Sirtuin 6 activator

Abstract

The purpose of the present invention is to provide a novel agent capable of activating sirtuin 6 (SIRT 6).　A SIRT 6 activator comprising urolithin as an active ingredient.

Description

Technical Field

[0001] The present disclosure relates to a sirtuin 6 activator, and more specifically, to a sirtuin 6 activator used in pharmaceuticals, quasi-drugs, cosmetics, or foods.

Background Art

[0002] In research on aging and lifespan control, the involvement of Sir2, a sirtuin having NAD-dependent deacetylase activity, has been attracting attention. SIRT1 to 7 are known as mammalian homologs of yeast Sir2. Among them, SIRT6 is localized in the cell nucleus (e.g., in human keratinocytes and skin fibroblasts), and it has been reported that the SIRT6 protein translated from the SIRT6 gene is useful as an early indicator marker of aging (Non-Patent Document 1).

[0003] For the purpose of enhancing the action effect of SIRT6, several SIRT6 activators have been reported. Specifically, carnosine and / or anserine (Patent Document 1), and a peptide consisting of the amino acid sequence of GAGVSAE-NH2 (Patent Document 2) have been reported as active ingredients of SIRT6 activators.

[0004] On the other hand, urolithins such as urolithin A and urolithin C are known as metabolites of ellagic acid derived from ellagitannins contained in pomegranates, raspberries, blackberries, cloudberries, strawberries, walnuts, etc. Further, as the action effects of urolithin A, antioxidant action (Non-Patent Document 2), anti-inflammatory action (Non-Patent Document 3), antiglycation action (Non-Patent Document 4), etc. are known.

[0005] Also, regarding SIRT1, it is known to be involved in the control of enhanced lipolysis, suppression of axonal degeneration, insulin secretion from β cells, gluconeogenesis in the liver, etc., and it is known that urolithin A, punicalin, punicalagin, caffeic acid phenethyl ester, etc. enhance the expression level of SIRT1 (Patent Document 3).

Prior Art Documents

[0006] [Patent Document 1] Japanese Patent Publication No. 2015-097508 [Patent Document 2] International Publication No. 2016 / 094073 [Patent Document 3] International Publication No. 2014 / 042261 [Non-patent literature]

[0007] [Non-Patent Document 1] “Circulating SIRT6 Expression, Effect on Aging Quality (Sirt6)”, [online], accessed January 30, 2020, US National Institutes of Health, Internet<URL:https: / / clinicaltrials.gov / ct2 / show / record / NCT01567176> [Non-Patent Document 2] Biosci. Biotechnol. Biochem. 76, 395-399 (2012) [Non-Patent Document 3] J. Agric. Food Chem. 60, 8866-8876 (2012) [Non-Patent Document 4] Mol. Nutr. Food Res. 55, S35-S43 (2011) [Overview of the Initiative] [Problems that the invention aims to solve]

[0008] Considering that, for example, carnosine produces β-alanine during digestion, which can cause numbness, anserine has a distinctive unpleasant odor (fishy smell) derived from its raw materials, and certain peptides cannot be taken orally, it is desirable to have other new options as active ingredients that can activate SIRT6.

[0009] Therefore, the purpose of this disclosure is to provide a novel agent that can activate SIRT6. [Means for solving the problem]

[0010] The inventors investigated the SIRT6 gene activity enhancing effects of uroritin A, punicalin, pricalazine, and cafestol, which are known to enhance SIRT1 gene activity. They found that punicalin, pricalazine, and cafestol showed little to no effect in enhancing SIRT6 gene activity, while uroritin had the effect of enhancing sirtuin 6 gene activity. This disclosure was completed by further investigation based on this finding.

[0011] In other words, this disclosure provides inventions in the following embodiments. Item 1. A sirtuin 6 activator containing urolithin as the active ingredient. Item 2. The sirtuin 6 activator according to Item 1, wherein the urolithin is urolithin A. Item 3. A sirtuin 6 activator as described in Item 1 or 2, used as a treatment or preventative agent for hair loss. Item 4. A sirtuin 6 activator as described in Item 1 or 2, used as an inhibitor of hair follicle stem cell aging. Item 5. A sirtuin 6 activator as described in Item 1 or 2, used as a treatment or preventative agent for gray hair. Item 6. A treatment or preventive agent for hair loss containing urolithin as an active ingredient. Item 7. A treatment or preventative agent for gray hair containing urolithin as an active ingredient. Item 8. Use of urolithin for the production of a sirtuin 6 activator. Item 9. A method for treating or preventing hair loss, comprising the step of administering a therapeutically or prophylactically effective amount of urolithin to a subject having a disease or condition in which hair loss occurs or a subject at risk of hair loss due to genetic or physical factors. Item 10. A method for treating or preventing gray hair, comprising the step of administering a therapeutically or prophylactically effective amount of urolithin to a subject having gray hair or a subject at risk of graying due to genetic or physical factors.

Advantages of the Invention

[0012] According to the present disclosure, a new agent capable of activating SIRT6 is provided.

Brief Description of the Drawings

[0013] [Figure 1] Shows the effect on the promoter activity of SIRT6 when urolithin A is added to cells transfected with the promoter of the sirtuin 6 gene.

Modes for Carrying Out the Invention

[0014] The present disclosure is a sirtuin 6 activator containing urolithin as an active ingredient. Hereinafter, embodiments of the sirtuin 6 activator of the present disclosure will be described in detail.

[0015] Active ingredients The sirtuin 6 activator of the present disclosure contains urolithin as an active ingredient. Urolithin is a known component having antioxidant, anti-inflammatory, antiglycation, and other effects.

[0016] The urolithin used in the present disclosure is not particularly limited. In one embodiment of the present disclosure, examples of urolithin include substances represented by the following general formula (1).

[0017]

Chemical formula

[0018] In formula (1), R 1 ~R 6 Each of these represents a hydrogen atom, a hydroxyl group, or a methoxy group, which may be the same or different.

[0019] A preferred example of uroritin is R in formula (1). 1 ~R 6 However, these include the groups shown in Table 1 below: uroritin A, uroritin B, uroritin C, uroritin D, uroritin E, uroritin M3, uroritin M4, uroritin M5, uroritin M6, uroritin M7, and isouroritin A.

[0020] [Table 1]

[0021] These urolithins may be used individually or in combination of two or more.

[0022] Among these uroritins, uroritin A is preferred from the viewpoint of obtaining an even better sirtuin 6 gene activity enhancing effect.

[0023] There are no particular limitations on the method of synthesizing urolithin, and examples include chemical synthesis and microbiological synthesis.

[0024] One example of a method for chemically synthesizing uroritin is to use 2-bromo-5-methoxybenzoic acid as a starting material, convert it to 2-bromo-5-hydroxybenzoic acid by demethylation, and then react it with resorcinol to obtain uroritin A.

[0025] An example of a method for the microbiological synthesis of uroritin is to produce uroritin from ellagic acid by fermentation in a culture medium containing ellagic acid using uroritin-producing microorganisms, and then collect the produced uroritins to obtain uroritin. The uroritin-producing microorganisms are not particularly limited, but are preferably from the genus Bacteroides and Gordonibacter, more preferably from Bacteroides uniformis, Gordonibacter urolithinfaciens, and Gordonibacter pamelaeae, and even more preferably from Bacteroides uniformis strain HGB5B146 (NITE BP-02193), Gordonibacter urolithinfaciens strain DSM27213, and Gordonibacter pamelaeae strain DSM19378.

[0026] In the sirtuin 6 activator of this disclosure, the urolithin content is not particularly limited, as long as it is an amount that allows for the administration or ingestion of an effective amount to enhance sirtuin 6 gene activity in vivo. In one embodiment of the sirtuin 6 activator of this disclosure, the urolithin content can be appropriately adjusted depending on the use, dosage form, administration method, etc., and specific examples include 0.01 to 50% by weight, preferably 0.1 to 20% by weight.

[0027] Purpose The sirtuin 6 activators of this disclosure are used for the purpose of activating sirtuin 6 (SIRT6). Activating SIRT6 means enhancing the activity of the SIRT6 gene, not limited to in vivo or in vitro, and more specifically, enhancing the transcription or expression of the SIRT6 gene.

[0028] The presence and extent of SIRT6 activation can be evaluated by constructing a system using the promoter region of the SIRT6 gene (SEQ ID NO: 1).

[0029] The sirtuin 6 activator in one embodiment of the present disclosure can be used to administer urolithin to subjects for whom SIRT6 activation is desirable, in order to treat diseases or conditions associated with decreased or deficient SIRT6 activity (including pathological and non-pathological conditions, the non-pathological conditions including, for example, conditions associated with physical activity and / or exercise in healthy subjects).

[0030] The sirtuin 6 activator in one embodiment of the present disclosure can be used more specifically for applications of treating or preventing hair loss, inhibiting hair follicle stem cell aging, and / or treating or preventing gray hair, based on sirtuin 6 activation. In other words, one embodiment of the present disclosure also provides a hair loss treatment or preventive agent, a hair follicle stem cell aging inhibitor, and a gray hair treatment or preventive agent, all containing urolithin as an active ingredient.

[0031] The specific target population for the treatment or preventive agent for hair loss in one embodiment of this disclosure may be any individual with a disease or condition in which hair loss is currently occurring, or any individual at risk of hair loss due to genetic or physical factors. For example, diseases or conditions in which hair loss is occurring include hair loss other than male pattern baldness (androgenetic alopecia), specifically female pattern baldness, alopecia areata, etc. Risk factors for hair loss include possession of the alopecia areata risk genotype (specifically, the T allele of SNP rs142986308 in the CCHCR1 gene), chemotherapy, vitamin A overdose, malnutrition (e.g., iron deficiency, zinc deficiency, etc.), stress (specifically, physical or mental stress associated with high fever, surgery, illness, weight loss, pregnancy, etc.).

[0032] The specific target population for the hair follicle stem cell aging inhibitor and the treatment or prevention agent for gray hair in one embodiment of this disclosure may be any subject who is currently experiencing hair follicle stem cell aging or gray hair, or any subject who is at risk of hair follicle stem cell aging or graying due to genetic or physical factors. For example, a risk of hair follicle stem cell aging or graying due to genetic factors may include possession of a graying risk genotype (specifically, the T allele of SNP rs12203592 located in intron 4 of the interferon regulatory factor 4 gene (IRF4)). Furthermore, a risk of hair follicle stem cell aging or graying due to physical factors may include poor blood circulation in the scalp (e.g., redness of the scalp) and mental stress.

[0033] In one embodiment of the present disclosure, the sirtuin 6 activator can be administered orally or parenterally (for example, percutaneously, permucosally (e.g., percutaneously, permucosally (e.g., pernasally, perinatally, perinatally), pervascularly (e.g., perarterally or perveally)) to subjects for whom SIRT6 activation is desirable.

[0034] The dosage or intake of the sirtuin 6 activator of this disclosure for a subject for whom SIRT6 activation is desired can be appropriately determined by those skilled in the art, depending on the subject's age, weight, sex, the disease or condition to which it is applied, etc. For example, in one embodiment of this disclosure, the dosage or intake of the sirtuin 6 activator is, for example, 0.1 to 10,000 mg / day, preferably 1 to 100 mg / day, as the active ingredient urolithin, and this daily dosage or intake can be administered or taken in one go or divided into multiple doses (for example, 2 to 3 times).

[0035] Dosage form / form The dosage form of the sirtuin 6 activator in this disclosure is not particularly limited. The dosage form of the sirtuin 6 activator in one embodiment of this disclosure may be solid, semi-solid, or liquid, and can be appropriately determined by those skilled in the art depending on the type of active ingredient, the use of the sirtuin 6 activator, and / or the method of administration.

[0036] The sirtuin 6 activator in one embodiment of this disclosure can be used, for example, as a component of pharmaceuticals, quasi-drugs, cosmetics, or foods. Those skilled in the art can appropriately select other components commonly used in pharmaceuticals, quasi-drugs, cosmetics, and foods. Specific examples of other components include excipients, disintegrants, diluents, lubricants, flavoring agents, colorants, sweeteners, flavoring agents, suspending agents, wetting agents, emulsifiers, dispersants, auxiliary agents, preservatives, buffers, binders, stabilizers, bulking agents, thickeners, pH adjusters, surfactants, coating agents, and nutritional components, all of which are pharmaceutically, food-grade, or cosmetically acceptable. These other components may be used individually or in combination of two or more.

[0037] When the sirtuin 6 activator in one embodiment of this disclosure is used as a component of a pharmaceutical, quasi-drug, cosmetic, or food, the forms of the pharmaceutical, quasi-drug, cosmetic, or food may include tablets, capsules, powders, granules, fine granules, sustained-release preparations, solutions, syrups, jellies, emulsions, etc., if intended for oral administration, and injections, ointments, lotions, emulsions, creams, powders, etc., if intended for parenteral administration. Furthermore, when the sirtuin 6 activator in one embodiment of this disclosure is used as a component of a food, the types of food may include general food and beverages, health functional foods (including foods for specified health uses, nutritional functional foods, supplements, etc.), and foods for sick people.

[0038] Each aspect disclosed herein can be combined with any other features disclosed herein. [Examples]

[0039] The present invention will be described more specifically below with reference to examples, but each configuration and combination thereof in each embodiment is merely an example, and additions, omissions, substitutions, and other modifications can be made as appropriate without departing from the spirit of the present invention. This disclosure is not limited by the embodiments, but is limited only by the scope of the claims.

[0040] [Example 1: Preparation of cells into which the sirtuin 6 gene promoter has been introduced] Using genomic DNA derived from human embryonic fibroblast TIG-1 cells as a template, the human SIRT6 promoter region (-1105 to -1 bp; SEQ ID NO: 1) was amplified by PCR using KOD FX (TOYOBO, Tokyo, Japan). Primers were designed based on reported hSIRT6 promoter nucleotide sequence information, with AseI and NheI restriction enzyme recognition sequences added to the ends; specifically, SIRT6p-AseI (ATTAATACTGCGCCCGGCTCACTCAC: SEQ ID NO: 2) and SIRT6p-NheI (GCTAGCCCTCGACTGCCCCACGGGAA: SEQ ID NO: 3). KOD FX (TOYOBO) was used as the DNA polymerase, and PCR was performed under reaction conditions of 94°C for 2 minutes, 98°C for 10 seconds, and 68°C for 1 minute, for a total of 40 cycles.

[0041] The SIRT6 promoter fragment obtained by PCR was TA-cloned into a pGEM-T Easy Vector (Promega). The base sequence was then confirmed by sequencing. The SIRT6 promoter fragment incorporated into the pGEM-T Easy Vector was excised by restriction enzyme AseI and NheI digestion, and the CMV promoter of EGFP-C3 (Takara Bio Inc.) was inserted into the site removed by AseI and NheI digestion to obtain pSIRT6p-EGFP.

[0042] Transfection was performed using HilyMax from DOJINDO, following its protocol. The day before transfection, Caco-2 cells (human colon cancer-derived cells; obtained from the RIKEN BioResource Center) 6.0 × 10⁶ were transfected. 5Cells were seeded in 5 mL dishes. On the day of transfection, pSIRT6p-EGFP (15 μg) was diluted in 1.5 mL tube to a volume of 300 μL in 10% FBS-containing DMEM medium, and then 70 μL of Hilymax was added and incubated at room temperature for 20 minutes. The entire volume was then added to Caco-2 cells and cultured for 48 hours.

[0043] Based on the fact that pSIRT6p-EGFP is resistant to the drug G418 (Wako Pure Chemical Industries, Ltd.), drug selection was performed by adding drug G418 to transfected cells to a final concentration of 800 μg / mL. The culture medium was replaced with fresh medium every 3 days, and G418 was added at the same concentration each time. This resulted in the acquisition of Caco-2-SIRT6p-EGFP cells.

[0044] [Test Example 2: SIRT6-enhancing effect of urolithin] Using Caco-2-SIRT6p-EGFP cells, we investigated the promoter-enhancing effect of urolithin on the sirtuin 6 gene (SIRT6). Similarly, we examined the promoter-enhancing effects of punicalin, pricalazine, and cafestol, which are known to enhance the sirtuin 1 gene, on the sirtuin 6 gene (SIRT6).

[0045] Caco-2-SIRT6p-EGFP cells 0.6 × 10 4Cells were seeded in a 96-well plate at a concentration of cells / well. The following day, 10 μM of the test component (uroritin A, punicalin, pricalazine, or cafestol) or control (PBS) was added to each well. Two days after addition, the culture medium was aspirated, and then 100 μL of 4% paraformaldehyde was added to each well and allowed to stand at room temperature for 10 minutes. After 10 minutes, 4% paraformaldehyde was aspirated, and 100 μL of Hoechst 33342 solution (Dojindo), diluted 1 / 500 with PBS, was added to each well and allowed to stand at room temperature in the dark for 20 minutes. After that, it was aspirated, and 100 μL of PBS was added to each well, and fluorescence intensity was measured using an IN Cell Analyzer 1000 (GE Healthcare, Amersham Place, UK). Promoter activity was expressed as a relative percentage to the activity of the control.

[0046] The results obtained (the effect of adding the test component to Caco-2-SIRT6p-EGFP cells on SIRT6 promoter activity) are shown in Figure 1. In Figure 1, the vertical axis represents relative SIRT6 promoter activity, with higher values ​​indicating stronger promoter activity. As shown in Figure 1, punicalin, pricalazine, and cafestol, which are known to enhance the sirtuin 1 gene, showed little to no SIRT6 promoter enhancing activity, while urolithin A showed strong SIRT6 promoter enhancing activity. [Sequence Listing Free Text]

[0047] Sequence IDs 2 and 3 are primers.

Claims

1. Sirtuin 6 activators containing urolithin A as the active ingredient (excluding those used as treatments or preventative agents for hair loss, hair follicle stem cell aging inhibitors, and treatments or preventative agents for gray hair).

2. A sirtuin 6 activator containing urolithin A as an active ingredient, which is used as a treatment or preventive agent for hair loss.

3. A sirtuin 6 activator containing urolithin A as an active ingredient, which is used as an inhibitor of hair follicle stem cell aging.

4. A sirtuin 6 activator containing urolithin A as an active ingredient, which is used as a treatment or preventative agent for gray hair.

Images