Liver-specific inducible promoters and methods of using them

JP7898477B2Active Publication Date: 2026-08-05ASKLEPIOS BIOPHARMACEUTICAL INC
View PDF 14 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
ASKLEPIOS BIOPHARMACEUTICAL INC
Filing Date
2024-06-25
Publication Date
2026-08-05

Smart Images

  • Figure 0007898477000019
    Figure 0007898477000019
  • Figure 0007898477000020
    Figure 0007898477000020
  • Figure 0007898477000021
    Figure 0007898477000021
Patent Text Reader

Abstract

To provide regulatory sequences to control gene expression in many contexts, regarding therapeutic gene expression in gene therapy and the like, in particular, regulatory sequences that provide inducible gene expression.SOLUTION: The foregoing problem is solved by a gene therapy vector including an expression cassette including a synthetic liver-specific inducible promoter operably linked to a gene, the synthetic liver-specific inducible promoter including a cis-regulatory element (CRE) that is capable of being bound and activated by a heterodimer of CAR and RXR.SELECTED DRAWING: Figure 1
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to liver-specific inducible promoters and vectors, in particular to gene therapy vectors containing these, and methods of using them. [Background technology]

[0002] The following discussion is provided to help readers understand this disclosure and does not constitute any acknowledgment of the content or relevance of the prior art.

[0003] Metabolism by liver microsomal cytochrome P450 enzymes (CYPs) plays a crucial role in the detoxification of xenochemicals such as pharmaceuticals and environmental pollutants. Inducible gene transcription upon exposure to xenochemicals is characteristic of CYPs, and this characteristic enhances the organism's defense against toxicity and carcinogenicity. Based on the discovery of PB induction of the CYP2B gene, PBs have served as prototypes for a large population of structurally and functionally diverse xenochemicals that induce the CYP2B gene. The PB-responsive enhancer module (PBREM) was identified as a 51-bp element in mouse Cyp2b10 and rat CYP2B1, with a nearly identical DNA element identified in rat CYP2B2. The PBREM sequence was also identified in humans, in which case it is associated with CYP2B6. The nuclear receptor heterodimer CAR-RXR was identified as a transactivator of PBREM. (See Negishi et al., "The Repressed Nuclear Receptor CAR Responds to Phenobarbital in Activating the Human CYP2B6 Gene"; J. Biol. Chem 1999, 274: pp. 6043-6046).

[0004] In many fields, including gene therapy, it is desirable to provide regulatory nucleic acid sequences that can drive gene expression to produce protein or nucleic acid expression products within desired cells, tissues, or organs.

[0005] Gene expression in the liver is of particular interest because the liver is involved in a wide range of essential functions in the body, including the synthesis of many proteins involved in metabolism, hemostasis, and protection against infection. Given that many diseases lead to disruption of gene expression in the liver, there is considerable interest in developing gene therapy strategies that enable the generation of therapeutic expression products through the expression of transgenes in the liver. Examples of liver diseases associated with abnormal gene expression include hemophilia (including hemophilia A or B), familial hypercholesterolemia, ornithine transcarbamylase deficiency, alpha-antitrypsin deficiency, hepatitis virus infection, nonviral hepatitis, liver cancer, and various other liver diseases (e.g., non-alcoholic fatty liver disease (NAFLD) and alcohol-related liver disease (ARLD)).

[0006] A key challenge in treating liver disease using gene therapy is the ability to provide liver-specific (also known as liver-specific) therapeutic gene expression. It is known that mammalian hepatocytes can be targeted by injecting DNA or viral vectors into the liver parenchyma, hepatic artery, or portal vein. Adenovirus vectors have also been reported to primarily target the liver in mice. However, adenovirus vectors can also infect other tissues, particularly the lungs and skeletal muscle, resulting in "off-target" effects. Some forms of adeno-associated virus vectors (AAVs) or lentiviral vectors preferentially transduce hepatocytes, but off-target effects also occur here.

[0007] Therefore, it is desirable to provide a system for regulating gene expression in a liver-specific manner. Ideally, such a system would be highly specific to the liver (thereby avoiding or minimizing off-target expression in non-target tissues) and also potent, i.e., driving high expression levels in the liver. The use of cis-acting regulatory elements has been proposed to provide both specificity and activity. Typically, this involves cis-regulating enhancer sequences, i.e., nucleic acid sequences that act cis-acting to enhance promoter activity. Enhancers are usually active regardless of orientation and typically act much closer to the promoter, although they may sometimes act over distances of several kilobases from the promoter.

[0008] It is also desirable to provide a gene expression inducible system so that gene expression can be induced as needed. Inducibility means that the expression of a therapeutic gene expression product can be induced when necessary. Furthermore, if the induction is dose-dependent, the expression level of the therapeutic gene expression product can be modulated by adjusting the amount of inducer administered. [Prior art documents] [Patent Documents]

[0009] [Patent Document 1] U.S. Patent Application Publication No. 2013 / 0280797 [Patent Document 2] U.S. Patent Application Publication No. 2012 / 0077429 [Patent Document 3] U.S. Patent Application Publication No. 2011 / 0280797 [Patent Document 4] U.S. Patent Application Publication No. 2009 / 0305626 [Patent Document 5] U.S. Patent No. 8,298,054 [Patent Document 6] U.S. Patent No. 7,629,167 [Patent Document 7] U.S. Patent No. 5,656,491 [License 8] U.S. Patent No. 4,683,195; [Non-licensed literature]

[0010] [Non-licensed Document 1] Negishi, "The Repressed Nuclear Receptor CAR Responds to Phenobarbital in Activating the Human CYP2B6 Gene"; J. Biol. Chem 1999, 274: 6043~6046 pages [Non-licensed Document 2] Sueyoshi (J. BIOL. CHEM. 274, 10, pages 6043~6046, 1999) [Non-licensed Document 3] HONKAKOSKIら, Molecular Pharmacology, 53:597~601 pages (1998), [Non-licensed Document 4] Cherian "Small-molecule modulators of the constitutive androstane receptor", Expert Opin Drug Metab Toxicol. July 2015; 11(7): 1099~1114 pages [Non-licensed Document 5] Banerjee "Targeting xenobiotic receptors PXR and CAR in human diseases", Drug Discov. Today. May 2015; 20(5): Pages 618~628 [Non-licensed Document 6] Omiecinski, "Multi-species Analyses of Direct Activators of the Constitutive Androstane Receptor" Toxicological Sciences, 123(2), pages 550~562 (2011) [Non-licensed Document 7] Current Protocols in Molecular Biology (Ausubel, 2000, Wiley and son Inc, Library of Congress, USA)

Non - Patent Document 8

Non - Patent Document 9

Non - Patent Document 10

Non - Patent Document 11

Non - Patent Document 12

Non - Patent Document 13

Non - Patent Document 14

Non - Patent Document 15

Non - Patent Document 16

[0011] Therefore, there is a need for regulatory sequences to control gene expression in many situations, particularly in therapeutic gene expression in gene therapy. In particular, there is a need for regulatory sequences that provide inducible gene expression. Regulatory sequences that provide inducible gene expression in the liver are of particular interest. [Means for solving the problem]

[0012] In a first aspect, the present invention provides a gene therapy vector comprising an expression cassette containing a synthetic liver-specific inducible promoter operably linked to a gene, the synthetic liver-specific inducible promoter comprising a cis regulatory element (CRE) that can be bound and activated by a heterodimer of CAR and RXR.

[0013] Constitutive androstane receptors (CARs) are members of the nuclear receptor superfamily and are key regulators of the metabolism of exogenous and endogenous substances. Unlike most nuclear receptors, CARs are constitutively active in the absence of a ligand and are regulated by both agonists and inverse agonists. Activation leads to the translocation of CARs from the cytosol to the nucleus, where the protein can bind to specific DNA sites called response elements. Binding occurs in both CARs and retinoid X receptors (RXRs), both as monomers, resulting in activation or repression of the transcription of target genes.

[0014] The retinoid X receptor (RXR) is a member of the nuclear receptor superfamily that is activated by 9-cis-retinoic acid and 9-cis-13,14-dihydroretinoic acid.

[0015] When CAR is activated (either directly or indirectly), it translocates to the nucleus, and CAR and RXR form a heterodimer (hereinafter referred to as the "CAR-RXR heterodimer" or "CAR-RXR") that can bind to an activating gene containing a suitable target sequence.

[0016] As discussed above, CAR-RXR binds to and induces target genes via the so-called PB-responsive enhancer module (PBREM). Therefore, in some preferred embodiments of the present invention, the CRE that can be bound and activated by a CAR-RXR heterodimer includes the PBREM element or a functional variant thereof.

[0017] The mouse PBREM sequence is described in Sequence ID No. 1. The human PBREM sequence is described in Sequence ID No. 2. In some embodiments of the present invention, the CRE that can be bound and activated by the CAR-RXR heterodimer includes or consists of the functional variant of Sequence ID No. 1 or Sequence ID No. 2, or Sequence ID No. 1 or Sequence ID No. 2. Therefore, in some embodiments, the CRE that can be bound and activated by the CAR-RXR heterodimer includes or consists of the PBREM element or a functional variant thereof.

[0018] Below are the arrangement and alignment of mouse and human PBREM elements:

[0019] [ka]

[0020] As shown, the so-called NR1 motifs are underlined, the NH1 motifs are italicized, and the NR2 motifs are bold (the sequence numbers are shown in parentheses).

[0021] PBREM is a 51-bp DNA-inducible enhancer consisting of two nuclear receptor DR4 motifs (NR1 and NR2) adjacent to the NF1 binding site. As can be seen from this alignment, there is an extremely high level of sequence conservation in the NR1 motif between mouse and human PBREM. The 16bp NR1 motif of human PBREM differs from the mouse NR1 motif by only one base, making NR1 the most conserved sequence between human and mouse PBREM elements. The NR1 sequence is the binding site for the CAR-RXR heterodimer, and it has been suggested in the literature that the remaining sequence is partially or completely redundant. Sueyoshi et al. (J. BIOL. CHEM. Vol. 274, 10, pp. 6043-6046, 1999) showed that the triple repeat of NR1 remains and is inducible. However, it is thought that the parts other than NR1 can play a role in making the PBREM element more specific and inducible (e.g., by reducing background and constitutive expression, enabling greater induction).

[0022] Therefore, a CRE that can be bound and activated by a CAR-RXR heterodimer preferably comprises at least one NR1 motif. Preferably, the NR1 motif comprises or consists of the sequence TGTACT-X-TGACC[C / T](Sequence ID #) (wherein X represents any sequence having a length of 3 to 6 nucleotides (preferably 4 to 5 nucleotides, preferably 4 nucleotides)). In some preferred embodiments, X comprises the sequence TTCC, and preferably comprises or consists of the sequence TTCC or TTTCC. When a nucleotide is shown in square brackets, it indicates that one of the nucleotides shown in square brackets is present at that position.

[0023] In some embodiments, the NR1 motif includes or consists of the sequence TGTACTTTCCTGACCN (SEQ ID NO: 20) (e.g., TGTACTTTCCTGACCT (SEQ ID NO: 3) or TGTACTTTCCTGACCC (SEQ ID NO: 4)), or a sequence different at two or fewer, preferably one or fewer, nucleotide positions from the sequence TGTACTTTCCTGACCN (SEQ ID NO: 20). Preferably, the functional variant of the PBREM element includes the sequence CTGTACTTTCCTGACCN (SEQ ID NO: 21) (e.g., CTGTACTTTCCTGACC[T / C] (SEQ ID NO: 22), i.e., CTGTACTTTCCTGACCT (SEQ ID NO: 23) or CTGTACTTTCCTGACCC (SEQ ID NO: 24)), or a sequence different at two or fewer, preferably one or fewer nucleotide positions from the sequence of SEQ ID NO: 21; this sequence includes a conserved C located at 5' of the NR1 sequence in both human and mouse PBREMs, as shown above. Appropriately, a functional variant of a PBREM sequence may include the sequence NCTGTACTTTCCTGACCNTG (SEQ ID NO: 25) (e.g., [T / A]CTGTACTTTCCTGACC[C / T]TG (SEQ ID NO: 26), TCTGTACTTTCCTGACCTTG (SEQ ID NO: 27), or ACTGTACTTTCCTGACCCTG (SEQ ID NO: 28)), or a sequence containing two or fewer, preferably one or fewer, nucleotide positions from the sequence of SEQ ID NO: 25; this sequence contains two nucleotides located at the 5' and 3' positions, respectively, of the NR1 sequence in both human and mouse PBREMs, as shown above. N represents any nucleotide if present in the nucleic acid sequences herein. When a nucleotide is shown in square brackets, this indicates that one of the nucleotides shown in square brackets is present at that position.

[0024] In some embodiments, the functional variant of the PBREM element appropriately includes two or more, preferably three or more, operablely linked NR1 motif-containing sequences.

[0025] Accordingly, in some embodiments, the CRE that can be bound and activated by the CAR-RXR heterodimer appropriately comprises two or more, preferably three or more, operablely linked NR1 motifs. In some embodiments, the NR1 motifs may be provided adjacent to one another (e.g., in tandem), but they may be directly adjacent to one another or separated by a spacer. Accordingly, the CRE that can be bound and activated by the CAR-RXR heterodimer appropriately comprises the general structure NR1-S-NR1 (wherein NR1 represents any NR1 motif discussed herein, and S represents an optional spacer). The spacer, if present, may have any sequence and can be of any suitable length, for example, 2 to 50, 3 to 40, 4 to 30, 5 to 20, 6 to 10, 7 to 9, or 8 nucleotides in length.

[0026] In some embodiments of the present invention, the CRE that can be bound and activated by a CAR-RXR heterodimer comprises or consists of a functional variant of a PBREM sequence containing one of the following sequences: - [TGTACTTTCCTGACCN-S-] n (Sequence code 29); - [CTGTACTTTCCTGACCN-S-] n (Sequence ID 30); - [NCTGTACTTTCCTGACCNTG-S-] n (Sequence ID 31) (wherein S is an optional spacer, and n is 1 to 5, optionally 2 to 4, and preferably 3). Thus, functional variants of the PBREM sequence may include multimers of NR1 motif-containing sequences. Various preferred NR1 motifs have been discussed above and can, of course, be used in this embodiment. In some embodiments, n is 1 to 10, 1 to 6, or 2 to 4. In some embodiments of the present invention, n is 3.

[0027] In some preferred embodiments, spacers are present between adjacent NR1 motif-containing sequences. If present, the spacers can be of any suitable length, for example, 2 to 50, 3 to 40, 4 to 30, 5 to 20, 6 to 10, 7 to 9, or 8 nucleotides in length.

[0028] In some embodiments of the present invention, the CRE that can be bound and activated by a CAR-RXR heterodimer comprises or consists of a functional variant of a PBREM sequence containing one of the following sequences: - TGTACTTTCCTGACCN-S-TGTACTTTCCTGACCN(Sequence ID 32); - TGTACTTTCCTGACCN-S-TGTACTTTCCTGACCN-S-TGTACTTTCCTGACCN(Sequence ID 33); - CTGTACTTTCCTGACCN-S-CTGTACTTTCCTGACCN(Sequence ID 34); - CTGTACTTTCCTGACCN-S-CTGTACTTTCCTGACCN-S-CTGTACTTTCCTGACCN(Sequence ID 35); - NCTGTACTTTCCTGACCNTG-S-NCTGTACTTTCCTGACCNTG(Sequence No. 36); and - NCTGTACTTTCCTGACCNTG-S-NCTGTACTTTCCTGACCNTG-S-NCTGTACTTTCCTGACCNTG(Sequence ID 37) (In the formula, S is an optional spacer). If present, the spacer can be of any suitable length, for example, 2 to 50, 3 to 40, 4 to 30, 5 to 20, 6 to 10, 7 to 9, or 8 nucleotides in length. Various preferred NR1 motifs have been discussed above and can, of course, be used in this embodiment.

[0029] In some embodiments of the present invention, a CRE that can be bound and activated by a CAR-RXR heterodimer comprises or consists of a functional variant of a PBREM sequence that appropriately includes one of the following sequences: - TCTGTACTTTCCTGACCTTG-S-TCTGTACTTTCCTGACCTTG-S-TCTGTACTTTCCTGACCTTG(Sequence ID 38); or - ACTGTACTTTCCTGACCCTG-S-ACTGTACTTTCCTGACCCTG-S-ACTGTACTTTCCTGACCCTG(Sequence ID 39), (In the formula, S is an optional spacer as described above.)

[0030] In some cases, the spacer may have the sequence GATCGATC (sequence number 40), but any other suitable spacer sequence can be used.

[0031] In other embodiments of the present invention, the CRE that can be bound and activated by a CAR-RXR heterodimer comprises an NR1 element, an NF1 element, and an NR2 element, respectively. Preferably, these are present in the order NR1-NF1-NR2. The NR1 element preferably comprises or consists of the sequences discussed above. The NF1 element preferably comprises or consists of the sequence TGGCACAGTGCCA (SEQ ID NO: 55) or TGAAGAGGTGGCA (SEQ ID NO: 56), or a sequence that differs from SEQ ID NO: 55 or 56 by seven or fewer nucleotides (e.g., 6, 5, 4, 3, 2, or 1 nucleotide). The NR2 element preferably comprises or consists of the sequence TCAACTTGCCTGACAC (SEQ ID NO: 57) or TGGACTTTCCTGAACC (SEQ ID NO: 58), or a sequence that differs from SEQ ID NO: 57 or 58 by five or fewer nucleotides (e.g., 4, 3, 2, or 1 nucleotide).

[0032] In some embodiments of the present invention, the CRE that can be bound and activated by a CAR-RXR heterodimer comprises or consists of a functional variant of a PBREM sequence that is at least 60% identical to either SEQ ID NO: 1 or SEQ ID NO: 2, preferably at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical to either SEQ ID NO: 1 or SEQ ID NO: 2. Mouse PBREM (SEQ ID NO: 1) and human PBREM (SEQ ID NO: 2) are 71% identical along their full length (i.e., 51 nucleotides). Mouse PBREM is still functional in human cells, and human function in PBREM is still functional in mouse cells. Therefore, such a level of overall sequence difference across PBREM elements is acceptable, at least.

[0033] However, as discussed above, it is generally preferable that the NR1 motif is highly conserved and therefore the functional variant of the PBREM sequence is at least 90% identical, preferably at least 95%, and more preferably completely identical to the sequence TCTGTACTTTCCTGACCTTG (SEQ ID NO: 27) or ACTGTACTTTCCTGACCCTG (SEQ ID NO: 28), and is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical to the remainder of SEQ ID NO: 1 or SEQ ID NO: 2. Preferably, the entire sequence is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical to either SEQ ID NO: 1 or SEQ ID NO: 2.

[0034] Therefore, in a preferred embodiment, the CRE that can be bound and activated by the CAR-RXR heterodimer includes or consists of a functional variant of the PBREM sequence, the functional variant being at least 90% identical, preferably at least 95%, and more preferably completely identical, to SEQ ID NO: 1 or SEQ ID NO: 2 in a region spanning nucleotides 3-18 (preferably a region spanning nucleotides 1-20), and also identical by at least 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% over the remainder of SEQ ID NO: 1 or SEQ ID NO: 2 (i.e., nucleotides 1, 2, and 19-51, or nucleotides 21-51). Naturally, the nucleotides are numbered with reference to SEQ ID NO: 1 or SEQ ID NO: 2. Preferably, the entire sequence is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical to either SEQ ID NO: 1 or SEQ ID NO: 2.

[0035] In some preferred embodiments of the present invention, the CRE that can be bound and activated by a CAR-RXR heterodimer has the following sequence: The sequence comprises or consists of NCTGTACTTTCCTGACCNTGNNNNNGTGNCANCATNNACTTNCCTGANNCN (SEQ ID NO: 41), or a sequence that is at least 90%, preferably 95%, more preferably 99%, identical thereto. In this case, identity is calculated with respect to a specifically defined nucleotide, not an undefined "N". Functional variants of the PBREM sequence in which one or more nucleotides identified as N are deleted are specifically contemplated as part of such embodiments of the present invention, for example, in this case up to 7, 6, 5, 4, 3, 2, or 1 nucleotide marked as N are deleted. Furthermore, functional variants of the PBREM sequence in which one or more nucleotides are inserted are specifically contemplated as part of such embodiments of the present invention, for example, in this case up to 7, 6, 5, 4, 3, 2, or 1 nucleotide are inserted. As a specific example, the rat PBREM element from the CYP2B2 gene contains a T inserted between T and C at positions 10-11, i.e., within NR1 of the PBREM element. Nucleotide substitutions, deletions, or insertions in the region outside the NR1 motif appear to be well-tolerated.

[0036] Functional variants of PBREM sequences that more closely resemble wild-type mouse or human PBREM elements (SEQ ID NO: 1 or SEQ ID NO: 2) are considered preferable in some cases because they can demonstrate particularly desirable properties such as low background expression and high levels of inducibility. Such properties are generally desirable when background expression of the gene provided by the vector of the present invention can be minimized, i.e., when no induction of expression occurs.

[0037] In some embodiments of the present invention, a CRE that can be bound and activated by a CAR-RXR heterodimer includes or consists of a portion of a PBREM element from each of two or more different species, preferably from two or more different genera (e.g., two different mammalian species). Such an element may be called a “hybrid PBREM element”. A hybrid PBREM element typically includes all the motifs of a wild-type PBREM element (i.e., the NR1, NF1, and NR2 motifs), but these motifs originate from two or more different species. In some embodiments, a hybrid PBREM element includes a portion from a first species (e.g., the NR1, NF1, and NR2 motifs) and corresponding portions from a second species (e.g., corresponding NR1, NF1, and NR2 motifs). As a non-limiting example, a hybrid PBREM element may include portions of PBREM elements from primates (e.g., humans) and rodents (e.g., mice) (e.g., the NR1, NF1, and NR2 motifs). For example, a hybrid PBREM element may include an NR1 motif from a primate (e.g., human) and an NR2 motif from a rodent (e.g., mouse), or an NR1 motif from a rodent (e.g., mouse) and an NR2 motif from a primate (e.g., human). Each of the primate or rodent NR1 and NR2 motifs can also be combined with an NF1 motif from the corresponding species.

[0038] In some embodiments, the hybrid PBREM element includes one of the following combinations of PBREM motifs: hNR1-mNF1-hNR2; hNR1-mNF1-mNR2; mNR1-hNF1-mNR2; or mNR1-hNF1-hNR2 (wherein "h" indicates a human motif and "m" indicates a mouse motif). Exemplary hybrid PBREM element sequences are underlined in sequence numbers 61-64 of Table 3 (Table 4); naturally, functional variants of these sequences are available, for example, sequences having 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity with the hybrid PBREM element sequences underlined in sequence numbers 61-64, with an optionally higher level of identity in the NR1 motif, as discussed above.

[0039] As discussed above, and without adhering strictly to theory, the induction of gene expression via PBREM elements or their variants is thought to depend on the binding of CAR-RXR heterodimers to the element or variant. The ability of any given CRE that can be bound and activated by CAR-RXR heterodimers, such as a variant of a PBREM element, to function as desired—that is, to be as inducible as the wild-type mouse or human PBREM element, though not necessarily to the same degree—can be easily determined experimentally. For example, a variant CRE can be inserted in place of SEQ ID NO: 1 in the constructs described in the following examples, and the ability of the constructs to induce expression can be compared with that containing SEQ ID NO: 1. For example, a variant CRE can be provided in place of SEQ ID NO: 1 in the PB1-MinTK construct and tested in hepatocytes, preferably primary hepatocytes, in AXOL assay-ready expanded (ARE) hepatocytes (Axol, ax3701) by induction with 1 μM CITCO, as described in Example 2. Alternatively, the variant can be inserted into the pAAV-PB1-MinTk construct, as described in Example 4. Alternatively, the experimental approach used by Sueyoshi et al. (J. BIOL. CHEM. Vol. 274, 10, pp. 6043-6046, 1999) can also be used. Specifically, the relevant putative PBREM variant sequence can be cloned before the tk promoter (BglII site) in a pGL3-Basic vector containing a firefly luciferase reporter gene (Promega), resulting in the PBREM VARIANT-tk-luciferase and reporter gene plasmid.Generally, a functional variant of CRE should provide a level of inducibility of at least 50%, preferably 75%, more preferably 80%, 85%, 90%, or 95%, compared to an equivalent construct containing a wild-type PBREM element, e.g., SEQ ID NO: 1 (measured in terms of a fold increase in expression resulting from induction, i.e., a fold increase in the reported gene expression upon induction is considered to be 50% inducible of a 4-fold increase). Generally, a functional variant provided in place of mouse wild-type PBREM in the above PB1-MinTK construct should, when tested in hepatocytes, preferably primary hepatocytes, for example, in AXOL assay-ready expanded (ARE) hepatocytes (Axol, ax3701) by induction with 1 μM CITCO, as described in Example 2 below, preferably provide at least a 2-fold induction, more preferably a 3-fold, 4-fold, 5-fold, 6-fold, or 7-fold induction. The functional variants preferably result in background expression levels that are no more than 3 times, preferably no more than 2 times, and preferably no more than 1.5 times higher than equivalent constructs containing wild-type mouse PBREM elements (as tested, for example, again in the PB1-MinTK construct and in ARE hepatocytes).

[0040] It is noteworthy that PBREM elements or their functional variants can exist in either direction. Therefore, the reverse complement of the PBREM elements described above forms part of the present invention. It is noteworthy that human PBREM elements naturally exist in the reverse direction compared to mouse PBREM elements, and that human PBREM elements were shown by Sueyoshi et al. (J. BIOL. CHEM. Vol. 274, 10, pp. 6043-6046, 1999) to still be functional in the "reverse" direction (i.e., the same direction as mouse PBREM).

[0041] In some embodiments of the present invention, the synthetic liver-specific inducible promoter appropriately comprises a plurality of CREs, each of which can be bound and activated by a heterodimer of CAR and RXR. Therefore, in some embodiments, the present invention provides a synthetic liver-specific inducible promoter comprising a polymer of CREs, each of which can be bound and activated by a heterodimer of CAR and RXR. Conversely, the synthetic liver-specific inducible promoter appropriately comprises a cis-regulatory module (CRM) comprising a plurality of CREs, each of which can be bound and activated by a heterodimer of CAR and RXR. The CREs that can be bound and activated by a heterodimer of CAR and RXR may be the same or different from each other.

[0042] In such embodiments, the synthetic liver-specific inducible promoter preferably comprises 2 to 10 CREs, each capable of being bound and activated by a heterodimer of CAR and RXR. The inducible promoter preferably comprises 2 to 7 CREs, 2 to 5 CREs, 2 to 4 CREs, or optionally 2 or 3 CREs, and in some embodiments, it is preferable to have 3 CREs, each capable of being bound and activated by a heterodimer of CAR and RXR.

[0043] As discussed above, the CRE that can be bound and activated by a heterodimer of CAR and RXR is preferably a PBREM element or a functional variant thereof. Therefore, in a preferred embodiment, the synthetic liver-specific inducible promoter appropriately comprises two to five, more preferably two to four, and even more preferably three PBREM elements, including SEQ ID NO: 1 or SEQ ID NO: 2, or a functional variant thereof. Various PBREM elements and their functional variants are discussed in detail above.

[0044] In some preferred embodiments of the present invention, the synthetic liver-specific inducible promoter comprises two to four, optionally two or three, operablely linked copies of CRE containing SEQ ID NO: 1 or SEQ ID NO: 2, or a functional variant of SEQ ID NO: 1 or SEQ ID NO: 2.

[0045] CRE, which can be bound and activated by a CAR-RXR heterodimer, can be separated by a spacer sequence. The spacer can have any suitable length, e.g., 2 to 100 nucleotides, 3 to 50 nucleotides, 5 to 30 nucleotides, and 10 to 25 nucleotides. In some embodiments, the spacer is said to be a multiple of 5 in length. Spacers of approximately 20 nucleotides in length have been found to be suitable (e.g., 18 to 22 nucleotides in length).

[0046] In some preferred embodiments of the present invention, the synthetic liver-specific inducible promoter comprises a CRM comprising one of the following sequences: - NCTGTACTTTCCTGACCNTGNNNNNGTGNCANCATNNACTTNCCTGANNCN-S-NCTGTACTTTCCTGACCNTGNNNNNGTGNCANCATNNACTTNCCTGANNCN(Sequence No. 42); or - NCTGTACTTTCCTGACCNTGNNNNNGTGNCANCATNNACTTNCCTGANNCN-S-NCTGTACTTTCCTGACCNTGNNNNNGTGNCANCATNNACTTNCCTGANNCN-S-NCTGTACTTTCCTGACCNTGNNNNNGTGNCANCATNNACTTNCCTGANNCN (SEQ ID NO: 43), (In the formula, S is an optional spacer). Spacers separate adjacent PBREM elements or their functional variants. Spacer options are described above. In some embodiments, spacers are approximately 20 nucleotides in length. Variants containing sequences that are at least 90%, preferably 95%, and more preferably 99%, identical to the PBREM element NCTGTACTTTCCTGACCNTGNNNNNGTGNCANCATNNACTTNCCTGANNCN (SEQ ID NO: 41) also form part of the present invention. In this case, identity is calculated with respect to a specifically defined nucleotide, rather than an indeterminate "N". Functional variants of PBREM sequences in which one or more nucleotides identified as N are deleted are specifically contemplated as part of such embodiments of the present invention, for example, in this case, up to 7, 6, 5, 4, 3, 2, or 1 nucleotide marked as N are deleted. Furthermore, functional variants of PBREM sequences in which one or more nucleotides are inserted are specifically contemplated as part of such embodiments of the present invention, for example, in this case, up to 7, 6, 5, 4, 3, 2, or 1 nucleotide are inserted. As a specific example, the rat PBREM element from the CYP2B2 gene contains a T inserted between T and C at positions 10-11, i.e., within the NR1 of the PBREM element. Nucleotide substitutions, deletions, or insertions in the region outside the NR1 motif appear to be well-tolerated.

[0047] In some preferred embodiments of the present invention, the synthetic liver-specific inducible promoter comprises a CRM comprising one of the following sequences: - TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC-S-TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC (SEQ ID NO: 44); - TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC-S-TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC-S-TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC (SEQ ID NO: 45); - ACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCA-S-ACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCA-S-ACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCA (SEQ ID NO: 46); or - ACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCA-S-ACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCA (SEQ ID NO: 47), (In the formula, S is an optional spacer). The spacer options are listed above. In some embodiments, the spacer is approximately 20 nucleotides in length.

[0048] The synthetic liver-specific inducible promoter of the present invention appropriately contains no nucleic acid sequences at all, or only minimal amounts thereof, that would result in constitutive expression or expression in non-hepatic cells (or, in some cases, in cells that do not express CAR and RXR). Therefore, background expression and expression in non-hepatic cells (or cells that do not express CAR and RXR) are minimized or completely avoided.

[0049] A synthetic liver-specific inducible promoter typically includes a minimal promoter or a proximal promoter, preferably a CRE operably ligated to a minimal promoter, which can be conjugated and activated by a CAR-RXR heterodimer. When a proximal promoter is used, it is preferably liver-specific. Generally, a minimal promoter is preferred because proximal promoters tend to drive at least some background expression. However, in some cases, a certain amount of background expression may be desirable.

[0050] The minimal promoter can be any suitable minimal promoter. A wide range of minimal promoters are known in the art. Suitable minimal promoters include, but are not limited to, the HSV thymidine kinase minimal promoter (MinTK), the CMV minimal promoter (CMVmp), or the SV40 minimal promoter (SV40mp). The minimal promoter may also be a synthetic minimal promoter.

[0051] In some preferred embodiments of the present invention, the synthetic liver-specific inducible promoter comprises a CRE operably linked to a MinTK minimal promoter and capable of being conjugated and activated by a CAR-RXR heterodimer. This combination has been shown to provide a desirable combination with respect to low background expression and inducibility. Some particularly preferred embodiments comprise two or three CREs operably linked to MinTK and capable of being conjugated and activated by a CAR-RXR heterodimer; such promoters are particularly potent inducible with low background.

[0052] In some preferred embodiments of the present invention, the synthetic liver-specific inducible promoter comprises a CRE operably linked to the SV40 minimal promoter and capable of being conjugated and activated by a CAR-RXR heterodimer. This combination has been shown to provide a high level of inducibility, although accompanied by some increase in background expression levels. Particularly preferred embodiments comprise two or three CREs operably linked to the minimal promoter and capable of being conjugated and activated by a CAR-RXR heterodimer; such promoters are particularly potent inducible.

[0053] In some preferred embodiments, a CRE that can be bound and activated by a CAR-RXR heterodimer is separated from the minimal promoter or proximal promoter by a spacer sequence. The spacer sequence can have any suitable length. For example, the spacer between the CRE that can be bound and activated by the CAR-RXR heterodimer (or, if multiple CREs exist, the most proximal CRE) and the minimal promoter or proximal promoter can have a length of 10 to 200 nucleotides. In the embodiments described below, we have successfully used spacers of various lengths (including, for example, 20, 46, 80, and 100 nucleotides).

[0054] In some embodiments of the present invention, the synthetic liver-specific inducible promoter comprises a sequence represented by any one of SEQ ID NOs: 7-18, or a functional variant thereof. The functional variant is preferably at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical to any one of SEQ ID NOs: 7-18. As described above, 90%, 95%, or 99% or more sequence identity in the region corresponding to the NR1 motif is preferred.

[0055] In some preferred embodiments of the present invention, the synthetic liver-specific inducible promoter comprises the sequence of SEQ ID NO: 7, SEQ ID NO: 10, SEQ ID NO: 11, or SEQ ID NO: 12, or a functional variant thereof. The functional variant is preferably at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical to any one of SEQ ID NO: 7, SEQ ID NO: 10, SEQ ID NO: 11, or SEQ ID NO: 12. As described above, 90%, 95%, or 99% or more sequence identity in the region corresponding to the NR1 motif is preferred. These promoters comprise 1, 2, 3, and 4 copies of the mouse PBREM linked to the MinTK minimal promoter, respectively. SEQ ID NO: 10 and SEQ ID NO: 11, or their functional variants, are particularly preferred embodiments of the present invention in view of their particularly desirable properties regarding high inducibility combined with low background expression levels.

[0056] In some embodiments of the present invention, the synthetic liver-specific inducible promoter comprises or consists of a sequence, or a functional variant thereof, of any one of SEQ ID NOs: 59 to 71. The functional variant is preferably at least 60%, 70%, 80%, 90%, 95%, or 99% identical to any one of SEQ ID NOs: 59 to 71. As described above, 90%, 95%, or 99% or more sequence identity in the region corresponding to the NR1 motif is preferred.

[0057] In some preferred embodiments of the present invention, the synthetic liver-specific inducible promoter comprises the sequence of any one of SEQ ID NOs. 68, 69, 70, or 71, or a functional variant thereof. The functional variant is preferably at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical to any one of SEQ ID NOs. 60 or 61. As described above, 90%, 95%, or 99% or greater sequence identity in the region corresponding to the NR1 motif is preferred. These promoters comprise a 2×MHM element or a 3×human PBREM element.

[0058] Suitablely, the expression cassette includes a sequence that provides or codes for one or more, preferably all, of a ribosome binding site, a start codon, a stop codon, and a transcription termination sequence. Suitablely, the expression cassette includes a nucleic acid that codes for a post-transcriptional regulatory element. Suitablely, the expression cassette includes a nucleic acid that codes for a poly(A) element.

[0059] The genes used in this invention typically encode a desired gene expression product, such as a polypeptide (protein) or RNA. The gene may be a full-length cDNA or genomic DNA sequence, or any fragment, subunit, or variant thereof having at least a desired portion of biological activity.

[0060] If a gene codes for a protein, the protein can be essentially any type of protein. Non-limiting examples include enzymes, antibodies or antibody fragments (e.g., monoclonal antibodies), viral proteins (e.g., REP, CAP, REV, VSV-G, or RD114), therapeutic proteins, or toxic proteins (e.g., caspases 3, 8, or 9).

[0061] In some preferred embodiments of the present invention, the gene encodes a therapeutic expression product, preferably a therapeutic protein suitable for use in the treatment of a liver-related disease or condition. Such a gene may be called a “therapeutic gene.” The therapeutic expression product may be a protein, such as a secreted protein, for example, a coagulation factor (e.g., factor IX or factor VIII), cytokines, growth factors, antibodies or nanobodies, chemokines, plasma factors, insulin, erythropoietin, lipoprotein lipase, or toxic proteins. Alternatively, the therapeutic expression product may be RNA such as siRNA or miRNA.A non-exclusive list of therapeutic expression products (and encoding sequences) intended for use in the present invention includes: Factor VIII, Factor IX, Factor VII, Factor X, von Willebrand factor, erythropoietin (EPO), interferon-a, interferon-B, interferon-y, interleukin-1 (IL-1), interleukin-2 (IL-2), interleukin-3 (IL-3), interleukin-4 (IL-4), interleukin-5 (IL-5), interleukin-6 (IL-6), inter - Leukin-7 (IL-7), Interleukin-8 (IL-8), Interleukin-9 (IL-9), Interleukin-10 (IL-10), Interleukin-11 (IL-11), Interleukin-12 (IL-12), Chemokine (CXC motif) ligand 5 (CXCL5), Granulocyte colony-stimulating factor (G-CSF), Granulocyte-macrophage colony-stimulating factor (GM-CSF), Macrophage colony-stimulating factor (M-CSF), Stem cell factor (SCF), Keratinocyte growth factor (KGF), Monocyte chemoattractant protein-1 (MC P-1), tumor necrosis factor (TNF), afamine (AFM), α1-antitrypsin, α-galactosidase A, α-L-idronidase, ATP7b, ornithine transcarbamoylase, phenylalanine hydroxylase, lipoprotein lipase, aromatic amino acid decarboxylase (AADC), ATPase myoplasty / endoplasmic reticulum Ca2+ transport 2 (ATP2A2), cystic fibrosis membrane conductance regulator (CTFR), glutamate decarboxylase 65kDa protein (GAD65), glutamate decarboxylase -ase 67kDa protein (GAD67), lipoprotein lipase (LPL), nerve growth factor (NGF), neurturin (NTN), porphobilinogen deaminase (PBGD), sarcoglycan alpha (SGCA), soluble fms-like tyrosine kinase-1 (sFLT-1), apoliprotein, low-density lipoprotein receptor (LDL-R), albumin, glucose-6-phosphatase, antibodies, nanobodies, aptamers, antiviral dominant-negative proteins, and their functional fragments, subunits, or variants.Preferably, the protein is a primate protein, more preferably a human protein.

[0062] The target protein or polypeptide may, for example, be: antibodies, enzymes or fragments thereof, viral proteins, cytokines, lymphokines, adhesion molecules, receptors and their derivatives or fragments, protein antibiotics, toxin fusion proteins, carbohydrate-protein conjugates, structural proteins, regulatory proteins, vaccines and vaccine-like proteins or particles, process enzymes, growth factors, hormones, and any other polypeptides that can function as agonists or antagonists and / or have therapeutic or diagnostic applications. According to one preferred embodiment, the protein is an immunoglobulin, preferably an antibody or antibody fragment, most preferably a Fab antibody or scFv antibody. According to another preferred embodiment, the protein is a viral protein.

[0063] In some embodiments of the present invention, the synthetic liver-specific expression cassette includes a gene encoding a site-specific nuclease, such as a meganuclease, zinc finger nuclease (ZFN), activator-like effector-based nuclease (TALEN), or a clustered, regularly spaced, short palindromic repeat (CRISPR-Cas) system, which is useful for gene editing. The site-specific nuclease is appropriately adapted to edit a desired target genomic locus by cleaving (typically site-specific double-strand breaks) and then repairing it via non-homologous end joining (NHEJ) or homology-dependent repair (HDR) to result in the desired editing. The editing may be partial or complete repair of a dysfunctional gene, or it may be knockdown or knockout of a functional gene.

[0064] The target product may also be nucleic acids, such as RNA, such as antisense RNA, microRNA, siRNA, tRNA, rRNA, guide RNA, or any other regulatory, therapeutic, or otherwise useful RNA.

[0065] In some preferred embodiments of the present invention, the gene therapy vector is a viral vector, such as a retrovirus, lentivirus, adenovirus, or adeno-associated virus (AAV) vector, but other forms of gene therapy vectors are also intended. In some preferred embodiments, the vector is an AAV vector. In some preferred embodiments, the AAV has a serotype suitable for hepatic transduction. In some embodiments, the AAV is selected from the group consisting of AAV2, AAV5, AAV6, AAV7, AAV8, AAV9, or derivatives thereof. To resolve one of the limiting steps in AAV transduction, the AAV vector is appropriately used as a self-complementary double-stranded AAV vector (scAAV) (i.e., conversion from single-stranded to double-stranded AAV), but the use of a single-stranded AAV vector (ssAAV) is also encompassed herein. In some embodiments of the present invention, the AAV vector is a chimeric and therefore means to contain components derived from at least two AAV serotypes, such as the ITR of AAV2 or the capsid protein of AAV5.

[0066] In some embodiments of the present invention, the vector is a plasmid. Such a plasmid may contain a variety of other functional nucleic acid sequences, such as one or more selection markers, one or more origins of replication, polycloning sites, etc.

[0067] In another aspect, the present invention provides an expression cassette comprising a synthetic liver-specific inducible promoter operably linked to a gene, comprising a CRE that can be conjugated and activated by a heterodimer of CAR and RXR. Various synthetic inducible promoters have been discussed above in the context of gene therapy vectors and can be used in this aspect of the present invention. Accordingly, the present invention also incorporates the synthetic liver-specific promoter described in relation to the first aspect into the expression cassette, both in the context of gene therapy vectors (as detailed above) and other contexts.

[0068] In some embodiments of the present invention, the expression cassette is present in the expression vector for expression in eukaryotic cells. Examples of eukaryotic expression vectors include, but are not limited to, pW-LNEO, pSV2CAT, pOG44, pXTl, and pSG available from Stratagene; pSVK3, pBPV, pMSG, and pSVL available from Amersham Pharmacia Biotech; and pCMVDsRed2-express, pIRES2-DsRed2, pDsRed2-Mito, and pCMV-EGFP available from Clontech. Many other vectors are well known and commercially available. In the case of adenovirus vectors for mammalian cells, the pSV and pCMV series vectors are particularly well known non-limiting examples. There are many well known yeast expression vectors, including, but are not limited to, yeast integration plasmids (YIp) and yeast replication plasmids (YRp). In the case of plants, the Agrobacterium Ti plasmid is an exemplary expression vector, and plant viruses also provide suitable expression vectors, such as tobacco mosaic virus (TMV), potato virus X, and cowpea mosaic virus.

[0069] In embodiments of this present aspect of the present invention, the gene is preferably not a reporter gene. Appropriately, the gene encodes a therapeutic expression product (e.g., as discussed above) or another expression product useful in industry or research. Therefore, in some preferred embodiments of the present invention, the expression cassette is preferably for the expression of a product that is not a reporter (e.g., a fluorescent protein, a luminescent protein, or a chromogenic protein), and is preferably for the expression of a therapeutic expression product. Various suitable expression products are discussed above. Further useful expression products will be apparent to those skilled in the art.

[0070] In another aspect, the present invention also provides a synthetic liver-specific inducible promoter comprising CRE that can be conjugated and activated by a heterodimer of CAR and RXR. Various synthetic inducible promoters discussed above in the context of gene therapy vectors are considered embodiments of this aspect of the present invention. In other words, the various promoters described above are considered embodiments of this aspect of the present invention, regardless of whether or not they are in the context of gene therapy vectors. In particular, various synthetic liver-specific inducible promoters having beneficial properties and not disclosed in the art are disclosed. These have practical applications in gene therapy, but also have broad practical applications in other situations such as cell culture and bioprocessing, as will be discussed further below.

[0071] In particular, but not exclusively, embodiments of this aspect of the present invention include a synthetic liver-specific inducible promoter comprising the sequence of any one of SEQ ID NOs: 7-18, or a functional variant thereof. The functional variant is preferably at least 60%, 70%, 80%, 90%, 95%, or 99% identical to any one of SEQ ID NOs: 7-18. As described above, 90%, 95%, or 99% or greater sequence identity in the region corresponding to the NR1 motif is preferred.

[0072] In some preferred embodiments, the synthetic liver-specific inducible promoter comprises the sequence of SEQ ID NO: 7, SEQ ID NO: 10, SEQ ID NO: 11, or SEQ ID NO: 12, or a functional variant thereof. The functional variant is preferably at least 60%, 70%, 80%, 90%, 95%, or 99% identical to one of SEQ ID NO: 7, SEQ ID NO: 10, SEQ ID NO: 11, or SEQ ID NO: 12. These promoters comprise one, two, three, and four copies of the mouse PBREM ligated to the MinTK minimal promoter, respectively.

[0073] In some embodiments of the present invention, the synthetic liver-specific inducible promoter comprises or consists of a sequence, or a functional variant thereof, of any one of SEQ ID NOs: 59 to 71. The functional variant is preferably at least 60%, 70%, 80%, 90%, 95%, or 99% identical to any one of SEQ ID NOs: 59 to 71. As described above, 90%, 95%, or 99% or more sequence identity in the region corresponding to the NR1 motif is preferred.

[0074] In some preferred embodiments of the present invention, the synthetic liver-specific inducible promoter comprises the sequence of any one of SEQ ID NOs. 68, 69, 70, or 71, or a functional variant thereof. The functional variant is preferably at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical to any one of SEQ ID NOs. 90%, 95%, or 99% sequence identity in the region corresponding to the NR1 motif is preferred. These promoters comprise a 2×MHM element or a 3×human PBREM element.

[0075] In further aspects of the present invention, a CRE is provided which can be bound and activated by a CAR-RXR heterodimer, comprising or consisting of a functional variant of the PBREM element. Preferably, the variant PBREM is a variant of PBREM that does not exist in nature, i.e., it comprises a sequence that does not exist in nature. For example, the variant does not contain the sequence of the human, mouse, or rat PBREM element (e.g., SEQ ID NO: 1 or SEQ ID NO: 2). Various non-natural CREs that can be bound and activated by a CAR-RXR heterodimer are described above in relation to the first aspect of the present invention and provide exemplary embodiments of this aspect.

[0076] In some embodiments, the CRE of the present invention includes or consists of a hybrid PBREM element, as discussed above. As a non-limiting example, the hybrid PBREM element may include a portion of PBREM elements from primates (e.g., humans) and rodents (e.g., mice). For example, the hybrid PBREM element may include an NR1 motif from humans and an NR2 motif from mice, or an NR1 motif from mice and an NR2 motif from humans. Each of the mouse or human NR1 and NR2 motifs may also be combined with an NF1 motif from the corresponding species. In some embodiments, the hybrid PBREM element includes one of the following combinations of PBREM motifs: hNR1-mNF1-hNR2; hNR1-mNF1-mNR2; mNR1-hNF1-mNR2; or mNR1-hNF1-hNR2 (wherein "h" represents a human motif and "m" represents a mouse motif). Exemplary hybrid PBREM element sequences are underlined in sequence numbers 61-64 of Table 3 (Table 4); naturally, functional variants of these sequences, such as sequences having 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity with the hybrid PBREM element sequences underlined in sequence numbers 61-64, can be used.

[0077] In some embodiments, the CRE that can be bound and activated by the CAR-RXR heterodimer is one of the following sequences: ACTGTACTTTCCTGACCCTGAAGAGACTGTACTTTCCTGACCCTGAAGAGACTGTACTTTCCTGACCCTGAAGAG(Sequence #; Human NR1x3); ACTGTACTTTCCTGACCCTGGCACAGTGCCACCATGGACTTTCCTGAACCA(Sequence ID 72; HMH Hybrid); ACTGTACTTTCCTGACCCTGGCACAGTGCCACCATCAACTTGCCTGACACC(Sequence ID 73; HMM Hybrid); TCTGTACTTTCCTGACCTTGAAGAGGTGGCACCATCAACTTGCCTGACACC(Sequence ID 74; MHM Hybrid); or TCTGTACTTTCCTGACCTTGAAGAGGTGGCAGCATGGACTTTCCTGAACCA (Sequence ID 75; MHH Hybrid), or include or consist of functional variants thereof. A functional variant appropriately includes a sequence that is 80%, 90%, 95%, or 99% identical to any of the aforementioned sequences.

[0078] Further aspects of the present invention provide a CRM comprising two or more CREs that can be bound and activated by a CAR-RXR heterodimer, comprising or consisting of a functional variant of a PBREM element. Various CRMs comprising two or more CREs that can be bound and activated by a CAR-RXR heterodimer are described above and in relation to the first aspect of the present invention, providing exemplary embodiments of this aspect. In some embodiments, the CRM comprises at least one non-natural CRE, e.g., at least one hybrid CRE, as discussed above.

[0079] In some embodiments, the CRM is one of the following sequences: TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC-S-CTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC (SEQ ID NO: 76; 2x Mouse PBREM CRE); 3x MousePBREMCRE); CTGTACTTTCCTGACCTTGAAGAGGTGGCACCATCAACTTGCCTGACACC-S-TCTGTACTTTCCTGACCTTGAAGAGGTGGCACCATCAACTTGCCTGACACC(Sequence ID 78; 2x MHM Hybrid CRE); ACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCA-S-ACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCA (SEQ ID NO: 79; 2x human PBREM CRE); ACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCA-S-ACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCA-S-ACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCA (SEQ ID NO: 80; 3x human PBREM CRE), or include any of those functional variants. A functional variant appropriately includes a sequence that is 80%, 85%, 90%, 95%, or 99% identical to any of the aforementioned sequences (wherein S is an optional spacer). If present, the spacer can have any suitable length, e.g., 2 to 100 nucleotides, 3 to 50 nucleotides, 5 to 30 nucleotides, and 10 to 25 nucleotides. In some embodiments, the spacer is said to be a multiple of 5 in length. Spacers with a length of approximately 20 nucleotides have been found to be suitable (e.g., 18 to 22 nucleotides in length).

[0080] In some embodiments, CRM is one of the following sequences: TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACCCATTACTCGCATCCATTCTCTCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC (SEQ ID NO: 81; 2x Mouse PBREM CRE); TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACCCATTACTCGCATCCATTCTCTCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACCGCACTGAAGGTCCT CAATCGTCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACCCTGACCTCCTGCCAGCAATATCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC (SEQ ID NO: 82; 3x Mouse PBREM) CTGTACTTTCCTGACCTTGAAGAGGTGGCACCATCAACTTGCCTGACACCCATTACTCGCATCCATTCTCTCTGTACTTTCCTGACCTTGAAGAGGTGGCACCATCAACTTGCCTGACACC (SEQ ID NO: 83; 2x MHM hybrid); ACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCACATTACTCGCATCCATTCTCACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCA(Sequence ID 84; 2x Human PBREM); or ACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCACATTACTCGCATCCATTCTCACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCAGCACTGAAGGTCCTCAATCGACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCA (SEQ ID NO: 85; 3x human PBREM), or include any of those functional variants. A functional variant appropriately includes a sequence that is 80%, 90%, 95%, or 99% identical to any of the aforementioned sequences.

[0081] In one embodiment, a cis-regulatory element, cis-regulatory module, or promoter, or variant thereof, presented herein may promote or drive gene expression in non-liver or non-liver-derived tissues (e.g., spleen, muscle, heart, lung, and brain). Gene expression in non-liver tissue may be exclusive or aggravating to expression in liver cells. If gene expression is driven in both non-liver and liver tissue, the expression level in non-liver tissue may be equal to or greater than the expression level in liver tissue. For example, a promoter, or variant thereof, presented herein may drive equal gene expression in the liver and heart.

[0082] In a further embodiment, the present invention provides recombinant virions (viral particles) comprising a gene therapy vector according to the present invention. The virions may be, for example, AAV particles, retroviral particles, lentiviral particles, or any other form of gene therapy virus particles.

[0083] The gene therapy vector or virion of the present invention can be formulated into a pharmaceutical composition with pharmaceutically acceptable excipients, i.e., one or more pharmaceutically acceptable carrier substances and / or additives, such as buffers, carriers, excipients, stabilizers, etc. The pharmaceutical composition can be provided in the form of a kit.

[0084] Accordingly, in a further embodiment, the present invention provides a pharmaceutical composition comprising the gene therapy vector or virion described above. The gene therapy vector or virion of the present invention can be formulated into a pharmaceutical composition together with pharmaceutically acceptable excipients, i.e., one or more pharmaceutically acceptable carrier substances and / or additives, such as buffers, carriers, excipients, stabilizers, etc. The pharmaceutical composition can be provided in the form of a kit.

[0085] A further aspect of the present invention provides cells comprising a gene therapy vector, expression cassette, promoter, CRE, or CRM according to various aspects of the present invention.

[0086] Appropriately, the cell is a eukaryotic cell. A eukaryotic cell can appropriately be a fungal cell (e.g., a yeast cell), an animal (metazoan) cell (e.g., a mammalian cell), or a plant cell. Alternatively, the cell may be a prokaryotic cell.

[0087] In some embodiments of the present invention, the cells are ex vivo, for example, in cell culture. In other embodiments of the present invention, the cells may be part of a tissue or a multicellular organism.

[0088] In preferred embodiments, the cells are hepatocytes, which may be ex vivo or in vivo. The hepatocytes may be primary hepatocytes or cells from a liver-derived cell line, such as an immortalized cell line. The cells may be present in the liver tissue environment (e.g., within the liver), isolated from liver tissue, or, for example, in cell culture. Preferably, the cells are human cells. Generally, hepatocytes express both CAR and RXR. However, some liver-derived cell lines do not express CAR (e.g., Huh7 cell line), in which case it is necessary to supply exogenous CAR. This can be done by supplying the cells with a suitable expression construct containing a promoter, such as a nucleic acid encoding CAR operably linked to a constitutively active promoter. Suitable approaches are known in the art and are described in the examples.

[0089] In some embodiments, the cells are modified to express CAR and / or RXR. Preferably, in such embodiments, the cells are those that do not normally express CAR, RXR, or both CAR and RXR. Preferably, the cells are not liver cells. Therefore, in some embodiments of the present invention, the promoter, expression cassette, and vector of the present invention are used in non-liver cells, which do not normally express CAR and / or RXR (i.e., in their native state); therefore, the promoter of the present invention would not normally be active in such cells. However, the cells can be modified to express CAR and RXR, and thus the promoter can be induced. In non-limiting examples, the cells may be primary cells of any type of animal or animal cell lines.

[0090] Gene therapy vectors, expression cassettes, promoters, CREs, or CRMs according to various aspects of the present invention may be inserted into the genome of a cell or present in an episomal vector.

[0091] Cells suitable for the present invention include, but are not limited to, eukaryotic cells such as yeast, plant, insect, or mammalian cells. For example, the cells may be any type of differentiated cell, and may be oocytes, embryonic stem cells, hematopoietic stem cells, or other forms. In some embodiments, the cells are animal (metazoan) cells (e.g., mammalian cells). In some preferred embodiments, the cells are liver cells (e.g., Huh7 cells, HepaRG cells, HEPG2 cells, etc.; a wide range of liver cells are available from ATCC, DSMZ, and other sources). In some embodiments, the cells are mammalian cells. In some embodiments, the mammalian cells are human, ape, mouse, rat, rabbit, hamster, goat, cattle, sheep, or pig cells. Preferred cells or "host cells" for producing the desired product are human, mouse, rat, monkey, or rodent cell lines. Hamster cells are preferred in some embodiments, e.g., BHK21, BHK TK - The cells are CHO, CHO-K1, CHO-DUKX, CHO-DUKX B1, CHO-S, and CHO-DG44, or derivatives / offspring of any of these cell lines. In alternative embodiments, the cells may be human cells. In preferred embodiments, the human cells may be human fetal kidney (HEK) cells, preferably HEK293 cells. In another preferred embodiment of the present invention, the cells may be retinal cells, e.g., retinal pigment epithelium (RPE) cells, e.g., ARPE-19 (ATCC CRL-2302). Furthermore, mouse myeloma cells, preferably NS0 and Sp2 / 0 cells, or derivatives / offspring of any of these cell lines are also well known as cell lines that produce biopharmaceutical proteins. A non-limiting list of cell lines that can be used in the present invention and sources from which they can be obtained is summarized in Table 1 (Table 2). Suitable host cells are commercially available from cell culture preservation institutions such as DSMZ (Deutsche Sammlung von Mikroorganismen and Zeilkuituren GmbH, Braunschweig, Germany) and the American Type Culture Collection (ATCC).

[0092] For bioprocessing applications, it is preferable to establish, adapt, and fully culture cells under serum-free conditions in a medium that optionally contains no animal-derived proteins / peptides. Commercially available media, such as Ham F12 (Sigma, Deisenhofen, Germany), RPMI-1640 (Sigma), Dulbecco's Modified Eagle Medium (DMEM; Sigma), Eagle's Minimum Essential Medium (MEM; Sigma), Iskov's Modified Dulbecco Medium (IMDM; Sigma), CD-CHO (Invitrogen, Carlsbad, CA), CHO-S-SFMII (Invitrogen), Serum-Free CHO Medium (Sigma), Protein-Free CHO Medium (Sigma), EX-CELL Medium (SAFC), CDM4CHO and SFM4CHO (HyClone), are suitable exemplary nutrient solutions. Any culture medium can be supplemented with various compounds as needed, examples of which include hormones and / or other growth factors (e.g., insulin, transferrin, epidermal growth factor, insulin-like growth factor), salts (e.g., sodium chloride, calcium, magnesium, phosphates), buffers (e.g., HEPES), nucleosides (e.g., adenosine, thymidine), glutamine, glucose or equivalent other energy sources, antibiotics, and trace elements. Any other necessary supplements can also be included in appropriate concentrations, as those skilled in the art would know. In this invention, the use of serum-free medium is preferred, but medium supplemented with an appropriate amount of serum can also be used for culturing host cells. For the proliferation and selection of genetically modified cells expressing a selected gene, an appropriate selector is added to the culture medium.

[0093] The cells may be prokaryotic cells, such as bacterial cells. In some embodiments of the present invention, the cells may be prokaryotic cells; although prokaryotic cells do not possess the CAR / RXR system related to the present invention, they may nevertheless be useful in vector production or other processes in vector handling, transport, or storage.

[0094] In some embodiments, the cells are packaging cells or producer cells for the production of viral vectors. For example, the cells may be packaging cells or producer cells for the production of AAV vectors. Various packaging cell lines or producer cell lines are known in the art. In packaging cell lines or producer cell lines, the promoter of the present invention may preferably be operably ligated to a viral protein, such as Rep or Cap or other viral structural or non-structural genes.

[0095] In a further embodiment of the present invention, the promoter of the present invention can be operably associated with a gene encoding a viral protein or RNA. The viral protein may be a structural protein or a non-structural protein. In non-limiting examples, the viral protein may be an AAV protein, such as a Rep protein or a Cap protein, or a viral helper protein such as E1A, E1B, E2A, or E4. In other embodiments, the viral protein may be REV, VSV-G, or RD114.

[0096] In further aspects of the present invention, gene therapy vectors, expression cassettes, promoters, virions, or pharmaceutical compositions according to various embodiments of the present invention are provided for use in treating diseases associated with abnormal gene expression, preferably optionally in the liver (e.g., hereditary liver diseases).

[0097] Gene expression in the liver is of particular interest because the liver is involved in a wide range of essential functions in the body, including the synthesis of many proteins involved in metabolism, hemostasis, and protection against infection. Given that many diseases are associated with disruption of gene expression in the liver, there is considerable interest in developing gene therapy strategies that enable the generation of therapeutic expression products through the expression of transgenes in the liver. Liver diseases associated with abnormal gene expression include, but are not limited to, hemophilia (including hemophilia A or B), familial hypercholesterolemia, ornithine transcarbamylase deficiency, phenylketonuria, glycogen storage disease, α1-antitrypsin deficiency, hereditary hemochromatosis, hypertyrosinemia type 1, argininosuccinateuria, hepatitis virus infection, nonviral hepatitis, liver cancer, hereditary cholestasis, Wilson's disease, and various other liver diseases (e.g., non-alcoholic fatty liver disease (NAFLD) and alcohol-related liver disease (ARLD)). The use of this invention for the treatment of hemophilia A or B represents a preferred embodiment of various aspects of this invention.

[0098] In a further embodiment, the present invention: - A step of preparing cells, comprising an expression cassette containing a synthetic liver-specific inducible promoter operably linked to a gene, the synthetic liver-specific inducible promoter comprising a cis regulatory element (CRE) capable of being bound and activated by a heterodimer of CAR and RXR; - A step of administering to the cells an inducer capable of inducing the expression of an expression product from a gene operably linked to an inducible promoter in the expression cassette, including, The present invention provides a method for generating expression products, specifically therapeutic expression products, in cells, particularly liver cells.

[0099] The method appropriately includes the step of maintaining the cells under conditions suitable for the expression of an expression product from a gene. In culture, the method may include the step of incubating cells or tissue containing cells under suitable culture conditions. The cells can, of course, be in vivo, for example, one or more cells in the liver of a subject. Accordingly, this aspect of the present invention provides, in particular, a method for producing a product of interest in cell culture (e.g., for bioprocessing applications) or in the expression of a therapeutic product (e.g., in a subject or ex vivo). Various cells suitable for use in this aspect are discussed above.

[0100] Preferably, the method of the present invention includes the step of introducing an expression cassette into the liver. A wide range of methods for transfecting hepatocytes are well known in the art. A preferred method for transfecting hepatocytes is to transduce cells with a viral vector containing a synthetic liver-specific expression cassette, such as an AAV vector. Details of various vectors for use in the present invention are described below.

[0101] The method of the present invention may include a step of collecting or isolating expression products. Suitable methods for collecting or isolating various expression products (e.g., proteins or nucleic acids) are well known to those skilled in the art.

[0102] In some embodiments, the cells are hepatocytes. Generally, hepatocytes express both CAR and RXR. However, some hepatocyte-derived cell lines do not express CAR (e.g., Huh7 cell line), and in such cases, it is necessary to supply exogenous CAR. This can be done, for example, by supplying cells with a suitable expression construct containing nucleic acids encoding the CAR operably linked to a suitable promoter to express the CAR. Suitable expression vectors and other approaches for expressing CAR in any given cell are well known in the art.

[0103] Spontaneous expression of CARs is generally limited to hepatocytes. Therefore, if cells do not express CARs (which is normal for non-hepatocytes), it is usually necessary to supply the cells with exogenous CARs. As mentioned above, this can be done, for example, by supplying cells with a suitable expression construct containing nucleic acids encoding CARs operably linked to a suitable promoter to express the CARs. Suitable expression vectors and other approaches for expressing CARs in any given cell are well known in the art.

[0104] The inducer used in this invention can be any agent suitable for inducing CAR activation and CAR-RXR heterodimer formation. Such an inducer can induce expression from PBREM elements in cells where an expression cassette is present. There are known prior art inducers that broadly induce expression from mouse and human PBREM elements (e.g., HONKAKOSKI et al., Molecular Pharmacology, 53:597-601 (1998), and Cherian et al., "Small-molecule modulators of the constitutive androstane receptor," Expert Opin Drug Metab Toxicol. July 2015; 11(7): 1099-1114; Banerjee et al., "Targeting xenobiotic receptors PXR and CAR in human diseases," Drug Discov. Today. May 2015; 20(5): 618-628; Omiecinski et al., "Multi-species Analyses of Direct Activators of the Constitutive Androstane Receptor," Toxicological). See Sciences, 123(2), pp. 550-562 (2011). Typically, these inducers are activating ligands for CARs. CARs are characterized by broad specificity to various endogenous and exogenous ligands with diverse chemical structures, a characteristic that enables CARs to act as xenobiotic sensors. Table 1 by Cherian et al. lists various activators of CAR activators in various species that can be used as inducers in any aspect of the present invention.

[0105] For example, but not limited to, inducers appropriately include one or more drugs selected from the following list: phenobarbital (PB); flavonoid compounds, e.g., flavone, chrysin, baicalein, or galangin; 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene (TCPOBOP); 6-(4-chlorophenyl)imidazo[2,1-b][1,3]thiazole-5-carbaldehyde-O-(3,4-dichlorobenzyl)oxime (CITCO); acetaminophen; buprenorphine; phenytoin; carbamazepine; valproic acid; artemisinin and derivatives; chlorpromazine; efavirenz; nevirapine; rilpivirine; etravirine; diazepam; cyclophosphamide; ifosfamide; cerivastatin; simvastatin; lovastatin; substituted sulfonates Mido; thiazolidined-4-one; estradiol; estrone and analogs; 17α-ethinyl-3; 17β-estradiol (EE2); dehydroepiandrosterone (DHEA); 5β-pregnane-3,20-dione; diethylstilbestrol; ginkgo biloba extract; galangin; chrysin; baicalein; diallyl sulfide; ellagic acid; resveratrol; squalestatin-1; bilovalide; triclocarban; triclosan; dichlorodiphenyltrichloroethane (DDT); dieldrin; methoxychlor; metofluthrin; permethrin; pyrethrin; sulfoxaflor; diethylhexyl phthalate (DEHP); cyproconazole; fluconazole; propiconazole; FL81; tri-p-methylphenyl phosphate (TMPP); UM104; and UM145.

[0106] In some preferred embodiments, the inducer is a drug (pharmaceutical), for example, a drug that has regulatory approval in at least one country (preferably the United States or an EU member state) for use in humans or animals (preferably humans) to treat at least one medical condition. Alternatively, the inducer may preferably have GRAS status in at least one country (preferably the United States or an EU member state). In some preferred embodiments, the inducer includes one or more drugs selected from the following list: phenobarbital (PB); flavonoid compounds, e.g., flavone, chrysin, baicalein, or galangin; acetaminophen; buprenorphine; phenobarbital; phenytoin; carbamazepine; valproic acid; artemisinin and derivatives; chlorpromazine; efavirenz; nevirapine; rilpivirine; etravirine; diazepam; cyclophosphamide; ifosfamide; cerivastatin; simvastatin; lovastatin; substituted sulfonamides; and thiazolidinedione-4-one.

[0107] All of these compounds are either known drugs or are GRAS (Generally Recognized as Safe for Human Use), and therefore can generally be used to induce expression in humans with a reasonable degree of safety.

[0108] In some embodiments of the present invention, the inducer is phenobarbital. In other embodiments, the inducer is citco or TCPOBOP. In yet another embodiment, the inducer is a flavonoid, such as a flavone.

[0109] Inducers can be administered to cells by any appropriate method. For example, in cell culture, the inducer can be added to the culture medium. When cells are in vivo, for example, in the liver of an animal, the inducer can be administered to the cells via systemic administration to the animal or via local administration to the target tissue (e.g., the liver). The appropriate dosage ratio for any given inducer can be easily determined by those skilled in the art. Therefore, for any inducer, a suitable method for delivering the inducer to cells and an appropriate concentration to use can be easily determined. In the case of CITCO, it has been demonstrated in the examples below that an administration of 0.5 μM to 3 μM, for example, approximately 1 μM, to cells is suitable for inducing expression. In the case of TCPOBOP administration, it has been demonstrated in the examples below that an administration of 50 nM to 150 nM to cells is suitable for inducing expression. In the case of flavones, it has been demonstrated in the examples below that an administration of 30 μM to cells is suitable for inducing expression. However, other suitable concentrations can be used, and the required dose administered to the patient can be determined by those skilled in the art. Accordingly, in some embodiments, the present invention intends to expose cells containing the expression cassette to 0.1 μM to 15 μM, e.g., 0.25 μM to 6 μM, or 0.5 μM to 3 μM of CITCO to induce expression. In some embodiments, the present invention intends to expose cells containing the expression cassette to 10 nM or 750 nM, e.g., 25 nM to 300 nM, or 50 nM to 150 nM of TCPOBOP to induce expression. In some embodiments, the present invention intends to expose cells containing the expression cassette to 6 μM to 150 μM, e.g., 15 to 150 μM, or 25 to 35 μM of flavone to induce expression.

[0110] The method of the present invention may appropriately include a step of discontinuing the administration of an inducer. Discontinuing the administration of the inducer will result in a decrease in the expression of the expression product. Typically, the expression of the expression product will return to baseline levels over time.

[0111] The method of the present invention may appropriately include a step of changing the concentration of an inducer administered to cells over time. This step can be used to modulate the level of expression of the expression product.

[0112] In some embodiments of the present invention, the concentration of an inducer administered to cells over time is varied to modulate the dosage of a therapeutic gene product offered to a subject or to alter the production of the expression product in cell culture. In the case of treatment of a subject (discussed in more detail below), the concentration of the inducer may be varied depending on the state of the subject, the level of biomarkers in the subject, or any other reason.

[0113] In some embodiments, the method of the present invention includes the step of administering an inhibitor to cells. The inhibitor can be any agent suitable for inhibiting or reducing CAR activation and CAR-RXR heterodimer formation. The addition of an inhibitor can be used to reduce or eliminate the expression of the expression product (i.e., to lower or switch off expression). As a non-limiting example, metformin is a known antagonist of CAR and can be used as an inhibitor. Furthermore, androstenol and several isomers of androstanol, known as androstanes, are known to be endogenous antagonists of CAR and can be administered as inhibitors. Various inhibitors of CAR are discussed in Cherian et al., "Small-molecule modulators of the constitutive androstane receptor," Expert Opin Drug Metab Toxicol. July 2015; 11(7): pp. 1099-1114 - see Figure 1 - which discloses various human, mouse, and rat CAR inhibitors. Further CAR (or RXR) inhibitors suitable for inhibiting or reducing CAR-RXR heterodimer formation, which can be used in the present invention, can naturally be identified by those skilled in the art. The appropriate dosage ratio of any given inhibitor can be easily determined by those skilled in the art.

[0114] In a further embodiment, the present invention provides a method for expressing a therapeutic transgene in liver cells, comprising the steps of introducing a gene therapy vector according to the present invention into liver cells, and subsequently administering an inducer to the cells. Suitable inducers are discussed above. Liver cells may be in vivo or ex vivo. As described above, the concentration of the inducer administered to the cells may be varied over time. Exemplary therapeutic genes for use in this embodiment are discussed above.

[0115] It will be apparent to those skilled in the art that gene therapy vectors, expression cassettes, virions, or pharmaceutical compositions according to various embodiments of the present invention can be used in gene therapy. Accordingly, the use of such gene therapy vectors, expression cassettes, virions, or pharmaceutical compositions in gene therapy forms part of the present invention. Accordingly, one embodiment of the present invention provides gene therapy vectors, expression cassettes, virions, or pharmaceutical compositions described herein for use in gene therapy, preferably by liver-specific expression of therapeutic genes, and appropriately for the treatment of diseases involving abnormal gene expression in the liver.

[0116] In a further embodiment, the present invention is The process involves introducing a gene therapy vector, expression cassette, or virion of the present invention, containing a gene encoding a therapeutic product, into the target liver; A step of administering an inducer to a subject so that a therapeutically effective amount of the therapeutic product is expressed in the subject, including, The present invention provides a gene therapy method, preferably for humans, that requires such therapy.

[0117] Appropriate therapeutic genes have also been discussed above. Conditions that can be treated have also been discussed above, and include, but are not limited to, hemophilia (including hemophilia A or B), familial hypercholesterolemia, ornithine transcarbamylase deficiency, phenylketonuria, ornithine transcarbamylase deficiency, glycogen storage disorders, α1-antitrypsin deficiency, hereditary hemochromatosis, hypertyrosinemia type 1, argininosuccinateuria, hepatitis virus infection, nonviral hepatitis, liver cancer, hereditary cholestasis, Wilson's disease, and various other liver diseases (e.g., non-alcoholic fatty liver disease (NAFLD), alcohol-related liver disease (ARLD)), and lysosomal storage disorders.

[0118] The method of the present invention preferably includes the step of expressing a therapeutically effective amount of a therapeutic product from a gene in the target liver. The therapeutic product may have a therapeutic effect in the target liver or in another site. For example, the therapeutic product may be released into the bloodstream.

[0119] Appropriate inducers are described above, as are methods of administering them. As discussed above, administration of inducers can be discontinued after a certain period, for example, after an appropriate therapeutic effect has been achieved. Alternatively, the amount of inducer administered to the subject can be changed over time. The amount of inducer administered to the subject can be adjusted to obtain the desired amount (dose) of the therapeutic product. Therefore, if an increase in the therapeutic product is clinically necessary (for example, due to an insufficient response in the subject), the amount of inducer administered to the subject may be increased, and vice versa (for example, due to an excessive response or undesirable side effects).

[0120] In some embodiments, the method of the present invention may include the following steps: - A step of determining the amount of therapeutic product expressed in the subject, or a step of evaluating the subject's response to the therapeutic product, and: a) If a higher amount of therapeutic product is desired in the subject, the process of increasing the amount of inducer administered to the subject, or b) A step of reducing the amount of inducer administered to a subject if a lower amount of the therapeutic product is desirable for that subject.

[0121] Using standard experimental techniques, the amount of therapeutic product in a subject can be determined.

[0122] Considering that the amount of inducer administered to a subject can be changed over time, it will naturally be understood that inducers are usually administered at a given time interval and at a given dosage level, rather than being continuously administered to the patient. Therefore, the present invention is intended to change the amount of inducer administered to a subject over time by adjusting the dose, adjusting the interval between doses, or both. For example, to increase the amount of inducer administered to a subject, the dose can be increased while keeping the interval between doses constant, the dose can be kept constant while shortening the interval between doses, or the dose can be increased and the interval between doses shortened. To decrease the amount of inducer administered to a subject, the dose can be decreased while keeping the interval between doses constant, the dose can be kept constant while shortening the interval between doses, or the dose can be decreased and the interval between doses extended.

[0123] Alternatively, or additionally, the method of the present invention may include a step of changing the inducer to alter the amount of therapeutic product in the subject. For example, a weak inducer can be replaced with a stronger inducer, or vice versa.

[0124] The method of the present invention may also include a step of changing the inducer, for example, if the subject has an adverse reaction to the inducer or if the inducer is found to be ineffective in the subject.

[0125] The method of the present invention can also include the step of administering an inhibitor to a subject. Suitable inhibitors for use in the present invention have been discussed above. The inhibitor can be added to reduce or stop the production of a therapeutic product in a subject. The amount of inhibitor administered to the subject can be adjusted to obtain the desired amount (dosage) of the therapeutic product.

[0126] Suitable genes encoding therapeutic gene products have been discussed above. However, specific mention can be made of therapeutic proteins such as factor VIII and factor IX for the treatment of hemophilia.

[0127] The method of the present invention suitably includes the step of administering to a subject a vector or virion according to the present invention. Suitably, the vector is a viral gene therapy vector, preferably an AAV vector.

[0128] In some embodiments, the method of the present invention includes the step of systemically administering a viral gene therapy vector. Systemic administration can be enteral (e.g., oral, sublingual, and rectal) or parenteral (e.g., injection). Preferred injection routes include intravenous, intramuscular, subcutaneous, intra-arterial, intra-articular, intrathecal, and intradermal injections.

[0129] In some embodiments, the viral gene therapy vector can be administered simultaneously or sequentially with one or more additional therapeutic products or one or more saturating agents designed to prevent clearance of the vector by the reticuloendothelial system.

[0130] When the vector is an AAV vector, the dosage of the vector can be from 1×10 10 gc / kg to 1×10 15 gc / kg or more, suitably from 1×10 12 gc / kg to 1×10 14 gc / kg, suitably from 5×10 12 gc / kg to 5×10 13 gc / kg.

[0131] Generally, the subjects requiring it are mammals, preferably primates, and more preferably humans. Typically, the subjects requiring it will present characteristic symptoms of a disease. The method of the present invention typically includes the step of improving the symptoms presented by the subject requiring it by expressing a therapeutic amount of the therapeutic product.

[0132] Gene therapy protocols for therapeutic gene expression in target cells in vitro and in vivo are well known in the art and will not be discussed in detail here. In summary, these include intramuscular injection, interstitial injection, intra-intravascular infusion, endothelial application, intrahepatic parenchymal, and intravenous or intra-arterial administration (e.g., intrahepatic artery, intrahepatic vein) of plasmid DNA vectors (naked or in liposomes) or viral vectors. Various devices have been developed to enhance the availability of DNA to target cells. A simple approach is to physically bring the target cells into contact with a catheter or implantable material containing the relevant vector, while more complex approaches may utilize jet injection devices, etc. Gene transfer into mammalian liver cells has been performed using both ex vivo and in vivo procedures. The ex vivo approach typically requires the collection of liver cells, in vitro transduction with a suitable expression vector, followed by the reintroduction of the transduced liver cells into the liver. In vivo gene transfer has been performed by injecting DNA or viral vectors into the liver parenchyma, hepatic artery, or portal vein.

[0133] Further embodiments of the present invention provide the use of various embodiments of the present invention of synthetic inducible promoters, synthetic expression cassettes, vectors, or virions for the production of pharmaceutical compositions for the treatment of any condition or disease described herein.

[0134] In a further embodiment, the present invention provides a method for producing an expression product, comprising the following steps: a) A step of preparing a population of eukaryotic cells, preferably animal cells, more preferably mammalian cells, more preferably hepatocytes, comprising an expression cassette containing a synthetic liver-specific inducible promoter operably linked to a gene, the synthetic liver-specific inducible promoter comprising a cis regulatory element (CRE) capable of being bound and activated by a heterodimer of CAR and RXR; b) A step of culturing the aforementioned cell population, c) The step of administering to the cells an inducer capable of inducing the expression of an expression product from a gene operably linked to an inducible promoter in the expression cassette; d) Product recovery step.

[0135] The method of the present invention is preferably a bioprocessing method, i.e., a process of obtaining a desired expression product using living cells. Preferred transgenes and the target products they encode are discussed above. The expression products can be useful in therapeutic, cosmetic, research, or other industrial processes. Inducers and cells suitable for this embodiment are discussed above.

[0136] Step (b) typically includes maintaining the cell population under conditions suitable for cell proliferation. These conditions typically prepare cells for expression of an expression product from a transgene, based on the induction in step (c). Those skilled in the art will likely know of conditions suitable for various types of cells intended. Therefore, the method of the present invention appropriately includes the steps of incubating the cell population under conditions suitable for cell proliferation, and then processing the cell population to induce expression (c).

[0137] The step of recovering the expression product typically involves separating the expression product from the cell population and, optionally, from other components of the cell culture medium. The method of the present invention preferably includes a step of purifying the expression product. Suitable methods for recovering and / or purifying the expression product are common practice in the art and will depend on the specific properties of the expression product.

[0138] It will be evident that the present invention makes it possible to delay the generation of expression products to a desired point in the cell culture process. This allows the cell population to grow until, for example, it reaches a desired number or concentration of cells, or reaches a desired growth phase. This can be desirable for many reasons, for example, to allow cells to grow under optimal conditions and then to express a transgene that can inhibit growth. In the case of toxic proteins, for example, the generation of toxic expression products can be avoided until the cell culture system reaches a desired stage. When toxic proteins are expressed, cells will naturally be adversely affected or killed. However, even in the case of non-toxic expression products, there can be considerable efficiency advantages in delaying the expression of a transgene to a desired point.

[0139] The methods of the present invention can be carried out in any suitable reactor, including, but not limited to, agitated tanks, bubble pumps, fibers, microfibers, hollow fibers, ceramic matrices, fluidized beds, fixed beds, and / or jet-bed bioreactors. As used herein, “reactor” may include a fermenter or fermentation unit or any other reaction vessel, but the term “reactor” is used interchangeably with “fermenter.” For example, in some embodiments, an exemplary bioreactor unit may perform one, more or all of the following: supplying a nutrient and / or carbon source, injecting a suitable gas (e.g., oxygen), fermentation or inlet and outlet flows of cell culture medium, separation of gas and liquid phases, maintaining temperature, maintaining oxygen and CO2 levels, maintaining pH levels, stirring (e.g., agitation), and / or washing / sterilization. An example of a reactor unit, such as a fermentation unit, may contain multiple reactors within the unit; for example, a unit may have 1 to 10 or more bioreactors in each unit. In various embodiments, the bioreactor may be suitable for batch, semi-fed-batch, fed-batch, perfusion, and / or continuous fermentation processes. In some embodiments, the bioreactor may have a capacity of about 100 ml to about 50,000 liters, preferably 10 liters or more. Furthermore, a suitable reactor may be multi-use, single-use, disposable, or non-disposable, and may be formed from any suitable material. Exemplary systems that can be used in the present invention are described in U.S. Patent Applications Publications 2013 / 0280797, 2012 / 0077429, 2011 / 0280797, 2009 / 0305626, and U.S. Patents 8,298,054, 7,629,167, and 5,656,491 (their entirety incorporated herein by reference).

[0140] In some preferred embodiments of the present invention, the method of the present invention is for the generation of gene therapy viral vectors, such as rAAV virus particles. In these embodiments, the cells are appropriately packaging cells or producer cells, and one of the helper functions is under the control of an inductive promoter. In non-limiting examples, the Rep, Cap, E1A, E1B, E2A, E4, and VA RNA genes can be placed under the control of an inductive promoter. Controlling the expression of Rep is of particular interest due to its toxicity. Accordingly, another aspect of the present invention provides the use of promoters discussed herein to control the expression of viral proteins in a method for generating a viral gene therapy product, preferably a viral helper protein, more preferably the Rep gene.

[0141] In a further embodiment, the present invention provides a reactor vessel comprising a cell culture containing the cells of the present invention and a medium sufficient to support cell proliferation. Various reactors suitable for the present invention are described above.

[0142] A further aspect of the present invention provides the use of a bioprocessing vector or cells of the present invention in a bioprocessing method for producing a target product, such as a therapeutic product. [Brief explanation of the drawing]

[0143] [Figure 1]- Figure 1A shows the measurement of luciferase expression from the PB1-MinTK construct after transfection of Huh7 cells and treatment with DMSO, 50 nM, 150 nM, and 250 nM TCPOBOP. - Figure 1B shows the measurement of luciferase expression from the PB1-MinTK construct after transfection of Huh7 cells, where Huh7 cells were either transfected with CAR or not. - Figure 1C shows the data from Figure 1A expressed as a ratio of strong viral promoter CMV-IE. Figure 1C also shows that there is no luciferase expression in the absence of CAR. A single PBREM element combined with the MinTK promoter drives CMV-IE gene expression up to 40%. - Figure 1D shows the measurement of EPO expression from the PB1-MinTK construct after transfection of Huh7 cells and treatment with DMSO, 0.5 μM, 1 μM, 2 μM, and 3 μM CITCO. This figure also shows that the addition of CITCO does not alter EPO expression from the promoter CMV-MP. [Figure 2] - Figure 2A shows the measurement of luciferase expression from the PB1-MinTK, PB1-CMV-MP, and PB1-SV40-MP constructs after transfection of AXOL ARE hepatocytes and treatment with DMSO (left) or 1 μM CITCO (right). - Figure 2B shows the data from Figure 2A expressed as the ratio of strong viral promoter CMV-IE. [Figure 3]- Figure 3A shows luciferase expression from the PB1-SV40, PB1-1-SV40, PB1-2-SV40, and PB1-3-SV40 constructs, each containing 1, 2, 3, and 4 PBREM elements, respectively. The PBREM multimer is inducible with the SV40 promoter combination, increasing the expression level, but only up to three copies of the PBREM element. - Figure 3B shows luciferase expression from the PB1-CMV, PB1-1-CMV, PB1-2-CMV, and PB1-3-CMV constructs, each containing 1, 2, 3, and 4 PBREM elements, respectively. The PBREM multimer is inducible with the CMV promoter combination, increasing the expression level, but only up to three copies of the PBREM element. - Figure 3C shows luciferase expression from the PB1-MinTK, PB1-1-MinTK, PB1-2-MinTK, and PB1-3-MinTK constructs, each containing 1, 2, 3, and 4 PBREM elements, respectively. The PBREM multimer is inducible with the MinTK promoter combination, increasing the expression level, but only up to three copies of the PBREM element. [Figure 4] - Figure 4A shows luciferase expression from the PB1-MinTK construct of the pGL4.10 vector in AXOL ARE hepatocytes, the PB1-MinTK construct of the pAAV vector in Huh7 cells, and the PB1-MinTK construct of the pAAV vector in AXOL ARE hepatocytes. The induction of luciferase expression from the PB1-MinTK construct is comparable across vector and cell types. - Figure 4B shows luciferase expression from the PB1-2-MinTK construct of the pGL4.10 vector in AXOL ARE hepatocytes, the PB1-2-MinTK construct of the pAAV vector in Huh7 cells, and the PB1-2-MinTK construct of the pAAV vector in AXOL ARE hepatocytes. The induction of luciferase expression from the PB1-2-MinTK construct is comparable across vector and cell types. [Figure 5]This figure shows luciferase expression from the PB1-MinTK and PB1-2-MinTK constructs of the pAAV vector in AXOL ARE hepatocytes, both with and without CITCO, and after CITCO discontinuation. [Figure 6] This is a diagram showing the PBREM elements of a mouse. [Figure 7] This figure shows the plasmid map of the pGL4.10 vector. [Figure 8] This figure shows in vivo results from the PB1 and PB1-2 constructs. A) This figure shows bioluminescence imaging of representative mice from 0 to 48 hours after induction. B) This figure shows bioluminescence plotted to illustrate different induction dynamics. C) This figure shows the induction saturation (n=5) observed for each construct. [Figure 9] This figure shows the effects of CITCO and flavones on the induction of PBREM hybrids in HUH7 cell lines that stably express human CAR. [Figure 10] This figure shows the effects of CITCO and flavones on the induction of PBREM hybrids in primary hepatocytes. [Figure 11] This figure shows the effects of CITCO and flavones on the induction of PBREM hybrid multimers in the Huh7 cell line, which stably expresses human CAR. [Figure 12] This figure shows the effects of CITCO and flavones on the induction of PBREM hybrid multimers in primary hepatocytes. [Modes for carrying out the invention]

[0144] Detailed Description and Examples of Embodiments of the Invention While various embodiments of the present invention are discussed in detail below, it should be recognized that the present invention provides many applicable inventive concepts that can be embodied in various specific circumstances. The specific embodiments discussed herein merely illustrate specific methods for carrying out and using the present invention and do not define the scope of the invention.

[0145] The practical application of this invention will, unless otherwise indicated, utilize conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA, and immunology, which are within the scope of the skills of those skilled in the art. Such techniques are well described in the literature. For example, see: Current Protocols in Molecular Biology (Ausubel, 2000, Wiley and Son Inc, Library of Congress, USA); Molecular Cloning: A Laboratory Manual, 3rd Edition (Sambrook et al., 2001, Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press); Oligonucleotide Synthesis (MJ Gait, ed., 1984); U.S. Patent No. 4,683,195; Nucleic Acid Hybridization (Harries and Higgins, eds., 1984); Transcription and Translation (Hames and Higgins, eds., 1984); Culture of Animal Cells (Freshney, Alan R. Liss, Inc., 1987); Immobilized Cells and Enzymes (IRL Press, 1986); Perbal, A Practical Guide to Molecular Cloning (1984); Series, Methods in Enzymology (Abelson and Simon, Academic Press, Inc., New York), specifically Vols. 154 and 155 (edited by Wu et al.) and Vol.185, "Gene Expression Technology" (Goeddel, ed.); Gene Transfer Vectors For Mammalian Cells (Miller and Calos, eds., 1987, Cold Spring Harbor Laboratory); Immunochemical Methods in Cell and Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987); Handbook of Experimental Immunology, Vols. I~IV (Weir and Blackwell, ed., 1986); and Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1986). .

[0146] The background discussions of the present invention included herein are provided for the purpose of explaining the context of the invention. Such discussions should not be taken as an acknowledgment that any matter referred to was already publicly disclosed, publicly known, or part of common knowledge in any country at the time of the priority date of any claim of the present invention.

[0147] Throughout this disclosure, various publications, patents, and published patent applications are referenced by acknowledgment. All documents referenced herein are incorporated herein in their entirety by reference. Specifically, the teachings or sections of documents specifically mentioned herein are incorporated by reference.

[0148] To facilitate understanding of the present invention, several terms are defined below. Terms as defined herein have meanings generally understood by those skilled in the art relating to the present invention. Terms such as "a," "an," and "the" are not intended to refer to a single entity only, but include general classes that constitute specific examples that may be used for illustrative purposes. Technical terms used herein are used to describe specific embodiments of the present invention, but their use does not define the scope of the invention except as described in the claims.

[0149] The term “cis-regulatory element” or “CRE” is well known to those skilled in the art and refers to nucleic acid sequences, such as enhancers, promoters, insulators, or silencers, that can regulate or modulate the transcription of an adjacent gene (i.e., in cis). CREs are found near the gene they regulate. CREs typically regulate gene transcription by binding to TFs, i.e., TFBSs. A single TF can bind to multiple CREs, and thus regulate the expression of multiple genes (polyfacial expression). CREs are usually, but not always, located upstream of the transcription start site (TSS) of the gene they regulate. An “enhancer” is a CRE that operatively enhances (i.e., upregulates) the transcription of a gene it regulates, and can be found upstream, downstream, or even within an intron of the gene it regulates. Multiple enhancers can act synergistically to regulate the transcription of a single gene. In this context, a “silencer” refers to a CRE that binds to a TF called a repressor, which acts to prevent or downregulate the transcription of a gene. The term "silencer" can also refer to the 3' untranslated region of a messenger RNA that binds to a protein that suppresses the translation of the mRNA molecule; however, this usage is distinctly different from its use in describing CRE. Generally speaking, the CRE of this invention is a liver-specific inducible enhancer. In this context, the CRE is preferably located 1500 nucleotides or less from the transcription start site (TSS), more preferably 1000 nucleotides or less from the TSS, more preferably 500 nucleotides or less from the TSS, and appropriately 250, 200, 150, or 100 or fewer nucleotides from the TSS. The CRE of this invention is preferably relatively short in length, preferably 100 nucleotides or less, for example, 90, 80, 70, 60 or fewer nucleotides in length.

[0150] The term “cis-regulatory module” or “CRM” means a functional module composed of two or more CREs; in the present invention, CREs are typically liver-specific inducible enhancers. Thus, in this application, a CRM typically comprises multiple liver-specific inducible CREs. Typically, multiple CREs within a CRM act together (e.g., additively or synergistically) to enhance the transcription of the gene to which the CRM is manipulably associated. There is a conservable range for shuffling (i.e., rearranging), inverting (i.e., reversing), and altering the spacing in the CREs within a CRM. Thus, a functional variant of the CRM of the present invention includes a variant of the CRM mentioned, where the CREs within this variant are shuffled and / or inverted, and / or the spacing between CREs is altered.

[0151] As used herein, the term “promoter” refers to a region of DNA generally located upstream of the nucleic acid sequence being transcribed, which is necessary for transcription to occur, i.e., to initiate transcription. A promoter allows for the precise activation or repression of transcription of a coding sequence under its control. Promoters typically contain specific sequences that are recognized and bound by multiple TFs. TFs bind to the promoter sequence, resulting in the recruitment of RNA polymerase, the enzyme that synthesizes RNA from the coding region of a gene. A great many promoters are known in the art. The inducible promoters of the present invention typically drive low levels of expression before induction and, once induced, drive significantly higher levels of expression (e.g., a 2, 3, 4, 5, 6, 7, 8, or even a 10-fold increase in post-induction expression).

[0152] The promoter of the present invention is a synthetic promoter. As used herein, the term “synthetic promoter” refers to a promoter that does not exist in nature. In this context, a synthetic promoter typically includes the synthetic CRE and / or CRM of the present invention operably ligated to a minimal (or core) promoter or a liver-specific proximal promoter. The CRE and / or CRM of the present invention function to produce inducible liver-specific transcription of the gene operably ligated to the promoter. Parts of the synthetic promoter may be natural (e.g., one or more CREs in the minimal promoter or promoter), but the synthetic promoter as a complete entity is not natural.

[0153] As used herein, a “minimal promoter” (also known as a “core promoter”) refers to a short DNA segment that is inactive or nearly inactive on its own but, when combined with other transcriptional regulatory elements, can mediate transcription. Minimal promoter sequences can originate from a variety of different sources, including prokaryotic and eukaryotic genes. Examples of minimal promoters are discussed above, and these examples include the dopamine beta-hydroxylase gene minimal promoter, the cytomegalovirus (CMV) pre-early gene minimal promoter (CMV-MP), the SV40 minimal promoter (SV40-MP), and the herpesthymidine kinase minimal promoter (MinTK). However, proximal promoters can be synthetic. Minimal promoters typically include a transcription start site (TSS), an RNA polymerase II binding site, and a general transcription factor binding site (often a TATA box), which are directly upstream elements.

[0154] As used herein, “proximal promoter” refers to a minimal promoter with the addition of a proximal sequence upstream of a gene that tends to contain primary regulatory elements. Proximal promoters often extend approximately 250 base pairs upstream of the TSS and contain specific TFBSs. In the present invention, the proximal promoter is preferably a naturally occurring liver-specific proximal promoter that can be appropriately combined with one or more CREs or CRMs of the present invention. However, proximal promoters can be synthetic.

[0155] In the context of the present invention, a “functional variant” of a cis-regulatory element, cis-regulatory module, promoter, or other nucleic acid sequence is a variant of a reference sequence that retains the ability to function in the same way as, for example, an inducible liver-specific cis-regulatory enhancer element, an inducible liver-specific cis-regulatory module, or an inducible liver-specific promoter. Alternative terms for such a functional variant include “biological equivalent” or “equivalent.”

[0156] As discussed above, it will be understood that the ability of a given cis-regulatory element to function as an inducible liver-specific enhancer is primarily determined by its ability to be bound by a CAR-RXR heterodimer so that expression is induced. Therefore, in most cases, functional variants of cis-regulatory elements will contain a binding site suitable for the CAR-RXR heterodimer. The CAR-RXR heterodimer is thought to bind to the NR1 motif of the wild-type PBREM element, and therefore, a sequence capable of functioning as the NR1 motif is desirable. There is a very high degree of sequence conservation between mouse and human PBREM in the NR1 motif, and therefore, it is generally desirable that a high level of identity with the NR1 motif is conserved in any functional variant. Further sequences within the wild-type PBREM element can help minimize background expression and result in a high level of inducibility, and therefore, it is generally preferable that the functional variant contains at least some degree of sequence identity in these other regions. Therefore, the level of sequence identity between the functional variant and the reference sequence can be an indicator or retained function. The high level of sequence identity in the NR1 motif of the cis-regulatory element is more important overall than the sequence identity in other regions (e.g., NF1 or NR2, in which case any need for arbitrary sequence conservation is considerably less).

[0157] The ability of a CAR-RXR heterodimer to bind to a given CRE can be determined by any relevant means known in the art, including, but not limited to, electrical mobility shift assays (EMSA), binding assays, chromatin immunoprecipitation (ChIP), and ChIP-sequencing (ChIP-seq). In a preferred embodiment, the ability of a CAR-RXR heterodimer to bind to a given functional variant is determined by EMSA. Methods for performing EMSA are well known in the art. A suitable approach is described by Sambrooke et al., cited above. Numerous relevant papers describing this procedure are available, e.g., Hellman and Fried, Nat Protoc. 2007; 2(8): pp. 1849-1861.

[0158] "Liver-specific" or "liver-specific expression" refers to the ability of a cis-regulatory element, cis-regulatory module, or promoter to preferentially or predominantly enhance or drive gene expression in the liver (or liver-derived cells) compared to other tissues (e.g., spleen, muscle, heart, lung, and brain). In the present invention, the expression is required to be inducible, that is, gene expression occurs or is significantly increased only when a suitable inducer is administered (inducers for use in all embodiments of the present invention are discussed above). Gene expression can be in the form of mRNA or protein. In preferred embodiments, liver-specific expression is such that negligible expression exists in other (i.e., non-liver) tissues or cells, i.e., the expression is highly liver-specific.

[0159] The ability of a promoter to function as a liver-specific inducible promoter can be readily assessed by those skilled in the art. Therefore, it can be readily determined whether any variant of a particular promoter exemplified herein is still functional (i.e., whether it is a functional variant as defined above). For example, any given CRE to be evaluated can be operably linked to a minimal promoter (e.g., located upstream of MinTK), and the ability of the cis-regulatory element to produce inducible liver-specific expression of a gene (usually a reporter gene) is measured. Alternatively, a variant of a CRE can be substituted for an inducible liver-specific promoter in place of the reference CRE, and the effect on inducible liver-specific expression driven by the modified promoter can be determined and compared to the unmodified form. Similarly, the ability of a promoter to induce liver-specific expression can be readily assessed by those skilled in the art (e.g., as described in the examples below). The expression level and inducibility of a gene driven by a variant of a reference promoter can be compared to the expression level and inducibility with a reference sequence, and appropriate approaches are discussed above.

[0160] Liver specificity can be identified when the expression of a gene (e.g., a therapeutic gene or reporter gene) upon induction occurs preferentially or predominantly in liver-derived cells. Preferential or dominant expression can be defined, for example, when the level of expression upon induction is significantly higher in liver-derived cells than in other cell types (i.e., non-liver-derived cells). For example, the expression level in liver-derived cells upon induction is appropriately at least 5 times higher than in non-liver cells, preferably at least 10 times higher, and in some cases more than 50 times higher. For convenience, liver-specific expression can be adequately demonstrated by comparing the expression levels in hepatocyte lines (e.g., liver-derived cell lines such as Huh7 and / or HepG2 cells) or primary liver cells with the expression levels in kidney-derived cell lines (e.g., HEK-293), cervical tissue-derived cell lines (e.g., HeLa), and / or lung-derived cell lines (e.g., A549).

[0161] The liver-specific inducible promoter of the present invention, when induced, preferably exhibits reduced expression levels of less than one-quarter compared to the CMV-IE promoter in non-liver-derived cells, preferably HEK-293, HeLa, and / or A549 cells.

[0162] The liver-specific inducible promoter of the present invention is preferably suitable for promoting expression in the target liver, for example, by driving liver-specific expression of a transgene, preferably a therapeutic transgene.

[0163] It should also be noted that the liver-specific promoter of the present invention may, in some cases, be used in non-hepatic cells. Generally, non-hepatic cells do not express CAR, and therefore the promoter of the present invention does not function in such cells. However, if non-hepatic cells are engineered to express CAR (and RXR if they do not naturally express RXR), such non-hepatic cells can express the inducible gene linked to the promoter of the present invention. In other words, the liver-specific promoter of the present invention can also function in non-hepatic cells modified to have liver-like expression types with respect to the expression of CAR and RXR. The term "liver-specific" should be interpreted as appropriate. Hepatic cells can similarly be engineered to express the relevant proteins if they do not express CAR (e.g., Huh-7 cell line) or RXR.

[0164] As used herein, the term “nucleic acid” typically refers to an oligomer or polymer of any length (preferably a linear polymer) that is essentially composed of nucleotides. A nucleotide unit usually includes at least one, for example, one, two, or three phosphate groups, including heterocyclic bases, sugar groups, and modified or substituted phosphate groups. Examples of heterocyclic bases include, in particular, purine and pyrimidine bases such as adenine (A), guanine (G), cytosine (C), thymine (T), and uracil (U), which are widely distributed in naturally occurring nucleic acids, as well as other naturally occurring bases (e.g., xanthine, inosine, hypoxanthine), and chemically or biochemically modified (e.g., methylated) unnatural or derivatized bases. Examples of sugar groups include, in particular, preferably pentose (pentofuranose) groups such as ribose and / or 2-deoxyribose, which are common in naturally occurring nucleic acids, or arabinose, 2-deoxyarabinose, threose, or hexose sugar groups, as well as modified or substituted sugar groups. Nucleic acids as used herein may include naturally occurring nucleotides, modified nucleotides, or mixtures thereof. Modified nucleotides may include modified heterocyclic bases, modified sugar moieties, modified phosphate groups, or combinations thereof. Modifications to phosphate groups or sugars may be introduced to improve stability, resistance to enzymatic degradation, or several other useful properties. The term “nucleic acid” more preferably encompasses DNA, RNA, and DNA / RNA hybrid molecules, specifically including hnRNA, pre-mRNA, mRNA, cDNA, genomic DNA, amplification products, oligonucleotides, and synthetic (e.g., chemically synthesized) DNA, RNA, or DNA / RNA hybrids. Nucleic acids may be natural, e.g., naturally occurring or isolated from nature; or non-natural, e.g., recombinants, i.e., recombinants produced by recombinant DNA technology and / or partially or entirely chemically or biochemically synthesized. “Nucleic acids” may be double-stranded, partially double-stranded, or single-stranded. If single-stranded, nucleic acids may be sense strands or antisense strands.In addition, nucleic acids may be circular or linear in shape.

[0165] The terms "identity" and "identity" refer to the sequence similarity between two polymer molecules, or between two nucleic acid molecules, such as two DNA molecules. Sequence alignment and sequence identity can be determined using tools such as the Basic Local Alignment Search Tool (BLAST), first described by Altschul et al. 1990 (J Mol Biol 215: pp. 403-401), or the "Blast 2 sequences" algorithm described by Tatusova and Madden 1999 (FEMS Microbiol Lett 174: pp. 247-250).

[0166] Methods for aligning sequences for comparison are well known in the art. Various programs and alignment algorithms are described, for example, below: Smith and Waterman (1981) Adv. Appl. Math. 2:482 pages; Needleman and Wunsch (1970) J. Mol. Biol. 48:443 pages; Pearson and Lipman (1988) Proc. Natl. Acad. Sci. USA 85:2444 pages; Higgins and Sharp (1988) Gene 73:237-44 pages; Higgins and Sharp (1989) CABIOS 5:151~3; Corpet et al. (1988) Nucleic Acids Res. 16:10881~90; Huang et al. (1992) Comp. Appl. Biosci. 8:155~65; Pearson et al. (1994) Methods Mol. Biol. 24:307~31; Tatiana et al. (1999) FEMS Microbiol. Lett. 174: pp. 247-245. For a detailed examination of sequence alignment methods and homology calculations, see, for example, Altschul et al. (1990) J. Mol. Biol. 215: pp. 403-410.

[0167] The National Center for Biotechnology Information (NCBI) Basic Local Alignment Search Tool (BLAST®; Altschul et al. (1990)) is available online from several sources, including the National Center for Biotechnology Information (Bethesda, MD), for use in conjunction with several sequence analysis programs. Instructions on how to determine sequence identity using this program are available online in the "Help" section for BLAST®. For nucleic acid sequence comparison, the "Blast 2 Sequence" function of the BLAST® (Blastn) program can be used with default parameters. Nucleic acid sequences with greater similarity to a reference sequence will show improved percentage identity when evaluated using this method. Typically, percentage sequence identity is calculated over the entire length of the sequence.

[0168] For example, the global optimal alignment is appropriately found using the Needleman-Wunsch algorithm with the following scoring parameters: match score: +2, mismatch score: -3; gap penalty: gap open 5, gap extended 2. The percentage identity of the resulting optimal global alignment is appropriately calculated by the ratio of the number of bases aligned to the total length of that alignment, in which case the length of the alignment includes both matched and mismatched bases, and multiplied by 100.

[0169] In this application, "synthetic" means a nucleic acid molecule that does not exist in nature. The synthetic nucleic acid expression constructs of the present invention are artificially produced, typically by recombinant technology. Such synthetic nucleic acids may contain naturally occurring sequences (e.g., promoters, enhancers, introns, and other such regulatory sequences), but in a manner not present in nature. For example, a synthetic gene (or part of a gene) typically contains one or more nucleic acid sequences that are not adjacent in nature (a chimeric sequence), and / or may include substitutions, insertions, deletions, and combinations thereof.

[0170] As used herein, “complementary” or “complementarity” refers to Watson-Crick base pairing between two nucleic acid sequences. For example, sequence 5'-AGT-3' binds to its complementary sequence 3'-TCA-5'. Complementarity between two nucleic acid sequences can be “partial” if only some of the bases bind to their complements, or it can be “complete” if every base in the sequence binds to its complementary base. The degree of complementarity between nucleic acid strands significantly affects the efficiency and strength of hybridization between nucleic acid strands.

[0171] In this application, "transfection" broadly refers to any process of intentionally introducing nucleic acids into cells, covering the introduction of viral and nonviral vectors, and including terms and processes such as transformation and transduction. Examples, though not limited to these, include: transfection with viral vectors; transformation with plasmid vectors; electroporation (Fromm et al. (1986) Nature 319:791-793); lipofection (Feigner et al. (1987) Proc. Natl. Acad. Sci. USA 84:7413-7); microinjection (Mueller et al. (1978) Cell 15:579-85); Agrobacterium-mediated transfer (Fraley et al. (1983) Proc. Natl. Acad. Sci. USA 80:4803-487); direct DNA uptake; whiskers-mediated transformation; and particulate guns (Klein et al. (1987) Nature 327:70).

[0172] As used herein, the term “transgene” refers to an exogenous nucleic acid sequence. In one example, the transgene is a gene that codes for an industrially or pharmaceutically useful compound, or a gene that codes for a desired trait. In yet another example, the transgene codes for an antisense nucleic acid sequence, in which case the expression of the antisense nucleic acid sequence inhibits the expression of the target nucleic acid sequence.

[0173] The term “vector” is well known in the art and, as used herein, refers to a nucleic acid molecule, such as double-stranded DNA, which can be inserted into a nucleic acid sequence according to the present invention. A vector is appropriately used to transport the inserted nucleic acid molecule to a suitable host cell. A vector typically contains all the necessary elements that enable the transcription of the inserted nucleic acid molecule and, preferably, the translation of the transcription into a polypeptide. A vector typically contains all the necessary elements that, once the vector is in a host cell, can be replicated independently or concurrently with host chromosomal DNA, so that several copies of the vector and the nucleic acid molecule into which it is inserted can be produced. The vectors of the present invention may be episomal vectors (i.e., not integrated into the host cell genome) or vectors integrated into the host cell genome. This definition includes both non-viral vectors and viral vectors. Non-viral vectors include, but are not limited to, plasmid vectors (e.g., pMA-RQ, pUC vectors, bluescript vectors (pBS), and pBR322, or their derivatives lacking bacterial sequences (minicircles)), transposon-based vectors (e.g., PiggyBac (PB) vector or Sleeping Beauty (SB) vector), etc. Larger vectors, such as artificial chromosomes (bacteria (BAC), yeast (YAC), or human (HAC)), can be used to accommodate larger inserts. Viral vectors are derived from, but are not limited to, viruses, and include retroviruses, lentiviruses, adeno-associated viruses, adenoviruses, herpesviruses, and hepatitis virus vectors. Viral vectors are typically replication-deficient because the viral genes essential for replication have been removed from the viral vector, thus losing the ability to proliferate in a given cell. However, some viral vectors can also be adapted to replicate specifically in a given cell, such as cancer cells, and are typically used to induce (cancer) cell-specific (tumor) lysis.Virosoms are a non-limiting example of vectors containing both viral and non-viral elements, particularly those combining liposomes with inactivated HIV or influenza virus (Yamada et al., 2003). Another example includes viral vectors mixed with cationic lipids.

[0174] As used herein, the terms “operably linked,” “operably connected,” or equivalent expressions refer to the arrangement of various nucleic acid elements relative to each other such that the elements are functionally connected and can interact with each other in an intended manner. Such elements may include, but are not limited to, promoters, enhancers, and / or regulatory elements, polyadenylated sequences, one or more introns and / or exons, and coding sequences of genes of interest to be expressed. When properly oriented or operably linked, nucleic acid sequence elements can act together to modulate each other’s activity, ultimately influencing the level of expression of the expression product. Modulation means increasing, decreasing, or maintaining the level of activity of a particular element. The position of each element relative to other elements can be expressed by the 5' and 3' ends of each element, and the distance between any particular elements can be referred to by the number of intervening nucleotides or base pairs between the elements. As those skilled in the art will understand, operably linked means functional activity and does not necessarily relate to linking in native positions. In fact, when used in nucleic acid expression cassettes, cis-regulatory elements are typically located immediately upstream of the promoter (although this is generally true, it should never be interpreted as a limitation or exclusion of location within the nucleic acid expression cassette), but this is not necessarily true in vivo. For example, a regulatory element sequence that is naturally downstream of the gene whose transcription is affected can function similarly if it is located upstream of the promoter. Therefore, according to certain embodiments, the regulatory or enhancing effect of a regulatory element is location-independent.

[0175] As used herein, “spacer sequence” or “spacer” refers to a nucleic acid sequence that separates two functional nucleic acid sequences (e.g., TFBS, CRE, CRM, minimal promoter, etc.). A spacer sequence can essentially contain any sequence, provided that it does not interfere with the functioning of the functional nucleic acid sequence (e.g., a cis-regulatory element) as desired (for example, this can happen if a silencer sequence is included, resulting in interference with the binding of the desired transcription factor, etc.). Typically, spacer sequences are non-functional, as they exist solely to space adjacent functional nucleic acid sequences apart from each other.

[0176] As used herein, the term “pharmaceutically acceptable” means that it is in harmony with the art, compatible with other components of a pharmaceutical composition, and not harmful to its recipient.

[0177] "Therapeutic effective dose" and similar phrases mean the dose or plasma concentration in a subject that produces a specific desired pharmacological effect, for example, to express a therapeutic gene in the liver. It is emphasized that even if such a dosage is considered therapeutic effective by those skilled in the art, it does not necessarily mean that the therapeutic effective dose is effective in treating the conditions described herein. Therapeutic effective doses can vary depending on the route of administration and dosage form, the age and weight of the subject, and / or the disease or condition being treated.

[0178] The terms “treatment” or “to treat” refer to reducing, improving, or eliminating one or more signs, symptoms, or effects of a disease or condition.

[0179] The terms “individual,” “subject,” and “patient” are used interchangeably and refer to any individual subject having a disease or condition requiring treatment. For the purposes of this disclosure, the subject may be a primate, preferably a human, or another mammal such as a dog, cat, horse, pig, goat, or cattle.

[0180] Technical Introduction nuclear receptors Nuclear receptors play a crucial role in translating chemical changes in the cellular environment into transcriptional changes, and therefore biological changes. This function is essential for maintaining homeostasis not only within cells but also throughout the entire organism. The number of nuclear receptors varies greatly across species; for example, humans have 48 species, while C. elegans has 270, although nuclear receptors are found only in metazoans.

[0181] Since their discovery, the importance and number of nuclear receptors have increased dramatically, and these proteins are now recognized as a protein superfamily. This family includes receptors that bind to and respond to steroids, thyroid hormones, nutrients, and xenobiotic chemicals. When a ligand binds, the receptor undergoes a conformational change and binds to DNA, thereby initiating or repressing gene expression. This ability to bind to genomic DNA is key to receptor function and its importance in cell fate, bodily development, and metabolism. The number of ligands shown to bind to nuclear receptors is constantly expanding, sometimes contradicting the function of related receptors. Ligands range from endogenous hormones to vitamins and xenobiotics, and as a result, their importance to cellular metabolism and homeostasis is attracting attention. Due to their significant potential impact on the transcriptome, these receptors are a prime target for drug therapy, and it is estimated that approximately 13% of FDA-approved drugs target nuclear receptors.

[0182] structure Nuclear receptors have a mass between 50 and 100 kDa, and mature polypeptides are classified into five domains: A / B: Highly variable between receptors. It acts as a weak transcription activator in the absence of a ligand, but contains activation function 1 (AF-1), which acts as a potent activator when a ligand is bound. This is due to the interaction of the E domain with AF-2. C: A highly conserved domain containing two zinc fingers that bind to the DNA response element. D: A flexible domain that connects LBD and DBD, enabling interaction. It is important in cell trafficking and intracellular distribution. E: The structure is highly conserved, but the sequence is only moderately conserved. It contains a ligand-binding cavity and confers ligand specificity to the receptor. It is useful as a dimer-forming surface along with DBD and also binds to coactivators and repressors. It contains activator 2 (AF2), whose action depends on ligand binding. F: Highly variable C-terminal domain.

[0183] Mechanism of action Nuclear receptors can be classified into four types based on their mechanism of action. Below is a summary of each type. Type I: These receptors are found in the cytoplasm of inactivated cells. Ligand binding triggers the dissociation, homodimerization, nuclear translocation, and binding of the receptor to the DNA response motif of a heat shock protein (HSP). These receptors bind to a DNA motif consisting of two half-sites separated by a variable-length DNA sequence (serial repeat sequence 1-5 (DR1-5)), in which case the second half-site is the inverted repeat sequence of the first half-site. Some receptors in this class can bind to the serial repeat sequence and can do so either as a monomer / dimer, or as a heterodimer with RXR in the case of constitutive androstan receptors. Type II: These receptors, whether inactive or active, reside in the nucleus. They typically bind to DNA as heterodimers with RXR. In the absence of a ligand, this receptor often forms a complex with corepressor proteins. Type III: Similar to Type I receptors, but exclusively binds to serial repeat sequences in the DNA sequence. Type IV: These can bind as dimeric monomers, but only a single DNA-binding domain binds to a single half-site on the DNA.

[0184] Constitutive androstane receptors (CARs) Constitutive androstan receptors (CARs) – or nuclear receptor subfamily 1, group I, member 3 – are members of the nuclear receptor superfamily, which is almost exclusively expressed in liver cells. Here, CARs work in conjunction with another nuclear receptor, the pregnane X receptor (PXR), to act as sensors for endogenous substances and xenobiotic chemicals. Upon binding by activating substances, these receptors modulate the activity of numerous genes, including cytochrome p450, and are therefore responsible for the metabolism and excretion of those compounds. It is this binding and gene activation ability that allows CARs and PXR to play a major role in the detoxification of foreign chemicals in the body.

[0185] function: As shown above, CAR functions as an important regulator of the metabolism of exogenous and endogenous substances. It has 24 predictive transcripts in the liver. Some of these transcripts are responsible for the low levels of constitutive activity of this receptor, while others have been shown to be inducible. Constitutive activity is thought to be modulated by interaction with transcriptional coactivators such as steroid receptor coactivator 1 (SRC1). This activity can be suppressed by binding of inverse agonists such as androstan.

[0186] Ligand activation: Inactive CARs are phosphorylated and reside in the cytoplasm of cells. Here, inactive CARs form a complex with heat shock protein 90 (hsp90) and cytoplasmic CAR-retaining protein (CCRP), which maintains the CAR in the cytoplasm and therefore inactive. These inactive CARs can be activated in two ways: 1) by direct ligand binding, such as by the mouse CAR ligand TCPOBOP, or 2) by indirect activation via phenobarbital. Both pathways lead to the dissociation of CARs from multiprotein complexes, enabling their translocation to the nucleus. In the nucleus, CARs can act as monomers or form heterodimers with the retinoid X receptor (RXR). Nuclear CARs bind to DNA via the phenobarbital response element (PBREM), through which they activate CAR regulatory genes, such as the CYP2B, CYP2C, and CYP3A subfamilies.

[0187] Direct activation: TCPOBOP is thought to directly bind to mouse CARs and induce their translocation to the nucleus. However, this chemical does not bind to human CARs, and therefore, CITCO is the equivalent compound for human studies.

[0188] Indirect activation: Indirect activation of CAR by the anticonvulsant phenobarbital (PB) is widely recognized as a model of indirect CAR activation. PB causes dephosphorylation of CAR through activation of the phosphatase PP2A. Although the exact mechanism of PP2A activation is unknown, PB activates AMP-activated protein kinase, which can then activate PP2A, which is subsequently recruited by a multiprotein complex.

[0189] Another theory suggests that PB competes with epidermal growth factor (EGF) for its receptor, the epidermal growth factor receptor (EGFR). Dissociation of EGF and EGFR inactivates SRC1, which leads to the dephosphorylation of the activated C kinase 1 (RACK 1) receptor, resulting in stimulation of PP2A.

[0190] PBREM element: The DNA binding site of the mouse CAR homolog was identified by Honkakoski et al. (MOLECULAR PHARMACOLOGY, 53:597-601 (1998)). In this study, the authors found that the RXR and CAR heterodimers bind to the phenobarbital-responsive enhancer module (PBREM) of the cytochrome P-450 Cyp2b10 gene in response to phenobarbital induction. RXR and CAR expression activated PBREM in mammalian cell lines, indicating that the CAR-RXR heterodimer is a trans-acting factor for the Cyp2b10 gene. It was also shown that this heterodimer binds to two incomplete serial repeat sequence-4 motifs, and that these motifs are conserved in humans. The PBREM element is shown in Figure 6, where NR1 and NR2 are nuclear receptor-binding sites with incomplete serial repeat sequences (shown in bold). The NFI binding site is also shown. The CAR-RXR heterodimer is thought to bind to the NR1 site.

[0191] Human PBREM elements have also been identified, Sueyoshi et al. (J. BIOL. CHEM. Vol. 274, 10, pp. 6043-6046, 1999).

[0192] Below are the arrangement and alignment of mouse and human PBREM elements:

[0193] [ka]

[0194] As shown, each of the so-called NR1 motifs is underlined (the sequence number is shown in parentheses).

[0195] The NR1 motif exhibits an extremely high level of preservation, while the identity in other areas is at a much lower level.

[0196] This invention is based on the remarkable discovery that PBREM elements and their functional variants can be used to induce inducible expression, for example, when provided in a gene therapy vector. This invention enables useful levels of inducibility and low levels of background (constitutive expression). [Examples]

[0197] The PBREM enhancer was used in conjunction with the MinTK promoter to drive the expression of luciferase and EPO.

[0198] material - Human liver cell line, Huh7 cells - DPBS: CaCl2-free, MgCl2-free (Gibco, 14190-094) - DMEM (Sigma, D6546) - FBS (Sigma, F9665) - Pen-Strep (Sigma, P4333) - Promega Fugene-HD (E2311) - TCPOBOP (Sigma, T2320) - CITCO (Cayman Chemicals Company, 16027) - Contains the pcDNA6 plasmid and the β-galactosidase gene, which is used as an internal control for transfection efficiency (Thermofisher, V22020). - Mouse CAR expression plasmid from Jouan et al., 2016 (BioCat GmbH, EX-Z4288-M51-10-GC). This was used because Huh7 is CAR-deficient. - β-galactosidase substrate solution (Thermofisher, 75707 / 75710) - Pierce BCA Kit (23225) - LARII (Dual Luciferase Reporter 1000 Assay System, Promega, E1980) - EPO ELISA kit (Abcam, ab119522)

[0199] method: Day 1 - Cells were seeded into 48-well plates at a density of 25,000 cells / 300 μl. Day 2 - On the day of transfection, the DNA to be transfected (CAR plasmid / PB1-MinTK operably linked to luciferase or EPO / pcDNA6 plasmid as an internal control) was diluted in 100 ng / μl stock solution. Per 48 wells of transfection: - 45 ng of DNA (15 ng of each plasmid, pcDNA6, CAR, and test plasmid) was mixed with 4.1 μl of Optimem medium. - 0.5 μl of FusionHD was mixed with 4 μl of Optimem medium. - These two solutions were mixed and incubated at room temperature for 15 minutes. Next, the final solution was added dropwise to the wells. - Three hours after transfection, the inducer TCPOBOP was added to the appropriate wells at the indicated concentration. Day 3 - 24 hours after induction, the culture medium was removed from the cells. - The cells were washed once with 300 μl of DPBS. Cells were lysed using 100 μl of passive lysis buffer and incubated for 15 minutes with shaking. - Cell debris was pelletized by centrifuging the plate at maximum speed for 1 minute using a benchtop centrifuge. - In the case of luciferase, 10 μl of the sample was transferred to a white 96-well plate, 50 μl of LARII substrate was injected, and the luminescence was measured. - β-galactosidase activity was measured using 25 μl of lysate according to the manufacturer's instructions (Mammalian β-galactosidase assay kit, 75707 / 75710, Thermo Scientific). 25 μl of lysate was transferred to a microplate well, mixed with 25 μl of β-galactosidase assay reagent, and equilibrated at room temperature. The mixture was incubated at 37°C for 30 minutes, and the absorbance was measured at 405 nm. - Protein concentration was measured using 25 μl of lysate according to the manufacturer's instructions (Pierce® BCA Protein Assay Kit, 23225 / 23227, Thermo Scientific). 25 μl of lysate was transferred to a microplate well and mixed with 200 μl of diluted standard solution. The mixture was incubated at 37°C for 30 minutes, cooled to room temperature, and then the absorbance was measured at approximately 562 nm. Protein concentration was calculated according to a standard protein curve created from assaying a standard substance with a known protein concentration.

[0200] The luciferase readings were normalized against both the β-galactosidase and protein concentrations in the lysate to create normalized relative luminometer units (RLUs).

[0201] To compare across the entire experiment, promoter strengths were compared to the CMV-IE promoter driving the same genes as the PBREM-containing constructs, and this was included in every experiment.

[0202] Transfection with PB1-MinTk-EPO was performed as described above, except that EPO was secreted into the culture medium. The medium was then collected, and the EPO concentration was measured using an ELISA assay according to the manufacturer's instructions (ab119522 Erythropoietin (EPO) Human ELISA Kit, Abcam). 50 μl of medium was transferred to a pre-washed microplate well and mixed with 50 μl of 1× biotin-conjugated antibody. The mixture was incubated at room temperature for 1 hour. The well was washed, 100 μl of streptavidin-HRP was added, and the plate was incubated at room temperature for 15 minutes. The well was washed again, and then 100 μl of TMB substrate solution was added. The mixture was incubated at room temperature for 10 minutes. The enzymatic reaction was stopped by adding 100 μl of stop solution, and the absorbance was read at 450 nm. The EPO concentration was calculated according to an EPO standard curve created by assaying a standard substance with a known EPO concentration.

[0203] The PB1-MinTK construct was cloned into vector pGL4.10 using restriction sites Kpnl and Ncol. This places the promoter directly upstream of the firefly luciferase reporter gene. The PB1-MinTK construct contains a 51 bp enhancer and a MinTK minimal promoter from the herpesthymidine kinase gene.

[0204] result: Figure 1A shows that when cells were treated with the vehicle (DMSO), the luciferase expression from the PB1-MinTK construct exhibited only minimal measurable luciferase activity from the promoter. This activity corresponds to leakage expression from the promoter. Addition of 50 nM or 150 nM TCPOBOP induced strong promoter induction, with induction up to 6-fold measured. Addition of 250 nM TCPOBOP did not induce this promoter response, suggesting that homeostatic mechanisms may have been activated to prevent excessive stress on the cells. Therefore, the PB1-MinTK construct is induced in Huh7 cells by the addition of TCPOBOP. Induction is regulated by the TCPOBOP concentration, but decreases at higher concentrations.

[0205] In Figure 1B, luciferase expression from the PB1-MinTK construct is high in the presence of CAR and 150 nM TCPOBOP, as previously observed in Figure 1A. However, when cells are transfected with PB1-MinTK but not with CAR, there is no measurable activity when 150 nM TCPOBOP is added. This can be explained by the absence of the receptor to which TCPOBOP binds in the absence of CAR. Therefore, induction is CAR-dependent and exhibits a highly liver-specific process.

[0206] In summary, these results indicate that the PB1-MinTk construct is inducible in Huh7 cells by adding TCPOBOP, that the induction is regulated, that the induction is CAR-dependent, and that expression from a single element is sufficient to drive 40% of CMV-IE gene expression.

[0207] The experimental data shown in Figure 1A is represented in Figure 1C as the ratio of luciferase expression from the strong viral promoter CMV-IE. This indicates that luciferase expression from a single PBREM element linked to the MinTK promoter is sufficient to drive 40% of the luciferase expression from the CMV-IE promoter. Figure 1C also shows that in the absence of CAR, there is no luciferase expression from the PB1-MlnTK construct at all.

[0208] Next, the expression of the therapeutically targeted protein EPO was driven using the PB1-MinkTK promoter. Expression was driven in Huh7 cells transfected with a PB1-MinTK promoter operably linked to the EPO protein and a CAR-containing plasmid. Transfection was performed as previously described, and EPO expression was induced by the human CAR inducer CITCO.

[0209] Since TCPOBOP does not activate human CARs, we used CITCO, a human CAR inducer, instead of TCPOBOP, a mouse inducer. This means that TCPOBOP cannot be used in the human cells that are the final target for which this invention will be used. This was also done to ensure that the mouse PBREM element can be activated by human CARs induced by the human CAR inducer CITCO.

[0210] Figure 1D shows EPO expression from the PB1-MinTK construct after transfection into Huh7 cells and treatment with DMSO, 0.5 μM, 1 μM, 2 μM, and 3 μM of each CITCO. As shown in this figure, without the addition of the drug, EPO expression is almost negligible, but when CITCO is added up to 2 μM, EPO production is significantly improved. This returns to the baseline activity at the highest concentration here as well. This figure also shows that the addition of CITCO does not change EPO expression from the promoter CMV-MP. The overall EPO expression level of PB1-MinTK in this example is approximately 22% of the EPO expression of CMV-IE (data not shown). This is different from the 40% previously observed in relation to CMV-IE in Figure 1C, since CITCO is a weaker inducer with respect to CAR activity than TCPOBOP.

[0211] Success was achieved in driving the regulatable expression of luciferase and EPO using PB1-MlnTK.

Example

[0212] Next, the PBREM element was used in combination with two other minimal promoters and tested for induction and expression. PBREM was cloned in front of the CMV minimal promoter, MinTK promoter, and SV40 minimal promoter and introduced into AXOL ARE hepatocytes.

[0213] Axol Assay-Ready Expanded (ARE) hepatocytes are primary human hepatocytes that have been expanded in vitro. A large batch size (up to 2000 vials) is available, providing a reliable, immediately available, and consistent source for primary hepatocytes. ARE hepatocytes express CYP enzymes, are metabolically functional, are polarized, and can be infected with hepatitis C virus. AXOL ARE-hepatocytes express CAR, thus saving the effort of transfection with plasmids expressing CAR.

[0214] Materials: - AXOL assay-ready expanded (ARE) hepatocytes (Axol, ax3701) - ARE hepatocyte thawing medium (Axol, ax3705) - ARE maintenance medium (Axol, ax3710) - Virimer red transfection reagent (Lipocalyx, VR04-02-15) - CITCO, luciferase, β-galactosidase, and BCA kit as described above.

[0215] method: ARE hepatocytes were cultured and transfected according to the manufacturer's manual. 200,000 cells were seeded in 2 ml of culture medium in a collagen-coated 6-well plate. For sufficient adhesion, the cells were incubated at 37°C and 5% CO2 for 4 hours. 200 μl of transfection mixture (PB1-MinTK / PB1-CMV / PB1-SV40 operably linked with luciferase and β-galactosidase-containing promoters) containing the DNA to be transfected was added, and the cells were incubated on an orbital shaker at 100 rpm at 37°C and 5% CO2 for 3 hours. Three hours after transfection, CITCO was added to the appropriate wells. The cells were incubated overnight under static conditions at 37°C and 5% CO2, and the medium was replaced with fresh ARE hepatocyte maintenance medium in the morning. Readings were taken 24 hours after induction.

[0216] result: Figure 2A shows that luciferase expression from the PB1-MinTK, PB1-CMV-MP, and PB1-SV40-MP constructs supports expression from the PBREM element when 1 μM CITCO is added to each minimal promoter. Induction was approximately 7-fold with SV40 and MinTK, and 2-fold with the CMV-IE promoter. The expression levels of each construct, compared to CMV-IE, were 20%, 10%, and 55% for PB1-MinTK, PB1-CMV, and PB1-SV40, respectively. SV40 can drive the highest expression, but at the cost of higher background levels. The CMV minimal promoter shows little to no expression. From these data, it appears that the original MinTk construct offers the best compromise between expression levels, inducibility, and strict control (i.e., minimizing background expression).

[0217] PBREM can be used to drive inducible expression in combination with various minimal promoters. [Examples]

[0218] This experiment was conducted to investigate whether multimerization of the NR binding site subsequently enhances promoter activity. Therefore, 2, 3, and 4 repeats of the PBREM element were cloned in front of the minimal promoters of MinTk, CMV, and SV40. A key consideration here was the spacing between elements, following the general rule of 5, which ensures that elements spaced 5 bp apart do not sterically interfere with each other. Using intratissue findings from previous inducible promoter designs, the above elements spaced 20 bp apart were cloned. These multimers were cloned into the previously described pGL4.10 plasmid. These constructs were then tested in AXOL ARE hepatocytes as described above.

[0219] MinTK Promoter: PB1-MinTK, PB1-1-MinTK, PB1-2-MinTK, and PB1-3-MinTK contain 1, 2, 3, and 4 PBREM elements, respectively, in combinations of the MinTK minimal promoter. Figure 3C shows that luciferase expression from each of the PB1-1-MinTK, PB1-2-MinTK, and PB1-3-MinTK constructs, when induced with 1 μl of CITCO, is induced into a multimer, and the multimer increases the expression level. However, this increase in expression level is observed only up to 3 copies of the PBREM element (PB1-2), because the addition of another element appears to adversely affect the level of induction and expression. Each multimer is induced up to CMV-IE 1.5, 4.1, and 2.66, respectively. However, the level of induction is similar to that of the first PB1-MinTK construct, shown here as PB1. This is due to increased background activity of the promoter. The results are expressed as a ratio to CMV-IE. The results are the average of three biological replicates.

[0220] SV40 Minimal Promoter: PB1-SV40, PB1-1-SV40, PB1-2-SV40, and PB1-3-SV40 contain 1, 2, 3, and 4 PBREM elements, respectively, in combination with the SV40 minimal promoter. Figure 3A shows that luciferase expression from each of the PB1-1-SV40, PB1-2-SV40, and PB1-3-SV40 constructs induced with 1 μl of CITCO is induced, and that the multimers increase the actual expression level. However, as before, this increase in expression level is observed only up to 3 copies of the PBREM element, because the addition of another element appears to adversely affect the level of induction and expression. Each multimer is induced up to CMV-IE 2.6, 3.6, and 2.57, respectively. The level of induction is higher than the 6-fold increase seen with the MinTk minimal promoter, with induction up to 9-fold. Here too, the background level of expression increases, but this is far less than what is seen with the CMV-MP promoter described below. The results are expressed as a ratio to CMV-IE. The results are the average of three biological repeats.

[0221] CMV Promoter: PB1-CMV, PB1-1-CMV, PB1-2-CMV, and PB1-3-CMV contain 1, 2, 3, and 4 PBREM elements, respectively, in combination with the CMV minimal promoter. Figure 3B shows that luciferase expression from the PB1-1-CMV, PB1-2-CMV, and PB1-3-CMV constructs induced with 1 μl of CITCO is induced, and that the multimers increase the actual expression level. However, as before, this increase in expression level is observed only up to 3 copies of the PBREM element, because the addition of another element appears to adversely affect the level of induction and expression. Each multimer is induced up to 1.9, 2.67, and 2.67 of CMV-IE, respectively. The level of induction is lower than that observed with either the MinTk or SV40 minimal promoter, up to 5 times. Using a CMV minimal promoter appears to increase the background level of expression to an extremely high level, and therefore can be considered the worst candidate for evaluation.

[0222] Increasing the number of PBREM elements increases the expression level up to three PBREM elements. Further increasing the number of PBREMs to four results in even lower luciferase expression. [Examples]

[0223] Following Example 3, it was decided to proceed with PB1-MinTK and PB1-2-MinTK for in vivo studies. To facilitate this, the two aforementioned constructs were cloned into pAAV vectors (Takara and Clontech) to enable the preparation of AAV viruses. The inserts were cloned using restriction digestion of the pAAV plasmid and PCR amplification of the original pGL4.10 construct.

[0224] The effect of the inverted terminal repeat (ITR) on the activity of the promoter was investigated. This was done because interference from the AAV ITR was observed in other projects. For this purpose, pAAV-PB1-MinTk and pAAV-PB1-2-MinTk were transfected into Huh7 and primary cells of ARE as described above, and their activities were evaluated.

[0225] The results of these experiments are shown in Figures 4A and 4B. These graphs represent the average of three biological replicates and show that the ITR does not affect the performance of the promoter. The induction of luciferase expression from the PB1-MinTK and PB1-2-MinTK constructs is equivalent across vectors and cell types. These constructs are remarkably robust, and the plasmid backbone does not appear to affect activity.

Example

[0226] Luciferase expression from the PB1-MinTK and PB1-2-MinTK constructs of the pAAV vector in AXOL ARE hepatocytes is inducible by CITCO (1 μM) but decreases after excluding CITCO, as shown in Figure 5. This indicates that when the drug is excluded, the activity of the promoter decreases to nearly the baseline level.

Example

[0227] - In vivo experiments using AAVs containing induction of PB1 and PB1-2 From the previous application, the constructs PB1 (a single mouse PBREM element and Min-TK promoter) and PB1-2 (3×PBREM and min-TK promoter) were selected for in vivo testing in mice. This was carried out as follows.

[0228] AAV viruses were produced using the AAV constructs of PB1 and PB1-2 from the previous application, the sequences below (SEQ ID NO: 49 and 50, Table 3 (Table 4)).

[0229] AAV generation Day 1: - Seed HEK293-AAV cells in a 15cm plate. On the day of transfection, 70-80% of the cells should be confluent. - Final volume of each plate: 15ml Day 2: Prepare the transfection mix: - DNA mix / plate: pDG9 (packaging plus for AAV9): 10.5 μg / pHGTI (Ad. helper plasmid): 31.5 μg / Vector plasmid: 10.5 μg / Serum-free DMEM / Prepared in Optimem - Transfer mix / plate: PEI: 125 μl / serum-free DMEM / prepared in Optimem - Add the DNA mix to the transfection mix. Mix and let stand at room temperature for 15-20 minutes. - Add 3 ml of transfection mix dropwise to each plate and gently distribute. Incubate for 24 hours. Day 3: - Replace the culture medium with 15 ml of DMEM supplemented with P / S and 2% FCS. Let stand for 48 hours. Day 5: - Collect the supernatant and pool 25 ml of each solution into 50 ml tubes. Store at -20°C. - Collect the cells: Add 5 ml of PBS to each plate → scrape and collect the cells in a 50 ml tube. - Add another 1 ml of PBS to wash the plate and collect it. - Rotate at 1500 rpm for 5 minutes. - Remove the supernatant and resuspend the pelleted cells in 1 ml / plate of TD lysis buffer → pool. Store at -80°C.

[0230] Endonuclease treatment cell: - Freeze and thaw the pellets five times: approximately 20 minutes at 37°C, followed by approximately 20 minutes with dry ice (or -80°C). - Add 25 μl / ml of 20% deoxycholic acid to the cells (or 50 μl / ml of 10% deoxycholic acid). - Add 8 μl / ml of benzoase to the cells. - Incubate at 37°C for 30 minutes. - It rotates at 4Krpm for 30 minutes. - Filter the supernatant using a 0.45 μM filter. - Store at 4°C for up to 24 hours. Supernatant: - Add 2.5 μl of benzonase / 25 ml of supernatant. - Add 450 μl / 25 ml of MgSO4 supernatant. - Incubate at 37°C for 30 minutes. - Rotate at 4Krpm for 30 minutes. - Filter the supernatant using a 0.45 μM filter. - Store at 4°C for up to 24 hours. HPLC purification - Place both series into 20% ETOH → Template → System Wash - Place series A in PBS and series B in glycine → template → system wash - Insert the column into the machine → Manual run → Flow rate: 5 ml / min → Run for 25 ml or until the UV line is flat. - Prepare FACS tubes (10 for cells, more for supernatant): Add 30 μl of Tris per tube → Place in the machine to collect the vector. - Place the waste liquid series into a separate tube so that it can be passed through the column again. - Run the sample (the flow rate is low, depending on how fast the system is and how concentrated the sample is; the flow rate is slower for cells and higher for supernatant). - After running the waste liquid through the column, wash with PBS → Flow rate: 5 ml / min until the UV line is flat. - Settings → Fraction size: 1 ml; Flow rate: 1 ml / min; Concentration %B: 100% → Run. - Begin collection. Look for peaks. Peaks indicate vector purification. Mark the tubes containing these vectors. - Save the program before exiting. - Wash with PBS → 75 ml, 5 ml / min - Wash with Na3PO4 (to preserve the column) → 75 ml, 5 ml / min - Remove the column and store it at 4°C. - Clean the machine with PBS → Template → System cleaning - Clean the machine with 20% ETOH → Template → System cleaning - Set both series to 20% ETOH and shut them down. - Add 2L of PBS to a large bucket and place the dialysis cassette (Side-A-Lyzer; Thermo Scientific) on top to prime it. - Collect the vector from the marked FACS tube using a syringe and needle and add it to the dialysis cassette → Remove excess air from the membrane, carefully place the rubber on top of the cassette and float it in a bucket containing PBS → Leave it overnight at room temperature on a slowly rotating rotor. the next day: - Prime the membrane by adding 5 ml of PBS onto a centrifugal filter (Amico Ultra 15; MERCK) → rotate at 4K rpm for 5 minutes. - Remove excess PBS from the inside of the membrane. - Remove the vector from the cassette and load it onto the membrane → Rotate at 4Krpm for 5 minutes. - The membrane containing the vector is washed several times, and then collected on a 2 ml centrifuge tube filter with a 0.22 μM (Spin-X; COSTAR) filter. - Rotate at 13Krpm for 3 minutes. - Filter and fixed volume: Take out 1 × 100 μl (for injection), and the remaining portion should be a fixed volume of 10 to 2 μl. - Store at 80°C. - Virus quantification was performed using qRT-PCR with primers and probes targeting the luciferase gene.

[0231] Mouse experiment The designated AAV serotype was AAV9, chosen because it is targeted to most tissues and organs, thus providing an ideal specificity for the promoter of this invention (avoiding the problem of AAV targeting). The output from the experiment was luciferase activity, visually measured by the first reading on day 5 after injection. Mice were then monitored weekly, and after 35 days, when the control vector AAV9 containing CMV-IE showed consistent and steady results, a baseline for induction profiling was established. Inducing substances were added at this point, but measurements were taken before and after induction. See below for more details. mouse: - Adult (8-week-old) CD1 male mice were injected with AAV9 vector via the tail vein. - Total 5×10 11 The vector genome copy number / ml was administered to each mouse. - Mice were imaged 5 days after injection. The mice were first anesthetized and given an intraperitoneal injection of luciferin (300 μl of luciferin stock at 15 mg / ml). Five minutes later, the mice were placed in an IVIS machine and images were acquired. Image creation: - The exposure times used for the images were set to 1 second and 10 seconds. - Images were taken once a week. Furthermore, mice were imaged daily for four days before administering the inducer or repressor. Induction: The inducer (phenobarbital) was administered at a concentration of 5 mg / ml. Mice received 10 μl intraperitoneally, or 50 micrograms per mouse (each mouse weighing approximately 30 g).

[0232] result The experimental results can be seen in Figure 8. Figure 8A shows representative mice from each construct tested. Here, we can see that the expression of both PB1 and PB1-2 is limited to the liver, while the CMV-IE promoter is expressed in almost all tissues of the mouse. Furthermore, at 0 hours, the PB1 and PB1-2 mice showed no expression of the luciferase gene, suggesting strictly controlled expression. However, upon addition of the inducer phenobarbital, the expression of both PB1 and PB1-2 increased. There was some variation in the magnitude and duration of induction. For example, PB1 induced approximately a 10-fold increase, with maximum activity observed at 9 hours, but induction was not complete until 24 hours, whereas PB1-2 showed approximately a 50-fold increase, with maximum activity at 24 hours, and in this case, induction was not complete until 48 hours after injection (Figures 8B and 8C). These data support the findings observed in model cell lines and further demonstrate the potential of the inducible system of the present invention for in vivo use. The system of the present invention exhibits low background noise and good inducibility even when the inducer is administered at one-tenth the recommended dose for humans. [Examples]

[0233] - Variants of the PBREM element As discussed above, the nuclear receptor CAR binds to DNA sequences in both humans and mice. As can be seen from the sequence alignment, there is some sequence variance between species. The 51-bp modular PBREM element can itself be broken down into three different parts (see table below): 1) the NR1 region (containing the NR1 element), which is thought to be responsible for most of the inducible activity; 2) the NF1 region (containing the NF1 element), which binds to other nuclear receptors and can be responsible for reducing background levels in the absence of activated CAR; and 3) the NR2 region (containing the NR2 element), which is also involved in the inducible activity of CAR.

[0234] The alignment and depiction of the component parts that make up the PBREM element are shown below:

[0235] [ka]

[0236] (Mouse = Sequence ID 1, Human = Sequence ID 2)

[0237] [Table 1]

[0238] In the previous example, the promoter variant used contained a mouse PBREM element. To confirm our expectation that human PBREM elements could also be used, we also evaluated the inducibility of human PBREM; this is potentially relevant as one objective of this project is to provide an inducible promoter for use in human gene therapy, and human sequences may have several advantages. In addition, we evaluated human-mouse hybrids of PBREM elements to determine whether they could modulate or improve the promoter's inducibility and background levels. Such novel combinations are not thought to occur naturally under any circumstances and may possess novel traits, such as novel backgrounds or induction levels. The constructs were tested with the PGL4.10 backbone as previously described, and are listed below in Table 2 (Table 3). These are as follows: Human NR1x3-Min TK (3x Human NR1 region containing the MinTK minimal promoter); Human PBREM-minTK (Human PBREM containing the MinTK minimal promoter); hNR1-mNFI-hNR2-Min TK (Human-mouse-human hybrid containing the MinTK minimal promoter); hNR1-mNFI-mNR2-Min TK (Human-mouse-mouse hybrid containing the MinTK minimal promoter); mNR1-hNFI-mNR2-Min TK (Mouse-human-mouse hybrid containing the MinTK minimal promoter); mNR1-hNFI-hNR2-Min TK (Mouse-human-human hybrid containing the MinTK minimal promoter); hPB-SV40 (Human PBREM containing the SV40 minimal promoter); and MHM-SV40 (Mouse-human-mouse hybrid containing the SV40 minimal promoter) - these are sequence numbers 59 to 66, respectively.

[0239] These constructs were tested in Huh7 stable cell lines and primary hepatocytes, as previously described. In addition, natural compound flavones were tested to test the constructs using the conventional human CAR activator CITCO. Flavones are GRAS (Generally Recognized as Safe) products that have been previously reported to activate human CARs, and due to their non-toxic nature and low side effects, they may be useful drugs for use in gene therapy. CITCO has been predicted to be relatively unstable in vivo, and there is no available data on its safety for use in humans; therefore, it is preferable to use it only in tissue culture. Furthermore, the in vivo results presented above were obtained using phenobarbital as an inducer. In some situations, the use of phenobarbital may be undesirable, even at one-tenth of the recommended dose (which appears possible based on the data above). Therefore, flavones can be considered a more desirable inducer, mitigating some safety and regulatory issues.

[0240] The results of these experiments are shown in Figures 9 and 10. These figures show a comparison with PB1 tested in vivo. In both stable CAR-expressing Huh7 cell lines (Figure 9) and primary cells (Figure 10), human PBREM (hPB) functioned almost identically to mouse PBREM (PB1), suggesting that they are compatible with both the Min-TK and SV40 minimal promoters. Of the hybrids tested, with the exception of the MHM hybrid, all were inducible to similar levels with similar backgrounds to PB1. This suggests that the MHM hybrid may have tighter expression regulation than the PB1 construct, despite lower backgrounds and lower overall activity; this is independent of the minimal promoter situation, as this hybrid showed similar results with both Min-Tk and SV40. All constructs were induced to similar levels with CITCO by flavones, indicating that this compound is indeed a useful inducer for PBREM constructs. The slight outlier in these experiments was a construct composed of 3×NR1 derived from human PBREM. This construct had a relatively high background, was induced only in stable cell lines, and was less so in primary cells.

[0241] From these experiments, we applied an approach similar to that of the examples discussed above. The best monomer, human PBREM, and MHM hybrid were polymerized and tested with both the Min-Tk minimal promoter and the SV40 minimal promoter. The sequences of these polymers are shown in Table 3 (Table 4). The promoters are as follows: 2×hPB SV40 (2× human PBREM element containing SV40 minimal promoter); 2×MHM-MinTK (2× mouse-human-mouse hybrid containing MinTK minimal promoter); 2×MHM-SV40 (2× mouse-human-mouse hybrid containing SV40 minimal promoter); 3×hPB minTK (3× human PBREM element containing MinTK minimal promoter); and 3×hPB-SV40 (3× human PBREM element containing SV40 minimal promoter) - SEQ ID NOs. 67-71, respectively.

[0242] Expression and induction from these promoters were evaluated using both CITCO and flavones in both stable Huh7CAR-expressing cell lines and primary hepatocytes, as described above.

[0243] The results are shown in Figures 11 and 12. The comparison here is with PB1-2 from previous examples. It was observed that all multimer promoters were highly induced with both compounds, and that they all had extremely low background regardless of the minimal promoter used. Furthermore, 2×MHM and 3×hPB showed the best results, with overall expression levels higher than those observed with PB1-2 and with comparable background levels. This suggests that some novel promoters may function better in vivo and also provide more options for controlling gene expression as needed.

[0244] [Table 2]

[0245] Table 3A

[0246] Table 3B

[0247]

Table 3C

[0248]

Table 3D

[0249] Table 4A

[0250] Table 4B

[0251] Table 4C

[0252] Table 4D

[0253] Table 4E

[0254] [Table 4F]

[0255]

Table 4G

[0256] Table 4H

[0257] Table 4I

Claims

1. A cis-regulating module (CRM) comprising two or more cis-regulating elements (CREs) capable of being coupled and activated by a heterodimer of CAR and RXR, Each CRE that can be bound and activated by the CAR-RXR heterodimer has the following sequence: A CRM comprising or consisting of the sequence NCTGTACTTTCCTGACCNTGNNNNNGTGNCANCATNNACTTNCCTGANNCN (Sequence ID 41), or a sequence that is at least 95% identical thereto.

2. One of the following arrays: - NCTGTACTTTCCTGACCNTGNNNNNGTGNCANCATNNACTTNCCTGANNCN-S-NCTGTACTTTCCTGACCNTGNNNNNGTGNCANCATNNACTTNCCTGANNCN(Sequence No. 42); or - NCTGTACTTTCCTGACCNTGNNNNNGTGNCANCATNNACTTNCCTGANNCN-S-NCTGTACTTTCCTGACCNTGNNNNNGTGNCANCATNNACTTNCCTGANNCN-S-NCTGTACTTTCCTGACCNTGNNNNNGTGNCANCATNNACTTNCCTGANNCN (SEQ ID NO: 43), (In the formula, S is an optional spacer.) The CRM according to claim 1, comprising or consisting of the following.

3. One of the following arrays: - TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC-S-TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC (SEQ ID NO: 44); - TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC-S-TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC-S-TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC (SEQ ID NO: 45); - ACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCA-S-ACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCA-S-ACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCA (SEQ ID NO: 46); or - ACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCA-S-ACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCA (SEQ ID NO: 47), (In the formula, S is an optional spacer.) A CRM according to claim 1 or 2, comprising or consisting of the following.

4. One of the following sequences: - TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC-S-CTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC (SEQ ID NO: 76); - TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC-S-TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC-S-TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC-S-TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC (SEQ ID NO: 77); - CTGTACTTTCCTGACCTTGAAGAGGTGGCACCATCAACTTGCCTGACACC-S-TCTGTACTTTCCTGACCTTGAAGAGGTGGCACCATCAACTTGCCTGACACC (SEQ ID NO: 78); The CRM according to claim 1, comprising a functional variant thereof that includes an array which is at least 90% identical to any of the above arrays (wherein S is an optional spacer).

5. The CRM according to claim 1, wherein each CRE, which can be bound and activated by a heterodimer of CAR and RXR, is separated by a spacer.

6. The CRM according to claim 4, wherein S is a spacer.

7. The CRM according to claim 5 or 6, wherein the spacer is 2 to 100 nucleotides.

8. The CRM according to any one of claims 5 to 7, wherein the spacer is a nucleotide with a length of 18 to 22 nucleotides.

9. One of the following sequences: - TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACCCATTACTCGCATCCATTCTCTCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC (SEQ ID NO: 81); - TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACCCATTACTCGCATCCATTCTCTCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACCGCACTGAAGGTCCT CAATCGTCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACCCTGACCTCCTGCCAGCAATATCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC (SEQ ID NO: 82) - CTGTACTTTCCTGACCTTGAAGAGGTGGCACCATCAACTTGCCTGACACCCATTACTCGCATCCATTCTCTCTGTACTTTCCTGACCTTGAAGAGGTGGCACCATCAACTTGCCTGACACC (SEQ ID NO: 83); - ACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCACATTACTCGCATCCATTCTCACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCA (SEQ ID NO: 84); or - ACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCACATTACTCGCATCCATTCTCACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCAGCACTGAAGGTCCTCAATCGACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCA (SEQ ID NO: 85), A CRM according to any one of claims 1 to 8, comprising a functional variant thereof, which includes a sequence that is at least 90% identical to any of the sequences.

10. A CRM according to any one of claims 1, 2, and 4-9, comprising at least one non-natural CRE.

11. A synthetic liver-specific inducible promoter comprising the CRM described in any one of claims 4 to 10.

12. The synthetic liver-specific inducible promoter according to claim 11, which contains no nucleic acid sequences that would result in constitutive expression or expression in non-hepatic cells, or contains a minimum amount of nucleic acid sequences that would result in constitutive expression or expression in non-hepatic cells.

13. The synthetic liver-specific inducible promoter according to claim 11, comprising 2 to 10 CREs that can be bound and activated by a heterodimer of CAR and RXR according to claim 1.

14. An expression cassette comprising a synthetic liver-specific inducible promoter according to any one of claims 11 to 13, which is linked to a gene.

15. The gene is not a reporter gene, and / or, Genes code for proteins or RNA, and / or The expression cassette according to claim 14, wherein the gene encodes a therapeutic expression product or a therapeutic protein suitable for use in the treatment of a liver-related disease or condition.

16. An expression cassette according to claim 14 or 15, comprising a sequence that provides or codes for one or more of the following: a ribosome binding site, a start codon, a stop codon, a transcription termination sequence, a nucleic acid encoding a post-transcriptional regulatory element, and / or a poly(A) element.

17. A gene therapy vector comprising an expression cassette according to any one of claims 14 to 16.

18. A recombinant virion comprising a synthetic liver-specific inducible promoter according to any one of claims 11 to 13, an expression cassette according to any one of claims 14 to 16, or a gene therapy vector according to claim 17.

19. A cell comprising the CRM according to any one of claims 1 to 10, the synthetic liver-specific inducible promoter according to any one of claims 11 to 13, the expression cassette according to any one of claims 14 to 16, or the gene therapy vector according to claim 17.

20. The cell according to claim 19, which is a eukaryotic cell, a hepatocyte, or a prokaryotic cell.

21. Use of cells according to claim 19 or 20 in a bioprocessing method for producing a target product.

22. - A step of preparing cells containing an expression cassette specified in any one of claims 14 to 16; and - A step of administering to the cells an inducer capable of inducing the expression of an expression product from a gene operably linked to an inducible promoter in the expression cassette. A method for generating expression products ex vivo in cells, including a method for this purpose.