Enhancement of eutrophin expression in cells by inducing mutations in eutrophin regulatory elements, and its therapeutic use.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- GENETHON
- Filing Date
- 2021-09-29
- Publication Date
- 2026-08-03
AI Technical Summary
が上回るものである。
Smart Images

Figure 0007899166000004 
Figure 0007899166000005 
Figure 0007899166000006
Abstract
Description
[Technical Field]
[0001] The present invention relates to a composition for enhancing eutrophin expression in cells by inducing mutations in a target sequence containing a eutrophin regulatory element using a gene editing enzyme. The present invention also relates to its therapeutic use for the treatment of dystrophin disorders. [Background technology]
[0002] Duchenne muscular dystrophy (DMD) is a fatal X-linked neuromuscular disorder caused by mutations in the dystrophin gene. The disease affects 1 in 5,000 newborn males and is one of the most common recessive disorders in the human population. In the absence of the dystrophin protein, the connections between the cytoskeleton and the extracellular matrix are impaired, resulting in a loss of muscle strength, flexibility, and stability. DMD patients are wheelchair-bound by age 12 and typically die between 20 and 40 years of age, usually due to cardiopulmonary failure. While considerable advances have been made in genetic, cellular, and pharmacological strategies, there is currently no effective treatment for DMD.
[0003] Among gene-based strategies, exon skipping and stop codon readthrough have shown limited efficacy and are applicable only to specific subsets of DMD patients. The use of exon skipping generally refers to the use of synthetic antisense oligonucleotides that inhibit splice enhancer sites to prevent specific exons from participating in splicing (Mann CJ et al. Proc Natl Acad Sci US A. January 2, 2001; 98(1): pp. 42-47). The exon skipping approach can only be used in certain patients who may have deletions that can be repaired by skipping additional exons adjacent to the deletion in the reading frame (Perry B Shieh, Neurotherapeutics. October 2018; 15(4): pp. 840-848). Gene therapy using recombinant adeno-associated virus (rAAV) and microdystrophin is currently the most promising approach (see Sakamoto M et al., Biochem Biophys Res Commun. May 17, 2002; 293 (4): pp. 1265-12672), but the safety and efficacy of the treatment are still under evaluation. Furthermore, this approach delivers truncated and partially functional dystrophin, and does not replicate the benefits of full-length dystrophin.
[0004] An alternative therapeutic approach applicable to all DMD patients, and potentially to Becker-type patients, consists of upregulating eutrophin, a structural and functional paralog of dystrophin, which can counteract the major defect in DMD regardless of the patient's genetic defect. Previous studies have demonstrated that a 3-fold increase in eutrophin levels rescues the pathophysiology of dystrophin in different animal models of DMD without any toxic effects. Several mechanisms for upregulating eutrophin expression at the gene, mRNA, and protein levels have been previously described. For example, in WO2015 / 018503, a recombinant adeno-associated virus (AAV) vector containing a gene encoding a fusion protein with a transcriptional activation element fused to a zinc finger protein that enables increased eutrophin expression is disclosed. In the same manner, a dual AAV system has been developed using a combination of Cas9 (dCas9) with inactivated nuclease activity fused to the transcriptional activation domain. Co-injection of AAV-dCas9 and AAV-gRNA-targeted utrophin can improve muscular dystrophy symptoms in the mdx mouse model of DMD (see Liao H. et al., Cell. December 14, 2017; 171(7): pp. 1495-507). A similar approach is disclosed in WO2020 / 101042.
[0005] Another approach involved targeting eutrophin repressor elements that upregulate eutrophin expression. Indeed, several eutrophin transrepressors have been identified in the 5'UTR / promoter-enhancer region (e.g., EN1, EN2, and Ets-2). Utrophin is also subject to repression by several miRNAs (e.g., Let7c, miR-206) and cis-AU rich repressor sequences in the 3'UTR region. Recently, it was shown that a 2'-O-methyl oligonucleotide that blocks the let7 miR binding site in eutrophin mRNA upregulated eutrophin protein expression 2-fold and 3-fold in mouse myoblasts and the mdx mouse model of DMD, respectively (WO2019 / 183005). Upregulation of eutrophin was associated with significant histological and functional improvements (Mishra et al., PLoS One. 2017, 12(10):e0182676). Inhibition of miRNAs using antisense sequences in C2C12 cells is also described in WO2009 / 134710. However, these approaches require sustained expression of the transgene to activate eutrophin expression, leaving the need to develop strategies in which the pregnancy modification that induces upregulation of eutrophin is permanent.
[0006] Recently, a CRISPR / Cas9-based approach has been used in vitro in immortalized human myoblasts to delete the 3'UTR region of the eutrophin (UTRN) gene, which includes the miRNA binding site (Soblechero-Martin et al., 2020, bioRχiv preprint; doi.org / 10.1101 / 2020.02.24.962316; Kasturi Sengupta et al., Molecular therapy: Nucleic Acids, 2020, p. 22). Complete deletion of the regulatory element can induce mRNA instability and ectopic expression of eutrophin, which can ultimately lead to adverse effects. [Prior art documents] [Patent Documents]
[0007]
Patent Document 1
Patent document 2
Patent Document 3
Patent document 4
Patent document 5
Patent document 6
Patent document 7
Patent document 8
Patent Document 9
Patent document 10
Patent document 11
Non-licensed literature
[0008] [Non-licensed document 1] Mann CJらProc Natl Acad Sci US A. January 2, 2001; 98(1):42~7 pages [Non-licensed document 2] Perry B Shieh, Neurotherapeutics. October 2018; 15(4): 840-848. [Non-licensed document 3] Sakamoto Mら, Biochem Biophys Res Commun. May 17, 2002; 293 (4): 1265~72 pages
Non-licensed Document 4
Non-licensed Document 5
Non - Patent Document 28
Non - Patent Document 29
Non - Patent Document 30
Non - Patent Document 31
Non - Patent Document 32
Non - Patent Document 33
[0009] The inventors have developed a novel therapeutic strategy for DMD based on eutrophin upregulation using gene editing enzymes such as the CRISPR-Cas system to disrupt the repressor domain in the eutrophin promoter or to disrupt the binding site of miR or other RNA unstable elements in order to desuppress eutrophin transcription and translation, respectively, and thus upregulate eutrophin levels. Unlike previous methods such as exon skipping / oligonucleotides, this strategy acts at the DNA level, and therefore the expected modifications will be permanent. In contrast to complete deletion of the regulatory element, the inventors here used gene editing enzymes such as CRISPR / Cas with a single guide RNA to induce mutations precisely within the target sequence. In contrast to deletion of the regulatory element, the method used herein allows for the maintenance of the stability of the regulatory element adjacent to the target repressor binding site, thereby reducing side effects. Furthermore, compared to conventional gene therapies based on truncated proteins lacking critical binding sites, a specific targeting strategy to upregulate endogenous eutrophin will result in full-length eutrophin with better therapeutic and immunological potential. Using this strategy, we demonstrated that specific disruption of the Let7c binding site, miR-196b binding site, ERF binding site, and EN1 binding site 2, in particular, allows for a more efficient increase in eutrophin expression compared to other repressor binding sites. Surprisingly, specific disruption of a single repressor binding site, especially the Let7c binding site, increased eutrophin expression as efficiently as deletion of the entire region of the repressor binding site, including clusters of repressor binding sites. In the mdx mouse model of DMD, co-administration of rAAV expressing Cas9 and rAAV expressing a single gRNA targeting the Let7c binding site improved muscle structure and histology compared to controls. This opens up new prospects for the treatment of dystrophin disorders.
[0010] The present invention relates to a method for enhancing eutrophin expression in cells, comprising the steps of introducing into cells a composition comprising at least one gene editing enzyme capable of inducing a sequence-specific mutation in a target sequence including a repressor binding site of the eutrophin gene selected from the group consisting of an Ets-2-repressor factor (ERF) binding site, preferably an Ets-2-repressor factor (ERF) binding site consisting of sequence CGGAA, a homeobox protein engrailed-1 (EN1) binding site 2, preferably a homeobox protein engrailed-1 (EN1) binding site 2 consisting of GTAGTGG, a Let7c binding site, preferably a Let7c binding site consisting of SEQ ID NO: 1, and a miR-196b binding site, preferably a miR-196b binding site consisting of SEQ ID NO: 2, wherein the mutation disrupts the repressor binding site without deleting the entire repressor binding site sequence.
[0011] In certain embodiments, the gene editing enzyme is a CRISPR / Cas gene editing enzyme comprising a site-specific nuclease, a base editor, and a prime editor, and more specifically, a guide RNA comprising a complementary sequence to the target sequence including a eutrophin repression binding site. In preferred embodiments, the gRNA comprises a sequence selected from the group consisting of SEQ ID NOs: 3-17 and 25.
[0012] In a particular embodiment, if the composition comprises at least two gene editing enzymes which are sequence-specific nucleases, the nucleases are used sequentially such that a first sequence-specific nuclease induces a first site-directed mutation event in the target sequence, and once the first mutation event is repaired, a second sequence-specific nuclease is used to induce a second site-directed mutation event in the target sequence.
[0013] In another embodiment, the present invention relates to a composition for enhancing eutrophin expression, comprising at least one gene editing enzyme capable of inducing a site-directed mutation in a target sequence including at least one repressor binding site of the eutrophin gene selected from the group consisting of an Ets-2-repressor factor (ERF) binding site, preferably an Ets-2-repressor factor (ERF) binding site consisting of the sequence CGGAA, a homeobox protein engrailed-1 (EN1) binding site 2, preferably a homeobox protein engrailed-1 (EN1) binding site 2 consisting of the sequence GTAGTGG, a Let7c binding site, preferably a Let7c binding site consisting of SEQ ID NO: 1, and a miR-196b binding site, preferably a miR-196b binding site consisting of SEQ ID NO: 2, wherein the mutation disrupts the repressor binding site without deleting the entire repressor binding site sequence. In some preferred embodiments, the repressor binding site of the eutrophin gene is a Let7c binding site, preferably a Let7c binding site consisting of SEQ ID NO: 1.
[0014] In a particular embodiment, the composition comprises a CRISPR / Cas gene editing enzyme comprising a guide RNA comprising a complementary sequence to the target sequence containing the eutrophin repression site. In a preferred embodiment, the gRNA comprises a sequence selected from the group consisting of SEQ ID NOs: 3-17 and 25.
[0015] In certain embodiments, the gene editing enzyme is encoded by a nucleic acid construct, preferably a nucleic acid construct contained in a viral vector, more preferably an AAV vector.
[0016] In a preferred embodiment, the present invention relates to the compositions described above for use in the treatment of dystrophin disorders, preferably Duchenne muscular dystrophy, Becker muscular dystrophy, or X-linked dilated cardiomyopathy.
[0017] In another embodiment, the present invention relates to a pharmaceutical composition comprising the composition and pharmaceutical excipients described above, and its use in the treatment of dystrophin disorders, preferably Duchenne muscular dystrophy, Becker muscular dystrophy, or X-linked dilated cardiomyopathy.
[0018] In another embodiment, the present invention relates to engineered cells comprising a site-directed mutation in at least one target sequence, preferably including a Let7c binding site, a miR-196b binding site, an ERF binding site, and / or an EN1 binding site 2, of the eutrophin gene, wherein the mutation disrupts the repressor binding site without deletion of the entire repressor binding site sequence, and to the use thereof in the treatment of dystrophin disorders, more preferably Duchenne muscular dystrophy, Becker muscular dystrophy, or X-linked dilated cardiomyopathy. [Brief explanation of the drawing]
[0019] [Figure 1] Schematic organization of the eutrophin gene, including its relevant promoter and important repressor domains. The eutrophin A promoter is CpG-rich at its 5' end and contains E-box and N-box motifs that regulate synaptic expression. The Ets-2 repressor factor silences extrasynaptic eutrophin expression via the N-box, and EN1 can also inhibit eutrophin expression. In the 3'UTR of eutrophin, several miRs repress eutrophin expression post-transcriptionally. Exons (gray boxes with exon numbers) and intron regions (black lines), intron enhancers (DUE for eutrophin), and the untranslated first exon 1A of eutrophin are defined. Arrows indicate transcription start sites. [Figure 2]Enhancement of eutrophin A expression after treatment with Cas9-RNP-sgRNA targeting the eutrophin repressor binding site. Human DMD myoblasts were exposed for 48 hours to Cas9-RNP and sgRNAs targeting the binding sites of Let7c, miR-196b, miR150 / 133b / 296-5p(II), or ERB (ERF binding site) (3 biological replicates). Eutrophin transcripts were normalized by gapdh. Values are mean ± SEM per condition (n=3); *P<0.05, **P<0.01, ***P<0.001. [Figure 3] Reporter systems and 3'UTR variants of eutrophin. Several 3'UTR constructs containing specific deletion regions were synthesized and inserted downstream of the Gaussia luciferase gene in the dual reporter plasmid pEZX-GA02. Nucleotide positions are shown on the right. [Figure 4] Reporter gene expression mediated by specific 3'UTR variants. All pEZX-GA02-3'UTR constructs were transfected into hDMD D52 myoblasts. After 48 hours, Gaussia luciferase levels were measured and normalized by SEAP expression. n=3 / group; *P<0.05, **P<0.01, ***P<0.01 relative to C1-full length. Data are expressed as mean ± SEM. [Figure 5] Eutrophin protein expression after sgRNA-Cas9 treatment. Relative eutrophin protein expression in human DMD D52 myoblasts treated with SpCas9 and hEN1, hERB, or hLet7c1 guides was determined by Western blotting and standardized for α-actinin loading. Relative eutrophin expression is shown as mean ± SEM for n=2 per condition. [Figure 6]Eutrophin mRNA expression in hDMD D52 myoblasts after sgRNA-Cas9 treatment. Relative eutrophin A mRNA levels in hDMD D52 myoblasts 5 days after treatment with SpCas9-gRNA. Eutrophin transcripts were normalized by gapdh. Values are mean ± SEM per condition (n=3); *P<0.05, **P<0.01, ***P<0.001. Percentage of indels is shown. [Figure 7] Eutrophin mRNA expression in C2C12 myoblasts after sgRNA-Cas9 treatment. Relative eutrophin A mRNA levels in C2C12 myoblasts 5 days after treatment with SpCas9-gRNA. Eutrophin transcripts were normalized by gapdh. Values are mean ± SEM for n=2 per condition. [Figure 8] Eutrophin protein expression after sgRNA-Cas9 treatment. Relative eutrophin protein expression in C2C12 myoblasts from healthy mice treated with SpCas9 and mLet7c2 and hLet7c2 guides was determined by Western blotting and standardized for tubulin loading. Relative eutrophin expression is shown as mean ± SEM for n=2 per condition. [Figure 9] Eutrophin mRNA expression in hDMD D52 myoblasts after sgRNA-Cas9 treatment. Relative utrophin A mRNA levels 5 days after treatment with SpCas9-hLet7c2 or SpCas9-mLet7c2. Different cas9:gRNA ratios were used as well as different enhancer concentrations. Initial condition: cas9:gRNA ratio of 1:2; 1x enhancer concentration. Optimized condition: cas9:gRNA ratio of 1:5; 5x enhancer concentration. Eutrophin transcripts were normalized by gapdh. Values are mean ± SEM per condition (n=3); *P<0.05, **P<0.01, ***P<0.001. [Figure 10]In vivo evaluation of rAAV-mLet7c2 / rAAV-SpCas9 treatment in mdx mice. (A) Relative eutrophin protein expression in mdx TA tissue treated with rAAV-Rosa26 / rAAV-SpCas9 (control) or rAAV-mLet7c2 / rAAV-SpCas9 was determined by Western blotting and standardized for α-actinin loading. Relative eutrophin expression is shown as mean ± SEM for n=3 per condition. (B) Immunofluorescence staining for eutrophin in TA muscle of 9-week-old mdx mice treated with a total dose of 1E12vg of rAAV-mLet7c2 / rAAV-SpCas9 or rAAV-Rosa26 / rAAV-SpCas9 (control) for 5 weeks. Cross sections were stained with anti-eutrophin monoclonal antibody SC-33700 and anti-mouse secondary antibody. Magnification: 20x. (C) Hematoxylin-eosin stained transverse muscle sections of TA muscle (9 weeks old) from control vs. rAAV-mLet7c2 / rAAV-SpCas9 treated mdx mice, showing necrotic areas (black stars) and regenerating fibers (black arrows). Magnification: 20x. (D) Quantification of centronucleation and necrosis / inflammation in transverse muscle sections (C) from rAAV-Rosa26 / rAAV-SpCas9 (control) and rAAV-mLet7c2 / rAAV-SpCas9 treated mice. Values are mean ± SEM per group (n=3); *P<0.05. [Modes for carrying out the invention]
[0020] Composition for enhancing eutrophin expression in cells Utrophin expression is controlled by several regulatory elements adjacent to the utrophin gene (Figure 1). For example, the AU-rich element in the 3'UTR modulates mRNA stability. Deletion of a regulatory element can induce mRNA instability and lead to ectopic expression of the utrophin gene. In contrast to deletion of an entire region of a regulatory element, we hereby use a gene editing enzyme that precisely induces site-directed mutations within the target sequence. In contrast to deletion of a regulatory element, the method used herein allows for the maintenance of stability with the regulatory element adjacent to the target repressor region, thereby reducing side effects. Furthermore, for clinical applications, the method of inducing site-directed mutations within the target sequence containing the utrophin repressor binding site results in 1) easier delivery; 2) higher efficiency of expected modification; 3) lower risk of off-target, chromosomal translocation, and abnormalities; and 4) lower toxic genomic double-strand disruption per cell compared to prior art methods that induce deletion of regulatory elements. Using this strategy, we demonstrated that specific disruption of the Let7c binding site, miR-196b binding site, ERF binding site, and EN1 binding site 2, in particular, allows for a more efficient increase in eutrophin expression compared to other repressor binding sites (Figures 2 and 6). Surprisingly, specific disruption of a single repressor binding site, especially the Let7c binding site, increased eutrophin expression as efficiently as deletion of an entire region of the repressor binding site, including a cluster of repressor binding sites (Figure 4).
[0021] Therefore, this disclosure relates to a method for enhancing eutrophin expression in cells, comprising the step of introducing into cells a composition comprising at least one gene editing enzyme capable of inducing a site-directed mutation in a target sequence including at least one repressor binding site selected from the group consisting of an Ets-2-repressor factor (ERF) binding site, a homeobox protein engrailed-1 (EN1) binding site 2, a Let7c binding site, and a miR-196b binding site, wherein the site-directed mutation disrupts repressor binding without deleting the entire repressor binding site sequence.
[0022] This disclosure also relates to compositions for enhancing eutrophin expression in cells, comprising a gene editing enzyme capable of inducing site-directed mutations within a target sequence including a repressor binding site of the eutrophin gene, selected from the group consisting of an Ets-2-repressor factor (ERF) binding site, a homeobox protein engrailed-1 (EN1) binding site 2, a Let7c binding site, and a miR196b binding site, wherein the mutation disrupts the repressor binding site without deleting the entire repressor binding site sequence. Mutations introduced into these specific target sequences inhibit repressor binding in the eutrophin (UTRN) gene or mRNA, subsequently increasing UTRN expression.
[0023] As used herein, “site-directed mutation disrupting a repressor binding site” refers to a mutation that alters a portion of a repressor binding site sequence without deleting the entire repressor binding site sequence. Mutations disrupting a repressor binding site alter the binding site in the eutrophin gene or mRNA in a manner that inhibits repressor binding. As used herein, “inhibit” refers to partial or total inhibition. Inhibition of repressor binding in the eutrophin gene or mRNA induces increased eutrophin expression.
[0024] The human utrophin (UTRN) gene (gene ID: 7402; Ensembl: ENSG00000152818 MIM: 128240) is located on chromosome 6 and contains several small exons totaling approximately 900 kb, as well as a long 5' untranslated region composed of two exons. The utrophin mRNA contains two full-length forms (named A- and B-utrophin), which have different initial exons and are transcribed from different promoters. The predicted protein sequences resulting from these transcripts differ at their N-terminuses, each having distinct sections of 31 and 26 amino acids, respectively. Thus, the utrophin is a complex of A- and B-utrophin, with only A-utrophin being upregulated in dystrophin-deficient striated muscle. The UTRN gene is conserved in chimpanzees, rhesus monkeys, dogs, cattle, mice, rats, chickens, zebrafish, and frogs. Human UTRN orthologs have been found in many organisms.
[0025] As used herein, the singular forms "a," "an," and "the" include both singular and plural referents unless the context explicitly indicates otherwise.
[0026] The regulation of eutrophin expression is complex. However, several upregulatory elements have been identified in the promoter, and eutrophin mRNA is also subject to transcriptional or translational repression mediated by its 5'- and 3'-UTR regions. Several regulatory sequences involved in the repression of eutrophin expression in adult muscle have been identified herein, which are referred to as eutrophin repressor binding sites. Utrophin repressor binding sites include, as non-limiting examples, sequences within the 3'-UTR region of the utrophin gene, such as the AU-rich element (ARE) described by Amirouche A. et al., Hum. Mol. Genet. 2013, pp. 22(15):3093-3111 and Gramolini AO et al., J. cell. Biol. 2001, pp. 154:1173-1183; sequences targeted by miRNAs, preferably by let7c, miR-296-5p(I), miR206, and miR-196b binding sites; Ets-2-repressor factor (ERF) binding sites, also known as N / box-EBS sites; or sequences within the 5'UTR / promoter-enhancer region of the utrophin gene, such as binding sites 1 or 2 for the homeobox protein engrailed-1 (EN1).
[0027] The inventors have shown that disruption of a specific repressor binding site selected from the group consisting of Let7c binding site, miR-196b binding site, ERF binding site, and EN1 binding site 2 is effective in increasing eutrophin expression.
[0028] In a preferred embodiment, the repressor binding site may be located in the 3'UTR sequence of the eutrophin gene localized at positions 144,850,989 to 144,853,034 of GRCh38.p13 on chromosome 6 (Genome Reference Consortium (March 2019), reference sequence CGF_000001405.39), or the repressor binding site may be the Let7c binding site of SEQ ID NO: 1 (positions 144,852,607 to 144,852,626 of GRCh38.p13 on chromosome 6 (Genome Reference Consortium (March 2019), reference sequence CGF_000001405.39)), or the miR-196b binding site of SEQ ID NO: 2.
[0029] In another preferred embodiment, the repressor binding site may be located in the 5'UTR sequence of the eutrophin gene, localized upstream of eutrophin A exon 1 starting at 144,291,829 of GRCh38.p13 on chromosome 6 (Genome Reference Consortium (March 2019), reference sequence CGF_000001405.39), and the repressor binding site may be located at 144,285,022~144,285,026 of GRCh38.p13 on chromosome 6 (Genome Reference Consortium (March 2019), reference sequence CGF_000001405.39), which consists of the sequence CGGAA, and is also called the Ets-2 N / box-EBS site. This is either a repressor (ERF) factor binding site, or homeobox protein engrailed-1 (EN1) binding site 2 located at 144,285,004~144,285,010 on GRCh38.p13 on chromosome 6 (Genome Reference Consortium (March 2019), reference sequence CGF_000001405.39), which consists of the sequence GTAGTGG.
[0030] In some preferred embodiments, the repressor binding site is a Let7c binding site, preferably a Let7c binding site consisting of SEQ ID NO: 1.
[0031] Advantageously, disruption of the repressor binding site within the 5'UTR / promoter-enhancer region of the eutrophin gene specifically increases the transcription of eutrophin A, which is upregulated in dystrophin-deficient striated muscle.
[0032] Sequences of eutrophin repressor binding sites in several different mammals, including but not limited to humans, pigs, chimpanzees, dogs, cattle, mice, rabbits, or rats, are publicly known and readily available in sequence databases. In some preferred embodiments, the eutrophin gene is human.
[0033] According to this disclosure, the inventors have used a gene editing enzyme to specifically induce site-directed mutations within a target sequence containing a eutrophin repressor binding site. The gene editing enzyme may be a sequence-specific nuclease, a base editor, or a prime editor.
[0034] In certain embodiments, the gene editing enzyme is a sequence-specific nuclease.
[0035] The term "nuclease" refers to a wild-type or variant enzyme capable of catalyzing the hydrolysis (cleavage) of phosphodiester bonds between nucleotides in nucleic acid (DNA or RNA) molecules, preferably DNA molecules. "Cleavage" refers to a double-strand or single-strand disruption event.
[0036] The term "sequence-specific nuclease" refers to a nuclease that cleaves nucleic acids in a sequence-specific manner. Different types of site-specific nucleases can be used, such as meganucleases, TAL nucleases (TALENs), zinc finger nucleases (ZFNs), or RNA / DNA guide end nucleases like the clustered and regularly arranged short palindromic sequence repeat CRISPR / Cas system, and Argonaut (discussed in Li et al., Nature Signal transduction and targeted Therapy, 5, 2020; Guha et al., Computational and Structural Biotechnology Journal, 2017, 15, pp. 146-160).
[0037] According to this disclosure, nucleases cause nucleic acid cleavage, preferably DNA cleavage, within the target sequence by sequence-specific targeting of a sequence containing a eutrophin repressor binding site. "Sequence-specific targeting of a sequence containing a repressor binding site" means targeting the sequence containing the repressor binding site described above, and / or a portion of a sequence adjacent to the repressor binding site, in particular, at least one (one or two) sequences of up to 15 nucleotides adjacent to the repressor binding site, preferably 10, 9, 8, 7, 6, or 5 nucleotides adjacent to the repressor binding site.
[0038] According to this disclosure, the target sequence includes or consists of a partial sequence of nucleotides from the -15th to the +15th position relative to the 5' and 3' ends of the eutrophin repressor binding site sequence disclosed herein.
[0039] The target sequence containing the eutrophin repressor binding site is shown in Table 1 below.
[0040] [Table 1]
[0041] In particular, the target sequence containing the Let7c binding site is sequence number 18 or sequence number 26, the target sequence containing the miR-196b binding site is sequence number 19, the target sequence containing the ERF binding site is sequence number 20, and the target sequence containing the EN1 binding site 2 is sequence number 21.
[0042] As disclosed herein, cleavage of a UTRN gene target sequence induces site-directed mutations, particularly indel and / or substitution mutations in the target sequence that disrupt the repressor binding site, thereby increasing UTRN expression by inhibiting UTRN repressor binding in the UTRN gene or mRNA.
[0043] DNA strand disruption introduced by the nuclease according to the present invention is repaired by the cell's own DNA repair processes, such as the non-homologous end joining (NHEJ) pathway and the microhomology-mediated end joining (MMEJ) pathway, which induce small insertions and deletions (indels) and substitutions.
[0044] The term "indel" refers to an insertion-deletion mutagenic event resulting from the cell's own DNA repair mechanism, such as NHEJ or MMEJ, following the introduction of a DNA break in a target sequence containing a eutrophin repressor binding site using the sequence-specific nucleases disclosed herein. According to this disclosure, the indel occurs in the target sequence containing the eutrophin repressor binding site and inhibits the function of this element, in particular, the repression of transcription or translation of the eutrophin gene. In other words, the indel induces an increase in the level of eutrophin gene expression. As used herein, the indel in a target sequence containing a repressor binding site according to this disclosure is different from the deletion of a repressor binding site induced by two site-specific nuclease-targeted sequences upstream and downstream of the repressor binding site as disclosed in the prior art.
[0045] In some embodiments, an indel refers to an insertion-deletion mutagenic event in which 50 or fewer nucleotide bases are altered, inserted, and / or deleted from a DNA or RNA sequence. The size of the indel depends on the gene editing enzyme. For example, for SpCas9, single nucleotides are the most common type of indel, with the majority of targets exhibiting 1-nt insertions or deletions, respectively. Nevertheless, sites showing a preference for longer deletions (e.g., up to 41 nt) may be observed (Chakrabarti et al., Molecular Cell, 2019, pp. 73, 699-713; Kurgan et al., Molecular Therapy: Methods & Clinical Development; 2021, pp. 21, 478-491).
[0046] According to this disclosure, the sequence-specific nuclease cleaves and induces site-directed mutations within a target sequence containing a eutrophin repressor binding site, thereby inhibiting repressor binding to the eutrophin gene or mRNA and increasing UTRN gene expression.
[0047] In certain embodiments, the inventors used a CRISPR system to induce cleavage within a target sequence containing the eutrophin repressor binding site described above.
[0048] The CRISPR system involves two components: the Cas protein (CRISPR-related protein) and a single guide RNA. The Cas protein is a DNA endonuclease that uses the guide RNA sequence as a guide to recognize and break double-strand DNA complementary to the single guide RNA sequence. The Cas protein contains two active cleavage sites: an HNH nuclease domain and a RuvC-like nuclease domain.
[0049] The term Cas protein also refers to a manipulated endonuclease or homolog of Cas9 that can cleave a target nucleic acid sequence. In certain embodiments, a Cas protein can induce cleavage at a target nucleic acid sequence that may correspond to either double-strand or single-strand disruption. Cas protein variants are virtually nonexistent in nature and may be Cas endonucleases obtained by protein manipulation or random mutagenesis. A Cas protein may be one of the Cas proteins known in the art. Non-exclusive examples of Cas proteins include Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl and Csxl2), Cas12 (Cas12a or Cpf1), CaslO, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Cmrl, Cmr3, Cmr4, Cmr5, Cnrr6, Csbl, Csb2, Csb3, Csxl7, CsxM, Csx lO, Cs l6, CsaX, Csx3, Cs Examples include Csxl5, Csfl, Csf2, CsO, Csf4, their homologs, orthologues, or modified versions thereof. Preferably, the Cas protein is Streptococcus pyogenes Cas9 protein and its orthologue, such as Staphylococcus aureus Cas9 protein and Streptococcus thermophilus Cas9. Another preferred Cas protein is Cas12a, such as Cas12a from Acidaminococcus or Lachnospiracae. Cas12a variants with enhanced activity are disclosed in Liyang Zhang et al. (Nature Communications, 2021, doi: 10.1038).
[0050] Cas contacts a guide RNA (gRNA) designed to include a complementary sequence of the target nucleic acid sequence that specifically induces DNA cleavage within the target sequence, and in particular, according to this disclosure, a complementary sequence of a portion of the target sequence that includes the eutrophin repressor binding site described above.
[0051] As used herein, “guide RNA,” “gRNA,” or “single guide RNA” refers to a nucleic acid that facilitates the specific targeting or homing of a gRNA / Cas complex to a target nucleic acid.
[0052] In particular, gRNA refers to RNA containing transactivating crRNA (tracrRNA) and crRNA. Preferably, the guide RNA corresponds to crRNA and tracrRNA that can be used separately or fused together. The complementary sequence that pairs with the target sequence recruits Cas to bind to and cleave the DNA at the target sequence.
[0053] According to this disclosure, the crRNA is engineered to include a complementary sequence to a portion of the target sequence containing the eutrophin repressor binding site so that it can target the said region. "Targeting the repressor binding site" means that the sequence containing the repressor binding site described above and / or at least a portion of the sequence adjacent to the repressor binding site is intended to target at least a sequence of up to 15 nucleotides adjacent to the repressor binding site, preferably 10, 9, 8, 7, 6, or 5 nucleotides adjacent to the repressor binding site.
[0054] In certain embodiments, the crRNA comprises a sequence of 5 to 50 nucleotides, preferably 15 to 30 nucleotides, and more preferably 20 nucleotides, which is complementary to the target sequence. According to this disclosure, the target sequence is a DNA sequence described above, which includes a eutrophin repressor binding site adjacent to a protospacer-adjacent motif (PAM).
[0055] As used herein, the term “complementary sequence” refers to a portion of a polynucleotide sequence (e.g., a portion of crRNA or tracRNA) that can hybridize with another portion of a polynucleotide under standard low-stringent conditions. Preferably, sequences are complementary to one another according to the complementarity between two nucleic acid strands, which relies on inter-strand Watson-Crick base pairing, i.e., intrinsic base pairing between adenine and thymine (AT) nucleotides, and between guanine and cytosine (GC) nucleotides.
[0056] The gRNA can be designed by any method known to those skilled in the art in consideration of this disclosure. In certain embodiments, the gRNA may target the eutrophin repressor binding site described above and may include one of the sequences (gRNA sequences) listed in Table 1.
[0057] [Table 2]
[0058] Sequence IDs 1 and 2 correspond to the (+) strand of the UTRN repressor binding site. Sequence IDs 3, 4, 5, 6, 7, 8, 12, 15, and 25 of the gRNA sequence correspond to the (-) strand of the UTRN repressor binding site. Sequence IDs 9, 10, 11, 13, 14, 16, and 17 of the gRNA sequence correspond to the (+) strand of the UTRN repressor binding site.
[0059] The gRNA sequences presented in Table 2 are shown in the form of the DNA sequence corresponding to the gRNA molecule, which represents the DNA equivalent of the gRNA's (RNA) sequence. - CTGAGGTAGAAAGGTGATCA (Sequence ID 3) corresponds to a gRNA with the sequence CUGAGGUAGAAAGGUGAUCA (Sequence ID 27). - CTGAGGTAGAAAGGTGGTCA (Sequence ID 4) corresponds to a gRNA with the sequence CUGAGGUAGAAAGGUGGUCA (Sequence ID 28). - ATGGATCTGAGGTAGAAAGG (Sequence ID 5) corresponds to a gRNA with the sequence AUGGAUCUGAGGUAGAAAGG (Sequence ID 29). - AAGATGGATCTGAGGTAGAA (Sequence ID 6) corresponds to a gRNA with the sequence AAGAUGGAUCUGAGGUAGAA (Sequence ID 30). - AAGGTGGTTCTGAGGTAGAA (Sequence ID 25) corresponds to a gRNA with the sequence AAGGGUGGUUCUGAGGUAGAA (Sequence ID 31). - GTGCTTTCTTGGGTATGACA (Sequence ID 7) corresponds to a gRNA with the sequence GUGCUUUCUUGGGUAUGACA (Sequence ID 32). - CTTTAAATAGGTGCTTTCTT (Sequence ID 8) corresponds to a gRNA with the sequence CUUUAAAUAGGUGCUUUCUU (Sequence ID 33). - TCTTCCGGAACAAAGTTGCT (Sequence ID 9) corresponds to a gRNA with the sequence UCUUCCGGAACAAAGUUGCU (Sequence ID 34). - GAACAAAGTTGCTGGGCCGG (Sequence ID 10) corresponds to a gRNA with the sequence GAACAAAGUUGCUGGGCCGG (Sequence ID 35). - ACGTAGTGGGGCTGATCTTC (Sequence ID 11) corresponds to a gRNA with the sequence ACGUAGUGGGGCUGAUCUUC (Sequence ID 36). - CCGGCCCAGCAACTTTGTTC (Sequence ID 12) corresponds to a gRNA with the sequence CCGGCCCAGCAACUUUGUUC (Sequence ID 37). - ATCTTCCGGAACAAAGTTGC (Sequence ID 13) corresponds to a gRNA with the sequence AUCUUCCGGAACAAAGUUGC (Sequence ID 38). - TCTTCCGGAACAAAGTTGCT (Sequence ID 14) corresponds to a gRNA with the sequence UCUUCCGGAACAAAGUUGCU (Sequence ID 39). - ATCAGCCCCACTACGTTCCC (Sequence ID 15) corresponds to a gRNA with the sequence AUCAGCCCCACUACGUUCCC (Sequence ID 40). - GCTGACCCGGGAACGTAGTG (Sequence ID 16) corresponds to a gRNA with the sequence GCUGACCCGGGAACGUAGUG (Sequence ID 41). - ACGCTGACCCGGGAACGTAG (Sequence ID 17) corresponds to a gRNA with the sequence ACGCUGACCCGGGAACGUAG (Sequence ID 42).
[0060] This disclosure includes gRNA variants that target eutrophin repressor binding sites and differ from the above gRNA sequences by up to 5 (1, 2, 3, 4, or 5) mutations (substitutions, deletions, or insertions).
[0061] This disclosure encompasses chemically modified gRNAs, particularly gRNAs that include at least one chemical modification to improve editing. Chemical modifications of gRNAs to improve editing are well known in the art, especially in most cell types, including primary and stem cells, both in vitro and in vivo (see, for example, Allen et al., Front. Genome Ed., January 28, 2021, doi: 10.3389). Non-limiting examples include 2'-O-methylation at the first and last three bases, and 3'-phosphorothionate linkages between the first three and last two bases of the gRNA.
[0062] In certain embodiments, the gRNA may target a miR-let7c binding site and include a sequence selected from the group consisting of SEQ ID NOs: 3-6 or SEQ ID NOs: 3-6 and 25. In certain embodiments, the gRNA may target a miR-196-b binding site and include a sequence of SEQ ID NOs: 7 or 8, preferably SEQ ID NO: 7. In certain embodiments, the gRNA may target an ERF binding site and include a sequence of SEQ ID NOs: 9 or 14, preferably SEQ ID NO: 9. In certain embodiments, the gRNA may target an EN1 binding site 2 and include a sequence of SEQ ID NOs: 15-17, preferably SEQ ID NO: 16. In some preferred embodiments, the gRNA targets a miR-let7c binding site, an ERF binding site, or an EN1 binding site 2, and preferably the gRNA includes a sequence selected from SEQ ID NOs: 3-6, 9, 16 and 25. In another preferred embodiment, the gRNA targets a miR-let7c binding site, and preferably the gRNA includes a sequence selected from the group consisting of SEQ ID NOs. 3 to 6 and 25, preferably the sequence of SEQ ID NO. 5.
[0063] In another specific embodiment, the gene editing enzyme is a DNA base editor described in Komor et al., Nature 533, pp. 420-424, doi:10.1038 / nature17946 and Rees HA, Liu DR. Nat Rev Genet. December 2018;19(12):770-788, or a prime editor described in Anzalone AV. et al. Nature, 2019, 576:149-157, Matsoukas IG. Front Genet. 2020; 11: 528 and Kantor A et al. Int. J. Mol. Sci. 2020, 21(p. 6240).
[0064] The use of a base editor or prime editor allows for the introduction of mutations, preferably point mutations at specific sites in the target sequence.
[0065] According to this disclosure, a base editor or prime editor induces mutations within a target sequence by sequence-specific targeting of a sequence containing a eutrophin repressor binding site. "Sequence-specific targeting of a sequence containing a repressor binding site" means targeting the sequence containing the repressor binding site described above, and / or a portion of a sequence adjacent to the repressor binding site, in particular, at least one (one or two) sequences of up to 15 nucleotides adjacent to the repressor binding site, preferably 10, 9, 8, 7, 6, or 5 nucleotides adjacent to the repressor binding site.
[0066] The base editor comprises a fusion of a catalytically inactive sequence-specific nuclease, as described above, capable of targeting a specific DNA target sequence, and a catalytically active base-modifying enzyme, such as a nucleotide deaminase domain.
[0067] In particular, the base editor or prime editor is a CRISPR base editor or prime editor. The CRISPR base editor or prime editor contains a dead Cas protein (dCas) as a catalytically inactive sequence-specific nuclease. dCas refers to a modified Cas nuclease lacking nucleotide chain cleavage activity. Nuclease activity can be inhibited or prevented in the dCas protein by one or more mutations and / or one or more deletions in the HNH and / or RuvC-like catalytic domains of the Cas protein. The resulting dCas protein lacks nuclease activity but binds to the guide RNA (gRNA)-DNA complex with high specificity and efficiency to specifically target the sequence. In certain embodiments, the dead Cas may be a Cas nickas in which one catalytic domain of Cas is inhibited or prevented.
[0068] The base editor contacts a guide RNA (gRNA) designed to include a complementary sequence of the target nucleic acid sequence that specifically binds to the target sequence, and in particular, according to this disclosure, a complementary sequence of a portion of the target sequence that includes the eutrophin repressor binding site described above.
[0069] The gRNA can be designed by any method known to those skilled in the art in consideration of this disclosure. In certain embodiments, the gRNA may target the eutrophin repressor binding site described above and include one of the sequences (gRNA sequences) listed in Table 2.
[0070] As a non-limiting example, the base editor is a dead Cas protein, in particular a nucleotide deaminase domain fused to Cas nickase. The nucleotide deaminase may be an adenosine deaminase or a cytidine deaminase.
[0071] In a particular embodiment, the base editor may, in non-limiting examples, include BE1, BE2, BE3, BE4, HF-BE3, Sa-BE3, Sa-BE4, BE4-Gam, saBE4-Gam, YE1-BE3, EE-BE3, YE2-BE3, YEE-BE3, VQR-BE3, VRER-BE3, SaKKH-BE3, cas12a-BE, Target-AID, Target-AID-NG, xBE3, eA3A-BE3, A3A-BE3, BE-PLUS, TAM, CRIPS-X, ABE7.9, ABE7.10, and ABE7.10. * The group may be selected from xABE, ABESa, VQR-ABE, VRER-ABE, and SaKKH-ABE.
[0072] The prime editor comprises a fusion of a catalytically inactive sequence-specific nuclease described above, particularly Cas nickase or wild-type Cas, and a catalytically active, manipulated reverse transcriptase (RT) enzyme. The fusion protein is used in combination with a prime editing guide RNA (pegRNA) that contains a complementary sequence to the target sequence described above, particularly one of the sequences listed in Table 2, and an additional sequence that includes a sequence that binds to the primer binding site region in DNA. In certain embodiments, the reverse transcriptase is Moloney mouse leukemia virus RT enzyme and its variants. The prime editor may, as a non-limiting example, be selected from the group consisting of PE1, PE2, PE3, and PE3b.
[0073] The compositions according to this disclosure increase eutrophin expression in cells, preferably in dystrophin-expressing cells such as muscle cells, in vitro and / or in vivo.
[0074] Eutrophin gene expression is enhanced in cells if the expression level of the utrophin gene is at least 1.5 times higher, or 2, 3, 4, or 5 times higher, in cells treated with a gene editing enzyme than in untreated cells. The increase in utrophin gene expression, which may be at the RNA or protein level, can be determined by any suitable method known to those skilled in the art.
[0075] For example, nucleic acids contained in a sample are first extracted according to standard methods, for example, using lytic enzymes or chemical solutions, or extracted with nucleic acid-binding resin according to the manufacturer's instructions for use. Then, the level of UTRN mRNA is detected by hybridization (e.g., Northern blot analysis) and / or amplification (e.g., RT-PCR).
[0076] The level of UTRN protein can also be determined by any suitable method known to those skilled in the art. The amount of protein can be measured, for example, by semi-quantitative Western blotting, enzyme-labeled and-mediated immunoassays such as ELISA, biotin / avidin assays, radioimmunoassays, immunoelectrophoresis, mass spectrometry, or immunoprecipitation, or by protein or antibody arrays.
[0077] The gene editing enzymes, such as gRNA and Cas proteins, can be constructed using chemical synthesis and enzymatic ligation reactions using procedures known in the art, and can be delivered to cells using any known technique, including, but not limited to, calcium phosphate transfection, DEAE-dextran transfection, electroporation, microinjection, particulate gun, viral infection, or liposome-mediated transfection.
[0078] In some embodiments, the composition for enhancing eutrophin expression comprises a single-sequence-specific nuclease capable of inducing a single mutation event within each target sequence containing a eutrophin repressor binding site.
[0079] In another specific embodiment, the composition for enhancing utrophin expression may comprise at least two of the gene editing enzymes described above that can induce mutational events in one or more target sequences containing utrophin repressor binding sites.
[0080] In particular, if the gene editing enzyme is a sequence-specific nuclease, the sequence-specific nucleases can be used sequentially such that the first sequence-specific nuclease cleaves and induces a first mutation event within the target sequence. Once the first mutation event is repaired, a second sequence-specific nuclease can be used to cleave and induce a second mutation event within the same or another target sequence.
[0081] In another specific embodiment, if the at least two gene editing enzymes are base editors or prime editors, the gene editing enzymes can be used simultaneously. In another specific embodiment, if the two gene editing enzymes are base editors or prime editors and single-sequence-specific nucleases, the gene editing enzymes can also be used simultaneously.
[0082] In some preferred embodiments, the target sequences of at least two gene editing enzymes are different. In some embodiments, the composition for enhancing eutrophin expression comprises a gene editing enzyme capable of inducing sequence-specific mutations within a target sequence comprising a eutrophin repressor binding site.
[0083] nucleic acid constructs and expression vectors In one embodiment, the gene editing enzyme is encoded by one or more nucleic acid constructs.
[0084] The term “nucleic acid construct,” as used herein, refers to an artificial nucleic acid molecule obtained from the use of recombinant DNA technology. A nucleic acid construct is either a single-stranded or double-stranded nucleic acid molecule that has been modified to contain segments of nucleic acid sequences and is combined and juxtaposed in a manner that would otherwise not exist in nature. A nucleic acid construct is typically a “vector,” i.e., a nucleic acid molecule used to deliver exogenously produced DNA to a host cell.
[0085] Preferably, the nucleic acid construct comprises the gene editing enzyme operably linked to one or more regulatory sequences that direct expression in muscle cells.
[0086] The regulatory sequence may be a ubiquitous promoter, a tissue-specific promoter, or an inducible promoter, which is functional in the cells of a target organ (i.e., muscle). Such sequences, which are well known in the art, include, in particular, promoters and, but are not limited to, enhancers, terminators, introns, silencers, especially tissue-specific silencers, and further regulatory sequences that can further control the expression of transgenes such as microRNAs.
[0087] Examples of ubiquitous promoters include the CAG promoter, phosphoglycerate kinase 1 (PGK) promoter, cytomegalovirus enhancer / promoter (CMV), SV40s initial promoter, retrovirus Roussarcoma virus (RSV) LTR promoter, dihydrofolate reductase promoter, β-actin promoter, and EF1 promoter.
[0088] Examples of muscle-specific promoters, though not limited to them, include the desmin (Des) promoter, muscle creatine kinase (MCK) promoter, CK6 promoter, alpha-myosin heavy chain (alpha-MHC) promoter, myosin light chain 2 (MLC-2) promoter, cardiac troponin C (cTnC) promoter, synthetic muscle-specific SpC5-12 promoter, and human skeletal actin (HSA) promoter.
[0089] In a preferred embodiment, the nucleic acid construct includes a gene editing enzyme capable of targeting a eutrophin repressor binding site region, comprising a sequence selected from the group consisting of sequences CGGAA, GTAGTGG, and SEQ ID NOs: 1 and 2.
[0090] In a more preferred embodiment, the nucleic acid construct includes a gene editing enzyme capable of targeting a Let7c binding site containing a gRNA sequence selected from the group consisting of SEQ ID NOs: 3-6 or SEQ ID NOs: 3-6 and 25, preferably the gRNA sequence of SEQ ID NO: 5.
[0091] In another preferred embodiment, the nucleic acid construct comprises a gene editing enzyme capable of targeting a miR196-b binding site, which includes a gRNA sequence selected from the group consisting of SEQ ID NO: 7 or 8, preferably the gRNA sequence of SEQ ID NO: 7.
[0092] In another preferred embodiment, the nucleic acid construct comprises a gene editing enzyme capable of targeting an ERF binding site comprising a gRNA sequence selected from the group consisting of SEQ ID NOs: 9 to 14, preferably the gRNA sequence of SEQ ID NO: 9.
[0093] In another preferred embodiment, the nucleic acid construct comprises a gene editing enzyme capable of targeting an EN1 binding site 2 containing a gRNA sequence selected from the group consisting of SEQ ID NOs: 15-17, preferably the gRNA sequence of SEQ ID NO: 16.
[0094] The nucleic acid constructs described above may be contained in the expression vector. The vector may be a self-replicating vector, i.e., a vector that exists as an extrachromosomal entity and whose replication is independent of chromosomal replication, such as a plasmid, extrachromosomal element, minichromosome, or artificial chromosome. The vector may contain any means to ensure self-replication. Alternatively, the vector may, once introduced into a host cell, be integrated into the genome and replicate together with the chromosome into which it is integrated.
[0095] Suitable vectors include, but are not limited to, recombinant embedded or non-embedded viral vectors, and vectors derived from recombinant bacteriophage DNA, plasmid DNA, or cosmid DNA. Preferably, the vector is a recombinant embedded or non-embedded viral vector. Examples of recombinant viral vectors include, but are not limited to, vectors derived from herpesviruses, retroviruses, lentiviruses, vaccinia viruses, adenoviruses, adeno-associated viruses, or bovine papillomaviruses.
[0096] AAV has garnered considerable interest as a promising vector for human gene therapy. Among its beneficial properties are its lack of association with any human disease, its ability to infect both dividing and non-dividing cells, and the wide range of cell lines derived from different tissues that it can infect.
[0097] The AAV genome consists of a linear single-stranded DNA molecule containing 4681 base pairs (Berns and Bohenzky, 1987, Advances in Virus Research (Academic Press, Inc.) 32: pp. 243-307). The genome contains inverted end repeats (ITRs) at each end, which function in cis as origins for DNA replication and as packaging signals for the virus. ITRs are approximately 145 bp long. The internal non-repeat portions of the genome contain two large open reading frames, known as AAV rep and cap genes, respectively. These genes encode viral proteins involved in virion replication and packaging. In particular, at least four viral proteins are synthesized from the AAV rep genes Rep 78, Rep 68, Rep 52, and Rep 40, named according to their apparent molecular weight. The AAV cap gene encodes at least three proteins: VP1, VP2, and VP3. For a detailed explanation of the AAV genome, see, for example, Muzyczka, N. 1992, Current Topics in Microbiol. and Immunol. 158: pp. 97-129.
[0098] This disclosure relates to an AAV vector comprising the guide RNA and / or Cas protein described above.
[0099] Therefore, in one embodiment, the nucleic acid construct or expression vector comprising the guide RNA and / or Cas protein described above further comprises 5'ITR and 3'ITR sequences, preferably 5'ITR and 3'ITR sequences of adeno-associated virus.
[0100] As used herein, the term “inverted terminal repeat (ITR)” refers to the nucleotide sequences located at the 5' end (5'ITR) and the nucleotide sequences located at the 3' end (3'ITR) of a virus, which contain palindromic sequences and can fold to form a T-shaped hairpin structure that functions as a primer during the initiation of DNA replication. They are also necessary for the integration of the viral genome into the host genome, for rescue from the host genome, and for the inclusion of viral nucleic acids into mature virions. The ITRs need to be cis for vector genome replication and their packaging into viral particles.
[0101] The AAV ITRs for use in the viral vectors of this disclosure may have wild-type nucleotide sequences or may be modified by insertions, deletions, or substitutions. The serotype of the AAV inverted terminal repeat (ITR) may be selected from any known human or non-human AAV serotype. In specific embodiments, nucleic acid constructs or viral expression vectors may be made by using ITRs of any AAV serotype, including AAV1, AAV2, AAV3 (including types 3A and 3B), AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh10, AAV11, AAV12, avian AAV, bovine AAV, canine AAV, equine AAV, sheep AAV, and any other AAV serotype, or any AAV serotype, including currently known or subsequently discovered engineered AAVs.
[0102] In one embodiment, the nucleic acid construct comprises the 5'ITR and 3'ITR of the corresponding capsid, preferably the 5'ITR and 3'ITR of serotype AAV-2.
[0103] On the other hand, the nucleic acid constructs or expression vectors of this disclosure can also be produced by using synthetic 5'ITR and / or 3'ITR, and by using 5'ITR and 3'ITR derived from different serotypes of the virus. All other viral genes necessary for viral vector replication can be provided trans within the virus-producing cells (packaging cells) described below. Therefore, their inclusion in the viral vector is optional.
[0104] In one embodiment, the nucleic acid construct or viral vector of the present disclosure comprises a viral 5'ITR, a ψpackaging signal, and a 3'ITR. The "ψpackaging signal" is a nucleotide sequence that acts in the cis position of the viral genome, which is essential for the process of packaging the viral genome into the viral capsid during replication in some viruses (e.g., adenoviruses, lentiviruses, etc.).
[0105] The construction of recombinant AAV virus particles is generally known in the art and is described, for example, in U.S. Patents 5,173,414 and 5,139,941; International Publication Nos. 92 / 01070 and 93 / 03769; Lebkowski et al. (1988) Molec. Cell. Biol. 8: pp. 3988-3996; Vincent et al. (1990) Vaccines 90 (Cold Spring Harbor Laboratory Press); Carter, BJ (1992) Current Opinion in Biotechnology 3: pp. 533-539; Muzyczka, N. (1992) Current Topics in Microbiol. and Immunol. 158: pp. 97-129; and Kotin, RM (1994) Human Gene Therapy 5: pp. 793-801.
[0106] Virus particles In a preferred embodiment, the disclosure relates to a viral particle comprising the nucleic acid construct or expression vector described above.
[0107] The nucleic acid constructs or expression vectors of this disclosure may be packaged in a viral capsid to produce "viral particles," also known as "viral vector particles." In certain embodiments, the nucleic acid constructs or expression vectors described above may be packaged in an AAV-derived capsid to produce "adeno-associated virus particles" or "AAV particles." This disclosure relates to viral particles comprising the nucleic acid constructs or expression vectors of this disclosure, preferably comprising an adeno-associated virus capsid protein.
[0108] The term AAV vector particle generally encompasses any engineered, recombinant AAV vector particle, or mutant AAV vector particle. Recombinant AAV particles may be prepared by encapsulating a nucleic acid construct or viral expression vector containing an ITR derived from a specific AAV serotype in a viral particle formed by a native or mutant Cap protein corresponding to the same or different serotypes of AAV.
[0109] The viral capsid proteins of adeno-associated viruses include capsid proteins VP1, VP2, and VP3. Differences in the capsid protein sequences among various AAV serotypes result in the use of different cell surface receptors for cell entry. Combined with alternative intracellular processing pathways, this gives rise to distinct tissue tropisms for each AAV serotype.
[0110] Several techniques have been developed to modify and improve the structural and functional properties of naturally occurring AAV virus particles (Bunning H et al. J Gene Med, 2008; 10: pp. 717-733; Paulk et al. Mol Ther. 2018; 26(1): pp. 289-303; Wang L et al. Mol Ther. 2015; 23(12): pp. 1877-87; Vercauteren et al. Mol Ther. 2016; 24(6): pp. 1042-1049; Zinn E et al., Cell Rep. 2015; 12(6): pp. 1056-68).
[0111] Therefore, in the AAV virus particles according to this disclosure, a nucleic acid construct or viral expression vector containing an ITR of a given AAV serotype can be packaged, for example, into: a) virus particles composed of capsid proteins derived from the same or different AAV serotypes; b) mosaic virus particles composed of a mixture of capsid proteins derived from different AAV serotypes or variants; or c) chimeric virus particles composed of capsid proteins shortened by domain swapping between different AAV serotypes or variants.
[0112] Those skilled in the art will recognize that AAV virus particles for use according to this disclosure may contain capsid proteins derived from any AAV serotype, including AAV1, AAV2, AAV3 (including types 3A and 3B), AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV2i8, AAVrh10, AAVrh39, AAVrh43, AAVrh74, AAV-LK03, AAV2G9, AAV.PHP, AAV-Anc80, AAV3B, and AAV9.rh74 (as disclosed in WO2019 / 193119).
[0113] For gene transfer into muscle, AAV serotypes 2, 6, 8, 9, AAVrh10, or AAV9.rh74 are preferred. In specific embodiments, the AAV virus particle comprises the nucleic acid construct or expression vector of this disclosure, and preferably a capsid protein derived from the AAV9 or AAV9.rh74 serotype.
[0114] Methods for enhancing eutrophin expression in cells This disclosure relates to a method for enhancing eutrophin expression in cells by inducing a site-directed mutation in a target sequence including a repressor binding site selected from the group consisting of a Let7c binding site, a miR-196b binding site, an ERF binding site, and an EN1 binding site 2, wherein the mutation disrupts the repressor binding site without deleting the entire repressor binding site sequence. The method comprises introducing the composition described above into cells such that the gene editing enzyme induces a site-directed mutation in the target sequence, wherein the mutation disrupts the repressor binding site without deleting the entire repressor binding site sequence.
[0115] In certain embodiments, the gene editing enzyme is selected from the group consisting of site-specific nucleases, base editors, and prime editors, preferably the CRISPR / cas gene editing enzymes described above.
[0116] In certain embodiments, the gene editing enzyme is a site-specific nuclease, more preferably a CRISPR / Cas nuclease comprising a guide RNA and a Cas protein, wherein the guide RNA combined with the Cas protein cleaves and induces indel and / or substitution mutations within the target sequence containing a eutrophin repressor binding site selected from the group consisting of a Let7c binding site, a miR-196b binding site, an ERF binding site, and an EN1 binding site 2, thereby disrupting the repressor binding site without deleting the entire repressor binding site sequence.
[0117] In another specific embodiment, the gene editing enzyme is a CRISPR base editor or prime editor that induces site-directed mutations in the target sequence, which includes a eutrophin repressor binding site selected from the group consisting of a Let7c binding site, a miR-196b binding site, an ERF binding site, and an EN1 binding site 2, thereby disrupting the repressor binding site without deleting the entire repressor binding site sequence.
[0118] The method described above involves introducing a gene editing enzyme, such as a Cas protein, a base editor or prime editor, and a guide RNA (crRNA, tracrRNa, or fusion guide RNA or pegRNA), into a cell. The gene editing enzyme, preferably the guide RNA and / or Cas protein, base editor or prime editor described above, may be synthesized in the cell at insights as a result of introducing a nucleic acid construct, preferably an expression vector encoding the gene editing enzyme, such as the guide RNA and / or Cas protein, base editor or prime editor described above, into the cell. Alternatively, the gene editing enzyme, such as the guide RNA and / or Cas protein, base editor or prime editor, may be produced outside the cell and then introduced into the cell.
[0119] The nucleic acid construct or expression vector can be introduced into cells by any method known in the art, and non-limiting examples include stable transformation methods in which the nucleic acid construct or expression vector is integrated into the cell genome, transient transformation methods in which the nucleic acid construct or expression vector is not integrated into the cell genome, and virus-mediated methods. For example, transient transformation methods include microinjection, electroporation, or a microparticle gun.
[0120] In some embodiments, the method is an in vitro method. The in vitro method is performed in a cell culture, such as cells collected from a patient.
[0121] Manipulated cells In another embodiment, this disclosure relates to manipulated cells that can be obtained or obtained by the methods described above.
[0122] In particular, this disclosure relates to engineered cells, preferably muscle cells, that include a site-directed mutation within at least one target sequence containing a eutrophin repressor binding site selected from the group consisting of the Let7c binding site, miR-196b binding site, EN1 binding site 2, or ERF binding site described above, which disrupts the repressor binding site without deleting the entire repressor binding site sequence.
[0123] The manipulated cells described herein may be used for the purpose of ex vivo gene therapy. In such embodiments, the guide RNA and Cas protein, the gene editing enzyme such as a base editor or prime editor, a nucleic acid construct, an expression vector, or a viral particle described above are introduced into the cells.
[0124] The cells can then be transplanted into a patient or subject. The transplanted cells may be autologous, allogeneic, or heterologous in origin. For clinical use, cell isolation is generally performed under Good Manufacturing Practice (GMP) conditions.
[0125] In certain embodiments, the manipulated cells are used for ex vivo gene therapy to muscle.
[0126] Preferably, the cells are eukaryotic cells such as mammalian cells, which include, but are not limited to, humans, non-human primates such as apes, chimpanzees, monkeys and orangutans, domesticated animals such as dogs and cats, and livestock such as horses, cattle, pigs, sheep and goats, or, but are not limited to, other mammalian species such as mice, rats, guinea pigs, rabbits and hamsters. Those skilled in the art will select more appropriate cells according to the patient or subject to be transplanted.
[0127] The manipulated cells may be cells having the properties of self-renewal and pluripotency, such as stem cells or induced pluripotent stem cells. Stem cells are preferably mesenchymal stem cells. Mesenchymal stem cells (MSCs) can differentiate into at least one of osteoblasts, chondrocytes, adipocytes, or myocytes and can be isolated from any type of tissue. Generally, MSCs are isolated from bone marrow, adipose tissue, umbilical cord, or peripheral blood. The cells may also be satellite cells (myocytes) and mesanioblasts. Methods for obtaining them are well known to those skilled in the art. Induced pluripotent stem cells (also known as iPS cells or iPSCs) are a type of pluripotent stem cell that can be created directly from adult cells. Yamanaka et al. induced iPS cells by transfecting mouse and human fibroblasts with the Oct3 / 4, Sox2, Klf4, and c-Myc genes and expressing the genes in the cells (WO2007 / 069666). Thomson et al. subsequently generated human iPS cells using Nanog and Lin28 instead of Klf4 and c-Myc (WO2008 / 118820).
[0128] The manipulated cells may also be muscle cells. As used herein, the term “muscle” refers to cardiac muscle (i.e., heart) and skeletal muscle. As used herein, the term “muscle cell” refers to muscle cells, myotubes, myoblasts and / or satellite cells.
[0129] Pharmaceutical composition The guide RNA and Cas protein, gene editing enzymes such as base editors or prime editors, nucleic acid constructs, expression vectors, viral particles, or engineered cells according to this disclosure are preferably used in the form of a pharmaceutical composition comprising a therapeutically effective amount of the above-described product.
[0130] In the context of this disclosure, a therapeutically effective dose means a dose sufficient to reverse, reduce or inhibit the progression of the disorder or condition to which such term applies, or to reverse, reduce or inhibit the progression of one or more symptoms of the disorder or condition to which such term applies.
[0131] The term "effective dose" or "effective dosage" is defined as the amount sufficient to achieve, or at least partially achieve, the desired effect.
[0132] The effective dose is determined and adjusted according to factors such as the composition used, the route of administration, the physical characteristics of the individual under consideration, including sex, age, and weight, concomitant drug therapies, and other factors, as recognized by those skilled in the medical field.
[0133] In various embodiments of this disclosure, the pharmaceutical composition comprises a pharmaceutically acceptable carrier and / or medium.
[0134] A "pharmaceutically acceptable carrier" refers to a medium that, if necessary, does not cause adverse reactions, allergic reactions, or other undesirable reactions when administered to mammals, particularly humans. A pharmaceutically acceptable carrier or excipient refers to a non-toxic solid, semi-solid, or liquid filler, diluent, mounting material, or any type of formulation aid.
[0135] Preferably, the pharmaceutical composition contains a pharmaceutically acceptable medium for an injectable formulation. These may be, in particular, isotonic sterile saline solutions (monosodium or disodium phosphate, sodium chloride, potassium chloride, calcium chloride or magnesium chloride, etc., or mixtures of such salts), or dried compositions, especially lyophilized compositions that, depending on the circumstances, allow for the formation of an injectable solution upon addition of sterile water or physiological saline.
[0136] Suitable pharmaceutical forms for injectable use include sterile aqueous solutions or aqueous suspensions. The solution or suspension may contain additives that are compatible with the viral vector but do not prevent the entry of viral vector particles into target cells. In all cases, the form must be sterile and liquid enough to allow for easy injection. It must be stable under manufacturing and storage conditions and protected from contamination by microorganisms such as bacteria and fungi. Examples of suitable solutions include phosphate-buffered saline (PBS) or Ringer's lactate buffer.
[0137] therapeutic use The gene editing enzymes described above, for example, combinations of guide RNA and Cas protein, a base editor or prime editor, nucleic acid constructs, expression vectors, viral particles or pharmaceutical compositions, or cells isolated according to this disclosure may be used as pharmaceuticals, in particular as pharmaceuticals for the treatment of dystrophin disorders.
[0138] Dystrophin disorders are a spectrum of X-linked muscle diseases caused by pathogenic variants in the DMD gene, which codes for the protein dystrophin. Dystrophin disorders include Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), and X-linked dilated cardiomyopathy (also known as DMD-associated dilated cardiomyopathy).
[0139] DMD is the only gene in which pathogenic variants cause dystrophin disorders. More than 5,000 pathogenic variants have been identified in individuals with DMD, BMD, or X-linked dilated cardiomyopathy. The alleles causing the disease are highly variable and include deletions of entire genes, deletions or duplications of one or more exons, and small deletions, insertions, or single nucleotide changes (Darras BT, Miller DT, Urion DK. Dystrophinopathies. September 5, 2000 [updated November 26, 2014]. In: Pagon RA, Adam MP, Ardinger HH et al., eds. GeneReviews® [Internet]. Seattle (WA): University of Washington, Seattle; 1993-2017. Available from https: / / www.ncbi.nlm.nih.gov / books / NBK1119 / , also see OMIM Entries for Dystrophinopathies 300376, 300377, 302045 and 310200).
[0140] The Disclosure also provides a method for treating dystrophin disorders, particularly Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), and X-linked dilated cardiomyopathy, the method comprising the step of administering a therapeutically effective amount of the composition, pharmaceutical composition, or isolated cells described above to a patient.
[0141] "Therapeutic dose" refers to the amount effective in the dosage and duration required to achieve the desired therapeutic outcome. The therapeutic dose of the products, pharmaceutical compositions containing them, or cells may vary depending on factors such as the disease state, the individual's age, sex, and weight, and the product's or pharmaceutical composition's ability to induce a desired response in the individual. The dosage regimen may be adjusted to provide an optimal therapeutic response. The therapeutic dose is also typically such that the therapeutically beneficial effects outweigh any toxic or adverse effects of the product or pharmaceutical composition.
[0142] As used herein, the terms “patient” or “individual” refer to a mammal. Preferably, the patient or individual as used herein is a human.
[0143] In the context of this disclosure, the terms “to treat” or “treatment” as used herein mean to reverse, mitigate or inhibit the progression of a disease caused by a dystrophinic disorder or condition to which such terms apply, or to reverse, mitigate or inhibit the progression of one or more symptoms of a disorder or condition to which such terms apply.
[0144] The products of this disclosure are generally administered in known procedures in doses and for durations effective in inducing a therapeutic effect in patients.
[0145] Administration may be systemic or local. Systemic administration is preferably intravascular, such as subcutaneous (SC), intramuscular (IM), intravenous (IV), or intraarterial, intraperitoneal (IP), intradermal (ID), or otherwise intratissue. Administration may be, for example, by injection or perfusion. In some preferred embodiments, administration is parenteral, preferably intravascular, such as intravenous (IV) or intraarterial. The implementation of this disclosure will use conventional techniques that are within the skill of the art unless otherwise indicated. Such techniques are fully described in the literature.
[0146] In a further embodiment, the disclosure also relates to non-therapeutic uses of the compositions described above, for example, for research tools, for use in activating eutrophin gene expression.
[0147] In another embodiment, the Disclosure relates to a kit for enhancing eutrophin expression, the kit comprising, for example, a combination of a gene editing enzyme, such as a guide RNA and a Cas protein, a base editor or prime editor, a nucleic acid construct, an expression vector, or a viral particle, or cells isolated according to the Disclosure.
[0148] The present invention is illustrated herein by the following examples, which are not limiting. [Examples]
[0149] 1. Materials and Methods cell culture Human DMD myoblasts were maintained in smooth muscle cell growth medium (C-23060, PromoCell) supplemented with 1% penicillin streptomycin (Invitrogen). The cells were maintained at 5% CO2 and 37°C.
[0150] sgRNA design Guides targeting the Let7c and ERF binding sites were selected based on their proximity to the intended mutations for editing and designed based on the most active sgRNAs predicted by computer using the online Benchling Tool described by Doench et al. 2016, Nat. Biotechnol. 34(2):184-191. All sgRNAs with a predicted activity score higher than 0.30 were then analyzed using the CRISPR design tool and ranked according to at least the possible number of off-target sites (Hsu et al. 2013, Nat Biotechnol. September 2013; 31(9):827-32). - hLetc1(Letc1):ATGGATCTGAGGTAGAAAGG(Sequence ID 5) - miR-196b:GTGCTTTCTTGGGTATGACA(Sequence ID 7) - miR-150-133b-296-5p(II):TTATTTTAGAATAGGTTGGG(Sequence ID 24) - hERB(ERB):TCTTCCGGAACAAAGTTGCT(Sequence ID 9) - hLet7c2:CTGAGGTAGAAAGGTGGTCA(Sequence ID 4) - hLet7c3:AAGATGGATCTGAGGTAGAA(Sequence ID 6) - mLet7c2:CTGAGGTAGAAAGGTGATCA(Sequence ID 3) - mLet7c4:AAGGTGGTTCTGAGGTAGAA(Sequence ID 25) - EN1(hEN1):GCTGACCCGGGAACGTAGTG(Sequence ID 16)
[0151] Nucleofection-chemically modified single guide RNA (Synthego), containing 2'-O-methyl bonds at the first and last three bases and 3'-phosphothionate bonds between the first three bases and the last two bases, was diluted according to the manufacturer's instructions. Ribonucleoprotein complexes were formed using sgRNA and 30 pmol of Streptococcus pyogenes Cas9 protein (ratio 1:2). 2.5 × 10⁻⁶ per condition. 5 Individual hDMD myoblasts were transfected with RNP using the P5 Primary Cell 4D-Nucleofector X kit (C2C12 program) in the presence of Alt-R® Cas9 Electroporation Enhancer (number 1075916; IDT). The culture medium was changed the following day, and the cells were excised for protein analysis 48 hours after electroporation.
[0152] DNA analysis Genomic DNA was extracted using QuickExtract® DNA extraction solution (Lucigen, Middelton, WI, USA). Using 50 ng of genomic DNA, regions corresponding to the cleavage sites of each gRNA were amplified using KAPA2G Fast ReadyMix (Kapa Biosystems, Wilmington, MA, USA). After Sanger sequencing (Genewiz, Takeley, UK), the percentage of insertions and deletions (indels) was calculated using TIDE software (Brinkman et al. 2014, NAR 41(12):168).
[0153] RNA extraction and RT-qPCR Total RNA was purified using the RNeasy Micro kit (Qiagen, Hilden, Germany). The RNA was reverse transcribed using the Transcriptor First Strand cDNA synthesis kit (Roche, Basel, Switzerland). qPCR was performed using Maxima Syber Green / Rox (Life Scientific, Thermo-Fisher Scientific, Waltham, MA, US). The mRNA expression levels of utrophin A (forward primer 5'-ACGAATTCAGTGACATCATTAAGTCC-3' (SEQ ID NO: 22) and reverse primer 5'ATCCATTTGGTAAAGGTTTTCTTCTG-3' (SEQ ID NO: 23) were normalized using human GAPDH as a reference gene (NM_002046.6) and expressed as a polyploid change (2^ΔΔCt) relative to the control. Reactions without reverse transcription (RT) and without template control (NTC) were used as negative controls in 40 cycles of PCR each (Cq values: NTC = undetermined, RT = undetermined).
[0154] Protein analysis Muscle cell samples were homogenized on ice in RIPA buffer (R0278-50 ml, Sigma-Aldrich) supplemented with a protease inhibitor (P8340, Sigma-Aldrich). After BCA quantification, 10 μg of total protein was heat-denatured at 100°C for 5 minutes, then loaded onto a NuPAGE 3-8% TRIS Acetate Midi gel (Novex, Life Technologies) and transferred to a PVDF membrane (Millipore). The membrane was blocked for 1 hour with Odyssey blocking buffer (926-41090; LI-COR; USA), and then incubated at room temperature for 2 hours with the following primary antibodies: mouse anti-eutrophin (1:50, MANCHO3(84A)) and rabbit anti-gapdh (1:5000, MAB374, Sigma-Aldrich). The target protein was quantified relative to vinculin using the Odyssey imaging system and Image Studio Lite software (LI-COR Biosciences; USA).
[0155] Reporter assay and transfection The eutrophin 3'UTR is based on the human eutrophin UTRN-001 (ENST00000367545.7) sequence. All eutrophin 3'UTR reporter constructs were prepared by GenScript Biotech (Leiden, Netherlands) and incorporated into a pEZX-GA02 Gaussia luciferase (Gluc) and downstream secreted alkaline phosphatase (SEAP) reporter cloning vector (ZX-104, Genecopoeia) for the Gaussia luciferase reporter gene. Accurate integration was controlled by enzymatic digestion, and all plasmids were sequenced to verify construct identity. After transformation in XL-10 bacteria, plasmid preparation was performed using the NucleoSpin Plasmid Kit (740588.50, Macherey Nagel) according to the manufacturer's recommendations. To study the effect of the eutrophin 3'UTR variant on the Gaussia luciferase reporter gene, hDMD D52 myoblasts were seeded at 10,000 cells / well in 96-well plates. The following day, cells were transfected using Lipofectamine® 3000 (L3000008, ThermoFisher) as the transfection agent. Briefly, 100 ng of pEZX-GA02-3'UTR variant and 0.2 ul of P3000 reagent were diluted in 5 ul of Optimen, and then gently mixed with 0.3 ul of Lipofectamine 3000 diluted in 5 ul of Optimen. After incubation at room temperature for 15 minutes, the mixture was diluted to a final volume of 100 ul of serum-free culture medium. The experiment was performed in three replicates. 48 hours after transfection, the supernatant was collected for enzyme dosing.
[0156] Enzyme dosage Gaussia luciferase activity was measured using the following protocol. Culture medium was collected and diluted in PBS 1X using a 1:10 dilution. 50 μl of the diluted supernatant was distributed into a white 96-well OptiPlate. 11 μl of coelenterazine (C3230-50UG, Sigma Aldrich) was diluted in 5.5 ml of PBS 1X and automatically distributed. Luciferase optic units were measured using an EnSpire Multimode plate reader (Perkin Elmer, Courtaboeuf, France). Transfection efficiency was controlled by quantification of SEAP using a Phospha-Light® SEAP reporter gene assay system (T1015, ThermoFisher) and a 1:20 dilution of the supernatant. Gaussia luciferase values were normalized by the SEAP measurements. All conditions were performed in three replicates.
[0157] Mice and drug treatment All animal procedures were carried out in accordance with European guidelines for the care and use of laboratory animals for humans, and the animal experiment was approved by the Ethics Committee for animal experiment C2AE-51 of Every, number APAFIS#29497-2020102611378971 v2 and DAP 2020-001-B. All C57BL / 10ScSn-Dmdmdx / J(BL10 / mdx) female mice were housed at the CERFE (Experimental Functional Research Exploration Center) facility, Genopole.
[0158] Four-week-old mdx mice were given a total of 10 doses of rAAV9-CMV-Cas9 and rAAV9-gmLet7c2. E Twelve vector genomes were administered by tail vein injection. The SpCas9(1):gmLet7c2(5) ratio was used. Control mdx mice had a total of 10 vector genomes: rAAV9-CMV-Cas9 and rAAV9-gRosa26.1. EThe mice received 12 vector genomes. Subsequently, all mice were excised at 9 weeks of age. For histological and molecular analysis of mouse tissue, samples were collected immediately after the animals were killed by cervical dislocation, flash-frozen in isopentane cooled with liquid nitrogen, and stored at -80°C.
[0159] Histological analysis Transverse frozen sections (8 μm thick) of the tibialis anterior muscle (TA) were prepared from frozen muscle, air-dried, and stored at -80°C. Mouse sections were treated for hematoxylin-eosin staining as previously described [Guiraud et al., HMG. 2015]. All muscle sections were visualized using an Axioscan Z1 automated slide scanner (Zeiss, Germany) with ZEN2.6 SlideScan software and a Plan APO 10×0.45 NA objective lens. The proportion of centrally nucleated fibers was determined by analyzing H&E images of all muscle sections. Necrotic areas were quantified based on DMD_M.1.2.007 MDC1A_M.1.2.004 TREAT-NMD SOPS in TA sections using Fiji ImageJ 1.49i software.
[0160] Immunofluorescence Frozen transverse muscle sections were fixed in acetone for 10 minutes, then blocked in MOM® (Mouse on Mouse) (BMK-2202, Vector Laboratories) for 30 minutes, and incubated overnight at 4°C with mouse monoclonal anti-eutrophin (1:50, SC-33700) primary antibody. Next, the sections were washed in PBS and incubated at room temperature for 1 hour with a suitable Alexa Fluor secondary antibody. The sections were examined under an Axioplan 2 microscope system (Carl Zeiss, Germany).
[0161] statistics The results were analyzed using Prism (GraphPad Software, Inc.) and Student's t-test with a two-tailed distribution (F-test) assuming equal or unequal sample variances according to equality of variances. Data are expressed as mean ± SEM (standard error of the mean), and n indicates the number of independent biological replicates used in each group for comparison. The difference is ( * )p<0.05, ( ** )p<0.01 and ( *** A p-value of < 0.001 was considered statistically significant.
[0162] 2.Results Using a single guide RNA, the inventors targeted a specific repressor domain in the utrophin promoter and the 3'-UTR of the utrophin gene (Figure 1). Using the 3'-UTR sequence (SEQ ID NO: 43) as a reference sequence, the AU-rich element is located at positions 314-336; miR-296-5p(I) at positions 314-336; miR-206 at positions 394-415; miR-150 at positions 1508-1527; Let7c at positions 1593-1616; and miR-196b at positions 1697-1715.
[0163] In human DMD myoblasts, the inventors nucleofected the ribonucleoprotein (RNP) Cas9, as well as different single guides targeting the Let7c, miR-196b, and miR-150 / 133b / 296-5p(II) binding sites in the 3'UTR of eutrophin, and the ERF binding site in the 5'UTR of the eutrophin gene.
[0164] Negative controls corresponded to human DMD myoblasts nucleofected with Cas9 without a single guide RNA. 48 hours after treatment, the inventors observed 70% and 87% efficacy (Table 3) of single-guide editing targeting miR-196b and Let7c, respectively, associated with significant 1.8-fold and 4.1-fold increases in eutrophin mRNA levels (Figure 2). The inventors also observed 90% efficacy (Table 3) of editing associated with a 4.7-fold increase in eutrophin mRNA levels (Figure 2) by disrupting the Ets-2 repressor factor binding site (ERB) in the promoter region using the RNP Cas9 system (Figure 2).
[0165] [Table 3]
[0166] The indel is determined using the TIDE software [Brinkman et al. 2014, NAR 41(12):168].
[0167] In dystrophy myoblasts, these results are superior to those obtained with previously published eutrophin-based strategies mentioned above. In contrast, 16% efficacy of editing without a significant increase in eutrophin mRNA levels (Table 3) was observed with a single guide targeting gmiR-150-133b-296-5p(II) (Figure 2).
[0168] Next, the inventors searched for the 3'UTR responsible for downregulated UTRN expression. Therefore, several variants of the 3'UTR were designed (Figure 3). These different 3'UTRs were incorporated into a dual reporter system, pEZX-GA02. All constructs were then transfected into hDMD-D52 myoblasts. Using the reporter system (Gaussia luciferase), the results of each construct / deletion on GLuc expression could be studied. This provided some ideas about the best deletion to induce to increase gene expression.
[0169] The results obtained using all constructs in hDMD D52 myoblasts are shown in Figure 4. These data allow us to define the best region to delete, corresponding to positions 341–2046 of the 3'UTR (construct C4). This deletion shows no significant difference compared to deletion of the Let7c binding site (construct C9), indicating that Let7c is a very interesting and possibly best sequence to target. Using guide hLet7c1, the main genetic modifications are the addition of one nucleotide and the deletion of eight nucleotides. Disruption of the Let7c binding site by the addition of one nucleotide or the deletion of eight nucleotides is as efficient as complete deletion of the Let7c binding site (comparison of constructs C9 vs. C10 and C11). These data demonstrate that a single guide to produce point mutations is more efficient than deletions caused by two sgRNAs.
[0170] The protein results obtained for hLet7c1, hEN1, and hERB in hDMD D52 are shown in Figure 5. Five days after treatment, all guides / treatments led to a 2 / 3-fold increase in eutrophin A expression compared to the negative control.
[0171] These data suggest that targeting the Let7c binding site with a single guide was the best option for the eutrophin 3'UTR. Several guides target hLet7c1 in human DMD myoblasts. The most efficient guide in human DMD myoblasts was hLet7c1 (Figure 6). Under normal conditions (cas9:guide ratio of 1:2 and 1x enhancer), this guide cleaves with 87% efficiency, increasing eutrophin mRNA expression by up to 4.1 times. Therefore, we focused on Let7c and explored other possible guides (Let7c2 and 3). Importantly, hLet7c1 is specific to human UTRNs, while the Let7c2 guide is "compatible" for human and mouse 3'UTR sequences (a one-nucleotide mismatch between hLet7c2 and mLet7c2). Under normal conditions, hLet7c2 and mLet7c2 cleave with 49–52% efficiency, increasing utrophin mRNA expression by up to twofold (Figure 6). hLet7c2 and mLet7c2 behave in a similar manner, and their indel profiles are similar.
[0172] To test UTRN upregulation by let7c BS disruption in a DMD mouse model (mdx mouse), we designed two additional guides specific to mLet7c BS, mLet7c2, and mLet7c4. In the C2C12 immortalized mouse myoblast cell line, mLet7c2 was the most potent, showing a twofold increase in eutrophin protein expression (Figures 7 and 8).
[0173] The cell treatment conditions were modified to improve cleavage efficiency and subsequent eutrophin levels. The cas9:guide ratio was varied from 1:2 to 1:5, and the concentration of the enhancer used was increased from 1-fold to 5-fold. Under these optimized conditions, cleavage efficacy increased by up to 95%, and eutrophin mRNA levels increased sevenfold (Figure 9). These studies were performed in hDMD D52 myoblasts.
[0174] Recombinant AAV expressing Cas9 and recombinant AAV expressing mLet7c2 were intravenously administered to mdx mice (using a 1:5 rAAV-SpCas9 / AAV-mLet7c2 ratio, 1 E 12 vg total dose). Treatment with rAAV-Rosa26 / rAAV-SpCas9 was used as a control. Western blot analysis of TA muscle tissue showed a 1.6-fold increase in dystrophin protein expression 5 weeks after treatment with 1 E 12 vg total dose of rAAV-mLet7c2 / rAAV-SpCas9 compared to the control (Figure 10A). Immunofluorescent staining of muscle sections confirmed that the dystrophin signal increased and localized to the sarcolemma after rAAV-mLet7c2 / rAAV-SpCas9 treatment compared to the control (Figure 10B). Muscle from mice treated with rAAV-mLet7c2 / rAAV-SpCas9 showed a significant 22% decrease (p = 0.03) in central nucleated fibers in the TA muscle compared to the control group. The necrotic muscle area in the TA of mice treated with rAAV-mLet7c2 / rAAV-SpCas9 was significantly decreased by 82% (P = 0.03) compared to the control group (Figure 10C). This indicates that treatment of mdx mice with rAAV expressing Cas9 and rAAV expressing a single gRNA targeting Let7c binding improved muscle structure and histology in mice compared to the control. These results open up new prospects for the treatment of dystrophinopathies.
Claims
1. A method for enhancing eutrophin expression in cells, comprising the step of introducing into cells a composition comprising at least one gene editing enzyme capable of inducing site-directed mutations in a target sequence containing at least one repressor binding site selected from the group consisting of an Ets-2-repressor factor (ERF) binding site, a homeobox protein engrailed-1 (EN1) binding site 2, a Let7c binding site, and a miR-196b binding site, wherein the mutation disrupts the at least one repressor binding site without deleting the entire individual repressor binding site sequence.
2. The method according to claim 1, wherein the repressor binding site is selected from the group consisting of an ERF binding site consisting of the sequence CGGAA, an EN1 binding site 2 consisting of the sequence GTAGTGG, a Let7c binding site consisting of sequence number 1, and a miR-196b binding site consisting of the sequence of sequence number 2.
3. The method according to claim 1 or 2, wherein the repressor binding site is a Let7c binding site.
4. The method according to any one of claims 1 to 3, wherein the gene editing enzyme is selected from the group consisting of site-specific nucleases, base editors, and prime editors.
5. The method according to claim 4, wherein the gene editing enzyme is a CRISPR / Cas gene editing enzyme comprising a guide RNA containing a complementary sequence to the target sequence containing a eutrophin repressor binding site.
6. The method according to claim 5, wherein the guide RNA is selected from the group consisting of SEQ ID NOs: 3 to 17 and 25.
7. The method according to any one of claims 1 to 6, wherein the composition comprises at least two gene editing enzymes which are sequence-specific nucleases, and the nucleases are used sequentially such that a first sequence-specific nuclease induces a first site-directed mutation event in a target sequence, and once the first mutation event is repaired, a second sequence-specific nuclease is used to induce a second site-directed mutation event in the target sequence.
8. A composition for enhancing eutrophin expression, comprising at least one gene editing enzyme capable of inducing site-directed mutations within a target sequence containing a repressor binding site of the eutrophin gene, selected from the group consisting of an Ets-2 repressor factor (ERF) binding site of sequence CGGAA, a homeobox protein engrailed-1 (EN1) binding site 2 of sequence GTAGTGG, a Let7c binding site of sequence number 1, and a miR-196b binding site of sequence number 2, wherein the mutation disrupts the repressor binding site without deleting the entire individual repressor binding site sequence.
9. The composition according to claim 8, wherein the repressor binding site of the eutrophin gene is the Let7c binding site corresponding to SEQ ID NO:
1.
10. The composition according to claim 8 or 9, wherein the gene editing enzyme is a CRISPR / Cas gene editing enzyme comprising a guide RNA containing a complementary sequence to the target sequence containing a eutrophin repressor binding site.
11. The composition according to claim 10, wherein the guide RNA comprises a sequence selected from the group consisting of SEQ ID NOs: 3 to 17 and 25.
12. The composition according to any one of claims 8 to 11, wherein the gene editing enzyme is encoded by a nucleic acid construct.
13. The composition according to claim 12, wherein the nucleic acid construct is contained in a viral vector.
14. The composition according to claim 12, wherein the nucleic acid construct is contained in an AAV vector.
15. A pharmaceutical composition comprising the composition according to any one of claims 8 to 14, and a pharmaceutical excipient.
16. A composition according to any one of claims 8 to 14 and a pharmaceutical composition according to claim 15 for use in the treatment of dystrophin disorders.
17. A composition according to any one of claims 8 to 14 and a pharmaceutical composition according to claim 15 for use in the treatment of Duchenne muscular dystrophy, Becker muscular dystrophy, or X-linked dilated cardiomyopathy.
18. Engineered cells comprising a site-directed mutation in at least one target sequence containing a repressor binding site of the eutrophin gene, selected from the group consisting of the Ets-2-repressor factor (ERF) binding site, the homeobox protein engrailed-1 (EN1) binding site 2, the Let7c binding site, and the miR-196b binding site, wherein the mutation disrupts the repressor binding site without deleting the entire individual repressor binding site sequence.
19. The manipulated cell according to claim 18, wherein the repressor binding site is selected from the group consisting of an Ets-2-repressor factor (ERF) binding site consisting of the sequence CGGAA, a homeobox protein engrailed-1 (EN1) binding site 2 consisting of the sequence GTAGTGG, a Let7c binding site consisting of SEQ ID NO: 1, and miR-196b consisting of SEQ ID NO:
2.
20. The manipulated cell according to claim 18 or 19, wherein the repressor binding site of the eutrophin gene is a Let7c binding site.