded by passing a solution of the reference substance alone over the Regnase-1 coated surface. Next, the theoretical maximum binding value of the mixture of the test and reference substances is calculated, which is the sum of the binding values of each substance (i.e., test and reference) when passing over the Regnase-1 surface individually. If the actual recorded binding value of the mixture is less than this theoretical maximum, the test and reference substances are competing with each other for binding to Regnase-1. Therefore, generally speaking, a competing test substance is a substance that binds to Regnase-1 in the BIACORE® blocking assay described above, in the presence of a reference substance, such that the recorded binding is between 80% and 0.1% (e.g., 80% > ~ 4%) of the theoretical maximum binding of the combined test substance and reference substance (as defined above), particularly between 75% and 0.1% (e.g., 75% ~ 4%) of the theoretical maximum binding, and more specifically between 70% and 0.1% (e.g., 70% ~ 4%) of the theoretical maximum binding.
[0240] In another exemplary competitive assay, BIACORE® analysis is used to determine the ability of the test substance to compete with the binding of a second (reference) substance to Regnase-1. In a further stage of operating a BIACORE® instrument (e.g., BIACORE® 3000) according to the manufacturer's recommendations, the reference substance is captured on a BIACORE® chip using standard techniques known in the art, creating a surface coated with the reference substance. Typically, 200–800 resonance units of the reference substance are bound to the chip (an amount that yields a readily measurable level of Regnase-1 binding). The test substance to be evaluated for its ability to compete with the reference substance and Regnase-1 are mixed in a suitable buffer to produce a mixture. A separate solution containing only Regnase-1 is also prepared. The Regnase-1 in these solutions can be in the same buffer as the mixture and at the same concentration and conditions. The solution containing only Regnase-1 is passed over the BIACORE® chip coated with the reference substance to record the total amount of binding. To regenerate the chip, the chip is processed to remove the reference substance coated on its surface. For example, if a BIACORE® chip with Protein A covalently immobilized is coated with a reference substance via an antibody, this is done by treating it with 10 mM Glycine-HCl to remove the antibody bound to Protein A. Then, the mixture containing the test substance and Regnase-1 is passed over the BIACORE® chip coated with the reference substance, and the total amount of binding is recorded. If the total amount of binding recorded when passing the mixture containing the test substance and Regnase-1 is smaller than the total amount of binding recorded when passing a solution containing only Regnase-1, then the test substance and the reference substance are competing substances. While not limited to this, competition between the test substance and the reference substance may mean that the value obtained by dividing the total amount of binding when passing through a test mixture containing both the test substance and Regnase-1 by the total amount of binding when passing through a solution containing only Regnase-1 is 0.8 or less, 0.7 or less, 0.6 or less, or 0.5 or less.
[0241] To capture a reference substance on the BIACORE® chip, a tag may be attached to the reference substance, such as the TFPI-tag and FLAG-tag described herein. The reference substance and the tag may be linked via a linker, such as a Gly-Gly linker, a linker composed of Gly and Ser (e.g., Gly-Gly-Gly-Ser (SEQ ID NO: 62) repeated 1 to 3 times), or a linker composed of Thr and Gly (e.g., Thr-Gly repeated 1 to 3 times). Examples of tagged reference substances, though not limited to these, include the PP7+tag, PP23+tag, and PP10+tag disclosed herein. The tagged reference substance may be captured on the chip via an antibody against the tag. A more detailed method for capturing a tagged reference substance on the chip is described in this embodiment.
[0242] C. Activity measurement method In one aspect, a method for identifying the biological activity of Regnase-1 binding molecules is provided. This biological activity may include, for example, activity that degrades target mRNA (RNase activity) or activity that suppresses the expression of target mRNA. Furthermore, Regnase-1 binding molecules possessing such biological activity under in vivo and / or in vitro conditions are provided.
[0243] In this specification, "suppressing mRNA expression" means reducing the amount of mRNA, and this includes reducing the amount of mRNA by degrading it.
[0244] In certain embodiments, the Regnase-1 binding molecule of the present invention is tested for such biological activity. The activity of degrading target mRNA can be measured using the methods described herein. Exemplarily, this may be measured by overexpressing IL-6 mRNA and 3'UTR as target mRNA in HEK293 cells in the presence of Regnase-1 and evaluating the difference in IL-6 mRNA levels in the presence and absence of the test substance by Northern blotting. The target is not limited to IL-6 mRNA. Alternatively, the test substance may be administered to disease model animals, and the target mRNA expression level in tissues collected from the animals may be measured by quantitative PCR analysis.
[0245] D. Affinity Measurement Method In one embodiment, the dissociation constant (KD) is measured by a radiolabeled antigen binding assay (RIA). In one embodiment, the RIA is performed using the Fab version of the antibody of interest and its antigen. For example, the solution binding affinity of Fab to the antigen is measured in the presence of a gradual increase in the concentration of the unlabeled antigen. 125 I) Fab is equilibrated with a labeled antigen, and then the bound antigen is captured by a plate coated with anti-Fab antibody. (See, for example, Chen et al., J. Mol. Biol. 293:865-881 (1999)). To establish the measurement conditions, a MICROTITER® multiwell plate (Thermo Scientific) is coated overnight with 5 μg / ml of capture anti-Fab antibody (Cappel Labs) in 50 mM sodium carbonate (pH 9.6), and then blocked with 2% (w / v) bovine serum albumin in PBS for 2-5 hours at room temperature (approximately 23°C). In a non-adsorbent plate (Nunc #269620), 100 pM or 26 pM [ 125Mix the [I]-antigen with serial dilutions of the Fab of interest (e.g., as in the evaluation of anti-VEGF antibody, Fab-12, in Presta et al., Cancer Res. 57:4593-4599 (1997)). Then incubate the Fab of interest overnight, although this incubation may be extended for a longer period (e.g., about 65 hours) to ensure equilibrium is achieved. Subsequently, transfer the mixture to a capture plate for incubation at room temperature (e.g., 1 hour). Then remove the solution and wash the plate eight times with 0.1% polysorbate 20 (TWEEN-20®) in PBS. Once the plate is dry, add 150 μl / well of scintillant (MICROSCINT-20®, Packard) and count the plate for 10 minutes on a TOPCOUNT® gamma counter (Packard). Select concentrations of each Fab that give less than 20% of maximum binding for use in competitive binding assays.
[0246] According to another aspect, KD is measured using a BIACORE® surface plasmon resonance assay. For example, a measurement method using BIACORE®-2000 or BIACORE®-3000 (BIAcore, Inc., Piscataway, NJ) is carried out at 25° C. using a CM5 chip with approximately 10 response units (RU) of antigen immobilized. In one aspect, a carboxymethylated dextran biosensor chip (CM5, BIACORE, Inc.) is activated using N-ethyl-N'-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) and N-hydroxysuccinimide (NHS) according to the supplier's instructions. The antigen is diluted to 5 μg / ml (approximately 0.2 μM) using 10 mM sodium acetate, pH 4.8 before being injected at a flow rate of 5 μl / min to achieve binding of approximately 10 reaction units (RU) of protein. After injection of the antigen, 1 M ethanolamine is injected to block unreacted groups. For kinetic measurements, a two-fold dilution series (0.78 nM to 500 nM) of Fab in PBS (PBST) containing 0.05% polysorbate 20 (TWEEN-20™) surfactant is injected at 25° C. at a flow rate of approximately 25 μl / min. The association rate (k on ) and dissociation rate (k off ) are calculated by simultaneously fitting the binding and dissociation sensorgrams using a simple 1:1 Langmuir binding model (BIACORE® evaluation software version 3.2). The equilibrium dissociation constant (Kd) is calculated as the ratio of k off / k on . See, for example, Chen et al., J. Mol. Biol. 293:865-881 (1999). The association rate by the above surface plasmon resonance assay is 10 6 M -1 s -1If it exceeds this, the ON rate can be determined by measuring the increase or decrease in fluorescence emission intensity (excitation = 295 nm; emission = 340 nm, bandpass 16 nm) at 25°C in the presence of gradually increasing concentrations of antigen using a spectrometer (e.g., a stop-flow spectrophotometer (Aviv Instruments) or an 8000 series SLM-AMINCO® spectrophotometer (ThermoSpectronic) using a stirred cuvette).
[0247] 10. Regnase-1 mutant In one aspect, the present invention provides a Regnase-1 mutant in which a Ser residue at at least one position selected from the group consisting of positions corresponding to positions 513 and 494 of Sequence ID No. 1 in Regnase-1 is substituted with another amino acid residue.
[0248] In some embodiments, the Regnase-1 variant of the present invention may be a Regnase-1 variant in which the Ser residues at positions 513 and 494; 513; or 494, respectively, of SEQ ID NO: 1 are substituted with other amino acids. In one embodiment, such a Regnase-1 variant may be a Regnase-1 variant in which the Ser residues at positions 513 and 494; 513; 494; 516 and 497; 516; or 497 of SEQ ID NO: 2 are substituted with other amino acids. Amino acid substitutions can be carried out using methods well known to those skilled in the art.
[0249] In some embodiments, the Regnase-1 variant of the present invention may be a mammalian Regnase-1, or a mouse or human Regnase-1.
[0250] In this specification, "substituted" means that an amino acid residue at a certain position in the reference amino acid sequence is occupied by another amino acid residue, and does not require an actual substitution step.
[0251] In some embodiments, other amino acids to which the Ser residue in the present invention is substituted include, but are not limited to, Ala or Glu. By substituting with Ala or the like, a Regnase-1 mutant can be obtained in which the amino acid at the target position is not phosphorylated, making it useful as a control substance for non-phosphorylated Regnase-1. Furthermore, by substituting with Glu, phosphorylation of the amino acid at the target position can be simulated, making it useful as a simulated substance for phosphorylated Regnase-1.
[0252] The present invention also relates to non-human animals having mutations in Regnase-1 and their offspring. Such non-human animals can be obtained by using methods known to those skilled in the art, for example, by creating transgenic non-human animals into which the gene encoding the Regnase-1 mutant described herein has been introduced. Examples of non-human animals include monkeys, pigs, dogs, rats, mice, rabbits, hamsters, cattle, sheep, cattle, and horses. [Examples]
[0253] The following are embodiments of the present invention. In light of the general description above, it will be understood that various other embodiments may be implemented.
[0254] <Materials and Methods> Unless otherwise specified in each example, the experiments were conducted using the methods described in this section.
[0255] (Preparation of Regnase-1 S435A / S439A(AA) knock-in mice) Genomic DNA containing the Regnase-1 gene was isolated from germinal stem (ES) cells (GSI-1). A genomic fragment of approximately 12 kbp encompassing exon 5, exon 6, and downstream of the Regnase-1 gene terminus was subcloned into a pCR-TOPO vector (Thermo Fisher Scientific). A targeted vector was designed to replace Ser435 and Ser439 residues of exon 6 with Ala by site-directed mutagenesis. The neomycin resistance gene, flanked by two loxPs, was inserted into the intron between exons 5 and 6. The linearized vector was introduced into GSI-1 ES cells by electroporation. Targeted ES cells were screened and identified by genomic PCR and Southern blotting. These cells were microinjected into blastocysts derived from C57BL / 6 mice. Chimeric male mice were mated with C57BL / 6 female mice to generate F1 heterozygous mice. To remove the neomycin gene cassette, F1 mice were further crossed with CAG-Cre transgenic mice. After removing the CAG-Cre allele by crossing with C57BL / 6 mice, Regnase-1 AA heterozygous (Regnase-1AA / +) mice were backcrossed with C57BL / 6 mice for at least 10 generations to obtain Regnase-1AA / AA homozygotes (these mice may be referred to as "Regnase-1AA / AA mice" or "Regnase-1 AA mutant mice" in this specification).
[0256] (Generation of a mouse Regnase-1 mutant allele with a frameshift mutation in the C-terminal amino acid) Regnase-1 frameshift mutant mice were designed and constructed using CRISPR / Cas9 genome editing technology by the Biotechnology Research and Development (Dr. M. Ikawa and M. Okabe, Osaka University, Osaka, Japan). The gRNA sequences used in this study are: 5'-GTGGGTGGGGGTAATGGGTA-3' (SEQ ID NO: 52) and 5'-CCTACCCATCCAGAGTAC-3' (SEQ ID NO: 53). Each gRNA sequence was cloned in-frame into the CRISPR / Cas9 vector pSpCas9(BB)-2A-Puro PX459 (Addgene; #62988) (Nat Protoc 8, 2281-2308 (2013)). Using a previously described method, the PX459 vector was introduced into fertilized eggs derived from C57BL / 6 x C57BL / 6 mice (Dev Growth Differ 56, 122-129 (2014)). These mouse embryos were transferred to the oviducts of pseudopregnant ICR females. Genetic mutations in the Regnase-1 allele were identified by DNA sequencing. Regnase-1ΔCTD homozygotes (also referred to as "Regnase-1ΔCTD / ΔCTD") were obtained by crossing mutant mice containing frameshift mutations resulting in the expression of C-terminally truncated Regnase-1 protein (Regnase-1ΔCTD).
[0257] (Generation of mouse Regnase-1 S513A / S513A mutant alleles) The Regnase-1 S513A mutant mouse was constructed using CRISPR / Cas9 genome editing technology by the Biotechnology Research and Development (Dr. M. Ikawa and M. Okabe, Osaka University, Osaka, Japan). The gRNA sequences used in this study were: 5'-GTGGGTGGGGGTAATGGGTA-3' and 5'-CCTACCCATCCAGAGTAC-3'. Each gRNA sequence was cloned in-frame into the CRISPR / Cas9 vector pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene; #42230) (Science 339, 819-23 (2013)). Furthermore, due to the S513A mutation, a single-stranded oligodeoxynucleotide sequence (103 bases, 5'-CCACCGACTATGTGCCCCCGCCACCCACCTACCCATCCAGAGAGTAtTGGgCTGAGCCGTAtCC ATTACCCCCACCCACTCCTGTCCTTCAGGAGCCCCAGAG -3' (SEQ ID NO: 54)) was synthesized. Following a previous report (Dev Growth Differ 56, 122-129 (2014)), the aforementioned PX459 vector and the single-stranded oligodeoxynucleotide sequence were introduced into fertilized eggs derived from C57BL / 6 x C57BL / 6 mice. These mouse embryos were transplanted into the fallopian tubes of pseudopregnant ICR females. Genetic mutations in the Regnase-1 allele were identified by DNA sequencing.
[0258] (plasmid) Regnase-1 expression vectors containing pFLAG-CMV2(Sigma) and pcDNA3.1-Myc, as well as viral expression vectors such as pMRX-FLAG-Regnase-1-ires-puro, have been previously described (Nature 458, 1185-1190 (2009); Nat Immunol 12, 1167-1175 (2011)). Tear-off Regnase-1 lacking the N-terminus or C-terminus was constructed by PCR amplification of Regnase-1 cDNA and inserted into the pFLAG-CMV2 vector. Point mutations in the Regnase-1 expression construct were prepared using the Quickchange II site-directed mutagenesis kit (Agilent Technologies). For overexpression using Escherichia coli (E. coli), a portion of Regnase-1, including the proline-rich domain and the C-terminal domain (441-598), was amplified from Regnase-1 cDNA and inserted into a pGEX 6P vector (GE Healthcare). Myc-Act1, HA-TBK1, and HA-IKKi were PCR-amplified from their respective cDNAs and inserted in-frame into a pcDNA3.1 vector. The pTREtight-IL-6 CDS+3'UTR vector has been previously described (Nature 458, 1185-1190 (2009)).
[0259] (Mouse Regnase-1 (45-339)) The expression construct was obtained by adding a GST tag to the N-terminus of the fragment of mouse Regnase-1 (ZC3h12a) (Uniprot ID: Q5D1E7) (Sequence ID: 1) from amino acid numbers 45-339. Mouse Regnase-1 (45-339) was expressed in E. coli using the above construct, purified with Glutathione-Sepharose 4B (GE Healthcare), cleaved the GST portion with PreScission Protease (GE Healthcare), and isolated by gel filtration chromatography.
[0260] (Anti-Regnase-1 antibody) Rabbits were immunosensitized by administering mouse Regnase-1 (45-339) protein. RNA was prepared from the immunosensitized rabbit cells, and RT-PCR was performed to amplify the antibody gene. The antibody gene was then incorporated into a plasmid. The plasmid containing the antibody gene was introduced into E. coli and cultured, and the plasmid was purified from the cultured E. coli. The plasmid containing the antibody gene was introduced into HEK293 cells, and the antibody was expressed in the culture supernatant. The antibody in the culture supernatant was purified with Protein A.
[0261] (Antiphosphorylated Regnase-1 antibody) Peptides LD(pS)GIG(pS)LESQMSEC (SEQ ID NO: 6), created by ligating cysteine residues to the ends of sequences containing phosphorylated serine residues at positions 435 and 439 of mouse Regnase-1, and CTYPSREYW(pS)EPY (SEQ ID NO: 7), created by ligating cysteine residues to the ends of sequences containing phosphorylated serine residues at position 513 of mouse Regnase-1, were synthesized. Rabbits were immunosensitized by administering proteins in which KLH was conjugated to the respective cysteine residues. Antibodies were purified from the antiserum of the immunosensitized rabbits by affinity purification using phosphorylated peptides and absorption using non-phosphorylated peptides. The original amino acid sequences LDSGIGSLESQMSE (SEQ ID NO: 8) and REYWSEPY (SEQ ID NO: 9), a portion of the original sequence, were conserved in mouse and human.
[0262] (Anti-TFPI-tag peptide antibody) A TFPI-tag peptide sequence (Thr-Gly-Thr-Gly-Thr-Gly-Thr-MeF-Pro-Ile-Thr-MeF-Pro-Ile (SEQ ID NO: 56), where MeF represents N-methylphenylalanine) with a T cell epitope peptide (Phe-Asn-Asn-Phe-Thr-Val-Ser-Phe-Trp-Leu-Arg-Val-Pro-Lys-Val-Ser-Ala-Ser-His-Leu-Glu-Gly (SEQ ID NO: 55), derived from tetanus toxin TT p30) and a PEG5 spacer at its N-terminus was synthesized and administered to rabbits for immunosensitization. RNA was prepared from the cells of the immunosensitized rabbits, and after amplifying the antibody gene by RT-PCR, the antibody gene was incorporated into a plasmid. The plasmid containing the antibody gene was introduced into E. coli and cultured, and the plasmid was purified from the cultured E. coli. Plasmids containing the antibody gene were introduced into HEK293 cells, and the antibody was expressed in the culture supernatant. The antibody in the culture supernatant was purified using Protein A.
[0263] (Reagents, cells) Recombinant mouse IL-17A was purchased from R&D Systems. Recombinant mouse IL-1β, mouse TNF-α, mouse IL-6, and human IL-17A were purchased from Biolegend. Anti-Act1 (H-300), IκB-α (C-21), NFκB p65 (C-20), MAPK p38 (C-20), and ERK1 (K23) were purchased from Santa Cruz Biotechnology. Anti-RPL7A (15340-1-AP) was obtained from Proteintech. Anti-FLAG M2, Myc (9E10), and HA (12CA5) antibodies, FLAG M2 affinity gel, and FLAG x 3 peptides were purchased from Sigma. Anti-phospho-IκBα (Ser32 / 36), phospho-NFκB p65 (Ser468), phospho-MAPK p38 (Thr180 / Tyr182), phospho-ERK 1 / 2 (Thr202 / Tyr204), JNK, phospho-JNK (Thr183 / Tyr185), phospho-STAT3 (Tyr705), phospho-TBK1 (Ser172), and phospho-IKKε (Ser172) were obtained from Cell Signaling Technology. Anti-CD3ε and type IV collagen were obtained from Abcam. LPS (S. Minnesota R595) and BX795 were purchased from InvivoGen. Bone marrow-derived macrophages were prepared by culturing bone marrow cells in RPMI medium containing 20 ng / ml macrophage colony-stimulating factor (M-CSF) (Peprotech). HeLa cells were purchased from the American Type Culture Collection. Wild-type and Regnase-1AA / AA MEFs were prepared from mouse embryos at gestation day 13.5. Act1-deficient MEFs were generated from Traf3ip2ADJM mice donated by Dr. Y. Matsushima (J Immunol 185, 2340-2349 (2010)).Regnase-1- / -, TBK1- / -, IKKi- / -, and TBK1- / - / IKKi- / - MEFs were prepared as previously described (Nature 458, 1185-1190 (2009); J Exp Med 199, 1641-1650 (2004); Nat Immunol 9, 684-691 (2008)). IKKα- / - / IKKβ- / - MEFs were donated by Dr. I. Verma (Genes & development 14, 1729-1733 (2000)). Effector CD4+ T cells induced by differentiation under in vitro conditions were prepared according to previously reported methods (Annu Rev Immunol 28, 445-489 (2010)). For induction of TH1, TH17, or iTreg cells, naive CD4+ T cells (1.0 x 10⁶ cells). 6The cells were seeded in 96-well plates coated with anti-CD3ε (BD Bioscience, 10 μg / ml), activated with anti-CD3ε (1 μg / ml) antibody and anti-CD28 antibody (1 μg / ml), and cultured for 3 days under TH1, TH17, or iTreg differentiation conditions: for TH1, 10 μg / ml anti-IL-4 (BD Bioscience) and 10 ng / ml IL-12 (Peprotech); for TH17, 10 μg / ml anti-IL-4, 10 μg / ml anti-IFN-γ (BD Bioscience), 10 ng / ml TGF-β (Peprotech), 30 ng / ml IL-6, and 50 ng / ml IL-23 (Peprotech); or for iTreg, 10 μg / ml anti-IL-4, 10 μg / ml anti-IFN-γ, and 10 ng / ml TGF-β. LSECs were prepared as previously described (Journal of leukocyte biology 38, 213-230 (1985)). Cell lines expressing Regnase-1 with an N-terminal FLAG epitope tag were constructed by retroviral infection of Regnase-1- / - immortalized MEFs using virus-containing culture supernatant from Plat-E retroviral packaging cells transfected with pMRX-FLAG-Regnase-1-ires-puro (Gene therapy 7, 1063-1066 (2000)). Cells were cultured and maintained in DMEM containing 2 μg / ml puromycin.
[0264] (EAE model) Conventional EAE was induced by immunization with myelin oligodendrocyte glycoprotein (MOG)(35-55) peptide (AnaSpec). An emulsion of MOG(35-55) peptide (300 ng / mouse) and complete Freund's adjuvant (CFA, InvivoGen) were mixed in a 1:1 ratio and subcutaneously injected into mice. After intraperitoneal injection of pertussis toxin on days 0 and 2, mice were monitored daily and evaluated by clinical scoring between days 7 and 28 post-immunization. Clinical scores were measured using a previously defined scale (Immunity 14, 471-481 (2001)). For the construction of bone marrow chimeric mice, 4-5 week old gamma-irradiated mice (10 Gy) were irradiated with bone marrow cells (3.0-5.0 x 10⁶ cells). 7 EAE induction was administered intravenously (4 cells / ml). At least 4 weeks later, EAE induction was induced in chimeric mice. Passive transplantation of pathogenic CD4+ T cells induced EAE induction was performed according to the previously described method (Cell 148, 447-457 (2012)). Briefly, wild-type mice were sacrificed 10 days after infusion of MOG(35-55) peptide / CFA and pertussis toxin. Splenocytes (4 x 10 cells) 6 CD4+ T cells were isolated from (1.5 x 10) cells and co-cultured with MOG peptide-pulsed irradiated splenocytes. CD4+ T cells isolated from co-cultured cells were cultured using CD4(L3T4) microbeads and autoMACS separator (Miltenyi) in wild-type, Regnase-1AA / AA, and Regnase-1ΔCTD mice (cells 1.5 x 10). 7 The substance was administered intravenously to individual mice. Frozen sections were prepared from the spinal cord, lymph nodes, and spleen using Leica CM 1850 cryostat (Leica) and immunostained with the indicated antibody. To prepare the spinal cord sections, the inventors used the previously described method (Archives of histology and cytology 66, 123-143 (2003)).
[0265] (Flow cytometry) The following antibodies were prepared for flow cytometry: PerCP-Cy5.5 conjugate anti-mouse CD4, PE conjugate anti-mouse IL-17A, FITC conjugate anti-mouse IFN-γ, PE conjugate anti-mouse CD25 (BD bioscience), and Alexa-647 conjugate anti-mouse Foxp3 (Biolegend). Spinal cord cells were stained with anti-CD4 antibody and F4 / 80 antibody (Biolegend). CD4+ T cells were cultured at 37°C for 2 hours with 100 nM phorbol 12-myristate 13-acetate (PMA) (Sigma), 1 μM ionomycin (Sigma), and GolgiPlug (BD bioscience). After permeabilization and fixation of the cells, intracellular staining (IFNγ, IL-17A, and Foxp3) was performed using either the Cytofix / Cytoperm intracellular staining kit (BD bioscience, for IFNγ and IL-17A) or the Foxp3 / transcription factor staining buffer kit (Affymetrix, for Foxp3).
[0266] (Immunoprecipitation) A method for transient protein expression using HEK293 cells has been previously described (Nat Immunol 12, 1167-1175 (2011)). Cells were disrupted by sonication 24 hours after transfection. After removing cell debris by centrifugation at 20,000 xg for 5 minutes, the cell lysates were incubated at 4°C for 1 hour with either anti-FLAG M2 antibody or anti-Myc antibody (Sigma) conjugated to Dynabeads Protein G (Thermo Fisher Scientific). The beads were then washed twice with Tris buffer. Immunoprecipitated proteins were eluted using 3 x SDS sample buffer and subjected to a 10% SDS-PAGE gel. Phosphorylated mouse Regnase-1 was purified from MEFs stably expressing FLAG-Regnase-1. Cells were disrupted by sonication after stimulation with IL-1β or IL-17A. Cell lysates were incubated with anti-FLAG M2 affinity gel at 4°C for 1 hour. The bound proteins were eluted with 0.15 mg / ml FLAG x 3 peptide (Sigma) in Tris buffer and subjected to a 7.5% undenatured PAGE gel.
[0267] (Gel filtration analysis) The C-terminal segment (441-598) of mouse Regnase-1 was synthesized as a GST fusion protein in E. coli Rosetta 2 (DE3) cells (Merck Millipore). The cells were lysed in Bugbuster protein extraction reagent (Merck Millipore) supplemented with a protease inhibitor. The fusion protein was purified from the cell lysate by affinity chromatography using Glutathione Sepharose 4B (GE Healthcare), and cleaved in Tris buffer [20 mM Tris-HCl (pH 7.4) and 150 mM NaCl] using PreScission Protease (GE Healthcare) to release the mouse Regnase-1 segment. After adding 1% CHAPS to increase protein solubility, the GST protein was removed using a Glutathione Sepharose 4B column. The purified mouse Regnase-1 segment was loaded onto a Superdex 200 gel filtration column (GE Healthcare). The apparent molecular weight of the elution peak was estimated from the elution pattern of a molecular weight marker (Sigma) for gel filtration chromatography.
[0268] (in vitro phosphorylation assay) Mouse Regnase-1 protein was obtained from MEFs stably expressing FLAG-Regnase-1. Cells were suspended in 20 mM Tris-HCl, pH 7.4, and 150 mM NaCl with a cocktail of Complete mini protease inhibitors and PhosStop phosphatase inhibitors (Roche) and disrupted using an ultrasonic water bath (Bioruptor Plus, Diagenode). Regnase-1 was purified using FLAG M2 affinity gel (Sigma). For in vitro phosphorylation assays, the following recombinant proteins were prepared: GST protein (Sigma), GST-tagged TBK1 (Sigma), GST-tagged IKKi (Thermo Fisher Scientific), and Lambda protein phosphatase (New England BioLabs). FLAG-Regnase-1 (50 μg / ml) was incubated for 4 hours at 30°C in 0.2 M HEPES, pH 7.0, 20 mM MgCl2, 2 mM ATP (or 50 μCi [γ-32P] ATP), and 1.0 M mannitol. The samples were mixed with either 3 x SDS-PAGE sample buffer 14 or 4 x undenatured PAGE sample buffer (0.2 M Tris-HCl, pH 6.8, 40% glycerol, and 0.4% bromophenol blue) and loaded onto 10% SDS-PAGE gels or 7.5% undenatured PAGE gels. Regnase-1 was detected by immunoblotting. Phosphorylated proteins were visualized by autoradiography in the presence of [γ-32P] ATP.
[0269] (Isolation of intracellular fractions) The ER membrane fraction was separated and isolated according to the previously described method (Rna 9, 1123-1137 (2003)). MEF cells (5 x 10 cells) 7The microsomal cells were suspended in homogenization buffer [10 mM HEPES-KOH, pH 7.5, 10 mM KoAc, 1.5 mM Mg(OAc)2, 2 mM DTT, 1 mM PMSF, and 200 U / ml RNaseOUT ribonuclease inhibitor (Thermo Fisher Scientific)] and then disrupted with a Dounce homogenizer. To separate the microsomal and cytosolic fractions, the homogenates were subjected to slow centrifugation (1,500 xg) for 5 minutes. The supernatant was further subjected to fast centrifugation (Beckman TLA 45 rotor) at 65,000 xg for 20 minutes at 4°C. The microsomal pellet was resuspended in Tris buffer. To isolate the ER membrane fraction, the homogenate was mixed with 2.5 M sucrose in HKM buffer [50 mM HEPES-KOH, 150 mM KoAc, and 5 mM Mg(OAc)2] in a 1:4 ratio. 0.5 ml of 0.25 M sucrose in HKM buffer and 0.75 ml of 1.3 M sucrose in HKM buffer were layered on top of 2 ml of the mixture. After centrifugation at 500,000 xg for 45 minutes at 4°C (Beckmann TLA100.3 rotor), the ER membrane at the 1.3 M / 2.0 M sucrose interface was extracted and diluted in HKM buffer. After centrifugation at 500,000 xg for 20 minutes at 4°C, the membrane was resuspended in Tris buffer.
[0270] (Polysome profiling) WT and mouse Regnase-1ΔCTD MEF cells (cells 1-2 × 10⁶) 8The cells were pretreated with 5 μg / ml cycloheximide for 10 minutes before cell harvesting. The harvested cells were suspended in 1 ml homogenization buffer to which 100 μg / ml cycloheximide had been added, and hypotonic lysis was performed by several strokes of a Downs homogenizer. 10% digitonin was added to solubilize the membrane containing the cell fraction, to a final concentration of 2%. After slow centrifugation (1500 × g) for 5 minutes, the lysate supernatant was loaded onto a linear gradient of 10–60% sucrose polysome buffer [50 mM HEPES-KOH, pH 7.5, 150 mM KCl, 10 mM MgSO4, 2 mM DTT, 1 mM PMSF, 100 μg / ml cycloheximide, and 100 U / ml RNaseOUT ribonuclease inhibitor]. After ultracentrifugation at 36,000 rpm for 2 hours at 4°C in a Beckman SW41 Ti rotor, the fraction was collected from the top of the sucrose gradient using a piston gradient fractionator (Biocomp Instruments), transferred to a UV-Star® 96-well plate (Greiner Bio-one), and monitored by UV absorbance at 260 nm.
[0271] (Quantitative PCR analysis) Total RNA was purified using the High Pure® RNA Isolation Kit (Roche) and reverse transcribed using the ReverTra Ace® Kit (TOYOBO). For quantitative PCR, cDNA was amplified using the Thunderbird® Probe qPCR Mix (TOYOBO). TaqMan probes for mouse IL-6, TNF, LCN-2, GM-CSF, CXCL-1, CXCL2, CCL5, and CCL-20 were purchased from Applied Biosystems. Fluorescence was detected using the Viia7® Real-Time PCR System (Applied Biosystems). mRNA expression levels were standardized using 18S rRNA expression.
[0272] (Tet-off system) HEK293 Tet-off cells (cells 3.0 x 10 6 Cells were co-transfected with the previously described 8pTREtight-IL6-CDS+3'UTR along with a set of expression vectors encoding mouse Regnase-1, Act1, and IKKi. After 3 hours, the cells were divided into three 60 mm culture dishes and cultured overnight. Suppression of IL6-CDS+3'UTR expression was induced by culturing the cells in the presence of 1 μg / ml doxycycline.
[0273] (Statistical analysis) Unless otherwise specified, statistical analysis of differences between two groups was performed using a Student's t-test (two-sided). A P < 0.05 was considered statistically significant.
[0274] <Result> Example 1 In this example, the S435A / S439A(AA) mutation was shown to inhibit IKK-mediated phosphorylation and degradation of Regnase-1.
[0275] Regnase-1 is phosphorylated by the IKK complex and then degraded via the ubiquitin-proteasome system in LPS-activated macrophages. Two serine residues in Regnase-1, Ser435 and Ser439, have been identified as putative IKK phosphorylation sites. To elucidate how IKK-mediated phosphorylation and degradation of Regnase-1 regulate cytokine expression in the immune response, we created knock-in mice in which two amino acids, Ser435 and Ser439, in the Regnase-1 protein were substituted with Ala (Figure 1-2A). The mutated Regnase-1 gene was identified by genomic PCR and direct sequencing (Figure 1-2B). Homozygous Regnase-1 knock-in mice (Regnase-1AA / AA) were born with predicted Mendelian ratios, developed normally, and did not exhibit any symptoms of autoimmune disease as previously described for Regnase-1-deficient mice.
[0276] To detect the non-phosphorylated and phosphorylated forms of Regnase-1, we constructed a monoclonal antibody with excellent sensitivity. As expected, LPS-stimulated Regnase-1AA / AA macrophages showed no Regnase-1 proteolysis, suggesting that this mutant protein is resistant to IKK-mediated degradation (Figure 1-3C). Compared to wild-type macrophages, Regnase-1AA / AA macrophages showed a significantly increased protein production over time. This indicates that IKK-mediated phosphorylation of Regnase-1 is essential for its degradation. IRAK-mediated phosphorylation of Regnase-1 was detected as a delay band in electrophoresis (Figure 1-3C), and this process was typically observed in Regnase-1AA / AA macrophages, as it occurs via an IKK-independent pathway. LPS, and other phosphorylations induced by LPS, such as IκB and NF-κB p65 in the NF-κB signaling pathway, as well as mitogen-activated protein kinase (MAPK) p38 and extracellular signal-regulated kinase (ERK) 1 / 2 in the MAPK pathway, were identical in both wild-type and Regnase-1AA / AA macrophages (Figure 1-3C), indicating that this mutation does not affect the LPS signaling pathway in Regnase-1AA / AA macrophages. Nevertheless, Regnase-1AA / AA macrophages showed reduced production of IL-6 and IL-12 compared to wild-type macrophages in the presence of very low concentrations of LPS or TLR ligands, but not for TNF-α (Figure 1-4D), suggesting that cytokine production was suppressed by this mutation upon exposure to various TLR ligands under in vitro conditions.
[0277] Example 2 In this example, Regnase-1AA / AA mice were shown to be resistant to experimental autoimmune encephalomyelitis (EAE) via a weakened response to IL-17.
[0278] To further investigate the immunosuppressive effects of the Regnase-1 AA mutant, the inventors used an EAE model. Regnase-1AA / AA mice showed delayed onset and slower progression of EAE compared to controls (Figure 2-1A). Histological analysis of the spinal cord revealed significant reductions in inflammation, demyelination, axonal degeneration, and T cell infiltration into neuronal tissue in Regnase-1AA / AA mice (Figure 2-1B). The number of invasive CD4+ T cells was significantly lower in Regnase-1AA / AA mice than in control mice (Figure 2-1C). Immunofluorescence analysis of lymph nodes revealed impaired germinal center formation and plasma cell accumulation in the lymph nodes of Regnase-1AA / AA mice (data not shown).
[0279] To clarify which cell type expressing the Regnase-1AA / AA protein is responsible for resistance to EAE, the inventors compared the ability of naive CD4+ T cells to differentiate into TH1, TH17, or Treg cells under in vitro conditions between wild-type mice and Regnase-1AA / AA mice. These showed similar differentiation patterns (Figure 3-1A). Next, the inventors used bone marrow chimeras to investigate whether immune cells or non-hematopoietic cells generated from bone marrow are necessary for suppressing the pathogenesis of EAE in Regnase-1AA / AA mice. Transplantation of wild-type bone marrow cells into Regnase-1AA / AA mice resulted in more effective disease suppression than controls, while wild-type mice with Regnase-1AA / AA bone marrow cells showed no significant difference (Figure 2-1D). These results suggest that the improvement in EAE disease in Regnase-1AA / AA mice was brought about by non-hematopoietic cells, not immune cells.
[0280] To further confirm this, the inventors used a transplanted EAE model in which MOG-specific autoreactive CD4+ T cells were intravenously transplanted into wild-type and Regnase-1AA / AA mice (Immunity 29, 628-636 (2008); Cell 148, 447-457 (2012)). In this model, activated TH17 cells could induce STAT3 (signal transducer and activator of transcription 3) activation and inflammation in endothelial cells of dorsal vessels of the fifth lumbar spinal cord in an IL-6 and IL-17-dependent manner. Immunohistochemical analysis of phosphorylated STAT3, an indicator of inflammation, in splenic endothelial cells (type IV collagen positive) revealed low levels of phospho-STAT3 in Regnase-1AA / AA mice, suggesting that the Regnase-1 AA mutation suppresses endothelial cell inflammation mainly induced by pathogenic TH17 cells (Figures 2-2E and 2-2F). STAT3 phosphorylation was also reduced in endothelial cells of dorsal vessels in the fifth lumbar spinal cord of Regnase-1AA / AA mice (Figures 2-2G and 2-2H). These findings suggest that this mutated protein suppresses STAT3 activation in endothelial cells by reducing IL-6 production, and that IKK-mediated degradation of Regnase-1 plays a crucial role in inducing the pathogenesis of EAEs.
[0281] IL-17 activates both the NF-κB and MAPK signaling pathways, but is a weak activator of NF-κB (Nature reviews. Immunology 9, 556-567 (2009)). In non-hematopoietic cells, synergistic stimulation of IL-6 and IL-17 leads to IL-6 overexpression in the feedback amplification loop of NF-κB and STAT3 activation (Immunity 29, 628-636 (2008); J Immunol 189, 1928-1936 (2012)). The inventors measured cytokine and chemokine production in primary cells from wild-type and Regnase-1AA / AA mice after stimulation with IL-17A, or a combination of IL-17A and TNF-α or IL-6. In mouse embryonic fibroblasts (MEFs) and hepatic sinusoidal endothelial cells (LSECs) derived from Regnase-1AA / AA mice, decreased expression of IL-6, Regnase-1, CXCL-1, CXCL-2, and CCL-20 mRNA was observed 24 hours after stimulation with TNF-α + IL-17A compared to wild-type cells (Figure 2-2I [MEF] and Figure 3-1B [LSEC]). The differences in target mRNA expression in MEFs between wild-type and Regnase-1AA / AA cells were more pronounced in the later stages of the stimulation period (Figure 2-2I). Similarly, levels of IL-6, CXCL-1, and CXCL-2 mRNA after stimulation with either IL-17A and either IL-6 or TNF-α were also lower in LSECs from Regnase-1AA / AA mice than in wild-type cells (Figure 3-2C). These results indicate that IKK-mediated phosphorylation and degradation of Regnase-1 occur via NF-κB activation in non-hematopoietic cells upon IL-17A stimulation, and that this can regulate the expression of inflammatory factor mRNAs.
[0282] Example 3. Disease reduction effect of Regnase-1 AA mutant mice in an imiquimod-induced psoriasis model. 62.5 mg of imiquimod cream (Beselna Cream 5%; Mochida Pharmaceutical Co., Ltd.) was applied daily for 5 days to the right auricle and depilated neck and back skin of C57BL / 6 mice (wild-type mice; WT) or Regnase-1 AA mutant mice (AA). The lesions in the auricle were evaluated by measuring the thickness of the right auricle sequentially before imiquimod application using a dial thickness gauge (Ozaki Seisakusho). The neck and back skin were evaluated macroscopically on a 4-point scale for the degree of erythema, thickening, and scaling, and the total score (12 points) was used to represent these evaluations.
[0283] As a result, wild-type mice showed significant thickening of the auricle following imiquimod application (Figure 4A). In addition, psoriasis-like skin lesions such as erythema, thickening, and scaling were induced in the neck and back skin where imiquimod was applied (Figure 4B). On the other hand, Regnase-1 AA mutant mice showed reduced thickening of the auricle and psoriasis-like skin lesions (erythema, thickening, scaling) in the neck and back compared to wild-type mice (Figures 4A, 4B).
[0284] (Pathological examination) Three days after the final application of imiquimod, wild-type mice or Regnase-1 AA mutant mice were euthanized by exsanguination under deep anesthesia and then necropsied. Skin samples were taken from the application site of the auricle, fixed by immersion in 10% neutral buffered formalin fixative, embedded in paraffin using a standard method, sectioned to approximately 3 micrometers, and hematoxylin-eosin (HE) stained specimens were prepared. The HE-stained specimens of the application site skin were histopathologically examined under a light microscope. In addition, the thickness of the epidermis was measured using a micrometer, classifying it into the following sections: basal layer and spinous layer, granular layer, stratum corneum, and the entire epidermis.
[0285] As a result, wild-type mice showed significant psoriasis-like skin lesions, such as epidermal hyperplasia and microabscesses accompanied by neutrophil infiltration in the dermis (Figure 5A, Table 2). On the other hand, Regnase-1 AA mutant mice showed a reduction in these psoriasis-like lesions compared to wild-type mice. Furthermore, morphological measurements of epidermal thickness showed that Regnase-1 AA mutant mice had lower values than wild-type mice in all categories (Figure 5B).
[0286] [Table 2]
[0287] (Quantitative analysis of various gene expression) Imiquimod was applied every other day on Day 0, 2, and 4. The mice were euthanized in stages the day after application, and the auricles at the application sites were collected. RNA was extracted using QIAZOL Lysis Reagent (QIAGEN, No. 79306) and RNeasy 96 kit (QIAGEN, No. 74182) according to standard procedures. After obtaining complementary DNA by reverse transcription, the expression of the following target genes was measured by Taqman PCR. Taqman PCR was performed using the QuantiTect Probe RT-PCR Kit (QIAGEN, No. 204445) and analyzed on a LightCycler 480 II (Roche). The Taqman probes used are listed below. B2m (Applied Biosystems, Mm00437762_m1): Endogenous control Il6 (Applied Biosystems, Mm00446190_m1): Inflammatory cytokine Il1a (Applied Biosystems, Mm00439620_m1): Inflammatory cytokine Cxcl2 (Applied biosystems, Mm00436450_m1): Leukocyte migration factor Hbegf (Applied Biosystems, Mm00439306_m1): Cell Growth Factor Sprr2i (Applied Biosystems, Mm00726832_s1): Keratinocyte marker Keratin 6A (Applied Biosystems, Mm00833464_g1): Keratinocyte marker
[0288] As a result, in wild-type mice, the genes targeted by Regnase-1 (Il6, Il1a, Cxcl2, Hbegf) (see Figures 19-1 to 19-5) increased with disease induction (Figure 6). On the other hand, in Regnase-1 AA mutant mice, the increase in these genes induced with disease induction was suppressed. This suggests that Regnase-1 AA mutant mice have an inhibitory effect on the production of inflammatory cytokines and cell proliferation activity associated with the disease state. In addition, in wild-type mice, the factors Spr2i and Keratin 6A, which are expressed in keratinocytes, increased with disease induction (Figure 6). On the other hand, in Regnase-1 AA mutant mice, the increase in these genes was suppressed, reflecting the effect of reducing psoriasis-like lesions. This suggests that keratinocyte proliferation was suppressed in Regnase-1 AA mutant mice.
[0289] Example 4. Disease reduction effect of Regnase-1 AA mutant mice in an anti-glomerular basement membrane antibody-induced glomerulonephritis model. Glomerular nephritis induced by anti-glomerular basement membrane antibodies was induced in wild-type mice and Regnase-1 AA mutant mice. Mice were immunized with sheep-derived IgG antibodies mixed with an adjuvant, and then administered sheep antiserum (nephrotoxic serum) obtained by immunizing rat glomeruli with sheep once daily for four consecutive days. Blood samples were collected two weeks after administration of nephrotoxic serum, and serum creatinine, urea nitrogen, and cystatin C, indicators of renal impairment, were measured. Similarly, urine was collected at two weeks, and urinary total protein and urinary creatinine levels were measured. Serum and urinary parameters were measured using TBA-120-FR (Toshiba Medical Systems Corporation). The following abbreviations were used in each figure: non-inducible wild-type mouse (WTNC); non-inducible Regnase-1 AA mutant mouse (AANC); inducible wild-type mouse (WTDC); inducible Regnase-1 AA mutant mouse (AADC).
[0290] As a result, serum creatinine levels and the urinary total protein to urinary creatinine ratio, indicators of glomerular damage, were lower in disease-induced Regnase-1 AA mutant mice (AADC) compared to disease-induced wild-type mice (WTDC) (Figure 7A). This suggests that Regnase-1 AA mutant mice have a protective effect against renal damage.
[0291] (Quantitative determination of hydroxyproline) Two weeks after administration of nephrotoxic serum, the mice were euthanized and their kidneys were collected. The collected kidneys were freeze-dried and then weighed. They were hydrolyzed overnight at 95°C with 6N hydrochloric acid, and the amount of hydroxyproline (Hyp) per unit weight of the kidney was measured by mass spectrometry.
[0292] As a result, hydroxyproline levels, an indicator of tissue fibrosis, were lower in disease-induced Regnase-1 AA mutant mice (AADCs) compared to disease-induced wild-type mice (WTDCs) (Figure 7B). This suggests that Regnase-1 AA mutant mice have a protective effect against renal fibrosis.
[0293] (Quantitative analysis of various gene expression) Two weeks after administration of nephrotoxic serum, mice were euthanized and their kidneys were collected. RNA was extracted from the collected kidneys using QIAZOL Lysis Reagent (QIAGEN, No. 79306) and RNeasy 96 kit (QIAGEN, No. 74182) according to standard procedures. After obtaining complementary DNA by reverse transcription, the expression of the following target genes was measured by Taqman PCR. Taqman PCR was performed using the QuantiTect Probe RT-PCR Kit (QIAGEN, No. 204445) and analyzed on a LightCycler 480 II (Roche). The Taqman probes used are listed below. Gapdh (Applied Biosystems, Mm99999915_g1): Endogenous control Col1a1 (Applied Biosystems, Mm00801666_g1): Organ fibrosis index Acta2 (Applied Biosystems, Mm00725412_s1): Organ fibrosis index CTGF (Applied Biosystems, Mm01192933_g1): Organ fibrosis index DDR1 (Applied Biosystems, Mm01273496_m1): Organ fibrosis index Pdgfb (Applied Biosystems, Mm00440677_m1): Organ fibrosis index
[0294] As a result, Col1a1 and Acta2 gene levels, indicators of tissue fibrosis, were lower in disease-induced Regnase-1 AA mutant mice (AADCs) compared to disease-induced wild-type mice (WTDCs) (Figure 8A). This suggests that Regnase-1 AA mutant mice have a protective effect against renal fibrosis.
[0295] Furthermore, in wild-type mice, the genes targeted by Regnase-1 (Ctgf, Ddr1, Pdgfb) (see Figures 19-1 to 19-5) increased with disease induction. On the other hand, in Regnase-1 AA mutant mice, the increase in these genes was suppressed (Figure 8B). This suggests that Regnase-1 AA mutant mice have an inhibitory effect on fibrosis by suppressing the expression of fibrosis-related factors.
[0296] (Changes in the counts of various blood cells in the blood) Blood counts were measured using XT-2000iV (Sysmex Corporation) in blood obtained from mice two weeks after administration of nephrotoxic serum. In wild-type mice, the number of white blood cells, neutrophils, and monocytes per unit blood volume increased with disease induction, but in Regnase-1 AA mutant mice (AADC), the increase in neutrophils and monocytes in the blood associated with disease was suppressed (Figure 8C). This suggests that Regnase-1 AA mutant mice may suppress the increase in inflammatory cells associated with the development of nephritis.
[0297] (Pathological examination) Two weeks after the initiation of anti-glomerular basement membrane antibody administration, wild-type mice or Regnase-1 AA mutant mice were euthanized by exsanguination under deep anesthesia and then necropsied. Kidneys and lungs were collected, fixed by immersion in 4% paraformaldehyde solution, embedded in paraffin using conventional methods, sectioned to approximately 3 micrometers, and hematoxylin-eosin (HE) stained specimens were prepared. The HE-stained specimens of the kidneys and lungs were histopathologically examined under a light microscope. In addition, for the kidneys, the number of lesions in all glomeruli on the specimen was counted, including crescents, sclerosis, the sum of crescents and sclerosis, and all glomerular lesions, and their respective percentages were calculated.
[0298] As a result, in the kidneys, wild-type mice (WT) showed prominent crescentic glomerulonephritis lesions, such as crescent formation and glomerulosclerosis (Figures 9A, 9B). On the other hand, Regnase-1 AA mutant mice (AA) showed a reduction in these glomerulonephritis lesions compared to wild-type mice. In the lungs, wild-type mice showed prominent inflammatory cell infiltration or granulomas in the alveoli or perivascular interstitium (Figure 9C, Table 3). On the other hand, Regnase-1 AA mutant mice showed a reduction in these lung lesions compared to wild-type mice.
[0299] [Table 3]
[0300] Example 5. Disease reduction effect of Regnase-1 AA mutant mice in a bleomycin-induced scleroderma model. Bleomycin-induced scleroderma models were induced in wild-type mice and Regnase-1 AA mutant mice. Bleomycin was administered via a subcutaneous implantable pump, and after 4 weeks, the mice were euthanized, and skin and lung samples were collected from the administration site. The following abbreviations were used in each figure: non-induced wild-type mouse (WTNC); non-induced Regnase-1 AA mutant mouse (AANC); induced wild-type mouse (WTDC); induced Regnase-1 AA mutant mouse (AADC).
[0301] (Quantitative determination of hydroxyproline in the skin) The collected skin samples were freeze-dried and then weighed. Hydrolysis was performed by adding 6N hydrochloric acid, and the amount of hydroxyproline per unit weight of skin was measured by mass spectrometry.
[0302] As a result, hydroxyproline levels, an indicator of tissue fibrosis, were lower in disease-induced Regnase-1 AA mutant mice (AADCs) compared to disease-induced wild-type mice (WTDCs) (Figure 10A). This suggests that Regnase-1 AA mutant mice possess a protective effect against skin fibrosis.
[0303] (Quantitative analysis of various gene expression in the lungs) Four weeks after the start of bleomycin administration, mice were euthanized and their lungs were collected. RNA was extracted from the collected lungs using QIAZOL Lysis Reagent (QIAGEN, No. 79306) and RNeasy 96 kit (QIAGEN, No. 74182) according to standard procedures. After obtaining complementary DNA by reverse transcription, the expression of the following target genes was measured by Taqman PCR. Taqman PCR was performed using the QuantiTect Probe RT-PCR Kit (QIAGEN, No. 204445) and analyzed on a LightCycler 480 II (Roche). The Taqman probes used are listed below. Gapdh (Applied Biosystems, Mm99999915_g1): Endogenous control Col1a1 (Applied Biosystems, Mm00801666_g1): Organ fibrosis index
[0304] As a result, in wild-type mice, the Col1a1 gene, an indicator of fibrosis, increased with disease induction. On the other hand, in Regnase-1 AA mutant mice, the increase in the gene was suppressed (Figure 10C). This suggests that Regnase-1 AA mutant mice have an inhibitory effect on fibrosis.
[0305] (Pathological examination of the lungs) Four weeks after the start of bleomycin administration, wild-type mice or Regnase-1 AA mutant mice were euthanized by exsanguination under deep anesthesia and then necropsied. Lungs were collected, fixed by immersion in 4% paraformaldehyde solution, embedded in paraffin using conventional methods, sectioned to approximately 3 micrometers, and hematoxylin-eosin (HE) stained specimens were prepared. The HE-stained lung specimens were histopathologically examined under a light microscope.
[0306] As a result, wild-type mice showed significant degeneration and necrosis of alveolar epithelium, inflammatory cell infiltration in the alveoli / interstitium (neutrophils, mononuclear cells / foam cells), eosinophilic substances / exudates in the alveoli, bronchoalveolar epithelial hyperplasia, alveolar / interstitium fibrosis, and edema / lymphatic dilation in the vascular / peribronchial interstitium (Figure 10B, Table 4). On the other hand, Regnase-1 AA mutant mice showed a reduction in these lung lesions, particularly inflammatory cell infiltration, bronchoalveolar epithelial hyperplasia, alveolar / interstitium fibrosis, and edema / lymphatic dilation in the vascular / peribronchial interstitium, compared to wild-type mice.
[0307] [Table 4]
[0308] Example 6. Disease reduction effect of Regnase-1 AA mutant mice in an experimental autoimmune uveitis model. Complete Freund's adjuvant and IRBP (photoreceptor-retinoid binding protein) peptide were mixed and intradermally immunized C57BL / 6 mice (wild-type mice) or Regnase-1 AA mutant mice. Mice assigned to the non-pathological control group were administered the solvent and complete Freund's adjuvant mixture without the peptide. The peptide was administered at a dose of 140 nmol or 280 nmol per individual. The sequences of the peptides used are shown below. IRBP peptide: LAQGAYRTAVDLESLASQLT (SEQ ID NO: 19)
[0309] After immunization, fundus examinations were performed approximately three times a week, and the degree of inflammation and retinal structural damage was scored. The scoring was performed based on literature, and the score was evaluated on a 5-point scale from 0 to 4 (Exp Eye Res 87(4), 319-326 (2008)). The results are shown in Figures 11-1A and 11-1B and Figures 11-2C and 11-2D.
[0310] As a result, wild-type mice showed an increase in inflammation and structural damage scores upon induction of disease, while Regnase-1 AA mutant mice showed almost no increase in inflammation or structural damage scores. This suggests that Regnase-1 AA mutant mice have a protective effect against ocular inflammation and retinal structural damage.
[0311] Example 7. Disease reduction effect of Regnase-1 AA mutant mice in an experimental autoimmune uveitis T cell transfer model. Similar to Example 6, a complete Freund's adjuvant and an IRBP (photoreceptor-retinoid binding protein) peptide were mixed and intradermally immunized in C57BL / 6 mice (wild-type mice). On day 12 after immunization, mice were euthanized and their spleens were collected. After hemolysis of the spleen cells, they were cultured for 2 days in RPMI-1640 medium containing 5 μM IRBP peptide and 0.3 μg / ml ODN1826 (Invitrogen, tlrl-1826). Cells were isolated using Pan T Cell Isolation Kit II, mouse (Miltenyi, 130-095-130), with 1 x 10⁶ cells per mouse. 6 The cells were transferred into wild-type mice and Regnase-1 AA mutant mice via intraperitoneal administration. From day 11 to day 18 after transplantation, fundus examinations were performed on both eyes, and the degree of inflammation was scored. The score was evaluated on a 5-point scale from 0 to 4. Eighteen days after transfer, the animals were euthanized by bleeding under deep anesthesia and then necropsy. Eyeballs were collected, fixed by immersion in glutaraldehyde solution or 4% paraformaldehyde solution, embedded in paraffin using the conventional method or AMeX method, sectioned to approximately 3 micrometers, and hematoxylin eosin (HE) stained specimens were prepared. The HE stained specimens of the eyeballs were histopathologically observed under a light microscope. Structural changes in the retina were scored according to the following criteria, and the sum of the scores was calculated. Outer segment of rod: score 1, cell infiltration; score 2, partial disappearance; score 3, moderate disappearance; score 4, almost complete disappearance. Nerve cell layer: score 1, cell infiltration; score 2, partial disappearance; score 3, moderate disappearance; score 4, almost complete disappearance; score 5, complete disappearance. Retinal structure: Score 1, less than 10% retinal folds; Score 2, 10% to 50% retinal folds; Score 3, more than 50% retinal folds. Fundus examination revealed that Regnase-1 AA mutant mice (AA) showed reduced inflammation in the eye (Figure 36A). Histopathological analysis showed that Regnase-1 AA mutant mice (AA) had a reduced score for retinal structural damage (Figure 36B). Therefore, it was suggested that Regnase-1 may be involved not only in immunosensitization but also in the progression of disease after sensitization.
[0312] Example 8 This example demonstrates that Regnase-1 is phosphorylated by TBK1 and IKKi in the IL-17 receptor signaling pathway.
[0313] The inventors then investigated how Regnase-1 is post-translationally modified by the IL-17A signaling component. Immunoblotting of Regnase-1 in wild-type and Regnase-1AA / AA MEFs revealed that IL-17A treatment induces Regnase-1 phosphorylation, which is represented by a shift in Regnase-1 electrophoretic mobility (Figure 12-1A). In wild-type MEFs, no dramatic loss of Regnase-1 occurred upon IL-17A stimulation (Figure 12-1A), but the Regnase-1 phosphorylation pattern was similar to that observed with IRAK1 and IRAK2-mediated phosphorylation upon LPS or IL-1 stimulation (Nat Immunol 12, 1167-1175 (2011)). IL-17A stimulation resulted in weak activation of NF-κB (Figure 12-3I), indicating that weak IKK activation in the IL-17A signaling pathway led to weak degradation of Regnase-1 upon IL-17A stimulation. Indeed, phosphorylated Regnase-1 AA mutant protein gradually accumulated in Regnase-1AA / AA MEFs during IL-17A stimulation.
[0314] To identify the kinase responsible for Regnase-1 phosphorylation in the IL-17A signaling pathway, we investigated a series of MEFs lacking TBK1, IKKi, TBK1 / IKKi, Act1, IKKα / IKKβ, or IRAK1 / IRAK2. We found that Regnase-1 phosphorylation did not occur in MEFs lacking both TBK1 and IKKi, or Act1, an adapter protein essential for the IL-17 signaling pathway (Figure 12-1B). Regnase-1 phosphorylation in response to IL-17A was observed in MEFs lacking either TBK1 or IKKi, indicating that TBK1 and IKKi possess independent Regnase-1 kinase activity (Figure 12-1B). Treatment of MEF cells with BX795, an inhibitor of both TBK1 and IKKi, inhibited Regnase-1 phosphorylation upon IL-17A stimulation (Figure 12-1C). To investigate whether TBK1 and IKKi directly phosphorylate Regnase-1, we prepared recombinant Regnase-1 purified from MEF cell lines stably expressing FLAG-tagged Regnase-1. Recombinant Regnase-1 phosphorylation by recombinant TBK1 and / or IKKi under in vitro conditions was observed via immunoblotting and 32 The phosphorylation was detected as an electrophoretic mobility shift pattern by P autoradiography (Figure 12-2D). These results confirmed that both TBK1 and IKKi are responsible for IL-17A-responsive Regnase-1 phosphorylation. The IRAK-mediated Regnase-1 phosphorylation pattern appeared similar to that of TBK1 and IKKi, but Regnase-1 phosphorylation occurred in IRAK1 / IRAK2 double-deficient MEFs (Figure 12-2E). In contrast, IL-1β-responsive Regnase-1 phosphorylation occurred in TBK1 / IKKi double-deficient MEFs (Figure 12-3J). These results suggest that TBK1 and IKKi phosphorylate Regnase-1 in an IRAK-independent manner, while IRAK phosphorylates Regnase-1 independently of TBK1 and IKKi.
[0315] Example 9 This example demonstrates that Act1 contributes to TBK1 / IKKi-mediated phosphorylation of Regnase-1 by interacting with Regnase-1.
[0316] The inventors investigated whether Regnase-1 interacts with Act1, TBK1, and IKKi. Co-immunoprecipitation of full-length or N-terminally or C-terminally cleaved Regnase-1 with Act1 revealed that Regnase-1 binds to Act1 via its C-terminal domain (Figure 12-2F). The inventors then co-expressed Regnase-1 with Act1, TBK1, or IKKi in HEK293 cells. A phosphorylation band shift of Regnase-1 was observed when co-expressed with Act1 but not with TBK1 or IKKi. A stronger band of phosphorylated Regnase-1 was detected when co-expressed with Act-1 and TBK1, or with Act-1 and IKKi (Figure 12-2G). In contrast, the amount of phosphorylated Regnase-1 decreased when co-expressed with an Act-1 mutant lacking the C-terminal region containing the SEFIR domain (Act1ΔSEFIR) and with TBK1 or with Act1ΔSEFIR and IKKi (Figure 12-2H), suggesting that TBK1 or IKKi-mediated phosphorylation of Regnase-1 requires interaction between the C-terminal domain of Regnase-1 and Act1. Co-immunoprecipitation analysis showed that Regnase-1 interacts with TBK1, IKKi, and the Act-1 SEFIR domain, and that Act1 interacts with TBK1, IKKi, and Regnase-1 (Figures 12-2G and 12-2H). These results indicate that the binding of Act1 to Regnase-1 via its C-terminal domain leads to improved reachability of Regnase-1 to TBK1 and IKKi, as well as simultaneous phosphorylation of Regnase-1 and Act1 by TBK1 or IKKi.
[0317] Example 10 This example demonstrates that phosphorylation of residues within the proline-rich region causes oligomerized Regnase-1 to dissociate.
[0318] The inventors attempted to identify Regnase-1 amino acid residues phosphorylated by TBK1 and IKKi. Phosphorylated Regnase-1 (derived from mouse) was prepared by co-expression of Act1 with TBK1 or IKKi. Purified phosphorylated Regnase-1 was digested with protease and analyzed using high-resolution liquid chromatography-mass spectrometry (LC-MS). Five Regnase-1 residues (Ser439, Ser494, Thr505, Ser508, and Ser513) were identified as important phosphorylation sites (Figure 13-1A, Table 5). One of the five residues (Ser439) corresponded to the phosphorylation target of IKK. The remaining four residues (Ser494, Thr505, Ser508, and Ser513) were localized within the proline-rich region of Regnase-1 and did not contain any consensus sequences related to phosphorylation. The inventors investigated whether these residues contribute to the phosphorylation of Regnase-1 in the IL-17 receptor (IL-17R) signaling pathway. Alanine substitution at Ser494 and Ser513 resulted in the disappearance of phosphorylated Regnase-1 when stimulated with IL-1β or IL-17A in HeLa cells (Figure 13-1B). This indicates that these residues are central to the changes in electrophoretic mobility of phosphorylated Regnase-1 and that they are phosphorylation sites common to IRAK and TBK1 / IKKi.
[0319] [Table 5]
[0320] The inventors then investigated the role of Regnase-1 phosphorylation within this proline-rich region. The proline-rich region has been reported to be involved in the oligomerization of Regnase-1, and Regnase-1 cleavage mutants lacking this region lose their RNase activity (Mol Cell 44, 424-436 (2011); Nucleic Acids Res 41, 3314-3326 (2013)). These findings suggest that phosphorylation of the proline-rich segment may regulate the self-assembly of Regnase-1. The inventors prepared and purified GST-tagged Regnase-1 fragments containing the proline-rich region and the C-terminal domain. In addition, to mimic phosphorylation, the inventors constructed mutant fragments in which the Ser and Thr residues in the proline-rich region were replaced with glutamic acid. Oligomerization of Regnase-1 fragments (wild-type, S494E / S513E, and S494E / T505E / S508E / S513E) was analyzed using gel filtration chromatography. The wild-type fragment formed several high molecular weight oligomers, while oligomerization was inhibited in the mutants (Figure 13-2C). This indicates that the introduction of phosphoserine and phosphothreonine residues into the proline-rich region promotes the dissociation of oligomerized Regnase-1. To investigate the molecular assembly of phosphorylated Regnase-1, the inventors used undenatured PAGE analysis of Regnase-1 purified from MEFs stably expressing N-terminal FLAG-tagged Regnase-1. This experiment demonstrated that IL-1β or IL-17A stimulation induces the appearance of Regnase-1 monomers (Figure 13-3D). Furthermore, in vitro phosphorylation of Regnase-1 by recombinant TBK1 and IKKi also induced conversion to the monomeric form (Figure 13-3E). These results support the view that phosphorylation of the proline-rich region of Regnase-1 influences the interactions necessary for Regnase-1 self-assembly and promotes conversion from the oligomeric form to the monomeric form.
[0321] Example 11 In this example, it was shown that Regnase-1 phosphorylation changes its intracellular localization from the ER to the cytosol.
[0322] Regnase-1 protein is found in the rough ER membrane fraction (Cell 161, 1058-1073 (2015)). The inventors isolated intracellular compartments such as the ER membrane, microsomes, and soluble cytoplasmic fraction from cellular homogenates of MEFs stimulated with IL-1β or IL-17A, and analyzed their protein distribution using Western blotting. All phosphorylated Regnase-1 proteins were located in the cytoplasm (Figure 14-1A), while unphosphorylated Regnase-1 remained localized in ribosome-containing organelles (Figure 14-1A). This cytosolic distribution of Regnase-1 protein was not observed in TNF-α-stimulated MEFs or IL-17A-stimulated Act-1-deficient MEFs where Regnase-1 was not phosphorylated (Figure 14-1B), indicating that Regnase-1 phosphorylation and subsequent dissociation of Regnase-1 oligomers triggered the translocation of Regnase-1 from the ER to the cytoplasm. Interestingly, after IL-17A stimulation, the amount of unphosphorylated Regnase-1 in the ER fraction increased over time in Regnase-1AA / AA MEFs compared to wild-type cells (Figure 14-1C). This finding suggests that unphosphorylated Regnase-1 protein attached to the ER upon IL-17A stimulation mediates the regulation of mRNA levels targeting Regnase-1.
[0323] Alterations in the intracellular distribution of phosphorylated Regnase-1 also increase the likelihood of Regnase-1 binding to Act1 and TBK1 / IKKi in the ER. We investigated whether interactions between Regnase-1, Act1, and TBK1 / IKKi occur in the ER by co-immunoprecipitation of intracellular fractions isolated from IL-17A-stimulated or unstimulated cells. Regnase-1 interacting with phosphorylated TBK1 and phosphorylated IKKi was observed in microsomes but not in the soluble cytoplasmic fraction (Figure 14-2D). Western blot analysis of intracellular fractions isolated from wild-type and Act1-deficient MEFs revealed that Act1 is responsible for the phosphorylation of both TBK1 and IKKi in the ER in response to IL-17A and promotes kinase-mediated phosphorylation of Regnase-1 (Figure 14-2E). These results suggest that Act1 acts as a signaling factor to promote the phosphorylation of TBK1, IKKi, and Regnase-1 on the ER membrane after IL-17A stimulation.
[0324] Example 12 This example demonstrates that IL-17-mediated phosphorylation of Regnase-1 leads to the loss of its RNase activity.
[0325] The inventors then investigated whether the dissociation of phosphorylated Regnase-1 from the ER affects IL-6 mRNA levels upon cell stimulation. Although IL-17A induces Regnase-1 phosphorylation, unlike stimulation with IL-1β and TNF-α, this cytokine does not sufficiently induce IL-6 mRNA due to its weak NF-κB activation. TNF-α induces IL-6 mRNA expression with strong NF-κB activation, but it cannot induce Regnase-1 phosphorylation. The inventors measured IL-6 mRNA levels in MEFs stimulated with IL-17A alone after TNF pretreatment. In wild-type MEFs, IL-6 mRNA induction was strongly enhanced upon IL-17A stimulation, which led to Regnase-1 phosphorylation (Figure 15-1A). In Regnase-1 AA mutant cells and TBK1 / IKKi double knockout cells, IL-6 mRNA induction was suppressed upon IL-17A stimulation, and was particularly significantly inhibited in double knockout MEFs (Figure 15-1B). TBK1 / IKKi double knockout cells did not show Regnase-1 phosphorylation and maintained intracellular localization in ribosome-containing organelles in response to IL-17A (data not shown).
[0326] The inventors evaluated the effect of Regnase-1 phosphorylation on mRNA degradation using a Tet-off induction system. Regnase-1 was readily phosphorylated when co-expressed with Act1 and IKKi. IL-6 mRNA and 3'UTR were overexpressed in Tet-off HEK293 cells in the presence of either Regnase-1 or phosphorylated Regnase-1, and IL-6 mRNA levels were subsequently evaluated by Northern blotting. Regnase-1-mediated IL-6 mRNA degradation was inhibited by co-expression with Act1 and IKKi (Figure 15-2C). This strongly indicates that phosphorylated Regnase-1 lacks the ability to degrade its target mRNA.
[0327] The inventors then investigated the mechanism of target mRNA repression in Regnase-1AA / AA cells. As described above, target mRNA repression is more enhanced at later stages of IL-17A stimulation. The inventors used immunoblot analysis of phosphorylated and unphosphorylated Regnase-1 during the recovery phase after IL-17A stimulation. Unphosphorylated Regnase-1 protein gradually appeared in wild-type MEFs during the recovery phase, which was observed in the presence of a protein synthesis inhibitor (Figure 15-2D). The increase in unphosphorylated Regnase-1 protein levels was much more strongly enhanced in Regnase-1AA / AA MEFs than in wild-type cells. In contrast, unphosphorylated Regnase-1 did not appear in the presence of okadaic acid, an inhibitor of protein phosphatase-1 and 2A (Figure 15-2D), indicating that the appearance of unphosphorylated Regnase-1 is mediated by phosphatases. Furthermore, IL-6 mRNA stability was enhanced in the presence of okadaic acid during the recovery phase following TNF-α and IL-17A treatment of Regnase-1AA / AA MEFs (Figure 15-2E). These results suggest that the suppression of Regnase-1 target mRNA observed in Regnase-1AA / AA cells upon IL-17A stimulation requires conversion from phosphorylated Regnase-1 to its non-phosphorylated form.
[0328] Example 13 In this example, it was shown that C-terminal truncated mutations of Regnase-1 (Regnase-1ΔCTD) and S513A mutations (Regnase-1 S513A) inhibit IL-17-mediated phosphorylation and eliminate IL-17-mediated inflammatory responses in vitro and in vivo.
[0329] Phosphorylated Regnase-1 is released from the ER by a conversion from a constitutively active oligomer to an inactive monomer. This finding suggests that Regnase-1 mutants may be able to maintain RNase function even when not phosphorylated. To investigate this, the inventors expressed various Regnase-1 mutants that are stable in MEFs and searched for Regnase-1 mutants that are resistant to IL-17-mediated phosphorylation. The inventors found that Regnase-1 mutants lacking the C-terminal domain, which is essential for interaction with Act-1, are not phosphorylated by IL-17A stimulation (Figure 16-1A). Next, the inventors attempted to create genetically mutant mice expressing C-terminally cleaved Regnase-1 by introducing a frameshift and an immature stop codon into the proline-rich domain of Regnase-1 (Figure 17-1A). The inventors successfully obtained mutant mice with a 1 bp deletion at codon 517, thereby inducing a frameshift mutation (referred to as Regnase-1ΔCTD, Figure 17-1B). To investigate the effects of this mutation on protein expression levels and arbitrary post-translational modifications, MEFs derived from Regnase-1ΔCTD / ΔCTD mutant mice were stimulated with TNF-α, IL-17A, and IL-1β. These stimuli induced an NF-κB-dependent increase in Regnase-1ΔCTD protein, and no mobility-shifted bands indicating phosphorylation were observed (Figure 16-1B). To investigate the possibility of Regnase-1ΔCTD protein phosphorylation upon IL-17A stimulation, Myc-Act-1, HA-TBK-1, and HA-IKKi were co-expressed with FLAG-tagged Regnase-1ΔCTD in HEK293 cells and co-immunoprecipitation was performed. The Regnase-1ΔCTD protein showed significantly reduced phosphorylation compared to the wild type (Figure 16-1C) and did not co-immunoprecipitate with Act-1 (Figure 16-1D). These results demonstrate that Regnase-1ΔCTD lacks the binding to Act-1 essential for Regnase-1 phosphorylation and remains in the unphosphorylated form upon IL-17A stimulation.
[0330] The inventors created mutant mice in which Ser513 was replaced with alanine (Figures 17-1C, 17-1D). To investigate the effect of this mutation on protein expression levels and arbitrary post-translational modifications, MEFs derived from Regnase-1 S513A mutant mice were stimulated with TNF-α, IL-17A, and IL-1β. These stimuli induced an NF-κB-dependent increase in Regnase-1 S513A protein, and no mobility-shifted bands representing phosphorylation were observed (Figure 16-4L). Next, the protein stability of the Regnase-1 mutant protein was investigated. MEFs derived from Regnase-1 AA mutant mice and Regnase-1 S513A mutant mice were stimulated with TNF-α, IL-1β, LPS, and IL-17A in the presence of the transcriptional repressor cycloheximide. As a result, Regnase-1 protein levels were significantly reduced in wild-type MEFs after IL-1β, LPS, and IL-17A stimulation, whereas no reduction in Regnase-1 protein levels was observed in MEFs derived from Regnase-1 AA mutant mice or Regnase-1 S513A mutant mice (Figure 16-4M, Figure 16-5N). Therefore, the Regnase-1 S513A mutation exhibits resistance to phosphorylation and degradation induced after IL-17A stimulation, thereby enhancing the stability of the Regnase-1 protein.
[0331] The inventors then investigated the binding pattern of Regnase-1ΔCTD protein in ribosome-containing organelles. Cytoplasmic and microsomal fractions were isolated from IL-17A-stimulated Regnase-1ΔCTD / ΔCTD MEF cell homogenates, and the protein distribution of Regnase-1, ribosomal protein L7a, GAPDH, and phospho-TBK1 was analyzed by Western blotting. Wild-type Regnase-1, phosphorylated by IL-17A, was no longer localized to microsomes after translocation to the cytoplasm, while the Regnase-1ΔCTD mutant continued to bind to microsomes after IL-17A stimulation. This was accompanied by an increase in Regnase-1ΔCTD protein in microsomes (Figure 16-2E). Reganase-1 also binds to translationally active ribosomes assembled on polysomes, promoting mRNA degradation in translational ribosomes (Cell 161, 1058-1073 (2015)). We confirmed the binding of Regnase-1 to translationally active polysomes in wild-type and Regnase-1ΔCTD / ΔCTD MEFs stimulated with TNF-α and IL-17A (Figure 16-2F). In wild-type MEFs, the localization of Regnase-1 to polysomes decreased with cytokine stimulation, but the localization of Regnase-1 to translationally active polysomes was increased in mutant MEFs stimulated with these cytokines compared to unstimulated MEFs (Figure 16-2G). The opposite pattern of protein localization between wild-type and mutant Regnase-1 suggests a role for the Regnase-1ΔCTD mutation in reducing target mRNA expression even during inflammatory stimuli. To verify this, the inventors investigated mRNA induction of Regnase-1 targeting genes in wild-type and Regnase-1 ΔCTD / ΔCTD MEF and Regnase-1 S513A MEF stimulated with pro-inflammatory cytokines.In wild-type MEFs, stimulation with TNF-α + IL-17A induced a time-dependent increase in Regnase-1 target mRNAs such as IL-6, LCN-2, and GM-CSF, which were not observed in mutant MEFs (Figure 16-3H, Figure 17-4E). In mutant MEFs, sequential stimulation with TNF-α and IL-17A induced reduced mRNA production of IL-17-related genes such as IL-6, CXCL-1, CXCL-2, CCL-20, LCN-2, and GM-CSF (Figure 17-2C, Figure 17-4F). Furthermore, protein production of IL-6, CXCL-1, and CXCL-2 after 24-hour stimulation with either IL-17A and either IL-6 or TNF-α was significantly lower in Regnase-1ΔCTD / ΔCTD MEFs compared to wild-type cells (Figure 17-3D). These findings indicate that the Regnase-1ΔCTD protein maintains its intracellular localization in ribosome-containing organelles after IL-17A stimulation, and that it acts as a negative regulator, inhibiting the enhancement of mRNA stability mediated by IL-17A and the subsequent production of inflammatory cytokines.
[0332] To investigate whether impaired IL-17-mediated release of Regnase-1 from the ER is important for suppressing TH17 cell-mediated autoimmune damage, the inventors induced EAE in Regnase-1ΔCTD / ΔCTD mice. In these mice, the severity of EAE was strongly attenuated compared to wild-type mice (Figure 16-3I). Flow cytometry analysis of mice 28 days after immunization showed a significant decrease in CD4+ T cell and macrophage infiltration into neuronal tissue in Regnase-1ΔCTD / ΔCTD mice (Figures 16-3J and K). On the other hand, with the exception of spleen-derived TH1 cells, which were increased in number in mutant mice compared to wild-type mice, the number of TH1 and TH17 cells in spleen and lymph node cells was comparable between wild-type and mutant mice (Figure 18). These results suggest that Regnase-1ΔCTD mutations also suppress EAE pathogenesis through persistent inhibition of STAT3 activation in endothelial cells, interfering with TH17 cell-mediated inflammation necessary for TH17 cell infiltration into the nervous system.
[0333] Example 14. Search for Regnase-1 target genes using luciferase assay. (Luciferase assay) HEK293 cells were transfused with either a pGL3-target gene 3'UTR plasmid expressing firefly-luciferase or a control pGL3-empty plasmid, along with a wild-type Regnase-1 expression plasmid, a mutant Regnase-1 (D141N) expression plasmid, or a control empty plasmid. Simultaneously, a renilla-luciferase expression plasmid was transfused as an internal control. After 24 hours of culture, luciferase activity in the cell lysates was measured using a Dual-luciferase reporter assay system (Promega Corporation).
[0334] (expression plasmid) Wild-type mouse Regnase-1 and mutant mouse Regnase-1 (D141N), in which the 141st amino acid is substituted from D to N, were inserted into the pCXND3 plasmid (Chugai Pharmaceutical Co., Ltd.) to prepare wild-type Regnase-1 expression plasmids and mutant Regnase-1 (D141N) expression plasmids. An empty plasmid with a FLAG tag inserted into the pCXND3 plasmid was prepared as a control plasmid. The pGL3-target gene 3'UTR plasmid was created by inserting the 3'UTR sequence of the target gene mRNA into the XbaI cleavage site of the pGL3 plasmid (promega Inc.). The target gene was selected using RNA immunoprecipitation assays with RAW264.7 and immortalized mouse keratinocytes.
[0335] As a result, in cells transfused with pGL3 plasmids containing Fabp5, Ackr3, Ctgf, Adamts1, Atf2, Cd80, Cyr61, Ddr1, Duox1, Dusp6, Csf3, Hbegf, Id3, Il19, Map3k8, Il1a, mcoln3, Mitf, Orc1, Pdgfb, Ptgs1, Sesn1, Ptger4, Shq1, Sulf1, Tnfrsf9, zc3h12c, Rarb, and Tmem9 3'UTR, luciferase activity was significantly reduced by Regnase-1 transfusion compared to transfusion with empty plasmids, and a dose-dependent relationship was observed (Figures 19-1 to 19-5). On the other hand, when a mutant Regnase-1 (D141N) expression plasmid was transfected, no significant change in luciferase activity was observed. These findings suggest that the above gene may be a novel target regulated by Regnase-1.
[0336] Example 15. Detection of Regnase-1 phosphorylation by IKKβ or TBK1 (Preparation of human Regnase-1) As the target protein, the full-length sequence of human Regnase-1 (UniProt ID: Q5D1E8) (SEQ ID NO: 2) was used as a construct with a GST tag at the N-terminus and a biotin ligase BirA recognition sequence at the C-terminus. Regnase-1 was expressed in mammalian cells Expi293, purified with glutathione Sepharose, and the GST tag was cleaved with Turbo3C protease (Accelagen). After cleavage, the Regnase-1 was isolated by gel filtration chromatography. If necessary, dephosphorylation was performed by adding 7 units of lambda phosphatase (SIGMA, P9614) to 1 μg of Regnase-1 and incubating at 4°C for 2 hours, followed by isolation by gel filtration chromatography.
[0337] (Phosphorylation reaction) A phosphorylation reaction was performed by reacting the kinase (IKKβ (SignalChem) or TBK1 (SignalChem)) with the biotinylated human Regnase-1 prepared above at room temperature for 1 hour in the presence of 20 μM ATP using Kinase assay buffer III (SignalChem) supplemented with 2 mM DTT, 100 μM sodium vanadate, and 2 mM manganese chloride.
[0338] (Detection of phosphorylated human Regnase-1) Detection of phosphorylated human Regnase-1 was performed by Western blotting using the antibodies described above. Western blotting was performed by transferring proteins from an SDS-PAGE gel to a PVDF membrane (Bio-Rad). The anti-Regnase-1 antibody or anti-phosphorylated Regnase-1 antibody was used as the primary antibody, and Anti-rabbit IgG horseradish peroxidase linked antibody (Cell Signaling Technology) was used as the secondary antibody. The peroxidase reaction was performed using a Super signal Westpura Extended Duration Substrate (Thermo), and chemiluminescence was detected using an ImageQuant LAS 4000 mini (GE Healthcare). As a result, the anti-phosphorylated Regnase-1 antibody specifically detected phosphorylated human Regnase-1 produced by kinase phosphorylation, and the anti-Regnase-1 antibody specifically detected human Regnase-1 (Figure 20).
[0339] The results from Example 15 confirmed that human Regnase-1 is phosphorylated by IKKβ and TBK1. Furthermore, the phosphorylation site in human Regnase-1 was considered to be the same site as the phosphorylation site in mouse Regnase-1. By using the methods of these examples, it is possible to identify substances that inhibit the phosphorylation of Regnase-1.
[0340] While not intending to be bound by any particular theory, the inventors of this study consider the following (1) to (5) based on the results of this research.
[0341] (1) Regnase-1 undergoes two-step phosphorylation in response to IL-1 or LPS, which activate the MyD88-dependent pathway. The first phosphorylation is mediated by the IRAK family of protein kinases, followed by IKK-mediated phosphorylation, which leads to protease-dependent degradation. The reduced Regnase-1 protein levels due to IKK-dependent degradation appear to attenuate its function as a “brake” on mRNA expression, thereby inducing the expression of Regnase-1 target mRNAs. However, our results demonstrate that IKK-independent phosphorylation of Regnase-1 contributes to the cessation of RNase activity. Regnase-1 exists in oligomeric form in ribosome-containing organelles, but phosphorylation induced by cellular stimulation interferes with the self-assembly of Regnase-1, causing it to be released from polysomes with ER and translational activity. In our experiments, the phosphorylation of Regnase-1 was maintained for a longer period than degradation and contributed to the stabilization of Regnase-1 target mRNA in response to stimulation by cytokines or TLR ligands.
[0342] (2) The inventors introduced a Regnase-1 AA mutant in which two serine residues phosphorylated by IKK were mutated to alanine residues. IL-17A stimulation induced rapid phosphorylation of Regnase-1 in both wild-type MEFs and Regnase-1 AA mutant MEFs. In Regnase-1 AA mutant cells, the appearance of non-phosphorylated Regnase-1 was observed late in IL-17A stimulation. This may be the cause of the repression of a series of mRNAs regulated by the Regnase-1 protein and the reduction in EAE severity observed in Regnase-1 AA mutant mice. This accumulation of non-phosphorylated Regnase-1 protein in Regnase-1 AA mutant cells occurred even in the presence of a protein synthesis inhibitor, suggesting that phosphorylated Regnase-1 is being converted to the non-phosphorylated form. The inventors hypothesized that the appearance of non-phosphorylated Regnase-1 protein may be due to phosphatase-mediated dephosphorylation. This hypothesis was confirmed by treating Regnase-1 AA mutant cells with the phosphatase inhibitor okadaic acid, which resulted in a dramatic extension of the IL-6 mRNA half-life. Dephosphorylation of Regnase-1 leads to the restoration of mRNA degradation activity via attachment to the ER. Therefore, Regnase-1 may inhibit the expression of its target mRNA in response to weak stimuli via reversible dephosphorylation and rapid rearrangement to the ER.
[0343] (3) The inventors also created Regnase-1ΔCTD mutant mice expressing a Regnase-1 protein lacking the C-terminal domain necessary for interaction with Act1. These mice, like Regnase-1 AA mutant mice, showed reduced EAE severity compared to the wild type, due to attenuated TH17 cell-mediated inflammation in non-hematopoietic cells. On the other hand, previous reports have shown that Regnase-1-deficient heterozygotes are more susceptible to EAE due to increased inflammation in non-hematopoietic cells (Immunity, 2015 Sep 15; 43(3): 475-487), which demonstrates the important role of Regnase-1 in suppressing inflammation in non-hematopoietic cells during the pathogenesis of EAE. However, the mechanism of inhibition of EAE pathogenesis in Regnase-1ΔCTD / ΔCTD mice may differ from that in Regnase-1AA / AA mice. Due to the lack of degradation induced by IKK-mediated phosphorylation, the Regnase-1 AA mutant protein is more abundant than the wild type, which has beneficial effects in the EAE. The Regnase-1 ΔCTD mutant exhibits lower levels of protein expression in a steady state and increased expression when stimulated by certain inflammatory cytokines, promoting the accumulation of unphosphorylated Regnase-1 in the ER and accelerating target mRNA degradation. Since Regnase-1 mRNA contains its own binding site in the 3'UTR, the low levels of Regnase-1 ΔCTD in a steady state may arise from the autoregulation of its own mRNA. This provides important insight into the regulatory role of Regnase-1 phosphorylation, not only in transmitting signals that lead to proteolysis, but also in weakening the degradation activity of target mRNA to avoid the intracellular accumulation of unphosphorylated / active proteins.
[0344] (4) IL-17 signals into the cytoplasm via the interaction between Act1, an essential adapter protein in the IL-17 signaling pathway, and the IL-17 receptor (IL-17R). The inventors identified the association of Regnase-1 with Act1, TBK1, and IKKi in the ER. Regnase-1 associates with Act-1 via its C-terminal domain. Binding of Act1 to Regnase-1 strongly promotes Regnase-1 phosphorylation by TBK1 and IKKi, which enhances the translocation of Regnase-1 from the ER to the cytoplasm and blocks its mRNA degrading ability. These findings suggest that Regnase-1 phosphorylation is directly correlated with Act1 activation that occurs after IL-17R association, and that Regnase-1 is involved in regulating IL-17-induced mRNA expression. In fact, a group of genes that are upregulated in response to IL-17, such as IL-6, IL-8, CXCL1, and CXCL2, correspond to the target mRNAs of Regnase-1.
[0345] (5) Regnase-1 is an RNA-binding RNase that destabilizes specific mRNAs in a steady state and is rapidly inactivated upon stimulation with IL-17, thereby stabilizing specific mRNAs in the IL-17 response. In the studies described herein, IL-17-inducible phosphorylation of Regnase-1 was severely impaired in Regnase-1ΔCTD mutants. Co-stimulation with TNF-α and IL-17 dramatically reduced IL-6, CXCL1, CXCL2, CCL-20, Lipocalin-2, and GM-CSF production in Regnase-1ΔCTD mutant cells to a level comparable to that of TBK1 / IKKi double knockout cells. These results strongly suggest that the interaction between Regnase-1, Act1, and TBK1 / IKKi influences the expression of these inflammatory genes induced by IL-17 stimulation, and that Regnase-1 plays a central role in regulating the IL-17-responsive inflammatory response. Blocking Regnase-1 phosphorylation may offer a novel strategy for treating TH17 cell-related diseases.
[0346] Example 16. Effect of phosphorylation of Regnase-1 at position 513 on IL-6 production To confirm that IL-6 mRNA levels are regulated by Regnase-1 phosphorylation and its dissociation from the ER upon stimulation, we created mouse Regnase-1 mutants resistant to phosphorylation by TBK1 / IKKi. Two MEF cell lines expressing the Regnase-1 mutant were established: one containing a substitution at Ser513 by Ala (Regnase-1 S513A), and the other lacking the C-terminal domain (Regnase-1 ΔCTD). Neither mutant showed Regnase-1 phosphorylation and maintained intracellular localization in the ER in response to IL-1β or IL-17A (Figure 21A). IL-6 mRNA production upon simultaneous stimulation with TNF-α and IL-17A was significantly reduced in these mutant MEFs compared to wild-type cells (Figure 21B). This indicates that inhibiting phosphorylation at position 513 of Regnase-1 strongly suppresses IL-6 production.
[0347] Example 17. Disease reduction effect of Regnase-1 S513A mutant mice in an imiquimod-induced psoriasis model. 62.5 mg of imiquimod cream (Beselna Cream 5%; Mochida Pharmaceutical Co., Ltd.) was applied every other day on Day 0, 2, and 4 to the right auricle and depilated neck and back skin of C57BL / 6 mice (wild-type mice; WT) or Regnase-1 S513A mutant mice (S513A). Auricle lesions were evaluated by measuring the thickness of the right auricle sequentially from before imiquimod application using a digital thickness gauge (Ozaki Seisakusho). The neck and back skin were evaluated macroscopically on a 4-point scale for erythema, thickening, and scaling, and the total score (12 points) was used to represent these results. As a result, wild-type mice showed significant thickening of the auricle following imiquimod application (Figure 22A). In addition, psoriasis-like skin lesions such as erythema, thickening, and scaling were induced in the neck and back skin where imiquimod was applied (Figure 22B). On the other hand, Regnase-1 S513A mutant mice showed reduced thickening of the auricle and psoriasis-like skin lesions (erythema, thickening, scaling) in the neck and back compared to wild-type mice (Figures 22A, 22B).
[0348] Evaluation of S513A mice (quantification of various gene expressions) Mice were euthanized, and the auricles of the applied areas were collected. RNA was extracted using QIAZOL Lysis Reagent (QIAGEN, No. 79306) and RNeasy 96 kit (QIAGEN, No. 74182) according to standard procedures. After obtaining complementary DNA by reverse transcription, the expression of the following target genes was measured by Taqman PCR. Taqman PCR was performed using the QuantiTect Probe RT-PCR Kit (QIAGEN, No. 204445) and analyzed on a LightCycler 480 II (Roche). The Taqman probes used are listed below. B2m (Applied Biosystems, Mm00437762_m1): Endogenous control Il6 (Applied Biosystems, Mm00446190_m1): Inflammatory cytokine Il1a (Applied Biosystems, Mm00439620_m1): Inflammatory cytokine Cxcl2 (Applied biosystems, Mm00436450_m1): Leukocyte migration factor Hbegf (Applied Biosystems, Mm00439306_m1): Cell Growth Factor Sprr2i (Applied Biosystems, Mm00726832_s1): Keratinocyte marker Keratin 6A (Applied Biosystems, Mm00833464_g1): Keratinocyte marker As a result, in S513A mice, the induction of the keratinocyte markers Spr2i and Keratin6A genes associated with disease induction was suppressed, revealing that the increase in keratinocytes characteristic of the psoriasis model was suppressed. Furthermore, in wild-type mice, the genes targeted by Regnase-1 (Il6, Il1a, Cxcl2, Hbegf) increased with disease induction (Figure 37). On the other hand, in S513A mutant mice, the increase in these genes induced with disease induction was suppressed. This suggests that Regnase-1 AA mutant mice have an inhibitory effect on the production of inflammatory cytokines and epidermal cell proliferation activity associated with disease.
[0349] Example 18. Disease reduction effect of Regnase-1 S513A mutant mice in an experimental autoimmune encephalomyelitis model. (EAE model) Conventional EAE was induced by immunization with myelin oligodendrocyte glycoprotein (MOG)(35-55) peptide (AnaSpec). An emulsion of MOG(35-55) peptide (300 ng / mouse) and complete Freund's adjuvant (CFA, InvivoGen) were mixed in a 1:1 ratio and subcutaneously injected into mice. Pertussis toxin (100 ng / mouse) was administered intraperitoneally on days 0 and 2. Mice were monitored every two days and evaluated by clinical scoring between days 7 and 28 post-immunization. Clinical scores were measured using a previously defined scale (Immunity 14, 471-481 (2001)). (Statistical analysis) Unless otherwise specified, statistical analysis of differences between two groups was performed using a Student's t-test (two-sided). A P < 0.05 was considered statistically significant. Regnase-1 S513A mutant mice showed a reduced increase in clinical scores associated with the disease compared to wild-type mice, thus mitigating the disease (Figure 38).
[0350] Example 19. In vitro selection (panning) of target-binding polypeptides. 19-1 Randomized double-stranded DNA library encoding polypeptide libraries A DNA library was constructed according to the method described in patent document (WO2013 / 100132). The library was prepared so that triplets of random regions appeared in 9 or 10 repetitions.
[0351] 19-2 Cyclic polypeptide library Using mRNA-puromycin linker ligation products and cell-free translation solutions prepared from the aforementioned double-stranded DNA library, a cyclic polypeptide library was translated and synthesized according to the method described in WO2013 / 100132. The random regions of the cyclic polypeptides constituting this library were randomly assigned 18 native amino acids, excluding methionine and cysteine.
[0352] 19-3 Implementing Panning Using the aforementioned cyclic polypeptide library, panning was performed according to the method described in WO2013 / 100132. Biotinylated human Regnase-1 was used as the target molecule for panning. The sequences enriched by repeating panning multiple times were identified as the sequences of cyclic polypeptides that bind to the target molecule, Regnase-1. Of these, PP1 to PP6 were synthesized using the method described in this example below. Furthermore, PP7 to PP25 were synthesized in the same manner.
[0353] Example 20. Synthesis of cyclic polypeptides The following abbreviations were used in the examples. AA Ammonium Acetate DBU 1,8-diazabicyclo[5.4.0]-7-undecene DCM Dichloromethane DCE 1,2-Dichloroethane DMF (N,N-dimethylformamide) DMSO (Dimethyl Sulfoxide) DIC N,N'-Diisopropylcarbodiimide DIPEA N,N-diisopropylethylamine FA Formic Acid MTBE methyl-tert-butyl ether NMP N-methyl-2-pyrrolidone TFA (Trifluoroacetic Acid) TFE 2,2,2-trifluoroethanol TIPS Triisopropylsilane HOAt 1-hydroxy-7-azabenzotriazole HATU O-(7-aza-1H-benzotriazol-1-yl)-N,N,N′,N′-tetramethyluronium hexafluorophosphate
[0354] For peptide synthesis and solid-phase synthesis, reaction solvents specifically for peptide synthesis (purchased from Watanabe Chemical and Wako Pure Chemical Industries) were used. Examples include DCM, DMF, NMP, 2% DBU in DMF, and TFA. In reactions where water was not added as a solvent, dehydrated solvents, superdehydrated solvents, and anhydrous solvents (purchased from Kanto Chemical, Wako Pure Chemic...
Claims
1. A method for identifying a substance that inhibits the phosphorylation of Regnase-1, using phosphorylation of a Ser residue at at least one position selected from the group consisting of positions corresponding to positions 513 and 494 of Sequence ID No. 1 as an indicator.
2. The method according to claim 1, comprising the following steps (a) and (b): (a) A step of mixing Regnase-1 with a kinase capable of phosphorylating Regnase-1 in the presence of a test substance and detecting the phosphorylation of Regnase-1 by the kinase; (b) A step of identifying a substance that inhibits the phosphorylation of Regnase-1 by the kinase compared to the absence of the test substance.
3. The method according to claim 2, wherein the kinase is a kinase capable of phosphorylating a Ser residue at at least one position selected from the group consisting of positions corresponding to positions 513 and 494 of SEQ ID NO:
1.
4. The method according to claim 2 or 3, wherein the kinase is at least one kinase selected from the group consisting of TBK1, IKKi, IKK, and IRAK.
5. The method according to any one of claims 2 to 4, wherein the detection of phosphorylation of Regnase-1 in step (a) is performed using an antibody capable of detecting phosphorylation of a Ser residue at at least one position selected from the group consisting of positions corresponding to positions 513 and 494 of SEQ ID NO:
1.
6. The method according to any one of claims 1 to 5, wherein Regnase-1 is human Regnase-1, and the positions corresponding to positions 513 and 494 of Sequence ID No. 1 are positions 516 and 497 of Sequence ID No.
2.
7. The method according to any one of claims 2 to 5, wherein the test substance is a Regnase-1 binding molecule.