Genetically modified T cells with disrupted Regnase-1 and / or TGFBRII showed improved functionality and persistence.

Abstract

A population of genetically engineered T cells comprising a disrupted Reg1 gene and / or a disrupted TGFBRII gene. Such genetically engineered T cells may comprise additional genetic modifications, such as a disrupted CD70 gene. The genetically engineered T cell population exhibits one or more of the following compared to their non-engineered T cell counterparts: (a) improved cell proliferation activity, (b) enhanced persistence, and (c) reduced T cell exhaustion, (d) enhanced cytotoxic activity, (e) resistance to the inhibitory effects induced by TGF-β, and (f) resistance to the inhibitory effects of fibroblasts and / or inhibitory factors secreted thereby.

Description

[Technical Field]

[0001] Cross-reference of related applications This application claims the benefit of the filing dates of U.S. Provisional Patent Application No. 63 / 082,357 filed September 23, 2020, U.S. Provisional Patent Application No. 63 / 124,429 filed December 11, 2020, and U.S. Provisional Patent Application No. 63 / 225,673 filed July 26, 2021. The entire contents of each prior application are incorporated herein by reference. [Background technology]

[0002] Chimeric antigen receptor (CAR) T-cell therapy uses genetically modified T cells to more specifically and efficiently target and kill cancer cells. After T cells are harvested from the blood, these cells are engineered to contain CARs on their surface. CARs can be introduced into T cells using CRISPR / Cas9 gene editing technology. When these allogeneic CAR-T cells are injected into a patient, the receptors enable the T cells to kill cancer cells. [Overview of the project] [Problems that the invention aims to solve]

[0003] T cells with improved persistence in culture medium are desired for CAR-T therapy. Such T cells would survive longer both in vitro and in vivo, thereby providing benefits in the production and clinical application of CAR-T cells. However, improving the persistence of T cells in culture medium remains challenging. [Means for solving the problem]

[0004] This disclosure is at least in part based on the development of gene-edited T cells carrying a disrupted Regnase 1 (Reg1) gene (e.g., “Reg1 knockout T cells”), a disrupted TGFBRII gene (e.g., “TGFBRII knockout T cells”), or gene-edited T cells carrying both a disrupted Reg1 gene and a disrupted TGFBRII gene, and on effective methods for producing such gene-edited T cells via CRISPR / Cas-mediated gene editing using guide RNAs, such as those that target specific sites within the Reg1 gene with high on-target editing efficiency and low off-target editing efficiency, and / or those that target specific sites within the TGFBRII gene with high on-target editing efficiency and low off-target editing efficiency.

[0005] Such genetically modified T cells exhibit at least one of the following advantageous characteristics: (a) improved cell proliferation activity, (b) enhanced persistence, (c) reduced T cell exhaustion, (d) resistance to inhibitory effects induced by TGF-β, (e) enhanced cytotoxicity, and (f) resistance to inhibitory effects by fibroblasts and / or inhibitory factors secreted by them.

[0006] T cells with disrupted Reg1, T cells with disrupted TGFBRII, or T cells with disrupted both Reg1 and TGFBRII, as disclosed herein, can be further genetically engineered to express chimeric antigen receptors (CARs) that target antigens of interest, such as those associated with undesirable cells like cancer cells, and may also contain one or more additional disrupted genes, such as TRAC, β2M, CD70, or a combination thereof. The resulting CAR-expressing, Reg1-disrupted T cells exhibit enhanced cytotoxicity and antitumor activity against target cells compared to CAR-T cells possessing the wild-type Reg1 gene.

[0007] In some embodiments, this disclosure relates to the development of genetically engineered CAR-T cells containing a disrupted Reg1 gene. In certain embodiments, the genetically engineered CAR-T cells are further genetically engineered to contain a disrupted differentiation antigen group 70 (CD70) gene. In some embodiments, the CAR-T cells described herein may express an anti-CD70 CAR, an anti-differentiation antigen group 19 (CD19) CAR, or an anti-B cell maturation antigen (anti-BCMA) CAR.

[0008] The gene-edited T cells disclosed herein exhibited enhanced cell growth, lifespan, and reproductive capacity in culture medium, improved potency (e.g., enhanced cytotoxicity), and enhanced CAR-T efficacy (e.g., through longer-lasting effects) in animal models. Furthermore, the gene-edited T cells showed cytokine-dependent proliferation, suggesting safety. Moreover, disruption of both the Reg1 and TGFBRII genes, as observed in animal models, demonstrated synergistic effects of antitumor activity and CAR-T cell growth and persistence.

[0009] Accordingly, the Disclosure provides, in some embodiments, a population of genetically engineered T cells comprising (i) a disrupted Regnase-1 (Reg1) gene and / or (ii) a disrupted transforming growth factor β receptor II (TGFBRII) gene. In some embodiments, the population of genetically engineered T cells comprises (i). In some embodiments, the population of genetically engineered T cells comprises (ii). In other embodiments, the population of genetically engineered T cells comprises both (i) and (ii). Any of the genetically engineered T cells may be further engineered to express a chimeric antigen receptor (CAR).

[0010] The genetically modified T cell populations disclosed herein have one or more of the following characteristics compared to their unmodified T cell counterparts: (a) improved cell proliferation activity, (b) enhanced persistence, (c) reduced T cell exhaustion, (d) resistance to inhibitory effects induced by TGF-β, (e) enhanced cytotoxicity, and (f) resistance to inhibitory effects by fibroblasts and / or inhibitory factors secreted therefrom.

[0011] In some embodiments, the disrupted Reg1 gene is edited within exon 1, exon 2, exon 3, or exon 4. In some examples, the disrupted Reg1 gene is edited within exon 2 and / or exon 4. Alternatively, the disrupted TGFBRII gene is edited within exon 1, exon 2, exon 3, exon 4, or exon 5. In some examples, the disrupted TGFBRII gene is edited within exon 4. In other examples, the disrupted TGFBRII gene is edited within exon 5. The disrupted Reg1 gene, the disrupted TGFBRII gene, or both can be edited by a CRISPR / Cas-mediated gene editing system.

[0012] In some cases, CRISPR / Cas-mediated gene editing involves a guide RNA (gRNA) that targets a portion of the Reg1 gene containing a nucleotide sequence (with or without PAM) listed in Table 22 (e.g., SEQ ID NOs. 320, 322, 323, or 327, or a corresponding PAM-containing sequence). For example, the gRNA targeting the Reg1 gene contains a spacer containing a nucleotide sequence listed in Table 22 (e.g., SEQ ID NOs. 24, 32, 36, or 52). In some examples, the disrupted Reg1 gene contains a nucleotide sequence selected from those listed in Tables 29-38 (e.g., Tables 31, 33, 34, or 38).

[0013] In some cases, the CRISPR / Cas-mediated gene editing system includes a guide RNA (gRNA) that targets a portion of the TGFBRII gene containing nucleotide sequences (with or without PAM) listed in Table 39. For example, a gRNA targeting the TGFBRII gene may include a spacer listed in Table 39, having, for example, one of the nucleotide sequences SEQ ID NOs. 270, 302, 308, and 312. In some examples, the disrupted TGFBRII gene may contain nucleotide sequences selected from those listed in Tables 40-48 (e.g., Table 43).

[0014] Any of the gRNAs disclosed herein may further include scaffold sequences. For example, a gRNA targeting the Reg1 gene may include any of the nucleotide sequences listed in Table 22. Examples include 22, 23, 30, 31, 34, 35, 50, and 51. Alternatively, a gRNA targeting the TGFBRII gene may further include any of the nucleotide sequences provided in Table 39. Examples include SEQ ID NOs. 270, 271, 300, 301, 306, 307, 312, and 313.

[0015] Any of the genetically engineered T cell populations disclosed herein may further include: (iii) a disrupted T cell receptor alpha chain constant region (TRAC) gene, (iv) a disrupted beta-2-microglobulin (β2M) gene, (v) a disrupted CD70 gene, or (vi) any combination of (iii) to (v). In some embodiments, the engineered T cells further include a disrupted T cell receptor alpha chain constant region (TRAC) gene. Or, the T cells further include a disrupted beta-2-microglobulin (β2M) gene. Any of the T cells disclosed herein may also include a disrupted CD70 gene. In some examples, the disrupted TRAC gene, the disrupted β2M gene, and / or the disrupted CD70 gene are gene-edited by one or more CRISPR / Cas-mediated gene-editing systems.

[0016] In some embodiments, the genetically engineered T cells may contain a nucleic acid encoding a CAR, which is inserted into the T cell genome. In some cases, the CAR-encoding nucleic acid is inserted into a disrupted Reg1 gene, a disrupted TGFBRII gene, a disrupted TRAC gene, a disrupted β2M gene, or a disrupted CD70 gene. In some examples, the CAR-encoding nucleic acid is inserted into a disrupted TRAC gene. In certain examples, the CAR-encoding nucleic acid can replace a deleted fragment containing sequence number 69 of the TRAC gene. In some examples, the disrupted Reg1 gene may contain nucleotide sequences listed in Tables 29-38 (e.g., Tables 31, 33, 34, or 38). In some examples, the disrupted TGFBRII gene may contain a nucleotide sequence selected from those listed in Tables 40-48 (e.g., Table 43). In some examples, the disrupted TRAC gene may contain one of the nucleotide sequences from sequence numbers 75-82 (see Table 24). In some cases, the disrupted β2M may contain one nucleotide sequence from sequence numbers 83–88 (see Table 25). In some cases, the disrupted CD70 gene may contain one nucleotide sequence from sequence numbers 89–94 (see Table 26).

[0017] Any of the CAR constructs disclosed herein may include an extracellular antigen-binding domain specific to a tumor antigen, a 4-1BB or CD28 costimulatory signaling domain, and a CD3ζ cytoplasmic signaling domain. In some examples, the tumor antigen is CD19. In some examples, the tumor antigen is BCMA. In some examples, the tumor antigen is CD70. In some examples, the tumor antigen is CD33. In some examples, the tumor antigen is PTK7.

[0018] In some embodiments, the CAR binds to CD19 (anti-CD19 CAR). The extracellular antigen-binding domain in the anti-CD19 CAR may be a single-chain variable fragment (scFv) that binds to CD19 (anti-CD19 scFv). In some cases, the anti-CD19 scFv may have (i) a heavy chain variable region (V) containing the same heavy chain complementarity-determining region (CDR) as that of SEQ ID NO: 124. H ), and (ii) a light chain variable region (V) containing the same light chain CDR as that of sequence number 125. L ) may include. In some examples, V H It contains the amino acid sequence of SEQ ID NO: 124, V L This includes the amino acid sequence of SEQ ID NO: 125. For example, anti-CD19 scFv includes the amino acid sequence of SEQ ID NO: 120. In certain specific examples, anti-CD19 CAR includes the amino acid sequence of SEQ ID NO: 118 (including the N-terminal signal peptide) or SEQ ID NO: 353 (without the N-terminal signal peptide).

[0019] In some embodiments, the CAR binds to CD70 (anti-CD70 CAR). The extracellular antigen-binding domain in the anti-CD70 CAR may be a single-chain variable fragment (scFv) that binds to CD70 (anti-CD70 scFv). In some cases, the anti-CD70 scFv may have (i) a heavy chain variable region (V) containing the same heavy chain complementarity-determining region (CDR) as that of SEQ ID NO: 143. H ), and (ii) a light chain variable region (V) containing the same light chain CDR as that of sequence number 144. L ) includes. In some examples, V H It contains the amino acid sequence of SEQ ID NO: 143, V L This includes the amino acid sequence of SEQ ID NO: 144. For example, anti-CD70 scFv includes the amino acid sequence of SEQ ID NO: 140 or 142. In certain examples, anti-CD70 CAR includes the amino acid sequence of SEQ ID NO: 138 (including the N-terminal signal peptide) or SEQ ID NO: 354 (without the N-terminal signal peptide).

[0020] In some embodiments, the CAR binds to BCMA (anti-BCMA CAR). The extracellular antigen-binding domain in the anti-BCMA CAR can be a single-chain variable fragment (scFv) that binds to BCMA (anti-BCMA CAR). In some cases, the anti-BCMA scFv comprises (i) a heavy-chain variable region (V H ) that contains the same heavy-chain complementarity-determining regions (CDRs) as those of SEQ ID NO: 149, and (ii) a light-chain variable region (V L ) that contains the same light-chain CDRs as those of SEQ ID NO: 150. In some examples, V H comprises the amino acid sequence of SEQ ID NO: 149 and V L comprises the amino acid sequence of SEQ ID NO: 150. In one example, the anti-BCMA scFv comprises the amino acid sequence of SEQ ID NO: 148. In a particular example, the anti-BCMA CAR comprises the amino acid sequence of SEQ ID NO: 146 (including the N-terminal signal peptide) or SEQ ID NO: 355 (without the N-terminal signal peptide).

[0021] The genetically engineered T cells disclosed herein can be derived from primary T cells of one or more human donors. In some cases, the genetically engineered T cells exhibit cytokine-dependent proliferation.

[0022] In other aspects, the disclosure provides a method for preparing any of the populations of genetically engineered T cells disclosed herein. In some cases, the method can include (a) providing a plurality of cells that are T cells or their progenitor cells, (b) genetically editing the Reg1 gene and / or the TGFBRII gene, and (c) generating a population of genetically engineered T cells having a disrupted Reg1 gene and / or TGFBRII gene. In some examples, the T cells of step (a) are derived from primary T cells of one or more human donors. In some examples, step (b) includes genetically editing the Reg1 gene. In some examples, step (b) includes genetically editing the TGFBRII gene. In some examples, step (b) includes genetically editing both the Reg1 gene and the TGFBRII gene.

[0023] In some embodiments, step (b) is carried out by one or more CRISPR / Cas-mediated gene editing systems. For example, step (b) may be carried out by delivering an RNA-induced nuclease and a gRNA that targets the Reg1 gene to a plurality of cells. In some cases, the gRNA that targets the Reg1 gene may be specific to an exon of the Reg1 gene, e.g., exon 2 or exon 4. In some examples, the gRNA that targets the Reg1 gene includes a spacer containing a nucleotide sequence listed in Table 22 (e.g., SEQ ID NOs: 24, 32, 36, or 52).

[0024] Alternatively, step (b) may be carried out by, among other things, delivering an RNA-induced nuclease and a gRNA that targets the TGFBRII gene to a plurality of cells. For example, the gRNA that targets the TGFBRII gene may be specific to an exon of the TGFBRII gene, e.g., exon 1, exon 2, exon 3, exon 4, and exon 5. In one example, the gRNA that targets the TGFBRII gene is specific to exon 4. In another example, the gRNA that targets the TGFBRII gene is specific to exon 5. In some cases, the gRNA that targets the TGFBRII gene includes spacers listed in Table 39. Examples include SEQ ID NOs: 272, 302, 308, and 314.

[0025] Any of the gRNAs disclosed herein may further include scaffold sequences. For example, a gRNA targeting the Reg1 gene may include any of the nucleotide sequences listed in Table 22. Examples include SEQ ID NOs. 22, 23, 30, 31, 34, 35, 50, and 51. Alternatively, a gRNA targeting the TGFBRII gene may further include any of the nucleotide sequences provided in Table 39. Examples include SEQ ID NOs. 270, 271, 300, 301, 306, 307, 312, and 313.

[0026] In any of the methods disclosed herein, the T cells of step (a) include one or more of the following gene modifications: (i) being engineered to express a chimeric antigen receptor (CAR), (ii) having a disrupted T cell receptor alpha chain constant region (TRAC) gene, (iii) having a disrupted β2M gene, and (iv) having a disrupted CD70 gene.

[0027] Alternatively, any of the methods disclosed herein, (i) Delivering nucleic acids encoding chimeric antigen receptors (CARs) to T cells, (ii) Destroying the expression of the TRAC gene through gene editing. (iii) Destroying the expression of the β2M gene through gene editing. (iv) Destroying the expression of the CD70 gene through gene editing, (v) These combinations may further include:

[0028] In some embodiments, one or more of (i) to (iv) are carried out by one or more CRISPR / Cas-mediated gene editing systems comprising one or more RNA-induced nucleases and one or more gRNAs that target the TRAC gene, the β2M gene, and / or the CD70 gene. In some examples, the gRNA that targets the TRAC gene includes a spacer containing the nucleotide sequence of SEQ ID NO: 61. In some examples, the gRNA that targets the β2M gene includes a spacer containing the nucleotide sequence of SEQ ID NO: 65. In some examples, the gRNA that targets the CD70 gene includes a spacer containing the nucleotide sequence of SEQ ID NO: 57. See Table 23.

[0029] In some embodiments, the methods disclosed herein may involve delivering to T cells one or more ribonucleoprotein particles (RNPs) which may contain one or more RNA-induced nucleases, one or more gRNAs, and nucleic acids encoding CARs. In some examples, the RNA-induced nuclease is a Cas9 nuclease, such as S. pyogenes Cas9 nuclease.

[0030] In some embodiments, the nucleic acid encoding the CAR is located in the AAV vector. In some cases, the nucleic acid encoding the CAR includes left and right homology arms adjacent to the nucleotide sequence encoding the CAR. The left and right homology arms are homologous to a genomic locus in the T cell, allowing for insertion of the nucleic acid into the genomic locus. In some examples, the genomic locus is located within the Reg1 gene. In some examples, the genomic locus is located within the TGFBRII gene. In some examples, the genomic locus is located within the TRAC gene. In some examples, the genomic locus is located within the β2M gene. In some examples, the genomic locus is located within the CD70 gene.

[0031] In some examples, the method involves disrupting the TRAC gene by a CRISPR / Cas-mediated gene editing system containing a gRNA containing the nucleotide sequence of SEQ ID NO: 59, and inserting the CAR-encoding nucleic acid into the site targeted by the gRNA. Alternatively, the method may further involve delivering a CAR-encoding nucleic acid specific to CD70 to a T cell and gene-editing the CD70 gene to disrupt its expression.

[0032] Any population of genetically modified T cells prepared by the methods disclosed herein is included in the scope of this disclosure.

[0033] Furthermore, this disclosure provides a method for eliminating undesirable cells in a subject, the method comprising administering one of the genetically engineered T cell populations disclosed herein to a subject in need thereof. In some embodiments, the undesirable cells are cancer cells such as hematopoietic carcinoma cells or solid tumor cells. In some embodiments, the undesirable cells are CD19 + In some embodiments, undesirable cells are BCMA + In some embodiments, the undesirable cells are CD70 + In some embodiments, the undesirable cells are CD33 + In some embodiments, the undesirable cells are PTK7 + That is the case.

[0034] In further embodiments, guide RNAs (gRNAs) that target the Reg1 gene are provided herein, comprising nucleotide sequences specific to a fragment in exon 2 or exon 4 of the Reg1 gene. In some embodiments, the gRNA comprises spacers listed in Table 22 (e.g., SEQ ID NOs: 24, 32, 36, or 52). Such gRNAs may further comprise scaffold sequences. Alternatively, the gRNA may further comprise one or more modified nucleotides. For example, the gRNA may comprise one or more 2'-O-methylphosphorothioate residues at the 5' and / or 3' ends of the gRNA. Examples of gRNAs that target Reg1 include any of those listed in Table 22 (e.g., SEQ ID NOs: 22, 23, 30, 31, 34, 35, 50, or 51; see also the disclosure herein).

[0035] In further embodiments, guide RNAs (gRNAs) that target the TGFBRII gene are provided herein, comprising nucleotide sequences specific to fragments in exon 1, exon 2, exon 3, exon 4, or exon 5 of the TGFBRII gene. In some examples, the gRNA comprises a nucleotide sequence specific to exon 4 of the TGFBRII gene. In other examples, the gRNA comprises a nucleotide sequence specific to exon 5 of the TGFBRII gene. In some cases, the gRNA comprises a spacer having nucleotide sequences listed in Table 39 (e.g., SEQ ID NOs. 272, 302, 308, and 314). Such gRNA may further comprise a scaffold sequence. Or, further, the gRNA comprises one or more modified nucleotides. For example, the gRNA comprises one or more 2'-O-methylphosphorothioate residues at the 5' and / or 3' ends of the gRNA. Examples of gRNAs that target the TGFBRII gene include any of those listed in Table 39 (e.g., SEQ ID NOs. 270, 271, 300, 301, 306, 307, 312, and 313).

[0036] The use of genetically modified T cells, Reg1-targeting gRNA, or TGFBRII-targeting gRNA for use in the treatment of a target disease disclosed herein (e.g., cancer, as disclosed herein), or for the manufacture of a drug intended for a therapeutic purpose, is also within the scope of this disclosure.

[0037] Details of one or more embodiments of the present invention are described below. Other features or advantages of the present invention will become apparent from the drawings below and the detailed descriptions of some embodiments, as well as from the appended claims. [Brief explanation of the drawing]

[0038] [Figure 1A-1B]Figures include illustrating that exemplary CAR-T cells with Reg1 knockout (anti-CD70 CAR-T cells) exhibit superior in vitro expansion. Figure 1A: Proliferation of anti-CD70 CAR-T cells (CAR-T) with Reg1 knockout using one of 10 guides (Z01-Z10) targeting Reg1 as shown. CAR-T indicates anti-CD70 CAR-T cells with the unedited (wild-type) Reg1 gene. Figure 1B: Proliferation of anti-CD70 CAR-T cells with Reg1 knockout using guide REG1-Z10 (Z10) for up to 52 days after HDR. Anti-CD70 CAR-T cells with the unedited Reg1 gene are also indicated as (CAR-T). (A) and (B) relate to the overlapping assay. [Figure 2A-2E]This includes diagrams showing that exemplary CAR-T cells with Reg1 knockout (+reg1 knockout) (anti-CD70 CAR-T cells) exhibit superior in vitro efficacy against tumor cell lines compared to CAR-T cells with the unedited Reg1 gene (CAR-T). Figure 2A: Cytolysis of ACHN cells by anti-CD70 CAR-T cells with Reg1 knockout using Regnase guide Z03 or Z10, compared to CAR-T cells with the unedited (wild-type) Reg1 gene (CAR-T). Cytolysis was measured after 24 hours of co-culture 12 days after HDR. Figure 2B: Cytolysis of ACHN cells by anti-CD70 CAR-T cells with Regnase 1 knockout using Regnase guide Z05 or Z06, compared to CAR-T cells with the unedited Reg1 gene. Cytolysis was measured after 24 hours of co-culture 12 days after HDR. Figure 2C: Cell lysis of ACHN cells by anti-CD70 CAR-T cells with Regnase 1 knockout using Regnase guides Z03, Z05, Z06, or Z10, compared to CAR-T cells with the unedited Reg1 gene. Cell lysis was measured after 24 hours of co-culture 27 days after HDR. Figure 2D: Cell lysis of caki-1 cells by anti-CD70 CAR-T cells with Regnase 1 knockout using Regnase guides Z03, Z05, Z06, or Z10, compared to CAR-T cells with the unedited Reg1 gene. Cell lysis was measured after 24 hours of co-culture 27 days after HDR. Figure 2E: Cell lysis of 769P cells by anti-CD70 CAR-T cells with Regnase 1 knockout using Regnase guides Z03, Z05, Z06, or Z10, compared to CAR-T cells with the unedited Reg1 gene. Cell lysis was measured after 24 hours of co-culture 27 days after HDR. [Figure 3A-3D]Figures include illustrating that exemplary CAR-T cells with Reg1 knockout (anti-CD70 CAR-T cells) (CAR-T + Reg KO, using a Z10 guide as an example) express lower levels of T cell exhaustion markers in vitro compared to their Reg1 wild-type counterpart (CAR-T). Figure 3A: Day 13 after HDR PD1 expression in Reg1 knockout (+Reg KO) CD4+ and CD8+ anti-CD70 CAR-T cells compared to their wild-type counterpart. Figure 3B: Day 26 after HDR PD1 expression in Reg1 knockout (+Reg KO) CD4+ and CD8+ anti-CD70 CAR-T cells compared to their wild-type counterpart. Figure 3C: Day 13 after HDR Tim3 expression in Reg1 knockout (+Reg KO) CD4+ and CD8+ anti-CD70 CAR-T cells compared to their wild-type counterpart. Figure 3D: Day 26 after HDR Tim3 expression in Reg1 KO (+Reg KO) CD4+ and CD8+ anti-CD70 CAR-T cells compared to wild-type counterparts. [Figure 4] This figure shows that exemplary CAR-T cells with Reg1 knockout (anti-CD19 CAR-T cells) exhibit enhanced expansion in the presence of cytokines in vitro, and that this in vitro expansion remains cytokine-dependent. Anti-CD19 CAR-T cells with Reg1 knockout (anti-CD19 CAR-T / Reg KO) and anti-CD19 CAR-T cells with the wild-type Reg1 gene (anti-CD19 CAR-T) were cultured for 40 days in the presence and absence of cytokines. [Figures 5A-5D]Figures include illustrating that in a xenograft mouse model of intravenously disseminated Nalm-6 human acute lymphoblastic leukemia tumor, exemplary CAR-T cells with Reg1 knockout (anti-CD19 CAR-T cells) (anti-CD19 CAR-T / Reg KO) resulted in superior in vivo survival and reduced tumor burden compared to Reg1 wild-type counterparts (anti-CD19 CAR-T). Figure 5A: Survival rates of untreated mice, mice treated with 4e6 anti-CD19 CAR-T cells, and mice treated with 4e6 anti-CD19 CAR-T / Reg KO cells. Figure 5B: Survival rates of untreated mice, mice treated with 8e6 anti-CD19 CAR-T cells, and mice treated with 8e6 anti-CD19 CAR-T / Reg KO cells. Figure 5C: Bioluminescent signals from bioluminescent model leukemia cells in mice treated with 4e6 anti-CD19 CAR-T cells or 4e6 anti-CD19 CAR-T / Reg KO cells. Figure 5D: Bioluminescent signals from bioluminescent model leukemia cells in mice treated with 8e6 anti-CD19 CAR-T cells or 8e6 anti-CD19 CAR-T / Reg KO cells. [Figure 6A] This includes a diagram showing that exemplary CAR-T cells with Reg1 knockout (anti-CD70 CAR-T cells) (CAR-T+Reg KO) exhibit superior in vitro efficacy against tumor cell lines compared to their Reg1 wild-type counterpart (CAR-T). Figure 6A: Cytolysis of ACHN cells by anti-CD70 CAR-T cells with Reg1 knockout using guide REG1-Z10 (CAR-T+Reg KO) compared to their Reg1 wild-type counterpart (CAR-T). Cytolysis was measured after 24-hour co-culture at 19 and 26 days post-HDR. [Figure 6B]This includes a diagram showing that exemplary CAR-T cells with Reg1 knockout (anti-CD70 CAR-T cells) (CAR-T+Reg KO) exhibit superior in vitro efficacy against tumor cell lines compared to their Reg1 wild-type counterpart (CAR-T). Figure 6B: Cytolysis of caki-1 cells by anti-CD70 CAR-T cells with Reg1 knockout using guide REG1-Z10 (CAR-T+Reg KO) compared to their Reg1 wild-type counterpart (CAR-T). Cytolysis was measured after 24-hour co-culture at 13, 19, and 26 days post-HDR. [Figures 7A-7B] The diagram includes images showing TGFBRII knockout using various guide RNAs, as shown. Figure 7A: Indel rates of the TGFBRII gene edited with eight gRNAs targeting various TGFBRII gene exons, as shown. From left to right: EX1_T1, EX1_T3, EX2_T1, EX3_T1, EX3_T2, EX4_T1, EX4_T2, and EX5_T1. The nucleotide sequences of each are shown in Table 32. Figure 7B: Immunoblot of TGFBRII expression in gene-edited T cells. GAPDH was used as a loading control. The mock sample was an unedited T cell with wild-type TGFBRII. [Figure 8A] This document includes figures illustrating the effect of TGF-β on CAR-T cell expansion. Anti-CD70 CAR-T cells were exposed to various concentrations of recombinant human TGF-β (10, 20, 50, 100 ng / ml), and cell numbers were recorded at various time points (Figure 8A). T cells with or without TGFBRII knockout, generated using various TGFBRII gRNAs as shown, were incubated with 0 or 50 ng / ml of TGF-β, and cell expansion was recorded over time (Figures 8B-8K). [Figure 8B-8E]This document includes figures illustrating the effect of TGF-β on CAR-T cell expansion. Anti-CD70 CAR-T cells were exposed to various concentrations of recombinant human TGF-β (10, 20, 50, 100 ng / ml), and cell numbers were recorded at various time points (Figure 8A). T cells with or without TGFBRII knockout, generated using various TGFBRII gRNAs as shown, were incubated with 0 or 50 ng / ml of TGF-β, and cell expansion was recorded over time (Figures 8B-8K). [Figure 8F-8I] This document includes figures illustrating the effect of TGF-β on CAR-T cell expansion. Anti-CD70 CAR-T cells were exposed to various concentrations of recombinant human TGF-β (10, 20, 50, 100 ng / ml), and cell numbers were recorded at various time points (Figure 8A). T cells with or without TGFBRII knockout, generated using various TGFBRII gRNAs as shown, were incubated with 0 or 50 ng / ml of TGF-β, and cell expansion was recorded over time (Figures 8B-8K). [Figure 8J-8K] This document includes figures illustrating the effect of TGF-β on CAR-T cell expansion. Anti-CD70 CAR-T cells were exposed to various concentrations of recombinant human TGF-β (10, 20, 50, 100 ng / ml), and cell numbers were recorded at various time points (Figure 8A). T cells with or without TGFBRII knockout, generated using various TGFBRII gRNAs as shown, were incubated with 0 or 50 ng / ml of TGF-β, and cell expansion was recorded over time (Figures 8B-8K). [Figure 9] This figure shows the effect of TGFBRII knockout on the CAR-T cell killing ability against A498 cells at various E:T ratios. TGFBRII knockout improves the cytotoxicity of CAR-T cells. [Figure 10A-10C]This document includes figures showing the effect of TGFBRII knockout on the cytotoxicity of CAR-T cells against multiple tumor cell lines. The cytotoxicity of anti-CD70 CAR-T cells was compared with that of anti-CD70 CAR-T cells with TGFBRII knockout. The cytotoxic activity of CAR-T cells was evaluated against CAKI-1 (Figure 10A), H1975 (Figure 10B), Hs-766T (Figure 10C), 786-O (Figure 10D), and SK-OV3 (Figure 10E). TGFBRII knockout improves the cytotoxicity of CAR-T cells. [Figure 10D-10E] This document includes figures showing the effect of TGFBRII knockout on the cytotoxicity of CAR-T cells against multiple tumor cell lines. The cytotoxicity of anti-CD70 CAR-T cells was compared with that of anti-CD70 CAR-T cells with TGFBRII knockout. The cytotoxic activity of CAR-T cells was evaluated against CAKI-1 (Figure 10A), H1975 (Figure 10B), Hs-766T (Figure 10C), 786-O (Figure 10D), and SK-OV3 (Figure 10E). TGFBRII knockout improves the cytotoxicity of CAR-T cells. [Figure 11] This graph shows the effect of TGFBRII knockout on CAR-T cell phenotype. Anti-CD70 CAR-T cells with or without TGFBRII knockout were exposed to 50 ng / ml recombinant human TGF-β, and CD25 expression was evaluated by flow cytometry. TGFBRII knockout protects CAR-T cells from the inhibitory effect of TGF-β on their cellular phenotype. [Figure 12] This graph shows that TGFBRII knockout protects CAR-T cells from the inhibitory effect of TGF-β on cytotoxicity. Anti-CD70 CAR-T cells were co-cultured with target tumor cells (A498) in the presence or absence of TGF-β (0, 1, 10, 50 ng / ml). The ability of anti-CD70 CAR-T cells with unedited TGFBRII to kill target cells was compared with anti-CD70 CAR-T cells with TGFBRII knockout, using the exemplary guide RNA shown. [Figure 13A-13C]The diagram includes images showing that TGFBRII knockout anti-CD70 CAR-T cells are resistant to the inhibitory effect of TGF-β on effector function. Anti-CD70 CAR-T cells were co-cultured with target cells containing TGF-β (50 ng / ml) or those lacking TGF-β (A498), and their ability to kill target cells was compared with anti-CD70 CAR-T cells containing TGFBRII knockout (e.g., anti-CD70 CAR+TGFBRII_EX4_T1). T cell proliferation (Figure 13A) and effector cytokine secretion were evaluated using Luminx (Figures 13B and 13C). [Figure 14] This graph shows that fibroblasts reduce the cytolytic activity of CAR-T cells. Anti-CD70 CAR-T cells were co-cultured in a 0.25:1 ratio of fibroblasts to anti-CD70 CAR-T cells with or without target cells (A498) containing fibroblasts (CCL-190) placed in a Transwell plate. [Figure 15A-15C] This includes graphs showing that TGFBRII knockout protects CAR-T cells from fibroblast inhibitory effects. Anti-CD70 CAR-T cells were co-cultured with target cells (A498) in a 0.1:1 (E:T) ratio in the presence of various doses of conditioned medium (2.5, 5, 10 μL) from CCL-190, and their cytotoxicity was evaluated and compared with cells containing TGFBRII knockout. The ability of anti-CD70 CAR-T cells (with or without TGFBRII knockout) to kill target cells is shown in Hs-766T pancreatic tumor cells (Figure 15A), A498 renal tumor cells (Figure 15B), and H1975 lung tumor cells (Figure 15C). [Figures 16A-16B] This includes a figure showing the synergistic effect of dual disruption of TGFBRII and Regnase compared to in vitro rechallenge of CAR-T cells with ACHN. Figure 16A: Improved efficacy. Figure 16B: Improved CAR enlargement. [Figure 17A]This includes a figure showing the synergistic effect of disrupting both the TGFBRII and Regnase genes in cancer xenograph models. Figure 17A: CAKI-1 renal cell carcinoma xenograph model with anti-CD70 CAR-T cells. Figure 17B: H1975 lung cancer xenograph model with anti-CD70 CAR-T cells. [Figure 17B] This includes a figure showing the synergistic effect of disrupting both the TGFBRII and Regnase genes in cancer xenograph models. Figure 17A: CAKI-1 renal cell carcinoma xenograph model with anti-CD70 CAR-T cells. Figure 17B: H1975 lung cancer xenograph model with anti-CD70 CAR-T cells. [Figure 18A] Includes a figure showing the synergistic effect of disrupting both the TGFBRII and Regnase genes in an RCC rechallenge xenograph model. Figure 18A: Reduction in RCC(A498) tumor size. Figure 18B: Inhibition of RCC tumor cell proliferation after rechallenge in ACHN cells. [Figure 18B] Includes a figure showing the synergistic effect of disrupting both the TGFBRII and Regnase genes in an RCC rechallenge xenograph model. Figure 18A: Reduction in RCC(A498) tumor size. Figure 18B: Inhibition of RCC tumor cell proliferation after rechallenge in ACHN cells. [Figure 19A] Includes figures showing the effects of Reg1 and / or TGFBRII disruption on CAR-T cell differentiation and expansion in vivo. Figure 19A: CAR-T cell differentiation. Figure 19B: CAR-T cell expansion. [Figure 19B] Includes figures showing the effects of Reg1 and / or TGFBRII disruption on CAR-T cell differentiation and expansion in vivo. Figure 19A: CAR-T cell differentiation. Figure 19B: CAR-T cell expansion. [Figure 20A] Includes figures showing the synergistic effect of dual knockout of TGFBRII and Regnase in a mouse model of Nalm6 leukemia (B-ALL). Figure 20A: Reduction in tumor size. Figure 20B: Survival rate. [Figure 20B]Includes figures showing the synergistic effect of dual knockout of TGFBRII and Regnase in a mouse model of Nalm6 leukemia (B-ALL). Figure 20A: Reduction in tumor size. Figure 20B: Survival rate. [Figure 21] This figure shows the survival advantage resulting from the dual disruption of TGFBRII and Regnase in a xenograft mouse model of NOG mantle cell lymphoma (MCL). [Figure 22A] Includes figures showing increased in vivo expansion of CAR-T cells with TGFBRII and / or Regnase knockout. Figure 22A shows CAR-T cell expansion in a Jeko-1 xenograph model. Figure 22B shows CAR-T cell expansion in a nalm-6 xenograph model. [Figure 22B] Includes figures showing increased in vivo expansion of CAR-T cells with TGFBRII and / or Regnase knockout. Figure 22A shows CAR-T cell expansion in a Jeko-1 xenograph model. Figure 22B shows CAR-T cell expansion in a nalm-6 xenograph model. [Figures 23A-23B] Figure 23A: Level of TCR- cells. Figure 23B: Level of β2M- cells. Figure 23C: Level of CAR+ cells. Figure 23D: CD4+ / CD8+ cell ratio. [Figure 23C] Figure 23A: Level of TCR- cells. Figure 23B: Level of β2M- cells. Figure 23C: Level of CAR+ cells. Figure 23D: CD4+ / CD8+ cell ratio. [Figure 23D]Figure 23A: Level of TCR- cells. Figure 23B: Level of β2M- cells. Figure 23C: Level of CAR+ cells. Figure 23D: CD4+ / CD8+ cell ratio. [Figures 24A-24B] Includes figures showing consistent editing rates in anti-BCMA CAR-T cells with Reg-1 and / or TGFBRII disruption. Figure 24A: TGFBRII disruption efficiency. Figure 24B: Reg-1 disruption efficiency. [Figures 25A-25B] Includes figures demonstrating the superior cytotoxicity of TRAC- / β2M- / Reg-1-TGFBRII-anti-BCMA CAR+ T cells. Figures 25A-25B: Cytotoxicity of MM1s (multiple myeloma cell line) cells (25A) compared to K562 cells (25B). Figures 25C-25D: Cytotoxicity of JeKo-1 cells (mantle cell lymphoma cell line) (25C) compared to K562 cells (25D). [Figures 25C-25D] Includes figures demonstrating the superior cytotoxicity of TRAC- / β2M- / Reg-1-TGFBRII-anti-BCMA CAR+ T cells. Figures 25A-25B: Cytotoxicity of MM1s (multiple myeloma cell line) cells (25A) compared to K562 cells (25B). Figures 25C-25D: Cytotoxicity of JeKo-1 cells (mantle cell lymphoma cell line) (25C) compared to K562 cells (25D). [Figure 26A] Figures include those showing that combined disruption of Regnase-1 and TGFBRII improved anti-BCMA CAR-T activity against multiple myeloma in mice in an animal model. Figure 26A: Reduction in tumor volume. Figure 26B: Survival rate. Figure 26C: Expansion of CAR-T cells in peripheral blood. [Figure 26B] Figures include those showing that combined disruption of Regnase-1 and TGFBRII improved anti-BCMA CAR-T activity against multiple myeloma in mice in an animal model. Figure 26A: Reduction in tumor volume. Figure 26B: Survival rate. Figure 26C: Expansion of CAR-T cells in peripheral blood. [Figure 26C]Figures include those showing that combined disruption of Regnase-1 and TGFBRII improved anti-BCMA CAR-T activity against multiple myeloma in mice in an animal model. Figure 26A: Reduction in tumor volume. Figure 26B: Survival rate. Figure 26C: Expansion of CAR-T cells in peripheral blood. [Figure 27A] Figures include showing that combined disruption of Regnase and TGFBRII improves anti-BCMA CAR-T activity against mouse mantle cell lymphoma in an animal model. Figure 27A: Decrease in tumor volume. Figure 27B: Survival rate. Figure 27C: Expansion of CAR-T cells in peripheral blood. Figure 27D: PD-1 and LAG-3 levels in CAR-T cells. Figure 27E: Levels of circulating T cells 3 weeks after CAR-T injection. Figure 27F: Levels of exhaustion markers (LAG-3 and PD-1) on circulating T cells 3 weeks after CAR-T injection. [Figure 27B] Figures include showing that combined disruption of Regnase and TGFBRII improves anti-BCMA CAR-T activity against mouse mantle cell lymphoma in an animal model. Figure 27A: Decrease in tumor volume. Figure 27B: Survival rate. Figure 27C: Expansion of CAR-T cells in peripheral blood. Figure 27D: PD-1 and LAG-3 levels in CAR-T cells. Figure 27E: Levels of circulating T cells 3 weeks after CAR-T injection. Figure 27F: Levels of exhaustion markers (LAG-3 and PD-1) on circulating T cells 3 weeks after CAR-T injection. [Figure 27C] Figures include showing that combined disruption of Regnase and TGFBRII improves anti-BCMA CAR-T activity against mouse mantle cell lymphoma in an animal model. Figure 27A: Decrease in tumor volume. Figure 27B: Survival rate. Figure 27C: Expansion of CAR-T cells in peripheral blood. Figure 27D: PD-1 and LAG-3 levels in CAR-T cells. Figure 27E: Levels of circulating T cells 3 weeks after CAR-T injection. Figure 27F: Levels of exhaustion markers (LAG-3 and PD-1) on circulating T cells 3 weeks after CAR-T injection. [Figure 27D]Figures include showing that combined disruption of Regnase and TGFBRII improves anti-BCMA CAR-T activity against mouse mantle cell lymphoma in an animal model. Figure 27A: Decrease in tumor volume. Figure 27B: Survival rate. Figure 27C: Expansion of CAR-T cells in peripheral blood. Figure 27D: PD-1 and LAG-3 levels in CAR-T cells. Figure 27E: Levels of circulating T cells 3 weeks after CAR-T injection. Figure 27F: Levels of exhaustion markers (LAG-3 and PD-1) on circulating T cells 3 weeks after CAR-T injection. [Figure 27E] Figures include showing that combined disruption of Regnase and TGFBRII improves anti-BCMA CAR-T activity against mouse mantle cell lymphoma in an animal model. Figure 27A: Decrease in tumor volume. Figure 27B: Survival rate. Figure 27C: Expansion of CAR-T cells in peripheral blood. Figure 27D: PD-1 and LAG-3 levels in CAR-T cells. Figure 27E: Levels of circulating T cells 3 weeks after CAR-T injection. Figure 27F: Levels of exhaustion markers (LAG-3 and PD-1) on circulating T cells 3 weeks after CAR-T injection. [Figure 27F] Figures include showing that combined disruption of Regnase and TGFBRII improves anti-BCMA CAR-T activity against mouse mantle cell lymphoma in an animal model. Figure 27A: Decrease in tumor volume. Figure 27B: Survival rate. Figure 27C: Expansion of CAR-T cells in peripheral blood. Figure 27D: PD-1 and LAG-3 levels in CAR-T cells. Figure 27E: Levels of circulating T cells 3 weeks after CAR-T injection. Figure 27F: Levels of exhaustion markers (LAG-3 and PD-1) on circulating T cells 3 weeks after CAR-T injection. [Figure 28] This figure shows that disruption of the TGFBRII and Reg-1 genes increases the proliferation of anti-PTK7 CAR-T cells. [Figure 29A]This includes figures showing the effects of TGFBRII disruption, optionally combined with Reg-1 disruption, in long-term in vitro rechallenge assays. Figure 29A: TGFBRII disruption alone improves the potency of anti-PTK7 CAR-T cells in long-term in vitro rechallenge assays. Figure 29B: TGFBRII disruption, as measured by human CD45+ cells, improves the persistence and expansion of anti-PTK7 CAR-T cells in long-term in vitro rechallenge assays. Figure 29C: TGFBRII disruption enhances cytotoxic CD8+ T cells expressing anti-PTK7 CAR. Figure 29D: CD4+ cells expressing anti-PTK7 CAR remain constant regardless of TGFBRII disruption. [Figure 29B] This includes figures showing the effects of TGFBRII disruption, optionally combined with Reg-1 disruption, in long-term in vitro rechallenge assays. Figure 29A: TGFBRII disruption alone improves the potency of anti-PTK7 CAR-T cells in long-term in vitro rechallenge assays. Figure 29B: TGFBRII disruption, as measured by human CD45+ cells, improves the persistence and expansion of anti-PTK7 CAR-T cells in long-term in vitro rechallenge assays. Figure 29C: TGFBRII disruption enhances cytotoxic CD8+ T cells expressing anti-PTK7 CAR. Figure 29D: CD4+ cells expressing anti-PTK7 CAR remain constant regardless of TGFBRII disruption. [Figures 29C-29D] This includes figures showing the effects of TGFBRII disruption, optionally combined with Reg-1 disruption, in long-term in vitro rechallenge assays. Figure 29A: TGFBRII disruption alone improves the potency of anti-PTK7 CAR-T cells in long-term in vitro rechallenge assays. Figure 29B: TGFBRII disruption, as measured by human CD45+ cells, improves the persistence and expansion of anti-PTK7 CAR-T cells in long-term in vitro rechallenge assays. Figure 29C: TGFBRII disruption enhances cytotoxic CD8+ T cells expressing anti-PTK7 CAR. Figure 29D: CD4+ cells expressing anti-PTK7 CAR remain constant regardless of TGFBRII disruption. [Figure 30A]This figure includes diagrams showing the antitumor activity of anti-PTK7 CAR-T cells with or without TGFBRII disruption. Figure 30A: Effect of treatment on tumor volume. Figure 30B: Effect of treatment on body weight. ● Group 1: No treatment. ○ Group 2: Anti-PTK7 CAR-T cells, 5 × 10⁶ cells / mouse (iv), day 1. □ Group 3: Anti-PTK7 CAR / TGFBRII KO T cells, 5 × 10⁶ cells / mouse (iv), day 1. UTA solid feed was administered to the treatment groups 9 days before CAR-T cell treatment. [Figure 30B] This figure includes diagrams showing the antitumor activity of anti-PTK7 CAR-T cells with or without TGFBRII disruption. Figure 30A: Effect of treatment on tumor volume. Figure 30B: Effect of treatment on body weight. ● Group 1: No treatment. ○ Group 2: Anti-PTK7 CAR-T cells, 5 × 10⁶ cells / mouse (iv), day 1. □ Group 3: Anti-PTK7 CAR / TGFBRII KO T cells, 5 × 10⁶ cells / mouse (iv), day 1. UTA solid feed was administered to the treatment groups 9 days before CAR-T cell treatment. [Figure 31A-31B] Includes figures showing T cell fractions in xenograft animal models of pancreatic cell carcinoma (Hs766T) tumor treated with anti-PTK7 CAR-T cells with or without TGFBRII disruption. Figure 31A: Number of human CD45+ cells in 1 μL of mouse blood 47 days post-administration. Figure 31B: Differentiation of CAR-T cells 47 days post-administration. [Modes for carrying out the invention]

[0039] This disclosure aims to establish genetically engineered T cells with improved proliferative activity, persistence, reduced T cell exhaustion, and enhanced efficacy, addressing a long-standing need in CAR-T therapy. Such T cells can be derived from genuine T cells, e.g., untransformed T cells, terminally differentiated T cells, T cells with a stable genome, and / or T cells dependent on cytokines and growth factors for reproduction and expansion. Alternatively, such T cells can be derived from T cells generated from progenitor cells such as hematopoietic stem cells (e.g., iPSCs) in in vitro culture medium. The T cells disclosed herein may confer one or more benefits in both the production and clinical application of CAR-T cells.

[0040] Conventional allogeneic CAR-T cells are generated, and in most cases, single-donor leukopak cells are edited so that the cells can evade components of the patient's immune system and thus do not cause GvHD. The process of expanding these CAR-T cells can result in formulations in tens to hundreds of vials. Patients may be administered single or multiple doses. During the manufacturing process, these CAR-T cells lose their potential due to various mechanisms such as apoptosis, exhaustion, replication senescence, and other processes that reduce cellular compatibility.

[0041] Genetically modified T cells having a disrupted TGFBRII gene, a disrupted Reg1 gene, or a combination thereof, and one or more optional additional gene edits, such as a disrupted TRAC gene, a disrupted β2M gene, a disrupted CD70 gene, and / or an inserted nucleic acid encoding a chimeric antigen receptor (CAR), or a combination thereof.

[0042] Unexpectedly, this disclosure reports that knocking out Reg1 in T cells has resulted in a variety of advantageous features in T cell-mediated therapies, such as CAR-T therapy. Examples include, but are not limited to: improved cell culture proliferation and in vitro expansion, including faster expansion, longer viability, faster reproduction, and / or improved apoptosis resistance, which are advantageous for the production and manufacture of therapeutic T cell lineage products such as CAR-T cells; advantages in T cell efficacy related to the maintenance of in vitro and in vivo potency and activity (target cell killing) of therapeutic T cells (e.g., CAR-T cells) for more effective and sustained T cell lineage therapeutic products; production and / or retention of more central memory cells; reduced expression of T cell exhaustion markers (PD-1, Tim-3, etc.); and improved efficacy of T cell therapeutics in vivo, associated with reduced tumor burden and increased survival rates of subjects treated with CAR-T.

[0043] Furthermore, unexpectedly, T cells possessing the disrupted TGFBRII gene exhibited advantageous characteristics including improved cell proliferation and expansion, enhanced cytotoxic activity, and resistance to inhibitory effects mediated by TGFβ and / or fibroblasts. Given these advantageous characteristics, genetically engineered T cells (e.g., CAR-T cells) disclosed herein, possessing the disrupted TGFBRII gene and other gene edits optionally disclosed herein, are expected to exhibit superior therapeutic effects, such as excellent antitumor effects in TME of solid tumors.

[0044] Furthermore, CAR-T cells possessing both disrupted Reg1 and disrupted TGFBRII genes showed significantly higher antitumor activity and CAR-T cell expansion in animal models compared to CAR-T cells possessing only one disrupted Reg1 gene or only one disrupted TGFBRII gene.

[0045] Other non-limiting advantageous features of T cells provided herein include: (a) Improved quality and consistency of CAR-T cell therapy drugs. (b) The superior efficacy and longer lifespan of CAR-T cells produced from T cells in human patients. (c) Reduced required dosage. The T cells disclosed herein have improved reproductive and expansion capabilities and may therefore have a longer lifespan in vivo. As a result, substantially similar therapeutic effects to high-dose conventional CAR-T cell therapy can be achieved using lower doses compared to standard CAR-T therapy. (d) Increased efficacy resulting from the improved proliferation and expansion, enhanced cytotoxicity, and long-term in vivo persistence of the CAR-T cells disclosed herein. Furthermore, the T cells provide the benefit of titrable administration in patients to optimize the safety and efficacy described above. (e) Reduction of T-cell exhaustion and / or replication senescence both in vitro and in vivo, and extension of therapeutic effects due to longer-lasting effects. (f) Enhanced antitumor activity, e.g., reduction in tumor size and / or longer survival rate.

[0046] Accordingly, this specification provides T cells with improved persistence in culture medium, methods for producing such T cells, and methods for using such T cells to produce therapeutic T cells such as CAR-T cells. Components and processes for producing T cells disclosed herein (e.g., CRISPR approaches for gene editing and the components used therein) are also within the scope of this disclosure.

[0047] I. Genetically modified T cells with enhanced characteristics The T cells disclosed herein include genetically modified T cells with enhanced persistence in culture medium. Such genetically modified T cells may have gene editing of the Reg1 gene or the TGFBRII gene. In some cases, such genetically modified T cells may have gene editing of both the Reg1 gene and the TGFBRII gene.

[0048] In some embodiments, genetically engineered T cells may have gene editing in one or more additional genes involved in T cell exhaustion, such as CD70. As demonstrated by the studies disclosed herein, such genetically engineered T cells exhibit one or more superior characteristics compared to T cell counterparts having the wild-type Regnase 1 gene: improved expansion ability in culture (e.g., expandable for at least 4 weeks, e.g., at least 6 weeks, and / or expandable at least 10-fold, e.g., at least 15-fold, compared to unedited counterparts), improved lifespan, improved reproductive capacity, better T cell activation, improved potency, improved expression of central memory T cell markers, and reduced expression of T cell exhaustion markers.

[0049] Genetically modified T cells can be derived from a suitable source, such as parental T cells (e.g., unedited wild-type T cells) obtained from one or more mammalian donors. In some cases, the parental T cells are primary T cells (e.g., transformed and undifferentiated T cells) obtained from one or more human donors. Alternatively, parental T cells can be differentiated from precursor T cells obtained from one or more suitable donors or stem cells such as hematopoietic stem cells or induced pluripotent stem cells (iPSCs), which can be cultured in vitro.

[0050] In some embodiments, genetically engineered T cells carry a disrupted Reg1 gene and, optionally, one or more disrupted genes involved in cell exhaustion (e.g., CD70). Such genetically engineered T cells may further contain one or more disrupted genes, such as TRAC or β2M. Such genetically engineered T cells may further express a chimeric antigen receptor (CAR), which may be capable of binding to an antigen of interest, such as a tumor-associated antigen (e.g., CD19, BCMA, CD70, CD33, or PTK7).

[0051] In some embodiments, genetically engineered T cells carry a disrupted TGFBRII gene and, optionally, one or more disrupted genes involved in cell exhaustion (e.g., CD70). Such genetically engineered T cells may further include one or more disrupted genes, such as TRAC or β2M. Such genetically engineered T cells may further express a chimeric antigen receptor (CAR), which may be capable of binding to an antigen of interest, such as a tumor-associated antigen (e.g., CD19, BCMA, CD70, CD33, or PTK7). In some examples, genetically engineered T cells may express an anti-PTK7 CAR, such as those disclosed herein. In some cases, such genetically engineered T cells may possess the wild-type endogenous Reg-1 gene.

[0052] In some embodiments, genetically engineered T cells carry a disrupted Reg1 gene, a disrupted TGFBRII gene, and optionally, one or more disrupted genes involved in cell exhaustion (e.g., CD70). Such genetically engineered T cells may further contain one or more disrupted genes, such as TRAC or β2M. Such genetically engineered T cells may further express a chimeric antigen receptor (CAR), which may be capable of binding to an antigen of interest, such as a tumor-associated antigen (e.g., CD19, BCMA, CD70, CD33, or PTK7).

[0053] Any genetically modified T cell can be generated through gene editing (including genome editing), a type of genetic manipulation in which nucleotides / nucleic acids are inserted, deleted, and / or substituted into DNA sequences, such as in the genome of a targeted cell. Targeted gene editing allows for insertion, deletion, and / or substitution at pre-selected sites in the genome of a targeted cell (e.g., in a targeted gene or a targeted DNA sequence). When the sequence of an endogenous gene is edited, for example, by deletion, insertion, or substitution of a nucleotide / nucleic acid, the endogenous gene containing the affected sequence can be knocked out due to the sequence mutation. Thus, targeted editing can be used to disrupt endogenous gene expression. "Targeted integration" refers to a process involving the insertion of one or more exogenous sequences, with or without deletion of the endogenous sequence at the insertion site. Targeted integration can result from targeted gene editing if a donor template containing the exogenous sequence is available.

[0054] (a) gene-edited genes In some embodiments, the disclosure provides genetically engineered T cells that may include a disrupted Reg1 gene, a disrupted TGFBRII gene, or a combination thereof. In some embodiments, the genetically engineered T cells provided herein include both a disrupted Reg1 gene and a disrupted TGFBRII gene. In some cases, the genetically engineered T cells disclosed herein may further include a disrupted CD70 gene, a disrupted β2M gene, a disrupted TRAC gene, or a combination thereof.

[0055] As used herein, “disrupted gene” refers to a gene containing an insertion, deletion, or substitution such that the expression of a functional protein from an endogenous gene is reduced or inhibited compared to the endogenous gene. As used herein, “disrupting a gene” refers to a method of inserting, deleting, or substituting at least one nucleotide / nucleic acid in an endogenous gene such that the expression of a functional protein from the endogenous gene is reduced or inhibited. Methods of disrupting genes are known to those skilled in the art and are described herein.

[0056] In some embodiments, cells containing a disrupted gene do not express the protein encoded by this gene at a detectable level (e.g., by an immunoassay using an antibody that binds to the encoded protein or by flow cytometry) (e.g., on the cell surface). Cells that do not express a detectable level of protein may be referred to as knockout cells.

[0057] Reg1 gene editing In some embodiments, genetically engineered T cells may contain disrupted genes involved in mRNA decay. These genes may be Reg1. Reg1 contains a zinc finger motif, binds to RNA, and exhibits ribonuclease activity. Reg1 plays a role in both immune and non-immune cells, and its expression can be rapidly induced under a variety of conditions, including microbial infection, treatment with inflammatory cytokines, and chemical or mechanical stimuli. The human Reg1 gene is located on chromosome 1p34.3. Further information can be found in the GenBank gene ID: 80149.

[0058] In some cases, genetically engineered T cells may contain a disrupted Reg1 gene such that Reg1 expression in the T cells is substantially reduced or completely eliminated. The disrupted Reg1 gene may contain one or more gene edits that disrupt Reg1 gene expression at one or more suitable target sites (e.g., in coding regions or non-coding regions such as promoter regions). These target sites may be identified based on the gene editing approach used to create genetically engineered T cells. Exemplary target sites for gene editing may include exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, or combinations thereof. In some cases, one or more gene edits may occur at exon 2 or exon 4. Such gene editing may be induced by CRISPR / Cas technology using suitable guide RNAs, e.g., those listed in Table 22. Edited Reg1 genes obtained using the gRNAs listed in Table 22 may contain one or more edited sequences provided in Tables 29-38 below.

[0059] TGFBRII gene editing In some embodiments, genetically engineered T cells may contain a disrupted TGFBRII gene encoding transforming growth factor receptor type II (TGFBRII). The TGFBRII receptor is a family of serine / threonine kinase receptors involved in the TGFβ signaling pathway. These receptors bind to TGFβ family growth factor and cytokine signaling proteins, such as TGFβ (TGFβ1, TGFβ2, and TGFβ3), bone morphogenetic protein (BMP), growth and differentiation factor (GDF), activin and inhibin, myostatin, anti-Müllerian hormone (AMH), and NODAL.

[0060] In some cases, genetically engineered T cells may contain a disrupted TGFBRII gene such that TGFBRII expression in the T cells is substantially reduced or completely absent. The disrupted TGFBRII gene may contain one or more gene edits that disrupt TGFBRII gene expression at one or more suitable target sites (e.g., in coding regions or non-coding regions such as promoter regions). These target sites may be identified based on the gene editing approach used to create genetically engineered T cells. Exemplary target sites for gene editing may include exon 1, exon 2, exon 3, exon 4, exon 5, or combinations thereof. In some cases, one or more gene edits may occur in exon 4 and / or exon 5. Such gene editing may be induced by gene editing techniques (e.g., CRISPR / Cas techniques) using suitable guide RNAs, e.g., those listed in Table 39. Edited TGFBRII genes obtained using the gRNAs listed in Table 39 may contain one or more edited sequences provided in Tables 40-48 below.

[0061] CD70 gene editing T cell exhaustion is a process of gradual and progressive loss of T cell function, which can be induced by prolonged antigen stimulation or other factors. Genes involved in T cell exhaustion refer to those that positively or negatively regulate this biological process. Genetically engineered T cells disclosed herein may include gene editing of genes that positively regulate T cell exhaustion and disrupt its expression. Alternatively, genetically engineered T cells may include gene editing of genes that negatively regulate T cell exhaustion and enhance its expression and / or the biological activity of its gene product.

[0062] In some embodiments, genetically engineered T cells may contain edited genes involved in T cell exhaustion, such as the disruption of genes that positively regulate T cell exhaustion. Such genes may be differentiation antigen group 70 (CD70) genes. CD70 is a member of the tumor necrosis factor superfamily, and its expression is limited to activated T and B lymphocytes as well as mature dendritic cells. CD70 is involved in the survival of tumor cells and regulatory T cells through its interaction with its ligand, CD27. CD70 and its receptor, CD27, interact with T cells (activated and T). reg It plays multiple roles in immune function in multiple cell types, including B cells.

[0063] Disruption of the CD70 gene in immune cells engineered to express the antigen-targeting portion enhanced the antitumor effect against large tumors and induced a durable anti-cancer memory response. In particular, the anti-cancer memory response prevented tumor growth upon re-challenge. Furthermore, disruption of the CD70 gene resulted in enhanced cytotoxicity of immune cells engineered to express the antigen-targeting portion at a relatively low ratio of engineered immune cells to target cells, demonstrating the potential efficacy of low-dose engineered immune cells. For example, see International Publication No. 2019 / 215500, whose relevant disclosures relating to the objectives and subject matter referred to herein are incorporated herein by reference.

[0064] The structure of the CD70 gene is known in this art. For example, the human CD70 gene is located on chromosome 19p13.3. This gene contains four proteins that encode exons. Further information can be found in the GenBank gene ID:970.

[0065] In some examples, genetically engineered T cells may include a disrupted CD70 gene such that the expression of CD70 in the T cells is substantially reduced or completely eliminated. The disrupted CD70 gene may involve one or more gene edits that disrupt the expression of the CD70 gene at one or more suitable target sites (e.g., in coding regions or non-coding regulatory regions such as promoter regions). Such target sites may be identified based on the gene editing approach used to produce genetically engineered T cells. Exemplary target sites for gene editing may include exon 1, exon 2, exon 3, exon 4, or combinations thereof. See also International Publication No. 2019 / 215500, whose relevant disclosures relating to the purposes and subject matter referred to herein are incorporated herein by reference.

[0066] In some embodiments, gRNAs targeting CD70 (CD70-7), listed in Table 23, can be used to disrupt the CD70 gene via CRISPR / Cas9 gene editing. In some examples, the edited CD70 gene may contain a nucleotide sequence selected from the sequences in Table 26 below.

[0067] β2M gene editing In some embodiments, the genetically engineered T cells disclosed herein may further include a disrupted β2M gene. β2M is a common (invariant) component of the MHC I complex. When its expression is disrupted by gene editing, the host-versus-therapeutic allogeneic T cell response is prevented, resulting in increased persistence of allogeneic T cells. In some embodiments, the expression of the endogenous β2M gene is eliminated to prevent the host-versus-graft response.

[0068] In some embodiments, the edited β2M gene may include a nucleotide sequence selected from the sequences in Table 25 below. It is known to those skilled in the art that different nucleotide sequences in edited genes, such as the edited β2M gene (e.g., those in Table 25), can be generated from a single gRNA (β2M-1), such as one of those listed in Table 23. See also International Publication No. 2019097305, which incorporates by reference its relevant disclosures for the subject matter and objectives referred to herein.

[0069] The genetically modified T cells disclosed herein may further include one or more additional gene edits (e.g., gene knock-in or knock-out) to improve T cell function. Examples include knock-in or knock-out genes to improve target cell lysis, and knock-in or knock-out genes to improve the performance of therapeutic T cells, such as CAR-T cells prepared from genetically modified T cells.

[0070] TRAC gene editing In some embodiments, the genetically engineered T cells disclosed herein may further include disrupted TRAC genes. This disruption results in loss of TCR function, making these engineered T cells non-allogeneic and suitable for allogeneic transplantation, thereby minimizing the risk of graft-versus-host disease. In some embodiments, expression of endogenous TRAC genes is eliminated to prevent graft-versus-host reaction. For further information regarding the objectives and subject matter referred to herein, please also refer to International Publication No. 2019097305, whose relevant disclosures are incorporated herein by reference.

[0071] In some embodiments, the edited TRAC gene may contain a nucleotide sequence selected from the sequences in Table 24 below. It is known to those skilled in the art that different nucleotide sequences in an edited gene, such as the edited TRAC gene (e.g., those in Table 24), can be generated from a single gRNA (TA-1), such as one of those listed in Table 23.

[0072] It should be understood that two or more suitable target sites / gRNAs may be used for each target gene disclosed herein, for example, those known in the art or disclosed herein. Further examples can be found, for example, in International Publication No. 2019097305, whose relevant disclosures with respect to the purposes and subjects referred to herein are incorporated herein by reference.

[0073] (b) Exemplary improved features of genetically engineered T cells disclosed herein Any genetically engineered T cells having a disrupted Reg1 gene and, optionally, one or more additional gene edits, such as a disrupted CD70 gene, a disrupted TRAC gene, a disrupted β2M gene, an insertion of a CAR-encoding nucleic acid, or a combination thereof, may be expandable in culture for more than 4 weeks, e.g., more than 5 weeks, more than 6 weeks, more than 8 weeks, and more than 10 weeks. In some examples, genetically engineered T cells containing a disrupted Reg1 (optionally, disruption in CD70) are expandable in culture after 6 weeks (e.g., 7 weeks, 8 weeks, 9 weeks, or 10 weeks). Such genetically engineered T cells may maintain their ability to be activated after 6 weeks in culture (e.g., 7 weeks, 8 weeks, 9 weeks, or 10 weeks). Furthermore, such genetically engineered T cells may have increased expansion capacity that is at least 10 times (e.g., at least 15 times) higher than their unengineered counterparts, i.e., T cells having the same genetic background as the engineered T cells disclosed herein except for having a wild-type Reg1 gene.

[0074] Furthermore, the genetically modified T cells disclosed herein may exhibit enhanced T cell persistence. As used herein, “T cell persistence” refers to the tendency of T cells to continue to proliferate, reproduce, regenerate, expand, and maintain healthy activity in a culture medium. In some cases, T cell persistence can be expressed by the lifespan over which T cells can proliferate and expand in vitro, which is measurable by conventional methods and / or assays described herein. In other cases, T cell persistence may be expressed by a reduction in cell death (e.g., apoptosis) or a reduction in cellular states characterized by exhaustion or replication senescence. In yet another case, T cell persistence may be expressed by the maintenance of T cell activity in a culture medium.

[0075] Alternatively, the genetically modified T cells disclosed may proliferate faster and for longer periods than unmodified T cells, as observed, for example, in in vitro cell culture. In some cases, genetically modified T cells may proliferate at least 50% (e.g., at least 1x, at least 2x, at least 5x, or more) than unmodified T cells in conventional in vitro T cell culture (e.g., as described in the examples below). In other cases, genetically modified T cells may maintain a high proliferation rate in vitro for at least 20 days (e.g., at least 25 days, at least 30 days, at least 35 days, at least 40 days, at least 45 days, at least 50 days, or more) (e.g., the proliferation rate is substantially the same or slightly reduced).

[0076] Furthermore, genetically modified T cells may exhibit reduced levels of cellular exhaustion compared to their unmodified T cell counterparts. In some cases, this reduction in cellular exhaustion is reflected in an increased level of central memory T cells in the overall T cell population. The disclosed genetically modified T cell population may contain more central memory T cells compared to its unmodified T cell counterparts. For example, in some cases, the genetically modified T cell population may contain more central memory T cells, which is characterized by increased expression of CD27 and / or CD45RO compared to its unmodified T cell counterparts. In some cases, the disclosed genetically modified T cell population may exhibit reduced T cell exhaustion, which is characterized, for example, by reduced expression of PD-1 and / or TIM3 compared to its unmodified T cell counterparts.

[0077] Any genetically engineered T cells having a disrupted TGFBRII gene, and one or more additional gene edits, such as a disrupted CD70 gene, a disrupted TRAC gene, a disrupted β2M gene, an insertion of a CAR-coding nucleic acid, or a combination thereof, may exhibit improved proliferation and growth activity both in vitro and in vivo compared to their unengineered counterparts (meaning T cells with the same genetic background except that the TGFBRII gene is not disrupted). Furthermore, such genetically engineered T cells (e.g., CAR-T cells) may show improved cytotoxic activity against undesirable cells (e.g., tumor cells) expressing antigens targeted by the CAR expressed in the CAR-T cells, compared to their unengineered counterparts. Such genetically engineered T cells (e.g., CAR-T cells) may also be resistant to inhibitory effects mediated by TGFβ signaling and / or fibroblasts (e.g., in TMEs). For example, genetically engineered T cells with a disrupted TGFBRII gene may be resistant to inhibitors secreted by fibroblasts.

[0078] In some embodiments, genetically engineered T cells may further contain one or more disrupted genes (e.g., CD70, Reg1, or a combination thereof) to improve T cell persistence. As used herein, “T cell persistence” refers to the tendency of T cells to continue to proliferate, reproduce, regenerate, expand, and maintain healthy activity in a culture medium. In some cases, T cell persistence can be expressed by the lifespan over which T cells can proliferate and expand in vitro, which is measurable by conventional methods and / or assays described herein. In other cases, T cell persistence may be expressed by a reduction in cell death (e.g., apoptosis) or a reduction in cellular states characterized by exhaustion or replication senescence. Yet another case may be expressed by the maintenance of T cell activity in a culture medium.

[0079] For example, such genetically modified T cells may be able to expand in culture for more than 4 weeks, e.g., more than 5 weeks, more than 6 weeks, more than 8 weeks, and more than 10 weeks. In some cases, genetically modified T cells containing a disrupted TGFBRII gene and a disrupted CD70 gene, Reg1 gene, or both may be able to expand in culture after 6 weeks (e.g., 7 weeks, 8 weeks, 9 weeks, or 10 weeks). Such genetically modified T cells may maintain their ability to be activated in culture after 6 weeks (e.g., 7 weeks, 8 weeks, 9 weeks, or 10 weeks). Such genetically modified T cells may exhibit improved proliferation and expansion capabilities compared to T cells with the same genetic background except for the undisrupted TGFBRII gene and the undisrupted CD70 gene and / or Reg1 gene.

[0080] Furthermore, any genetically modified T cells having disrupted TGFBRII and Reg1 genes, as well as one or more optional additional gene edits, such as disrupted CD70, TRAC, β2M, insertion of CAR-coding nucleic acids, or a combination thereof, may offer advantages in expansion (e.g., in vivo) over their counterpart T cells (i.e., having disrupted TGFBRII or Reg1 genes (but not both), and other additional gene edits). CAR-T cells with disruption of both TGFBRII and Reg1 genes have been shown to be more potent than their counterpart T cells in cancer treatment when observed in xenograft mouse models. Therefore, CAR-T cells with disruption of both TGFBRII and Reg1 genes are expected to demonstrate superior cancer therapeutic efficacy.

[0081] (c) Method for producing genetically modified T cells The genetically modified T cells disclosed herein may be prepared by gene editing parental T cells or their progenitor cells via conventional gene editing methods or the methods described herein.

[0082] (a) T cells In some embodiments, T cells may be derived from one or more suitable mammals, for example, one or more human donors. T cells can be obtained from many sources, including, but not limited to, peripheral blood mononuclear cells, bone marrow, lymph node tissue, umbilical cord blood, thymic tissue, tissue from infection sites, ascites, pleural fluid, splenic tissue, and tumors. In certain embodiments, T cells may be obtained from units of blood recovered from a subject using any number of techniques known to those skilled in the art, such as centrifugation, e.g., FICOLL® separation.

[0083] In some cases, T cells can be isolated from a mixture of immune cells (e.g., those described herein) to generate isolated T cell populations. For example, after isolation of peripheral blood mononuclear cells (PBMCs), both cytotoxic and helper T lymphocytes can be fractionated into naive, memory, and effector T cell subpopulations, either before or after activation, expansion, and / or genetic modification.

[0084] Specific subpopulations of T cells expressing one or more of the following cell surface markers: TCRab, CD3, CD4, CD8, CD27, CD28, CD38, CD45RA, CD45RO, CD62L, CD127, CD122, CD95, CD197, CCR7, KLRG1, MCH-I protein, and / or MCH-II protein may be further isolated by positive or negative selection techniques. In some embodiments, specific subpopulations of T cells expressing one or more markers selected from the group consisting of TCRab, CD4, and / or CD8 are further isolated by positive or negative selection techniques. In some embodiments, subpopulations of T cells may be isolated by positive or negative selection before and / or after genetic engineering.

[0085] An isolated population of T cells may express one or more T cell markers, including but not limited to CD3+, CD4+, CD8+, or combinations thereof. In some embodiments, T cells are isolated from a donor or subject, initially activated before gene editing, and stimulated to reproduce in vitro.

[0086] In some cases, a T cell population may include primary T cells isolated from one or more human donors. These T cells are terminally differentiated, untransformed, dependent on cytokines and / or growth factors for growth, and / or have a stable genome.

[0087] Alternatively, T cells can be induced from stem cells (e.g., HSCs or iPSCs) via in vitro differentiation.

[0088] T cells derived from a suitable source may be subjected to one or more stimulation, activation, and / or expansion. T cells can generally be activated and expanded using the methods described in, for example, U.S. Patent Nos. 6,352,694; 6,534,055; 6,905,680; 6,692,964; 5,858,358; 6,887,466; 6,905,681; 7,144,575; 7,067,318; 7,172,869; 7,232,566; 7,175,843; 5,883,223; 6,905,874; 6,797,514; and 6,867,041. In some embodiments, T cells may be activated and expanded over a period of about 1 to 4 days, about 1 to 3 days, about 1 to 2 days, about 2 to 3 days, about 2 to 4 days, about 3 to 4 days, or about 1, 2, 3, or 4 days prior to the introduction of the genome editing composition into the T cells.

[0089] In some embodiments, T cells are activated and expanded for approximately 4, 6, 12, 18, 24, 36, 48, 60, or 72 hours prior to the introduction of the gene editing composition into the T cells. In some embodiments, T cells are activated simultaneously with the introduction of the genome editing composition into the T cells. In some cases, the T cell population may be expanded and / or activated after the gene editing disclosed herein. T cell populations or isolated T cells produced by any of the gene editing methods described herein are also within the scope of this disclosure.

[0090] (b) Gene editing methods Any genetically modified T cell can be prepared using conventional gene editing methods or those described herein for editing one or more of the target genes disclosed herein (targeted editing). Targeted editing can be achieved via either a nuclease-independent or nuclease-dependent approach. In a nuclease-independent targeted editing approach, homologous recombination is induced by a homologous sequence adjacent to an exogenous polynucleotide introduced into an endogenous sequence via an enzymatic mechanism of the host cell. This exogenous polynucleotide may introduce nucleotide deletions, insertions, or substitutions in the endogenous sequence.

[0091] Alternatively, nuclease-dependent approaches can achieve targeted editing with relatively high frequency through the specific introduction of double-strand breaks (DSBs) by specific rare-cutting nucleases (e.g., endonucleases). Such nuclease-dependent targeted editing also utilize DNA repair mechanisms, such as non-homologous end junctions (NHEJs) that occur in response to DSBs. NHEJ-mediated DNA repair often results in random insertions or deletions (indels) of a small number of endogenous nucleotides. In contrast to NHEJ-mediated repair, repair can also occur via homologous recombination repair (HDR). If a donor template exists containing exogenous genetic material adjacent to pairs of homologous arms, this exogenous genetic material can be introduced into the genome via HDR, resulting in targeted integration of this exogenous genetic material.

[0092] In some embodiments, gene disruption can be caused by deletion of a genomic sequence using two guide RNAs. Methods using CRISPR-Cas gene editing techniques to induce genomic deletion in cells (e.g., knock out a gene in a cell) are known (Bauer DE et al. Vis.Exp. 2015;95:e52118).

[0093] Available endonucleases capable of introducing specific and targeted DSBs include, but are not limited to, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and RNA-inducible CRISPR-Cas9 nucleases (CRISPR / Cas9; associated with clustered, regularly arranged short palindromic sequence repeats). In addition, DICE (Dual Integrase Cassette Exchange) systems utilizing phiC31 and Bxb1 integrases may also be used for targeted integration. Several exemplary approaches are disclosed in detail below.

[0094] CRISPR-Cas9 gene editing system The CRISPR-Cas9 system is a naturally occurring defense mechanism in prokaryotes that has been repurposed as an RNA-guided DNA targeting platform used for gene editing. The CRISPR-Cas9 system relies on the DNA nuclease Cas9 and two non-coding RNAs, crsprRNA (crRNA) and transactivating RNA (tracrRNA), and aims to cleave DNA. CRISPR is an abbreviation for clustered, regularly arranged short palindromic sequence repeats, a family of DNA sequences found in bacterial and archaeal genomes that contain DNA fragments (spacer DNA) similar to foreign DNA previously exposed to cells by, for example, viruses that infect or attack prokaryotes. For instance, if a similar virus is reintroduced during a subsequent attack, these DNA fragments are used by the prokaryote to detect and destroy the similar foreign DNA. Transcription of the CRISPR locus leads to the formation of an RNA molecule containing a spacer sequence. This RNA molecule then binds to and becomes a target for Cas (CRISPR-related) proteins, which can recognize and cleave foreign exogenous DNA. Numerous types and classes of CRISPR / Cas systems have been described (see, for example, Koonin et al., (2017) Curr Opin Microbiol 37:67-78).

[0095] crRNA typically facilitates the sequence recognition and specificity of the CRISPR-Cas9 complex by forming Watson-Crick base pairs with a 20-nucleotide (nt) sequence in the target DNA. By modifying the 5' 20nt sequence within the crRNA, it becomes possible to target the CRISPR-Cas9 complex to a specific gene locus. The CRISPR-Cas9 complex will only bind to DNA sequences containing a sequence that matches the first 20nt of the crRNA if the target sequence follows a specific short DNA motif (containing the sequence NGG) called a protospacer adjacency motif (PAM).

[0096] TracrRNA hybridizes with the 3' end of crRNA to form an RNA double-strand structure, to which Cas9 endonuclease binds to form a catalytically active CRISPR-Cas9 complex, which can then cleave target DNA.

[0097] When the CRISPR-Cas9 complex binds to DNA at the target site, two independent nuclease domains within the Cas9 enzyme each cleave one strand of the DNA upstream of the PAM site, leaving behind a double-strand break (DSB) where both strands of DNA are terminated by a base pair (blunt end).

[0098] After the CRISPR-Cas9 complex binds to DNA at a specific target site and forms a site-specific double-segment break (DSB), the next crucial step is DSB repair. Cells use two major DNA repair pathways to repair DSBs: non-homologous end joining (NHEJ) and homologous recombination repair (HDR).

[0099] NHEJ is a robust repair mechanism that appears to be highly active in most cell types, including non-dividing cells. NHEJ is error-prone, often resulting in the removal or addition of 1 to several hundred nucleotides at the DSB site, although such modifications are typically <20 nt. The resulting insertions and deletions (indels) can disrupt the coding or non-coding regions of a gene. In contrast, HDR repairs DSBs with high fidelity using a long, continuous sequence of homologous donor DNA, either endogenously or exogenously provided. HDR is active only in dividing cells and occurs relatively infrequently in most cell types. In many embodiments of this disclosure, NHEJ is utilized as the repair operand.

[0100] Endonucleases for use in CRISPR In some embodiments, Cas9 (CRISPR-related protein 9) endonuclease is used in CRISPR methods for producing genetically engineered T cells as disclosed herein. The Cas9 enzyme may be derived from Streptococcus pyogenes, but other Cas9 homologs may also be used. It will be understood that wild-type Cas9 may be used, as provided herein, or modified versions of Cas9 (e.g., evolved versions of Cas9, or Cas9 orthologues or mutants) may be used. In some embodiments, Cas9 may be substituted with another RNA-induced endonuclease, such as Cpf1 (of a class II CRISPR / Cas system).

[0101] In some embodiments, the CRISPR / Cas system includes components derived from type I, type II, or type III systems. The latest classification scheme for CRISPR / Cas loci defines class I and class II CRISPR / Cas systems having types I-V or VI (Makarova et al., (2015) Nat Rev Microbiol, 13(11):722-36; Shmakov et al., (2015) Mol Cell, 60:385-397). Class II CRISPR / Cas systems have a single protein effector. Type II, V, and VI Cas proteins are single-protein RNA-induced endonucleases referred herein as "class II Cas nucleases." Examples of class II Cas nucleases include the Cas9, Cpf1, C2c1, C2c2, and C2c3 proteins. The Cpf1 nuclease (Zetsche et al., (2015) Cell 163:1-13) is homologous to Cas9 and contains a RuvC-like nuclease domain.

[0102] In some embodiments, the Cas nuclease is derived from a type II CRISPR / Cas system (e.g., the Cas9 protein derived from the CRISPR / Cas9 system). In some embodiments, the Cas nuclease is derived from a class II CRISPR / Cas system (a single-protein Cas nuclease such as the Cas9 protein or the Cpf1 protein). The Cas9 and Cpf1 families of proteins are enzymes having DNA endonuclease activity, which can be induced to cleave a desired nucleic acid target by designing an appropriate guide RNA, as further described herein.

[0103] In some embodiments, the Cas nuclease may contain two or more nuclease domains. For example, the Cas9 nuclease may contain at least one RuvC-like nuclease domain (e.g., Cpf1) and at least one HNH-like nuclease domain (e.g., Cas9). In some embodiments, the Cas9 nuclease introduces a double-sided block (DSB) at the target sequence. In some embodiments, the Cas9 nuclease is modified to contain only one functional nuclease domain. For example, the Cas9 nuclease is modified so that one of its nuclease domains is mutated or completely or partially deleted to reduce its nucleic acid cleavage activity. In some embodiments, the Cas9 nuclease is modified so that it does not contain a functional RuvC-like nuclease domain. In other embodiments, the Cas9 nuclease is modified so that it does not contain a functional HNH-like nuclease domain. In some embodiments, where only one of the nuclease domains is functional, the Cas9 nuclease is a nickase capable of introducing single-strand breaks ("nicks") into a target sequence. In some embodiments, conserved amino acids within the Cas9 nuclease domain are substituted to reduce or modify nuclease activity. In some embodiments, the Cas nuclease nickase includes amino acid substitutions in the RuvC-like nuclease domain. Exemplary amino acid substitutions in the RuvC-like nuclease domain include D10A (based on S. pyogenes Cas9 nuclease). In some embodiments, the nickase includes amino acid substitutions in the HNH-like nuclease domain. Exemplary amino acid substitutions in the HNH-like nuclease domain include E762A, H840A, N863A, H983A, and D986A (based on S. pyogenes Cas9 nuclease).

[0104] Amino acid sequence of Cas9 nuclease (SEQ ID NO: 1):

[0105] [ka]

[0106] In some embodiments, the Cas nuclease is derived from a type I CRISPR / Cas system. In some embodiments, the Cas nuclease is a component of a cascade complex of a type I CRISPR / Cas system. For example, the Cas nuclease is a Cas3 nuclease. In some embodiments, the Cas nuclease is derived from a type III CRISPR / Cas system. In some embodiments, the Cas nuclease is derived from a type IV CRISPR / Cas system. In some embodiments, the Cas nuclease is derived from a type V CRISPR / Cas system. In some embodiments, the Cas nuclease is derived from a type VI CRISPR / Cas system.

[0107] Guide RNA (gRNA) CRISPR technology involves the use of genome-targeted nucleic acids that can guide an endonuclease to a specific target sequence within a target gene in order to edit a gene at a specific target sequence. This genome-targeted nucleic acid may be RNA. The genome-targeted RNA is referred to herein as “guide RNA” or “gRNA”. The guide RNA includes at least one spacer sequence that hybridizes to the target nucleic acid sequence and the CRISPR repeat sequence within the target gene for editing.

[0108] In the type II system, the gRNA also contains a second RNA called the tracrRNA sequence. In type II gRNA, the CRISPR repeat sequence and the tracrRNA sequence hybridize to form a double helix. In type V gRNA, the crRNA forms the double helix. In both systems, the double helix binds to a site-specific polypeptide, resulting in the formation of a complex between the guide RNA and the site-specific polypeptide. In some embodiments, the genome-targeted nucleic acid, through its association with the site-specific polypeptide, imparts target specificity to the complex. Thus, the genome-targeted nucleic acid induces the activity of the site-specific polypeptide.

[0109] As is understood by those skilled in the art, each guide RNA is designed to contain a spacer sequence complementary to its genomic target sequence. See Jinek et al., Science, 337, 816-821 (2012) and Deltcheva et al., Nature, 471, 602-607 (2011).

[0110] In some embodiments, the genome-targeting nucleic acid (e.g., gRNA) is a bimolecule guide RNA. In some embodiments, the genome-targeting nucleic acid (e.g., gRNA) is a single-molecule guide RNA.

[0111] The bimolecular guide RNA contains two strands of RNA molecules. The first strand contains an optional spacer extension sequence, a spacer sequence, and a minimal CRISPR repeat sequence in the 5' to 3' direction. The second strand contains a minimal tracrRNA sequence (complementary to the minimal CRISPR repeat sequence), a 3' tracrRNA sequence, and an optional tracrRNA extension sequence.

[0112] In the Type II system, the single-molecule guide RNA (referred to as "sgRNA") includes an optional spacer extension sequence, a spacer sequence, a minimal CRISPR repeat sequence, a single-molecule guide linker, a minimal tracrRNA sequence, a 3' tracrRNA sequence, and an optional tracrRNA extension sequence, running from 5' to 3'. The optional tracrRNA extension may contain elements that confer further functionality (e.g., stability) to the guide RNA. The single-molecule guide linker ligates the minimal CRISPR repeat sequence and the minimal tracrRNA sequence to form a hairpin structure. The optional tracrRNA extension contains one or more hairpins. In the Type V system, the single-molecule guide RNA includes a minimal CRISPR repeat sequence and a spacer sequence, running from 5' to 3'.

[0113] The spacer sequence in the gRNA is a sequence (e.g., a 20-nucleotide sequence) that defines the target sequence of the target gene of interest (e.g., a DNA target sequence such as a genomic target sequence). In some embodiments, the spacer sequence is in the range of 15 to 30 nucleotides. For example, the spacer sequence may contain 15, 16, 17, 18, 19, 29, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. In some embodiments, the spacer sequence contains 20 nucleotides.

[0114] The "target sequence" is a sequence located in a target gene adjacent to the PAM sequence and modified by an RNA-induced nuclease (e.g., Cas9). The "target sequence" is located on the so-called PAM strand within the "target nucleic acid," which is a double-stranded molecule containing the PAM strand and a complementary non-PAM strand. Those skilled in the art recognize that the gRNA spacer sequence hybridizes to a complementary sequence located on the non-PAM strand of the target nucleic acid of interest. Therefore, the gRNA spacer sequence is the RNA equivalent of the target sequence. For example, if the target sequence is 5'-AGAGCAACAGTGCTGTGGCC**-3' (SEQ ID NO: 69), then the gRNA spacer sequence is 5'-AGAGCAACAGUGCUGUGGCC**-3' (SEQ ID NO: 61). The gRNA spacer interacts with the target nucleic acid of interest in a sequence-specific manner via hybridization (i.e., base pairing). Therefore, the nucleotide sequence of the spacer changes depending on the target sequence of the target nucleic acid of interest.

[0115] In the CRISPR / Cas system described herein, the spacer sequence is designed to hybridize to a region of the target nucleic acid located at 5' of a PAM recognizable by the Cas9 enzyme used in this system. The spacer may be a perfect match or a mismatch with the target sequence. Each Cas9 enzyme has a specific PAM sequence that is recognized within the target DNA. For example, S. pyogenes recognizes a PAM in the target nucleic acid that contains the sequence 5'-NRG-3' (where R is either A or G, N is any nucleotide, and N is immediately adjacent to 3' of the target nucleic acid sequence targeted by the spacer sequence).

[0116] In some embodiments, the target nucleic acid sequence has 20 nucleotides in length. In some embodiments, the target nucleic acid has fewer than 20 nucleotides in length. In some embodiments, the target nucleic acid has more than 20 nucleotides in length. In some embodiments, the target nucleic acid has at least 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides in length. In some embodiments, the target nucleic acid has up to 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides in length. In some embodiments, the target nucleic acid sequence has 20 bases immediately adjacent to the 5' of the first nucleotide of the PAM. For example,

[0117] [ka]

[0118] In sequences containing , the target nucleic acid may be the sequence corresponding to N (where N can be any nucleotide, and the underlined NRG sequence is the PAM of S. pyogenes).

[0119] The guide RNAs disclosed herein can target any desired sequence by a spacer sequence within the crRNA. In some embodiments, the degree of complementarity between the spacer sequence of the guide RNA and the target sequence in the target gene may be about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100%. In some embodiments, the spacer sequence of the guide RNA and the target sequence in the target gene are 100% complementary. In other embodiments, the spacer sequence of the guide RNA and the target sequence in the target gene may contain up to 10 mismatches, for example, up to 9, up to 8, up to 7, up to 6, up to 5, up to 4, up to 3, up to 2, or up to 1 mismatch.

[0120] With respect to any of the gRNA sequences provided herein, if a modification is not explicitly indicated, it means that both unmodified sequences and sequences with any suitable modifications are included.

[0121] The length of the spacer sequence in any of the gRNAs disclosed herein may depend on the CRISPR / Cas9 system and the components used to edit any of the target genes further disclosed herein. For example, different Cas9 proteins from different bacterial species have a variety of optimal spacer sequence lengths. Thus, the spacer sequence may have 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, or more than 50 nucleotides. In some embodiments, the spacer sequence may have 18 to 24 nucleotides. In some embodiments, the targeting sequence may have 19 to 21 nucleotides. In some embodiments, the spacer sequence may contain 20 nucleotides.

[0122] In some embodiments, the gRNA may be an sgRNA, which may contain a 20-nucleotide spacer sequence at the 5' end of the sgRNA sequence. In some embodiments, the sgRNA may contain a spacer sequence of fewer than 20 nucleotides at the 5' end of the sgRNA sequence. In some embodiments, the sgRNA may contain a spacer sequence of more than 20 nucleotides at the 5' end of the sgRNA sequence. In some embodiments, the sgRNA may contain a variable-length spacer sequence having 17 to 30 nucleotides at the 5' end of the sgRNA sequence. Examples are provided in Table 23 below. In these exemplary sequences, the “n” fragment refers to the spacer sequence at the 5' end.

[0123] In some embodiments, the sgRNA does not contain uracil at the 3' end of the sgRNA sequence. In other embodiments, the sgRNA may contain one or more uracils at the 3' end of the sgRNA sequence. For example, the sgRNA may contain 1 to 8 uracil residues at the 3' end of the sgRNA sequence, for example, 1, 2, 3, 4, 5, 6, 7, or 8 uracil residues at the 3' end of the sgRNA sequence.

[0124] Any of the gRNAs disclosed herein, including any of the sgRNAs, may be unmodified. Alternatively, they may contain one or more modified nucleotides and / or modified backbone. For example, a modified gRNA such as an sgRNA may contain one or more 2'-O-methylphosphorothioate nucleotides that may be located at either the 5' end, the 3' end, or both.

[0125] In certain embodiments, two or more guide RNAs can be used with the CRISPR / Cas nuclease system. Each guide RNA may contain different targeting sequences so that the CRISPR / Cas system cleaves two or more target nucleic acids. In some embodiments, one or more guide RNAs may have the same or different properties, such as activity or stability, within the Cas9 RNP complex. When two or more guide RNAs are used, each guide RNA may be encoded on the same or different vectors. The promoters used to drive the expression of the two or more guide RNAs may be the same or different.

[0126] In some embodiments, the gRNAs disclosed herein target the Reg1 gene, for example, targeting sites within exon 1, exon 2, exon 3, exon 4, exon 5, or exon 6 of the Reg1 gene. Such gRNAs may contain spacer sequences that are (fully or partially) complementary to the target sequence or fragment thereof in exon 2 or exon 4 of the Reg1 gene. Exemplary target sequences and exemplary gRNA sequences of Reg1 are shown in Table 22 below.

[0127] In some embodiments, the gRNAs disclosed herein target the TGFBRII gene, for example, targeting sites within exon 1, exon 2, exon 3, exon 4, exon 5, or exon 6 of the TGFBRII gene. Such gRNAs may contain a spacer sequence that is (fully or partially) complementary to the target sequence or fragment thereof in exon 4 or exon 5 of the TGFBRII gene. Exemplary target sequences and exemplary gRNA sequences of TGFBRII are shown in Table 39 below.

[0128] In some embodiments, the gRNAs disclosed herein target the CD70 gene, for example, targeting a site within exon 1 or exon 3 of the CD70 gene. Such gRNAs may contain a spacer sequence that is (completely or partially) complementary to the target sequence or fragment thereof in exon 1 or exon 3 of the CD70 gene. Exemplary target sequences in the CD70 gene and exemplary gRNAs specific to the CD70 gene are shown in Table 23 below.

[0129] In some embodiments, the gRNAs disclosed herein target the β2M gene, for example, a preferred site within the β2M gene. For the purposes and subjects referred to herein, see also International Publication No. 2019097305, whose relevant disclosures are incorporated herein by reference. Other gRNA sequences may be designed using the β2M gene sequence located on chromosome 15 (GRCh38 coordinates: chromosome 15: 44,711,477~44,718,877; Ensembl: ENSG00000166710). In some embodiments, gRNAs and RNA-inducible nucleases targeting the β2M genomic region cause cleavage in the β2M genomic region, resulting in indels in the β2M gene and disrupting mRNA or protein expression.

[0130] In some embodiments, the gRNAs disclosed herein target the TRAC gene. See also International Publication No. 2019097305, whose relevant disclosures relating to the subject matter and objectives mentioned herein are incorporated herein by reference. Other gRNA sequences may be designed using the TRAC gene sequence located on chromosome 14 (GRCh38: chromosome 14: 22,547,506-22,552,154; Ensembl; ENSG00000277734). In some embodiments, gRNAs and RNA-inducible nucleases targeting the TRAC genomic region result in cleavage in the TRAC genomic region, leading to indels in the TRAC gene that disrupt mRNA or protein expression.

[0131] Exemplary spacer sequences and gRNAs that target the β2M gene or the TRAC gene are shown in Table 23 below.

[0132] For example, guide RNAs or other smaller RNAs used in CRISPR / Cas / Cpf1 systems can be readily synthesized by chemical means, as described below and in the Art. While chemical synthesis methods continue to expand, the increasing length of polynucleotides, often well over 100 nucleotides, makes the purification of such RNAs by methods such as high-performance liquid chromatography (avoiding the use of gels such as HPLC and PAGE) increasingly difficult. One technique used to generate relatively long RNAs is to produce two or more molecules that are ligated together. Much longer RNAs, such as those encoding Cas9 endonuclease or Cpf1 endonuclease, are more readily synthesized enzymatically. As described in the Art, various types of RNA modifications (e.g., modifications that enhance stability, reduce the likelihood or degree of innate immune response, and / or enhance other properties) can be introduced during or after the chemical synthesis and / or enzymatic production of RNA.

[0133] In some cases, the gRNAs of this disclosure may be produced by in vitro transcription (IVT), synthesis and / or chemical synthesis, or a combination thereof. Enzymatic (IVT), solid-phase, liquid-phase, complex-type synthesis, micro-region synthesis, and ligation methods are utilized. In one embodiment, the gRNA is produced using an IVT enzymatic synthesis method. Methods for producing polynucleotides by IVT are known in the art and are described in International Publication No. 2013 / 151666. Accordingly, this disclosure also includes polynucleotides, such as DNA constructs, and vectors are used to in vitro transcribe the gRNAs described herein.

[0134] As described in the art, various types of RNA modifications (e.g., modifications that enhance stability, reduce the likelihood or degree of innate immune response, and / or enhance other properties) can be introduced during or after the chemical synthesis and / or enzymatic production of RNA. In some embodiments, unnaturally modified nucleic acid bases can be introduced into any of the gRNAs disclosed herein during or after synthesis. In certain embodiments, the modifications are in nucleoside bonds, purine or pyrimidine bases, or sugars. In some embodiments, the modifications are introduced at the ends of the gRNA using chemical synthesis or polymerase enzymes. Examples of modified nucleic acids and their synthesis are disclosed in International Publication No. 2013 / 052523. The synthesis of modified polynucleotides is also described in Verma and Eckstein, Annual Review of Biochemistry, vol. 76, 99-134 (1998).

[0135] In some embodiments, polynucleotides or regions thereof can be conjugated with various functional moieties, such as targeted or delivered drugs, fluorescent labels, liquids, and nanoparticles, using enzymatic or chemical ligation methods. Conjugation of polynucleotides and modified polynucleotides is outlined in Goodchild, Bioconjugate Chemistry, vol.1(3), 165-187 (1990).

[0136] In some embodiments of this disclosure, a CRISPR / Cas nuclease system for use in gene editing of any of the target genes disclosed herein may include at least one guide RNA. In some examples, the CRISPR / Cas nuclease system may include multiple gRNAs, e.g., 2, 3, or 4 gRNAs. These multiple gRNAs may target different sites within the same target gene. Alternatively, the multiple gRNAs may target different genes. In some embodiments, the guide RNA and Cas protein may form a ribonucleoprotein (RNP), e.g., a CRISPR / Cas complex. The guide RNA may guide the Cas protein to a target sequence on one or more target genes, such as those disclosed herein, where the Cas protein cleaves the target gene at the target site. In some embodiments, the CRISPR / Cas complex is a Cpf1 / guide RNA complex. In some embodiments, the CRISPR complex is a type II CRISPR / Cas9 complex. In some embodiments, the Cas protein is a Cas9 protein. In some embodiments, the CRISPR / Cas9 complex is a Cas9 / guide RNA complex.

[0137] In some embodiments, the indel frequency (edit frequency) of a particular CRISPR / Cas nuclease system containing one or more specific gRNAs can be determined using TIDE analysis, which can be used to identify gRNA molecules that are highly efficient at editing target genes. In some embodiments, highly efficient gRNAs result in gene editing frequencies higher than 80%. For example, a gRNA is considered highly efficient if it results in gene editing frequencies of at least 80%, at least 85%, at least 90%, at least 95%, or 100%.

[0138] Delivery of guide RNA and nucleases to T cells A CRISPR / Cas nuclease system disclosed herein, comprising one or more gRNAs, at least one RNA-inducible nuclease, and optionally a donor template, can be delivered to target cells (e.g., T cells) via conventional methods for gene editing of a target gene. In some embodiments, the components of the CRISPR / Cas nuclease system disclosed herein can be delivered to the target cell individually, either simultaneously or sequentially. In other embodiments, the components of the CRISPR / Cas nuclease system can be delivered together into the target, for example, as a complex. In some cases, the gRNA and RNA-inducible nuclease can pre-complex together to form a ribonucleoprotein (RNP) that can be delivered into the target cell.

[0139] RNPs are useful for gene editing because, at the very least, they minimize the risk of disruptive interactions in nucleic acid-rich cellular environments and protect RNA from degradation. Methods for forming RNPs are known in the art. In some embodiments, RNPs containing an RNA-induced nuclease (e.g., a Cas nuclease such as Cas9 nuclease) and one or more gRNAs targeting one or more genes of interest can be delivered to cells (e.g., T cells). In some embodiments, RNPs can be delivered to T cells by electroporation.

[0140] In some embodiments, RNA-inducible nucleases can be delivered to cells in a DNA vector that expresses the RNA-inducible nuclease within the cell. In other embodiments, RNA-inducible nucleases can be delivered to cells in RNA that encodes the RNA-inducible nuclease and causes the nuclease to be expressed within the cell. Alternatively, a gene-targeting gRNA can be delivered to cells as RNA or as a DNA vector that expresses the gRNA within the cell.

[0141] The delivery of RNA-induced nucleases, gRNAs, and / or RNPs may be by direct injection or by cell transfection using known methods, such as electroporation or chemical transfection. Other cell transfection methods may be used.

[0142] Other gene editing methods In addition to the CRISPR method disclosed herein, other gene editing methods known in the art may also be used to produce the genetically modified T cells disclosed herein. Some examples include gene editing approaches involving zinc finger nucleases (ZFNs), transcriptional activator-like effector nucleases (TALENs), restriction endonucleases, and meganuclease-homing endonucleases.

[0143] ZFNs are targeted nucleases containing nucleases fused to zinc finger DNA-binding domains (ZFBDs), which are polypeptide domains that bind to DNA in a sequence-specific manner via one or more zinc fingers. A zinc finger is a domain of approximately 30 amino acids within a zinc finger-binding domain whose structure is stabilized via the coordination of a zinc ion. Examples of zinc fingers include, but are not limited to, C2H2, C3H, and C4 zinc fingers. Designed zinc finger domains are non-natural domains whose design / composition is primarily derived from reasonable criteria (e.g., the application of substitution rules and computer-processed algorithms to process information in databases storing information on existing ZFP designs and binding data). For example, see U.S. Patent Nos. 6,140,081; 6,453,242; and 6,534,261, and also see International Publication Nos. 98 / 53058; 98 / 53059; 98 / 53060; 02 / 016536; and 03 / 016496. Selected zinc finger domains are non-naturally occurring domains, primarily resulting from experimental processes such as phage display, interaction trapping, or hybrid selection. ZFNs are described in more detail in U.S. Patent Nos. 7,888,121 and 7,972,854. The most recognized example of a ZFN is a fusion of a FokI nuclease and a zinc finger DNA-binding domain.

[0144] TALEN is a targeted nuclease containing a nuclease fused to the TAL effector DNA-binding domain. The "transcription activator-like effector DNA-binding domain," "TAL effector DNA-binding domain," or "TALE DNA-binding domain" is the polypeptide domain of the TAL effector protein involved in the binding of the TAL effector protein to DNA. TAL effector proteins are secreted during infection by plant pathogens of the genus Xanthomonas. These proteins enter the nucleus of plant cells and bind to effector-specific DNA sequences via their DNA-binding domains, and activate gene transcription at these sequences via their transcription activator domains. The specificity of the TAL effector DNA-binding domain depends on the effector-variable number of incomplete repeats of 34 amino acids, including polymorphism at a selective repeat site called a repeating variable two residue (RVD). TALEN is described in more detail in U.S. Patent Application Publication No. 2011 / 0145940. The most recognized example of TALEN in this field is a fusion polypeptide of FokI nuclease to the TAL effector DNA-binding domain.

[0145] Further examples of suitable targeted nucleases provided herein, whether used individually or in combination, include, but are not limited to, Bxb1, phiC31, R4, PhiBT1, and Wβ / SPBc / TP901-1.

[0146] Any of the nucleases disclosed herein may be delivered using vector systems, including but not limited to plasmid vectors, DNA rings, retroviral vectors, lentiviral vectors, adenovirus vectors, poxvirus vectors; herpesvirus vectors and adeno-associated virus vectors, and combinations thereof.

[0147] Conventional viral and nonviral gene transfer methods can be used to introduce nucleic acids encoding nucleases and donor templates into cells (e.g., T cells). Nonviral vector delivery systems include DNA plasmids, DNA rings, naked nucleic acids, and nucleic acids complexed with delivery media such as liposomes or poloxamers. Viral vector delivery systems include DNA viruses and RNA viruses that, after delivery to cells, have either an episome or an integrated genome.

[0148] Nonviral methods of nucleic acid delivery include electroporation, lipofection, microinjection, gene guns, virosomes, liposomes, immunoliposomes, polycations or lipids: nucleic acid conjugates, naked DNA, naked RNA, capped RNA, artificial virions, and drug-enhanced DNA. For example, sonoporation using the Sonitron 2000 system (Rich-Mar) can also be used for nucleic acid delivery. Several specific examples are provided below.

[0149] II. Genetically modified T cells expressing chimeric antigen receptors (CARs) Genetically engineered T cells having a disrupted Reg1 gene, a disrupted TGFBRII gene, or a combination of a disrupted Reg1 gene and a disrupted TGFBRII gene. Optionally, such genetically engineered T cells may further contain one or more additional disrupted genes, such as β2M, TRAC, CD70, or combinations thereof, as disclosed herein, and may further express a chimeric antigen receptor (CAR) that targets an antigen of interest or cells expressing such antigen.

[0150] (a) Chimeric antigen receptor (CAR) Chimeric antigen receptors (CARs) are artificial immune cell receptors engineered to recognize and bind to antigens expressed on undesirable cells, such as diseased cells like cancer cells. T cells that express CAR polypeptides are called CAR-T cells. CARs have the ability to reinduce the specificity and responsiveness of T cells to selected targets in a manner that is not restricted by MHC. This MHC-independent antigen recognition gives CAR-T cells the ability to recognize antigens independently of antigen processing, thereby bypassing the main mechanism of tumor escape. Furthermore, when expressed on T cells, CARs advantageously do not dimerize with the alpha and beta chains of the endogenous T cell receptor (TCR).

[0151] Various generations of CARs exist, each containing different components. First-generation CARs ligate an antibody-derived scFv to the CD3 zeta (ζ or z) intracellular signaling domain of the T cell receptor via a hinge and transmembrane domain. Second-generation CARs incorporate additional costimulatory domains, e.g., CD28, 4-1BB (41BB), or ICOS, to supply costimulatory signals. Third-generation CARs contain two costimulatory domains fused to the CD3 ζ chain of the TCR (e.g., a combination of CD27, CD28, 4-1BB, ICOS, or OX40). (Maude et al., Blood. 2015; 125(26): 4017-4023; Kakarla and Gottschalk, Cancer J. 2014; 20(2): 151-155). Any of the various generations of CAR constructs are within the scope of this disclosure.

[0152] Generally, a CAR is a fusion polypeptide containing an extracellular domain that recognizes a target antigen (e.g., a single-chain fragment of an antibody (scFv) or other antibody fragment), and an intracellular domain containing a signaling domain of the T cell receptor (TCR) complex (e.g., CD3ζ), which is in most cases a co-stimulatory domain (Enblad et al., Human Gene Therapy. 2015;26(8):498-505). CAR constructs may further contain a hinge and a transmembrane domain between the extracellular and intracellular domains, and may contain a signal peptide at the N-terminus for surface expression. Examples of signal peptides include SEQ ID NOs. 95 and 96, shown in Table 27 below. Other signal peptides may also be used.

[0153] (i) antigen-binding extracellular domain The antigen-binding extracellular domain is the region of the CAR polypeptide that is exposed to the extracellular fluid when CAR is expressed on the cell surface. In some cases, a signal peptide may be located at the N-terminus to promote cell surface expression. In some embodiments, the antigen-binding domain is a single-chain variable fragment (scFv) and the antibody heavy chain variable region (V H ) and antibody light chain variable region (V L ) and (may include in either direction). In some cases, V H Fragments and V L The fragments can be linked via a peptide linker. In some embodiments, the linker includes hydrophilic residues containing a sequence of glycine and serine for mobility and a sequence of glutamate and lysine to confer solubility. The scFv fragment retains the antigen-binding specificity of the parent antibody from which the scFv fragment is derived. In some embodiments, the scFv is humanized V H Domain and / or V L It may include a domain. In other embodiments, the V of scFv H Domain and / or V L The domain is fully humanoid.

[0154] The antigen-binding extracellular domain may be specific to the target antigen of interest, such as a pathological antigen like a tumor antigen. In some embodiments, tumor antigens are “tumor-associated antigens” that refer to immunogenic molecules, such as proteins, that are expressed at higher levels in tumor cells than in non-tumor cells, which may not be expressed at all or only at low levels. In some embodiments, tumor-associated structures recognized by the immune system of a host containing a tumor are referred to as tumor-associated antigens. In some embodiments, tumor-associated antigens are universal tumor antigens if they are widely expressed by most types of tumors. In some embodiments, tumor-associated antigens are differentiation antigens, mutagenic antigens, overexpressed cell antigens, or viral antigens. In some embodiments, tumor antigens are “tumor-specific antigens” or “TSAs” that refer to immunogenic molecules, such as proteins, that are specific to tumor cells. Tumor-specific antigens are expressed in tumor cells, for example, only in certain types of tumor cells.

[0155] In some embodiments, the antigen-binding extracellular domain may be a single-chain variable fragment (scFv) that binds to a tumor antigen as disclosed herein. The scFv may optionally be linked via a mobile peptide linker to an antibody heavy chain variable region (V H ) and antibody light chain variable region (V L ) may include. In some cases, scFv is V H From V L It may have the orientation (from N-terminus to C-terminus). Alternatively, scFv is V L From V H It may have an orientation (from the N-terminus to the C-terminus).

[0156] Examples of tumor antigens include, but are not limited to, CD19, BCMA, CD70, CD33, and PTK7. Any known antibodies specific to such tumor antigens, such as those authorized for market sale and those in clinical trials, may be used to construct the CAR constructs disclosed herein. Non-limiting examples of CAR constructs are provided in International Publications 2019097305, 2019215500, 2020 / 095107, and International Patent Application PCT / IB2021 / 053849, the relevant disclosures of which are incorporated herein by reference.

[0157] In some cases, the antigen-binding extracellular domain may be a single-chain variable fragment (scFv) that binds to human CD19. In some cases, the anti-CD19 scFv may have (i) a heavy chain variable region (V) that contains the same heavy chain complementarity-determining region (CDR) as that of SEQ ID NO: 124. H ), and (ii) a light chain variable region (V) containing the same light chain CDR as that of sequence number 125. L ) may include. In some specific examples, the anti-CD19 antibodies disclosed herein may include heavy chain CDR1, heavy chain CDR2, and heavy chain CDR3, respectively, as determined by the Kabat method and described as SEQ ID NOs. 108-110. Alternatively, the anti-CD19 antibodies disclosed herein may further include light chain CDR1, light chain CDR2, and light chain CDR3, respectively, as determined by the Kabat method and described as SEQ ID NOs. 105-107. Alternatively, the anti-CD19 antibodies disclosed herein may include heavy chain CDR1, heavy chain CDR2, and heavy chain CDR3, respectively, as determined by the Chothia method and described as SEQ ID NOs. 114-116. Alternatively, the anti-CD19 antibodies disclosed herein may further include light chain CDR1, light chain CDR2, and light chain CDR3, respectively, as determined by the Chothia method and described as SEQ ID NOs. 111-113. In a specific case, anti-CD19 scFv contains the amino acid sequence of sequence number 124. H It may include V L This contains the amino acid sequence of sequence number 125. See sequence listing 27 below.

[0158] In some cases, the antigen-binding extracellular domain may be a single-chain variable fragment (scFv) that binds to human CD70. In some cases, the anti-CD70 scFv may have a heavy chain variable region (V) containing the same heavy chain complementarity-determining region (CDR) as that of SEQ ID NO: 143. H ), and (ii) a light chain variable region (V) containing the same light chain CDR as that of sequence number 144. L ) may include. In some specific examples, the anti-CD70 antibodies disclosed herein may include heavy chain CDR1, heavy chain CDR2, and heavy chain CDR3, respectively, as determined by the Kabat method and described as SEQ ID NOs. 132, 134, and 136. Alternatively, the anti-CD70 antibodies disclosed herein may further include light chain CDR1, light chain CDR2, and light chain CDR3, respectively, as determined by the Kabat method and described as SEQ ID NOs. 127, 129, and 130. Alternatively, the anti-CD70 antibodies disclosed herein may include heavy chain CDR1, heavy chain CDR2, and heavy chain CDR3, respectively, as determined by the Chothia method and described as SEQ ID NOs. 133, 135, and 137. Alternatively, the anti-CD70 antibodies disclosed herein may further include light chain CDR1, light chain CDR2, and light chain CDR3, respectively, as determined by the Chothia method and described as SEQ ID NOs. 128, LAS, and 131. In a specific case, anti-CD70 scFv contains the amino acid sequence of sequence number 143. H It may include V L This contains the amino acid sequence of sequence number 144. See sequence listing 27 below.

[0159] In some cases, the antigen-binding extracellular domain may be a single-chain variable fragment (scFv) that binds to human BCMA. In some cases, the anti-BCMA scFv may have a heavy chain variable region (V) containing the same heavy chain complementarity-determining region (CDR) as that of SEQ ID NO: 149. H ), and (ii) a light chain variable region (V) containing the same light chain CDR as that of sequence number 150. L) may include. In some specific examples, the anti-BCMA antibodies disclosed herein may include heavy chain CDR1, heavy chain CDR2, and heavy chain CDR3, respectively, as determined by the Kabat method and described as SEQ ID NOs. 155, 157, and 159. Alternatively, the anti-BCMA antibodies disclosed herein may further include light chain CDR1, light chain CDR2, and light chain CDR3, respectively, as determined by the Kabat method and described as SEQ ID NOs. 151, 152, and 153. Alternatively, the anti-BCMA antibodies disclosed herein may include heavy chain CDR1, heavy chain CDR2, and heavy chain CDR3, respectively, as determined by the Chothia method and described as SEQ ID NOs. 156, 158, and 160. Alternatively, the anti-BCMA antibodies disclosed herein may further include light chain CDR1, light chain CDR2, and light chain CDR3, respectively, as determined by the Chothia method and described as SEQ ID NOs. 151, 152, and 154. In a specific case, anti-BCMA scFv contains the amino acid sequence of sequence number 149. H It may include V L This contains the amino acid sequence of sequence number 150. See sequence listing 27 below.

[0160] In some cases, the antigen-binding extracellular domain may be a single-chain variable fragment (scFv) that binds to human CD33. Exemplary anti-CD33scFv and anti-CD33CAR constructs can be found, for example, in Sequence Listing 27 below, and in International Publication No. 2020 / 095107, whose related disclosures are incorporated herein by reference with respect to the subject and objectives described herein.

[0161] In some cases, the antigen-binding extracellular domain may be a single-chain variable fragment (scFv) that binds to human CD33. In some cases, the anti-CD33 scFv may be a heavy chain variable region (V) containing the same heavy chain complementarity-determining region (CDR) as that of SEQ ID NO: 334. H ), and (ii) a light chain variable region (V) containing the same light chain CDR as that of sequence number 335. L) may include. In some specific examples, the anti-CD33 antibodies disclosed herein may include heavy chain CDR1, heavy chain CDR2, and heavy chain CDR3, respectively, as determined by the Kabat method and described as SEQ ID NOs. 328-330. Alternatively, the anti-CD33 antibodies disclosed herein may further include light chain CDR1, light chain CDR2, and light chain CDR3, respectively, as determined by the Kabat method and described as SEQ ID NOs. 331-333. In some specific examples, anti-BCMA scFv may include V, which contains the amino acid sequence of SEQ ID NO. 149. H It may include V L This contains the amino acid sequence of sequence number 150. See sequence listing 27 below.

[0162] In some cases, the antigen-binding extracellular domain may be a single-chain variable fragment (scFv) that binds to human PTK7. In some cases, the anti-PTK7 scFv may have (i) a heavy chain variable region (V) containing the same heavy chain complementarity-determining region (CDR) as that of SEQ ID NO: 346. H ), and (ii) a light chain variable region (V) containing the same light chain CDR as that of sequence number 347. L ) may include. In some specific examples, the anti-PTK7 antibodies disclosed herein may include heavy chain CDR1, heavy chain CDR2, and heavy chain CDR3, respectively, as determined by the Kabat method and described as SEQ ID NOs. 340-342. Alternatively, the anti-PTK7 antibodies disclosed herein may further include light chain CDR1, light chain CDR2, and light chain CDR3, respectively, as determined by the Kabat method and described as SEQ ID NOs. 343-345. In some specific examples, anti-BCMA scFv may include V, which contains the amino acid sequence of SEQ ID NO. 346. H It may include V L This contains the amino acid sequence of sequence number 347. See sequence listing 27 below.

[0163] The same V H and / or V LTwo antibodies having the same CDR means that these CDRs are identical when determined by the same approach (e.g., the Kabat approach, Chothia approach, AbM approach, Contact approach, or IMGT approach known in the art; see, for example, bioinf.org.uk / abs / or abysis.org / abysis / sequence_input).

[0164] (ii) Transmembrane domain The CAR polypeptides disclosed herein may contain a transmembrane domain, which may be a hydrophobic alpha-helix spanning the membrane. As used herein, “transmembrane domain” refers to any protein structure that is thermodynamically stable within the cell membrane, preferably the eukaryotic cell membrane. The transmembrane domain may contribute to the stability of the CAR containing it.

[0165] In some embodiments, the transmembrane domain of the CAR provided herein may be a CD8 transmembrane domain. In other embodiments, the transmembrane domain may be a CD28 transmembrane domain. In yet other embodiments, the transmembrane domain is a chimera of the CD8 and CD28 transmembrane domains. Other transmembrane domains may be used as provided herein. In some embodiments, the transmembrane domain is a CD8a transmembrane domain containing the sequence of Sequence ID No. 97 shown in Table 27 below. Other transmembrane domains may be used.

[0166] (iii) Hinge Domain In some embodiments, the hinge domain may be located between the extracellular domain (including the antigen-binding domain) and the transmembrane domain of the CAR, or between the cytoplasmic domain and the transmembrane domain of the CAR. The hinge domain may be any oligopeptide or polypeptide that functions to link the transmembrane domain to the extracellular domain and / or the cytoplasmic domain in the polypeptide chain. The hinge domain may function to provide mobility to the CAR or its domains, or to prevent steric hindrance to the CAR or its domains.

[0167] In some embodiments, the hinge domain may contain up to 300 amino acids (e.g., 10 to 100 amino acids, or 5 to 20 amino acids). In some embodiments, one or more hinge domains may be included in other regions of the CAR. In some embodiments, the hinge domain may be a CD8 hinge domain. Other hinge domains may be used.

[0168] (iv) Intracellular signaling domain Each CAR construct contains one or more intracellular signaling domains (e.g., CD3ζ, and optionally one or more costimulatory domains) that are functional ends of the receptor. After antigen recognition, the receptors cluster and transmit signals to the cell.

[0169] CD3ζ is the cytoplasmic signaling domain of the T cell receptor complex. CD3ζ contains three immunoreceptor-activated tyrosine motifs (ITAMs) that transmit activation signals to T cells after association with an alloantigen. Often, CD3ζ provides activation signals to primary T cells, but these are not sufficiently qualified activation signals and require co-stimulatory signaling.

[0170] In some embodiments, the CAR polypeptides disclosed herein may further comprise one or more co-stimulatory signaling domains. For example, the CD28 and / or 4-1BB co-stimulatory domains may be used in conjunction with a primary signaling pathway mediated by CD3ζ to transmit a sufficient reproduction / survival signal. In some examples, the CARs disclosed herein comprise a CD28 co-stimulatory molecule. In other examples, the CARs disclosed herein comprise a 4-1BB co-stimulatory molecule. In some embodiments, the CAR comprises a CD3ζ signaling domain and a CD28 co-stimulatory domain. In other embodiments, the CAR comprises a CD3ζ signaling domain and a 4-1BB co-stimulatory domain. In yet other embodiments, the CAR comprises a CD3ζ signaling domain, a CD28 co-stimulatory domain, and a 4-1BB co-stimulatory domain.

[0171] Table 27 provides examples of signal transduction domains derived from 4-1BB, CD28, and CD3-zeta that may be used herein.

[0172] In certain examples, the anti-CD19 CAR disclosed herein may include the amino acid sequence of SEQ ID NO: 118, which can be encoded by the nucleotide sequence of SEQ ID NO: 117. Alternatively, the anti-CD19 CAR may be a mature form that does not include the N-terminal signal peptide, for example, the amino acid sequence of SEQ ID NO: 353.

[0173] In other examples, the anti-BCMA CAR disclosed herein may include the amino acid sequence of SEQ ID NO: 146, which can be encoded by the nucleotide sequence of SEQ ID NO: 145. Alternatively, the anti-CDBCMA CAR may be a mature form that does not include the N-terminal signal peptide, for example, the amino acid sequence of SEQ ID NO: 355.

[0174] In other examples, the anti-CD70 CAR disclosed herein may include the amino acid sequence of SEQ ID NO: 138, which can be encoded by the nucleotide sequence of SEQ ID NO: 141. Alternatively, the anti-CD70 CAR may be a mature form that does not include the N-terminal signal peptide, for example, the amino acid sequence of SEQ ID NO: 354.

[0175] In some examples, the anti-CD33 CARs disclosed herein may include the amino acid sequence of SEQ ID NO: 338 or 339. Alternatively, the anti-CD33 CAR may be a mature form that does not include the N-terminal signal peptide, for example, the amino acid sequence of SEQ ID NO: 356 or 357.

[0176] In some examples, the anti-PTK7 CARs disclosed herein may include the amino acid sequence of SEQ ID NO: 349 or 350. Alternatively, the anti-PTK7 CAR may be a mature form that does not include the N-terminal signal peptide, for example, the amino acid sequence of SEQ ID NO: 358 or 359.

[0177] Please refer to Sequence Listing 27 provided below.

[0178] (b) Delivery of CAR constructs to T cells In some embodiments, nucleic acids encoding CARs can be introduced into any of the genetically engineered T cells disclosed herein by methods known to those skilled in the art. For example, the coding sequence of a CAR can be cloned into a vector that can be introduced into genetically engineered T cells for CAR expression. Any of the nucleic acids or expression vectors disclosed herein can be introduced into immunoeffector cells using a variety of different methods known in the art. Non-limiting examples of methods for introducing nucleic acids into cells include lipofection, transfection (e.g., calcium phosphate transfection, transfection using highly branched organic compounds, transfection using cationic polymers, dendrimer-based transfection, optical transfection, particle-based transfection (e.g., nanoparticle transfection) or transfection using liposomes (e.g., cationic liposomes)), microinjection, electroporation, cell squeezing, sonoporation, protoplast fusion, impalefection, hydrodynamic delivery, gene gun, magnetofection, viral transfection, and nucleofection.

[0179] In certain cases, nucleic acids encoding CAR constructs can be delivered to cells using adeno-associated virus (AAV). AAV is a small virus that can site-specifically integrate into the host genome and thus deliver transgenes such as CARs. Reverse terminal repeats (ITRs) are located adjacent to the AAV genome and / or the target transgene and function as replication origins. The AAV genome also contains rep and cap proteins that, when transcribed, form capsids to encapsulate the AAV genome and deliver it to target cells. Surface receptors on these capsids confer the serotype of the AAV, determining which target organ the capsid first binds to and therefore which cells the AAV most efficiently infects. There are currently 12 known serotypes of human AAV. In some embodiments, the AAV used to deliver CAR-encoding nucleic acids is AAV serotype 6 (AAV6).

[0180] Adeno-associated viruses (AAVs) are among the most frequently used viruses in gene therapy for several reasons. Firstly, AAVs do not induce an immune response when administered to mammals, including humans. Secondly, AAVs are efficiently delivered to target cells, especially when appropriate AAV serotype selection is taken into account. Finally, AAVs have the ability to infect both dividing and non-dividing cells, as they can persist in host cells without genome integration. This characteristic makes AAVs an ideal candidate for gene therapy.

[0181] CAR-encoding nucleic acids can be designed to be inserted into a target genomic site within a host T cell. In some embodiments, the target genomic site may be located within a safe harbor locus.

[0182] In some embodiments, the nucleic acid encoding the CAR may be designed to be inserted into a position within the TRAC gene to disrupt the TRAC gene in genetically engineered T cells (e.g., via a donor template that can be carried by a viral vector such as an adeno-associated virus (AAV) vector) and express the CAR polypeptide. Disruption of TRAC results in loss of function of the endogenous TCR. Disruption of the TRAC gene can be caused by an endonuclease, such as those described herein, and one or more gRNAs that target one or more TRAC genomic regions. Any of the TRAC gene and target region-specific gRNAs disclosed herein can be used for this purpose.

[0183] In some cases, homologous recombination repair, i.e., HDR (using a donor template that may be part of a viral vector such as an adeno-associated virus (AAV) vector), can cause genomic deletions and substitutions with CAR-encoding segments within the TRAC gene. In some embodiments, disruption of the TRAC gene can be caused by inserting a CAR-encoding segment into the TRAC gene using an endonuclease, such as those disclosed herein, and one or more gRNAs that target one or more TRAC genomic regions.

[0184] In some embodiments, the nucleic acid encoding the CAR may be designed to be inserted into a position within the β2M gene to disrupt the β2M gene in genetically engineered T cells (e.g., via a donor template that can be carried by a viral vector, such as an adeno-associated virus (AAV) vector) and express the CAR polypeptide. Disruption of β2M results in loss of function of the endogenous MHC class I complex. Disruption of the β2M gene can be induced by, for example, an endonuclease, such as those described herein, and one or more gRNAs that target one or more β2M genomic regions. Any of the β2M gene and target region-specific gRNAs disclosed herein can be used for this purpose.

[0185] In some examples, homologous recombination repair, i.e., HDR (using a donor template that can be part of a viral vector such as an adeno-associated virus (AAV) vector), can result in genomic deletions within the β2M gene and substitution by a segment encoding a CAR. In some embodiments, disruption of the β2M gene can be caused by an endonuclease such as those disclosed herein and one or more gRNAs targeting one or more β2M genomic regions, and by inserting a segment encoding a CAR into the β2M gene.

[0186] In some embodiments, the nucleic acid encoding a CAR can be designed to be inserted at a position within the CD70 gene to disrupt the CD70 gene (e.g., via a donor template that can be carried by a viral vector such as an adeno-associated virus (AAV) vector) in genetically engineered T cells to express the CAR polypeptide. Disruption of CD70 results in loss of function of the endogenous CD70 protein. For example, disruption in the CD70 gene can be caused by an endonuclease such as those described herein and one or more gRNAs targeting one or more CD70 genomic regions. Any of the gRNAs specific for the CD70 gene and target regions disclosed herein can be used for this purpose.

[0187] In some examples, homologous recombination repair, i.e., HDR (using a donor template that can be part of a viral vector such as an adeno-associated virus (AAV) vector), can result in genomic deletions within the CD70 gene and substitution by a segment encoding a CAR. In some embodiments, disruption of the CD70 gene can be caused by an endonuclease such as those disclosed herein and one or more gRNAs targeting one or more CD70 genomic regions, and by inserting a segment encoding a CAR into the CD70 gene.

[0188] In some embodiments, the nucleic acid encoding the CAR may be designed to be inserted into a position within the Reg1 gene to disrupt the Reg1 gene in genetically engineered T cells (e.g., via a donor template that can be carried by a viral vector, such as an adeno-associated virus (AAV) vector) and express the CAR polypeptide. Disruption of Reg1 results in loss of function of the endogenous Reg1 protein. Disruption in the Reg1 gene can be induced, for example, by an endonuclease, such as those described herein, and one or more gRNAs that target one or more Reg1 genomic regions. Any of the Reg1 gene and target region-specific gRNAs disclosed herein can be used for this purpose.

[0189] In some cases, homologous recombination repair, i.e., HDR (using a donor template that may be part of a viral vector such as an adeno-associated virus (AAV) vector), can cause genomic deletions and substitutions with CAR-encoding segments within the Reg1 gene. In some embodiments, disruption of the Reg1 gene can be caused by inserting a CAR-encoding segment into the Reg1 gene using an endonuclease, such as those disclosed herein, and one or more gRNAs that target one or more Reg1 genomic regions.

[0190] In some embodiments, the nucleic acid encoding the CAR may be designed to be inserted into a position within the TGFBRII gene to disrupt the TGFBRII gene in genetically engineered T cells (e.g., via a donor template that can be carried by a viral vector such as an adeno-associated virus (AAV) vector) and express the CAR polypeptide. Disruption of Reg1 results in loss of function of the endogenous TGFBRII receptor. Disruption in the TGFBRII gene can be induced, for example, by an endonuclease such as those described herein and one or more gRNAs that target one or more TGFBRII genomic regions. Any of the TGFBRII gene and target region-specific gRNAs disclosed herein can be used for this purpose.

[0191] In some cases, homologous recombination repair, i.e., HDR (using a donor template that may be part of a viral vector such as an adeno-associated virus (AAV) vector), can cause genomic deletions and substitutions with CAR-encoding segments within the TGFBRII gene. In some embodiments, disruption of the TGFBRII gene can be caused by inserting a CAR-encoding segment into the TGFBRII gene using an endonuclease, such as those disclosed herein, and one or more gRNAs that target one or more TGFBRII genomic regions.

[0192] The donor templates disclosed herein may contain a CAR coding sequence. In some cases, the CAR coding sequence may be flanked by two homology regions so that efficient HDR can be performed at a target genomic site, e.g., the TRAC gene, using gene editing methods known in the art. In some cases, a CRISPR-based method can be used. In this case, both strands of DNA can be cleaved at the target locus by the CRISPR Cas9 enzyme induced by a gRNA specific to the target locus. Subsequently, HDR occurs to repair the double-strand break (DSB) and insert the donor DNA encoding the CAR. To ensure this occurs correctly, the donor sequence is designed to have flanking residues (hereinafter referred to as "homology arms") complementary to the sequence surrounding the DSB site of the target gene, such as the TRAC gene. These homology arms function as templates for DSB repair, making HDR an essentially error-free mechanism. The rate of homologous recombination repair (HDR) is a function of the distance between the mutation site and the cleavage site; therefore, it is important to select overlapping or nearby target sites. The template may include extra sequences adjacent to homologous regions, or it may include sequences different from the genome sequence, thereby enabling sequence editing.

[0193] Alternatively, the donor template may not have a region homologous to the targeted site of the DNA, and may be incorporated by NHEJ-dependent terminal ligation after being cleaved at the target site.

[0194] The donor template may be single-stranded and / or double-stranded DNA or RNA, and can be introduced into cells in linear or circular form. When introduced in linear form, the ends of the donor sequence can be protected (e.g., from degradation by exonucleases) by methods known to those skilled in the art. For example, one or more dideoxynucleotide residues may be added to the 3' end of the linear molecule, and / or self-complementary oligonucleotides may be ligated to one or both ends. See, for example, Chang et al., (1987) Proc. Natl. Acad. Sci. USA 84:4959-4963; Nehls et al., (1996) Science 272:886-889. Further methods for protecting exogenous polynucleotides from degradation include, but are not limited to, the addition of terminal amino groups and the use of modified nucleotide bonds such as phosphorothioates, phosphoramidates, and O-methylribose or deoxyribose residues.

[0195] The donor template can be introduced into cells as part of a vector molecule having additional sequences, such as replication origins, promoters, and genes encoding antibiotic resistance. Furthermore, the donor template can be introduced into cells as naked nucleic acid, as nucleic acid complexed with a drug such as a liposome or poloxamer, or delivered by a virus (e.g., adenovirus, AAV, herpesvirus, retrovirus, lentivirus, and integrase-deficient lentivirus (IDLV)).

[0196] In some embodiments, the donor template may be inserted near the endogenous prompter (e.g., downstream or upstream) so that its expression can be driven by the endogenous promoter. In other embodiments, the donor template may include an exogenous promoter and / or enhancer, such as a constitutive promoter, an inducible promoter, or a tissue-specific promoter, to control the expression of the CAR gene. In some embodiments, the exogenous promoter is the EF1α promoter (see, for example, SEQ ID NO: 167 provided in Table 28 below). Other promoters may be used.

[0197] Furthermore, the exogenous sequence may also include transcriptional or translational regulatory sequences, such as promoters, enhancers, insulators, intrasequence ribosome entry sites, sequences encoding 2A peptides, and / or polyadenylation signals.

[0198] If necessary, additional gene editing (e.g., gene knock-in or knock-out) may be introduced into the therapeutic T cells disclosed herein to improve T cell function and therapeutic efficacy. For example, disruption of β2M may be performed to reduce or prevent the risk of host-versus-graft reaction. Other examples include knock-in or knock-out genes to improve target cell lysis, and knock-in or knock-out genes to improve the performance of therapeutic T cells such as CAR-T cells.

[0199] In some embodiments, the donor template for delivering anti-CD19 CAR may be an AAV vector inserted with a nucleic acid fragment containing the coding sequence of the anti-CD19 CAR, and optionally, a regulatory sequence for the expression of the anti-CD19 CAR (e.g., a promoter such as the EF1a promoter shown in the sequence listing) that can be flanked by homology arms for inserting the coding sequence and regulatory sequence into the target genomic locus. In some examples, the nucleic acid fragment is inserted into the endogenous TRAC locus, thereby disrupting the expression of the TRAC gene. In certain examples, the nucleic acid may replace a fragment within the TRAC gene, for example, a fragment containing the nucleotide sequence of SEQ ID NO: 69. In some specific examples, the donor template for delivering anti-CD19 CAR may contain the nucleotide sequence of SEQ ID NO: 117, which may be inserted into the disrupted TRAC gene to replace, for example, the fragment of SEQ ID NO: 69.

[0200] In some embodiments, the donor template for delivering anti-BCMA CAR may be an AAV vector inserted with a nucleic acid fragment containing the coding sequence of the anti-BCMA CAR, and optionally, a regulatory sequence for the expression of the anti-BCMA CAR (e.g., a promoter such as the EF1a promoter shown in the sequence listing) that can be flanked by homology arms for inserting the coding sequence and regulatory sequence into the target genomic locus. In some examples, the nucleic acid fragment is inserted into the endogenous TRAC locus, thereby disrupting the expression of the TRAC gene. In certain examples, the nucleic acid may replace a fragment within the TRAC gene, for example, a fragment containing the nucleotide sequence of SEQ ID NO: 69. In some specific examples, the donor template for delivering anti-BCMA CAR may contain the nucleotide sequence of SEQ ID NO: 145, which may be inserted into the disrupted TRAC gene to replace, for example, the fragment of SEQ ID NO: 69.

[0201] In some embodiments, the donor template for delivering anti-CD70 CAR may be an AAV vector inserted with a nucleic acid fragment containing the coding sequence of anti-CD70 CAR, and optionally, a regulatory sequence for the expression of anti-CD70 CAR (e.g., a promoter such as the EF1a promoter shown in the sequence listing) that can be flanked by homology arms for inserting the coding sequence and regulatory sequence into the target genomic locus. In some examples, the nucleic acid fragment is inserted into the endogenous TRAC locus, thereby disrupting the expression of the TRAC gene. In certain examples, the nucleic acid may replace a fragment within the TRAC gene, for example, a fragment containing the nucleotide sequence of SEQ ID NO: 69. In some specific examples, the donor template for delivering anti-CD70 CAR may contain the nucleotide sequence of SEQ ID NO: 139, which may be inserted into the disrupted TRAC gene to replace, for example, the fragment of SEQ ID NO: 69.

[0202] Genetically engineered T cells having a disrupted Reg1 gene, additional disrupted genes such as β2M, TRAC, and CD70, and further expressing a chimeric antigen receptor (CAR), can be produced by sequential targeting of the target gene. For example, in some embodiments, the Reg1 gene may be disrupted first, followed by the disruption of the TRAC and β2M genes, and then the CAR may be inserted. In other embodiments, the TRAC and β2M genes may be disrupted first, followed by the insertion of the CAR, and then the Reg1 gene may be disrupted. Thus, in some embodiments, the genetically engineered T cells disclosed herein can be produced by a series of sequential electroporation events using multiple RNPs that target the target gene, such as Reg1, β2M, TRAC, and CD70.

[0203] In other embodiments, the genetically engineered CAR-T cells disclosed herein may be produced by a single electroporation event using an RNP complex containing an RNA-induced nuclease and multiple gRNAs that target a gene of interest, such as Reg1, β2M, TRAC, or CD70.

[0204] (c) Exemplary genetically engineered T cells expressing chimeric antigen receptors It will be understood that gene disruption encompasses gene modification via gene editing (e.g., using CRISPR / Cas gene editing to insert or delete one or more nucleotides). A disrupted gene may contain one or more mutations (e.g., insertions, deletions, or nucleotide substitutions) relative to its wild-type counterpart, such as substantially reducing or completely eliminating the activity of the encoded gene product. One or more mutations may be located in a non-coding region, e.g., a promoter region, a regulatory region controlling transcription or translation, or an intron region. Alternatively, one or more mutations may be located in a coding region (e.g., an exon). In some cases, a disrupted gene may not express the encoded protein, or may express the encoded protein at a substantially reduced level. In other cases, a disrupted gene may express the encoded protein in a mutated form, none of which may function, or their activity may be substantially reduced. In some embodiments, the disrupted gene is a gene that does not encode a functional protein. In some embodiments, cells containing the disrupted gene do not express the protein encoded by the gene at a detectable level (e.g., on the cell surface) (e.g., by antibody, e.g., by flow cytometry). Cells that do not express a detectable level of protein may be referred to as knockout cells. For example, if the β2M protein cannot be detected on the cell surface using an antibody that specifically binds to the β2M protein, cells with β2M gene editing may be considered β2M knockout cells.

[0205] In some embodiments, the genetically engineered T cell populations disclosed herein express CARs (e.g., anti-CD19, anti-BCMA, or anti-CD70 CARs), disrupted Reg1 genes, disrupted TGFBRII genes, disrupted TRAC genes, and optionally disrupted β2M genes and optionally disrupted CD70 genes. The nucleotide sequence encoding the CAR can be inserted into the disrupted TRAC gene (e.g., by substituting a site targeted by an sgRNA such as TA-1). In some examples, such genetically engineered T cell populations express approximately 70–99% Reg1 - Cells, for example, about 90-97% of Reg1 - Cells, approximately 70-99% TGFBRII - Cells, for example, about 80-89% TGFBRII - Cells, approximately 70-99% TCR - Cells, for example, about 90-99% of TCR - Cells, and / or optionally about 60-99% of β2M - Cells, for example, about 60-82% β2M - Cells, and / or selectively about 70-99% of CD70 - Cells, for example, about 90-99% CD70 - It may contain cells. The cell population may also contain at least about 30% to 50% (e.g., at least 60%) CAR-expressing cells.

[0206] i. Anti-CD19 CAR-T cells with Reg1 and / or TGFBRII gene disruption A population of genetically engineered immune cells (e.g., T cells such as human T cells) that contain a disrupted Reg1 gene, a disrupted TGFBRII gene, or a combination thereof and express an anti-CD19 CAR, such as those disclosed herein, is also provided herein. In some cases, a population of genetically engineered immune cells (e.g., T cells such as human T cells) that contain both a disrupted Reg1 gene and a disrupted TGFBRII gene and express an anti-CD19 CAR, such as those disclosed herein. In some examples, the anti-CD19 CAR-T cells disclosed herein that express any of the anti-CD19 CARs disclosed herein (e.g., an anti-CD19 CAR comprising the amino acid sequence of SEQ ID NO: 106) may also contain a disrupted TRAC gene and / or a disrupted β2M gene as also disclosed herein.

[0207] In some examples, the population of genetically engineered T cells is an anti-CD19 CAR cell that further contains a disrupted Regnanse-1 gene. In some examples, the anti-CD19 CAR cell is a CD19-directed T cell having a disrupted TRAC gene and a β2M gene. A nucleic acid encoding an anti-CD19 CAR can be inserted at the site of SEQ ID NO: 69 of the disrupted TRAC gene, and the expression of the TRAC gene is disrupted by the substitution of this site by the nucleic acid encoding the anti-CD19 CAR. The disrupted TRAC gene of the anti-CD19 CAR cell can contain the nucleotide sequence of SEQ ID NO: 119.

[0208] Anti-CD19 CAR-T cells containing a disrupted Reg1 gene can be produced by ex vivo gene modification using CRISPR / Cas9 (clustered and regularly arranged short palindromic sequence repeats / CRISPR-related protein 9) technology to disrupt target genes (Reg1, and optionally TRAC and / or β2M genes), and adeno-associated virus (AAV) transduction to deliver anti-CD19 CAR constructs. CRISPR-Cas9-mediated gene editing involves at least sgRNAs targeting Reg1 (e.g., REG1-Z03 (SEQ ID NO: 22), REG1-Z05 (SEQ ID NO: 30), REG1-Z06 (SEQ ID NO: 34), or REG1-Z10 (SEQ ID NO: 50)), and optionally TA-1 sgRNA (SEQ ID NO: 59) targeting the TRAC locus and β2M-1 sgRNA (SEQ ID NO: 63) targeting the β2M locus. With respect to any of the gRNA sequences provided herein, if a modification is not explicitly indicated, it means that both unmodified sequences and sequences with any suitable modifications are included.

[0209] Anti-CD19 CAR-T cells containing a disrupted TGFBRII gene can be produced by ex vivo gene modification using CRISPR / Cas9 (clustered and regularly arranged short palindromic sequence repeats / CRISPR-related protein 9) technology to disrupt target genes (TGFBRII, and optionally TRAC and / or β2M genes), and adeno-associated virus (AAV) transduction to deliver the anti-CD19 CAR construct. CRISPR-Cas9-mediated gene editing involves at least sgRNAs targeting TGFBRII (e.g., those listed in Table 39, e.g., TGFBRII_EX1_T2, TGFBRII_EX4_T1, TGFBRII_EX4_T2, TGFBRII_EX5_T1), and optionally TA-1 sgRNA (SEQ ID NO: 59) targeting the TRAC locus and β2M-1 sgRNA (SEQ ID NO: 63) targeting the β2M locus.

[0210] Anti-CD19 CAR-T cells containing both disrupted TGFBRII and disrupted Reg1 genes can be produced by ex vivo gene modification using CRISPR / Cas9 (clustered and regularly arranged short palindromic sequence repeats / CRISPR-related protein 9) technology to disrupt target genes (TGFBRII and Reg1, optionally TRAC and / or β2M genes), and adeno-associated virus (AAV) transduction to deliver anti-CD19 CAR constructs. CRISPR-Cas9-mediated gene editing involves at least sgRNAs targeting TGFBRII (e.g., listed in Table 39) and Reg1 (e.g., listed in Table 22), optionally TA-1 sgRNA targeting the TRAC locus (SEQ ID NO: 59), and β2M-1 sgRNA targeting the β2M locus (SEQ ID NO: 63).

[0211] Anti-CD19 CAR-T cells consist of an anti-CD19 single-chain antibody fragment (scFv, which may contain the amino acid sequence of SEQ ID NO: 120), followed by a CD8 hinge and transmembrane domain (e.g., containing the amino acid sequence of SEQ ID NO: 97) fused to the intracellular co-signaling domain of CD28 (e.g., SEQ ID NO: 101) and the CD3ζ signaling domain (e.g., SEQ ID NO: 103). In certain examples, anti-CD19 CAR-T cells contain the amino acid sequence of SEQ ID NO: 118.

[0212] In some embodiments, at least 30% of the population of anti-CD19 CAR-T cells express detectable levels of anti-CD19 CAR. For example, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of anti-CD19 CAR-T cells express detectable levels of anti-CD19 CAR.

[0213] In some embodiments, at least 50% of a population of anti-CD19 CAR-T cells may not express detectable levels of β2M surface protein. For example, at least 55%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of anti-CD19 CAR-T cells may not express detectable levels of β2M surface protein. In some embodiments, 50%-100%, 50%-90%, 50%-80%, 50%-70%, 50%-60%, 60%-100%, 60%-90%, 60%-80%, 60%-70%, 70%-100%, 70%-90%, 70%-80%, 80%-100%, 80%-90%, or 90%-100% of the manipulated T cells in the population do not express detectable levels of β2M surface protein.

[0214] Alternatively, at least 50% of the population of anti-CD19 CAR-T cells may not express detectable levels of TRAC surface protein. For example, at least 55%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of anti-CD19 CAR-T cells may not express detectable levels of TRAC surface protein. In some embodiments, 50%-100%, 50%-90%, 50%-80%, 50%-70%, 50%-60%, 60%-100%, 60%-90%, 60%-80%, 60%-70%, 70%-100%, 70%-90%, 70%-80%, 80%-100%, 80%-90%, or 90%-100% of the manipulated T cells in the population may not express detectable levels of TRAC surface protein. In certain cases, more than 90% (e.g., more than 99.5%) of anti-CD19 CAR-T cells do not express detectable TRAC surface proteins.

[0215] In some embodiments, a significant proportion of the population of anti-CD19 CAR-T cells may have undergone two or more gene edits, resulting in a certain proportion of cells that do not express two or more genes and / or proteins.

[0216] For example, at least 50% of a population of anti-CD19 CAR-T cells may not express two surface proteins at detectable levels, such as β2M and TRAC proteins. In some embodiments, 50%-100%, 50%-90%, 50%-80%, 50%-70%, 50%-60%, 60%-100%, 60%-90%, 60%-80%, 60%-70%, 70%-100%, 70%-90%, 70%-80%, 80%-100%, 80%-90%, or 90%-100% of anti-CD19 CAR-T cells may not express TRAC and β2M surface proteins at detectable levels. In another example, at least 50% of a population of anti-CD19 CAR-T cells may not express TRAC and β2M surface proteins at detectable levels.

[0217] In some embodiments, a population of anti-CD19 CAR-T cells may include two or more gene edits (e.g., within two or more genes) that may be edits described herein. For example, a population of anti-CD19 CAR-T cells may include a disrupted TRAC gene via CRISPR / Cas technology using TA-1 TRAC gRNA. In some examples, anti-CD19 CAR-T cells may include a deletion within the TRAC gene compared to unmodified T cells. For example, anti-CD19 CAR-T cells may include a deletion of the fragment AGAGCAACAGTGCTGTGGCC (SEQ ID NO: 69) within the TRAC gene. This fragment can be replaced with a nucleic acid encoding anti-CD19 CAR (e.g., SEQ ID NO: 117). Alternatively, a population of anti-CD19 CAR-T cells may include a disrupted β2M gene via CRISPR / Cas9 technology using β2M-1 gRNA. These anti-CD19 CAR-T cells may contain indels within the β2M gene that include one or more nucleotide sequences of sequence numbers 83-88. In certain cases, anti-CD19 CAR-T cells have ≥30% CAR + T cells, ≤50% β2M + Cells, and ≤30% TCRαβ +This includes cells. In further specific cases, anti-CD19 CAR-T cells have ≥30% CAR + T cells, ≤30% β2M + Cells, and ≤0.5% TCRαβ + Contains cells.

[0218] See also International Publication No. 2019 / 097305A2 and International Publication No. 2019215500, which incorporate by reference the respective relevant disclosures relating to the subject matter and objectives mentioned herein.

[0219] In certain cases, the genetically engineered T cell population may be anti-CD19 CAR-T cells disclosed herein, further comprising disrupted Reg1 genes. The disrupted Reg1 genes may comprise any of the sequences listed in Tables 29–38 below. In some cases, anti-CD19 CAR-T cells have at least 80% Reg1 - Cells, for example, at least 85%, at least 90%, at least 95%, at least 98%, or more than Reg1 - It may contain cells.

[0220] In certain cases, the genetically engineered T cell population may be anti-CD19 CAR-T cells disclosed herein, further containing disrupted TGFBRII genes. In some cases, the disrupted TGFBRII genes may contain nucleotide sequences selected from those listed in Tables 40-48 below. In some cases, anti-CD19 CAR-T cells contain at least 80% TGFBRII - Cells, for example, at least 85%, at least 90%, at least 95%, at least 98%, or more than TGFBRII - It may contain cells.

[0221] In certain cases, the genetically engineered T cell population may be anti-CD19 CAR-T cells disclosed herein, further comprising disrupted TGFBRII genes and disrupted Reg1 genes. The disrupted Reg1 gene may contain any of the sequences listed in Tables 29-38 below. Alternatively, the disrupted TGFBRII gene may further contain a nucleotide sequence selected from those listed in Tables 40-48 below. In some cases, anti-CD19 CAR-T cells have at least 80% TGFBRII - Cells, for example, at least 85%, at least 90%, at least 95%, at least 98%, or more than TGFBRII - It may contain cells. Or, furthermore, anti-CD19 CAR-T cells may contain at least 80% Reg1 - Cells, for example, at least 85%, at least 90%, at least 95%, at least 98%, or more Reg - It may contain cells. In some cases, anti-CD19 CAR-T cells have at least 60% Reg1 - / TGFBRII - Cells, for example, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or more than Reg1 - / TGFBRII - It may contain cells.

[0222] In some cases, these genetically modified T cell populations consist of approximately 90-97% Reg1 - Cells, approximately 80-89% TGFBRII - Cells, approximately 90-99% TCR - Cells, and / or about 60-82% β2M - The population of cells may also contain at least 50% (e.g., at least 60%) anti-CD19 CAR-expressing cells.

[0223] ii Anti-BCMA CAR-T cells with Reg1 and / or TGFBRII gene disruption A population of genetically modified immune cells (e.g., T cells such as human T cells) expressing anti-BCMA CARs, such as those disclosed herein, and containing a disrupted Reg1 gene, is also provided herein. In some examples, anti-BCMA CAR-T cells disclosed herein, expressing any of the anti-BCMA CARs disclosed herein (e.g., an anti-BCMA CAR containing the amino acid sequence of SEQ ID NO: 146), may also include a disrupted TRAC gene and / or a disrupted β2M gene, as disclosed herein.

[0224] In some examples, the genetically engineered T cell population is anti-BCMA CAR-T cells further comprising a disrupted Reg1 gene, a disrupted TGFBRII gene, or a combination thereof. In some cases, the population is a genetically engineered immune cell population (e.g., T cells such as human T cells) that expresses anti-BCMA CAR, such as those disclosed herein, and includes both a disrupted Reg1 gene and a disrupted TGFBRII gene. In some examples, anti-BCMA CAR-T cells are anti-BCMA CAR-T cells having a disrupted TRAC gene and a disrupted β2M gene. The nucleic acid encoding anti-BCMA CAR can be inserted into the site of SEQ ID NO: 69 of the disrupted TRAC gene, and the expression of the TRAC gene is disrupted by the substitution of this site with the nucleic acid encoding anti-BCMA CAR. The disrupted TRAC gene of anti-BCMA CAR-T cells may contain the nucleotide sequence of SEQ ID NO: 145.

[0225] Anti-BCMA CAR-T cells containing a disrupted Reg1 gene can be produced by ex vivo gene modification using CRISPR / Cas9 (clustered, regularly arranged short palindromic sequence repeats / CRISPR-related protein 9) technology to disrupt target genes (Reg1, and optionally TRAC and β2M genes), and adeno-associated virus (AAV) transduction to deliver the anti-BCMA CAR construct. CRISPR-Cas9-mediated gene editing is accompanied by at least three guide RNAs (sgRNAs), as described above for anti-CD19 CAR-T cells.

[0226] Anti-BCMA CAR-T cells containing the disrupted TGFBRII gene can be produced by ex vivo gene modification using CRISPR / Cas9 (clustered, regularly arranged short palindromic sequence repeats / CRISPR-related protein 9) technology to disrupt target genes (TGFBRII, and optionally TRAC and β2M genes), and adeno-associated virus (AAV) transduction to deliver the anti-BCMA CAR construct. CRISPR-Cas9-mediated gene editing is accompanied by at least three guide RNAs (sgRNAs), as described above for anti-BCMA CAR-T cells.

[0227] Anti-BCMA CAR-T cells containing disrupted Reg1 and TGFBRII genes can be produced by ex vivo gene modification using CRISPR / Cas9 (clustered, regularly arranged short palindromic sequence repeats / CRISPR-related protein 9) technology to disrupt target genes (TGFBRII and Reg1, and optionally TRAC and β2M genes), and adeno-associated virus (AAV) transduction to deliver anti-BCMA CAR constructs. CRISPR-Cas9-mediated gene editing is accompanied by at least three guide RNAs (sgRNAs), as described above for anti-BCMA CAR-T cells.

[0228] Anti-BCMA CAR-T cells consist of an anti-BCMA single-chain antibody fragment (scFv, which may contain the amino acid sequence of SEQ ID NO: 148), followed by a CD8 hinge and transmembrane domain (e.g., containing the amino acid sequence of SEQ ID NO: 97) fused to the intracellular co-signaling domain of CD28 (e.g., SEQ ID NO: 101) and the CD3ζ signaling domain (e.g., SEQ ID NO: 103). In certain examples, anti-BCMA CAR-T cells contain the amino acid sequence of SEQ ID NO: 146.

[0229] In some embodiments, at least 30% of the population of anti-BCMA CAR-T cells express detectable levels of anti-BCMA CAR. For example, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of anti-BCMA CAR-T cells express detectable levels of anti-BCMA CAR.

[0230] In some embodiments, at least 50% of a population of anti-BCMA CAR-T cells may not express detectable levels of β2M surface protein. For example, at least 55%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of anti-BCMA CAR-T cells may not express detectable levels of β2M surface protein. In some embodiments, 50%-100%, 50%-90%, 50%-80%, 50%-70%, 50%-60%, 60%-100%, 60%-90%, 60%-80%, 60%-70%, 70%-100%, 70%-90%, 70%-80%, 80%-100%, 80%-90%, or 90%-100% of engineered T cells in a population may not express detectable levels of β2M surface protein.

[0231] Alternatively, at least 50% of the population of anti-BCMA CAR-T cells may not express detectable levels of TRAC surface protein. For example, at least 55%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of anti-BCMA CAR-T cells may not express detectable levels of TRAC surface protein. In some embodiments, 50%–100%, 50%–90%, 50%–80%, 50%–70%, 50%–60%, 60%–100%, 60%–90%, 60%–80%, 60%–70%, 70%–100%, 70%–90%, 70%–80%, 80%–100%, 80%–90%, or 90%–100% of the manipulated T cells in the population may not express detectable levels of TRAC surface protein. In certain cases, more than 90% (e.g., more than 99.5%) of anti-BCMA CAR-T cells do not express detectable TRAC surface proteins.

[0232] In some embodiments, a significant proportion of the population of anti-BCMA CAR-T cells may contain two or more gene edits, resulting in a certain proportion of cells that do not express two or more genes and / or proteins.

[0233] For example, at least 50% of a population of anti-BCMA CAR-T cells may not express two surface proteins at detectable levels, such as β2M and TRAC proteins. In some embodiments, 50%-100%, 50%-90%, 50%-80%, 50%-70%, 50%-60%, 60%-100%, 60%-90%, 60%-80%, 60%-70%, 70%-100%, 70%-90%, 70%-80%, 80%-100%, 80%-90%, or 90%-100% of anti-BCMA CAR-T cells may not express TRAC and β2M surface proteins at detectable levels. In another example, at least 50% of a population of anti-BCMA CAR-T cells may not express TRAC and β2M surface proteins at detectable levels.

[0234] In some embodiments, the population of anti-BCMA CAR-T cells can include two or more gene edits (e.g., within two or more genes) that can be the edits described herein. For example, the population of anti-BCMA CAR-T cells can include a disrupted TRAC gene via CRISPR / Cas technology using TA-1 TRAC gRNA. In some examples, the anti-BCMA CAR-T cells can include a deletion within the TRAC gene as compared to unmodified T cells. For example, the anti-CD19 CAR-T cells can include a deletion of the fragment AGAGCAACAGTGCTGTGGCC (SEQ ID NO: 69) within the TRAC gene. This fragment can be replaced by a nucleic acid encoding an anti-BCMA CAR (e.g., SEQ ID NO: 145). Alternatively or additionally, the population of anti-BCMA CAR-T cells can include a disrupted β2M gene via CRISPR / Cas9 technology using β2M-1 gRNA. Such anti-BCMA CAR-T cells can include an indel comprising one or more of the nucleotide sequences of SEQ ID NOs: 83-88 within the β2M gene. In certain examples, the anti-BCMA CAR-T cells include ≧30% CAR + T cells, ≦50% β2M + cells, and ≦30% TCRαβ + cells. In a further specific example, the anti-BCMA CAR-T cells include ≧30% CAR + T cells, ≦30% β2M + cells, and ≦0.5% TCRαβ + cells.

[0235] See also International Publication No. WO 2019 / 097305 A2 and International Publication No. WO 2019 / 215,500, each of which is incorporated by reference herein for its relevant disclosure with respect to each of the subject matter and objectives referred to herein.

[0236] In certain examples, the population of genetically engineered T cells can be the anti-BCMA CAR-T cells disclosed herein that further contain a disrupted Reg1 gene. The disrupted Regnase 1 (Reg1) gene can contain any of the sequences described in Tables 29-38 below. In some examples, the anti-BCMA CAR-T cells are at least 80% Reg1 - cells, e.g., at least 85%, at least 90%, at least 95%, at least 98%, or more than 98% Reg1 - cells.

[0237] In certain examples, the population of genetically engineered T cells can be the anti-BCMA CAR-T cells disclosed herein that further contain a disrupted TGFBRII gene. In some examples, the disrupted TGFBRII gene can contain a nucleotide sequence selected from those listed in Tables 40-48 below. In some examples, the anti-BCMA CAR-T cells are at least 80% TGFBRII - cells, e.g., at least 85%, at least 90%, at least 95%, at least 98%, or more than 98% TGFBRII - cells.

[0238] In certain examples, the population of genetically engineered T cells can be the anti-BCMA CAR-T cells disclosed herein that further contain a disrupted TGFBRII gene and a disrupted Reg1 gene. The disrupted Reg1 gene can contain any of the sequences described in Tables 29-38 below. Alternatively or further, the disrupted TGFBRII gene can contain a nucleotide sequence selected from those listed in Tables 40-48 below. In some examples, the anti-BCMA CAR-T cells are at least 80% TGFBRII - cells, e.g., at least 85%, at least 90%, at least 95%, at least 98%, or more than 98% TGFBRII - cells. Alternatively or further, the anti-BCMA CAR-T cells are at least 80% Reg1 -Cells, for example, at least 85%, at least 90%, at least 95%, at least 98%, or more Reg - It may contain cells. In some cases, anti-BCMA CAR-T cells have at least 60% Reg1 - / TGFBRII - Cells, for example, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or more than Reg1 - / TGFBRII - It may contain cells.

[0239] iii. Anti-CD70 CAR-T cells with Reg1 and / or TGFBRII gene disruption A population of genetically modified immune cells (e.g., T cells such as human T cells) expressing an anti-CD70 CAR, such as those disclosed herein, comprising a disrupted Reg1 gene, a disrupted TRFBRII gene, or a combination thereof. In some cases, a population of genetically modified immune cells (e.g., T cells such as human T cells) expressing an anti-CD70 CAR, such as those disclosed herein, comprising both a disrupted Reg1 gene and a disrupted TGFBRII gene. In some examples, the anti-CD70 CAR-T cells disclosed herein, expressing any of the anti-CD70 CARs disclosed herein (e.g., an anti-CD70 CAR containing the amino acid sequence of SEQ ID NO: 138), may also include a disrupted TRAC gene, a disrupted β2M gene, and / or a disrupted CD70 gene, as also disclosed herein.

[0240] In some cases, anti-CD70 CAR-T cells are those that have a disrupted TRAC gene, a disrupted β2M gene, and a disrupted CD70 gene. The nucleic acid encoding anti-CD70 CAR can be inserted into the site of sequence number 69 of the disrupted TRAC gene, and this substitution by the anti-CD70 CAR-encoding nucleic acid disrupts TRAC gene expression. The disrupted TRAC gene in anti-CD70 CAR-T cells may contain the nucleotide sequence of sequence number 139.

[0241] Anti-CD70 CAR-T cells containing a disrupted Reg1 gene can be produced by ex vivo gene modification using CRISPR / Cas9 (clustered and regularly arranged short palindromic sequence repeats / CRISPR-related protein 9) technology to disrupt target genes (Reg1, and optionally TRAC, β2M, and / or CD70 genes), and adeno-associated virus (AAV) transduction to deliver the anti-CD70 CAR construct. CRISPR-Cas9-mediated gene editing involves at least an sgRNA targeting the Reg1 gene (see, for example, Table 22), such as those disclosed herein, and optionally an sgRNA targeting the CD70 locus (SEQ ID NO: 55), a TA-1 sgRNA targeting the TRAC locus (SEQ ID NO: 59), and a β2M-1 sgRNA targeting the β2M locus (SEQ ID NO: 63).

[0242] Anti-CD70 CAR-T cells containing a disrupted TGFBRII gene can be produced by ex vivo gene modification using CRISPR / Cas9 (clustered and regularly arranged short palindromic sequence repeats / CRISPR-related protein 9) technology to disrupt target genes (TGFBRII, and optionally TRAC, β2M, and / or CD70 genes), and adeno-associated virus (AAV) transduction to deliver the anti-CD70 CAR construct. CRISPR-Cas9-mediated gene editing involves at least an sgRNA targeting the TGFBRII gene (see, for example, Table 39), such as those disclosed herein, and optionally an sgRNA targeting the CD70 locus (SEQ ID NO: 43), a TA-1 sgRNA targeting the TRAC locus (SEQ ID NO: 59), and a β2M-1 sgRNA targeting the β2M locus (SEQ ID NO: 63).

[0243] Anti-CD70 CAR-T cells containing disrupted TGFBRII and Reg1 genes can be produced by ex vivo gene modification using CRISPR / Cas9 (clustered and regularly arranged short palindromic sequence repeats / CRISPR-related protein 9) technology to disrupt target genes (TGFBRII and Reg1, and optionally TRAC, β2M, and / or CD70 genes), and adeno-associated virus (AAV) transduction to deliver anti-CD70 CAR constructs. CRISPR-Cas9-mediated gene editing involves at least an sgRNA that targets the TGFBRII gene (see, for example, Table 39), such as those disclosed herein, an sgRNA that targets the Reg1 gene (see, for example, Table 22), such as those disclosed herein, and optionally an sgRNA that targets the CD70 locus (SEQ ID NO: 55), a TA-1 sgRNA that targets the TRAC locus (SEQ ID NO: 59), and a β2M-1 sgRNA that targets the β2M locus (SEQ ID NO: 63).

[0244] Anti-CD70 CAR-T cells consist of an anti-CD70 CAR single-chain antibody fragment (scFv, which may contain the amino acid sequence of SEQ ID NO: 138), followed by a CD8 hinge and transmembrane domain (e.g., containing the amino acid sequence of SEQ ID NO: 97) fused to the intracellular co-signaling domain of CD28 (e.g., SEQ ID NO: 101) and the CD3ζ signaling domain (e.g., SEQ ID NO: 103). In certain examples, anti-CD70 CAR-T cells contain the amino acid sequence of SEQ ID NO: 138.

[0245] In some embodiments, at least 30% of the population of anti-CD70 CAR-T cells express detectable levels of anti-CD70 CAR. For example, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of anti-CD70 CAR-T cells express detectable levels of anti-CD70 CAR.

[0246] In some embodiments, at least 50% of a population of anti-CD70 CAR-T cells may not express detectable levels of β2M surface protein. For example, at least 55%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of anti-CD70 CAR-T cells may not express detectable levels of β2M surface protein. In some embodiments, 50%-100%, 50%-90%, 50%-80%, 50%-70%, 50%-60%, 60%-100%, 60%-90%, 60%-80%, 60%-70%, 70%-100%, 70%-90%, 70%-80%, 80%-100%, 80%-90%, or 90%-100% of the manipulated T cells in the population do not express detectable levels of β2M surface protein.

[0247] Alternatively, at least 50% of the population of anti-CD70 CAR-T cells may not express detectable levels of TRAC surface protein. For example, at least 55%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of anti-CD70 CAR-T cells may not express detectable levels of TRAC surface protein. In some embodiments, 50%-100%, 50%-90%, 50%-80%, 50%-70%, 50%-60%, 60%-100%, 60%-90%, 60%-80%, 60%-70%, 70%-100%, 70%-90%, 70%-80%, 80%-100%, 80%-90%, or 90%-100% of the manipulated T cells in the population may not express detectable levels of TRAC surface protein. In certain cases, more than 90% (e.g., more than 99.5%) of anti-CD70 CAR-T cells do not express detectable TRAC surface proteins.

[0248] In some embodiments, at least 50% of a population of anti-CD70 CAR-T cells may not express detectable levels of CD70 surface protein. For example, at least 55%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% of the engineered T cells in the population may not express detectable levels of CD70 surface protein. In some embodiments, 50%–100%, 50%–90%, 50%–80%, 50%–70%, 50%–60%, 60%–100%, 60%–90%, 60%–80%, 60%–70%, 70%–100%, 70%–90%, 70%–80%, 80%–100%, 80%–90%, 90%–100%, or 95%–100% of the manipulated T cells in the population do not express detectable levels of CD70 surface protein.

[0249] In some embodiments, a significant proportion of the population of anti-CD70 CAR-T cells may contain two or more gene edits, resulting in a certain proportion of cells that do not express two or more genes and / or proteins.

[0250] For example, at least 50% of a population of anti-CD70 CAR-T cells may not express two surface proteins at detectable levels, such as β2M and TRAC proteins, β2M and CD70 proteins, or TRAC and CD70 proteins. In some embodiments, 50%-100%, 50%-90%, 50%-80%, 50%-70%, 50%-60%, 60%-100%, 60%-90%, 60%-80%, 60%-70%, 70%-100%, 70%-90%, 70%-80%, 80%-100%, 80%-90%, or 90%-100% of the manipulated T cells in the population may not express two surface proteins at detectable levels. In another example, at least 50% of a population of CTX130 cells may not express all three target surface proteins β2M, TRAC, and CD70 at detectable levels. In some embodiments, 50%–100%, 50%–90%, 50%–80%, 50%–70%, 50%–60%, 60%–100%, 60%–90%, 60%–80%, 60%–70%, 70%–100%, 70%–90%, 70%–80%, 80%–100%, 80%–90%, or 90%–100% of engineered T cells in a population may not express β2M, TRAC, and CD70 surface proteins at detectable levels.

[0251] In some embodiments, a population of anti-CD70 CAR-T cells may include two or more gene edits (e.g., within two or more genes) that may be edits described herein. For example, a population of anti-CD70 CAR-T cells may include a disrupted TRAC gene via CRISPR / Cas technology using TA-1 TRAC gRNA. In some examples, anti-CD70 CAR-T cells may include a deletion within the TRAC gene compared to unmodified T cells. For example, anti-CD70 CAR-T cells may include a deletion of the fragment AGAGCAACAGTGCTGTGGCC (SEQ ID NO: 69) within the TRAC gene. This fragment can be replaced with a nucleic acid encoding anti-CD70 CAR (e.g., SEQ ID NO: 139). Alternatively, a population of anti-CD70 CAR-T cells may include a disrupted β2M gene via CRISPR / Cas9 technology using β2M-1 gRNA. These anti-CD70 CAR-T cells may contain indels within the β2M gene that include one or more nucleotide sequences of sequence numbers 83-88. In certain cases, anti-CD70 CAR-T cells have ≥30% CAR + T cells, ≤50% β2M + Cells, and ≤30% TCRαβ + Includes cells. In further specific cases, anti-CD70 CAR-T cells have ≥30% CAR + T cells, ≤30% β2M + Cells, and ≤0.5% TCRαβ + Contains cells.

[0252] See also International Publication No. 2019 / 097305A2 and International Publication No. 2019215500, which incorporate by reference the respective relevant disclosures relating to the subject matter and objectives mentioned herein.

[0253] In certain cases, the genetically engineered T cell population may be anti-CD70 CAR-T cells disclosed herein, further comprising a disrupted Regnase 1 gene. The disrupted Regnase 1 gene may contain any of the sequences listed in Tables 22-31 below. Such genetically engineered T cells have ≥30% CAR+ T cells, ≤0.4% TCR + T cells, ≤30% β2M + T cells and ≤2% CD70 + They may possess T cells. In some cases, anti-CD70 CAR-T cells have at least 80% Reg1 - Cells, for example, at least 85%, at least 90%, at least 95%, at least 98%, or more than Reg1 - It may contain cells.

[0254] In certain cases, the genetically engineered T cell population may be anti-CD70 CAR-T cells disclosed herein, further containing a disrupted TGFBRII gene. Such genetically engineered T cells have ≥30% CAR + T cells, ≤0.4% TCR + T cells, ≤30% β2M + T cells and ≤2% CD70 + They may possess T cells. In some cases, anti-CD70 CAR-T cells have at least 80% TGFBRII - Cells, for example, at least 85%, at least 90%, at least 95%, at least 98%, or more than TGFBRII - It may contain cells.

[0255] In certain cases, the genetically engineered T cell population may be anti-CD70 CAR-T cells disclosed herein, further comprising disrupted TGFBRII and disrupted Reg1 genes. The disrupted Regnase 1 gene may contain any of the sequences listed in Tables 29-38 below. Alternatively, the disrupted TGFBRII gene may further contain a nucleotide sequence selected from those listed in Tables 40-48 below. Such genetically engineered T cells have ≥30% CAR + T cells, ≤0.4% TCR + T cells, ≤30% β2M + T cells and ≤2% CD70 + They may possess T cells. In some cases, anti-CD70 CAR-T cells have at least 80% TGFBRII- Cells, for example, at least 85%, at least 90%, at least 95%, at least 98%, or more than TGFBRII - It may contain cells. In some cases, anti-CD70 CAR-T cells have at least 60% Reg1 - / TGFBRII - Cells, for example, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or more than Reg1 - / TGFBRII - It may contain cells.

[0256] III. Therapeutic Indications Therapeutic T cells generated using the genetically modified T cells disclosed herein are expected to maintain T cell integrity, which can be achieved by disrupting the Reg1 gene, the TGFBRII gene, the CD70 gene, or a combination thereof. For example, maintaining T cell integrity can extend the expansion during production, thereby improving yield and consistency. In another example, maintaining T cell integrity can rescue exhausted / unhealthy T cells, thereby enabling potentially lower doses and more robust responses in patients. Furthermore, disruption of the Reg1 and TGFBRII genes showed synergistic effects in improving the potency and in vivo expansion of CAR-T cells.

[0257] The therapeutic T cells disclosed herein may be administered to subjects for therapeutic purposes, for example, for the treatment of solid tumors targeted by CAR constructs expressed by therapeutic T cells.

[0258] The administration step may include the placement (e.g., transplantation) of therapeutic T cells to a subject by a method or route that results in at least partial localization of therapeutic T cells to a desired site, such as a tumor site, so that the desired effect can be achieved. The therapeutic T cells may be administered by any suitable route that results in delivery to a desired location in the subject where the transplanted cells or at least a portion of the components of these cells remain viable. The survival period of cells after administration to a subject may range from a short period of a few hours (e.g., 24 hours) to several days, several years, or even the lifespan of the subject (i.e., long-term engraftment). For example, in some embodiments described herein, an effective amount of therapeutic T cells may be administered via a systemic route of administration, such as an intraperitoneal or intravenous route.

[0259] In some embodiments, therapeutic T cells are administered systemically, which refers to the administration of a population of cells that enter the target circulatory system and are thereby subjected to metabolism and other similar processes, rather than directly to a target site, tissue, or organ. Preferred modes of administration include injection, infusion, infusion, or oral ingestion. Injections include, but are not limited to, intravenous, intramuscular, intra-arterial, intrathecal, intraventricular, intra-articular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subepidermal, intra-articular, subcapsular, subarachnoid, intraspinal, intracerebrospinal, and intrasternal injections and infusions. In some embodiments, the route is intravenous.

[0260] The subject may be any subject for which diagnosis, treatment, or therapy is desired. In some embodiments, the subject is a mammal. In some embodiments, the subject is a human.

[0261] In some cases, therapeutic T cells may be of self-derived ("self") to the target, meaning the cells originate from the same target. Alternatively, therapeutic T cells may be of non-self-derived ("non-self," e.g., allogeneic, syngeneic, or heterogeneous) to the target. "Allogeneic" means that the therapeutic T cells are induced not from the target being treated, but from another individual of the same species as the target (a donor). The donor is an individual that is not the target being treated. The donor is an individual that is not the patient. In some embodiments, the donor is an individual that does not have or is not suspected of having the cancer being treated. In some embodiments, multiple donors (e.g., two or more donors) are used.

[0262] In some embodiments, the engineered T cell population administered according to the methods described herein includes allogeneic T cells obtained from one or more donors. Allogeneic means cells, cell populations, or a biological sample containing cells obtained from one or more different donors of the same species whose genes at one or more loci are not identical to those of the recipient (e.g., subject). For example, the engineered T cell population administered to a subject may be derived from one or more unrelated donors or one or more non-identical siblings. In some embodiments, a geneagenetic cell population, such as one obtained from a genetically identical donor (e.g., identical twins), may be used. In some embodiments, the cells are autologous cells, i.e., the engineered T cells are obtained from or isolated from the subject and administered to the same subject, i.e., the donor and recipient are identical.

[0263] An effective dose refers to the amount of manipulated T cells necessary to prevent or alleviate at least one sign or symptom of a medical condition (e.g., cancer), and relates to a composition sufficient to produce the desired effect (e.g., to treat a subject with a medical condition). An effective dose may also be sufficient to prevent or delay the onset of disease symptoms, alter the course of disease symptoms (e.g., slow the progression of disease symptoms), or reverse disease symptoms. It is understood that, in any given case, a suitable effective dose can be determined by those skilled in the art using ordinary experiments.

[0264] For the improved persistence and efficacy of the therapeutic T cells disclosed herein, the doses of therapeutic T cells provided herein are lower than the standard doses of CAR-T cells prepared by conventional approaches (e.g., using T cells that do not have one or more of the gene editing events disclosed herein, including disrupted Reg1 genes and / or disrupted CD70 genes). In some cases, the effective dose of therapeutic T cells disclosed herein can be at least 2 times lower, at least 5 times lower, at least 10 times lower, at least 20 times lower, at least 50 times lower, or at least 100 times lower than the standard dose of CAR-T therapy. In some cases, the effective dose of therapeutic T cells disclosed herein is 10 6 Less than a cell, for example, 10 5 cells, 5 x 10 4 cells, 10 4 cells, 5 x 10 3 Cells or 10 3 They may be smaller than cells. In some examples described herein, cells are expanded in a culture medium before being administered to the target that requires them.

[0265] The effectiveness of treatments using therapeutic T cells disclosed herein may be determined by an experienced clinician. A treatment is considered “effective” if, in some cases, the level of any one or all signs or symptoms is altered in a favorable manner (e.g., increased by at least 10%), or if other clinically recognized symptoms or markers of the disease (e.g., cancer) are improved or alleviated. Effectiveness may also be measured by whether the subject does not worsen (e.g., the progression of the disease is stopped or at least slowed), assessed by the need for hospitalization or medical intervention. Methods for measuring these indicators are known to those skilled in the art and / or are described herein. Treatments include any treatment of the disease in a subject and include (1) inhibiting the disease, e.g., stopping or slowing the progression of symptoms, or (2) mitigating the disease, e.g., causing a regression of symptoms, and (3) preventing or reducing the likelihood of the onset of symptoms.

[0266] Combination therapies are also included in this disclosure. For example, the therapeutic T cells disclosed herein may be used in combination with other therapeutic agents to treat the same indication or to improve the efficacy of the therapeutic T cells and / or to reduce the side effects of the therapeutic T cells.

[0267] IV. Kit This disclosure also provides genetically modified T cells, their use in generating therapeutic T cells, and kits for therapeutic use.

[0268] In some embodiments, the kits provided herein may include components for performing gene editing on one or more of the Reg1 gene, the TGFBRII gene, and the CD70 gene, as well as a population of immune cells (e.g., LeucoPak) on which gene editing is optionally performed. The LeucoPak sample may be a concentrated leukocyte export product recovered from peripheral blood. This typically contains a variety of blood cells, including monocytes, lymphocytes, platelets, plasma, and erythrocytes. The components for gene editing on one or more target genes may include a suitable endonuclease, such as an RNA-induced endonuclease, and one or more nucleic acid guides that induce cleavage of one or more suitable genomic sites by the endonuclease. For example, the kit may include a Cas enzyme such as Cas9, as well as one or more gRNAs that target the Reg1 gene, the TGFBRII gene, and / or the CD70 gene. Any of these target gene-specific gRNAs may be included in the kit. These kits may further include components for further gene editing, such as gRNA and additional endonucleases for selectively editing other target genes, such as β2M and / or TRAC.

[0269] In some embodiments, the kits provided herein may comprise a population of genetically engineered T cells as disclosed herein, and one or more components for generating therapeutic T cells as also disclosed herein. Such components may comprise endonucleases suitable for gene editing and nucleic acid encoding for the CAR construct of interest. The nucleic acid encoding the CAR may be part of a donor template as disclosed herein, which may contain homology arms adjacent to the CAR coding sequence. In some cases, the donor template may be carried by a viral vector, such as an AAV vector.

[0270] The kit may further include a TRAC gene-specific gRNA for inserting a CAR coding sequence into the TRAC gene. In other examples, the kit may further include a β2M gene-specific gRNA for inserting a CAR coding sequence into the β2M gene. In other examples, the kit may further include a CD70 gene-specific gRNA for inserting a CAR coding sequence into the CD70 gene. In yet other examples, the kit may further include a Reg1 gene-specific gRNA for inserting a CAR coding sequence into the Reg1 gene. In yet other examples, the kit may further include a TGFBRII gene-specific gRNA for inserting a CAR coding sequence into the TGFBRII gene.

[0271] In further embodiments, the kits disclosed herein may include a population of disclosed therapeutic T cells for an intended therapeutic purpose.

[0272] Any of the kits disclosed herein may further include instructions for the production of therapeutic T cells or for the therapeutic indication of therapeutic T cells. In some examples, the included instructions may include a description of the use of gene editing components to genetically modify one or more target genes (e.g., Reg1, TGFBRII, CD70, or a combination thereof). In other examples, the included instructions may include a description of a method for introducing nucleic acids encoding CAR constructs into T cells in order to produce therapeutic T cells.

[0273] Alternatively, the kit may further include instructions for administering the therapeutic T cells disclosed herein to achieve the desired activity, for example, the elimination of disease cells targeted by CARs expressed on therapeutic T cells. The kit may further include instructions for selecting a suitable subject for treatment based on whether the subject requires treatment. Instructions for using the therapeutic T cells described herein generally include information regarding the dosage, administration schedule, and route of administration for the treatment of interest. Containers may be unit volume, bulk packages (e.g., multi-dose packages) or sub-unit doses. Instructions supplied within the kits of this disclosure are typically written instructions on a label or accompanying document. The label or accompanying document indicates that the therapeutic T cells are used to treat, delay, and / or alleviate disease or impairment in a subject.

[0274] The kits provided herein are contained in suitable packaging. Suitable packaging includes, but is not limited to, vials, bottles, jars, and flexible packaging. Packaging for use in combination with specific devices, such as infusion devices for administering therapeutic T cells, may also be considered. The kits may have a sterile access port (for example, the container may be an intravenous solution bag or vial with a stopper that can be punctured by a subcutaneous needle). The container may also have a sterile access port.

[0275] The kit may optionally provide additional components such as cushioning material and explanatory information. Typically, the kit includes a container and a label or accompanying document on or attached to the container. In some embodiments, the disclosure provides a manufactured article containing the contents of the kit described above.

[0276] general technology Unless otherwise noted, the implementation of this disclosure will utilize prior art in molecular biology (including recombinant technologies), microbiology, cell biology, biochemistry, and immunology, which are within the scope of the art in this field. Such techniques are described in detail in the following literature: Molecular Cloning: A Laboratory Manual, second edition (Sambrook, et al., 1989) Cold Spring Harbor Press; Oligonucleotide Synthesis (MJ Gait, ed. 1984); Methods in Molecular Biology, Humana Press; Cell Biology: A Laboratory Notebook (JECellis, ed., 1989) Academic Press; Animal Cell Culture (RIFreshney, ed. 1987); Introduction to Cell and Tissue Culture (JP Mather and PER Oberts, 1998) Plenum Press; Cell and Tissue Culture: Laboratory Procedures (A. Doyle, JB Griffiths, and DG Newell, eds. 1993-8) J. Wiley and Sons; Methods in Enzymology (Academic Press, Inc.); Handbook of Experimental Immunology (DM Weir and CCBlackwell, eds.): Gene Transfer Vectors for Mammalian Cells (JMMiller and MP Calos, eds., 1987); Current Protocols in Molecular Biology (FMAusubel, et al. eds. 1987); PCR: The Polymerase Chain Reaction, (Mullis, et al., eds. 1994); Current Protocols in Immunology (JEColigan et al., eds., 1991); Short Protocols in Molecular Biology (Wiley and Sons, 1999); Immunobiology (C.A. Janeway and P. Travers, 1997); Antibodies (P. Finch, 1997); Antibodies: a practice approach (D. Catty., ed., IRL Press, 1988 - 1989); Monoclonal antibodies: a practical approach (P. Shepherd and C. Dean, eds., Oxford University Press, 2000); Using antibodies: a laboratory manual (E. Harlow and D. Lane (Cold Spring Harbor Laboratory Press, 1999); The Antibodies (M. Zanetti and J.D. Capra, eds. Harwood Academic Publishers, 1995); DNA Cloning: A practical Approach, Volumes I and II (D.N. Glover ed. 1985); Nucleic Acid Hybridization (B.D. Hames & S.J. Higgins eds. (1985>>; Transcription and Translation (B.D. Hames & S.J. Higgins, eds. (1984>>; Animal Cell Culture (R.I. Freshney, ed. (1986>>; Immobilized Cells and Enzymes (lRL Press, (1986>>; and B. Perbal, A practical Guide To Molecular Cloning (1984); F.M. Ausubel et al. (eds.).

[0277] Those skilled in the art will likely be able to make the most of the present invention based on the above description without further detail. Accordingly, the following specific embodiments should be construed as merely illustrative and in no way limit the following disclosure. All publications referenced herein are incorporated by reference for the purposes or subject matter referred to herein. [Examples]

[0278] Example 1: Screening of sites to target Reg1 by CRISPR / Cas-mediated gene editing (A) Efficient disruption of Reg1 by Cas9:sgRNA RNP in T cells The Reg1 gene was efficiently edited in exovivotal primary human T cells using CRISPR / Cas9 gene editing. A genomic segment of the Reg1 gene containing six protein-coding exons was used as input data in gRNA design software. The desired gRNAs were those that disrupted the Reg1 amino acid sequence by causing insertions or deletions in the coding sequence, resulting in out-of-frame / loss-of-function alleles (referred to as "Reg1 knockout (KO)" alleles or "disrupted Reg1 alleles"). All 10 gRNA spacer sequences identified in silico targeting the Reg1 gene were synthesized, and the gRNAs were specifically modified as shown in Table 1. The gRNAs used in this example were modified with 2'-O-methylphosphorothioate modification, but unmodified gRNAs or gRNAs with other modifications can also be used. The target sequences and gRNA sequences for Reg1 guides Z01-Z10 are shown in Table 22 below.

[0279] [Table 1]

[0280] Primary human T cells were transfected (electroporated) with ribonucleoprotein particles (RNPs) containing synthetically modified sgRNA targeting the Cas9 nuclease and Reg1 gene (sequences in Table 22), or with a control (without Cas9 and gRNA). Four days after transfection, cells were subjected to TIDE analysis to assess indel frequencies.

[0281] The 10 gRNAs yielded measurable data by TIDE analysis, as shown in Table 1. Eight of the gRNA sequences yielded indel percentages (editing frequencies) exceeding 90%, indicating highly efficient gene editing.

[0282] Four gRNAs targeting either exon 2 or 4 were selected for subsequent studies (REG1-Z03, REG1-Z05, REG1-Z06, and REG1-Z10). These showed Reg1 editing rates of 96.8%, 98.5%, 95%, and 94.9%, respectively, as shown in Table 1.

[0283] (B) On-target and off-target editing of REG1 guide RNA The on-target and off-target editing efficiencies of the various REG1-targeting gRNAs described above were investigated according to the methods disclosed in the section above. Briefly, activated T cells were transfected (electroporated) with ribonucleoprotein particles (RNPs) containing synthetically modified sgRNAs that target Cas9 nuclease and the Reg1 gene (sequences in Table 22 below), or with a control (without Cas9 and without gRNA).

[0284] For on- and off-target evaluation of the genome, these electroporation methods were used to generate two populations of edited cells from two different donor T cells (referred to as 1 and 2). Cells were gene-edited using each of the ten guides described above and collected 10 days after transfection. These samples were analyzed using a hybrid capture method of homology-dependent approaches to enrich on- and off-target sites, combined with next-generation sequencing. In summary, on- and off-target sites homologous to each gRNA target site were identified by computer, these sites were enriched from bulk genomic DNA using single-stranded RNA probes, these enriched sites were sequenced by next-generation sequencing, and this data was analyzed for insertions and deletions (indels) indicating post-CRISPR editing repair.

[0285] (i) Analysis of on-target indel profiles in T cells The data used to quantify off-target editing was also used to quantify and summarize the most frequent on-target indels for all Reg1 guides listed in Table 22. This data was generated from hybrid capture of Reg1 loci combined with next-generation sequencing in two donors (referred to as Donor 1 and Donor 2).

[0286] Following gene editing, hybrid capture analysis of the Reg1 locus in the T cell population after CRISPR / Cas9 gene editing to generate Reg1 KO T cells yielded specific indel frequencies and edited gene sequences at the Reg1 locus (Tables 29-38; dashed lines indicate deletions, bold indicates insertions).

[0287] To quantify individual sequences from hybrid capture data, sequence reads aligned across Regnase 1 on-target sites 20 bp upstream and downstream of the cleavage site were selected and examined for indel sequence quantification. From the selected reads, sequences within 10 bp upstream and downstream of each presumptive cleavage site (approximately 3 bp upstream of the PAM (Jinek, et al., Science 2012)) were quantified as representative regions for on-target non-homologous end ligation (NHEJ) editing.

[0288] Table 2 below shows the results of exemplary on- and off-target editing of Reg1 gRNA obtained by the hybrid capture assay disclosed herein (from two donors).

[0289] [Table 2]

[0290] Tables 29–38 below show sequences edited on target genes using exemplary Reg1 gRNA. The frequencies of these sequences represent the percentage of all sequences across the on-target site within 20 bp upstream and downstream of each cleavage site. The indels for each guide are shown relative to the on-target reference sequence in Tables 29–38. The reference sequence is placed in the center of the cleavage site, which is accompanied by 10 bp in either direction and ends at 4 bp at 3' of the PAM.

[0291] Example 2: Disruption of Regnase 1 improves CAR-T cell expansion. Using T cells expressing the anti-CD70 CAR disclosed herein as an example, this study demonstrated that knocking out Reg1 in CAR-T cells improved the expansion of CAR-T cell cultures in vitro.

[0292] Allogeneic human T cells expressing a chimeric antigen receptor (CAR) targeting CD70 were produced, without expression of the TRAC gene, β2M gene, CD70 gene, and Regnase-1 gene. Briefly, activated human T cells were first isolated, followed by the delivery of Cas9:sgRNA RNP (1 μM Cas9, 5 μM gRNA) to the activated human T cells by electroporation, and then incubated with recombinant adeno-associated adenovirus vector (AAV), serotype 6 (AAV6) (MOI 50,000). The nucleofection mixture was prepared using Nucleofector® solution, 5 × 10⁶ 6 The cells contained 1 μM Cas9 and 5 μM gRNA (as described in Hendel et al., Nat Biotechnol. 2015;33(9):985-989, PMID:26121415). The RNP complex contained Cas9, as well as TRAC, B2M, and CD70 (shown in Table 23), and sgRNAs that selectively targeted the Regnase-1 gene (using REG1-Z01 to REG1-Z10 sgRNAs shown in Table 22). The rAAV vector contained a nucleotide sequence encoding anti-CD70 CAR (the donor template of SEQ ID NO: 169, encoding the anti-CD70 CAR amino acid sequence of SEQ ID NO: 138).

[0293] Anti-CD70 CAR-T cells were used to evaluate their ability to expand in cytokine-containing medium (IL-2 + IL-7). Specifically, 2.5–3.8 × 10⁶ cells, including quadruple disruption, were used. 6 Total anti-CD70 CAR-T cells (TRAC- / β2M- / CD70- / Reg1-) were generated and compared to unedited anti-CD70 CAR-T cells (TRAC- / β2M- / CD70-) containing Reg1.

[0294] Cells were seeded and grown in flasks containing cytokine-containing medium. The total number of cells was counted every 3-4 days and reseeded as needed. This process was repeated weekly for a total of 21 days. Allogeneic anti-CD70 CAR-T cells containing disruption of the Reg1 gene showed increased cell growth after 21 days (Figure 1A). Reg1 guides REG1-Z01, REG1-Z03, REG1-Z07, REG1-Z09, and REG1-Z10 appeared to be more effective in promoting cell growth than cells produced using Reg1 guides REG1-Z02 or REG1-Z08.

[0295] In the second experiment, the Reg1 guide REG1-Z10 was used in replicates of CAR-T cells produced from different T cell donors by two operators (labeled A and B). The effect of increasing cell culture expansion was again demonstrated. Increased cell expansion was observed as early as day 13 and continued throughout the experiment until day 52 (Figure 1B). Furthermore, anti-CD70 CAR-T cells containing Reg1 disruption were maintained in culture for a longer period (at least until day 52) compared to anti-CD70 CAR-T cells containing the unedited Regnase 1 gene (one of which was not viable by day 26). In summary, these data indicate that disruption of the Reg1 gene results in higher cell culture yield and longer cell maintenance in culture compared to CAR-T cells with the unedited Reg1 gene.

[0296] Example 3: Cell-killing function of anti-CD70 CAR-T cells with Reg1 disruption. Allogeneic human T cells expressing a chimeric antigen receptor (CAR) targeting CD70 were produced, without expression of the TRAC, β2M, and CD70 genes. The edited CAR-T cells further contained a knockout of the Reg1 gene. As described in the above example, activated human T cells were electroporated with Cas9:sgRNA RNP (1 μM Cas9, 5 μM gRNA) and subsequently incubated with recombinant adeno-associated adenovirus vector, serotype 6 (AAV6) (MOI 50,000).

[0297] The recombinant AAV contained the nucleotide sequence of SEQ ID NO: 169 (encoding an anti-CD70 CAR, including the amino acid sequence of SEQ ID NO: 138). The following sgRNAs were used: TRAC (SEQ ID NO: 58), β2M (SEQ ID NO: 62), CD70 (SEQ ID NO: 54), and optionally Reg1 (e.g., REG1-Z03, Z05, Z06, and Z10; see Table 22 and Figures 2A-2E).

[0298] CAR expression on T cells was examined by flow cytometry one week and one month after electroporation. Both anti-CD70 CAR-T cells and anti-CD70 CAR-T cells lacking Reg1 (using four gRNAs REG1-Z03, Z05, Z06, and Z10) expressed nearly identical amounts of CAR on their surface at day 7 (85.6%, 81.8%, 80%, 84.4%, and 85.6%) and day 32 (97.6%, 90.7%, 91.5%, 92.6%, and 93.2%) after HDR.

[0299] The cytotoxic function of anti-CD70 CAR-T cells that disrupt Regnase-1 (Reg1). The ability of TRAC- / β2M- / CD70- / Reg1- / anti-CD70 CAR+ cells to kill CD70+ adherent renal cell carcinoma (RCC) cell lines (ACHN, Caki-1, and / or 769P cell lines) was evaluated using a cell killing assay. Adherent cells were seeded at 50,000 cells per well in a 96-well plate and incubated overnight at 37°C. The following day, edited anti-CD70 CAR-T cells (cultured up to 12 or 27 days post-HDR) were added to the wells containing target cells in CAR-T:target cell ratios of 1:1, 2:1, or 1.5:1. After co-culture for 24 hours, CAR-T cells were removed from the culture by aspirate, and 100 μL of Cell titer-Glo (Promega) was added to each well of the plate to assess the number of remaining viable target cells. Next, the amount of light emitted per well was quantified using a plate reader.

[0300] Cells with Reg1 disruption exhibited greater cytotoxicity from RCC-derived cells after 24 hours of co-incubation. Anti-CD70 CAR-T cells showed slightly higher efficacy when Reg1 was knocked out at 12 days post-HDR (Figures 2A and 2B), and significantly higher efficacy at 27 days post-HDR (Figures 2C, 2D, and 2E). This suggests that knockout of the Reg1 gene imparts sustained / persistent higher cytotoxicity to anti-CD70 CAR+ T cells over time after HDR. This finding was consistent across three tumor lines derived from renal cell carcinoma. CD70 CAR+ T cells with Reg1 disruption using REG1-Z03, REG1-Z05, and REG1-Z10 gRNAs exhibited higher sustained efficacy than those using REG1-Z06 gRNA. CAR-T cells with Reg1 disruption showed a noticeable increase in potency after co-culture with caki-1 (Figures 2A, 2B, and 2C) and ACHN (Figure 2D) for 24 hours, and after co-culture with 769P for 6 hours (no difference was visible after 24 hours) (Figure 2E).

[0301] CAR-T cells showed similar efficacy with and without Regnase knockout at 13 days post-HDR, but older cells (19 and 26 days) appeared to show reduced efficacy without Regnase knockout. Surprisingly, TRAC- / β2M- / CD70- / Reg1- / anti-CD70 CAR+ cells still retained the ability to kill ACHN and Caki-1 cells in culture medium with similar activity (Figures 6A and 6B).

[0302] This suggests that disrupting the Reg1 gene, after HDR editing, imparts longer-lasting activity and higher cytotoxicity to CAR+ T cells.

[0303] Example 4: Effect of Regnase-1 (Reg1) disruption on the expression of fatigue markers Levels of T cell exhaustion markers were evaluated in TRAC- / β2M- / CD70- / anti-CD70 CAR+ cells and TRAC- / β2M- / CD70- / Reg1- / anti-CD70 CAR+ cells. CD4+ and CD8+ T cells were evaluated by flow cytometry on day 13 (Figure 3A and 3C) and day 26 (Figure 3B and 3D) after HDR, in terms of PD-1 expression (Figure 3A and 3B) and TIM3 expression (Figure 3C and 3D).

[0304] The data demonstrate that Reg1 knockout (using the Z10 guide, for example) reduces the expression of exhaustion markers in CAR-T cells at all measured time points. The data also demonstrate that Reg1 knockout reduced potential exhaustion in populations of CD8+ and CD4+ gene-edited CAR+ T cells, resulting in better therapeutic outcomes.

[0305] Example 5: Disruption of Regnase-1 (Reg1) increases the proportion of central memory cells in the CAR-T cell population. When antigen peptides presented by antigen-presenting cells are activated, native T cells develop T stem cell memory (T SCM ), T central memory cells (T CM), T effector memory cell ( TEM ), and T effector cells (T EFF T cells differentiate into various types in the following order. Exemplary surface markers of T cells at various differentiation stages are shown below. CM Cells are associated with the long-term persistence of T cells in vivo, CM CD8+ clones isolated from cells have been shown to persist for extended periods in vivo during adoptive T cell transfer in non-human primates, whereas clones isolated from effector cells did not. (Berger et al., J. Clin. Investig. (2008) 118:294-305). Representative cell surface markers for various types of T cells are shown in Table 3 below.

[0306] [Table 3]

[0307] The levels of CD27 and CD45 RO T central memory T cell markers were evaluated in TRAC- / β2M- / CD70- / anti-CD70 CAR+ cells and TRAC- / β2M- / CD70- / Reg1- / anti-CD70 CAR+ cells. Cells were stained with a commercially available antibody for CD27 (Biolegend, clone M-T271) and a commercially available antibody for CD45 RO (Biolegend, clone UCHL1), and analyzed by flow cytometry.

[0308] As shown in Table 4, CAR-T cells with Reg1 knockout tended to exhibit a higher tendency to be central memory T cells (double-positive for CD27 and CD45 RO) and a lower tendency to exhibit an effector memory cell identity (identified as CD27- and CD45 RO+).

[0309] [Table 4]

[0310] The results obtained from this study show that disruption of Reg1 leads to a decrease in the total T cell population compared to its Reg1 WT counterpart. CM This demonstrates an improvement at the cellular level, suggesting that disrupting Reg1 can increase the long-term persistence of T cells in vivo, thus benefiting CAR-T therapy.

[0311] Example 6: Disruption of Reg1 does not affect the cytokine-dependent nature of CAR-T cells. To determine whether gene editing resulted in unwanted off-target editing that could produce cells with harmful characteristics such as uncontrolled cell proliferation, the ability of TRAC- / β2M- / anti-CD19 CAR+ and TRAC- / β2M- / Reg1- / anti-CD19 CAR+ cells to proliferate in the absence of cytokines and / or serum was evaluated. Approximately two weeks after cell production (day 0), 5 × 10¹⁶ cells were grown in 10 mL of full media containing IL-2, IL-7, and human serum, or in serum-containing medium without cytokines (IL-2 and IL-7). 6 Nine cells were seeded. Fresh complete medium or cytokine-free medium was added to each culture once a week. The amount of medium added allowed the culture to maintain a density of approximately 1 to 2 million cells / mL. If the cell density fell below 1 million cells / mL, no medium was added to the culture. The number of viable cells was counted twice a week until 40 days after seeding. In cytokine-deficient cultures, TRAC- / β2M- / anti-CD19 CAR+ or TRAC- / β2M- / Reg1- / anti-CD19 CAR+ was undetectable by 40 days, indicating that any potential off-target effects from genome editing did not induce growth factor-independent growth / reproduction in the cells (Figure 4). Cells reproduced only in the presence of cytokines (complete medium containing cytokines) and not in the presence of serum alone. Therefore, genome editing did not induce any adverse events that would allow cells to grow in the absence of cytokines, growth factors, or antigen stimulation.

[0312] Example 7: In vivo effect of Reg1 knockout on allogeneic CAR-T cells in a xenograft model of intravenously disseminated Nalm-6 human acute lymphoblastic leukemia tumor. The in vivo efficacy of allogeneic CAR-T cells, excluding β2M, TRAC, and Reg1, was further evaluated using a seeded mouse model. To demonstrate the efficacy of TRAC- / β2M- / anti-CD19 CAR+ T cells (anti-CD19 CAR-T cells) regardless of Reg1 locus editing, a CD19+B-ALL-derived Nalm-6 human acute lymphoblastic leukemia tumor cell line was used in NOG mice. The Reg1 gene was edited by CRISPR / Cas-mediated gene editing using REG1-Z10 guide RNA (see Table 22). Anti-CD19 CAR-T cells express anti-CD19 CAR containing the amino acid sequence of Sequence ID No. 118. See also Sequence Listings 27 and 28 below, and International Publication No. 2019 / 097305, which incorporates relevant disclosures relating to the subject matter and objectives referenced herein.

[0313] The efficacy of anti-CD19 CAR-T cells was evaluated in a disseminated disease model using methods employed by Translations Drug Development, LLC (Scottsdale, AZ) and methods described herein. In summary, 25 female CIEA NOG (NOD.Cg-PrkdcscidI12rgtm1Sug / JicTac) mice, aged 5–8 weeks, were individually housed in ventilated micro-isolater cages maintained under pathogen-free conditions 5–7 days prior to the start of the study. At the start of the study, the mice were divided into five treatment groups as shown in Table 5. Disseminated disease was modeled by intravenously seeding Nalm6-Fluc-GFP (Nalm6-Fluc-Neo / eGFP--Puro) cells into the mice. On day 1, all mice received 0.5 × 10⁶ cells. 6 Nalm6 cells / mouse were administered intravenously. On day 4, as shown in Table 5, CAR-T cells (4 × 10⁶) were administered to groups 2-5. 6 Intravenous injection of CAR+ cells (in mice) was administered.

[0314] [Table 5]

[0315] During the study, mice were monitored daily, and their body weight was measured twice a week. Bioluminescence (BLI; total ROI, photons / second) was measured twice a week, starting on day 4 of the study. A key endpoint was time to surrounding disease, and the effect of T cell engraftment was also evaluated. Throughout the study, the percentage of animal mortality and time to death were recorded for all groups. Mice were euthanized before reaching a mortal state. A mouse was defined as mortal and could be sacrificed if one or more of the following criteria were met: Weight loss of more than 20% that continues for more than one week, Tumors that interfere with normal physiological functions such as the ability to eat, drink, move, urinate, and / or defecate. Excessive diarrhea for a prolonged period resulting in excessive weight loss (>20%), or Persistent wheezing and difficulty breathing.

[0316] Animals were also considered mortal if they had prolonged or excessive pain or suffering, as defined by clinical observation, including: collapse, kyphosis, complete / incomplete paralysis, abdominal distension, ulceration, abscess, seizures, and / or bleeding.

[0317] In vivo survival rate Mice administered with TRAC- / β2M- / anti-CD19 CAR+ T cells showed increased survival compared to untreated mice, regardless of the presence or absence of further Reg1 disruption (Group 1). Mice administered with any dose of TRAC- / β2M- / Reg1- / anti-CD19 CAR+ T cells showed increased survival compared to TRAC- / β2M- / anti-CD19 CAR+ T cells at their respective doses (Figures 5A and 5B). Furthermore, mice administered with any dose of TRAC- / β2M- / Reg1- / anti-CD19 CAR+ T cells showed reduced leukemia burden, as indicated by reduced bioluminescence signaling compared to TRAC- / β2M- / anti-CD19 CAR+ T cells at their respective doses (Figures 5C and 5D).

[0318] These data demonstrate that disruption of Reg1 in CAR-T cells increases the efficacy of CAR-T cells in vivo, reduces tumor burden, and increases survival.

[0319] Example 8: Efficient disruption of TGFBRII by Cas9:sgRNA RNP in T cells This example describes efficient editing of the TGFBRII gene in primary human T cells using ex vivo CRISPR / Cas9 gene editing. A genomic segment of the TGFBRII gene containing the first five protein-coding exons was used as input data in gRNA design software. The genomic segment also included adjacent splice site acceptor / donor sequences. The desired gRNA was one that would disrupt the amino acid sequence of TGFBRII by causing an insertion or deletion in the coding sequence, resulting in an out-of-frame / loss-of-function allele (referred to as the "TGFBRII knockout allele" or "disrupted TGFBRII allele"). Eight gRNA spacer sequences identified in silico targeting the CD70 gene were synthesized, and the gRNAs were specifically modified as shown in Table 39 and Figures 7A and 7B. The modified gRNAs in Table 39 were modified with 2'-O-methylphosphorothioate modification, but unmodified gRNAs or gRNAs with other modifications may also be used.

[0320] Primary human T cells were transfected (electroporated) with ribonucleoprotein particles (RNPs) containing synthetically modified sgRNA targeting the Cas9 nuclease and the TGFBRII gene (sequence shown in Table 39), or with a control (without Cas9 and without gRNA). Four to six days after transfection, cells were subjected to (1) TIDE analysis to assess indel frequency, and (2) Western blotting (primary antibody: anti-human TGFBRII antibody, clone #16H2L4) to assess TGFBRII expression levels on the cell surface (Figure 7B).

[0321] Eight gRNAs yielded measurable data by TIDE analysis, as shown in Figure 7A. Seven gRNA sequences resulted in indel percentages (editing frequencies) exceeding 80%, indicating highly efficient gene editing (Figure 7A). TIDE analysis data were confirmed by evaluating TGFBRII protein expression levels by Western blotting, and GAPDH was used as a loading control. Seven of the gRNAs showed near-complete knockout of TGFBRII on T cells (Figure 7B).

[0322] On-target and off-target editing of TGFBRII guide RNA The on-target and off-target editing efficiencies of the various TGFBRII-targeting gRNAs described above were investigated according to the methods disclosed in the section above. Briefly, activated T cells were transfected (electroporated) with ribonucleoprotein particles (RNPs) containing synthetically modified sgRNAs that target the Cas9 nuclease and the TGFBRII gene (sequences in Table 39 below), or with a control (without Cas9 and without gRNA).

[0323] For on- and off-target evaluation of the genome, these electroporation methods were used to generate two cell populations of edited cells from two different donor T cells. Cells were gene-edited using each of the nine guides listed in Table 39 and collected 10 days after transfection. These samples were analyzed using a hybrid capture method of homology-dependent approaches to enrich on- and off-target sites, combined with next-generation sequencing. In summary, on- and off-target sites homologous to each gRNA target site were identified by computer, these sites were enriched from bulk genomic DNA using single-stranded RNA probes, these enriched sites were sequenced by next-generation sequencing, and this data was analyzed for insertions and deletions (indels) indicating post-CRISPR editing repair.

[0324] Five gRNAs showed no off-target effects and had an on-target editing rate of over 85%, including TGFBRII_Ex1_T1, TGFBRII-Ex1-T2, TGFBRII_Ex1_T3, TGFBRII_Ex2_T1, and TGFBRII_Ex5_T1, as shown in Table 6 below.

[0325] [Table 6]

[0326] Tables 29-38 list potential indel sequences that can be generated by the gRNAs disclosed herein (dashed lines indicate deletions, bold indicates insertions).

[0327] Example 9: Generation of genetically modified T cells that do not express TGFBRII and are resistant to TGF-β. This example describes the production of CAR-T cells that do not express TGFBRII, and the evaluation of the effect of TGF-β on the expansion of CAR-T cells using TGFBRII KO cells grown in complete medium (X-Vvivo 15 supplemented with IL-2 and IL-7).

[0328] In short, human T cells were first isolated, Cas9:sgRNA RNP (1 μM Cas9, 5 μM gRNA) was delivered to activated human T cells by electroporation, and subsequently incubated with recombinant adeno-associated adenovirus vector (AAV), serotype 6 (AAV6) (MOI 50,000). The nucleofection mixture was prepared using Nucleofector® solution, 5 × 10⁶ 6 The cells contained 1 μM Cas9 and 5 μM gRNA (as described in Hendel et al., Nat Biotechnol. 2015;33(9):985-989, PMID:26121415). The RNP complex contained Cas9, as well as sgRNAs that selectively targeted TRAC, B2M, CD70, and the TGFBRII gene (sgRNAs are shown in Tables 23 and 39, and SEQ ID NOs. 58, 62, 54, and 301, respectively). The rAAV vector contained nucleotide sequences encoding anti-CD70 CAR (donor template SEQ ID NO. 169 and anti-CD70 CAR amino acid sequence SEQ ID NO. 138).

[0329] Approximately one week after electroporation, untreated (i.e., wild-type or unmanipulated counterpart) CAR-T cells containing the TGFBRII gene were exposed to various levels of recombinant human TGF-β (10, 20, 50, and 100 ng / ml), and cell expansion was recorded over time. TGF-β significantly inhibited CAR-T expansion, with a concentration of only 10 ng / ml being sufficient to reduce CAR-T expansion in untreated cells containing the TGFBRII gene (Figure 8A).

[0330] In another study, anti-CD70 CAR-T cells with disrupted TGFBRII were incubated with or without recombinant human TGF-β at 50 ng / ml. T cell expansion was monitored 2 and 8 days after incubation with TGF-β and compared to mock cells. Mock cells (Figure 8B) were anti-CD70 CAR-T cells that lacked the disrupted TGFBRII gene. As shown in Figures 8C-8K, TGFBRII-knockout T cells were protected from the inhibitory effect of TGF-β on T cell expansion. The degree of protection differed depending on the sgRNA used to disrupt the TGFBRII gene. T cells transfected with gRNAs targeting exons 1, 4, and 5 (TGFBRII_EX1_T2, TGFBRII_EX4_T1, TGFBRII_EX4_T2, TGFBRII_EX5_T1) showed the highest resistance to the inhibitory effect of TGF-β. The sequences of these gRNAs are provided in Table 39 below.

[0331] Example 10: Cell-killing function of anti-CD70 CAR-T cells with TGFBRII disruption. This example describes the production of allogeneic human T cells that do not express the TRAC, β2M, and CD70 genes, and that express a chimeric antigen receptor (CAR) targeting CD70. The edited CAR-T cells further included knockout of the TGFBRII gene. As described in the above example, activated human T cells were electroporated with Cas9:sgRNA RNP (1 μM Cas9, 5 μM gRNA) and subsequently incubated with recombinant adeno-associated adenovirus vector, serotype 6 (AAV6) (MOI 50,000).

[0332] The recombinant AAV contained the nucleotide sequence of SEQ ID NO: 169 (encoding an anti-CD70 CAR, including the amino acid sequence of SEQ ID NO: 138). The following sgRNAs were used: TRAC (SEQ ID NO: 58), β2M (SEQ ID NO: 62), CD70 (SEQ ID NO: 54), and TGFBRII (SEQ ID NO: 301).

[0333] Approximately one week after electroporation, CAR expression on T cells was examined by flow cytometry. Both anti-CD70 CAR-T cells and anti-CD70 CAR-T cells without TGFBRII expressed nearly the same amount of CAR on their surface (71.5% CAR). + Cell pair 73.7% CAR + cell).

[0334] The ability of TRAC- / β2M- / CD70- / TGFBRII- / anti-CD70 CAR+ cells to kill CD70+ adherent renal cell carcinoma (RCC) cell line (A498 cells) was evaluated using a cell killing assay. Adherent cells were seeded at 50,000 cells per well in a 96-well plate and left overnight at 37°C. The following day, edited anti-CD70 CAR-T cells were added to the wells containing target cells at a CAR-T:T cell (E:T) ratio of 0.05:1 or 0.1:1. After the specified incubation period, CAR-T cells were removed from the culture by aspirate, and 100 μL of Cell titer-Glo (Promega) was added to each well of the plate to assess the number of remaining viable target cells. The amount of light emitted per well was then quantified using a plate reader. Cells with TGFBRII knockout exhibited greater cytotoxicity of RCC-derived cells after 24 hours of co-incubation. Anti-CD70 CAR-T cells showed higher efficacy when TGFBRII was knocked out, which is clearly visible in the two T cell:A498 ratios (0.05:1 and 0.1:1) (Figure 9). This suggests that knockout of the TGFBRII gene confers greater cytotoxicity to anti-CD70 CAR+ T cells. This finding was consistent across a broad panel of tumor lines from various tissues, as shown in Figures 10A–10E. Knockout of the TGFBRII gene enhances the cytotoxicity of anti-CD70 CAR-T cells against 786-O and CAKI-1 (renal cell carcinoma strains), H1975 (non-small cell lung cancer), Hs-766T (pancreatic cancer), and SK-OV3 (ovarian cancer) (Figures 10A-10E).

[0335] In another study, anti-CD70 CAR-T cells were incubated with 50 ng / ml recombinant human TGF-β for 24 hours, and CD25(IL-2R) expression on the cell surface was evaluated by flow cytometry. As shown in Figure 11, anti-CD70 CAR-T cells are susceptible to the inhibitory effect of TGF-β, which causes CD25 downregulation. CD25 is an activation marker and is involved in T cell proliferation. When the TGFBRII gene is knocked out, these cells become resistant to TGF-β, and the CAR-T cells retain their activity and CD25 expression.

[0336] Furthermore, when target cells (A498) were repeatedly killed in the presence of recombinant human TGF-β at concentrations of 1, 10, and 50 ng / ml, anti-CD70 CAR-T cells were adversely affected by the presence of TGF-β, as demonstrated by the reduced cytotoxicity of untreated CAR-T cells with the TGFBRII gene (Figure 12). However, anti-CD70 CAR-T cells with TGFBRII knockout (anti-CD70 CAR+TGFBRII_EX4_T1) did not show a reduction in cytotoxicity in the presence of TGF-β (Figure 12). In addition, T cell proliferation when exposed to target antigen and effector cytokine production (IFN-γ and IL-2) was reduced in the presence of TGF-β (Figures 13A-13C). However, as also shown in Figures 13A-13C, when cells did not express TGFBRII, they were completely protected from the inhibitory effect of TGF-β. This protects CAR-T cells in the tumor microenvironment from the adverse effects of TGF-β by knocking out TGFBRII on the surface of CAR-T cells.

[0337] Example 11: Generation of anti-CD70 CAR-T cells that do not express TGFBRII and are resistant to fibroblast inhibitory effects. This example describes the production of allogeneic human T cells that do not express the TRAC, β2M, and CD70 genes, and that express a chimeric antigen receptor (CAR) targeting CD70, and how these cells are susceptible to the inhibitory effect of fibroblasts, which are major components of the solid tumor microenvironment (TME). The edited CAR-T cells further included knockout of the TGFBRII gene. As described in the above example, activated human T cells were electroporated with recombinant adeno-associated adenovirus vector, serotype 6 (AAV6) (MOI 50,000), and Cas9:sgRNA RNP (1 μM Cas9, 5 μM gRNA).

[0338] The recombinant AAV contained the nucleotide sequence of SEQ ID NO: 169 (encoding an anti-CD70 CAR, including the amino acid sequence of SEQ ID NO: 138). The following sgRNAs were used: TRAC (SEQ ID NO: 58), β2M (SEQ ID NO: 62), CD70 (SEQ ID NO: 54), and TGFBRII (SEQ ID NO: 301).

[0339] The inhibitory effect of fibroblasts on anti-CD70 CAR-T cells to kill the following CD70+ adherent tumor cell lines was evaluated using a cell killing assay: H1975 (non-small cell lung cancer), Hs-766T (pancreatic cancer), or SK-OV3 (ovarian cancer). The cell killing assay was performed as described in Example 3. Briefly, adherent cells were seeded at 50,000 cells per well in a 96-well plate and left overnight at 37°C. Fibroblasts (LL 86(LeSa)ATCC(registered trademark)CCL-190(trademark)) were added to the upper chamber of the Transwell plate without direct contact with the target cells. The following day, edited anti-CD70 CAR-T cells were added to the wells containing the target cells. After the specified incubation period, CAR-T cells were removed from the culture by aspiration, and 100 μL of Cell titer-Glo (Promega) was added to each well of the plate to assess the number of remaining viable target cells. Next, the amount of light emitted per well was quantified using a plate reader. As shown in Figure 14, the presence of fibroblasts on the upper chamber reduced the cytotoxicity of anti-CD70 CAR-T cells against target cells, suggesting that these fibroblasts secreted factors that reduced the anti-CD70 CAR-T killing effect.

[0340] This finding was validated when the experiment was repeated in the presence of fibroblast-derived conditioning medium, rather than on cells, and similar inhibition was observed. In short, 1 × 10 6CCL-190 fibroblasts were seeded in 24-well plates at 0.5 ml / well, incubated overnight, and the supernatant was collected. The aforementioned cell toxicity assay was performed using anti-CD70 CAR-T cells and tumor cells in an effector-to-target cell ratio of 0.1:1, with or without fibroblast supernatant, and incubated overnight. Cell toxicity was measured using the CellTiter-Glo® bioluminescent cell survival assay. This experiment demonstrates that fibroblasts secrete factors that lead to a reduction in the toxicity of anti-CD70 CAR-T cells. These cells were protected from this inhibitory effect by disrupting the TGFBRII gene on the surface of anti-CD70 CAR-T cells. TGFBRII knockout improved the cytotoxicity of anti-CD70 CAR-T cells against pancreatic tumor cells Hs-766T (Figure 15A), renal tumor cells A498 (Figure 15B), and lung tumor cells H1975 (Figure 15C) in the presence of fibroblasts. These data suggest that fibroblasts contribute to TGF-β production in the TME, reducing the cytotoxicity of anti-CD70 CAR-T cells, but this can be avoided by disrupting TGFBRII on the surface of CAR-T cells.

[0341] Example 12: Generation of CAR-T cells containing disrupted TGFBRII and Regnase-1 genes. Allogeneic human T cells were produced that did not express the TRAC gene, β2M gene, CD70 gene, TGFBRII gene, and Regnase-1 gene, but expressed a chimeric antigen receptor (CAR) that targets CD70. Activated human T cells were electroporated with Cas9:sgRNA RNP (1 μM Cas9, 5 μM gRNA) and subsequently incubated with recombinant adeno-associated adenovirus vector, serotype 6 (AAV6) (MOI 50,000).

[0342] The recombinant AAV contained the nucleotide sequence of SEQ ID NO: 169 (encoding an anti-CD70 CAR, including the amino acid sequence of SEQ ID NO: 138). The following sgRNAs were used: TRAC (SEQ ID NO: 58), β2M (SEQ ID NO: 62), CD70 (SEQ ID NO: 54), TGFBRII (SEQ ID NO: 313), and REG-1 (SEQ ID NO: 51). sgRNAs that form RNPs with the Cas9 enzyme can be introduced into T cells in a single electroporation event to produce the modified cell population shown in Table 7 below. Alternatively, these can be introduced into T cells in two sequential electroporation events to produce the resulting cell population. After electroporation, the cells are transduced with recombinant AAV to introduce a donor template encoding an anti-CD70 CAR.

[0343] [Table 7]

[0344] Seven days after electroporation, CAR expression on T cells was examined by flow cytometry. Both anti-CD70 CAR-T cells and Regnase-free anti-CD70 CAR-T cells expressed approximately the same amount of CAR on their surface seven days after HDR. The results are shown in Table 7A below.

[0345] [Table 8]

[0346] Example 13: Disruption of Regnase-1 and TGFBRII increases CAR-T cell killing during continuous in vitro rechallenge. The anti-CD70 CAR+ T cells generated above were successively rechallenged using the CD70+ kidney cancer cell line ACHN, and their ability to kill the CD70+ kidney cancer cell line ACHN was evaluated.

[0347] The anti-CD70 CAR used in this experiment + T cells include the following edits: ·Anti-CD70 CAR-T cells: Anti-CD70 CAR+ / TRAC- / B2M- / CD70- ·Anti-CD70 CAR-T+Reg KO cells: Anti-CD70 CAR+ / TRAC- / B2M- / CD70- / Reg- ·Anti-CD70 CAR-T+TGFBRII KO cells: Anti-CD70 CAR+ / TRAC- / B2M- / CD70- / TGFBRII- ·Anti-CD70 CAR-T+Reg KO+TGFBRII KO cells: Anti-CD70 CAR+ / TRAC- / B2M- / CD70- / Reg- / TGFBRII-.

[0348] In a 96-well plate format, CAR-T cells were initially co-cultured with ACHN cells on day 0 (4,000 CAR-T cells, 16,000 tumor cells), and then re-challenged with tumor cells as follows: 16,000 tumor cells on days 2 and 4; 40,000 cells on day 7; 50,000 cells on day 9; and 50,000 cells on day 11).

[0349] Tumor cell and CAR-T cell counts were analyzed using flow cytometry on days 1, 3, 6, 8, 10, and 12 (the method was modified from Wang et al., JoVE 2019). The antibodies listed in Table 8 below were used at a 1:100 dilution.

[0350] [Table 9]

[0351] The results show that disrupting both the TGFBRII and Regnase genes improved efficacy (Figure 16A) and CAR+ T cell expansion (Figure 16B) when CAR-T cells were repeatedly challenged with CD70+ positive target cells. Efficacy and expansion were improved compared to CAR-T cells that lacked either of the disrupted genes or possessed only one (i.e., TGFBRII or Regnase).

[0352] Example 14: Therapeutic efficacy of anti-CD70 CART cells with multiple gene disruptions in a subcutaneous renal cell carcinoma xenograft model. Treatment in a renal cell carcinoma model The ability of T cells expressing CD70 CARs with TGFBRII and / or Regnase gene editing to eliminate renal cell carcinoma cells expressing moderate levels of CD70 was evaluated in vivo using a subcutaneous renal cell carcinoma (CAKI-1) tumor xenograft mouse model. Anti-CD70 CAR+ T cells were produced as described above. See, for example, Example 13.

[0353] The ability of these anti-CD70 CAR+ T cells to improve disease caused by CD70+ renal cell lines was evaluated in NSG mice using a method employed by Translational Drug Development, LLC (Scottsdale, AZ). In summary, 20 female NSG mice aged 5–8 weeks were individually housed in ventilated micro-isolated cages maintained under pathogen-free conditions 5–7 days prior to the start of the study. 5 × 10¹⁴ cells were placed in the right posterior flank of each mouse. 6 Each mouse was subcutaneously inoculated with Caki-1 renal cell carcinoma cells. The average tumor size was approximately 70 mm. 3 Upon reaching the target, the mice were further divided into five treatment groups shown in Table 9. On day 1, four of the treatment groups received a single intravenous dose of 200 μl, 1 × 10⁶, according to Table 9. 7 Individual anti-CD70 CAR+ T cells were administered.

[0354] [Table 10]

[0355] Tumor volume was measured twice a week (approximately every 3-4 days) from the start of treatment. By day 11 after injection, anti-CD70 CAR-T cells with knockout of both TGFBRII and Regnase genes began to show a significant effect on reducing tumor volume compared to other treatment groups. Approximately one month later, tumor growth of anti-CD70 CAR-T + Reg KO + TGFBRII KO cells completely disappeared in the subcutaneous CAKI-1 model (Figure 17A).

[0356] These results demonstrate that in a subcutaneous CAKI-1 renal cell carcinoma xenograft model, disrupting both TGFBRII and Regnase genes in CAR-T cells increased the efficacy of CAR-T cells and effectively removed the tumor.

[0357] Treatment in non-small cell lung cancer (NSCLC) tumor models The ability of T cells expressing CD70 CARs with TGFBRII and / or Regnase gene editing to eliminate lung adenocarcinoma cells expressing moderate levels of CD70 was evaluated in vivo using a subcutaneous lung cancer (NCI-H1975) tumor xenograft mouse model. Anti-CD70 CAR+ T cells were produced as described herein. See, for example, Example 13.

[0358] The ability of these anti-CD70 CAR+ T cells to improve disease caused by CD70+ lung cancer cell lines was evaluated in NSG mice using a method employed by Translational Drug Development, LLC (Scottsdale, AZ). In summary, 20 female NSG mice aged 5–8 weeks were individually housed in ventilated micro-isolated cages maintained under pathogen-free conditions 5–7 days prior to the start of the study. 5 × 10¹⁴ cells were placed in the right posterior flank of each mouse. 6 Each mouse was subcutaneously inoculated with NCI-H1975 lung cancer cells. The average tumor size was approximately 85 mm. 3 Upon reaching the target, the mice were further divided into five treatment groups shown in Table 10. On day 1, four of the treatment groups received a single intravenous dose of 200 μl, 1 × 10⁶, according to Table 10.7 Individual anti-CD70 CAR+ T cells were administered.

[0359] [Table 11]

[0360] Tumor volume was measured twice weekly from the start of treatment. By day 12 post-injection, animals treated with anti-CD70 CAR-T cells with TGFBRII editing showed attenuation of tumor growth. Tumors treated with anti-CAR-T cells in which both TGFBRII and Regnase genes were disrupted began to show a decrease in tumor volume by day 8 post-injection, and by day 29, tumors were eliminated in all four mice. This complete regression of tumors in the treated animals continued throughout 53 days post-injection. Treatment with anti-CD70 CAR+ / TRAC- / B2M- / CD70- / Reg- / TGFBRII-T cells resulted in potent activity against established H1975 lung cancer xenografts throughout 53 days post-injection (Figure 17B). These data demonstrate that disrupting TGFBRII alone, or TGFBRII and Regnase-1, in CAR-T cells has potent activity against human CD70+ lung cancer in vivo.

[0361] Example 15: Tumor re-challenge model, large renal cell carcinoma tumor xenograft model The efficacy of anti-CD70 CAR-T cells containing disrupted TGFBRII and / or Regnase-1 genes (see, e.g., Example 10) was tested in a subcutaneous A498 xenograft model using ACHN rechallenge. In summary, 5 million A498 cells were subcutaneously injected into the right flank of NSG mice. The tumor was approximately 425 mm². 3 The tumor-bearing mice were allowed to grow to their average size and then randomly divided into five groups (N=5 / group). Group 1 remained untreated, while groups 2-5 received one of the anti-CD70 CAR-T cell treatments shown in Table 11.

[0362] [Table 12]

[0363] On day 56, we started a second attempt at treating the tumor, 1 x 10 7 ACHN cells were injected into the left flank of treated mice and into a new control group (untreated).

[0364] As shown in Figure 18A, all mice treated with all CAR-T cell populations possessing disrupted TGFBRII and / or Regnase genes showed complete removal of A498 tumors by day 50. However, when mice were rechallenged with novel RCC tumor cells (ACHN) alone, CAR-T cells with editing of both Regnase and TGFBRII were able to remove the tumors more effectively than cells with disruption of either Regnase-1 or TGFBRII (Figure 18B).

[0365] Example 16: Analysis of T cell fractions in a renal cell carcinoma (CAKI-1) tumor xenograft model Blood samples were collected from mice with CAKI-1 RCC tumors 44 days after CAR-T administration. In summary, 100 μl of whole mouse blood was collected from the submandibular vein. Optimal erythrocyte lysis was achieved using erythrocyte lysis buffer, minimizing the impact on lymphocytes. Human and mouse cells were isolated by FACS using human and mouse CD45 as biomarkers. Blood samples were evaluated by flow cytometry to search for absolute CAR-T counts and memory T cell subsets. CAR-T cells and CD45RO+CD27+ were detected and central memory T cells defined using an anti-CD70 CAR anti-idiotype antibody. For relevant disclosures relating to the subject matter and objectives mentioned herein, please refer to U.S. Patent Application No. 63 / 069,889, which is incorporated by reference.

[0366] The results showed that the addition of TGFBRII and Regnase-1 gene editing significantly improved the central memory T cell population compared to editing either TGFBRII or Regnase-1 alone, which correlates with the substantial expansion of CAR-T cells observed in these animals (Figure 19A). Furthermore, editing of TGFBRII further enhanced the potential for CAR-T cell proliferation in vivo, suggesting a robust synergistic effect with Regnase editing (Figure 19B).

[0367] Example 17: Evaluation of anti-CD19 CAR-T cells with TGFBRII and / or Regnase-1 gene disruption in an intravenous dissemination model of NOG mice. Intravenously disseminated Nalm-6 human acute lymphoblastic leukemia tumor xenograft model The efficacy of anti-CD19 CAR-T cells with TGFBRII and / or Regnase-1 gene editing was further demonstrated using an intravenous dissemination model (dissemination model) with the Nalm-6 human acute lymphoblastic leukemia tumor cell line in NOG mice. The efficacy of various anti-CD19 CAR-T populations was evaluated in a dissemination model using the method employed by Translations Drug Development, LLC (Scottsdale, AZ) and the method described herein. In summary, 24 5-8 week old female CIEA NOG (NOD.Cg-Prkdc scid I12rg tm1Sug (JicTac) Mice were individually housed in ventilated micro-isolator cages maintained under pathogen-free conditions 5–7 days prior to the start of the study. At the start of the study, the mice were divided into five treatment groups as shown in Table 12. On day 1, mice in groups 2–4 received 0.5 × 10⁶ doses. 6 Nalm6 cells / mice were administered intravenously. Mice were inoculated intravenously to serve as a model for disseminated disease. On day 4 (3 days after Nalm6 cell injection), treatment groups 2-4 received a single intravenous administration of 200 μl of CAR+ T cells according to Table 12.

[0368] [Table 13]

[0369] During the trial period, the mice were observed daily, and their weight was measured twice a week as described above.

[0370] TGFBRII gene editing combined with regenase editing induced sustained NALM6 tumor regression at an earlier time (day 18) after tumor inoculation compared to editing alone. This reduction in tumor size was sustained (Figure 20A). The rapid reduction in tumor size 74 days after tumor inoculation in the TGFBRII KO group represented only 5 out of 15 mince. Ten out of 15 mice in the TGFBRII KO group had already reached the tumor BLI endpoint.

[0371] In Nalm6 model mice treated with anti-CD19 CAR+ cells, disruption of either TGFBRII or Regnase showed some survival-prolonging effect, but disruption of both TGFBRII and Regnase genes showed the greatest survival-prolonging effect (Figure 20B).

[0372] Intravenous dissemination of JeKo-1 tumor xenograft model The efficacy of anti-CD19 CAR-T cells with TGFBRII and / or Regnase gene editing was further demonstrated using an intravenous dissemination model (dissemination model) with the JeKo-1 human mantle cell lymphoma (MCL) tumor cell line in NOG mice. The efficacy of various anti-CD19 CAR-T populations was evaluated in a dissemination model using the method employed by Translations Drug Development, LLC (Scottsdale, AZ) and the method described herein. In summary, 24 5-8 week old female CIEA NOG (NOD.Cg-Prkdc scid I12rg tm1Sug (JicTac) Mice were individually housed in ventilated micro-isolator cages maintained under pathogen-free conditions 5–7 days prior to the start of the experiment. At the start of the experiment, the mice were divided into five treatment groups as shown in Table 13. On day 1, mice in groups 2–4 received 0.5 × 10⁶ doses. 6JeKo-1 cells / mice were administered intravenously. Mice were inoculated intravenously to serve as a model for disseminated disease. On day 4 (3 days after JeKo-1 cell injection), treatment groups 2-4 received a single intravenous administration of 200 μl of CAR-T cells according to Table 13.

[0373] [Table 14]

[0374] During the trial period, the mice were observed daily, and their weight was measured twice a week as described above.

[0375] In JeKo-1 model mice treated with anti-CD19 CAR+ cells, either TGFBRII or Regnase showed some survival-prolonging effect, but the greatest survival-prolonging effect was observed when both TGFBRII and Regnase gene editing were performed (Figure 21).

[0376] In vivo expansion of CAR-T cells The expansion of CAR-T cells was evaluated by measuring the copy number of CARs by ddPCR of DNA isolated from blood samples collected throughout the JeKo-1 and Nalm-6 studies described above.

[0377] DNA was isolated from mouse tissue using the Qiagen Dneasy blood and tissue kit (Qiagen, Venlo, Netherlands). The total mass of nucleic acids from RBC-lysed samples was quantified using either Nanodrop (Thermo Fisher Scientific) or DropSense96 (trinean, Gentbrugge, Belgium). A set of primers and 6-carboxyfluorescein (FAM)-labeled probes (shown in Table 14 below) was designed to quantify the level of CAR constructs integrated into the human TRAC locus by droplet digital PCR (ddPCR). ddPCR was performed using a Bio-Rad Automated Droplet Generator, Bio-Rad T100 Thermal Cycler, and Bio-Rad QX200 Droplet Reader (Bio-rad Laboratories, Hercules, CA). The absolute number of integrated CAR copies per sample was calculated using QuantaSoft Version 1.7.4.0917 (Bio-rad Laboratories) software. Finally, the absolute number of CAR copies per unit mass of input sample was calculated by dividing the number of detected CAR alleles by the total input DNA volume. The ddPCR assay detects the number of integrated CAR transgenes per unit mass of genomic DNA (gDNA) by amplifying an 866 bp unit replication sequence across the endogenous TRAC sequence and the CAR expression cassette promoter (EF-1α). In short, qualitative analysis of the assay provides linear data (R) within the tested range (2-300,000 copies per 1 μg of gDNA). 2 A result of >0.95 was obtained, and not only that, the % relative error (%RE) and coefficient of variation (%CV) within the normal range (%RE≦100% and %CV≦20%) for the condition ≥LLOQ were generated. LLOD and LLOQ were calculated based on available data, with LLOD set to 5 copies per 0.2 μg of gDNA and LLOQ set to 40 copies per 0.2 μg.

[0378] [Table 15]

[0379] These analyses are based on allogeneic CAR-T cells (TRAC). - / B2M - We demonstrate that adding either TGFBRII or Regnase-1 knockout to group C-10 allowed for a higher level of T cell expansion in the blood of treated mice (e.g., group C10-TG, C10-R, C10-TG / R) compared to groups treated with allogeneic CAR-T cells without these knockouts (e.g., group C10) (Figure 22A). This expansion was evident on day 14 of the JeKo-1 study. Loss of both TGFBRII and Regnase-1 (Figure 22A, C10-TG / R) resulted in a more uniform expansion compared to single knockouts of TGFBRII (Figure 22A, C10-TG) or Regnase-1 (Figure 22A, C10-R). In the Nalm-6 study, as shown in Figure 22B, the disruption of both TGFBRII and Regnase-1 had a synergistic effect on CAR-T cell expansion on day 28.

[0380] In summary, all groups that lost either TGFBRII or Regnase-1 showed an increase in CAR-T cells in their peripheral blood.

[0381] Example 18: Generation of CAR-T cells with multiple gene edits, and verification of gene editing. Activated primary human T cells were electroporated with a Cas9 / sgRNA RNP complex (200 pmol of Cas9, 1000 pmol of gRNA) to generate cells edited for TRAC- / β2M-, TRAC- / β2M- / Regnase-1-, TRAC- / β2M- / TGFBRII-, and TRAC- / β2M- / Regnase-1- / TGFBRII-. Sequences encoding anti-BCMA CAR were inserted into the TRAC locus using recombinant AAV6 carrying the anti-BCMA CAR DNA sequence (SEQ ID NO: 170). The following sgRNAs were used: TRAC (SEQ ID NO: 58), β2M (SEQ ID NO: 62), Reg-1 (SEQ ID NO: 51; REG1-Z10), and TGFBRII (SEQ ID NO: 313).

[0382] Flow cytometry was used to verify the editing of TRAC and β2M, as well as the insertion and expression of anti-BCMA CARs. In summary, approximately one week after electroporation, cells were stained with anti-human TCR, anti-human β2M, and recombinant biotinylated human BCMA / streptavidin-APC to evaluate the levels of TRAC and β2M editing, as well as the insertion of nucleotide sequences encoding anti-BCMA CARs.

[0383] TRAC- / β2M-, TRAC- / β2M- / Reg-1-, TRAC- / β2M- / TGFBRII-, and TRAC- / β2M- / Reg-1- / TGFBRII- anti-BCMA CAR+ T cells showed a constant percentage of TCR and β2M disruption, determined by flow cytometry at rates of >90% and >60%, respectively (Figures 23A and 23B). Anti-BCMA CAR expression was measured by flow cytometry by determining the percentage of cells binding to recombinant biotinylated BCMA / streptavidin-APC conjugates. All conditions, including those involving TRAC- / β2M-, TRAC- / β2M- / Reg-1-, TRAC- / β2M- / TGFBRII-, and TRAC- / β2M- / Reg-1- / TGFBRII- anti-BCMA CAR+ T cells, showed a constant percentage of CAR insertions (>70%), but unedited RNP-T cells did not exhibit detectable staining for anti-BCMA CARs (Figure 23C). Flow cytometry analysis revealed that the CD4 / CD8 T cell ratio in TRAC- / β2M-, TRAC- / β2M- / Reg-1-, TRAC- / β2M- / TGFBRII-, and TRAC- / β2M- / Reg-1- / TGFBRII- anti-BCMA CAR+ T cells remained constant in the range of 55-60% / 40-45% across all samples (Figure 23D).

[0384] TIDE analysis was performed to verify the editing rates of the Reg-1 and TGFBRII genes. In summary, approximately one week after electroporation, 2 million cells derived from TRAC- / β2M-, TRAC- / β2M- / Reg-1-, TRAC- / β2M- / TGFBRII-, and TRAC- / β2M- / Reg-1- / TGFBRII- anti-BCMA CAR+ T cells, as well as 2 million unedited T cells from the same donor, were removed from the culture and transferred to 1.5 mL microcentrifuge tubes. The cells were allowed to settle in a benchtop microcentrifuge at 300 g for 10 minutes, and the resulting supernatant was discarded. The cells were washed twice with 1000 μL of 1 × PBS, and the cell pellet was frozen at -80°C. Subsequently, the frozen cell pellet was used for genomic DNA extraction using the QIAamp DNA Blood Mini Kit (Qiagen, catalog #51106). Using gene-specific primers, regions adjacent to the cleavage sites of Reg-1 and TGFBRII were amplified (Invitrogen® Platinum® SuperFi® II Green PCR Master Mix; Catalog #12369050). The induced PCR unit replicate sequences were then sequenced and analyzed by TIDE to determine the indel pattern / frequency (edit frequency).

[0385] The analyzed indel frequencies were found to be within the expected ranges of 65–80% for TGF sgRNA and >80% for Regnase-1 sgRNA (Figures 24A and 24B).

[0386] Example 19: Cytotoxicity of anti-BCMA CAR-T cells with multiple gene editing Cytotoxicity (cytotoxicity) assays were used to evaluate the ability of TRAC- / β2M-, TRAC- / β2M- / Reg-1-, TRAC- / β2M- / TGFBRII-, and TRAC- / β2M- / Reg-1- / TGFBRII- anti-BCMA CAR+ T cells (produced by the methods disclosed herein; see, e.g., Example 18) to induce cytolysis in two target cell lines, MM.1S (multiple myeloma cell line) and JeKo-1 (mantle cell lymphoma cell line). Specific lysis of CAR+ T cells was determined using unedited RNP cells without CAR as a negative control. In summary, target cell lines were stained with eBioscience® Cell Proliferation Dye eFluor® 670 (Thermofisher Scientific; catalog #65-0840-85) according to the manufacturer's instructions and seeded at 50,000 cells per well in 96-well plates. Next, CAR-T cells or RNP-T cells were added to the wells containing target cells in ratios of 0, 0.5:1, 1:1, 2:1, or 4:1 (T cells:target cells), and incubated for approximately 4 hours for MM.1S and 24 hours for JeKo-1. After each incubation period, the 96-well plate was allowed to settle at 300g for 10 minutes, and 100 μL of supernatant was removed for cytokine quantification. Subsequently, the cells were washed once with 1×PBS, stained with 150 μl of 1×PBS supplemented with 0.5% BSA and 5 μg / mL DAPI (Invitrogen; catalog #D3571), and incubated in the dark for 15 minutes. After incubation, DAPI was rinsed off the cells, resuspended in 150 μl of 1×PBS supplemented with 0.5% BSA, and obtained and analyzed using a flow cytometer. Target cells were identified using eFluor-based fluorescence, and then separated into live and dead cells based on their DAPI fluorescence.

[0387] TRAC- / β2M- / Reg-1- / TGFBRII-anti-BCMA CAR+ T cells showed higher cytotoxicity against MM.1S cell lines (Figure 25A) and JeKo-1 cell lines (Figure 25C) compared to TRAC- / β2M-, TRAC- / β2M- / Regnase-1-, or TRAC- / β2M- / TGFBRII-anti-BCMA CAR+ T cells. Comparative data from K562 cells (as a control) are shown in Figures 25B and 25D.

[0388] Example 20: Effect of TGFBRII+Regnase-1 disruption on allogeneic CAR-T cells in an in vivo subcutaneous RPMI-8226 xenograft tumor model. The in vivo efficacy of allogeneic anti-BCMA CARs was evaluated using a subcutaneous tumor mouse model with the following gene disruptions: 1) β2M and TRAC, 2) β2M, TRAC, and TGFBRII, 3) β2M, TRAC, and Reg-1, and 4) β2M, TRAC, TGFBRII, and Reg-1. The subcutaneous tumor mouse model used was the RPMI-8226 tumor cell line derived from BCMA+ multiple myeloma in NSG mice. The TGFBRII gene was edited by CRISPR / Cas-mediated gene editing using the TGFBRII Ex5_T1 guide (SEQ ID NO: 313). The Reg-1 gene was edited by CRISPR / Cas-mediated gene editing using the Z10 guide (SEQ ID NO: 51). Anti-BCMA CAR-T cells express anti-BCMA CAR containing the amino acid sequence of SEQ ID NO: 146. See also sequence listings 22, 23, 27, and 39 below.

[0389] The efficacy of anti-BCMA CAR-T cells was evaluated in a subcutaneous xenograft model using the methods employed by Translations Drug Development, LLC (Scottsdale, AZ) and the methods described herein. In summary, 25 female NSG mice aged 5–8 weeks were individually housed in ventilated micro-isolated cages maintained under pathogen-free conditions 5–7 days prior to the start of the study. On day 1, 1 × 10¹⁶ cells were placed in the right posterior flank of the mice. 7Each mouse was subcutaneously inoculated with RPMI-8226 cells. Nine days later (day 10), the tumor inoculation site was examined to determine if the tumor was palpable. After confirming palpability, the mice were further divided into five treatment groups as shown in Table 1. All treatment groups received a single intravenous administration of 200 μl of 1e6 anti-BCMA CAR+ T cells.

[0390] [Table 16]

[0391] Throughout the study, mice were observed macroscopically once daily, and tumor volume and body weight were measured twice a week (approximately every 3-4 days) starting on day 10. A key endpoint was time to surrounding disease, and the effectiveness of T cell engraftment was also evaluated. During the study, the percentage of animal mortality and time to death were recorded for all groups. Mice were euthanized before reaching a mortal state. A mouse was defined as mortal and could be sacrificed if one or more of the following criteria were met: • Weight loss of 20% or more that continues for more than one week, Tumors that impair normal physiological functions such as eating, drinking, motility, and urination and / or defecation; Excessive diarrhea for a prolonged period resulting in excessive weight loss (>20%), or • Persistent wheezing and difficulty breathing.

[0392] Animals were also considered mortal if they had prolonged or excessive pain or suffering, as defined by clinical observation, including: collapse, kyphosis, complete / incomplete paralysis, abdominal distension, ulceration, abscess, seizures, and / or bleeding.

[0393] Mice treated with TRAC- / β2M- / TGFBRII- / Reg-1-anti-BCMA CAR+ T cells showed increased survival compared to untreated mice and mice treated with TRAC- / β2M-anti-BCMA CAR+ T cells, TRAC- / β2M- / TGFBRII-anti-BCMA CAR+ T cells, or TRAC- / β2M- / Reg-1-anti-BCMA CAR+ T cells (Figure 26B). Mice treated with TRAC- / β2M- / TGFBRII- / Regnase-anti-BCMA CAR+ T cells showed significant tumor regression, but none of the other conditions tested showed significant inhibition of tumor growth (Figure 26A). These data demonstrate that disrupting TGFBRII and Reg-1 in CAR-T cells increases the efficacy of CAR-T cells in a mouse xenograft tumor model.

[0394] Next, small amounts of blood were collected from each mouse for FACS analysis to characterize circulating CAR-T cells and determine the pharmacokinetics of the drug. Two weeks after CAR-T administration, approximately 75 μL of blood was withdrawn by inducing bleeding from the submandibular region. Subsequently, the blood was transferred to a K2 EDTA tube and transported overnight to CRISPR Therapeutics in a 4°C cold pack. The following day, the blood samples were processed with RBC (Red Blood Cell) Lysis Buffer (BioLegend®, catalog #420301) according to the manufacturer's instructions. Subsequently, the samples were subjected to anti-mouse CD16 / 32 blocking with anti-mouse Trustin FcX® (BioLegend®, catalog #101320) according to the manufacturer's instructions. The samples were then processed by flow cytometry to determine the prevalence of human CD45-expressing cells representing circulating CAR-T cells. Blood from mice treated with TRAC- / β2M- / TGFBRII- / Regnase-anti-BCMA CAR+ T cells showed a large amount of circulating human CD45+ cells, which was not observed in any of the other treatment groups (Figure 26C). This indicates that knockout of TGFBRII and Reg-1 results in a superior expansion of CAR-T cells in a multiple myeloma mouse xenograft model.

[0395] Example 21: Synergistic effect of TGFBRII + Regnase-1 disruption on allogeneic CAR-T cells in an in vivo subcutaneous JeKo-1 xenograft tumor model The in vivo efficacy of TRAC- / β2M-anti-BCMA CAR+ T cells and TRAC- / β2M- / TGFBRII- / Reg-1 / anti-BCMA CAR+ T cells was further evaluated using a subcutaneous tumor mouse model. The subcutaneous tumor mouse model used was the JeKo-1 tumor cell line derived from low-BCMA-expressing mantle cell lymphoma in NSG mice. The TGFBRII gene was edited by CRISPR / Cas-mediated gene editing using the TGFBRII Ex5_T1 guide (SEQ ID NO: 313). The Reg-1 gene was edited by CRISPR / Cas-mediated gene editing using the Z10 guide (SEQ ID NO: 51). Anti-BCMA CAR- T cells express anti-BCMA CAR containing the amino acid sequence of SEQ ID NO: 146. See also sequence listings 22, 23, 27, and 39 below.

[0396] The efficacy of anti-BCMA CAR-T cells was evaluated in a subcutaneous xenograft model using the methods employed by Translations Drug Development, LLC (Scottsdale, AZ) and the methods described herein. In summary, 15 female NSG mice aged 5–8 weeks were individually housed in ventilated micro-isolated cages maintained under pathogen-free conditions 5–7 days prior to the start of the study. On day 1, 5 × 10¹⁴ cells were placed in the right posterior flank of the mice. 6 Each mouse was subcutaneously inoculated with JeKo-1 cells. Subsequently, tumor size was measured periodically using a calipas. The average tumor size was 150 mm. 3 (Tolerance range is 125-175mm) 3 Once the mice reached a certain stage, they were further divided into three treatment groups as shown in Table 1. All treatment groups received a single intravenous administration of 200 μl of 10e6 anti-BCMA CAR+ T cells. The day of T cell injection was marked as day 1.

[0397] [Table 17]

[0398] Throughout the study, mice were observed macroscopically once daily, and tumor volume and body weight were measured twice a week (approximately every 3-4 days), starting from day 1. A key endpoint was time to surrounding disease, and the effectiveness of T cell engraftment was also evaluated. During the study, the percentage of animal mortality and time to death were recorded for all groups. Mice were euthanized before reaching a mortal state. A mouse was defined as mortal and could be sacrificed if one or more of the following criteria were met: • Weight loss of 20% or more that continues for more than one week, Tumors that impair normal physiological functions such as eating, drinking, motility, and urination and / or defecation; • Prolonged, excessive diarrhea resulting in excessive weight loss (>20%), or • Persistent wheezing and difficulty breathing.

[0399] Animals were also considered mortal if they had prolonged or excessive pain or suffering, as defined by clinical observation, including: collapse, kyphosis, complete / incomplete paralysis, abdominal distension, ulceration, abscess, seizures, and / or bleeding.

[0400] Mice treated with TRAC- / β2M- / TGFBRII- / Reg-1-anti-BCMA CAR+ T cells showed significantly increased survival compared to both untreated mice and mice treated with TRAC- / β2M-anti-BCMA CAR+ T cells (Figure 27B). Tumor growth was stunted in mice treated with TRAC- / β2M- / TGFBRII- / Reg-1-anti-BCMA CAR+ T cells, but TRAC- / β2M-anti-BCMA CAR+ T cells did not significantly inhibit tumor growth (Figure 27A). These data demonstrate that disrupting the TGFBRII and Reg-1 genes in CAR-T cells increases the efficacy of CAR-T cells in a mouse xenograft tumor model.

[0401] Next, small amounts of blood were collected from each mouse for FACS analysis to characterize circulating CAR-T cells and determine the pharmacokinetics of the drug. Approximately 75 μL of blood was withdrawn by inducing bleeding from the submandibular region two and three weeks after CAR-T administration. Subsequently, the blood was transferred to a K2 EDTA tube and transported overnight to CRISPR Therapeutics in a 4°C cold pack. The following day, the blood samples were treated with RBC (Red Blood Cell) Lysis Buffer (BioLegend®, catalog #420301) according to the manufacturer's instructions. Subsequently, the samples were subjected to anti-mouse CD16 / 32 blocking using anti-mouse Trustin FcX® (BioLegend®, catalog #101320) according to the manufacturer's instructions. To quantify the number of circulating T cells, the total number of human CD4 and CD8-positive cells was determined. At two weeks, blood from mice administered with TRAC- / β2M- / TGFBRII- / Reg-1-anti-BCMA CAR+ T cells showed significantly higher concentrations of human CD4 and human CD8+ expressing cells compared to blood from mice administered with TRAC- / β2M-anti-BCMA CAR+ T cells (Figure 27C).

[0402] Furthermore, TRAC- / β2M-TGFBRII- / Reg-1-anti-BCMA CAR+ T cells showed lower expression of T cell exhaustion markers Lag3 and PD1 compared to TRAC- / β2M-anti-BCMA CAR+ T cells (Figure 27D). At 3 weeks, the overall level of circulating hCD45+ cells was equal between the groups (Figure 27E), but Lag3 and PD1 expression remained low in mice treated with TRAC- / β2M-TGFBRII- / Reg-1-anti-BCMA CAR+ T cells (Figure 27F). This indicates that CAR-T cells containing TGFBRII and Regnase knockouts reduce the expression of T cell exhaustion markers PD-1 and Lag3 while exhibiting superior expansion capabilities compared to CAR-T cells without these edits.

[0403] Example 22: Generation of anti-PTK7 CAR-T cells possessing disrupted TGFBRII and Regnase-1 genes. Allogeneic human T cells expressing a chimeric antigen receptor (CAR) targeting PTK7 were produced, without expression of the TRAC gene, β2M gene, TGFBRII gene, and Reg-1 gene. Activated human T cells were electroporated with Cas9:sgRNA RNP (1 μM Cas9, 5 μM gRNA) and subsequently incubated with recombinant adeno-associated adenovirus vector, serotype 6 (AAV6) (MOI 50,000).

[0404] Recombinant AAV contained a nucleotide sequence encoding an anti-PTK7 CAR, including the amino acid sequence of SEQ ID NO: 349. The following sgRNAs were used: TRAC (SEQ ID NO: 58), β2M (SEQ ID NO: 62), TGFBRII (SEQ ID NO: 313), and REGNASE-1 (SEQ ID NO: 51). sgRNAs that form RNPs with the Cas9 enzyme can be introduced into T cells in a single electroporation event to produce the modified cell population shown in Table 17 below. After electroporation, the cells are transduced with recombinant AAV to introduce a donor template encoding an anti-PTK7 CAR.

[0405] [Table 18]

[0406] Seven days after electroporation, CAR expression on T cells was examined by flow cytometry. Both anti-PTK7 CAR-T cells, anti-PTK7 CAR-T cells without TGFBRII, and anti-PTK7 CAR-T cells without TGFBRII and Regnase expressed approximately the same amount of CAR on their surface seven days after HDR. The results are shown in Table 18 below.

[0407] [Table 19]

[0408] Efficient editing of TGFBRII and / or Regnase was achieved in engineered anti-Ptk7 CAR-T cells (Table 19 below), showing increased cell proliferation due to the disruption of TGFBRII and Reg-1 (Figure 28), while cell survival and the CD4+ / CD8+ T cell ratio remained unchanged.

[0409] [Table 20]

[0410] In summary, the data presented in this example demonstrate that disruption of TGFBRII and / or Reg-1 in anti-Ptk7 CAR-T cells (e.g., anti-PTK7 CAR+ / TRAC- / B2M- / TGFBRII-, or anti-PTK7 CAR+ / TRAC- / B2M- / TGFBRII- / Reg-1-) can increase cell proliferation while not affecting cell survival or the CD4 / CD8 cell ratio.

[0411] Example 23: Destruction of TGFBRII alone increases CAR-T cell killing during continuous in vitro rechallenge. The anti-PTK7 CAR generated above + T cells were successively rechallenged in the PTK7+ osteosarcoma cell line Saos2, and their ability to kill the PTK7+ osteosarcoma cell line Saos2 was evaluated.

[0412] The anti-PTK7 CAR used in this experiment + T cells include the following edits: ·Anti-PTK7 CAR-T cells: Anti-PTK7 CAR+ / TRAC- / B2M- ·Anti-PTK7 CAR-T+TGFBRII KO cells: Anti-PTK7 CAR+ / TRAC- / B2M- / TGFBRII- ·Anti-PTK7 CAR-T+TGFBRII KO+Reg KO cells: Anti-PTK7 CAR+ / TRAC- / B2M- / TGFBRII- / Reg-.

[0413] In a 96-well plate format, CAR-T cells were initially co-cultured with Saos2 cells on day 0 (6,250 CAR-T cells, 50,000 tumor cells), and then re-challenged with 50,000 tumor cells on days 2, 4, 6, 8, 10, 12, and 14.

[0414] Tumor cell and CAR-T cell counts were analyzed using flow cytometry on days 1, 3, 5, 7, 9, 11, and 13 (the method was modified from Wang et al., JoVE 2019). The antibodies listed in Table 20 below were used at a 1:100 dilution.

[0415] [Table 21]

[0416] The results show that when CAR-T cells were repeatedly challenged with PTK7+ positive target cells, disruption of the TGFBRII gene improved efficacy (as measured by human CD45 staining) (Figure 29A) and CAR-T cell expansion (Figure 29B). Adding disruption of the Regnase gene did not provide an additional efficacy benefit exceeding that of TGFBRII deletion alone. Efficacy and expansion were improved compared to CAR-T cells that lacked either of the disrupted genes or both (i.e., TGFBRII and Regnase). Furthermore, these results demonstrate that when the TGFBRII gene is disrupted, cytotoxic CD8+ CAR-T cells persist longer during continuous retries on tumor cells (Figure 29C) compared to anti-PTK7 CAR-T cells that lacked either of the disrupted genes or both (i.e., TGFBRII and Regnase). CD4+ CAR-T cells remained constant regardless of whether the TGFBRII and / or Regnase genes were disrupted or not (Figure 29D).

[0417] Example 24: Therapeutic efficacy of anti-PTK7 CART cells with multiple gene disruptions in a subcutaneous pancreatic cell carcinoma xenograft model. Treatment in a pancreatic cell carcinoma model The ability of T cells expressing PTK7 CARs with TGFBRII and / or Reg-1 gene editing to eliminate pancreatic cell carcinoma cells expressing moderate levels of PTK7 was evaluated in vivo using a subcutaneous renal cell carcinoma (Hs766T) tumor xenograft mouse model. Anti-PTK7 CAR+ T cells were produced as described above. See, for example, Example 22.

[0418] The ability of these anti-PTK7 CAR+ T cells to improve disease caused by PTK7+ pancreatic cancer cell lines was evaluated in NSG mice using a method employed by Translational Drug Development, LLC (Scottsdale, AZ). In summary, 20 female NSG mice aged 5–8 weeks were individually housed in ventilated micro-isolated cages maintained under pathogen-free conditions 5–7 days prior to the start of the study. 5 × 10⁶ cells were placed in the right posterior flank of each mouse. 6 Subcutaneous inoculation of Hs766T pancreatic cell carcinoma cells / mice was administered. The average tumor size was approximately 50 mm. 3 Upon reaching the target, the mice were further divided into three treatment groups as shown in Table 21. On day 1, the four treatment groups received a single intravenous dose of 200 μl of 0.5 × 10¹⁶ according to Table 21. 7 Individual anti-PTK7 CAR+ T cells were administered.

[0419] [Table 22]

[0420] Tumor volume was measured twice a week (approximately every 3-4 days) from the start of treatment. By day 11 after injection, anti-PTK7 CAR-T cells with and without TGFBRII gene knockout began to show a significant effect on reducing tumor volume compared to the untreated group 1. Approximately one month later, in the subcutaneous Hs766T model, anti-PTK7 CAR-T cells with and without TGFBRII knockout cells showed complete cessation of tumor growth (Figure 30A).

[0421] These results demonstrate that disrupting the TGFBRII gene in CAR-T cells effectively eliminated tumors in a subcutaneous Hs766T renal cell carcinoma xenograft model. No clinical signs of GvHD were observed in anti-PTK7 CAR-T cells with or without TGFBRII knockout cells (Figure 30B).

[0422] Example 25: Analysis of T cell fractions in a pancreatic cell carcinoma (Hs766T) tumor xenograft model Blood samples were collected from mice with Hs766T tumors 47 days after CAR-T administration. In summary, 100 μl of whole mouse blood was collected from the submandibular vein. Optimal erythrocyte lysis was achieved using erythrocyte lysis buffer, minimizing the impact on lymphocytes. Human and mouse cells were isolated by FACS using human and mouse CD45 as biomarkers. Blood samples were evaluated by flow cytometry to search for absolute human CD45+ counts and memory T cell subsets. Central memory T cells were defined using CD45RO+CD27+ staining.

[0423] The results showed that the addition of TGFBRII gene editing significantly improved the central memory T cell population compared to anti-PTK7 CAR-T cells without TGFBRII knockout (Figure 31B), which correlates with the substantial expansion of CAR-T cells observed in these animals (Figure 31A). Furthermore, TGFBRII editing further enhanced the potential for CAR-T cell proliferation in vivo (Figure 31B).

[0424] Sequence List The following table provides details of the various nucleotide and amino acid sequences disclosed herein.

[0425] [Table 23]

[0426] [Table 24]

[0427] Table 25

[0428] Table 26

[0429] Table 27

[0430] Table 28

[0431] Table 29

[0432] Table 30

[0433] Table 31

[0434] Table 32

[0435] Table 33

[0436] Table 34

[0437] Table 35

[0438] Table 36

[0439] Table 37

[0440] Table 38

[0441] Table 39

[0442] Table 40

[0443] Table 41

[0444] Table 42

[0445] Table 43

[0446] Table 44

[0447] Table 45

[0448] Table 46

[0449] Table 47

[0450] Table 48

[0451] Table 49

[0452] Table 50

[0453] Table 51

[0454] Table 52

[0455] Table 53

[0456] Table 54

[0457] Table 55

[0458] Table 56

[0459] Table 57

[0460] Table 58

[0461] Table 59

[0462] Table 60

[0463] Table 61

[0464] Table 62

[0465] Table 63

[0466] Table 64

[0467] Table 65

[0468] [Table 66]

[0469] [Table 67]

[0470] [Table 68]

[0471] [Table 69]

[0472] [Table 70]

[0473] [Table 71]

[0474] [Table 72]

[0475] Other Embodiments All features disclosed herein can be combined in any combination. Each feature disclosed herein can be replaced by an alternative feature that serves the same, equivalent, or similar purpose. Thus, unless expressly indicated otherwise, each feature disclosed is merely an example of a general set of equivalent or similar features.

[0476] From the above description, those skilled in the art will readily grasp the essential characteristics of the present invention and can make various modifications and alterations to adapt the invention to various uses and conditions without departing from its spirit and scope. Therefore, other embodiments are also included within the scope of these claims.

[0477] Equal parts While several embodiments of the present invention have been described and illustrated herein, those skilled in the art will readily conceive of various other means and / or structures to perform the functions described herein and / or obtain the results and / or one or more advantages. Furthermore, each of such variations and / or modifications is considered to be within the scope of the embodiments of the present invention described herein. More broadly, those skilled in the art will readily understand that all parameters, dimensions, materials and configurations described herein are intended as examples, and that actual parameters, dimensions, materials and / or configurations will depend on the specific application in which the teachings of the present invention are used. Those skilled in the art can recognize or confirm many equivalents to specific embodiments of the present invention described herein using only routine experiments. Accordingly, it should be understood that the embodiments described above are presented merely as examples, and that embodiments of the present invention may be practiced in ways other than those specifically described and claimed, within the scope of the appended claims and their equivalents. Embodiments of the present invention in this disclosure cover each individual feature, system, article, material, kit and / or method described herein. In addition, any combination of two or more such features, systems, articles, materials, kits and / or methods is included within the scope of the present invention as long as such features, systems, articles, materials, kits and / or methods are not mutually inconsistent.

[0478] All definitions defined and used herein should be understood to take precedence over dictionary definitions, definitions in literature incorporated by reference, and / or the ordinary meaning of the terms defined.

[0479] All references, patents, and patent applications disclosed herein are incorporated by reference with respect to the subject matter they cite, and may in some cases encompass the entirety of the reference.

[0480] When used herein and in the claims, the indefinite articles "a" and "an" should be understood to mean "at least one" unless explicitly stated otherwise.

[0481] When used herein and in the claims, the expression “and / or” should be understood to mean “either or both” of the elements thus combined, i.e., elements presented in some cases conjunctively and in other cases disjunctly. Multiple elements listed with “and / or” should be treated similarly, i.e., interpreted as “one or more” of the elements thus combined. In addition to the elements specifically identified by the “and / or” clause, other elements may be presented at will, whether related to or unrelated to the specifically identified elements. As a non-restrictive example, when used with open-ended terms such as “including,” a reference to “A and / or B” may, for example, refer to A only (optionally including elements other than B) in one embodiment, B only (optionally including elements other than A) in another embodiment, and both A and B (optionally including other elements) in yet another embodiment.

[0482] Where used herein and in the claims, “or” should be understood to have the same meaning as “and / or” as defined above. For example, when separating items in a list, “or” or “and / or” should be interpreted as inclusive, i.e., including at least one of the list of elements, but also including two or more and optionally additional unlisted items. Only terms that clearly indicate the opposite, such as “only one of” or “exactly one of” or, when used in the claims, “consisting of,” refer to the inclusion of multiple elements or exactly one element of a list of elements. In general, where used herein, the term “or” should be interpreted as merely indicating an exclusive substitute (i.e., “one or the other, but not both”) when placed before an exclusive term such as “either,” “one of,” “only one of” or “exactly one of”. Where used in the claims, “essentially consisting of” should have the usual meaning as it is used in the field of patent law.

[0483] As used herein, the term “about” means within the tolerance range of a particular value as determined by those skilled in the art, which depends in part on the method by which the value is measured or determined, i.e., the limits of the measuring system. For example, “about” may mean within the tolerance standard deviation according to the convention of the art. Alternatively, “about” may mean within a range of up to ±20%, preferably up to ±10%, more preferably up to ±5%, and even more preferably up to ±1% of a given value. Where a particular value is described in this application and claims, unless otherwise indicated, the term “about” is implicit and in relation to that, means that the particular value is within the tolerance range.

[0484] When used herein, the phrase “at least one” in relation to an enumeration of one or more elements should be understood to mean at least one element selected from any one or more elements in the enumeration of elements, but not necessarily including at least one of every element specifically enumerated in the enumeration of elements, nor necessarily excluding any combination of elements in the enumeration of elements. This definition also makes it possible that elements other than those specifically identified may be optionally present in the enumeration of elements that the phrase “at least one” means, whether or not they relate to those specifically identified elements. Therefore, as a non-restrictive example, "at least one of A and B" (or in other words, "at least one of A or B," or in other words, "at least one of A and / or B") may, in one embodiment, refer to at least one that optionally includes two or more A's and does not include B (and optionally includes elements other than B); in another embodiment, refer to at least one that optionally includes two or more B's and does not include A (and optionally includes elements other than A); and in yet another embodiment, refer to at least one that optionally includes two or more A's and optionally includes two or more B's (and optionally includes other elements), and so on.

[0485] Similarly, unless explicitly stated otherwise, in any method claimed herein that includes two or more steps or actions, the order of the steps or actions of the method is not necessarily limited to the order in which the steps or actions of the method are enumerated.

Claims

1. (i) the disrupted RegNase-1 (Reg1) gene, and (ii) Disrupted transforming growth factor β receptor II (TGFBRII) gene A population of genetically modified T cells, including T cells containing [specific traits / conditions].

2. The population of genetically modified T cells according to claim 1, wherein the T cells are further modified to express a chimeric antigen receptor (CAR).

3. The genetically engineered T cell population according to claim 1, wherein the disrupted Reg1 gene is gene-edited within exon 2 and / or exon 4.

4. The genetically engineered T cell population according to claim 1, wherein the disrupted TGFBRII gene is gene-edited within exon 4 or exon 5.

5. The genetically modified T cell population according to claim 1, wherein the disrupted Reg1 gene, the disrupted TGFBRII gene, or both are gene-edited by a CRISPR / Cas-mediated gene editing system.

6. The population of genetically modified T cells according to claim 5, wherein the CRISPR / Cas-mediated gene editing comprises a guide RNA (gRNA) that targets a part of the Reg1 gene, and the target site is selected from the group consisting of SEQ ID NOs: 320, 322, 323, and 327.

7. The population of genetically engineered T cells according to claim 6, wherein the gRNA that targets the Reg1 gene comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 22, 30, 34, and 50.

8. The population of genetically modified T cells according to claim 5, wherein the CRISPR / Cas-mediated gene editing system includes a guide RNA (gRNA) that targets a part of the TGFBRII gene, and the target site includes a nucleotide sequence selected from the group consisting of SEQ ID NOs: 275, 305, 311, and 317.

9. The population of genetically engineered T cells according to claim 8, wherein the gRNA that targets the TGFBRII gene comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 270, 300, 306, and 312.

10. (iii) Disrupted T cell receptor alpha chain constant region (TRAC) gene, (iv) Disrupted beta-2-microglobulin (β2M) gene, (v) A disrupted CD70 gene, or A population of genetically modified T cells according to claim 1, further comprising any combination of (vi), (iii) to (v).

11. The population of genetically modified T cells according to claim 10, wherein the T cells comprise a disrupted T cell receptor alpha chain constant region (TRAC) gene and a disrupted beta-2-microglobulin (β2M) gene.

12. The population of genetically modified T cells according to claim 11, wherein the T cells further comprise a disrupted CD70 gene.

13. The genetically engineered T cell population according to claim 12, wherein the disrupted TRAC gene, the disrupted β2M gene, and / or the disrupted CD70 gene are gene-edited by one or more CRISPR / Cas-mediated gene editing systems.

14. The population of genetically modified T cells according to claim 2, wherein the T cells contain nucleic acids encoding the CAR, and the nucleic acids are inserted into the genome of the T cells.

15. A population of genetically modified T cells according to claim 14, wherein the nucleic acid encoding the CAR is inserted into the disrupted TRAC gene.

16. The population of genetically engineered T cells according to claim 2, wherein the CAR comprises an extracellular antigen-binding domain specific to a tumor antigen, a 4-1BB or CD28 costimulatory signaling domain, and a CD3ζ cytoplasmic signaling domain.

17. The population of genetically modified T cells according to claim 16, wherein the tumor antigen is CD19, BCMA, CD70, CD33, or PTK7.

18. The CAR binds to CD19 (anti-CD19 CAR), and the extracellular antigen-binding domain in the anti-CD19 CAR is a single-chain variable fragment (scFv) that binds to CD19 (anti-CD19 scFv), and the anti-CD19 scFv has a heavy chain variable region (V) that includes the same heavy chain complementarity-determining region (CDR) as that of SEQ ID NO:

124. Ｈ (ii) a light chain variable region (V) containing the same light chain CDR as in sequence number 125. Ｌ A population of genetically modified T cells according to claim 17, including )

19. The aforementioned V Ｈ The amino acid sequence of sequence number 124 is included, and the V Ｌ A population of genetically modified T cells according to claim 18, wherein the T cells include the amino acid sequence of sequence number 125.

20. The population of genetically modified T cells according to claim 19, wherein the anti-CD19 scFv comprises the amino acid sequence of SEQ ID NO:

120.

21. The population of genetically modified T cells according to claim 20, wherein the anti-CD19 CAR comprises the amino acid sequence of SEQ ID NO: 117 or SEQ ID NO:

353.

22. The population of genetically modified T cells according to claim 21, wherein the T cells comprise a disrupted T cell receptor alpha chain constant region (TRAC) gene and a disrupted beta-2-microglobulin (β2M) gene, and the nucleic acid encoding the anti-CD19 CAR is inserted into the disrupted TAC gene.

23. The CAR binds to CD70 (anti-CD70 CAR), and the extracellular antigen-binding domain in the anti-CD70 CAR is a single-chain variable fragment (scFv) that binds to CD70 (anti-CD70 scFv), and the anti-CD70 scFv has a heavy chain variable region (V) that includes the same heavy chain complementarity-determining region (CDR) as that of SEQ ID NO:

143. Ｈ (ii) a light chain variable region (V) containing the same light chain CDR as in sequence number 144. Ｌ A population of genetically modified T cells according to claim 17, including )

24. The aforementioned V Ｈ The amino acid sequence of sequence number 143 is included, and the V Ｌ A population of genetically modified T cells according to claim 23, comprising the amino acid sequence of sequence number 144.

25. The population of genetically modified T cells according to claim 24, wherein the anti-CD70 scFv comprises the amino acid sequence of SEQ ID NO: 140 or 142.

26. The genetically engineered T cell population according to claim 25, wherein the anti-CD70 CAR comprises the amino acid sequence of SEQ ID NO: 138 or SEQ ID NO:

354.

27. The population of genetically modified T cells according to claim 26, wherein the T cells comprise a disrupted T cell receptor alpha chain constant region (TRAC) gene, a disrupted beta-2-microglobulin (β2M) gene, and a disrupted CD70, and the nucleic acid encoding the anti-CD70 CAR is inserted into the disrupted TAC gene.

28. The population of genetically modified T cells according to claim 1, wherein the genetically modified T cells are derived from primary T cells of one or more human donors.

29. A pharmaceutical composition comprising a population of genetically modified T cells as described in claim 1, and a pharmaceutically acceptable carrier.

30. (i) The disrupted RegNase-1 (Reg1) gene, (ii) Disrupted transforming growth factor β receptor II (TGFBRII) gene, (iii) Disrupted T cell receptor alpha chain constant region (TRAC) gene, (iv) The disrupted beta-2-microglobulin (β2M) gene, and (v) Anti-CD19 CAR gene inserted into the disrupted TRAC gene A population of genetically modified T cells, including T cells containing [specific traits / conditions].

31. (i) The disrupted RegNase-1 (Reg1) gene, (ii) Disrupted transforming growth factor β receptor II (TGFBRII) gene, (iii) Disrupted T cell receptor alpha chain constant region (TRAC) gene, (iv) The disrupted beta-2-microglobulin (β2M) gene, and (v) Anti-CD70 CAR gene inserted into the disrupted TRAC gene A population of genetically modified T cells, including T cells containing [specific traits / conditions].

Images