Recombinant microorganisms, methods for preparing them, and their use in the production of tagatose

Recombinant microorganisms with modified enzymatic activities and gene expression levels address the challenges of high costs and complexity in tagatose production, enabling efficient and cost-effective industrial production using glycerol and glucose substrates.

JP7897843B2Active Publication Date: 2026-07-30TIANJIN YEAHE BIOTECHNOLOGY CO LTD
View PDF 8 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
TIANJIN YEAHE BIOTECHNOLOGY CO LTD
Filing Date
2021-10-18
Publication Date
2026-07-30

AI Technical Summary

Technical Problem

Current methods for producing tagatose face challenges such as high raw material costs, low conversion rates, and complex purification processes, making them unsuitable for industrial application.

Method used

Development of recombinant microorganisms with modified enzymatic activities and gene expression levels, specifically reducing glucose-specific transfer protein activity, enhancing tagatose-6-phosphate epimerase and phosphatase activity, and utilizing glycerol and glucose as substrates to produce tagatose efficiently.

Benefits of technology

The recombinant microorganisms achieve high conversion efficiency, reduced production costs, and simplified purification processes, making tagatose production suitable for industrial use.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007897843000001
    Figure 0007897843000001
  • Figure 0007897843000002
    Figure 0007897843000002
  • Figure 0007897843000003
    Figure 0007897843000003
Patent Text Reader

Abstract

The present invention provides a genetically engineered recombinant microorganism and its use in tagatose production, a method for preparing the recombinant microorganism, a tagatose-producing strain, and a method for producing tagatose. The recombinant microorganism can produce tagatose using glucose or glycerol and glucose as substrates, and has high tagatose production efficiency by conversion, eliminating the need for a multi-enzyme purification process.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present disclosure belongs to the technical fields of biotechnology and genetic engineering, and specifically relates to recombinant microorganisms, methods for preparing recombinant microorganisms and their use in the production of tagatose, as well as tagatose-producing strains and methods for producing tagatose.

Background Art

[0002] Tagatose is a naturally occurring rare ketohexose, an isomer of the aldose galactose, and also an epimer of fructose. Tagatose has a sweetening property similar to sucrose, with about one-third of the calories of sucrose, and is called a low-calorie sweetener. Natural tagatose is mainly contained in dairy products such as yogurt and powdered milk. Tagatose provides a very fresh and pure sweetness and has a taste characteristic similar to fructose. Studies have shown that tagatose has important physiological functions such as low calorie, low glycemic index, anti-caries, antioxidant, prebiotics, improvement of intestinal function, immune regulation, and prodrug, and can be widely applied in fields such as food, beverage, medicine, and health maintenance, and has great economic value. [1] 。

[0003] Currently, the production methods of tagatose mainly include two types: chemical synthesis method and bioconversion method. The chemical synthesis method mainly uses galactose as a raw material, uses an alkali metal salt as a catalyst to isomerize galactose to generate a tagatose-metal hydroxide complex precipitate, and then neutralizes it with an acid to obtain tagatose. The chemical synthesis method has a large energy consumption, many side reactions, and complex products, so the separation and purification process of tagatose is difficult, and chemical pollution is also likely to occur due to the discharge of acids, alkalis, and metal ions.

[0004] Compared to chemical synthesis, bioconversion is the primary method for producing tagatose due to its high conversion efficiency, strong specificity, fewer by-products, and simpler purification steps. Bioconversion primarily uses galactitol or galactose as a raw material, converting the corresponding substrate into tagatose through enzymatic or microbial catalytic action. However, galactitol is expensive and difficult to obtain, making it unsuitable for industrial production. The mainstream method for producing pure tagatose involves using galactose as a raw material and going through steps such as isomerization, desalting, decolorization, separation, concentration, and crystallization. However, galactose cannot be completely converted into tagatose, and the final product is a mixture of galactose and tagatose. This requires a complex separation process to separate the pure tagatose, increasing the difficulty and cost of the process. Furthermore, the high price of galactose contributes to the high cost of tagatose production. [2-4] Therefore, ensuring the conversion efficiency of tagatose while simultaneously reducing the cost and difficulty of the tagatose production process are important challenges that need to be addressed now.

[0005] Patent Document 1 discloses a method for producing tagatose by multi-enzyme catalytic conversion, in which the catalytic enzymes are phosphofructokinase, 6-phosphotagato epimerase, and 6-phosphotagato phosphatase, and can convert fructose to tagatose. However, in order for phosphofructokinase to catalyze the process of converting fructose to fructose 6-phosphate, additional ATP must be added to phosphorylate the fructose substrate. Adding expensive ATP increases the production cost of tagatose, making it not industrially viable.

[0006] Patent Document 2 discloses a hexuronate C4-epimerase mutant having improved hexuronate C4-epimerase conversion activity, which can convert fructose to tagatose. However, the modified hexuronate C4-epimerase mutant still has low activity and low tagatose conversion efficiency, which is a problem as it cannot meet the demand for industrial production.

[0007] Patent Document 3 discloses a tagatose-6-phosphate phosphatase that is useful in a process for producing tagatose by converting substrates such as starch, maltodextrin, and sucrose. However, this tagatose-6-phosphate phosphatase still has low enzymatic activity, which is a problem as it has little practical value in actual industrial production.

[0008] Patent Document 4 discloses a method for preparing tagatose, in which starch or a starch derivative is used as a substrate, and α-glucan phosphatase, phosphoglucomutase, phosphoglucose isomarase, tagatose-6-phosphate epimerase, tagatose-6-phosphate phosphatase, and an inorganic phosphate ion are added to construct a multi-enzyme molecular machine, and a multi-enzyme catalytic reaction is carried out to obtain tagatose. The preparation method in cited document 4 improves the conversion rate of the raw materials and the yield of tagatose, but after synthesizing tagatose, it is necessary to purify the tagatose from a mixture of multiple enzymes, increasing the number of steps in the purification process and making it more difficult. [Prior art documents] [Non-patent literature]

[0009] [Non-Patent Document 1] [1] Oh DK: Tagatose: properties, applications, and biotechnological processes. App. Microbiol. Biotechnol. 2007,76:1-8. [Non-Patent Document 2] [2] Rhimi M, Aghajari N, Juy M, Chouayekh H, Maguin E, Haser R, Bejar S: Rational design of Bacillus stearothermophilus US100l-arabinose isomerase: Potential applications for d-tagatose production. Biochim. 2009,91:650-653. [Non-Patent Document 3] [3] Oh HJ, Kim HJ, Oh DK: Increase in d-tagatose production rate by site-directed mutagenesis of l-arabinose isomerase from Geobacillus thermodenitrificans. Biotechnol. Lett. 2006,28:145-149. [Non-Patent Document 4] [4] Bosshart A, Hee CS, Bechtold M, Schirmer T, Panke S: Directed divergent evolution of a thermostable D-tagatose epimerase towards improved activity for two hexose substrates. ChemBi℃hem 2015,16:592-601. [Patent Documents]

[0010] [Patent Document 1] WO2015016544A1 [Patent Document 2] CN109415715A [Patent Document 3] WO2018004310A1 [Patent Document 4] CN106399427A [Overview of the Initiative] [Problems that the invention aims to solve]

[0011] In light of the technical challenges in the prior art, such as high raw material costs, low conversion rates, the need for multiple enzyme purification steps, and the complexity of the tagatose production process, this disclosure provides a recombinant microorganism that can convert glycerol and glucose as substrates to produce tagatose, and that has advantages such as high conversion efficiency, environmental friendliness, no need for multiple enzyme purification, and low production costs, making it suitable for the industrial production of tagatose. [Means for solving the problem]

[0012] (1) Recombinant microorganisms, Compared to wild-type microorganisms, the recombinant microorganisms described above (a) Reduced or eliminated protein activity of glucose-specific transfer proteins of the phosphotransferase system and / or expression levels of their coding genes, (b) Enhanced enzymatic activity of tagatose-6-phosphate epimerase and / or expression level of its coding gene, (c) Having the characteristic shown in at least one of the improved enzymatic activity of tagatose-6-phosphate phosphatase and / or the expression level of its coding gene.

[0013] (2) The glucose-specific transfer protein is (a1) A polypeptide that contains the amino acid sequence shown in SEQ ID NO:1 or SEQ ID NO:3 and has glucose-specific transfer protein activity. (a2) A polypeptide that substitutes, repeats, deletes or adds one or more amino acids for the amino acid sequence shown in SEQ ID NO:1 or SEQ ID NO:3 and has glucose-specific transfer protein activity. (a3) Selected from the group consisting of any one of the polypeptides encoded by the nucleotide sequences shown in SEQ ID NO:2 or SEQ ID NO:4. Preferably, the tagatose-6-phosphate epimerase is (b1) A polypeptide that contains the amino acid sequence shown in SEQ ID NO:5 and has tagatose-6-phosphate epimerase activity. (b2) A polypeptide that substitutes, repeats, deletes or adds one or more amino acids for the amino acid sequence shown in SEQ ID NO:5 and has tagatose-6-phosphate epimerase activity. (b3) Selected from the group consisting of any one of the polypeptides encoded by the nucleotide sequence shown in SEQ ID NO:6. Preferably, the tagatose-6-phosphate phosphatase is (c1) A polypeptide that contains the amino acid sequence shown in SEQ ID NO:7 or SEQ ID NO:54 and has tagatose-6-phosphate phosphatase activity. (c2) A polypeptide that substitutes, repeats, deletes or adds one or more amino acids for the amino acid sequence shown in SEQ ID NO:7 or SEQ ID NO:54 and has tagatose-6-phosphate phosphatase activity. (c3) The recombinant microorganism according to (1), selected from the group consisting of any one of the polypeptides encoded by the nucleotide sequences shown in SEQ ID NO:8 or SEQ ID NO:55.

[0014] (3) The recombinant microorganism has, compared with the wild-type microorganism, (d) an improved enzyme activity of glucokinase and / or an expression level of its encoding gene, (e) an improved enzyme activity of glucose-6-phosphate isomerase and / or an expression level of its encoding gene, (f) a reduced or eliminated enzyme activity of fructose-6-phosphate kinase and / or an expression level of its encoding gene, (g) a reduced or eliminated enzyme activity of pyruvate kinase and / or an expression level of its encoding gene, (h) a reduced or eliminated enzyme activity of phosphoglucomutase and / or an expression level of its encoding gene, (i) a reduced or eliminated enzyme activity of glucose-6-phosphate dehydrogenase and / or an expression level of its encoding gene, (j) The recombinant microorganism according to (1) or (2), further having a characteristic shown by at least one of a reduced or eliminated enzyme activity of HPr kinase and / or an expression level of its encoding gene.

[0015] (4) The glucokinase is (d1) a polypeptide comprising the amino acid sequence shown in SEQ ID NO:9 or SEQ ID NO:11 and having glucokinase activity, (d2) a polypeptide having glucokinase activity, with one or more amino acids substituted, repeated, deleted or added to the amino acid sequence shown in SEQ ID NO:9 or SEQ ID NO:11, (d3) selected from the group consisting of any one of the polypeptides encoded by the nucleotide sequences shown in SEQ ID NO:10 or SEQ ID NO:12, Preferably, the glucose-6-phosphate isomerase is (e1) A polypeptide comprising the amino acid sequence shown in SEQ ID NO:13 or SEQ ID NO:15 and having glucose-6-phosphate isomerase activity, (e2) A polypeptide having glucose-6-phosphate isomerase activity, obtained by substituting, repeating, deleting, or adding one or more amino acids to the amino acid sequence shown in SEQ ID NO:13 or SEQ ID NO:15. (e3) A recombinant microorganism according to polypeptide (3) selected from the group represented by any one polypeptide encoded by the nucleotide sequence shown in SEQ ID NO:14 or SEQ ID NO:16.

[0016] (5) Recombinant microorganisms described in any one of items (1) to (4) derived from Escherichia coli, Corynebacterium glutamicum, Bacillus subtilis, Lactobacillus, or Saccharomyces cerevisiae.

[0017] (6) A step of performing gene knockout or knockdown on the encoding gene of a glucose-specific transfer protein of the phosphotransferase system in a wild-type microorganism, A method for preparing a recombinant microorganism according to any one of (1) to (5), comprising the steps of introducing a recombinant expression vector expressing tagatose-6-phosphate epimerase and tagatose-6-phosphate phosphatase into the recombinant microorganism, or introducing recombinant expression vectors expressing tagatose-6-phosphate epimerase and tagatose-6-phosphate phosphatase, respectively, into the recombinant microorganism.

[0018] (7) The step of improving the expression level of the glucokinase coding gene in the recombinant microorganism, The steps include improving the expression level of the glucose-6-phosphate isomerase encoding gene within the recombinant microorganism, The steps include knocking out or knocking down the fructose-6-phosphate kinase encoding gene in the recombinant microorganism, The steps include knocking out or knocking down the pyruvate kinase encoding gene within the recombinant microorganism, The steps include knocking out or knocking down the phosphoglucumutase encoding gene in the recombinant microorganism, The steps include knocking out or knocking down the glucose-6-phosphate dehydrogenase encoding gene in the recombinant microorganism, The preparation method according to step (6), further comprising at least one of the steps of knocking out or knocking down the HPr kinase coding gene in the recombinant microorganism.

[0019] (8) Recombinant microorganisms described in any one of items (1) to (5), or (6) or (7) Use of recombinant microorganisms prepared by the method described above in the production of tagatose.

[0020] (9) A tagatose-producing strain, wherein the tagatose-producing strain is a recombinant microorganism described in any one of items (1) to (5), or a recombinant microorganism prepared by the method described in (6) or (7).

[0021] (10) The tagatose-producing strain uses glucose or glucose and glycerol as substrates. Preferably, a tagatose-producing strain as described in (9) derived from Escherichia coli, Corynebacterium glutamicum, Bacillus subtilis, Lactobacillus, or Saccharomyces cerevisiae.

[0022] (11) A method for producing tagatose, comprising the step of carrying out a fermentation reaction using glucose or glucose and glycerol as a substrate and a recombinant microorganism described in any one of (1) to (5), a recombinant microorganism prepared by the method described in (6) or (7), or a tagatose-producing strain described in any one of (9) to (10).

[0023] (12) The method for producing tagatose according to (11), further comprising the step of separating tagatose from the fermentation reaction liquid after the completion of the fermentation reaction. [Effects of the Invention]

[0024] In one embodiment, the present disclosure provides a recombinant microorganism that reduces or eliminates the glucose inhibitory effect on the recombinant microorganism's utilization of glycerol as a substrate by reducing or eliminating the glucose-specific transfer protein activity of the phosphotransferase system, thereby enabling the recombinant microorganism to produce tagatose using glycerol and glucose as substrates. The raw material cost is low and readily available, the conversion efficiency of tagatose is high, it does not require the steps of a multi-enzyme purification process, it reduces production costs, reduces environmental pollution, and has potential for industrial application.

[0025] In one embodiment, the method for preparing recombinant microorganisms according to this disclosure is simple and easy to implement, and allows for obtaining recombinant microorganisms that produce tagatose using glucose and glycerol as substrates.

[0026] In one embodiment, the tagatose-producing strain according to this disclosure uses glycerol and glucose as substrates. Of these, glycerol is used as a carbon source for intracellular metabolism and growth of the strain. As a result, the strain utilizes glucose to synthesize tagatose under conditions suitable for growth, yielding tagatose with improved yield.

[0027] In one embodiment, the method for producing tagatose according to this disclosure involves producing tagatose by fermentation using recombinant microorganisms or tagatose-producing strains, and has the advantages of high raw material conversion efficiency, high tagatose yield, simplified process, and reduced cost, making it suitable for industrial production of tagatose. [Brief explanation of the drawing]

[0028] [Figure 1] This diagram shows a schematic representation of the metabolic process by which recombinant microorganisms produce tagatose using glucose and glycerol as substrates. [Figure 2A] Figure 2 shows the vector maps for pTKSCS, pTKRed, pACYCDuet, and pETDuet, respectively. Figure 2A is the vector map for pTKSCS. [Figure 2B] Figure 2B is a vector map of pTKRed. [Figure 2C] Figure 2C is a vector map of pACYCDuet. [Figure 2D] Figure 2D is a vector map of pETDuet. [Figure 3A] Figure 3 shows the vector maps for pSS and pWB980, respectively. Figure 3A is the vector map for pSS. [Figure 3B] Figure 3B is a vector map of the pWB980. [Figure 4] This shows the results of a high-performance liquid chromatogram analysis of the tagatose-producing recombinant E. coli strain YH6-2, which ferments glycerol and glucose to produce tagatose. [Figure 5] This shows the results of a high-performance liquid chromatogram analysis of the Bacillus subtilis recombinant strain YJ14-1, which produces tagatose, by fermenting glycerol and glucose. [Modes for carrying out the invention]

[0029] definition The terms “a” or “an,” when used in the claims and / or specification together with the term “including,” may mean “one,” but may also mean “one or more,” “at least one,” or “one or more.”

[0030] Where used in the claims and specification, the terms “include,” “have,” “contain,” or “contain” mean included or open, and do not exclude any additional components or method steps not cited.

[0031] Throughout the application, the term “approximately” means that one value includes the standard deviation of the error of the apparatus or method used to measure that value.

[0032] The disclosed information supports the definition of the term "or" as merely a substitute and "and / or," but unless it is explicitly indicated that the substitutes are merely substitutes or mutually exclusive, the term "or" in the claims means "and / or."

[0033] When used in the claims or specification, the selective / preferred / desired "numerical range" includes both the numerical endpoints at both ends of the range and all natural numbers that are in the middle of the numerical endpoints.

[0034] While other organic or inorganic catalysts may be used as used in this disclosure, the term “converting” means the chemical conversion of one molecule to another, catalyzed primarily by one or more polypeptides (enzymes). It can also refer to the ratio (in %) between the molar amount of the desired product and a given molar amount of the substrate.

[0035] As used in this disclosure, the terms “polypeptide,” “enzyme,” “polypeptide or enzyme,” and “polypeptide / enzyme” are synonymous and are interchangeable within this disclosure. The aforementioned terms refer to polymers consisting of many amino acids via peptide bonds, which may or may not include modifications such as phosphate groups or formyl groups.

[0036] As used in this disclosure, the term "phosphotransferase system glucose-specific transfer protein" means a glucose-specific transfer protein involved in the phosphotransferase system (PTS). The PTS system is widely present in bacteria, fungi, and some archaea, but not in plants and animals. The PTS system mediates the regulation of carbon metabolism in living organisms, and inducer exclusion occurs. Inducer exclusion is the inhibition of the absorption and utilization of other unfavorable carbon sources when one preferred carbon source (e.g., PTS carbon source - glucose) performs transport metabolism. In the case of E. coli, when glucose and other carbon sources (e.g., lactose, maltose, glycerol, etc.) are present simultaneously in the culture medium, glucose is preferentially utilized, phosphate groups cascade between glucose-specific transfer proteins of the PTS system, and dephosphorylation of glucose-specific transfer proteins increases. Unphosphorylated glucose-specific transfer proteins inhibit the transport and phosphorylation of carbon sources such as lactose, maltose, and glycerol by binding to their respective transporters or kinases (LacY, MalK, GlpK, etc.).

[0037] The term "Tagatose-6-phosphate 4-epimeras" (T6PE), also known as "6-phosphotagatoepimeras" as used in this disclosure, is capable of catalyzing the interconversion of fructose-6-phosphate and tagatose-6-phosphate. In some embodiments, the tagatose-6-phosphate epimerase of this disclosure is derived from Agrobacterium tumefaciens. In one specific embodiment, the tagatose-6-phosphate epimerase of this disclosure is derived from Agrobacterium tumefaciens str.C58.

[0038] The term "Tagatose-6-phosphate phosphatase" (T6PP), also known as "6-phosphotagatophosphatase" as used in this disclosure, is a catalyst for the conversion of tagatose-6-phosphate to tagatose. In some embodiments, the tagatose-6-phosphate phosphatases of this disclosure are derived from the genera Archaeoglobus, Archaeoglobus fulgidus and Archaeoglobus profundus.

[0039] As used in this disclosure, the term "glucokinase" (glk) refers to a type of hexokinase isozyme involved in the process by which glucose is phosphorylated to produce glucose-6-phosphate (G6P), which consumes one ATP and is converted to ADP, and Mg 2+ This requires. In some embodiments, the glucokinase of the present disclosure is derived from Escherichia coli, and in some other embodiments, the glucokinase may also be derived from a strain that performs sugar metabolism using glucose as a substrate, such as Corynebacterium glutamicum, Bacillus subtilis, Lactobacillus, or Saccharomyces cerevisiae.

[0040] The term "glucose-6-phosphate isomerase" (G6PI, pgi), also known as "6-phosphoglucoisomerase" as used in this disclosure, is present in the cytoplasm and extracellular fluid, and its primary function is to catalyze the conversion between D-glucose-6-phosphate and D-fructose-6-phosphate. It is an important enzyme in glycolysis and gluconeogenesis and possesses both enzymatic and cellular and growth factor activity. In some embodiments, the glucose-6-phosphate isomerase of this disclosure is derived from Escherichia coli; in some embodiments, the glucose-6-phosphate isomerase of this disclosure is derived from Bacillus subtilis; and in some other embodiments, the glucose-6-phosphate isomerase may be derived from strains that perform glucose metabolism using glucose as a substrate, such as Corynebacterium glutamicum, Lactobacillus, or Saccharomyces cerevisiae.

[0041] The term "phosphoglucomutase" (pgm), also known as glucose phosphomutase as used in this disclosure, is capable of catalyzing the interconversion of glucose-1-phosphate and glucose-6-phosphate and plays an important role in sugar metabolism. In some embodiments, the phosphoglucomutase of this disclosure is derived from Escherichia coli; in some embodiments, the phosphoglucomutase of this disclosure is derived from Bacillus subtilis; and in some other embodiments, the phosphoglucomutase may also be derived from strains that perform sugar metabolism using glucose as a substrate, such as Corynebacterium glutamicum, Lactobacillus, or Saccharomyces cerevisiae.

[0042] As used in this disclosure, the term "glucose 6-phosphate dehydrogenase" refers to an oxidoreductase that accepts NAD+ or NADP+ as a receptor and acts on the CH-OH group of a donor. This enzyme can catalyze the following enzymatic reaction: D-glucose-6-phosphate + NADP + = D-gluconic acid-1,5-lactone-6-phosphate + NADPH + H +Glucose-6-phosphate dehydrogenase is primarily involved in the pentose phosphate pathway and can also act mildly on other sugars such as β-D-glucose. In some embodiments, the glucose-6-phosphate dehydrogenase of the present disclosure is derived from Escherichia coli; in some embodiments, the glucose-6-phosphate dehydrogenase of the present disclosure is derived from Bacillus subtilis; and in other embodiments, the glucose-6-phosphate dehydrogenase may be derived from strains that metabolize sugars using glucose as a substrate, such as Corynebacterium glutamicum, Lactobacillus, or Saccharomyces cerevisiae.

[0043] The term “fructose-6-phosphokinase” (Phosphofructokinase, pfk), also known as 6-phosphofructokinase as used in this disclosure, refers to a type of kinase that can act on fructose-6-phosphate, where phosphofructokinase-1 (pfk-1) acts to produce fructose-1,6-diphosphate, and phosphofructokinase-2 (pfk-2) acts to produce fructose-2,6-diphosphate. In some embodiments, the fructose-6-phosphokinase of this disclosure is derived from Escherichia coli and comprises pfkA and pfkB; in some embodiments, the fructose-6-phosphokinase of this disclosure is derived from Bacillus subtilis and comprises pfkA; and in some other embodiments, the glucokinase may be derived from a sugar-metabolizing strain such as Corynebacterium glutamicum, Lactobacillus, or Saccharomyces cerevisiae.

[0044] As used in this disclosure, the term "pyruvate kinase" (PK), also known as pyruvate phosphate transferase or phosphopyruvate kinase, catalyzes the transfer of a phosphate group from phosphoenolpyruvate (PEP) to ADP, producing one molecule of pyruvate and one molecule of ATP. Pyruvate kinase converts phosphoenolpyruvate and ADP into ATP and pyruvate, and is one of the major rate-limiting enzymes in glycolysis. In some embodiments, the pyruvate kinase of this disclosure is derived from Escherichia coli and comprises pykA and pykF. In some other embodiments, the pyruvate kinase may also be derived from strains such as Corynebacterium glutamicum, Bacillus subtilis, Lactobacillus, or Saccharomyces cerevisiae.

[0045] As used in this disclosure, the term "HPr kinase" (HPrK) refers to a specific transferase element involved in the phosphotransferase system (PTS). In the presence of PTS transport sugars such as glucose, fructose-1,6-bisphosphate promotes the phosphorylation of serine at position 46 of HPr by HPr kinase (HPrK), producing the phosphorylation product P-Ser-HPr. The phosphorylation product P-Ser-HPr further binds to catabolite regulatory protein (CcpA), and the binding product acts on the catabolite response element (cre) region in front of the HPr kinase coding gene to exert a catabolite repressive effect, preventing cells from transporting glycerol into the cell for metabolism.

[0046] Where used in this disclosure, the terms “enzyme activity” and “protein activity” may also be expressed as “specific activity,” which has the same meaning in this disclosure, and may be used interchangeably. These refer to enzyme activity (U / mg) and protein activity (U / mg) per 1 mg of polypeptide (enzyme, protein).

[0047] The term “expression” as used in this disclosure includes, but is not limited to, all steps relating to RNA production and protein production, including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

[0048] In this disclosure, the term "coding gene" means a DNA molecule that can guide the synthesis of a protein according to certain rules, and the process by which a protein coding gene guides protein synthesis generally includes a transcription process using double-stranded DNA as a template and a translation process using mRNA as a template. A coding gene includes a CDS sequence (Coding Sequence) and can guide the production of mRNA that codes for a protein. The coding genes relating to this disclosure include proteins such as glucose-specific transfer proteins of the phosphotransferase system, tagatose-6-phosphate epimerase, tagatose-6-phosphate phosphatase, glucokinase, glucose-6-phosphate isomerase, fructose-6-phosphate kinase, pyruvate kinase, phosphoglucumutase, glucose-6-phosphate dehydrogenase, and HPr kinase, as well as the coding genes for these enzymes.

[0049] As used in this disclosure, the term “wild-type” refers to an entity that can be found in nature. For example, a polypeptide, polynucleotide sequence, or microorganism that can be isolated from a single source in nature and has not been intentionally modified in the laboratory by humans is naturally occurring. As used in this disclosure, “naturally occurring” and “wild-type” are synonymous.

[0050] As used in this disclosure, the term "microorganism" refers to a general term for microscopic organisms, including bacteria and fungi, that are difficult to observe with the naked eye. Because microorganisms have a large surface area-to-volume ratio, they can rapidly exchange substances with the external environment and produce metabolites. The microorganisms in this disclosure refer, in particular, to fermentation microorganisms that can produce metabolites such as sugars, lipids, amino acids, and nucleotides through fermentation culture.

[0051] As used in this disclosure, the term “recombinant microorganism” means a modified microorganism obtained by genetic engineering techniques. Embodiments include, but are not limited to, operations such as the introduction of recombinant genes, knockout of endogenous genes in microorganisms, and knockdown treatments. Here, the term “recombinant gene” means a gene that does not exist in nature, and a recombinant gene includes a protein-coding sequence operably ligated to an expression regulatory sequence. Embodiments include, but are not limited to, genes having foreign genes introduced into microorganisms, endogenous protein-coding sequences operably ligated to heterologous promoters, and modified protein-coding sequences. Recombinant genes are conserved on the genome of microorganisms, on plasmids of microorganisms, or on phages of microorganisms.

[0052] In some embodiments, recombinant microorganisms exhibiting reduced or eliminated protein activity, reduced or eliminated protein coding gene expression levels, reduced or eliminated enzyme activity, and reduced or eliminated enzyme coding gene expression levels include recombinant microorganisms obtained by genetic engineering techniques, such as introducing weak promoters or weak ribosome binding sites into microbial cells, knocking out or knocking down protein or enzyme coding genes, or inserting random fragments into protein or enzyme coding genes to eliminate protein or enzyme activity.

[0053] In some embodiments, recombinant microorganisms exhibiting improved protein activity, improved protein-coding gene expression levels, improved enzyme activity, and improved enzyme-coding gene expression levels include recombinant microorganisms obtained by genetic engineering techniques, such as introducing strong promoters and strong ribosome-binding sites into microbial cells, introducing non-integrated recombinant protein and enzyme expression vectors, and introducing chromosome-integrated recombinant protein and enzyme expression vectors.

[0054] In some embodiments, the recombinant microorganisms of the Disclosure are recombinant strains modified by genetic engineering using Escherichia coli as the wild-type microorganism; in some embodiments, the recombinant microorganisms of the Disclosure are recombinant strains modified by genetic engineering using Bacillus subtilis as the wild-type microorganism; and in some other embodiments, the recombinant microorganisms of the Disclosure may be recombinant strains modified by genetic engineering using fermentation strains such as Corynebacterium glutamicum, Lactobacillus, or Saccharomyces cerevisiae as the wild-type microorganism.

[0055] As used in this disclosure, the term “operably linked” means a structure in which a control sequence is positioned appropriately relative to the coding sequence of a polynucleotide, so that the control sequence guides the expression of the coding sequence. As an example, the control sequence may be selected from sequences coded by promoters and / or enhancers.

[0056] As used in this disclosure, the term “endogenous” means a polynucleotide, polypeptide, or other compound that is naturally expressed or produced within an organism or cell. That is, an endogenous polynucleotide, polypeptide, or other compound is not exogenous. For example, when a cell is first isolated from nature, “endogenous” polynucleotides or polypeptides are present within the cell.

[0057] As used in this disclosure, the term “exogenous” means any polynucleotide or polypeptide that is found or expressed naturally in any cell or organism in which expression is required. Exogenous polynucleotides, polypeptides, or other compounds are not endogenous.

[0058] As used in this disclosure, the terms “amino acid mutation” or “nucleotide mutation” include “substitution, repetition, deletion, or addition of one or more amino acids or nucleotides.” In this disclosure, the term “mutation” means a change in a nucleotide sequence or an amino acid sequence. In one particular embodiment, the term “mutation” means “substitution.”

[0059] In one embodiment, the “mutation” in this disclosure may be selected from “conservative mutations.” In this disclosure, the term “conservative mutation” means a mutation that can maintain the normal function of a protein. A typical example of a conservative mutation is a conservative substitution.

[0060] As used in this disclosure, the term “conservative substitution” means the substitution of an amino acid residue with an amino acid residue having a similar side chain. In the art, families of amino acid residues having similar side chains are defined, and these include basic side chains (e.g., lysine, arginine, and histidine), acidic side chains (e.g., aspartic acid and glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, and cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, and tryptophan), β-branched chains (e.g., threonine, valine, and isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, and histidine). As used in this disclosure, a “conservative substitution” typically involves the exchange of amino acids at one or more sites in a protein. This substitution may be conservative. In addition to the substitutions considered conservative, conservative mutations also include mutations that occur naturally due to individual differences in genes, strains, or species.

[0061] As used in this disclosure, the term “polynucleotide” means a polymer composed of nucleotides. A polynucleotide may be in the form of individual fragments, or it may be a component of a larger nucleotide sequence structure derived from a nucleotide sequence isolated at least once in quantity or concentration, and whose sequence and its constituent nucleotide sequences can be recognized, manipulated, and recovered by standard molecular biological methods (e.g., the use of a cloning vector). If the nucleotide sequence is represented as a DNA sequence (i.e., A, T, G, C), then it also includes an RNA sequence (i.e., A, U, G, C), where “U” is substituted with “T”. In other words, a “polynucleotide” may be a nucleotide polymer removed from other nucleotides (individual fragments or whole fragments), or a component or part of a larger nucleotide structure, such as an expression vector or a multiple cistron sequence. Polynucleotides include DNA, RNA, and cDNA sequences. A “recombinant polynucleotide” is a type of “polynucleotide”.

[0062] As used in this disclosure, the term “vector” means a DNA construct comprising a DNA sequence operably linked to a suitable regulatory sequence for expressing a target gene in a suitable host. “Recombinant expression vector” refers, for example, to a DNA structure for expressing a polynucleotide encoding a desired polypeptide. A recombinant expression vector may include, for example, i) a collection of genetic elements having a regulatory effect on gene expression, such as promoters and enhancers; ii) a structure or coding sequence that is transcribed into mRNA and translated into a protein; and iii) transcriptional subunits of suitable transcription and translation start and end sequences. Recombinant expression vectors can be constructed in any suitable way. The nature of the vector is not important, and any vector, including plasmids, viruses, phages, and transposons, can be used. Possible vectors for this disclosure include, but are not limited to, chromosomal, non-chromosomal, and synthetic DNA sequences, such as bacterial plasmids, phage DNA, yeast plasmids, and vectors derived from combinations of plasmids and phage DNA, such as DNA from viruses including cowpox, adenovirus, chickenpox, baculovirus, SV40, and pseudorabies.

[0063] As used in this disclosure, the term “transduction” means the process of introducing exogenous DNA into a host, as is commonly understood by those skilled in the art. The transformation method includes, but is not limited to, any method for introducing nucleic acids into cells, including, electroporation, calcium phosphate (CaPO4) precipitation, calcium phosphate (CaPO2) precipitation, microinjection, polyethylene glycol (PEG), DEAE-glucan, cationic liposome, and lithium acetate-DMSO.

[0064] Where used in this disclosure, the term “tagatose yield” has the meaning generally understood by those skilled in the art, namely, the proportion of the substrate consumed to produce tagatose to the total substrate. In this disclosure, “tagatose yield” and “substrate conversion rate” may be used interchangeably.

[0065] The culture of recombinant microorganisms according to this disclosure can be carried out based on conventional methods such as plate culture with wells, flask culture, batch culture, continuous culture, and fed-batch culture, but is not limited to these, and various culture conditions such as temperature, time, and pH of the culture medium can be appropriately adjusted according to the actual situation.

[0066] Unless otherwise defined or clearly indicated by the context, all scientific and technical terms in this disclosure have the same meaning as those generally understood by those skilled in the art.

[0067] Tagatose-producing strains In one proposed technology, this disclosure describes a method of genetically modifying wild-type microorganisms to obtain recombinant microorganisms and producing tagatose.

[0068] In one particular embodiment, the recombinant microorganism used in this disclosure is derived from Escherichia coli, Corynebacterium glutamicum, Bacillus subtilis, Lactobacillus, or Saccharomyces cerevisiae.

[0069] In one particular embodiment, the disclosure uses Escherichia coli and Bacillus subtilis as wild-type microorganisms and performs genetic engineering modifications on each of them.

[0070] In one particular embodiment, the present disclosure eliminates the enzymatic activity of the PTS-system glucose-specific transfer protein by, for example, knocking out the coding gene for the PTS-system glucose-specific transfer protein or introducing a random fragment into the coding gene for the PTS-system glucose-specific transfer protein.

[0071] In one particular embodiment, the purpose of eliminating the PTS-type glucose-specific transfer protein in this disclosure is to eliminate the inhibitory effect of glucose on the utilization of glycerol substrates. Recombinant strains of Escherichia coli or Bacillus subtilis utilize both glycerol and glucose as substrates. Of these, glycerol enters the cell as a carbon source, is metabolized, and used for strain growth. Under conditions suitable for growth, the strain can introduce glucose as a carbon source into the cell and synthesize tagatose via the tagatose synthesis pathway (Figure 1).

[0072] In one particular embodiment, the present disclosure enhances the enzymatic activity of glucokinase and glucose-6-phosphate isomerase by increasing the expression intensity of the coding genes for glucokinase and glucose-6-phosphate isomerase, for example by introducing a strong promoter or employing a plasmid-free expression method, or by incorporating more enzymatically active glucokinase and glucose-6-phosphate isomerase coding genes from another species by chromosomal incorporation.

[0073] In one particular embodiment, the enzymatic activity of fructose-6-phosphate kinase is eliminated in this disclosure by, for example, knocking out the encoding gene for fructose-6-phosphate kinase or inserting a random fragment into the encoding gene for fructose-6-phosphate kinase.

[0074] In one particular embodiment, the present disclosure enhances the enzymatic activity of tagatose-6-phosphate epimerase and tagatose-6-phosphate phosphatase, thereby increasing the expression intensity of the gene encoding tagatose-6-phosphate epimerase and tagatose-6-phosphate phosphatase, for example, by a strong promoter, a strong ribosome binding site, chromosomal integration, or plasmid-free expression.

[0075] In one particular embodiment, the enzymatic activity of pyruvate kinase is eliminated in this disclosure, for example, by knocking out the pyruvate kinase coding gene or by inserting a random fragment into the pyruvate kinase coding gene.

[0076] Phosphoenolpyruvate (PEP) provides a high-energy phosphate group in the glycerol metabolic pathway, specifically in the step where glycerol enters the cell and produces glycerol-3-phosphate (G3P). This facilitates the production of G3P from glycerol and accelerates glycerol metabolism, a step that contributes to the glycerol-dependent growth of bacterial strains.

[0077] In one particular embodiment, the enzymatic activity of phosphoglucumutase is eliminated in this disclosure, for example, by knocking out the phosphoglucumutase coding gene or by inserting a random fragment into the phosphoglucumutase coding gene.

[0078] In one particular embodiment, the enzyme activity of glucose-6-phosphate dehydrogenase is reduced in this disclosure by, for example, knocking out the glucose-6-phosphate dehydrogenase coding gene or inserting a random fragment into the glucose-6-phosphate dehydrogenase coding gene, or by reducing the transcriptional expression level of the glucose-6-phosphate dehydrogenase coding gene with a weak promoter or a weak ribosome binding site.

[0079] In one particular embodiment, the enzymatic activity of HPr kinase is eliminated in this disclosure, for example, by knocking out the HPr kinase coding gene or by inserting a random fragment into the HPr kinase coding gene. The purpose of eliminating HPr kinase is to eliminate the glucose inhibitory effect on the utilization of glycerol substrates.

[0080] Method for constructing recombinant engineered strains of E. coli that produce Tagatose In one proposed technology, this disclosure provides a method for constructing recombinant engineered strains of E. coli that produce tagatose.

[0081] In one particular embodiment, primers containing upstream and downstream homology arms of the ptsG gene, which codes for the glucose-specific transfer protein of the PTS system in Escherichia coli, are designed; the SceI-tet-SceI fragment of the vector pTKSCS (Figure 2A) is amplified by PCR; the homologous recombination fragment is transformed into Escherichia coli MG1655 (DE3); and the ptsG gene, which codes for the glucose-specific transfer protein of the PTS system, is knocked out by λ-Red homologous recombination to obtain recombinant strain YH1.

[0082] In one particular embodiment, the coding gene for glucokinase glucK and the coding gene for glucose-6-phosphate isomerase pgi, both derived from Escherichia coli, are amplified, constructed in the expression vector pACYCDuet, to obtain the recombinant expression vector pACYCDuet-glcK-pgi, and the recombinant expression vector pACYCDuet-glcK-pgi is used to transform E. coli YH1 to obtain the recombinant strain YH2.

[0083] In one particular embodiment, primers containing upstream and downstream homology arms of the Escherichia coli fructose-6-phosphate kinase coding gene pfkA are designed; the SceI-tet-SceI fragment of the vector pTKSCS (Figure 2A) is amplified by PCR; the homologous recombination fragment is transformed into recombinant strain YH2; the fructose-6-phosphate kinase coding gene pfkA is knocked out by λ-Red homologous recombination technology to obtain recombinant strain YH3; and recombinant expression vector pACYCDuet-glcK-pgi is used to transform E. coli YH3 into recombinant strain YH3-1.

[0084] In one particular embodiment, primers containing upstream and downstream homology arms of the Escherichia coli pyruvate kinase coding gene pykF are designed; the SceI-tet-SceI fragment of the vector pTKSCS (Figure 2A) is amplified by PCR; the homologous recombination fragment is transformed into recombinant strain YH3; the pyruvate kinase coding gene pykF is knocked out by λ-Red homologous recombination to obtain recombinant strain YH4; and recombinant expression vector pACYCDuet-glcK-pgi is transformed into E. coli YH4 to obtain recombinant strain YH4-1.

[0085] In one particular embodiment, primers containing upstream and downstream homology arms of the Escherichia coli phosphoglucumutase coding gene pgm are designed; the SceI-tet-SceI fragment of the vector pTKSCS (Figure 2A) is amplified by PCR; the homologous recombination fragment is transformed into recombinant strain YH4; the phosphoglucumutase coding gene pgm is knocked out by λ-Red homologous recombination to obtain recombinant strain YH5; and recombinant expression vector pACYCDuet-glcK-pgi is transformed into E. coli YH5 to obtain recombinant strain YH5-1.

[0086] In one particular embodiment, primers containing upstream and downstream homology arms of the glucose-6-phosphate dehydrogenase encoding gene zwf of Escherichia coli are designed; the SceI-tet-SceI fragment of vector pTKSCS (Figure 2A) is amplified by PCR; the homologous recombination fragment is transformed into recombinant strain YH5; the glucose-6-phosphate dehydrogenase encoding gene zwf is knocked out by λ-Red homologous recombination technology to obtain recombinant strain YH6; and recombinant expression vector pACYCDuet-glcK-pgi is transformed into E. coli YH6 to obtain recombinant strain YH6-1.

[0087] In one particular embodiment, the tagatose-6-phosphate epimerase T6PE derived from Agrobacterium tumefaciens str. C58 and the tagatose-6-phosphate phosphatase T6PP gene derived from Archaeoglobus fulgidus and / or Archaeoglobus profundus are amplified, constructed into the expression vector pETDuet, to obtain the recombinant expression vector pETDuet-T6PE-T6PP, and the recombinant expression vector pETDuet-T6PE-T6PP is transformed into Escherichia coli MG1655(DE3) to obtain the recombinant strain MG1655-1.

[0088] In one particular embodiment, a recombinant expression vector pETDuet-T6PE-T6PP containing the tagsatose-6-phosphate epimerase T6PE and tagsatose-6-phosphate phosphatase T6PP genes is constructed in recombinant strain YH1 to obtain recombinant strain YH1-1.

[0089] In one particular embodiment, a recombinant expression vector pETDuet-T6PE-T6PP containing the tagsatose-6-phosphate epimerase T6PE and tagsatose-6-phosphate phosphatase T6PP genes is constructed in recombinant strain YH2 to obtain recombinant strain YH2-1.

[0090] In one particular embodiment, a recombinant expression vector pETDuet-T6PE-T6PP containing the tagsatose-6-phosphate epimerase T6PE and tagsatose-6-phosphate phosphatase T6PP genes is constructed in recombinant strain YH3-1 to obtain recombinant strain YH3-2.

[0091] In one particular embodiment, a recombinant expression vector pETDuet-T6PE-T6PP containing the tagsatose-6-phosphate epimerase T6PE and tagsatose-6-phosphate phosphatase T6PP genes is constructed in recombinant strain YH4-1 to obtain recombinant strain YH4-2.

[0092] In one particular embodiment, a recombinant expression vector pETDuet-T6PE-T6PP containing the tagsatose-6-phosphate epimerase T6PE and tagsatose-6-phosphate phosphatase T6PP genes is constructed in recombinant strain YH5-1 to obtain recombinant strain YH5-2.

[0093] In one particular embodiment, as disclosed herein, a recombinant expression vector pETDuet-T6PE-T6PP of the tagatose-6-phosphate epimerase T6PE and tagatose-6-phosphate phosphatase T6PP genes is constructed in recombinant strain YH6-1 to obtain recombinant strain YH6-2.

[0094] In some specific embodiments of this disclosure, recombinant strains BMG1655-1, YH1-1, YH2-1, YH3-2, YH4-2, YH5-2, and YH6-2 can produce tagatose as recombinant engineered strains of Escherichia coli that produce tagatose by fermenting glucose or a mixture of glucose and glycerol.

[0095] Method for constructing recombinant engineered strains of Bacillus subtilis that produce Tagatose In one proposed technology, this disclosure provides a method for constructing recombinant engineered strains of Bacillus subtilis that produce Tagatose.

[0096] In one particular embodiment, a primer containing the upstream and downstream homology arms of the Bacillus subtilis 168 uracilphosphoribosyltransferase coding gene upp is designed, the upstream and downstream homology arms of the uracilphosphoribosyltransferase coding gene upp are amplified by PCR, and this is constructed in the embedded vector pSS to obtain the recombinant embedded vector pSS-upp-FR, the recombinant embedded vector pSS-upp-FR is transformed into Bacillus subtilis SCK6, and then recombinant engineered strain YJ8 in which the uracilphosphoribosyltransferase coding gene upp is knocked out is obtained by intramolecular homologous recombination technology.

[0097] In one particular embodiment, a primer containing upstream and downstream homology arms of the ptsG encoding gene for the PTS-type glucose-specific transfer protein of Bacillus subtilis 168 is designed; the upstream and downstream homology arms of the ptsG encoding gene for the PTS-type glucose-specific transfer protein are amplified by PCR; this is constructed into an embedded vector pSS to obtain a recombinant embedded vector pSS-ptsG-FR; the recombinant embedded vector pSS-ptsG-FR is transformed into Bacillus subtilis YJ8; and then a recombinant engineered strain YJ9 in which the ptsG encoding gene for the PTS-type glucose-specific transfer protein is knocked out is obtained by intramolecular homologous recombination technology.

[0098] In one particular embodiment, a primer containing upstream and downstream homology arms of the HPr kinase coding gene hprK of Bacillus subtilis 168 is designed; the upstream and downstream homology arms of the HPr kinase coding gene hprK are amplified by PCR; this is constructed into an embedded vector pSS to obtain recombinant embedded vector pSS-hprK-FR; recombinant embedded vector pSS-hprK-FR is transformed into Bacillus subtilis YJ9; and then recombinant engineered strain YJ10 in which the HPr kinase coding gene hprK is knocked out is obtained by intramolecular homologous recombination technology.

[0099] In one particular embodiment, the glucokinase coding gene glcK and the glucose-6-phosphate isomerase coding gene pgi, both derived from Bacillus subtilis 168, are amplified and constructed into the integration vector pSS-ptsG-FR to obtain the recombinant integration vector pSS-ptsG-FR-glcK-pgi. This recombinant integration vector pSS-ptsG-FR-glcK-pgi is then used to transform Bacillus subtilis YJ10, and subsequently, by intramolecular homologous recombination technology, a recombinant engineered strain YJ11 is obtained in which the glucokinase coding gene glcK and the glucose-6-phosphate isomerase coding gene pgi are integrated into the genome.

[0100] In one particular embodiment, a primer containing upstream and downstream homology arms of the Bacillus subtilis 168 fructose-6-phosphate kinase coding gene pfkA is designed; the upstream and downstream homology arms of the fructose-6-phosphate kinase coding gene pfkA are amplified by PCR; these are constructed into an embedded vector pSS to obtain a recombinant embedded vector pSS-pfkA-FR; the recombinant embedded vector pSS-pfkA-FR is transformed into Bacillus subtilis YJ11; and then a recombinant engineered strain YJ12 in which the fructose-6-phosphate kinase coding gene pfkA is knocked out is obtained by intramolecular homologous recombination technology.

[0101] In one particular embodiment, a primer containing upstream and downstream homology arms of the Bacillus subtilis 168 phosphoglucomutase coding gene pgm is designed, the upstream and downstream homology arms of the phosphoglucomutase coding gene pgm are amplified by PCR, constructed into an embedded vector pSS, a recombinant embedded vector pSS-pgm-FR is obtained, the recombinant embedded vector pSS-pgm-FR is transformed into Bacillus subtilis YJ12, and then recombinant engineered strain YJ13 in which the phosphoglucomutase coding gene pgm is knocked out is obtained by intramolecular homologous recombination technology.

[0102] In one particular embodiment, a primer containing upstream and downstream homology arms of the Bacillus subtilis 168 glucose-6-phosphate dehydrogenase coding gene zwf is designed, the upstream and downstream homology arms of the glucose-6-phosphate dehydrogenase coding gene zwf are amplified by PCR, constructed into an embedded vector pSS, a recombinant embedded vector pSS-zwf-FR is obtained, the recombinant embedded vector pSS-zwf-FR is transformed into Bacillus subtilis YJ13, and then recombinant engineered strain YJ14 in which the glucose-6-phosphate dehydrogenase coding gene zwf is knocked out is obtained by intramolecular homologous recombination technology.

[0103] In one particular embodiment, the tagatose-6-phosphate epimerase T6PE derived from Agrobacterium tumefaciens str. C58 and the tagatose-6-phosphate phosphatase T6PP gene derived from the genus Archaeoglobus, Archaeoglobus fulgidus and / or Archaeoglobus profundus are amplified and constructed in the expression vector pWB980 to obtain the recombinant expression vector pWB980-T6PE-T6PP, and the recombinant expression vector pWB980-T6PE-T6PP is transformed into Bacillus subtilis SCK6 to obtain the recombinant strain SCK6-1.

[0104] In one particular embodiment, a recombinant expression vector pWB980-T6PE-T6PP containing the tagsatose-6-phosphate epimerase T6PE and tagsatose-6-phosphate phosphatase T6PP genes is constructed in recombinant strain YJ8 to obtain recombinant strain YJ8-1.

[0105] In one particular embodiment, a recombinant expression vector pWB980-T6PE-T6PP containing the tagsatose-6-phosphate epimerase T6PE and tagsatose-6-phosphate phosphatase T6PP genes is constructed in recombinant strain YJ9 to obtain recombinant strain YJ9-1.

[0106] In one particular embodiment, a recombinant expression vector pWB980-T6PE-T6PP containing the tagsatose-6-phosphate epimerase T6PE and tagsatose-6-phosphate phosphatase T6PP genes is constructed in recombinant strain YJ10 to obtain recombinant strain YJ10-1.

[0107] In one particular embodiment, a recombinant expression vector pWB980-T6PE-T6PP containing the tagsatose-6-phosphate epimerase T6PE and tagsatose-6-phosphate phosphatase T6PP genes is constructed in recombinant strain YJ11 to obtain recombinant strain YJ11-1.

[0108] In one particular embodiment, a recombinant expression vector pWB980-T6PE-T6PP containing the tagsatose-6-phosphate epimerase T6PE and tagsatose-6-phosphate phosphatase T6PP genes is constructed in recombinant strain YJ12 to obtain recombinant strain YJ12-1.

[0109] In one particular embodiment, a recombinant expression vector pWB980-T6PE-T6PP containing the tagsatose-6-phosphate epimerase T6PE and tagsatose-6-phosphate phosphatase T6PP genes is constructed in recombinant strain YJ13 to obtain recombinant strain YJ13-1.

[0110] In one particular embodiment, a recombinant expression vector pWB980-T6PE-T6PP containing the tagsatose-6-phosphate epimerase T6PE and tagsatose-6-phosphate phosphatase T6PP genes is constructed in recombinant strain YJ14 to obtain recombinant strain YJ14-1.

[0111] In some particular embodiments of this disclosure, recombinant strains SCK6-1, YJ8-1, YJ9-1, YJ10-1, YJ11-1, YJ12-1, YJ13-1 and YJ14-1 are recombinant engineered strains of Bacillus subtilis that produce tagatose, and can produce tagatose by fermenting glucose or a mixture of glucose and glycerol in a culture medium.

[0112] Tagathos production method In one proposed technology, this disclosure provides a method for producing tagatose.

[0113] In one particular embodiment, the method for producing tagatose according to this disclosure, Step (1) involves fermenting and culturing the Tagatose-producing strain, The process may also include step (2) of collecting the fermentation reaction liquid after the fermentation reaction is complete and separating the tagatose from it.

[0114] In the production process described above, the tagatose-producing strain efficiently converts glucose and glycerol as substrates to produce tagatose, enabling high yields of tagatose. The tagatose production method disclosed herein uses glucose and glycerol as substrates, making the raw materials readily available, inexpensive, eliminating the need for multi-enzyme separation processes, environmentally friendly, and low-cost, thus offering potential for industrial applications.

[0115] In some embodiments, the culture medium for fermenting recombinant engineered strains of E. coli that produce tagatose is LB medium (10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride, 25 ng / mL kanamycin, 100 ng / mL ampicillin) to which a final concentration of 20 g / L glucose is added.

[0116] In some embodiments, the culture medium for fermenting and culturing recombinant engineered strains of E. coli that produce tagatose is M9Y medium (10 g / L glycerol, 20 g / L glucose, 6 g / L Na2HPO4, 0.5 g / L NaCl, 3 g / L KH2PO4, 1 g / L NH4Cl, 1 mM MgSO4, 0.1 mM CaCl2, and 2 g / L yeast extract).

[0117] In some embodiments, the culture medium for fermenting and culturing recombinant Bacillus subtilis strains that produce tagatose is SR medium (15 g / L peptone, 25 g / L yeast extract, 3 g / L K2HPO4, kanamycin 25 ng / mL) to which glucose at a final concentration of 20 g / L is added.

[0118] In some embodiments, the culture medium for fermenting and culturing recombinant Bacillus subtilis strains that produce tagatose is SR medium (15 g / L peptone, 25 g / L yeast extract, 3 g / L K2HPO4, kanamycin 25 ng / mL) to which glucose and glycerol at a final concentration of 20 g / L are added.

[0119] In some embodiments, the fermentation culture conditions for the tagatose-producing strain include culturing the strain at 37°C and 200 rpm for 12 to 24 hours.

[0120] In some embodiments, the method for separating tagatose may include, but is not limited to, filtration, decolorization, desalting, concentration, crystallization, and HPLC detection, and may also include, but is not limited to, common methods in the art.

[0121] In this field, methods for manipulating microorganisms are known, as can be interpreted in publications such as "Modern Methods in Molecular Biology" (Online ISBN: 9780471142720, John Wiley and Sons, Inc.), "Microbial Metabolic Engineering: Methods and Procedures" (Qiong Cheng Ed., Springer), and "Systematic Metabolic Engineering: Methods and Procedures" (Hal S. Alper Ed., Springer).

[0122] In this disclosure, the meanings of the nucleotide or amino acid numbers shown in SEQ ID NO:1 to SEQ ID NO:17 and SEQ ID NO:54 to SEQ ID NO:55 are as follows:

[0123] The sequence shown in SEQ ID NO:1 is the amino acid sequence of the glucose-specific transfer protein of E. coli.

[0124] The sequence shown in SEQ ID NO:2 is a nucleotide sequence that encodes a glucose-specific transfer protein in E. coli.

[0125] The sequence shown in SEQ ID NO:3 is the amino acid sequence of the glucose-specific transfer protein of Bacillus subtilis.

[0126] The sequence shown in SEQ ID NO:4 is a nucleotide sequence that encodes a glucose-specific transfer protein in Bacillus subtilis.

[0127] The sequence shown in SEQ ID NO:5 is the amino acid sequence of Agrobacterium tumefacien stagateose-6-phosphate epimerase.

[0128] The sequence shown in SEQ ID NO:6 is a nucleotide sequence that encodes tagatose-6-phosphate epimerase from Agrobacterium tumefaciens.

[0129] The sequence shown in SEQ ID NO:7 is the amino acid sequence of tagatose-6-phosphate phosphatase from the genus Archaeoglobus fulgidus.

[0130] The sequence shown in SEQ ID NO:8 is a nucleotide sequence encoding tagatose-6-phosphate phosphatase from the genus Archaeoglobus fulgidus.

[0131] The sequence shown in SEQ ID NO:9 is the amino acid sequence of glucokinase from E. coli.

[0132] The sequence shown in SEQ ID NO:10 is a nucleotide sequence that encodes glucokinase in E. coli.

[0133] The sequence shown in SEQ ID NO:11 is the amino acid sequence of glucokinase from Bacillus subtilis.

[0134] The sequence shown in SEQ ID NO:12 is a nucleotide sequence that encodes glucokinase from Bacillus subtilis.

[0135] The sequence shown in SEQ ID NO:13 is the amino acid sequence of glucose-6-phosphate isomerase from E. coli.

[0136] The sequence shown in SEQ ID NO:14 is a nucleotide sequence that encodes glucose-6-phosphate isomerase from E. coli.

[0137] The sequence shown in SEQ ID NO:15 is the amino acid sequence of glucose-6-phosphate isomerase from Bacillus subtilis.

[0138] The sequence shown in SEQ ID NO:16 is a nucleotide sequence encoding glucose-6-phosphate isomerase from Bacillus subtilis.

[0139] The sequence shown in SEQ ID NO:17 is the nucleotide sequence of the SceI-tet-SceI fragment.

[0140] The sequence shown in SEQ ID NO:54 is the amino acid sequence of tagatose-6-phosphate phosphatase from the genus Archaeoglobus profundus.

[0141] The sequence shown in SEQ ID NO:55 is a nucleotide sequence encoding tagatose-6-phosphate phosphatase from the genus Archaeoglobus, Archaeoglobus profundus.

[0142] Examples Other purposes, features, and advantages of this disclosure will become apparent from the following detailed description. However, the detailed description and specific examples (which illustrate specific embodiments of this disclosure) are provided for illustrative purposes only, and it should be understood that various modifications and modifications made within the spirit and scope of this disclosure will be obvious to those skilled in the art upon reading the detailed description.

[0143] Unless otherwise specified, the experimental techniques and methods used in these embodiments are all standard technical methods. For example, in the following embodiments, experimental methods for which specific conditions are not explicitly stated generally follow the conditions described in Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or the conditions suggested by the manufacturer. Unless otherwise specified, the materials, reagents, etc., used in the embodiments can be obtained through legitimate commercial channels.

[0144] Example 1: Construction of recombinant E. coli strain YH1 (1) Based on the ptsG encoding gene for the PTS-type glucose-specific transfer protein derived from E. coli MG1655 in the KEGG database, primers 1 and 2 were designed, each containing an upstream 65bp homologous fragment and a downstream 65bp homologous fragment of the ptsG encoding gene for the PTS-type glucose-specific transfer protein. The SceI-tet-SceI fragment of the pTKSCS vector (the nucleotide sequence of the SceI-tet-SceI fragment is shown in SEQ ID NO:17) was amplified by PCR to obtain resistance fragment 1 containing the upstream and downstream homologous fragments of the ptsG gene. The specific primer sequences are shown below.

[0145] Primer 1, sequence is shown in SEQ ID NO:18: CAGGAGCACTCTCAATTATGTTTAAGAATGCATTTGCTAACCTGCAAAAGGTCGGTAAATCGCTGTACGGCCCCAAGGTCCAAACGGTGA Primer 2, sequence shown in SEQ ID NO:19:GCCATCTGGCTGCCTTAGTCTCCCCAACGTCTTACGGATTAGTGGTTACGGATGTACTCATCCATCAGCGATTTACCGACCTTTTGCAGGTTAGCTTGGCTTCAGGGATGAGGCGCCATC (2) Construction of recombinant E. coli strain YH1 MG1655(DE3) competent cells (100 μL) were prepared, transfected with the pTKRed plasmid (temperature-sensitive plasmid) (Figure 2B) necessary for Red recombination, and spread on a spectinomycin-containing resistance plate. The cells were incubated overnight at 30°C. Subsequently, a single colony was selected from the plate, transferred to a liquid LB containing spectinomycin and IPTG, and incubated at 30°C to prepare MG1655(DE3) electroporation-competent cells (100 μL) containing pTKRed.

[0146] Fragment 1 obtained in Step 1 was homogeneously mixed with electroporation competent, and after electric shock, it was spread onto a plate containing spectinomycin and chloramphenicol biantibodies and incubated at 30°C for 30 hours. A single clone was selected and colony PCR validation was performed (validation primers were primer 3 and primer 4). The strain with a PCR product size of approximately 1775 bp (containing the upstream ptsG gene fragment, SceI-tet-SceI fragment, and downstream ptsG gene fragment on the genome) was identified as the correct double-exchange strain.

[0147] Positive clones were selected and inoculated into LB liquid medium containing spectinomycin, IPTG, and arabinose, and cultured for 8-12 hours. The bacterial suspension was then diluted and spread onto plates containing spectinomycin, IPTG, and arabinose, and cultured overnight. The purpose of this step was to induce SceI expression with arabinose, cleave the DNA containing the SceI recognition site, promote intramolecular homologous recombination in positive transformants, and remove tet-resistant fragments. Multiple single clones were selected from the plates, and colony PCR was performed again (using primers 3 and 4 for validation). Transformants with a PCR product of approximately 382 bp of DNA were identified as positive clones. Positive clones were inoculated into antibody-free liquid LB and cultured at 37°C for 8-12 hours, which removed the pTKRed plasmid. Transformant PCR was subjected to sequencing for verification, and the correct strain, namely a recombinant engineered E. coli strain in which the coding gene for the PTS-type glucose-specific transfer protein was knocked out, was preserved and named YH1. The specific primer sequence is shown below.

[0148] Primer 3, sequence shown in SEQ ID NO:20:CGTCAAACAAATTGGCACTG Primer 4, sequence shown in SEQ ID NO:21:GAACGTCAATAACCTGTTCG

[0149] Example 2: Construction of recombinant E. coli strain YH2 (1) Construction of the recombinant expression vector pACYCDuet-glk-pgi Based on the glucokinase coding gene glk and glucose-6-phosphate isomerase coding gene pgi from the KEGG database, primers 5 and 6 were designed to amplify glk, and primers 7 and 8 were designed to amplify pgi. Primers 9 and 10 were designed to amplify the plasmid skeleton pACYCDuet (Figure 2C), and a simple cloning ligation method was used.[5] The recombinant expression vector pACYCDuet-glcK was constructed using [method / tool ​​name]. Subsequently, primers 11 and 12 were designed to amplify the plasmid framework pACYCDuet-glk, and the recombinant expression vector pACYCDuet-glk-pgi was obtained by simple cloning. The specific primer sequences are shown below.

[0150] Primer 5, sequence shown in SEQ ID NO:22: GTTTAACTTTAATAAGGAGATATACCATGACAAAGTATGCATTAGTCGGTG

[0151] Primer 6, sequence is shown in SEQ ID NO:23: CGATTACTTTCTGTTCGACTTAAGCATTACAGAATGTGACCTAAGGTCTG

[0152] Primer 7, sequence shown in SEQ ID NO:24:GTTAAGTATAAGAAGGAGATATACATATGAAAAACATCAATCCAACGCAG

[0153] Primer 8, sequence shown in SEQ ID NO:25:TCAGCGGTGGCAGCAGCCTAGGTTAATTAACCGCGCCACGCTTTATAGCG

[0154] Primer 9, sequence shown in SEQ ID NO:26:CAGACCTTAGGTCACATTCTGTAATGCTTAAGTCGAACAGAAAGTAATCG

[0155] Primer 10, sequence shown in SEQ ID NO:27:CACCGACTAATGCATACTTTGTCATGGTATATCTCCTTATTAAAGTTAAAC

[0156] Primer 11, sequence shown in SEQ ID NO:28: GCTATAAAGCGTGGCGCGGTTAATTAACCTAGGCTGCTGCCACCGCTGAG

[0157] Primer 12, sequence is shown in SEQ ID NO:29: CTGCGTTGGATTGATGTTTTTCATATGTATATCTCCTTCTTATACTTAAC

[0158] (2) Construction of recombinant E. coli strain YH2

[0159] The recombinant expression vector pACYCDuet-glk-pgi was used to transform recombinant strain YH1, yielding recombinant strain YH2.

[0160] Example 3: Construction of recombinant E. coli strain YH3-1 (1) Construction of pfkA gene knockout recombinant fragments Based on the pfkA encoding gene for fructose-6-phosphate kinase derived from E. coli MG1655 in the KEGG database, primers 13 and 14 were designed for the upstream 65bp homologous fragment and the downstream 65bp homologous fragment of pfkA. The SceI-tet-SceI fragment on the pTKSCS vector was amplified by PCR to obtain resistance fragment 2 containing the upstream and downstream homologous fragments of the pfkA gene. The specific primer sequences are shown below.

[0161] Primer 13, sequence shown in SEQ ID NO:30:CATTCCAAAGTTCAGAGGTAGTCATGATTAAGAAAATCGGTGTGTTGACAAGCGGCGGTGATGCGtacggccccaaggtccaaacggtga

[0162] Primer 14, sequence shown in SEQ ID NO:31: GCCTTTTTCCGAAATCATTAATACAGTTTTTTCGCGCAGTCCAGCCAGTCACCTTTGAACGGACGCGCATCACCGCCGCTTGTCAACACACCGATttggcttcagggatgaggcgccatc

[0163] (2) Construction of recombinant E. coli strain YH3 E. coli YH2 competent cells (100 μL) were prepared, transfected with the pTKRed plasmid (temperature-sensitive plasmid) necessary for Red recombination, spread on a spectinomycin-containing resistance plate, and incubated overnight at 30°C. Subsequently, a single colony was selected from the plate, transferred to a liquid LB containing spectinomycin and IPTG, incubated at 30°C, and prepared YH2 electroporation-competent cells (100 μL) containing pTKRed.

[0164] Fragment 2 obtained in Step 1 was homogeneously mixed with electroporation competent, and after electric shock, it was spread onto a plate containing dual antibodies against spectinomycin and chloramphenicol and incubated at 30°C for 30 hours. A single clone was selected and colony PCR validation was performed (validation primers were primer 15 and primer 16). The strain with a PCR product size of approximately 1757 bp (containing the upstream fragment of the pfkA gene on the genome, the SceI-tet-SceI fragment, and the downstream fragment of the pfkA gene on the genome) was identified as the correct double-exchange strain.

[0165] Positive clones were selected and transferred to LB liquid medium containing spectinomycin, IPTG, and arabinose, and incubated for 8-12 hours. The bacterial suspension was then diluted and spread onto plates containing spectinomycin, IPTG, and arabinose, and incubated overnight. The purpose of this step was to induce SceI expression with arabinose, cleave the DNA containing the SceI recognition site, promote intramolecular homologous recombination in positive transformants, and remove tet-resistant fragments. Multiple single clones were selected from the plates, and colony PCR was performed again (using primers 15 and 16 for validation). Transformants with a PCR product of approximately 364 bp of DNA were identified as positive clones. Positive clones were inoculated into antibody-free liquid LB and incubated at 37°C for 8-12 hours, which removed the pTKRed plasmid. The transformed strains were validated by sequencing, and the correct strain, namely a recombinant E. coli strain in which the fructose 6-phosphate kinase coding gene pfkA was knocked out, was preserved and named YH3. The specific primer sequences are shown below.

[0166] Primer 15, sequence shown in SEQ ID NO:32:CATTTGGCCTGACCTGAATC

[0167] Primer 16, sequence shown in SEQ ID NO:33: CGAACGCCTTATCCGGCCTAC

[0168] (3) Construction of recombinant E. coli strain YH3-1 The recombinant expression vector pACYCDuet-glk-pgi was used to transform recombinant strain YH3, yielding recombinant strain YH3-1.

[0169] Example 4: Construction of recombinant E. coli strain YH4-1 (1) Construction of pykF gene knockout recombinant fragments Based on the E. coli-derived pyruvate kinase encoding gene pykF in the KEGG database, primers 17 and 18 were designed for the upstream 65bp homologous fragment and downstream 65bp homologous fragment of pykF. The SceI-tet-SceI fragment on the pTKSCS vector was amplified by PCR to obtain resistance fragment 3, which contains the upstream and downstream homologous fragments of the pykF gene. The specific primer sequences are shown below.

[0170] Primer 17, sequence shown in SEQ ID NO:34:AGACTGTCATGAAAAAGACCAAAATTGTTTGCACCATCGGACCGAAAACCGAATCTGAAGAGATGtacggccccaaggtccaaacggtga

[0171] Primer 18, sequence shown in SEQ ID NO:35: CAAAAGCAATATTACAGGACGTGAACAGATGCGGTGTTAGTAGTGCCGCTCGGTACCAGTGCACCCATCTCTTCAGATTCGGTTTTCGGTCCGATttggcttcagggatgaggcgccatc

[0172] (2) Construction of recombinant E. coli strain YH4 E. coli YH3 competent cells (100 μL) were prepared, transfected with the pTKRed plasmid (temperature-sensitive plasmid) necessary for Red recombination, spread on a spectinomycin-containing resistance plate, and incubated overnight at 30°C. Subsequently, a single colony was selected from the plate, transferred to a liquid LB containing spectinomycin and IPTG, incubated at 30°C, and 100 μL of YH3 electroporation-competent cells containing pTKRed were prepared.

[0173] Fragment 3 obtained in Step 1 was homogeneously mixed with electroporation competent, and after electric shock, it was spread onto a plate containing dual antibodies against spectinomycin and chloramphenicol and incubated at 30°C for 30 hours. A single clone was selected and colony PCR validation was performed (validation primers were primer 19 and primer 20). The strain with a PCR product size of approximately 2310 bp (containing the upstream pykF gene fragment, SceI-tet-SceI fragment, and downstream pykF gene fragment on the genome) was identified as the correct double-exchange strain.

[0174] Positive clones were selected and transferred to LB liquid medium containing spectinomycin, IPTG, and arabinose, and incubated for 8-12 hours. The bacterial suspension was then diluted and spread onto plates containing spectinomycin, IPTG, and arabinose, and incubated overnight. The purpose of this step was to induce SceI expression with arabinose, cleave the DNA containing the SceI recognition site, promote intramolecular homologous recombination in positive transformants, and remove tet-resistant fragments. Multiple single clones were selected from the plates, and colony PCR was performed again (using primers 15 and 16 for validation). Transformants with a PCR product of approximately 364 bp of DNA were identified as positive clones. Positive clones were inoculated into antibody-free liquid LB and incubated at 37°C for 8-12 hours, which removed the pTKRed plasmid. The transformed PCR was subjected to sequencing for verification, and the correct strain, i.e., a recombinant engineered E. coli strain in which the pyruvate kinase coding gene pykF was knocked out, was preserved and named YH4. The specific primer sequences are shown below.

[0175] Primer 19, sequence shown in SEQ ID NO:36: AACTTCGGCACCAGACGTTG

[0176] Primer 20, sequence shown in SEQ ID NO:37:TCTGAACGTCAGAAGACAGC

[0177] (3) Construction of recombinant E. coli strain YH4-1 The recombinant expression vector pACYCDuet-glk-pgi was used to transform recombinant strain YH4, yielding recombinant strain YH4-1.

[0178] Example 5: Construction of recombinant E. coli strain YH5-1 (1) Construction of pgm gene knockout recombinant fragments Based on the E. coli-derived phosphoglucomutase encoding gene pgm in the KEGG database, primers 21 and 22 were designed for the upstream 65bp homologous fragment and the downstream 65bp homologous fragment of pgm. The SceI-tet-SceI fragment on the pTKSCS vector was amplified by PCR to obtain resistance fragment 4 containing the upstream and downstream homologous fragments of the pgm gene. The specific primer sequences are shown below.

[0179] Primer 21, sequence shown in SEQ ID NO:38:AAACGTTGCAGACAAAGGACAAAGCAATGGCAATCCACAATCGTGCAGGCCAACCTGCACAACAGtacggccccaaggtccaaacggtga

[0180] Primer 22, sequence shown in SEQ ID NO:39: GTGTTTACGCGTTTTTCAGAACTTCGCTAACAATCTCAACCGCTTCTTTCTCAATCTGCTTGCGCTGTTGTGCAGGTTGGCCTGCACGATTGTGttggcttcagggatgaggcgccatc

[0181] (2) Construction of recombinant E. coli strain YH5 E. coli YH4 competent cells (100 μL) were prepared, transfected with the pTKRed plasmid (temperature-sensitive plasmid) necessary for Red recombination, spread on a spectinomycin-containing resistance plate, and incubated overnight at 30°C. Subsequently, a single colony was selected from the plate, transferred to a liquid LB containing spectinomycin and IPTG, incubated at 30°C, and prepared YH4 electroporation-competent cells (100 μL) containing pTKRed.

[0182] Fragment 4 obtained in Step 1 was homogeneously mixed with electroporation competent, and after electric shock, it was spread onto a plate containing dual antibodies against spectinomycin and chloramphenicol and incubated at 30°C for 30 hours. A single clone was selected and colony PCR validation was performed (validation primers were primer 23 and primer 24). The strain with a PCR product size of approximately 2200 bp (containing the upstream pgm gene fragment, SceI-tet-SceI fragment, and downstream pgm gene fragment on the genome) was identified as the correct double-exchange strain.

[0183] Positive clones were selected and transferred to LB liquid medium containing spectinomycin, IPTG, and arabinose, and incubated for 8-12 hours. The bacterial suspension was then diluted and spread onto plates containing spectinomycin, IPTG, and arabinose, and incubated overnight. The purpose of this step was to induce SceI expression with arabinose, cleave the DNA containing the SceI recognition site, promote intramolecular homologous recombination in positive transformants, and remove tet-resistant fragments. Multiple single clones were selected from the plates, and colony PCR was performed again (using primers 15 and 16 for validation). Transformants with a PCR product of approximately 807 bp of DNA were identified as positive clones. Positive clones were inoculated into antibody-free liquid LB and incubated at 37°C for 8-12 hours, which removed the pTKRed plasmid. The transformed PCR was subjected to sequencing for verification, and the correct strain, i.e., a recombinant engineered E. coli strain in which the phosphoglucumutase coding gene pgm was knocked out, i.e., a recombinant engineered E. coli strain lacking the phosphoglucumutase coding gene pgm, was preserved and named YH5. The specific primer sequences are shown below.

[0184] Primer 23, sequence shown in SEQ ID NO:40:CGGTCAAAACGATTAAAGACAAG

[0185] Primer 24, sequence shown in SEQ ID NO:41:CCAGTCGCCAGCTAATGATG

[0186] (3) Construction of recombinant E. coli strain YH5-1 The recombinant expression vector pACYCDuet-glk-pgi was used to transform recombinant strain YH5, yielding recombinant strain YH5-1.

[0187] Example 6: Construction of recombinant E. coli strain YH6-1 (1) Construction of zwf gene knockout recombinant fragments Based on the E. coli-derived glucose-6-phosphate dehydrogenase encoding gene zwf in the KEGG database, primers 21 and 22 were designed for the upstream 65bp homologous fragment and downstream 65bp homologous fragment of zwf. The SceI-tet-SceI fragment on the pTKSCS vector was amplified by PCR to obtain resistance fragment 5 containing the upstream and downstream homologous fragments of the zwf gene. The specific primer sequences are shown below.

[0188] Primer 25, sequence shown in SEQ ID NO:42:GTTAACTTAAGGAGAATGACATGGCGGTAACGCAAACAGCCCAGGCCTGTGACCTGGTCATTTTCtacggccccaaggtccaaacggtga

[0189] Primer 26, sequence shown in SEQ ID NO:43: AAGCGCAGATATTACTCAAACTCATTCCAGGAACGACCATCACGGGTAATCATCGCCACCGAGGCGAAAATGACCAGGTCACAGGCCTGGGCTGTttggcttcagggatgaggcgccatc

[0190] (2) Construction of recombinant E. coli strain YH6 E. coli YH5 competent cells (100 μL) were prepared, transfected with the pTKRed plasmid (temperature-sensitive plasmid) necessary for Red recombination, spread on a spectinomycin-containing resistance plate, and incubated overnight at 30°C. Subsequently, a single colony was selected from the plate, transferred to a liquid LB containing spectinomycin and IPTG, incubated at 30°C, and prepared YH5 electroporation-competent cells (100 μL) containing pTKRed.

[0191] Fragment 5 obtained in Step 1 was homogeneously mixed with electroporation competent, and after electric shock, it was spread onto a plate containing dual antibodies against spectinomycin and chloramphenicol and incubated at 30°C for 30 hours. A single clone was selected and colony PCR validation was performed (validation primers were primer 27 and primer 28). The strain with a PCR product size of approximately 2306 bp (containing the upstream zwf gene fragment, SceI-tet-SceI fragment, and downstream zwf gene fragment on the genome) was identified as the correct double-exchange strain.

[0192] Positive clones were selected and transferred to LB liquid medium containing spectinomycin, IPTG, and arabinose, and incubated for 8-12 hours. The bacterial suspension was then diluted and spread onto plates containing spectinomycin, IPTG, and arabinose, and incubated overnight. The purpose of this step was to induce SceI expression with arabinose, cleave the DNA containing the SceI recognition site, promote intramolecular homologous recombination in positive transformants, and remove tet-resistant fragments. Multiple single clones were selected from the plates, and colony PCR was performed again (using primers 27 and 28 for validation). Transformants with a PCR product of approximately 913 bp of DNA were identified as positive clones. Positive clones were inoculated into antibody-free liquid LB and incubated at 37°C for 8-12 hours, which removed the pTKRed plasmid. The transformed PCR was subjected to sequencing for verification, and the correct strain, i.e., a recombinant engineered E. coli strain in which the glucose-6-phosphate dehydrogenase coding gene zwf was knocked out, i.e., a recombinant engineered E. coli strain lacking the glucose-6-phosphate dehydrogenase coding gene zwf, was preserved and named YH6. The specific primer sequences are shown below.

[0193] Primer 27, sequence shown in SEQ ID NO:44: GATTTGCTCAAATGTTCCAGC

[0194] Primer 28, sequence shown in SEQ ID NO:45:GCAACATGCTTTTCAAAGAG

[0195] (3) Constructed recombinant Escherichia coli strain YH6-1 The recombinant expression vector pACYCDuet-glk-pgi was used to transform recombinant strain YH6, yielding recombinant strain YH6-1.

[0196] Example 7: Construction of recombinant E. coli strain MG1655-1 (1) Construction of the recombinant expression vector pETDuet-t6pe-t6pp Based on the tagatose-6-phosphate epimerase T6PE from Agrobacterium tumefaciens str. C58 and the tagatose-6-phosphate phosphatase T6PP from Archaeoglobus fulgidus or Archaeoglobus profundus genes in the KEGG database, primers 29 and 30 were designed to amplify t6pe, and primers 31 and 32 were designed to amplify t6pp. Primers 33 and 34 were designed to amplify the plasmid skeleton pETDuet (Figure 2D) using a simple cloning ligation method. [5] The recombinant expression vector pETDuet-t6pe was constructed using [method / tool ​​name]. Subsequently, primers 35 and 36 were designed, and the plasmid framework pETDuet-t6pe was amplified. The recombinant expression vector pETDuet-t6pe-t6pp was obtained by simple cloning. The specific primer sequences are shown below.

[0197] Primer 29, sequence shown in SEQ ID NO:46:GTTAAGTATAAGAAGGAGATATACATATGAACACCGAACATCCGCTGAAAAATG

[0198] Primer 30, sequence shown in SEQ ID NO:47:CGGTGGCAGCAGCCTAGGTTAATTACTCGAGAATCAGTTTGAATTCACCG

[0199] Primer 31, sequence shown in SEQ ID NO:48: GTTTAACTTTAAGAAGGAGATATACCATGTTCAAGCCGAAAGCGATCGCG

[0200] Primer 32, sequence shown in SEQ ID NO:49:GATTACTTTCTGTTCGACTTAAGCATTAACGCAGCAGGCCCAGAAACTGCAG

[0201] Primer 33, sequence shown in SEQ ID NO: 50: CATTTTTCAGCGGATGTTCGGTGTTCATATGTATATCTCCTTCTTATACTTAAC

[0202] Primer 34, sequence shown in SEQ ID NO:51:CGGTGAATTCAAACTGATTCTCGAGTAATTAACCTAGGCTGCTGCCACCG

[0203] Primer 35, sequence shown in SEQ ID NO: 52: CTGCAGTTTCTGGGCCTGCTGCGTTAATGCTTAAGTCGAACAGAAAGTAATC

[0204] Primer 36, sequence shown in SEQ ID NO: 53: CGCGATCGCTTTCGGCTTGAACATGGTATATCTCCTTCTTAAAGTTAAAC

[0205] (2) Construction of recombinant Escherichia coli strain MG1655-1 The recombinant expression vector pETDuet-t6pe-t6pp was used to transform Escherichia coli MG1655(DE3) to obtain recombinant strain MG1655-1.

[0206] By a similar method, the recombinant expression vector pETDuet-t6pe-t6pp was inserted into recombinant E. coli strains YH1, YH2, YH3-1, YH4-1, YH5-1, and YH6-1 to obtain recombinant E. coli strains YH1-1, YH2-1, YH3-2, YH4-2, YH5-2, and YH6-2 with improved enzymatic activity of tagatose 6-phosphate epimerase and tagatose 6-phosphate phosphatase.

[0207] Example 8: Use of recombinant Escherichia coli strain MG1655-1 in tagatose production (1) Synthesis of tagatose by glucose fermentation using recombinant Escherichia coli strain MG1655-1 100 mL of LB medium (10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride, 25 ng / mL kanamycin) was mixed with glucose at a final concentration of 20 g / L. Recombinant E. coli strain MG1655-1 was cultured at 37°C and 200 rpm for 12-24 hours. After fermentation, the sample was centrifuged at 14000 rpm for 20 minutes, filtered through a 0.22 μm microporous filtration membrane, and the filtrate was subjected to HPLC. High-performance liquid chromatography analysis was performed under the following conditions: Apparatus: Agilent High-Performance Liquid Chromatograph 1200, analytical column: HPX-87H, mobile phase: 5 mM H2SO4, flow rate: 0.6 mL / min, column temperature: 60°C, detector: differential refractive index detector, injection volume: 20 μl. After 12 hours of fermentation, the yield of tagatose was 1.0%.

[0208] (2) Synthesis of tagatose by glucose and glycerol fermentation using recombinant Escherichia coli strain MG1655-1 Recombinant E. coli strain MG1655-1 was cultured for 12-24 hours at 37°C and 200 rpm in 100 mL of M9Y medium (10 g / L glycerol, 20 g / L glucose, 6 g / L Na2HPO4, 0.5 g / L NaCl, 3 g / L KH2PO4, 1 g / L NH4Cl, 1 mM MgSO4, 0.1 mM CaCl2, and 2 g / L yeast extract). After fermentation, the sample was centrifuged at 14000 rpm for 20 minutes, filtered through a 0.22 μm microporous filtration membrane, and the filtrate was subjected to HPLC. High-performance liquid chromatography analysis was performed under the following conditions. Equipment: Agilent High Performance Liquid Chromatograph 1200, Analytical column: HPX-87H, Mobile phase: 5 mM H2SO4, Flow rate: 0.6 mL / min, Column temperature: 60°C, Detector: Differential refractive index detector, Injection volume: 20 μl. After 12 hours of fermentation, the yield of tagatose was 1.0%.

[0209] Example 9: Use of recombinant E. coli strain YH1-1 in tagatose production (1) Synthesis of tagatose by glucose fermentation using recombinant E. coli strain YH1-1 100 mL of LB medium (10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride, 25 ng / mL kanamycin) was mixed with glucose at a final concentration of 20 g / L. Recombinant E. coli strain YH1-1 was cultured at 37°C and 200 rpm for 12-24 hours. After fermentation, the sample was centrifuged at 14000 rpm for 20 minutes, filtered through a 0.22 μm microporous filtration membrane, and the filtrate was subjected to HPLC. High-performance liquid chromatography analysis was performed under the following conditions: Apparatus: Agilent High-Performance Liquid Chromatograph 1200, analytical column: HPX-87H, mobile phase: 5 mM H2SO4, flow rate: 0.6 mL / min, column temperature: 60°C, detector: differential refractive index detector, injection volume: 20 μl. After 12 hours of fermentation, the yield of tagatose was 2.0%.

[0210] (2) Synthesis of tagatose by fermentation of glucose and glycerol using recombinant E. coli strain YH1-1 Recombinant E. coli strain YH1-1 was cultured for 12-24 hours at 37°C and 200 rpm in 100 mL of M9Y medium (10 g / L glycerol, 20 g / L glucose, 6 g / L Na2HPO4, 0.5 g / L NaCl, 3 g / L KH2PO4, 1 g / L NH4Cl, 1 mM MgSO4, 0.1 mM CaCl2, and 2 g / L yeast extract). After fermentation, the sample was centrifuged at 14000 rpm for 20 minutes, filtered through a 0.22 μm microporous filtration membrane, and the filtrate was subjected to HPLC. High-performance liquid chromatography analysis was performed under the following conditions. Equipment: Agilent High Performance Liquid Chromatograph 1200, Analytical column: HPX-87H, Mobile phase: 5 mM H2SO4, Flow rate: 0.6 mL / min, Column temperature: 60°C, Detector: Differential refractive index detector, Injection volume: 20 μl. After 12 hours of fermentation, the yield of tagatose was 6.0%.

[0211] Example 10: Use of recombinant E. coli strain YH2-1 in tagatose production (1) Synthesis of tagatose by glucose fermentation using recombinant E. coli strain YH2-1 100 mL of LB medium (10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride, 25 ng / mL kanamycin) was mixed with glucose at a final concentration of 20 g / L, and recombinant E. coli strain YH2-1 was cultured for 12-24 hours at 37°C and 200 rpm. After fermentation, the sample was centrifuged at 14000 rpm for 20 minutes, filtered through a 0.22 μm microporous filtration membrane, and the filtrate was subjected to HPLC. High-performance liquid chromatography analysis was performed under the following conditions: Apparatus: Agilent High-Performance Liquid Chromatograph 1200, analytical column: HPX-87H, mobile phase: 5 mM H2SO4, flow rate: 0.6 mL / min, column temperature: 60°C, detector: differential refractive index detector, injection volume: 20 μl. After 12 hours of fermentation, the yield of tagatose was 2.0%.

[0212] (2) Synthesis of tagatose by fermentation of glucose and glycerol using recombinant E. coli strain YH2-1 Recombinant E. coli strain YH2-1 was cultured for 12-24 hours at 37°C and 200 rpm in 100 mL of M9Y medium (10 g / L glycerol, 20 g / L glucose, 6 g / L Na2HPO4, 0.5 g / L NaCl, 3 g / L KH2PO4, 1 g / L NH4Cl, 1 mM MgSO4, 0.1 mM CaCl2, and 2 g / L yeast extract). After fermentation, the sample was centrifuged at 14000 rpm for 20 minutes, filtered through a 0.22 μm microporous filtration membrane, and the filtrate was subjected to HPLC. High-performance liquid chromatography analysis was performed under the following conditions. Equipment: Agilent High Performance Liquid Chromatograph 1200, Analytical column: HPX-87H, Mobile phase: 5 mM H2SO4, Flow rate: 0.6 mL / min, Column temperature: 60°C, Detector: Differential refractive index detector, Injection volume: 20 μl. After 12 hours of fermentation, the yield of tagatose was 8.0%.

[0213] Example 11: Use of recombinant E. coli strain YH3-2 in tagatose production (1) Synthesis of tagatose by glucose fermentation using recombinant E. coli strain YH3-2 100 mL of LB medium (10 g / L peptone, 5 g / L yeast extract, 5 g / L sodium chloride, 25 ng / mL kanamycin, 100 ng / mL ampicillin) was mixed with glucose at a final concentration of 20 g / L. Recombinant E. coli strain YH3-2 was cultured at 37°C and 200 rpm for 12-24 hours. After fermentation, the sample was centrifuged at 14000 rpm for 20 minutes, filtered through a 0.22 μm microporous filtration membrane, and the filtrate was subjected to HPLC. High-performance liquid chromatography analysis was performed under the following conditions: Apparatus: Agilent High-Performance Liquid Chromatograph 1200, analytical column: HPX-87H, mobile phase: 5 mM H2SO4, flow rate: 0.6 mL / min, column temperature: 60°C, detector: differential refractive index detector, injection volume: 20 μl. After 12 hours of fermentation, the yield of tagatose was 20%.

[0214] (2) Synthesis of tagatose by fermentation of glucose and glycerol using recombinant Escherichia coli strain YH3-2 Recombinant E. coli strain YH3-2 was cultured for 12-24 hours at 37°C and 200 rpm in 100 mL of M9Y medium (10 g / L glycerol, 20 g / L glucose, 6 g / L Na2HPO4, 0.5 g / L NaCl, 3 g / L KH2PO4, 1 g / L NH4Cl, 1 mM MgSO4, 0.1 mM CaCl2, and 2 g / L yeast extract). After fermentation was complete, the sample was centrifuged at 14000 rpm for 20 minutes, filtered through a 0.22 μm microporous filtration membrane, and the filtrate was subjected to HPLC. High-performance liquid chromatography analysis was performed under the following conditions. Equipment: Agilent High Performance Liquid Chromatograph 1200, Analytical column: HPX-87H, Mobile phase: 5 mM H2SO4, Flow rate: 0.6 mL / min, Column temperature: 60°C, Detector: Differential refractive index detector, Injection volume: 20 μl. After 12 hours of fermentation, the yield of tagatose was 30%.

[0215] Example 12: Use of recombinant E. coli strain YH4-2 in tagatose production (1) Synthesis of tagatose by glucose fermentation using recombinant E. coli strain YH4-2 100 mL of LB medium (10 g / L peptone, 5 g / L yeast extract, 5 g / L sodium chloride, 25 ng / mL kanamycin, 100 ng / mL ampicillin) was mixed with glucose at a final concentration of 20 g / L. Recombinant E. coli strain YH4-2 was cultured at 37°C and 200 rpm for 12-24 hours. After fermentation, the sample was centrifuged at 14000 rpm for 20 minutes, filtered through a 0.22 μm microporous filtration membrane, and the filtrate was subjected to HPLC. High-performance liquid chromatography analysis was performed under the following conditions: Apparatus: Agilent High-Performance Liquid Chromatograph 1200, analytical column: HPX-87H, mobile phase: 5 mM H2SO4, flow rate: 0.6 mL / min, column temperature: 60°C, detector: differential refractive index detector, injection volume: 20 μl. After 12 hours of fermentation, the yield of tagatose was 16%.

[0216] (2) Synthesis of tagatose by fermentation of glucose and glycerol using recombinant Escherichia coli strain YH4-2 Recombinant E. coli strain YH4-2 was cultured for 12-24 hours at 37°C and 200 rpm in 100 mL of M9Y medium (10 g / L glycerol, 20 g / L glucose, 6 g / L Na2HPO4, 0.5 g / L NaCl, 3 g / L KH2PO4, 1 g / L NH4Cl, 1 mM MgSO4, 0.1 mM CaCl2, and 2 g / L yeast extract). After fermentation, the sample was centrifuged at 14000 rpm for 20 minutes, filtered through a 0.22 μm microporous filtration membrane, and the filtrate was subjected to HPLC. High-performance liquid chromatography analysis was performed under the following conditions. Equipment: Agilent High Performance Liquid Chromatograph 1200, Analytical column: HPX-87H, Mobile phase: 5 mM H2SO4, Flow rate: 0.6 mL / min, Column temperature: 60°C, Detector: Differential refractive index detector, Injection volume: 20 μl. After 12 hours of fermentation, the yield of tagatose was 32%.

[0217] Example 13: Use of recombinant E. coli strain YH5-2 in tagatose production (1) Synthesis of tagatose by glucose fermentation using recombinant E. coli strain YH5-2 100 mL of LB medium (10 g / L peptone, 5 g / L yeast extract, 5 g / L sodium chloride, 25 ng / mL kanamycin, 100 ng / mL ampicillin) was mixed with glucose at a final concentration of 20 g / L, and recombinant E. coli strain YH5-2 was cultured for 12-24 hours at 37°C and 200 rpm. After fermentation, the sample was centrifuged at 14000 rpm for 20 minutes, filtered through a 0.22 μm microporous filtration membrane, and the filtrate was subjected to HPLC. High-performance liquid chromatography analysis was performed under the following conditions: Apparatus: Agilent High-Performance Liquid Chromatograph 1200, analytical column: HPX-87H, mobile phase: 5 mM H2SO4, flow rate: 0.6 mL / min, column temperature: 60°C, detector: differential refractive index detector, injection volume: 20 μl. After 12 hours of fermentation, the yield of tagatose was 24%.

[0218] (2) Synthesis of tagatose by fermentation of glucose and glycerol using recombinant Escherichia coli strain YH5-2 Recombinant E. coli strain YH5-2 was cultured for 12-24 hours at 37°C and 200 rpm in 100 mL of M9Y medium (10 g / L glycerol, 20 g / L glucose, 6 g / L Na2HPO4, 0.5 g / L NaCl, 3 g / L KH2PO4, 1 g / L NH4Cl, 1 mM MgSO4, 0.1 mM CaCl2, and 2 g / L yeast extract). After fermentation, the sample was centrifuged at 14000 rpm for 20 minutes, filtered through a 0.22 μm microporous filtration membrane, and the filtrate was subjected to HPLC. High-performance liquid chromatography analysis was performed under the following conditions. Equipment: Agilent High Performance Liquid Chromatograph 1200, Analytical column: HPX-87H, Mobile phase: 5 mM H2SO4, Flow rate: 0.6 mL / min, Column temperature: 60°C, Detector: Differential refractive index detector, Injection volume: 20 μl. After 12 hours of fermentation, the yield of tagatose was 60%.

[0219] Example 14: Use of recombinant E. coli strain YH6-2 in tagatose production (1) Synthesis of tagatose by glucose fermentation using recombinant E. coli strain YH6-2 100 mL of LB medium (10 g / L peptone, 5 g / L yeast extract, 5 g / L sodium chloride, 25 ng / mL kanamycin, 100 ng / mL ampicillin) was mixed with glucose at a final concentration of 20 g / L. Recombinant E. coli strain YH6-2 was cultured at 37°C and 200 rpm for 12-24 hours. After fermentation, the sample was centrifuged at 14000 rpm for 20 minutes, filtered through a 0.22 μm microporous filtration membrane, and the filtrate was subjected to HPLC. High-performance liquid chromatography analysis was performed under the following conditions: Apparatus: Agilent High-Performance Liquid Chromatograph 1200, analytical column: HPX-87H, mobile phase: 5 mM H2SO4, flow rate: 0.6 mL / min, column temperature: 60°C, detector: differential refractive index detector, injection volume: 20 μl. After 12 hours of fermentation, the yield of tagatose was 41%.

[0220] (2) Synthesis of tagatose by fermentation of glucose and glycerol using recombinant Escherichia coli strain YH6-2 Recombinant E. coli strain YH6-2 was cultured for 12-24 hours at 37°C and 200 rpm in 100 mL of M9Y medium (10 g / L glycerol, 20 g / L glucose, 6 g / L Na2HPO4, 0.5 g / L NaCl, 3 g / L KH2PO4, 1 g / L NH4Cl, 1 mM MgSO4, 0.1 mM CaCl2, and 2 g / L yeast extract). After fermentation, the sample was centrifuged at 14000 rpm for 20 minutes, filtered through a 0.22 μm microporous filtration membrane, and the filtrate was subjected to HPLC. High-performance liquid chromatography analysis was performed under the following conditions. Equipment: Agilent High Performance Liquid Chromatograph 1200, Analytical column: HPX-87H, Mobile phase: 5 mM H2SO4, Flow rate: 0.6 mL / min, Column temperature: 60°C, Detector: Differential refractive index detector, Injection volume: 20 μl. After 12 hours of fermentation, the yield of tagatose was 79%.

[0221] Figure 4 shows the results of high-performance liquid chromatography analysis of recombinant E. coli strain YH6-2 fermenting glucose and glycerol to produce tagatose. The recombinant E. coli strain can efficiently produce tagatose by utilizing both glucose and glycerol for fermentation, and the components in the fermentation reaction solution are simple, making it easy to separate and purify tagatose.

[0222] Example 15: Construction of recombinant Bacillus subtilis strain YJ8 (1) Construction of the recombinant embedded vector pSS-upp-FR Based on the upp gene sequence of the uracilphosphoribosyltransferase encoding gene derived from Bacillus subtilis 168 in the KEGG database, primers were designed, amplified by PCR, and obtained upstream 500 bp homologous fragments and downstream 500 bp homologous fragments of the uracilphosphoribosyltransferase encoding gene. These were then constructed into the recombinant embedded vector pSS using a simple cloning method, resulting in the recombinant embedded vector pSS-upp-FR.

[0223] (2) Construction of recombinant Bacillus subtilis strain YJ8 Bacillus subtilis strain SCK6 super-competent cells [6] A 200 μL solution was prepared, and the recombinant embedded vector pSS-upp-FR (1 μg) and Bacillus subtilis strain SCK6 supercompetent cells (200 μL) were homogeneously mixed. Subsequently, the mixture was shaken in a 37°C shaker for 90 minutes, and the bacterial suspension was spread onto solid medium LB containing chloramphenicol (5 μg / mL) (yeast extract 5 g / L, peptone 10 g / L, sodium chloride 10 g / L), and incubated in a 37°C incubator for 14-16 hours.

[0224] Positive single crossover transformant colonies grown on chloramphenicol-resistant plates were selected and PCR validation of the colonies was performed. PCR amplification results in two bands, one with a 1000 bp DNA fragment and the other with a 2000 bp DNA fragment (the size of the 1000 bp DNA fragment is the size of the upstream and downstream homology arms of the upp coding gene in the vector pSS-upp-FR, and the size of the 2000 bp DNA fragment is the size of the fragment in the genome that includes the upstream homology arm of the upp coding gene, the upp coding gene, and the downstream homology arm of the upp coding gene), and these were identified as positive clones.

[0225] Positive clones were selected and transferred to LB medium without antibiotics for 8-12 hours of incubation. Subsequently, 200 μL of bacterial suspension was centrifuged to remove the supernatant, and then resuspended in sterile water. This was then spread onto a 5-FU basal salt plate (40% glucose 20.0 ml / L, 4% glutamine 50.0 mL / L, 0.5% histidine 10.0 mL / L, 1% vitamin B1 1.0 mL / L, 20 mM 5-FU 500 μL / L, 10× spizizen 100.0 mL / L, 1000× trace elements 1.0 mL / L) and incubated in a 37°C incubator for 24 hours. The purpose of this step is to promote intramolecular homologous recombination of positive transformants by culturing in LB medium without antibiotics, and to obtain target transformants with upp knocked out by screening culture on 5-FU basal salt medium.

[0226] Multiple colonies were selected from a 5-FU basal salt medium solid plate, and further PCR validation of the colonies was performed. PCR amplification revealed that transformants containing only a 1000 bp DNA fragment were positive clones. PCR sequencing of the transformants confirmed the correct strain, namely a recombinant Bacillus subtilis strain in which the uracil phosphoribosyltransferase coding gene was knocked out, i.e., a recombinant Bacillus subtilis strain lacking uracil phosphoribosyltransferase enzyme activity, which was saved and named YJ8.

[0227] Example 16: Construction of recombinant Bacillus subtilis strain YJ9 (1) Construction of the recombinant embedded vector pSS-ptsG-FR Based on the ptsG gene sequence, which codes for a glucose-specific transfer protein of the PTS system derived from Bacillus subtilis 168, as found in the KEGG database, primers were designed, amplified by PCR, and homologous fragments of the upstream 500 bp and downstream 500 bp of the encoding gene for the glucose-specific transfer protein of the PTS system were obtained. These were then constructed into the recombinant vector pSS using a simple cloning method to obtain the recombinant recombinant vector pSS-ptsG-FR.

[0228] (2) Construction of recombinant Bacillus subtilis strain YJ9 Bacillus subtilis strain YJ8 supercompetent cells (200 μL) were prepared, and the recombinant embedded vector pSS-ptsG-FR (1 μg) was homogeneously mixed with the Bacillus subtilis strain YJ8 supercompetent cells (200 μL). Subsequently, the mixture was incubated in a 37°C shaker for 90 minutes, and the bacterial suspension was spread onto solid medium LB containing chloramphenicol (5 μg / mL) (yeast extract 5 g / L, peptone 10 g / L, sodium chloride 10 g / L), and incubated in a 37°C incubator for 14-16 hours.

[0229] Positive single crossover transformant colonies grown on chloramphenicol-resistant plates were selected and PCR validation of the colonies was performed. PCR amplification results in two bands, one containing a 1000 bp DNA fragment and the other a 2000 bp DNA fragment (the size of the 1000 bp DNA fragment is the size of the upstream and downstream homology arms of the ptsG coding gene in the vector pSS-ptsG-FR, and the size of the 2000 bp DNA fragment is the size of the fragment containing the upstream homology arm of the ptsG coding gene, the ptsG coding gene, and the downstream homology arm of the ptsG coding gene in the genome), and these were identified as positive clones.

[0230] Positive clones were selected and transferred to LB medium without antibiotics for 8-12 hours of incubation. Subsequently, 200 μL of bacterial suspension was centrifuged to remove the supernatant, and then resuspended in sterile water. This was then spread onto a 5-FU basal salt plate (40% glucose 20.0 ml / L, 4% glutamine 50.0 mL / L, 0.5% histidine 10.0 mL / L, 1% vitamin B1 1.0 mL / L, 20 mM 5-FU 500 μL / L, 10× spizizen 100.0 mL / L, 1000× trace elements 1.0 mL / L) and incubated in a 37°C incubator for 24 hours. The purpose of this step was to promote intramolecular homologous recombination of positive transformants by culturing in LB medium without antibiotics, and to obtain target transformants with knocked-out ptsG by screening culture on 5-FU basal salt medium.

[0231] Multiple colonies were selected from a 5-FU basal salt medium solid plate, and further PCR validation of the colonies was performed. PCR amplification revealed that transformants containing only a 1000 bp DNA fragment were positive clones. PCR sequencing of the transformants confirmed the existence of a correct strain, namely a recombinant Bacillus subtilis strain in which the coding gene for the PTS-type glucose-specific transfer protein was knocked out, i.e., a recombinant Bacillus subtilis strain lacking PTS-type glucose-specific transfer protease activity. This strain was preserved and named YJ9.

[0232] Example 17: Construction of recombinant Bacillus subtilis strain YJ10 (1) Construction of the recombinant embedded vector pSS-hprK-FR Based on the hprK gene sequence, which codes for HPr kinase derived from Bacillus subtilis 168, in the KEGG database, primers were designed, amplified by PCR, and homologous fragments of the upstream 500 bp and downstream 500 bp of the HPr kinase coding gene were obtained. These were then constructed into the recombinant embedded vector pSS using a simple cloning method to obtain the recombinant embedded vector pSS-hprK-FR.

[0233] (2) Construction of recombinant Bacillus subtilis strain YJ10 Bacillus subtilis strain YJ9 super-competent cells (200 μL) were prepared, and the recombinant embedded vector pSS-hprK-FR (1 μg) was homogeneously mixed with the Bacillus subtilis strain YJ9 super-competent cells (200 μL). Subsequently, the mixture was incubated in a 37°C shaker for 90 minutes, and the bacterial suspension was spread onto solid medium LB containing chloramphenicol (5 μg / mL) (yeast extract 5 g / L, peptone 10 g / L, sodium chloride 10 g / L), and incubated in a 37°C incubator for 14-16 hours.

[0234] Positive single crossover transformant colonies grown on chloramphenicol-resistant plates were selected and PCR validation of the colonies was performed. PCR amplification results in two bands, one with a 1000 bp DNA fragment and the other with a 2000 bp DNA fragment (the size of the 1000 bp DNA fragment is the size of the upstream and downstream homology arms of the hprK coding gene in the vector pSS-hprK-FR, and the size of the 2000 bp DNA fragment is the size of the fragment in the genome that includes the upstream homology arm of the hprK coding gene, the hprK coding gene, and the downstream homology arm of the hprK coding gene), and these were identified as positive clones.

[0235] Positive clones were selected and transferred to LB medium without antibiotics for 8-12 hours of incubation. Subsequently, 200 μL of bacterial suspension was centrifuged to remove the supernatant, and then resuspended in sterile water. This was then spread onto a 5-FU basal salt plate (40% glucose 20.0 ml / L, 4% glutamine 50.0 mL / L, 0.5% histidine 10.0 mL / L, 1% vitamin B1 1.0 mL / L, 20 mM 5-FU 500 μL / L, 10× spizizen 100.0 mL / L, 1000× trace elements 1.0 mL / L) and incubated in a 37°C incubator for 24 hours. The purpose of this step is to promote intramolecular homologous recombination of positive transformants by culturing in LB medium without antibiotics, and to obtain target transformants with knocked-out ptsG by screening culture on 5-FU basal salt medium.

[0236] Multiple colonies were selected from a 5-FU basal salt medium solid plate, and further PCR validation of the colonies was performed. PCR amplification revealed that transformants containing only a 1000 bp DNA fragment were positive clones. PCR sequencing of the transformants confirmed the existence of a correct strain, namely a recombinant Bacillus subtilis strain in which the HPr kinase coding gene was knocked out, i.e., a recombinant Bacillus subtilis strain lacking HPr kinase enzyme activity. This strain was preserved and named YJ10.

[0237] Example 18: Construction of recombinant Bacillus subtilis strain YJ11 (1) Construction of the recombinant embedded vector pSS-ptsG-FR-glcK-pgi Based on the glcokinase coding gene (glcK) and glucose-6-phosphate isomerase coding gene (pgi) sequences derived from Bacillus subtilis 168, as found in the KEGG database, primers were designed to amplify the glcK and pgi genes. These were then constructed into the recombinant vector pSS-ptsG-FR using a simple cloning method, yielding the recombinant recombinant vector pSS-ptsG-FR-glcK-pgi.

[0238] (2) Construction of recombinant Bacillus subtilis strain YJ11 Super-competent Bacillus subtilis strain YJ10 cells (200 μL) were prepared, and the recombinant embedded vector pSS-ptsG-FR-glcK-pgi (1 μg) was homogeneously mixed with the Bacillus subtilis strain YJ10 super-competent cells (200 μL). Subsequently, the mixture was incubated in a 37°C shaker for 90 minutes, and the bacterial suspension was spread onto solid medium LB containing chloramphenicol (5 μg / mL) (yeast extract 5 g / L, peptone 10 g / L, sodium chloride 10 g / L), and incubated in a 37°C incubator for 14-16 hours.

[0239] Positive single crossover transformant colonies grown on chloramphenicol-resistant plates were selected and PCR validation of the colonies was performed. PCR amplification results obtained two bands, a 2000 bp DNA fragment and a 4000 bp DNA fragment (the size of the 2000 bp DNA fragment is the size of the fragment containing the upstream homology arm of the ptsG coding gene, the ptsG coding gene, and the downstream homology arm of the ptsG coding gene in the genome, and the size of the 4000 bp DNA fragment is the size of the fragment containing the upstream homology arm of the ptsG coding gene, the glcK gene, the pgi gene, and the downstream homology arm of ptsG in the vector pSS-ptsG-FR-glcK-pgi). These were identified as positive clones.

[0240] Positive clones were selected and transferred to LB medium without antibiotics for 8-12 hours of incubation. Subsequently, 200 μL of bacterial suspension was centrifuged to remove the supernatant, and then resuspended in sterile water. This was then spread onto a 5-FU basal salt plate (40% glucose 20.0 ml / L, 4% glutamine 50.0 mL / L, 0.5% histidine 10.0 mL / L, 1% vitamin B1 1.0 mL / L, 20 mM 5-FU 500 μL / L, 10× spizizen 100.0 mL / L, 1000× trace elements 1.0 mL / L) and incubated in a 37°C incubator for 24 hours. The purpose of this step is to promote intramolecular homologous recombination of positive transformants by culturing in LB medium without antibiotics, and to obtain target transformants in which the glcK and pgi genes are incorporated into the ptsG gene site by screening culture in 5-FU basal salt medium.

[0241] Multiple colonies were selected from a 5-FU basal salt medium solid plate, and further PCR verification of the colonies was performed. As a result of PCR amplification, the transformant having only a 4000 bp DNA fragment was a positive clone. As a result of verifying the transformant by PCR sequencing, the correct strain, that is, a Bacillus subtilis recombinant engineering strain in which the coding gene glcK gene sequence of glucokinase and the coding gene pgi of glucose-6-phosphate isomerase were integrated into the ptsG site, that is, a Bacillus subtilis recombinant engineering strain with improved enzyme activities of glucokinase and glucose-6-phosphate isomerase was preserved and named YJ11.

[0242] Example 19 Construction of Bacillus subtilis Recombinant Strain YJ12 (1) Construction of Recombinant Integration Vector pSS-pfkA-FR According to the coding gene pfkA gene sequence of fructose-6-phosphate kinase derived from Bacillus subtilis 168 in the KEGG database, primers were designed and amplified by PCR to obtain a 500 bp homologous fragment upstream and a 500 bp homologous fragment downstream of the coding gene of fructose-6-phosphate kinase, and they were constructed into the integration vector pSS by the simple cloning ligation method to obtain the recombinant integration vector pSS-pfkA-FR.

[0243] (2) Construction of Bacillus subtilis Recombinant Strain YJ12 Bacillus subtilis strain YJ11 supercompetent cells (200 μL) were prepared, and the recombinant integration vector pSS-pfkA-FR (1 μg) and Bacillus subtilis strain YJ11 supercompetent cells (200 μL) were uniformly mixed. Subsequently, they were placed in a 37 °C shaker and resuscitated for 90 min, and the bacterial solution was applied to a solid medium LB (5 g / L yeast extract, 10 g / L peptone, 10 g / L sodium chloride) containing chloramphenicol (5 μg / mL), and placed in a 37 °C incubator and cultured for 14 - 16 h.

[0244] Positive single cross-transformant colonies growing on the chloramphenicol-resistant plate were selected for PCR verification of the colonies. As a result of PCR amplification, transformants with two bands of 1000bp DNA fragment and 2000bp DNA fragment (the size of the 1000bp DNA fragment is the size of the upstream and downstream homologous arm fragments of the pfkA coding gene in the vector pSS-pfkA-FR, and the size of the 2000bp DNA fragment is the size of the fragment containing the upstream homologous arm of the pfkA coding gene, the pfkA coding gene, and the downstream homologous arm of the pfkA coding gene in the genome) were positive clones.

[0245] Positive clones were selected and transferred to LB medium without added antibiotics for 8 - 12 h of culture. Then, 200 μL of the bacterial solution was centrifuged to remove the supernatant, and then resuspended with sterile water and spread on a 5-FU basal salt medium solid plate (40% glucose 20.0 mL / L, 4% glutamine 50.0 mL / L, 0.5% histidine 10.0 mL / L, 1% vitamin B1 1.0 mL / L, 20 mM 5-FU 500 μL / L, 10× spizizen 100.0 mL / L, 1000× trace elements 1.0 mL / L), and placed in a 37 °C incubator for 24 h of culture. The purpose of this step is to promote the homologous recombination within the molecule of the positive transformant by culturing in LB medium without added antibiotics, and to perform screening culture in 5-FU basal salt medium to obtain the target transformant with pfkA knocked out.

[0246] Multiple colonies were selected from the 5-FU basal salt medium solid plate for further PCR verification of the colonies. As a result of PCR amplification, transformants with only a 1000bp DNA fragment were positive clones. The transformants were verified by PCR sequencing, and the correct strain, that is, the recombinant engineering strain of Bacillus subtilis with the coding gene of fructose-6-phosphate kinase knocked out, that is, the recombinant engineering strain of Bacillus subtilis without fructose-6-phosphate kinase enzyme activity, was preserved and named YJ12.

[0247] Example 20: Construction of recombinant Bacillus subtilis strain YJ13 (1) Construction of the recombinant embedded vector pSS-pgm-FR Based on the pgm gene sequence of the phosphoglucumutase encoding gene derived from Bacillus subtilis 168 in the KEGG database, primers were designed, amplified by PCR, and homologous fragments of the upstream 500 bp and downstream 500 bp of the phosphoglucumutase encoding gene were obtained. These were then constructed into the recombinant embedded vector pSS using a simple cloning method to obtain the recombinant embedded vector pSS-pgm-FR.

[0248] (2) Construction of recombinant Bacillus subtilis strain YJ13 Super-competent Bacillus subtilis strain YJ12 cells (200 μL) were prepared, and the recombinant embedded vector pSS-pgm-FR (1 μg) was homogeneously mixed with the Bacillus subtilis strain YJ12 super-competent cells (200 μL). Subsequently, the mixture was incubated in a 37°C shaker for 90 minutes, and the bacterial suspension was spread onto solid medium LB containing chloramphenicol (5 μg / mL) (yeast extract 5 g / L, peptone 10 g / L, sodium chloride 10 g / L), and incubated in a 37°C incubator for 14-16 hours.

[0249] Positive single crossover transformant colonies grown on chloramphenicol-resistant plates were selected and PCR validation of the colonies was performed. PCR amplification results in two bands, one with a 1000 bp DNA fragment and the other with a 2000 bp DNA fragment (the size of the 1000 bp DNA fragment is the size of the upstream and downstream homology arms of the pgm coding gene in the vector pSS-pgm-FR, and the size of the 2000 bp DNA fragment is the size of the fragment in the genome that includes the upstream homology arm of the pgm coding gene, the pgm coding gene, and the downstream homology arm of the pgm coding gene), and these were identified as positive clones.

[0250] Positive clones were selected and transferred to LB medium without antibiotics for 8-12 hours of incubation. Subsequently, 200 μL of bacterial suspension was centrifuged to remove the supernatant, and then resuspended in sterile water. This was then spread onto a 5-FU basal salt plate (40% glucose 20.0 ml / L, 4% glutamine 50.0 mL / L, 0.5% histidine 10.0 mL / L, 1% vitamin B1 1.0 mL / L, 20 mM 5-FU 500 μL / L, 10× spizizen 100.0 mL / L, 1000× trace elements 1.0 mL / L) and incubated in a 37°C incubator for 24 hours. The purpose of this step is to promote intramolecular homologous recombination of positive transformants by culturing in LB medium without antibiotics, and to obtain target transformants with pgm knockout by screening culture on 5-FU basal salt medium.

[0251] Multiple colonies were selected from a 5-FU basal salt medium solid plate, and further PCR validation of the colonies was performed. PCR amplification revealed that transformants containing only a 1000 bp DNA fragment were positive clones. PCR sequencing of the transformants confirmed the correct strain, namely a recombinant Bacillus subtilis strain in which the phosphoglucumutase coding gene was knocked out, and this recombinant Bacillus subtilis strain lacking phosphoglucumutase enzyme activity was preserved and named YJ13.

[0252] Example 21: Construction of recombinant Bacillus subtilis strain YJ14 (1) Construction of the recombinant embedded vector pSS-zwf-FR Based on the zwf gene sequence of the glucose-6-phosphate dehydrogenase encoding gene derived from Bacillus subtilis 168 in the KEGG database, primers were designed, amplified by PCR, and homologous fragments of the upstream 500 bp and downstream 500 bp of the glucose-6-phosphate dehydrogenase encoding gene were obtained. These were then constructed into the recombinant embedded vector pSS using a simple cloning method to obtain the recombinant embedded vector pSS-zwf-FR.

[0253] (2) Construction of recombinant Bacillus subtilis strain YJ14 Bacillus subtilis strain YJ13 super-competent cells (200 μL) were prepared, and the recombinant embedded vector pSS-zwf-FR (1 μg) was homogeneously mixed with the Bacillus subtilis strain YJ13 super-competent cells (200 μL). Subsequently, the mixture was incubated in a 37°C shaker for 90 minutes, and the bacterial suspension was spread onto solid medium LB containing chloramphenicol (5 μg / mL) (yeast extract 5 g / L, peptone 10 g / L, sodium chloride 10 g / L), and incubated in a 37°C incubator for 14-16 hours.

[0254] Positive single crossover transformant colonies grown on chloramphenicol-resistant plates were selected and PCR validation of the colonies was performed. PCR amplification results in two bands, one with a 1000 bp DNA fragment and the other with a 2000 bp DNA fragment (the size of the 1000 bp DNA fragment is the size of the upstream and downstream homology arms of the zwf coding gene in the vector pSS-pgm-FR, and the size of the 2000 bp DNA fragment is the size of the fragment in the genome that includes the upstream homology arm of the zwf coding gene, the zwf coding gene, and the downstream homology arm of the zwf coding gene), and these were identified as positive clones.

[0255] Positive clones were selected and transferred to LB medium without antibiotics for 8-12 hours of incubation. Subsequently, 200 μL of bacterial suspension was centrifuged to remove the supernatant, and then resuspended in sterile water. This was then spread onto a 5-FU basal salt plate (40% glucose 20.0 ml / L, 4% glutamine 50.0 mL / L, 0.5% histidine 10.0 mL / L, 1% vitamin B1 1.0 mL / L, 20 mM 5-FU 500 μL / L, 10× spizizen 100.0 mL / L, 1000× trace elements 1.0 mL / L) and incubated in a 37°C incubator for 24 hours. The purpose of this step is to promote intramolecular homologous recombination of positive transformants by culturing in LB medium without antibiotics, and to obtain target transformants with zwf knocked out by screening culture on 5-FU basal salt medium.

[0256] Multiple colonies were selected from a 5-FU basal salt medium solid plate, and further PCR validation of the colonies was performed. PCR amplification revealed that transformants containing only a 1000 bp DNA fragment were positive clones. PCR sequencing of the transformants confirmed the existence of the correct strain, namely a recombinant Bacillus subtilis strain in which the glucose-6-phosphate dehydrogenase coding gene was knocked out, i.e., a recombinant Bacillus subtilis strain lacking glucose-6-phosphate dehydrogenase enzyme activity. This strain was preserved and named YJ14.

[0257] Example 22: Construction of recombinant Bacillus subtilis strain SKC6-1 (1) Construction of the recombinant expression vector pWB980-T6PE-T6PP Based on the T6PE gene for tagatose-6-phosphate epimerase derived from Agrobacterium tumefaciens str. C58 and the T6PP gene for tagatose-6-phosphate phosphatase derived from Archaeoglobus fulgidus or Archaeoglobus profundus, as found in the KEGG database, primers were designed and amplified by PCR to obtain the gene fragments for tagatose-6-phosphate epimerase and tagatose-6-phosphate phosphatase. These fragments were then constructed into the expression vector pWB980 using a simple cloning method to obtain the recombinant expression vector pWB980-T6PE-T6PP.

[0258] (2) Construction of recombinant Bacillus subtilis strain SCK6-1 Super-competent Bacillus subtilis strain SCK6 cells (200 μL) were prepared, and the recombinant expression vector pWB980-T6PE-T6PP (1 μg) was homogeneously mixed with the SCK6 super-competent cells (200 μL). Subsequently, the mixture was incubated in a 37°C shaker for 90 minutes, and the bacterial suspension was spread onto solid medium LB containing kanamycin (25 μg / mL) (yeast extract 5 g / L, peptone 10 g / L, sodium chloride 10 g / L). The mixture was then incubated in a 37°C incubator for 14-16 hours. Positive single crossover transformants growing on kanamycin-resistant plates were selected, and colony PCR validation was performed. PCR amplification revealed that transformants with a 2000 bp DNA fragment were positive clones. After verifying the transformants by PCR sequencing, we preserved the correct strain, namely a recombinant Bacillus subtilis strain with enhanced tagatose-6-phosphate epimerase and tagatose-6-phosphate phosphatase enzyme activity, and named it SCK6-1.

[0259] By the same method as described above, plasmid pWB980-T6PE-T6PP was introduced into recombinant Bacillus subtilis strains YJ8, YJ9, YJ10, YJ11, YJ12, YJ13, and YJ14 to obtain recombinant engineered Bacillus subtilis strains YJ8-1, YJ9-1, YJ10-1, YJ11-1, YJ12-1, YJ13-1, and YJ14-1, which showed improved tagatose-6-phosphate epimerase and tagatose-6-phosphate phosphatase enzyme activity.

[0260] Example 23: Use of recombinant Bacillus subtilis strain SCK6-1 in the production of Tagatose (1) Synthesis of tagatose by glucose fermentation using recombinant Bacillus subtilis strain SCK6-1 Add glucose with a final concentration of 20 g / L to 100 mL of SR medium (15 g / L peptone, 25 g / L yeast extract, 3 g / L K2HPO4, 25 ng / mL kanamycin). Culture the recombinant Bacillus subtilis engineering strain SCK6-1 at 37 °C and 200 rmp for 12 - 24 h. After fermentation, centrifuge the sample at 14,000 rmp for 20 min, filter it through a 0.22 μm microporous filtration membrane, and perform HPLC on the filtrate. High-performance liquid chromatography analysis was carried out under the following conditions. Instrument: Agilent 1200 high-performance liquid chromatograph, analytical column: HPX-87H, mobile phase: 5 mM H2SO4, flow rate: 0.6 mL / min, column temperature: 60 °C, detector: differential refractive index detector, injection volume: 20 μL. After 12 h of fermentation, the yield of tagatose was 1.0%.

[0261] (2) Synthesis of tagatose by fermentation of glucose and glycerol using the recombinant Bacillus subtilis engineering strain SCK6-1 Add glucose with a final concentration of 20 g / L and glycerol with a final concentration of 20 g / L to 100 mL of SR medium (15 g / L peptone, 25 g / L yeast extract, 3 g / L K2HPO4, 25 ng / mL kanamycin). Culture the recombinant Bacillus subtilis engineering strain SCK6-1 at 37 °C and 200 rmp for 12 - 24 h. After fermentation, centrifuge the sample at 14,000 rmp for 20 min, filter it through a 0.22 μm microporous filtration membrane, and perform HPLC on the filtrate. High-performance liquid chromatography analysis was carried out under the following conditions. Instrument: Agilent 1200 high-performance liquid chromatograph, analytical column: HPX-87H, mobile phase: 5 mM H2SO4, flow rate: 0.6 mL / min, column temperature: 60 °C, detector: differential refractive index detector, injection volume: 20 μL. After 12 h of fermentation, the yield of tagatose was 1.0%.

[0262] Example 24 Use of the recombinant Bacillus subtilis engineering strain YJ8-1 in the production of tagatose (1) Synthesis of tagatose by glucose fermentation using the recombinant Bacillus subtilis engineering strain YJ8-1 100 mL of SR medium (15 g / L peptone, 25 g / L yeast extract, 3 g / L K2HPO4, 25 ng / mL kanamycin) was mixed with glucose at a final concentration of 20 g / L, and recombinant Bacillus subtilis strain YJ8-1 was cultured for 12-24 hours at 37°C and 200 rpm. After fermentation, the sample was centrifuged at 14000 rpm for 20 minutes, filtered through a 0.22 μm microporous filtration membrane, and the filtrate was subjected to HPLC. High-performance liquid chromatography analysis was performed under the following conditions: Apparatus: Agilent High-Performance Liquid Chromatograph 1200, analytical column: HPX-87H, mobile phase: 5 mM H2SO4, flow rate: 0.6 mL / min, column temperature: 60°C, detector: differential refractive index detector, injection volume: 20 μl. After 12 hours of fermentation, the yield of tagatose was 2.0%.

[0263] (2) Synthesis of tagatose by glucose and glycerol fermentation using recombinant Bacillus subtilis strain YJ8-1 100 mL of SR medium (15 g / L peptone, 25 g / L yeast extract, 3 g / L K2HPO4, 25 ng / mL kanamycin) was mixed with 20 g / L glucose and 20 g / L glycerol. Recombinant engineered strain YJ8-1 of Bacillus subtilis was cultured at 37°C and 200 rpm for 12-24 hours. After fermentation, the sample was centrifuged at 14000 rpm for 20 minutes, filtered through a 0.22 μm microporous filtration membrane, and the filtrate was subjected to HPLC. High-performance liquid chromatography analysis was performed under the following conditions: Apparatus: Agilent High-Performance Liquid Chromatograph 1200, analytical column: HPX-87H, mobile phase: 5 mM H2SO4, flow rate: 0.6 mL / min, column temperature: 60°C, detector: differential refractive index detector, injection volume: 20 μl. After 12 hours of fermentation, the yield of tagatose was 2.0%.

[0264] Example 25: Use of recombinant Bacillus subtilis strain YJ9-1 in the production of tagatose (1) Synthesis of tagatose by glucose fermentation using recombinant Bacillus subtilis strain YJ9-1 100 mL of SR medium (15 g / L peptone, 25 g / L yeast extract, 3 g / L K2HPO4, 25 ng / mL kanamycin) was mixed with glucose at a final concentration of 20 g / L, and recombinant Bacillus subtilis strain YJ9-1 was cultured for 12-24 hours at 37°C and 200 rpm. After fermentation, the sample was centrifuged at 14000 rpm for 20 minutes, filtered through a 0.22 μm microporous filtration membrane, and the filtrate was subjected to HPLC. High-performance liquid chromatography analysis was performed under the following conditions: Apparatus: Agilent High-Performance Liquid Chromatograph 1200, analytical column: HPX-87H, mobile phase: 5 mM H2SO4, flow rate: 0.6 mL / min, column temperature: 60°C, detector: differential refractive index detector, injection volume: 20 μl. After 12 hours of fermentation, the yield of tagatose was 2.3%.

[0265] (2) Synthesis of tagatose by glucose and glycerol fermentation using recombinant Bacillus subtilis strain YJ9-1 100 mL of SR medium (15 g / L peptone, 25 g / L yeast extract, 3 g / L K2HPO4, 25 ng / mL kanamycin) was mixed with 20 g / L glucose and 20 g / L glycerol. Recombinant engineered strain YJ9-1 of Bacillus subtilis was cultured at 37°C and 200 rpm for 12-24 hours. After fermentation, the sample was centrifuged at 14000 rpm for 20 minutes, filtered through a 0.22 μm microporous filtration membrane, and the filtrate was subjected to HPLC. High-performance liquid chromatography analysis was performed under the following conditions: Apparatus: Agilent High-Performance Liquid Chromatograph 1200, analytical column: HPX-87H, mobile phase: 5 mM H2SO4, flow rate: 0.6 mL / min, column temperature: 60°C, detector: differential refractive index detector, injection volume: 20 μl. After 12 hours of fermentation, the yield of tagatose was 2.5%.

[0266] Example 26: Use of recombinant Bacillus subtilis strain YJ10-1 in the production of tagatose (1) Synthesis of tagatose by glucose fermentation using recombinant Bacillus subtilis strain YJ10-1 100 mL of SR medium (15 g / L peptone, 25 g / L yeast extract, 3 g / L K2HPO4, 25 ng / mL kanamycin) was mixed with glucose at a final concentration of 20 g / L. Recombinant engineered strain YJ10-1 of Bacillus subtilis was cultured for 12-24 hours at 37°C and 200 rpm. After fermentation, the sample was centrifuged at 14000 rpm for 20 minutes, filtered through a 0.22 μm microporous filtration membrane, and the filtrate was subjected to HPLC. High-performance liquid chromatography analysis was performed under the following conditions: Apparatus: Agilent High-Performance Liquid Chromatograph 1200, analytical column: HPX-87H, mobile phase: 5 mM H2SO4, flow rate: 0.6 mL / min, column temperature: 60°C, detector: differential refractive index detector, injection volume: 20 μl. After 12 hours of fermentation, the yield of tagatose was 2.7%.

[0267] (2) Synthesis of tagatose by glucose and glycerol fermentation using recombinant Bacillus subtilis strain YJ10-1 100 mL of SR medium (15 g / L peptone, 25 g / L yeast extract, 3 g / L K2HPO4, 25 ng / mL kanamycin) was mixed with 20 g / L glucose and 20 g / L glycerol. Recombinant engineered strain YJ10-1 of Bacillus subtilis was cultured at 37°C and 200 rpm for 12-24 hours. After fermentation, the sample was centrifuged at 14000 rpm for 20 minutes, filtered through a 0.22 μm microporous filtration membrane, and the filtrate was subjected to HPLC. High-performance liquid chromatography analysis was performed under the following conditions: Apparatus: Agilent High-Performance Liquid Chromatograph 1200, analytical column: HPX-87H, mobile phase: 5 mM H2SO4, flow rate: 0.6 mL / min, column temperature: 60°C, detector: differential refractive index detector, injection volume: 20 μl. After 12 hours of fermentation, the yield of tagatose was 4.0%.

[0268] Example 27: Use of recombinant Bacillus subtilis strain YJ11-1 in the production of tagatose (1) Synthesis of tagatose by glucose fermentation using recombinant Bacillus subtilis strain YJ11-1 100 mL of SR medium (15 g / L peptone, 25 g / L yeast extract, 3 g / L K2HPO4, 25 ng / mL kanamycin) was mixed with glucose at a final concentration of 20 g / L, and recombinant Bacillus subtilis strain YJ11-1 was cultured for 12-24 hours at 37°C and 200 rpm. After fermentation, the sample was centrifuged at 14000 rpm for 20 minutes, filtered through a 0.22 μm microporous filtration membrane, and the filtrate was subjected to HPLC. High-performance liquid chromatography analysis was performed under the following conditions: Apparatus: Agilent High-Performance Liquid Chromatograph 1200, analytical column: HPX-87H, mobile phase: 5 mM H2SO4, flow rate: 0.6 mL / min, column temperature: 60°C, detector: differential refractive index detector, injection volume: 20 μl. After 12 hours of fermentation, the yield of tagatose was 3.0%.

[0269] (2) Synthesis of tagatose by glucose and glycerol fermentation using recombinant Bacillus subtilis strain YJ11-1 100 mL of SR medium (15 g / L peptone, 25 g / L yeast extract, 3 g / L K2HPO4, 25 ng / mL kanamycin) was mixed with 20 g / L glucose and 20 g / L glycerol. Recombinant engineered strain YJ11-1 of Bacillus subtilis was cultured at 37°C and 200 rpm for 12-24 hours. After fermentation, the sample was centrifuged at 14000 rpm for 20 minutes, filtered through a 0.22 μm microporous filtration membrane, and the filtrate was subjected to HPLC. High-performance liquid chromatography analysis was performed under the following conditions: Apparatus: Agilent High-Performance Liquid Chromatograph 1200, analytical column: HPX-87H, mobile phase: 5 mM H2SO4, flow rate: 0.6 mL / min, column temperature: 60°C, detector: differential refractive index detector, injection volume: 20 μl. After 12 hours of fermentation, the yield of tagatose was 5.0%.

[0270] Example 28: Use of recombinant Bacillus subtilis strain YJ12-1 in the production of tagatose (1) Synthesis of tagatose by glucose fermentation using recombinant Bacillus subtilis strain YJ12-1 100 mL of SR medium (15 g / L peptone, 25 g / L yeast extract, 3 g / L K2HPO4, 25 ng / mL kanamycin) was mixed with glucose at a final concentration of 20 g / L. Recombinant engineered strain YJ12-1 of Bacillus subtilis was cultured for 12-24 hours at 37°C and 200 rpm. After fermentation, the sample was centrifuged at 14000 rpm for 20 minutes, filtered through a 0.22 μm microporous filtration membrane, and the filtrate was subjected to HPLC. High-performance liquid chromatography analysis was performed under the following conditions: Apparatus: Agilent High-Performance Liquid Chromatograph 1200, analytical column: HPX-87H, mobile phase: 5 mM H2SO4, flow rate: 0.6 mL / min, column temperature: 60°C, detector: differential refractive index detector, injection volume: 20 μl. After 12 hours of fermentation, the yield of tagatose was 8.0%.

[0271] (2) Synthesis of tagatose by glucose and glycerol fermentation using recombinant Bacillus subtilis strain YJ12-1 To 100 mL of SR medium (15 g / L peptone, 25 g / L yeast extract, 3 g / L K2HPO4, 25 ng / mL kanamycin), glucose at a final concentration of 20 g / L and glycerol at 20 g / L were added. Recombinant engineered strain YJ12-1 of Bacillus subtilis was cultured for 12-24 hours at 37°C and 200 rpm. After fermentation, the sample was centrifuged at 14000 rpm for 20 minutes, filtered through a 0.22 μm microporous filtration membrane, and the filtrate was subjected to HPLC. High-performance liquid chromatography analysis was performed under the following conditions: Apparatus: Agilent High-Performance Liquid Chromatograph 1200, analytical column: HPX-87H, mobile phase: 5 mM H2SO4, flow rate: 0.6 mL / min, column temperature: 60°C, detector: differential refractive index detector, injection volume: 20 μl. After 12 hours of fermentation, the yield of tagatose was 16.0%.

[0272] Example 29: Use of recombinant Bacillus subtilis strain YJ13-1 in the production of Tagatose (1) Synthesis of tagatose by glucose fermentation using recombinant Bacillus subtilis strain YJ13-1 100 mL of SR medium (15 g / L peptone, 25 g / L yeast extract, 3 g / L K2HPO4, 25 ng / mL kanamycin) was mixed with glucose at a final concentration of 20 g / L, and recombinant Bacillus subtilis strain YJ13-1 was cultured for 12-24 hours at 37°C and 200 rpm. After fermentation, the sample was centrifuged at 14000 rpm for 20 minutes, filtered through a 0.22 μm microporous filtration membrane, and the filtrate was subjected to HPLC. High-performance liquid chromatography analysis was performed under the following conditions: Apparatus: Agilent High-Performance Liquid Chromatograph 1200, analytical column: HPX-87H, mobile phase: 5 mM H2SO4, flow rate: 0.6 mL / min, column temperature: 60°C, detector: differential refractive index detector, injection volume: 20 μl. After 12 hours of fermentation, the yield of tagatose was 16%.

[0273] (2) Synthesis of tagatose by glucose and glycerol fermentation using recombinant Bacillus subtilis strain YJ13-1 100 mL of SR medium (15 g / L peptone, 25 g / L yeast extract, 3 g / L K2HPO4, 25 ng / mL kanamycin) was mixed with 20 g / L glucose and 20 g / L glycerol. Recombinant engineered strain YJ13-1 of Bacillus subtilis was cultured at 37°C and 200 rpm for 12-24 hours. After fermentation, the sample was centrifuged at 14000 rpm for 20 minutes, filtered through a 0.22 μm microporous filtration membrane, and the filtrate was subjected to HPLC. High-performance liquid chromatography analysis was performed under the following conditions: Apparatus: Agilent High-Performance Liquid Chromatograph 1200, analytical column: HPX-87H, mobile phase: 5 mM H2SO4, flow rate: 0.6 mL / min, column temperature: 60°C, detector: differential refractive index detector, injection volume: 20 μl. After 12 hours of fermentation, the yield of tagatose was 35%.

[0274] Example 30: Use of recombinant Bacillus subtilis strain YJ14-1 in the production of tagatose (1) Synthesis of tagatose by glucose fermentation using recombinant Bacillus subtilis strain YJ14-1 100 mL of SR medium (15 g / L peptone, 25 g / L yeast extract, 3 g / L K2HPO4, 25 ng / mL kanamycin) was mixed with glucose at a final concentration of 20 g / L, and recombinant Bacillus subtilis strain YJ14-1 was cultured for 12-24 hours at 37°C and 200 rpm. After fermentation, the sample was centrifuged at 14000 rpm for 20 minutes, filtered through a 0.22 μm microporous filtration membrane, and the filtrate was subjected to HPLC. High-performance liquid chromatography analysis was performed under the following conditions: Apparatus: Agilent High-Performance Liquid Chromatograph 1200, analytical column: HPX-87H, mobile phase: 5 mM H2SO4, flow rate: 0.6 mL / min, column temperature: 60°C, detector: differential refractive index detector, injection volume: 20 μl. After 12 hours of fermentation, the yield of tagatose was 33%.

[0275] (2) Synthesis of tagatose by glucose and glycerol fermentation using recombinant Bacillus subtilis strain YJ14-1 100 mL of SR medium (15 g / L peptone, 25 g / L yeast extract, 3 g / L K2HPO4, 25 ng / mL kanamycin) was mixed with 20 g / L glucose and 20 g / L glycerol. Recombinant engineered strain YJ14-1 of Bacillus subtilis was cultured at 37°C and 200 rpm for 12-24 hours. After fermentation, the sample was centrifuged at 14000 rpm for 20 minutes, filtered through a 0.22 μm microporous filtration membrane, and the filtrate was subjected to HPLC. High-performance liquid chromatography analysis was performed under the following conditions: Apparatus: Agilent High-Performance Liquid Chromatograph 1200, analytical column: HPX-87H, mobile phase: 5 mM H2SO4, flow rate: 0.6 mL / min, column temperature: 60°C, detector: differential refractive index detector, injection volume: 20 μl. After 12 hours of fermentation, the yield of tagatose was 70%.

[0276] Figure 5 shows the results of high-performance liquid chromatography analysis of the recombinant Bacillus subtilis strain YJ14-1 fermenting glucose and glycerol to produce tagatose. The recombinant Bacillus subtilis strain can efficiently produce tagatose by utilizing both glucose and glycerol for fermentation, and moreover, the components in the fermentation reaction solution are simple, making it easy to separate and purify tagatose.

[0277] [5] You, C., Zhang, XZ, & Zhang, YH (2012). Simple cloning via direct transformation of PCR product (DNA Multimer) to Escherichia coli and Bacillus subtilis. Appl. Environ. Microbiol., 78(5), 1593-1595. doi:10.1128 / AEM.07105-11.

[0278] [6] Zhang, XZ, & Zhang, YHP (2011). Simple, fast and high-efficiency transformation system for directed evolution of cellulase in Bacillus subtilis. Microb. Biotechnol., 4(1), 98-105. doi:10.1111 / j.1751-7915.2010.00230.x.

[0279] All technical features disclosed herein can be combined in any way. Each feature disclosed herein may be replaced by another feature having the same, equivalent, or similar function. Therefore, unless otherwise specified, each disclosed feature is merely an example of a set of equivalent or similar features.

[0280] Furthermore, from the above description, those skilled in the art will readily be able to identify the important features of this disclosure, and many modifications can be made to suit various purposes and conditions of use without departing from the spirit and scope of this disclosure, and such modifications are therefore also intended to fall within the scope of the claims.

Claims

1. Recombinant microorganisms for the production of Tagatose, The recombinant microorganisms are derived from Escherichia coli, Corynebacterium glutamicum, Bacillus subtilis, Lactobacillus, or Saccharomyces cerevisiae. The recombinant microorganism is a recombinant microorganism that possesses all of the following characteristics (a) to (c) compared to a wild-type microorganism of the same species and lineage before genetic modification. (a) Reduced or absent protein activity of glucose-specific transfer proteins of the phosphotransferase system and / or expression level of their coding genes (b) Improved enzymatic activity of tagatose-6-phosphate epimerase and / or expression level of its coding gene (c) Improved enzymatic activity of tagatose-6-phosphate phosphatase and / or expression level of its coding gene

2. The glucose-specific transfer protein is The recombinant microorganism according to claim 1, which is a polypeptide (polypeptide) comprising the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 3 and having glucose-specific transfer protein activity.

3. The aforementioned tagatose-6-phosphate epimerase is The recombinant microorganism according to claim 1, which is a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 5 and having tagatose-6-phosphate epimerase activity.

4. The aforementioned tagatose-6-phosphate phosphatase is The recombinant microorganism according to claim 1, which is a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 7 or SEQ ID NO: 54 and having tagatose-6-phosphate phosphatase activity.

5. Compared to wild-type microorganisms, the recombinant microorganisms described above (d) Improved glucokinase enzyme activity and / or expression level of its coding gene, (e) Improved enzyme activity of glucose-6-phosphate isomerase and / or expression level of its coding gene, (f) Decreased or absent enzymatic activity of fructose-6-phosphate kinase and / or expression level of its coding gene, (g) Decreased or absent pyruvate kinase enzyme activity and / or expression level of its coding gene, (h) Decreased or absent enzymatic activity of phosphoglucumutase and / or expression level of its coding gene, (i) Reduced or absent enzyme activity of glucose-6-phosphate dehydrogenase and / or expression level of its coding gene, (j) further having a characteristic shown in at least one of the reduced or absent enzymatic activity of HPr kinase and / or the expression level of its coding gene Recombinant microorganism according to any one of claims 1 to 4.

6. The aforementioned glucokinase is The recombinant microorganism according to claim 5, which is a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 9 or SEQ ID NO: 11 and having glucokinase activity.

7. The glucose-6-phosphate isomerase is The recombinant microorganism according to claim 5, which is a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 13 or SEQ ID NO: 15 and having glucose-6-phosphate isomerase activity.

8. A method for preparing recombinant microorganisms according to any one of claims 1 to 7, The preparation method described above The steps include modifying wild-type microorganisms derived from Escherichia coli, Corynebacterium glutamicum, Bacillus subtilis, Lactobacillus, or Saccharomyces cerevisiae to reduce or eliminate the protein activity of glucose-specific transfer proteins of the phosphotransferase system and / or the expression level of their coding genes, The step of modifying the microorganism to improve the enzymatic activity of tagatose-6-phosphate epimerase and / or the expression level of its coding gene, and improving the enzymatic activity of tagatose-6-phosphate phosphatase and / or the expression level of its coding gene, is included. Method for preparing recombinant microorganisms.

9. A method for producing Tagathos, A method for producing tagatose, comprising the step of carrying out a fermentation reaction using glucose or glucose and glycerol as substrates and recombinant microorganisms as described in any one of claims 1 to 7.

10. The step further includes separating tagatose from the fermentation reaction liquid after the completion of the fermentation reaction. The method for producing Tagathos according to claim 9.