Method for culturing and detecting two or more types of bacteria

Abstract

To provide a simple culture method that enables simultaneous growth of multiple types of target bacteria in a liquid sample, and to provide a simple detection method that enables simultaneous detection of multiple types of target bacteria in a liquid sample.SOLUTION: Provided is a method for culturing two or more types of bacteria, comprising putting a liquid sample in which bacteria selected from bacteria and fungi may exist and two or more types of solid media for growing bacteria selected from bacteria and fungi in one container and culturing while covering the solid media with the liquid sample. Provided is a method for detecting two or more types of bacteria, comprising: putting a liquid sample in which bacteria selected from bacteria and fungi may exist and two or more types of solid media for growing bacteria selected from bacteria and fungi in one container and culturing while covering the solid media with the liquid sample; and performing nucleic acid amplification using the liquid sample after culturing as a template-containing sample to amplify a target sequence portion of a nucleic acid of target bacteria selected from bacteria and fungi.SELECTED DRAWING: Figure 7

Description

Technical Field

[0004] , ,

[0001] The present invention relates to a method for culturing bacteria in a liquid sample, a culturing method for collectively growing a plurality of target bacteria present in the liquid sample, a method for collectively detecting a plurality of target bacteria present in the liquid sample, and a solid medium.

Background Art

[0002] Two major diseases in the oral cavity are dental caries and periodontal disease. Dental caries occurs when causative bacteria such as Streptococcus mutans and Streptococcus sobrinus decompose sucrose on the tooth surface to produce acid, the acid demineralizes the enamel of the tooth, and the acid further penetrates into the enamel.

[0003] It is known that causative bacteria of dental caries are involved not only in dental caries but also in the onset and progression of systemic diseases. For example, Non-Patent Document 1 examined whether 279 subjects carried Streptococcus mutans having a surface cnm protein that binds to type I collagen (cnm-positive Streptococcus mutans) in saliva, whether they had cerebral microbleeds, and their cognitive function. As a result, the group of subjects with cerebral microbleeds had a higher frequency of carrying cnm-positive Streptococcus mutans than the group of subjects without cerebral microbleeds, the risk of cerebral microbleeds was significantly higher in the cnm-positive Streptococcus mutans detection group than in the non-detection group (odds ratio = 14.3), and the group carrying cnm-positive Streptococcus mutans had a lower cognitive function. Similarly, Non-Patent Document 2 examined the presence or absence of cnm-positive Streptococcus mutans in saliva and the presence or absence of cerebral microbleeds in 51 subjects, and disclosed that the occurrence of cerebral microbleeds was higher in the group having cnm-positive Streptococcus mutans.

[0004] Furthermore, Non-Patent Document 3 discloses that inflammatory bowel disease is exacerbated when cnm-positive Streptococcus mutans enters the bloodstream.

[0005] Furthermore, Non-Patent Documents 3 and 4 disclose that when a strain of Streptococcus mutans having cnm protein and PA protein on its surface was administered intravenously to mice fed a high-fat diet, the mice exhibited symptoms of non-alcoholic steatohepatitis (NASH). In recent years, liver damage has been observed even in non-alcoholic individuals due to factors such as excessive nutrient intake, and this condition is referred to as non-alcoholic fatty liver disease (NAFLD). Among NAFLDs, non-alcoholic steatohepatitis (NASH), in which inflammatory changes and fibrosis progress along with liver steatosis, is considered a problem because it can progress to cirrhosis and even liver cancer, making early detection essential.

[0006] Thus, Streptococcus mutans, particularly those possessing cnm or PA proteins on their cell surface, are associated with cerebral microhemorrhages and the resulting strokes, dementia, inflammatory bowel disease, and NASH (non-alcoholic steatohepatitis). Therefore, by examining whether or not these bacteria are present, it is possible to predict the onset of these diseases and prevent them early.

[0007] Furthermore, periodontal disease is caused by the proliferation of causative bacteria such as Porphyromonas gingivalis, Tannerella forsythia, Treponema denticola, Prevotella intermedia, Fusobacterium nucleatum, and Aggregatibacter actinomycetemcomitans in dental plaque. Inflammation occurs to eliminate these bacteria, and the destruction of periodontal tissue progresses.

[0008] It is known that the bacteria that cause periodontal disease, either themselves or through the endotoxins they produce, are involved in the onset and progression of systemic diseases. For example, it is known that worsening periodontal disease increases the risk of angina pectoris, myocardial infarction, and cerebral infarction due to arteriosclerosis. In addition, some periodontal disease-causing bacteria can enter the lungs through the bronchi via aspiration, causing aspiration pneumonia. Furthermore, gingipain, a proteolytic enzyme produced by Porphyromonas gingivalis, has been suggested to potentially contribute to the worsening of Alzheimer's disease. Endotoxins produced by periodontal disease-causing bacteria are known to promote the production of the inflammatory cytokine TNFα, which in turn inhibits insulin and worsens diabetes. Additionally, Fusobacterium nucleatum is known to cause colorectal cancer and oral cancer.

[0009] Porphyromonas gingivalis is the most severe causative bacterium of periodontal disease. It is believed that Porphyromonas gingivalis uses fimbriae on its surface to aggregate cells, increasing its adhesiveness and invasiveness, and causing alveolar bone resorption. The pathogenicity of Porphyromonas gingivalis differs depending on the genotype of the fimA gene, which codes for fimbriae proteins. Experiments using mouse models and clinical trials are revealing that type II is strongly associated with the severity of periodontal disease, while type IV is strongly associated with systemic diseases. Therefore, by checking for the presence of periodontal disease-causing bacteria such as Porphyromonas gingivalis, it is possible to predict the onset of these diseases and prevent them early.

[0010] In addition to the above, another disease caused by bacteria normally present in the oral cavity is actinomycosis, which is caused by the obligate anaerobic bacterium Actinomyces israelii. Actinomyces israelii is found in tooth enamel, gums, tonsils, as well as the mucous membranes of the vagina and intestines. When this bacterium migrates throughout the body and settles in damaged tissue, abscesses form, causing symptoms such as pain and fever. Therefore, by examining the presence or absence of Actinomyces israeri in the oral cavity, it is possible to predict the onset of actinomycosis and prevent it early.

[0011] Furthermore, the oral cavity is home not only to bacteria but also to fungi. For example, aerobic fungi of the Candida genus, such as Candida albicans, Candida parapsilosis, and Candida glabrata, cause oral candidiasis, which presents with symptoms such as pain in the oral mucosa and taste disorders. They can also spread throughout the body, causing skin and mucosal lesions and fungal infections. Therefore, by checking for the presence or absence of Candida fungi in the oral cavity, it is possible to predict the onset of candidiasis and prevent it early.

[0012] Since bacteria involved in oral diseases, including those that cause dental caries and periodontal disease, as well as systemic diseases, are all present in dental plaque and saliva, it would be convenient to be able to simultaneously detect multiple types of bacteria using these oral samples. In particular, since caries-causing bacteria and periodontal disease-causing bacteria are either facultative anaerobes or obligate anaerobes, methods have been proposed to detect anaerobic bacteria collectively. For example, Patent Document 1 shows that if a culture medium inoculated with a sample is cultured in an oxygen-free environment containing approximately 10-12% carbon dioxide, many types of representative anaerobic bacteria will proliferate. However, this method requires an anaerobic chamber because it involves adjusting the atmosphere, and is therefore not convenient. Furthermore, it cannot selectively grow the desired anaerobic bacteria. [Prior art documents] [Patent Documents]

[0013] [Patent Document 1] Japanese Patent Publication No. 4-117300 [Overview of the Initiative] [Problems that the invention aims to solve]

[0014] The present invention aims to provide a simple culture method that can simultaneously grow multiple types of bacteria and fungi (hereinafter abbreviated as "bacteria") selected from a liquid sample, a simple detection method that can simultaneously detect multiple types of bacteria in a liquid sample, and a solid culture medium suitable for growing multiple types of bacteria. [Means for solving the problem]

[0015] The inventors conducted extensive research to solve the above problems and obtained the following findings. (1) By culturing a liquid sample, such as saliva, together with a solid culture medium covering it, the surface of the solid culture medium becomes moderately anaerobic, allowing anaerobic bacteria (facultative anaerobic bacteria and obligate anaerobic bacteria) in the liquid sample to grow efficiently. In addition, in areas where the layer of liquid sample covering the solid culture medium is thin, aerobic bacteria can also grow. (2) By using two or more solid culture media that selectively grow two or more target species of bacteria, it is possible to selectively grow two or more target species of bacteria. (3) By using the cultured liquid sample as a template sample and performing nucleic acid amplification to amplify a specific target sequence portion on the nucleic acid of the target bacterium, it is possible to determine whether or not the bacterium was present in the liquid sample.

[0016] The present invention was completed based on the above findings and provides the following [1] to [9]. [1] A method for culturing two or more types of bacteria, comprising placing a liquid sample that may contain bacteria and fungi, and two or more solid culture media for growing the bacteria and fungi, in a single container, and culturing the solid culture media with the liquid sample covering them. [2] The method according to [1], wherein at least one of the two or more types of bacteria is an anaerobic bacterium. [3] The method according to [1] or [2], wherein the two or more solid media are a mixture of the two or more solid media, two or more solid media molded separately, or two or more solid media combined or linked together. [4] The method according to any one of [1] to [3], wherein the solid culture medium is formed into granules. [5] A method for detecting two or more types of bacteria, comprising the steps of: placing a liquid sample that may contain bacteria and fungi selected from among bacteria and fungi, and two or more solid culture media for growing bacteria and fungi selected from among bacteria and fungi, into a single container, and culturing the solid culture media with the liquid sample covering them; and performing nucleic acid amplification using the cultured liquid sample as a sample containing a template, to amplify the target sequence portion of the nucleic acid of the bacteria and fungi selected from among the target bacteria. [6] The method according to [5], wherein at least one of the two or more types of bacteria is an anaerobic bacterium. 〔7〕 The method according to 〔5〕 or 〔6〕, wherein two or more solid media are a mixture of two or more solid media, separately formed two or more solid media, or two or more solid media united or connected together. 〔8〕 The method according to any one of 〔5〕 to 〔7〕, wherein the solid medium is formed into a granular shape. 〔9〕 A solid medium obtained by mixing two or more solid media for growing bacteria selected from bacteria and fungi.

Advantages of the Invention

[0017] When culturing anaerobic bacteria, conventionally, culture vessels such as petri dishes and microtubes were sealed in an airtight container together with an oxygen scavenger for culturing, or a large-scale apparatus such as an anaerobic chamber was used for culturing. Also, even for facultative anaerobic bacteria, bacteria present in the oral cavity grow more easily under anaerobic conditions than under aerobic conditions, so they were cultured by such methods. In this regard, in the method of the present invention, by covering the solid medium with a liquid sample, the surface of the solid medium and its vicinity become anaerobic conditions suitable for the growth of anaerobic bacteria. Therefore, if anaerobic bacteria are present in the liquid sample, they can be grown. These conditions can grow both facultative anaerobic bacteria and obligate anaerobic bacteria. Therefore, anaerobic bacteria can be grown simply and efficiently without using an oxygen scavenger or special containers / devices. Also, it can be carried out at a very low cost.

[0018] Also, in the method of the present invention, aerobic bacteria can also be grown in a thin portion of the liquid sample layer covering the solid medium. Therefore, the target anaerobic bacteria and aerobic bacteria can be grown together in one culture.

[0019] Further, in the method of the present invention, before subjecting to a nucleic acid amplification reaction, it is not necessary to grow bacteria by inoculating a liquid sample onto a solid medium or a liquid medium, and the cultured liquid sample can be directly subjected to nucleic acid amplification as it is, which saves time and effort. Furthermore, the present invention allows for the detection of the target base sequence by subsequent nucleic acid amplification, without the need to extract nucleic acids from bacterial cells grown in a liquid sample. In this respect, it is also a time-saving method. Due to these features, the present invention allows for the determination of the presence or absence of a target bacterium in a short time, as little as 12 to 13 hours, after collecting a liquid sample. Therefore, the present invention is suitable for mass screenings and hospital screenings that handle a large number of test samples.

[0020] Furthermore, while anaerobic bacteria cultures typically use oxygen absorbers or anaerobic chambers, these methods cannot seal the containers, posing a risk of contamination. However, the method of the present invention allows for container sealing, thus suppressing contamination. Thus, the method of the present invention allows for culturing with the lid of the culture vessel closed. For example, a patient can put their saliva into a microtube containing a solid culture medium and mail it to a testing laboratory with the lid closed, making it suitable for mail-in testing.

[0021] According to the method of the present invention, multiple specific species of bacteria with different growth conditions can be cultured or detected simultaneously. Microorganisms change their environment to suit their own growth during their development. For example, Streptococcus mutans makes the environment acidic by breaking down sugars to produce lactic acid. Streptococcus mutans thrives in an acidic environment of pH 5, which suppresses the growth of other microorganisms that are not suited to acidic environments. For example, Porphyromonas gingivalis cannot grow even at a slightly acidic pH of 6, so it is thought that the growth of Streptococcus mutans suppresses the growth of Porphyromonas gingivalis. In fact, it is known that patients with advanced periodontitis have fewer Streptococcus mutans in their saliva, and patients with dental caries have fewer Porphyromonas gingivalis in their saliva, which also indicates that when one bacterium proliferates, it creates an environment where other bacteria cannot easily proliferate. ("Association between periodontitis and caries," Journal of the Japanese Society of Periodontology 50(suppl-spring):132-132, 2008) Thus, different types of bacteria have different pH ranges in which they can grow, and the growth of one type of bacteria suppresses the growth of other types of bacteria. For this reason, normally, two or more types of bacteria intended for detection are not grown in the same culture medium. However, surprisingly, according to the method of the present invention, two or more types of bacteria can be grown in the same liquid sample to a degree that allows for detection by nucleic acid amplification reaction. Although not limited to this, it is presumed that one reason for this is that in the method of the present invention, multiple culture medium components are mixed in the liquid sample, and the growth rate of each bacterium is appropriately adjusted.

[0022] A suitable application of the present invention is the simultaneous detection of caries-causing bacteria and periodontal disease-causing bacteria from oral cavity samples. However, unlike plaque, the present invention can detect caries-causing bacteria and periodontal disease-causing bacteria by subsequent nucleic acid amplification even when using saliva, which has a low bacterial density, as the test sample. As mentioned above, the present invention allows for the simple and rapid processing of a large number of test samples, making it easy to incorporate into hospital examinations and mass screenings. This enables the prediction and early prevention of systemic diseases caused by caries-causing bacteria, such as cerebral microhemorrhage and the resulting stroke, dementia, inflammatory bowel disease, NASH and the resulting cirrhosis and liver cancer, as well as systemic diseases caused by periodontal disease-causing bacteria, such as angina pectoris, myocardial infarction, cerebral infarction, aspiration pneumonia, Alzheimer's disease, and diabetes, in a large number of subjects, leading to a reduction in medical costs. [Brief explanation of the drawing]

[0023] [Figure 1] This figure shows the preparation steps for MSB-TSBYE hybrid agar medium. [Figure 2] This figure shows that Streptococcus sobrinus, Streptococcus mutans, and Porphyromonas gingivalis could be detected using two types of granular solid culture media. [Figure 3] This figure shows that Streptococcus sobrinus and Porphyromonas gingivalis could be detected using granular hybrid solid media. [Figure 4] This figure shows that Streptococcus sobrinus, Streptococcus mutans, and Porphyromonas gingivalis could be detected using a granular mixed solid culture medium. [Figure 5] This figure shows that Streptococcus sobrinus, Streptococcus mutans, and Porphyromonas gingivalis could be detected using freeze-dried granular mixed solid culture media. [Figure 6] This figure shows that there is no difference in the detection efficiency of anaerobic bacteria when using two types of granular solid media, a hybrid granular solid media, or a mixed solid media. [Figure 7] This figure shows that three types of anaerobic bacteria were detected using three types of granular solid culture media. [Figure 8] This figure shows that Streptococcus sobrinus and Candida albicans could be detected using two types of granular solid culture media. [Modes for carrying out the invention]

[0024] The present invention will be described in detail below. (1) Method for culturing two or more types of bacteria The present invention provides a method for culturing two or more types of microorganisms, in which a liquid sample potentially containing bacteria and fungi, and two or more solid culture media for growing the bacteria and fungi are placed in a single container, and the solid culture media are covered with the liquid sample while culturing.

[0025] sample The test sample can be in liquid form. In this invention, "liquid form" refers to a state in which the sample has enough fluidity to spread over a solid culture medium, and viscous samples are also included in the definition of a liquid sample. Examples of such liquid samples include biological samples such as saliva, blood, urine, dental plaque suspensions, and fecal suspensions, as well as environmental water samples such as river water, lake water, seawater, wastewater (sewage), and drinking water. Food samples in solution or suspension form, or food samples in which food is dissolved or suspended in water or aqueous solutions, are also included.

[0026] Suitable targets for the method of the present invention include anaerobic bacteria such as caries-causing bacteria like Streptococcus mutans and Streptococcus sobrinus, periodontal disease-causing bacteria such as Porphyromonas gingivalis, Tannerella forsythia, Treponema denticola, Prevotella intermedia, Fusobacterium nucleatum, and Aggregatibacter actinomycetemcomitans, and actinomycete-causing bacteria such as Actinomyces islaeri. Furthermore, aerobic bacteria include Candida species, such as Candida albicans, Candida parapsis, and Candida glabrata, which are causative agents of candidiasis. To detect bacteria present in the oral cavity, saliva and dental plaque are used as samples. Since dental plaque is a mass of bacteria, if bacteria are present, the bacterial density is very high. Therefore, it is easy to increase the number of bacteria through culture, and the amplified nucleic acids are easy to detect. However, since it is usually difficult for the subject to collect dental plaque themselves, it is desirable to use saliva to easily perform oral bacteria testing. However, since the bacterial density in saliva is low, conventional detection methods required relatively long incubation times. In this respect, the present invention allows for the detection of oral bacteria using saliva through short-term culture and nucleic acid amplification. Therefore, saliva is a suitable sample for the present invention.

[0027] Furthermore, suitable targets for the method of the present invention include bacteria that cause food poisoning. Examples of bacteria that cause food poisoning include facultative anaerobic bacteria such as Salmonella spp., Vibrio parahaemolyticus, Escherichia coli (enterohemorrhagic E. coli O157, diarrheagenic E. coli, etc.), Bacillus cereus, Vibrio cholerae, Staphylococcus aureus, and Listeria monocytogenes; and obligate anaerobic bacteria such as Clostridium botulinum and Clostridium perfringens. Examples of samples used to detect bacteria that cause food poisoning include environmental water samples, food samples, and biological samples.

[0028] Furthermore, the method of the present invention can also be suitably used for detecting useful bacteria. For example, facultative anaerobic bacteria such as Lactobacillus spp., Lactococcus spp., and Streptococcus spp.; and obligate anaerobic bacteria such as Bifidobacterium spp. (Bifidobacteria) are bacteria used in the production of fermented products, and the presence or absence of these in a food sample can be confirmed using the method of the present invention. This makes it possible to check the quality of food and to confirm whether or not there is any food fraud.

[0029] Solid culture medium A solid culture medium is a culture medium solidified using a gelling agent such as agar or gelatin, and it is acceptable as long as it contains the components necessary for bacterial growth. By adding a component to a solid culture medium that specifically resistant the target bacteria, it is possible to selectively grow the target bacteria. Alternatively, by adding a component to a solid culture medium that specifically promotes the growth of the target bacteria, it is possible to selectively grow the target bacteria.

[0030] For example, bacitracin, a drug to which Streptococcus mutans and Streptococcus sobrinus show high resistance, can be used. The bacitracin concentration in the solid medium should be around 0.05 to 0.5 units / mL, preferably 0.1 to 0.3 units / mL, and more preferably 0.2 units / mL. Adding tellurite in addition to bacitracin improves the selectivity for the growth of Streptococcus mutans and Streptococcus sobrinus. Furthermore, if the solid culture medium contains a relatively high concentration of sucrose, it becomes difficult for contaminating bacteria to grow, but Streptococcus mutans and Streptococcus sobrinus can proliferate. Therefore, it is preferable that the solid culture medium contains, for example, 5 to 40% by weight of sucrose, more preferably 10 to 30% by weight, and more preferably 15 to 20% by weight.

[0031] In the present invention, the component that can selectively grow the target bacteria is not limited to one that completely prevents the growth of bacteria other than the target bacteria, but may also cause other bacteria to grow to an extent that does not affect the results of the method of the present invention.

[0032] Examples of solid media that can selectively grow the caries-causing bacteria Streptococcus mutans and Streptococcus sobrinus include MSB solid medium and TYCSB (Trypticase-yeast-cysteine-sucrose-bacitracin) solid medium. As a solid culture medium that can selectively promote the growth of periodontal disease-causing bacteria such as Porphyromonas gingivalis, Prevotella intermedia, Fusobacterium nucleatum, and Aggregatibacter actinomycetemcomitans, one example is TSBYE liquid medium solidified with a gelling agent. TSBYE liquid medium is TSB (trypticase soy broth) liquid medium with added yeast extract. Adding hemin and menadione to TSBYE solid medium improves the selectivity of Porphyromonas gingivalis growth. One example of a solid medium that can selectively grow Porphyromonas gingivalis, Prevotella intermedia, Fusobacterium nucleatum, and Agregatibacter actinomycetemcomitans is GAM solid medium supplemented with hemin and menadione. One example of a solid culture medium that can selectively promote the growth of Tannerella forsythia, a bacterium that causes periodontal disease, is a medium prepared by adding N-acetylmuramic acid (NAM) and cysteine ​​to TSBYE solid medium. This is because Tannerella forsythia requires NAM as a growth factor. Furthermore, it is preferable to add hemin and menadione as well. Furthermore, examples of solid media that can selectively grow Tannerella forsythia include GAM solid medium with added NAM and cysteine, and GAM solid medium with added hemin and menadione. PGTFSM medium (CDC blood agar medium supplemented with kanamycin 250 mg / L, fosfomycin 300 mg / L, polymyxin 50 mg / L, and mupirocin 2 mg / L; Journal of the Japanese Society of Oral Examination, Vol. 12, No. 1: 22-30, 2020) is a solid culture medium that can selectively grow the periodontal disease-causing bacteria Porphyromonas gingivalis and Tannerella forsythia. Examples of solid culture media that can selectively grow obligate anaerobic bacteria of the genus Bifidobacterium (bifidobacteria) and facultative anaerobic bacteria of the genus Lactobacillus include TOS propionic acid solid medium. TOS propionic acid solid medium contains galactooligosaccharides that selectively promote the growth of Bifidobacterium and Lactobacillus bacteria. Examples of solid media that can selectively grow Lactobacillus bacteria include Logosa agar and MRS agar. Examples of solid culture media that can selectively grow Bacteroides bacteria include Bacteroides solid medium, and among these, bile esculin solid medium is a solid culture medium that can selectively grow Bacteroides fragilis. Examples of solid culture media that can selectively grow Fusobacterium bacteria include modified FM solid media. Examples of solid culture media that can selectively grow aerobic Candida fungi include XM-Candida agar (Nissui Pharmaceutical Co., Ltd.), Candida GE agar (Nissui Pharmaceutical Co., Ltd.), and BD BBL CHROMagar Candida II agar (Becton Dickinson Japan).

[0033] Generally, solid culture media containing 1.5 w / v% agar are used, and the solid culture media used in the present invention should also be formulated with a gelling agent to achieve a similar degree of hardness. Examples of gelling agents include agar and gelatin. The gelling agent concentration is preferably 0.2 w / v% or higher, more preferably 0.5 w / v% or higher, and even more preferably 1 w / v% or higher. It is also preferably 20 w / v% or lower, more preferably 10 w / v% or lower, and even more preferably 5 w / v% or lower. If the gelling agent is agar, it can also be 3 w / v% or lower, or 2 w / v% or lower. Within the above range, the solid culture medium will be less likely to crumble during distribution, storage, and use. Furthermore, if the gelling agent concentration is too high, the culture medium components will hardly dissolve into the liquid sample, making it difficult for bacteria to grow near the surface of the solid culture medium. However, within the above range, bacteria can grow near the surface of the solid culture medium. Solid culture media can be prepared by heating the culture medium to a liquid state, pouring it into a culture vessel, and then cooling and solidifying it, as is commonly done.

[0034] Increasing the total component concentration of the solid culture medium above the manufacturer's specified concentration will promote bacterial growth in the sample, thereby improving the sensitivity of bacterial detection. The total component concentration of the solid culture medium can be 1 to 10 times, 1 to 5 times, 1 to 3 times, or 1 to 2 times the manufacturer's specified concentration.

[0035] Alternatively, a separately formed granular solid culture medium can be placed in the culture vessel. Granulation increases the specific surface area of ​​the solid culture medium, thereby increasing the surface area in contact with the liquid sample and improving the efficiency of bacterial growth. The granular solid culture medium is preferably heavier than the liquid sample, which makes it easier to sink into the liquid sample. The shape of the grains is not particularly limited and can be spherical, polyhedron, elongated sphere, small plate-like, rectangular prism, cube, rod-like, or irregular. To increase the specific surface area, shapes with strong undulations and irregularities, such as konpeito (Japanese sugar candy), shapes with fine pores or grooves on the surface, or shapes with fine cavities extending from the surface to the interior can also be used. The size of the granular solid culture medium varies depending on the capacity of the culture vessel, but it is preferable that the longest diameter is 0.5 mm or more, more preferably 1.5 mm or more, more preferably 2 mm or more, and 50 mm or less, more preferably 10 mm or less, and more preferably 3 mm or less. In particular, 2.5 mm is preferred. It is preferable to use a large number of granular solid culture media of a size generally referred to as granular in the culture vessel.

[0036] Granular solid culture media can be molded by methods such as: heating the culture medium to a liquid state, cooling and solidifying it into a flat plate shape, and then cutting it out; injecting it into molds such as spheres, polyhedra, elongated spheres, small flat plates, or cubes and then cooling and solidifying it; extruding the heated culture medium to a liquid state into cold water to solidify it, and then cutting it as needed; or injecting the heated culture medium into cold water. Furthermore, after molding, holes, grooves, and fine cavities extending from the surface to the interior can be created using needles, lasers, or water jets.

[0037] Granular solid culture media can be stored frozen or freeze-dried, and when used, they can be directly added to liquid samples in their frozen or freeze-dried state. Freeze-dried products can be stored at room temperature, but storage at -80 to 4°C, particularly -25 to 4°C, is preferable. The storage period can be 1 day to 3 years, more specifically 1 day to 1 year, or more specifically 1 day to 6 months. Frozen solid culture media can also be returned to room temperature before use, and freeze-dried solid culture media can be returned to a moist state with sterile water before use, but they can also be added directly to liquid samples as is. The ability to freeze or freeze-dry solid culture media is a significant advantage, as it allows testing laboratories to prepare and store large quantities of the media. Furthermore, granular solid culture media can be sealed in containers such as film or bottles, sterilized without heat using UV or ozone, and stored at room temperature or refrigerated. Granular solid culture media may also be individually packaged or packaged in multiples (e.g., single-use portions).

[0038] The shape of the culture vessel is not particularly limited and can include dish-shaped containers, containers with a single recess such as a cylindrical bag-shaped container, containers with multiple dish-shaped or cylindrical bag-shaped recesses, and sets of multiple cylindrical bag-shaped containers. For example, general-purpose items such as microtubes, multi-well plates, and petri dishes can be used. In this invention, a liquid sample and two or more types of solid media are placed in a single container for cultivation, but in this case, "a single container" refers to a single recess. For example, in a multi-well plate, a liquid sample and two or more types of solid media are placed in each well for cultivation.

[0039] The method of the present invention uses two or more solid culture media for growing bacteria. Three or more, four or more, five or more, or six or more may be used. There is no particular upper limit, but approximately ten types can be used. The two or more solid culture media are media with different compositions that selectively grow multiple different types of bacteria. "Selectively growing" does not mean that no other bacteria are allowed to grow at all; other bacteria may grow as long as the target bacteria can be grown to a level detectable by nucleic acid amplification. Whether a solid culture medium is prepared by heating a culture medium to make it liquid, pouring it into a culture vessel, and then cooling it to solidify, or by placing granular solid culture medium into a culture vessel, two or more types of solid culture media may be used separately (without mixing) or mixed together.

[0040] To prevent two or more solid media from mixing, two or more separately molded solid media (usually granular solid media) can be placed in the culture vessel, or a solid media formed by combining or linking two or more solid media (hybrid type or integrally molded solid media) can be placed in the culture vessel. A hybrid type granular solid media can be manufactured, for example, by hollowing out a plate-shaped solid media formed in two or more layers. Alternatively, when forming a solid media within a culture vessel by pouring a heated, liquefied medium into the culture vessel and allowing it to cool, two or more solid media can be formed by dividing them in the direction of the vessel's surface.

[0041] "Using a mixture of two or more solid media" means using a medium that is solidified using a gelling agent, by mixing a component that selectively promotes the growth of one type of bacteria with a component that selectively promotes the growth of another type of bacteria. For example, mixing MSB solid medium and TSBYE liquid medium, each prepared at twice the normal concentration, in a 1:1 ratio constitutes mixing two or more solid media.

[0042] The present invention provides a solid culture medium comprising a mixture of two or more solid culture media for growing bacteria and fungi selected from among bacteria and fungi. This solid culture medium may be in granular form or in the form of a plate formed in the wells of a petri dish or multi-well plate. Granular solid media have a significantly larger specific surface area than plate-type solid media, and because they can be used in small quantities in culture containers of various capacities, they can be used to grow bacteria on the surface of a small culture container along with a small amount of liquid sample containing bacteria. Furthermore, because components that promote bacterial growth diffuse from the solid media into the liquid sample, bacteria can grow not only on the surface of the solid media but also in the liquid sample. Subsequently, the bacteria that have grown on the surface of the granular solid media or in the liquid sample can be collected and used in the next step. One method for collecting bacteria that have grown on the surface of the granular solid media is to use the entire granular solid media with the bacteria attached in the next step. If the next step is nucleic acid amplification, the granular solid media with the bacteria attached can be added directly to the reaction solution.

[0043] culture For cultivation, place the liquid sample into the culture vessel and cover the surface of the solid culture medium with the liquid sample. It is sufficient to cover the entire surface of the solid culture medium.

[0044] When using a solid culture medium prepared by pouring a liquid culture medium into a culture vessel and letting it solidify, the thickness of the liquid sample covering the surface of the solid culture medium is preferably 1 mm or more, more preferably 2 mm or more, more preferably 3 mm or more, and more preferably 4 mm or more, which allows the surface of the solid culture medium to be sufficiently anaerobic. There is no particular upper limit to the thickness of the liquid sample covering the surface of the solid culture medium, but it should be around 50 mm. Furthermore, in the case of a slant culture medium prepared in a culture vessel, or if the surface of the medium is uneven, the upper part of the slant culture medium or the convex parts of the medium surface may extend above the surface of the liquid sample. In this case as well, by adjusting the amount of liquid sample used, the surface of the solid medium covered with the liquid sample can be made anaerobic enough for anaerobic bacteria to grow. In this case, 10% or more of the solid medium surface, more than 25%, more than 50%, more than 80%, more than 90%, and more than 95% can be covered with the liquid sample. If the liquid sample covering the solid culture medium has both a thickness of 1 mm or more and a thickness of less than 1 mm, both anaerobic and aerobic bacteria can be grown. In other words, in the method of the present invention, the liquid sample covering the surface of the solid culture medium can have a portion with a thickness of 1 mm or more, thereby enabling the growth of at least anaerobic bacteria. After culturing begins, water in the liquid sample may be absorbed or evaporate into the solid culture medium, potentially creating areas where the liquid sample does not appear to cover the solid culture medium visually. However, even in this case, the liquid sample is still considered to cover the solid culture medium in the present invention.

[0045] When granular solid culture media are placed in a culture vessel, it is preferable to cover the top of the granules with liquid sample to a height of 1 mm or more, preferably 2 mm or more, preferably 3 mm or more, and preferably 4 mm or more. In other words, even when using granular solid culture media, it is preferable to cover the surface of the solid culture media with liquid sample to a thickness of 1 mm or more, preferably 2 mm or more, preferably 3 mm or more, and preferably 4 mm or more. This allows the surface of the solid culture media to be sufficiently anaerobic. There is no particular upper limit to the height from the top of the granules to the surface of the liquid culture media, but it should be around 50 mm. However, if there is too much solid culture media compared to the liquid sample, a portion of the granular solid culture media may be exposed above the liquid sample. In this case as well, by adjusting the container capacity and the amount of liquid sample used, the surface of the solid culture media covered with liquid sample can be made anaerobic enough for anaerobic bacteria to grow. The order in which the liquid sample and granular solid culture medium are added to the culture vessel does not matter. Similarly, when granular solid culture media are placed in a culture vessel, if the liquid sample covering the solid culture media has both a thickness of 1 mm or more and a thickness of less than 1 mm, both anaerobic and aerobic bacteria can be grown. In other words, in the method of the present invention, the liquid sample covering the surface of the solid culture media can have a portion with a thickness of 1 mm or more, thereby enabling the growth of at least anaerobic bacteria.

[0046] The incubation time varies depending on the sample and type of bacteria, but it can be 12 hours or more, particularly 16 hours or more, and particularly 20 hours or more. It can also be 96 hours or less, particularly 48 hours or less, particularly 30 hours or less, and particularly 24 hours or less. Within this range, if bacteria are present in the liquid sample when the cultured sample is used directly as the sample solution for nucleic acid amplification, their presence can be confirmed. If the optimal culture time differs for multiple bacteria being detected, the culture of some bacteria can be stopped by removing a portion of the culture medium midway through the process, while the remaining culture medium continues to be cultured. Alternatively, the same liquid sample can be cultured in two or more culture vessels using two or more of the same solid media, allowing the culture time to be adjusted to suit each of the bacteria being detected.

[0047] The culture temperature should be the optimal temperature for the bacteria to be detected, such as 25-45°C, 30-45°C, 35-40°C, and especially 36-38°C.

[0048] (2) Method for detecting two or more types of bacteria The present invention provides a method for detecting two or more types of bacteria, comprising the steps of: placing a liquid sample that may contain bacteria and fungi selected from among bacteria and fungi, and two or more solid culture media for growing the selected bacteria and fungi in a single container, and culturing the solid culture media with the liquid sample covering them; and performing nucleic acid amplification using the cultured liquid sample as a sample containing a template to amplify the target sequence portion of the nucleic acid of the target bacteria. The method for culturing a liquid sample that may contain bacteria is as described above. If the optimal culture time differs among the multiple bacteria being detected, a portion of the culture medium can be sampled midway through the process and subjected to the nucleic acid amplification step, while the remaining culture medium is continued to be cultured and subjected to the nucleic acid amplification step after the appropriate culture time.

[0049] Nucleic acid extraction In the method of the present invention, nucleic acids (DNA or RNA) may be extracted from the recovered bacteria, but bacteria can also be detected by subjecting the liquid sample after culture directly to a nucleic acid amplification method without extraction. In this invention, nucleic acid extraction refers to a process that increases the permeability of cells to remove at least a portion of nucleic acids from the cell. Such processes are well known to those skilled in the art and include, for example, heat treatment (heating to about 65-100°C), surfactant treatment (nonionic surfactants such as TritonX-100, ionic surfactants such as SDS and guanidine salts, etc.), calcium chloride treatment, enzyme treatment (cell wall lysis enzymes such as lysozyme, etc.), pulse voltage application, osmotic shock application, and electron beam irradiation.

[0050] nucleic acid amplification Methods for amplifying DNA include methods involving thermal denaturation of double-stranded DNA, such as PCR (Polymerase chain reaction) (Science 239, 487-491 (1988)), LCR (Ligase chain reaction) (Proc. Natl. Acad. Sci. USA, 88:189-193 (1991)); LAMP (Loop-mediated isothermal amplification) (International Publication No. 00 / 28082), SDA (Strand displacement amplification) (US Patent No. 5455166), ICAN (Isothermal and chimeric primer-initiated amplification of nucleic acids) (International Publication No. 00 / 56877), SMAP (Smart amplification process) (Seibutsu Butsuri Kagaku, 52(4):183-187, 2008), and 3SR (Self-stranded sequence Examples include isothermal amplification methods that do not involve the thermal denaturation step of double-stranded DNA, such as replication (Am. Biotechnol. Lab. 8, 14-25 (1990)).

[0051] Furthermore, RNA can be amplified instead of DNA. When amplifying RNA, since RNA is single-stranded from the beginning, there is no need for thermal denaturation, and isothermal amplification can be performed. In addition, RNA has a large copy number within cells, resulting in high detection sensitivity, and its high diversity between species leads to higher accuracy in detecting the target bacteria. Examples of nucleic acid amplification methods that amplify RNA include TMA (Transcription Mediated Amplification) (In Ferre, F.(ed), Gene quantification, Boston, Birkhauser p189-201(1998)), NASBA (Nucleic Acid Sequence-Based Amplification) (In Ferre, F.(ed), Gene quantification, Boston, Birkhauser p169-188(1998)), and TRC (Transcription-reverse transcription concerted reaction) (J.Clin.Microbiol, .42(9):4284-4292,2004).

[0052] Additionally, methods that amplify DNA using RNA as a template, such as RT (reverse transcription)-PCR and RT-LAMP, can also be used.

[0053] Among these methods, isothermal amplification is preferable because it is simple and inexpensive, as it does not require temperature changes. The LAMP method is particularly simple because it can amplify DNA in a single step using only one type of synthetic enzyme. Furthermore, the LAMP method has high amplification efficiency, allowing for detectable amplification even with small amounts of target DNA, and its extremely high specificity minimizes false detection of related bacterial species. In isothermal amplification, the amplification temperature varies depending on the type of DNA polymerase, but it is generally around 50-70°C, with 60-70°C being preferred and 60-67°C being more preferred.

[0054] In the present invention, two or more types of bacteria are grown, and then the specific target sequence of the nucleic acid of the bacterium to be detected is amplified. If multiple types of bacteria are to be detected, nucleic acid amplification to detect the specific base sequence of each bacterium can usually be performed separately. Furthermore, if the goal is to determine whether or not any of two or more types of bacteria are present in a liquid sample, i.e., if it is not necessary to distinguish between two or more types of bacteria, then a method such as multiplex PCR or multiplex LAMP can be used, where specific primers for the specific base sequences of each bacterium are mixed in a single tube.

[0055] The target sequence to be amplified using nucleic acid amplification methods can be any specific base sequence portion on the nucleic acid of the target bacterium. The target sequence can be the entire region or part of any gene, or it can be amplified across sequences spanning multiple genes. Typically, a region of 100-300 bases is sufficient for amplification. When detecting Streptococcus mutans, the glycosyltransferase gene (GenBank accession number: M1736) exhibits relatively large nucleotide sequence differences among species of the Streptococcus genus. Therefore, targeting a sequence portion containing all or part of the glycosyltransferase gene allows for accurate detection. Furthermore, targeting a sequence portion containing all or part of the gene encoding the cnm protein (GenBank accession number: AB465300.1) allows for the detection of cnm-positive Streptococcus mutans, and targeting a sequence portion containing all or part of the gene encoding the PA protein (GenBank accession number: KM219946) allows for the detection of PA-positive Streptococcus mutans.

[0056] In particular, targeting the sequence portion of the transglucosidase gene of Streptococcus mutans, which consists of the base sequence shown in Sequence ID No. 1, allows for even more specific nucleic acid amplification, thus reducing the likelihood of false detection of other bacterial species and failure to detect Streptococcus mutans. Furthermore, by targeting the sequence portion of the cnm protein gene of Streptococcus mutans, which consists of the base sequence shown in Sequence ID No. 2, even more specific nucleic acid amplification can be performed, meaning that false detections of other bacterial species or cnm-negative Streptococcus mutans, as well as failure to detect cnm-positive Streptococcus mutans, will be reduced.

[0057] When detecting Streptococcus sobrinus, targeting the nucleic acid sequence of Streptococcus sobrinus described in "Rapid Detection of the Cariogenic pathogens Streptococcus Mutans and Streptococcus Sobrinus Using Loop-Mediated Isothermal Amplification. S Nagashima, A Yoshida, T Ansai, H Watari, T Notomi, K Maki, T Takehara, Oral Microbiol Immunol. 2007 Dec;22(6):361-8." allows for the specific detection of Streptococcus sobrinus. When detecting Porphyromonas gingivalis, targeting the 16S ribosomal RNA gene (GenBank Accession No. MN044790) of Porphyromonas gingivalis strain 2381, which consists of the nucleotide sequence shown in Sequence ID No. 3, allows for the specific detection of Porphyromonas gingivalis. When detecting Lactobacillus gasseri, targeting a partial sequence of the Lactobacillus gasseri 16S ribosomal RNA gene (GenBank Accession No. AF182721), which consists of the nucleotide sequence shown in Sequence ID No. 4, allows for specific detection of Lactobacillus gasseri. When detecting Candida albicans, targeting the nucleic acid sequence of Candida albicans described in "Detection of Fungi from an Indoor Environment using Loop-mediated Isothermal Amplification (LAMP) Method. Nakayama T, Yamazaki T, Yo A, Tone K, Mahdi Alshahni M, Fujisaki R, Makimura K., Biocontrol Sci. 2017;22(2):97-104." allows for the specific detection of Candida albicans.

[0058] Determination of the presence or absence of bacteria Amplification of the target sequence region of the desired bacterium can be performed by carrying out the amplification reaction in the presence of an intercalator that binds to double-stranded nucleic acids, such as ethidium bromide (EtBr) or SYBR GREEN, and confirming the fluorescence under a UV lamp. Furthermore, chelating agents such as calcein bind to manganese ions and are quenched before amplification, but as the nucleic acid amplification reaction proceeds, the generated pyrophosphate ions steal the manganese ions, causing fluorescence. The fluorescence is further enhanced by binding to magnesium ions in the reaction solution, so the presence or absence of amplification can be confirmed by observing the fluorescence under a UV lamp. Furthermore, the DNA polymerase-mediated extension reaction produces pyrophosphate as a byproduct, which reacts with magnesium ions in the reaction solution to form magnesium pyrophosphate. In methods that produce a large amount of amplification product, such as the LAMP method, magnesium pyrophosphate precipitates in the reaction solution, causing turbidity. By visually confirming this turbidity, the amplification of the target sequence can be confirmed. Furthermore, since the reaction solution becomes acidic when the amplification reaction by LAMP occurs, adding a pH indicator to the reaction solution will cause a color change, which can be used as an indicator to confirm the amplification of the target sequence.

[0059] In the culture method and detection method of the present invention, "bacteria" (aerobic bacteria, anaerobic bacteria) refers to bacteria (aerobic bacteria, anaerobic bacteria) and fungi (aerobic fungi, anaerobic fungi). The bacterial growth method of the present invention is suitable for the growth of two or more anaerobic bacteria (particularly two or more anaerobic bacteria), and for the growth of anaerobic bacteria (particularly anaerobic bacteria) and aerobic bacteria. Furthermore, the bacterial detection method of the present invention is suitable for the detection of two or more anaerobic bacteria (particularly two or more anaerobic bacteria), and for the detection of anaerobic bacteria (particularly anaerobic bacteria) and aerobic bacteria. That is, in the culture method and detection method of the present invention, it is preferable that at least one of the two or more bacteria is an anaerobic bacterium. [Examples]

[0060] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these examples. (1) Preparation of solid culture medium MSB agar MSB agar is a culture medium used to grow Streptococcus mutans and Streptococcus sobrinus. 9g of Mitis salivarius agar (BD) and 15g of sucrose (Wako) were mixed, made up to 100mL with distilled water, and autoclaved (121°C, 15 minutes). After autoclaving, the mixture was poured into a petri dish and left to stand until the medium solidified. The upper end (the end with the larger opening) of a Pasteur pipette was pressed against the MSB agar medium in a Petri dish, and a cylindrical portion of the MSB agar medium was cut out. The cylindrical portion of MSB agar medium was approximately 5 mm in diameter, 3 mm thick, and weighed approximately 75 mg.

[0061] TSBYE agar medium Mix 20 mL of Triptycase soy broth solution (Merck), 0.3 g of Bactagar (BD), and 0.2 g of yeast extract (BD), and autoclave (121°C, 15 minutes). After autoclaving, to the medium, which had cooled enough not to solidify, add 100 μL of 25 mg / mL hemin (Merck) and 20 μL of 5 mg / mL menation (Merck). After stirring, pour into a petri dish and allow to stand until the medium solidifies. The upper end (the end with the larger diameter) of the Pasteur pipette was pressed against the TSBYE agar medium in the petri dish, and a cylindrical portion of the TSBYE agar medium was cut out. The cylindrical MSB agar medium had a diameter of approximately 5 mm, a thickness of approximately 3 mm, and a weight of approximately 75 mg.

[0062] MSB-TSBYE Hybrid Agar Medium 20 mL of Triptycase soy broth solution (Merck), 0.3 g of Bactagar (BD), and 0.2 g of yeast extract (BD) were mixed and autoclaved (121°C, 15 minutes). After autoclaving, 100 μL of 25 mg / mL hemin (Merck) and 20 μL of 5 mg / mL menation (Merck) were added to the medium, which had cooled to a non-solid state. After stirring, the mixture was poured into a petri dish and allowed to stand until the medium solidified (Figure 1, left). Next, 1.8 g of Mitis salivarius agar (BD) and 3 g of sucrose (Wako) were mixed, the mixture was made up to 20 mL with distilled water, and the mixture was autoclaved (121°C, 15 minutes). After autoclaving, the mixture was poured into a petri dish containing TSBYE agar medium that had been solidified earlier, and left to stand until the medium solidified (Figure 1, center and right).

[0063] The upper end (the end with the larger diameter) of a Pasteur pipette was pressed against the MSB agar medium in a Petri dish, and a cylindrical portion of the MSB agar medium was cut out. The cylindrical MSB-TSBYE hybrid agar medium had a diameter of approximately 5 mm, a thickness of approximately 5 mm, and a weight of approximately 100 mg.

[0064] MSB-TSBYE mixed agar medium 1.8 g of Mitis salivarius agar (BD), 3 g of sucrose (Wako), 20 mL of Tripticase soy broth solution (Merck), and 0.2 g of yeast extract (BD) were mixed and autoclaved (121°C, 15 minutes). After autoclaving, 100 μL of 25 mg / mL hemin (Merck) and 20 μL of 5 mg / mL menation (Merck) were added to the medium, which had cooled enough not to solidify. After stirring, the mixture was poured into a petri dish and left to stand until the medium solidified. The upper end (the end with the larger diameter) of a Pasteur pipette was pressed against the MSB agar medium in a Petri dish, and a cylindrical portion of the MSB agar medium was cut out. The cylindrical MSB-TSBYE mixed agar medium had a diameter of approximately 5 mm, a thickness of approximately 5 mm, and a weight of approximately 100 mg.

[0065] TOS propionate agar TOS propionate agar is a culture medium used to grow lactic acid bacteria. 12.5 g of TOS propionate agar (Yakult Pharmaceutical Co., Ltd.) was diluted to 100 mL with distilled water and autoclaved (121°C, 15 minutes). After autoclaving, the mixture was poured into a petri dish and allowed to stand until the medium solidified. The upper end (the end with the larger diameter) of a Pasteur pipette was pressed against the TOS propionate agar medium in a petri dish, and a cylindrical portion of the TOS propionate agar medium was cut out. The cylindrical portion of TOS propionate agar medium was approximately 5 mm in diameter, 3 mm thick, and weighed approximately 75 mg.

[0066] Candida GE agar Candida GE agar is a culture medium used to grow Candida fungi. 6.2 g of Candida GE agar (Nissui Pharmaceutical Co., Ltd.) was diluted to 100 mL with distilled water and dissolved by repeatedly heating in a microwave oven. After dissolution, the mixture was poured into a petri dish and left to stand until the medium solidified. The upper end (the end with the larger diameter) of a Pasteur pipette was pressed against the Candida GE agar medium in a petri dish, and a cylindrical portion of the Candida GE agar medium was cut out. The cylindrical portion of Candida GE agar medium was approximately 5 mm in diameter, 3 mm thick, and weighed approximately 75 mg.

[0067] (2) Detection by LAMP reaction LAMP reaction After culturing, the contents of the microtube were mixed by tapping. 1 μL of saliva was taken from the microtube after culturing and used as a sample solution containing the template. DNA was amplified using the LAMP method reagent (Loopamp DNA amplification reagent, Eiken Chemical Co., Ltd.). The amounts of each component contained in 25 μL of LAMP reaction solution are as follows: Primers: 1600 nM FIP, 1600 nM BIP, 800 nM LF, 800 nM LB, 400 nM F3, 400 nM R3 Saliva (template DNA): 1 μL Loopamp Fluorescence / Visual Detection Reagent (Eiken Chemical Co., Ltd.) 1 μL 0.8M betaine (Use only when amplifying Streptococcus mutans, Lactobacillus gasseri, or Candida albicans) 8% polyethylene glycol (for use only when amplifying Streptococcus sobrinus or Porphyromonas gingivalis) The primer set used is as follows: Primer set for amplifying the CNM protein gene of Streptococcus mutans. F3: CCAGTAATACTGTCATTGAAAGT (Sequence ID 5) B3: CGCTTTGAGTTTGATGAGC (Sequence ID 6) FIP: AACCATTAAGCTGGAGGTTCAGGAACTGCTTTGTCTTGCGT (Sequence ID 7) BIP: CGTATAACCTGTTCCTCTGACTGTAATATTAAAGCAGGCGACAC (Sequence ID 8) LF: GCAAGTATGTTGGTGATTTG (Sequence ID 9) LB: CCTGAATTCTGCCAGTTAAC (Sequence ID 10) A primer set for amplifying nucleic acid-specific sequences found in Streptococcus sobrinus. F3: GGGAGGCTCAAAGGAACT (Sequence ID 11) B3: GATGATTTGCTCATCATAGTCTG (Sequence ID 12) FIP: GGTAGCAAAGGTTAAATAGCCCATCGCTATTTTTACTGCTACAGC (Sequence ID 13) BIP: TGCTTCTCTCTCTTATCAGTATCGGTCTTTATGACCAGTTGTCGA (Sequence ID 14) LF: TCCTACGGCAATGCCAATG (Sequence ID 15) LB: TTGGTCAACACACTAGAACCCG (Sequence ID 16) The above primers were prepared by referring to the following paper. Rapid Detection of the Cariogenic pathogens Streptococcus Mutans and Streptococcus Sobrinus Using Loop-Mediated Isothermal Amplification S Nagashima, A Yoshida, T Ansai, H Watari, T Notomi, K Maki, T Takehara Oral Microbiol Immunol. 2007 Dec;22(6):361-8. Primer set for amplifying nucleic acid-specific sequences found in Porphyromonas gingivalis F3: GCAGCTTGCCATACTGCG (Sequence ID 17) B3: ACATGTTCCTCCGCTTGTG (Sequence ID 18) FIP: TGCGTGGACTACCAGGGTATCTACTGACACTGAAGCACGAAG (Sequence ID 19) BIP: TACCGTCAAGCTTCCACAGCGACTTTGAGTTTCACCGTTGCC (Sequence ID 20) Primer set for amplifying nucleic acid-specific sequences found in Lactobacillus gasseri FIP: gcagctacttagatgtttctcaagagctgttaaggctgt (Sequence ID 21) BIP: gagcccaaaccagctggcttgctatcgcttcaagtgctttc(Sequence ID 22) F3: gaacccaataccgggaggt (Sequence code 23) B3: gcttatctttccagataatt (Sequence ID 24) LF: gttcactgcgtcttccttc (Sequence ID 25) LB: gttggggtagtaggactgca (SEQ ID NO: 26) Primer set for amplifying nucleic acid-specific sequences found in Candida albicans. FIP: CCAATATTTAGCTTTAGATGGAATTGAGTCGAGTTGTTTGGGA (Sequence ID 27) BIP: AGACCGATAGCGAACAAGTACTACTTTTTCACTCTCTTTTCAAAGT (Sequence ID 28) F3: GAGGGTGAGAATCCCGT (Sequence No. 29) B3: CTTCCCTTTCAACAATTTCAC (Sequence ID 30) The above primers were prepared by referring to the following paper. Detection of Fungi from an Indoor Environment using Loop-mediated Isothermal Amplification (LAMP) Method. Nakayama T, Yamazaki T, Yo A, Tone K, Mahdi Alshahni M, Fujisaki R, Makimura K. Biocontrol Sci. 2017;22(2):97-104. After preparing the above LAMP reaction solution, the reaction was carried out at 64°C for 90 minutes (Streptococcus mutans), at 65°C for 60 minutes (Streptococcus sobrinus, Lactobacillus gasseri), at 65°C for 90 minutes (Porphyromonas gingivalis), or at 60°C for 120 minutes (Candida albicans).

[0068] detection After the LAMP reaction, the reaction tube was placed on a transilluminator and irradiated with ultraviolet light (wavelength 312 nm) to detect fluorescence. The detected fluorescence was photographed using a print graph AE-6914.

[0069] (3) Detection of bacteria in liquid samples Example 1 (Detection of anaerobic bacteria using two types of granular solid culture media) A cylindrical agar medium was placed in a 2 mL microcentrifuge tube (Greiner), and 200 μL of saliva sample was added to it using a pipette (Gilson). Five microcentrifuge tubes were prepared, and 200 μL each of saliva samples A-E collected from five subjects was placed in each. One cylindrical agar medium and one TSBYE agar medium were placed in a 1:1 weight ratio in the microcentrifuge tubes, with the amount used being enough to completely cover the cylindrical agar medium with saliva. The saliva level was 1 mm above the top of the cylindrical MSB agar medium. These were incubated at 37°C for 48 hours. Because Streptococcus sobrinus and Streptococcus mutans grow relatively quickly, saliva samples were taken after 24 hours of incubation. Because Porphyromonas gingivalis grows relatively slowly, saliva samples were taken after 48 hours of incubation. The LAMP reaction was performed using primers to amplify each bacterium as described above. Figure 2 shows the results of observing each reaction tube under a UV lamp. In Figure 2, "Sobrinus" refers to "Streptococcus sobrinus," "Mutans" refers to "Streptococcus mutans," and "Porphyromonas gingivalis" refers to "Porphyromonas gingivalis." A negative control was used, which followed the same procedure except that phosphate buffer (PBS) was used instead of saliva. The same abbreviations are used in subsequent figures. As a result, all five individuals tested positive for Streptococcus sobrinus (Figure 2, top panel A-E), and Streptococcus mutans was detected in one individual (Figure 2, middle panel D). Additionally, Porphyromonas gingivalis was detected in one individual (Figure 2, bottom panel E).

[0070] Streptococcus sobrinus is a bacterium carried by many Japanese people, so its detection in all individuals is not inconsistent. Furthermore, for Streptococcus mutans, a primer targeting the cmn gene was used, and it is estimated that around 30% of Japanese people possess this gene. Therefore, its detection in only one person is not inconsistent. Additionally, the presence of Porphyromonas gingivalis, which is estimated to be present in about one in five Japanese people, is also not inconsistent. These results suggest that facultative anaerobic bacteria, Streptococcus mutans and Streptococcus sobrinus, can be grown on MSB agar, while obligate anaerobic bacteria, Porphyromonas gingivalis, can be grown on TSBYE agar. From the above, it was found that by placing two different solid culture media in the same culture vessel, bacteria specific to each medium can be grown simultaneously from saliva to a level detectable by nucleic acid amplification reactions, and that each anaerobic bacterium can be detected even when the cultured saliva is used directly in the amplification reaction without DNA extraction.

[0071] Example 2 (Detection of anaerobic bacteria using granular hybrid solid culture medium) Saliva was cultured in the same manner as in Example 1, except that cylindrical MSB-TSBYE hybrid agar was used instead of cylindrical MSB agar and cylindrical TSBYE agar. The saliva samples were saliva samples A to E collected from five subjects different from those in Example 1. The LAMP reaction was performed as described above, using primers for detecting Streptococcus sobrinus and primers for detecting Porphyromonas gingivalis. Figure 3 shows the results of observing each reaction tube under an ultraviolet lamp after the LAMP reaction. The results showed that all five participants tested positive for Streptococcus sobrinus (Figure 3, upper panel A-E). Additionally, Porphyromonas gingivalis was detected in one participant (Figure 3, lower panel D). These results suggest that both Streptococcus sobrinus, a facultative anaerobic bacterium, and Porphyromonas gingivalis, an obligate anaerobic bacterium, could be grown simultaneously to a level detectable by nucleic acid amplification on the MSB-TSBYE hybrid agar medium. From the above, it was found that by using a solid medium formed by linking two different solid media, bacteria specific to each medium can be grown from saliva, and that the cultured saliva can be detected even when used directly in the amplification reaction without DNA extraction.

[0072] Example 3 (Detection of anaerobic bacteria using granular mixed solid culture medium) Saliva was cultured in the same manner as in Example 1, except that cylindrical MSB-TSBYE mixed agar was used instead of cylindrical MSB agar and cylindrical TSBYE agar. The saliva samples were saliva samples A to E collected from five subjects different from those in Examples 1 and 2. Streptococcus sobrinus and Streptococcus mutans were detected using saliva samples A and B from two subjects, and Porphyromonas gingivalis was detected using saliva samples A to E from five subjects. The LAMP reaction was performed as described above, using primers to amplify each bacterium. Figure 4 shows the results of observing each reaction tube under an ultraviolet lamp. The results showed that both subjects tested positive for Streptococcus sobrinus (top panel, Figure 4), and Streptococcus mutans was detected in one subject (A, middle panel, Figure 4). Additionally, Porphyromonas gingivalis was detected in one subject (B, bottom panel, Figure 4). These results suggest that, even when using MSB-TSBYE mixed agar medium, facultative anaerobic bacteria such as Streptococcus sobrinus and Streptococcus mutans, and the obligate anaerobic bacterium Porphyromonas gingivalis, could be grown simultaneously to a level detectable by nucleic acid amplification. From the above, it was found that by using a solid culture medium prepared by mixing two different solid culture media, bacteria specific to each medium can be grown from saliva, and each bacterium can be detected even when the cultured saliva is used directly in a nucleic acid amplification reaction without DNA extraction.

[0073] Example 4 (Detection of anaerobic bacteria using freeze-dried granular solid culture medium) We investigated whether anaerobic bacteria under two different culture conditions could be detected using freeze-dried cylindrical solid culture media. Specifically, cylindrical MSB-TSBYE mixed agar medium in a microcentrifuge tube was frozen at -82°C for 1 hour, and then freeze-dried under reduced pressure for 22 hours using a freeze-dryer (EYELA FDU-1200, Tokyo Rikakikai). We then investigated whether Streptococcus sobrinus, Streptococcus mutans, and Porphyromonas gingivalis could be detected when saliva was cultured in a microcentrifuge tube containing this freeze-dried cylindrical MSB-TSBYE mixed agar medium.

[0074] Saliva was cultured in the same manner as in Example 1, except that lyophilized cylindrical MSB-TSBYE mixed agar was used instead of cylindrical MSB agar and cylindrical TSBYE agar. The saliva samples were saliva samples A to C collected from three subjects different from those in Examples 1 to 3. The LAMP reaction was performed as described above, using primers to amplify each bacterium. Figure 5 shows the results of observing each reaction tube under an ultraviolet lamp. The results showed that all three subjects tested positive for Streptococcus sobrinus (top panel of Figure 5), and Streptococcus mutans was detected in one subject (C in the middle panel of Figure 5). Additionally, Porphyromonas gingivalis was detected in one subject (A and C in the bottom panel of Figure 5). These results show that even when freeze-dried solid culture media are used, culture-specific bacteria can be grown from saliva, and that the cultured saliva can be directly used in nucleic acid amplification reactions without DNA extraction, allowing for detection. Since detection was also possible on freeze-dried cylindrical MSB-TSBYE agar, it was demonstrated that granular solid media can be stored for a long period of time in a freeze-dried state.

[0075] Example 5 (Comparison of growth ability of three types of solid culture media) Examples 1 to 4 demonstrated that multiple oral bacteria could be detected in the presence of MSB agar and TSBYE agar, MSB-TSBYE hybrid agar, MSB-TSBYE mixed agar, and lyophilized MSB-TSBYE mixed agar, respectively. Next, we investigated whether there were differences in the detection efficiency of anaerobic bacteria among the three granular media: the presence of MSB agar and TSBYE agar, MSB-TSBYE hybrid agar, and MSB-TSBYE mixed agar. Specifically, 200 μL of saliva was added to each of the three 2 mL microcentrifuge tubes. Then, three types of granular culture media were added to each of the three microcentrifuge tubes and cultured together with the saliva for 24 hours. At this time, a microcentrifuge tube without granular culture media was also cultured as a negative control. Saliva samples 1-4 were collected from four subjects. The culture conditions were the same as in Example 1. The LAMP reaction was performed using primers that amplify Streptococcus sobrinus, as described above. Figure 6 shows the results of observing each reaction tube under a UV lamp. The results showed that Streptococcus sobrinus could be detected with similar sensitivity using any of the granular media. In other words, it was demonstrated that all forms of media had similar growth efficiency. These results suggest that using a mixed agar medium, which is easy to prepare and use, can facilitate the detection of multiple samples.

[0076] Example 6 (Detection of three types of anaerobic bacteria using three types of solid culture media) In Example 1, instead of cylindrical MSB agar and TSBYE agar, cylindrical MSB agar, TSBYE agar, and TOS propionate agar were added to a single 2 mL microcentrifuge tube and cultured with saliva. Saliva samples T and N were collected from two subjects. Equal amounts of each cylindrical medium were used, with the total volume being enough to cover the cells with saliva. The amount of saliva was 400 μL instead of 200 μL. The target organisms were Streptococcus sobrinus, Porphyromonas gingivalis, and Lactobacillus gasseri (a type of lactic acid bacteria), and the culture time for all was 38 hours. The LAMP reaction was performed using primers to amplify each bacterium as described above. Figure 7 shows the results of observing each reaction tube under a UV lamp. In Figure 7, "Lactic acid bacteria" refers to "Lactobacillus gasseri". As a negative control, the LAMP amplification reaction was performed using phosphate buffer (PBS) instead of saliva. As a result, both subjects tested positive for Streptococcus sobrinus and Porphyromonas gingivalis (Figure 7, top and middle panels), while Lactobacillus gasseri was detected only in sample T (Figure 7, bottom panel). From these results, it was found that by culturing three different types of granular solid media in a single culture vessel, bacteria specific to each medium can be grown. Considering Examples 1-3, it is thought that similar results can be obtained with three types of hybrid solid media and three types of mixed solid media.

[0077] Example 7 (Detection of aerobic and anaerobic bacteria) Cylindrical MSB-TSBYE mixed agar medium and cylindrical Candida GE agar medium were added to one 2 mL microcentrifuge tube in a 1:1 weight ratio and cultured with saliva. The amount of saliva was adjusted between 150 and 200 μL so that the saliva covering the surface of the cylindrical Candida GE agar medium was less than 1 mm. Streptococcus sobrinus was sampled 20 hours after incubation and detected by LAMP reaction. Candida albicans was cultured at 37°C for 90 hours and then detected by LAMP reaction. Figure 8 shows the results of observing each reaction tube under a UV lamp. In Figure 8, "Candida" refers to "Candida albicans." The three samples are represented as A, B, and C, and phosphate buffer (labeled PBS in Figure 8) was used as a negative control instead of saliva. These results showed that Streptococcus sobrinus was positive in both B and C (Figure 8, top panel), while Candida albicans could only be detected in B (Figure 8, bottom panel). From these results, it was found that this method allows for the simultaneous growth and detection of both aerobic and anaerobic bacteria. [Industrial applicability]

[0078] The present invention's method for detecting two or more types of bacteria is suitable for processing a large number of test samples because it can easily and quickly detect multiple specific types of bacteria. For example, it is suitable for simultaneous detection of caries-causing bacteria and periodontal disease-causing bacteria using saliva as a sample in hospital examinations, mass screenings, and mail-in tests.

Claims

1. A method for culturing two or more types of bacteria, comprising placing a liquid sample that may contain bacteria and fungi selected from among them, and two or more solid culture media for growing the bacteria and fungi selected from among them, in a single container, and culturing the solid culture media with at least 10% of the surface covered by the liquid sample to a thickness of 1 mm or more.

2. The method according to claim 1, wherein at least one of the two or more types of bacteria is an anaerobic bacterium.

3. The method according to claim 1 or 2, wherein the solid culture medium is formed into granules.

4. A method for detecting two or more types of bacteria, comprising the steps of: placing a liquid sample that may contain bacteria and fungi selected from among bacteria and fungi, and two or more solid culture media for growing the bacteria and fungi selected from among bacteria and fungi, in a single container, and culturing the solid culture media with at least 10% of the surface covered by the liquid sample to a thickness of 1 mm or more; and performing nucleic acid amplification using the cultured liquid sample as a sample containing a template, to amplify the target sequence portion of the nucleic acid of the bacteria and fungi selected from among the target bacteria.

5. The method according to claim 4, wherein at least one of the two or more types of bacteria is an anaerobic bacterium.

6. The method according to claim 4 or 5, wherein the solid culture medium is formed into granules.

Images