Composition for treating sensorineural hearing loss using an otoferrin bivector system

JP7899196B2Active Publication Date: 2026-08-03DECIBEL THERAPEUTICS INC
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
DECIBEL THERAPEUTICS INC
Filing Date
2022-02-18
Publication Date
2026-08-03

Smart Images

  • Figure 0007899196000113
    Figure 0007899196000113
  • Figure 0007899196000114
    Figure 0007899196000114
  • Figure 0007899196000115
    Figure 0007899196000115
Patent Text Reader

Abstract

The present disclosure features compositions and methods for treating subjects 25 years of age or older who have a biallelic mutation in otoferlin (OTOF) by OTOF gene therapy. The present disclosure provides various compositions that include a first nucleic acid vector containing a polynucleotide encoding an N-terminal portion of the OTOF protein and a second nucleic acid vector containing a polynucleotide encoding a C-terminal portion of the OTOF protein. These vectors can be used to treat hearing loss or auditory neuropathy in subjects who have a biallelic OTOF mutation.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Sequence List This application includes a sequence listing submitted electronically in ASCII format, which is incorporated herein by reference in its entirety. The ASCII copy created on 18 February 2022 is named 51471-008WO2_Sequence_Listing_2_17_22_ST25 and has a size of 366,491 bytes.

[0002] This specification describes compositions and methods for the treatment of sensorineural hearing loss and auditory neuropathy, particularly forms of diseases associated with mutations in otoferrin (OTOF), in humans aged 25 years or older, by OTOF gene therapy. This disclosure provides a dual vector system comprising a first nucleic acid vector containing a polynucleotide encoding the N-terminal portion of the OTOF protein and a second nucleic acid vector containing a polynucleotide encoding the C-terminal portion of the OTOF protein. These vectors can be used to increase or provide wild-type OTOF expression in subjects such as humans suffering from sensorineural hearing loss. [Background technology]

[0003] Sensorineural hearing loss is a type of hearing loss caused by defects in the cells of the inner ear or in the nerve pathways that project from the inner ear to the brain. While sensorineural hearing loss is often acquired and can be caused by noise, infection, head trauma, ototoxic drugs, or aging, there is also congenital sensorineural hearing loss associated with autosomal recessive mutations. One such form of autosomal recessive sensorineural hearing loss is associated with mutations in the otoferrin (OTOF) gene, which is linked to non-symptomatic hearing loss before language acquisition. In recent years, efforts to treat hearing loss have increasingly focused on gene therapy as a possible solution. However, OTOF is too large to be treated using standard gene therapy techniques. New therapies are needed to treat OTOF-related sensorineural hearing loss. [Overview of the project]

[0004] This invention provides compositions and methods for treating human subjects aged 25 years or older who have a bialleletic otoferrin (OTOF) mutation known to cause hearing loss and auditory neuropathy. The compositions described herein can be used to deliver wild-type (WT) OTOF to subjects via gene therapy and, therefore, can be used to treat hearing loss and auditory neuropathy in subjects. Gene therapy for treating bialleletic OTOF mutations is considered necessary during the first year of life to restore hearing. However, the inventors have shown that gene therapy can restore hearing lost due to bialleletic OTOF mutations, even if treatment is initiated much later in life. Furthermore, the compositions described herein can be used to treat subjects identified as having a bialleletic OTOF mutation and possessing detectable otoacoustic emissions, detectable cochlear microphone potentials, and / or detectable cluster potentials.

[0005] In a first aspect, the present invention provides a method for treating human subjects aged 25 years or older who have a bialleletic otoferrin (OTOF) mutation by administering a therapeutically effective dose of a dual vector system, the dual vector system comprising a first nucleic acid vector containing a promoter operably bound to a first coding polynucleotide encoding the N-terminal portion of the OTOF protein, and a second nucleic acid vector containing a second coding polynucleotide encoding the C-terminal portion of the OTOF protein, and a polyadenylation (poly(A)) sequence located at 3' of the second coding polynucleotide, wherein neither the first nor the second nucleic acid vector encodes the full-length OTOF protein.

[0006] In another embodiment, the present invention provides a therapeutic method for administering a therapeutically effective dose of a dual vector system to a human subject identified as having a bialleletic otoferrin (OTOF) mutation and possessing detectable otoacoustic emissions, detectable cochlear microphone potentials, and / or detectable collection potentials; the dual vector system comprises a first nucleic acid vector containing a promoter operably bound to a first coding polynucleotide encoding the N-terminal portion of the OTOF protein, and a second nucleic acid vector containing a second coding polynucleotide encoding the C-terminal portion of the OTOF protein, and a polyadenylation (poly(A)) sequence located at 3' of the second coding polynucleotide, wherein neither the first nor the second nucleic acid vector encodes the full-length OTOF protein.

[0007] In some embodiments of any of the aforementioned aspects, the first coding polynucleotide and the second coding polynucleotide do not overlap. In some embodiments of any of the above-described aspects, the first nucleic acid vector includes a splice donor signal sequence located at the 3' position of the first coding polynucleotide, and the second nucleic acid vector includes a splicing acceptor signal sequence located at the 5' position of the second coding polynucleotide. In some embodiments, the first nucleic acid vector includes a first recombination region located at the 3' position of the splice donor signal sequence, and the second nucleic acid vector includes a second recombination region located at the 5' position of the splice acceptor signal sequence. In some embodiments, the first and second recombination regions are identical. In some embodiments, the first and / or second recombination regions are an AP gene fragment or an F1 phage AK gene. In some embodiments, the F1 phage AK gene includes or has the sequence of SEQ ID NO: 19. In some embodiments, the AP gene fragment includes or has one of the sequences of SEQ ID NOs: 62-67. In some embodiments, the AP gene fragment includes or has the sequence of SEQ ID NO: 65. In some embodiments, the splice donor sequence includes or has the sequence of SEQ ID NO: 20 or SEQ ID NO: 68. In some embodiments, the splicing acceptor sequence includes or has the sequence of SEQ ID NO: 21 or SEQ ID NO: 69. In some embodiments, the first nucleic acid vector further includes a degradation signal sequence located at 3' of the recombinant gene region, and the second nucleic acid vector further includes a degradation signal sequence located between the recombinant region and the splicing acceptor signal sequence. In some embodiments, the degradation signal sequence includes or has the sequence of SEQ ID NO: 22.

[0008] In some embodiments of any of the aforementioned aspects, the first and second coding polynucleotides are separated by an OTOF exon boundary. In some embodiments, the OTOF exon boundary is not located inside the first or second coding polynucleotide encoding the C2 domain.

[0009] In some embodiments of any of the aforementioned embodiments, the first coding polynucleotide partially overlaps with the second coding polynucleotide. In some embodiments, the first coding polynucleotide overlaps with the second coding polynucleotide by at least 1 kilobase (kb). In some embodiments, the overlapping region between the first and second coding polynucleotides is centered around the OTOF exon boundary. In some embodiments, the first coding polynucleotide codes for the N-terminal portion of the OTOF protein and includes the OTOF N-terminus 500 bp to 3' of the exon boundary at the center of the overlapping region; and the second coding polynucleotide codes for the C-terminal portion of the OTOF protein and includes the OTOF C-terminus 5' to the OTOF C-terminus 5' of the exon boundary at the center of the overlapping region. In some embodiments, the OTOF exon boundary at the center of the overlapping region is not present in part of the first coding polynucleotide or the second coding polynucleotide encoding the C2 domain.

[0010] In some embodiments of any of the aforementioned aspects, the OTOF exon boundary is selected such that the first coding polynucleotide codes for the entire C2C domain, and the second coding polynucleotide codes for the entire C2D domain. In some embodiments, the OTOF exon boundary is the exon 19 / 20 boundary, the exon 20 / 21 boundary, or the exon 21 / 22 boundary.

[0011] In some embodiments of any of the aforementioned aspects, the OTOF exon boundary is selected such that the first coding polynucleotide encodes the entire C2D domain, and the second coding polynucleotide encodes the entire C2E domain. In some embodiments, the OTOF exon boundary is the exon 26 / 27 boundary, or the exon 28 / 29 boundary.

[0012] In some embodiments of any of the aforementioned aspects, the OTOF exon boundary is located in a first coding polynucleotide encoding the C2D domain and in a portion of the second coding polynucleotide. In some embodiments, the OTOF exon boundary is the exon 24 / 25 boundary or the exon 25 / 26 boundary.

[0013] In some embodiments of any of the aforementioned aspects, each of the first and second coding polynucleotides codes for approximately half of the OTOF protein sequence. In some embodiments of any of the aforementioned aspects, the first nucleic acid vector and the second nucleic acid vector do not contain an OTOF untranslated region (UTR).

[0014] In some embodiments of any of the aforementioned aspects, the first nucleic acid vector includes OTOF 5'UTR. In some embodiments of any of the aforementioned aspects, the second nucleic acid vector includes OTOF 3'UTR.

[0015] In some embodiments of any of the aforementioned aspects, the first and second coding polynucleotides encoding the OTOF protein do not include introns.

[0016] In some embodiments of any of the aforementioned aspects, the first and second coding polynucleotides encoding the OTOF protein do not contain introns.

[0017] In some embodiments of any of the aforementioned aspects, the OTOF protein is a mammalian OTOF protein. In some embodiments of any of the embodiments described above, the OTOF protein is a mouse OTOF protein. In some embodiments of any of the embodiments described above, the mouse OTOF protein has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity) to the sequence of SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, or SEQ ID NO: 9. In some embodiments of any of the embodiments described above, the OTOF protein contains or consists of the sequence of SEQ ID NO: 6.

[0018] In some embodiments of any of the embodiments described above, the OTOF protein is a human OTOF protein. In some embodiments of any of the embodiments described above, the human OTOF protein has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity) to the sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5. In some embodiments of any of the embodiments described above, the OTOF protein includes or consists of the sequence of SEQ ID NO: 1. In some embodiments of any of the embodiments described above, the OTOF protein includes or consists of the sequence of SEQ ID NO: 2. In some embodiments of any of the embodiments described above, the OTOF protein includes or consists of the sequence of SEQ ID NO: 3. In some embodiments of any of the embodiments described above, the OTOF protein includes or consists of the sequence of SEQ ID NO: 4. In some embodiments of any of the embodiments described above, the OTOF protein contains or consists of the sequence of SEQ ID NO: 5. In some embodiments of any of the embodiments described above, the human OTOF protein contains SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5, or one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more) of conserved amino acid substitutions. In some embodiments, less than 10% (10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less) of the amino acids in the OTOF protein variant are conserved amino acid substitutions.

[0019] In some embodiments of any of the above-described aspects, the OTOF protein is encoded by one of sequence numbers 10 to 14. In some embodiments, the OTOF protein is encoded by sequence number 10. In some embodiments, the OTOF protein is encoded by sequence number 14.

[0020] In some embodiments of any of the aforementioned aspects, the OTOF protein is encoded by one of sequence numbers 15-18. In some embodiments of any of the above-described aspects, the first coding polynucleotide codes for amino acids 1-802 of SEQ ID NO: 1 or SEQ ID NO: 5, and the second coding polynucleotide codes for amino acids 803-1997 of SEQ ID NO: 1 or SEQ ID NO: 5. In some embodiments, the first coding polynucleotide codes for amino acids 1-802 of SEQ ID NO: 1, and the second coding polynucleotide codes for amino acids 803-1997 of SEQ ID NO: 1. In some embodiments, the first coding polynucleotide codes for amino acids 1-802 of SEQ ID NO: 5, and the second coding polynucleotide codes for amino acids 803-1997 of SEQ ID NO: 5.

[0021] In some embodiments of any of the above-described aspects, the N-terminal portion of the OTOF protein consists of the sequence of SEQ ID NO: 73, or a variant thereof having one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more) conserved amino acid substitutions. In some embodiments, less than 10% (10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less) of the amino acids in the N-terminal portion of the OTOF protein variant are conserved amino acid substitutions. In some embodiments, the N-terminal portion of the OTOF protein consists of the sequence of SEQ ID NO: 73. In some embodiments, the N-terminal portion of the OTOF protein is encoded by the sequence of SEQ ID NO: 71.

[0022] In some embodiments of any of the above-described aspects, the C-terminal portion of the OTOF protein consists of the sequence of SEQ ID NO: 74, or a variant thereof having one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more) conserved amino acid substitutions. In some embodiments, less than 10% (10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less) of the amino acids in the C-terminal portion of the OTOF protein variant are conserved amino acid substitutions. In some embodiments, the C-terminal portion of the OTOF protein consists of the sequence of SEQ ID NO: 74. In some embodiments, the C-terminal portion of the OTOF protein is encoded by the sequence of SEQ ID NO: 72.

[0023] In some embodiments of any of the above-described aspects, the first nucleic acid vector includes a Kozak sequence located at 3' of the promoter and a first coding polynucleotide at 5' that encodes the N-terminal portion of the OTOF protein.

[0024] In some embodiments of any of the above-described embodiments, the promoter is a ubiquitous promoter. In some embodiments, the ubiquitous promoter is a CAG promoter, a cytomegalovirus (CMV) promoter, a chicken β-actin promoter, a deleted CMV-chicken β-actin promoter (smCBA), a CB7 promoter, a hybrid CMV enhancer / human β-actin promoter, a human β-actin promoter, an elongation factor-1α (EF1α) promoter, or a phosphoglycerate kinase (PGK) promoter. In some embodiments, the ubiquitous promoter is a CAG promoter. In some embodiments, the ubiquitous promoter is an smCBA promoter. In some embodiments, the smCBA promoter has the sequence of SEQ ID NO: 70.

[0025] In some embodiments of any of the above-described aspects, the promoter is a cochlear hair cell-specific promoter. In some embodiments, the cochlear hair cell-specific promoter is the myosin 15 (Myo15) promoter, the myosin 7A (Myo7A) promoter, the myosin 6 (Myo6) promoter, the POU class 4 homeobox 3 (POU4F3) promoter, the asynthetic BHLH transcription factor 1 (ATOH1) promoter, the LIM homeobox 3 (LHX3) promoter, the α9 acetylcholine receptor (α9AChR) promoter, or the α10 acetylcholine receptor (α10AChR) promoter. In some embodiments, the cochlear hair cell-specific promoter is the Myo15 promoter.

[0026] In some embodiments of any of the above-described aspects, the promoter is an inner hair cell-specific promoter. In some embodiments, the inner hair cell-specific promoter is the fibroblast growth factor 8 (FGF8) promoter, the vesicle glutamate transporter 3 (VGLUT3) promoter, the OTOF promoter, or the calcium-binding protein 2 (CABP2) promoter. In some embodiments, the inner hair cell-specific promoter is the CABP2 promoter.

[0027] In some embodiments of any of the above-described aspects, the promoter is a short promoter (for example, a promoter of 1kb or less, for example, approximately 1kb, 950bp, 900bp, 850bp, 800bp, 750bp, 700bp, 650bp, 600bp, 550bp, 500bp, 450bp, 400bp, 350bp, 300bp, or less). In some embodiments, the short promoter is a CAG promoter. In some embodiments, the short promoter is a CMV promoter. In some embodiments, the short promoter is a smCBA promoter. In some embodiments, the short promoter is a Myo15 promoter of 1kb or less (for example, a Myo15 promoter having a sequence that has at least 85% sequence identity with any one of sequence numbers 38, 39, or 49-60 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity)).

[0028] In some embodiments of any of the above-described aspects, the promoter is a long promoter (e.g., a promoter longer than 1kb, e.g., 1.1kb, 1.25kb, 1.5kb, 1.75kb, 2kb, 2.5kb, 3kb, or longer). In some embodiments, the long promoter is a Myo15 promoter longer than 1kb (e.g., a Myo15 promoter containing or consisting of sequences having at least 85% sequence identity with respect to the sequence of Sequence ID No. 36 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity)).

[0029] In some embodiments of any of the aforementioned aspects, the first and second nucleic acid vectors are the pair of nucleic acid vectors listed in Table 4. In some embodiments of any of the above-described embodiments, the first nucleic acid vector includes a polynucleotide sequence comprising the sequence of nucleotides 2272 to 6041 of SEQ ID NO: 75. In some embodiments of any of the above-described embodiments, the first nucleic acid vector includes, or comprises, a polynucleotide sequence comprising the sequence of nucleotides 2049 to 6264 of SEQ ID NO: 75.

[0030] In some embodiments of any of the above-described embodiments, the first nucleic acid vector includes a polynucleotide sequence comprising the sequence of nucleotides 182 to 3949 of SEQ ID NO: 77. In some embodiments of any of the above-described embodiments, the first nucleic acid vector includes a polynucleotide sequence comprising, or consisting of, the sequence of nucleotides 19 to 4115 of SEQ ID NO: 77.

[0031] In some embodiments of any of the above-described embodiments, the first nucleic acid vector comprises a polynucleotide sequence including the sequence of nucleotides 2267-6014 of SEQ ID NO: 79. In some embodiments of any of the above-described embodiments, the first nucleic acid vector comprises a polynucleotide sequence including, or consisting of, the sequence of nucleotides 2049-6237 of SEQ ID NO: 79.

[0032] In some embodiments of any of the above-described embodiments, the first nucleic acid vector includes a polynucleotide sequence comprising the sequence of nucleotides 177 to 3924 of SEQ ID NO: 80. In some embodiments of any of the above-described embodiments, the first nucleic acid vector includes a polynucleotide sequence comprising, or consisting of, the sequence of nucleotides 19 to 4090 of SEQ ID NO: 80.

[0033] In some embodiments of any of the above-described embodiments, the second nucleic acid vector includes a polynucleotide sequence comprising the sequence of nucleotides 2267 to 6476 of SEQ ID NO: 76. In some embodiments of any of the above-described embodiments, the second nucleic acid vector includes, or comprises, a polynucleotide sequence comprising the sequence of nucleotides 2049 to 6693 of SEQ ID NO: 76.

[0034] In some embodiments of any of the above-described embodiments, the second nucleic acid vector includes a polynucleotide sequence comprising the sequence of nucleotides 187 to 4396 of SEQ ID NO: 78. In some embodiments of any of the above-described embodiments, the second nucleic acid vector includes, or comprises, a polynucleotide sequence comprising the sequence of nucleotides 19 to 4589 of SEQ ID NO: 78.

[0035] In some embodiments of any of the above-described embodiments, the first nucleic acid vector includes a polynucleotide sequence comprising the sequence of nucleotides 235 to 4004 of SEQ ID NO: 81. In some embodiments of any of the above-described embodiments, the first nucleic acid vector includes a polynucleotide sequence comprising, or consisting of, the sequence of nucleotides 12 to 4227 of SEQ ID NO: 81.

[0036] In some embodiments of any of the above-described embodiments, the first nucleic acid vector includes a polynucleotide sequence comprising the sequence of nucleotides 230 to 3977 of SEQ ID NO: 83. In some embodiments of any of the above-described embodiments, the first nucleic acid vector includes a polynucleotide sequence comprising or consisting of the sequence of nucleotides 12 to 4200 of SEQ ID NO: 83.

[0037] In some embodiments of any of the above-described embodiments, the second nucleic acid vector includes a polynucleotide sequence comprising the sequence of nucleotides 229 to 4438 of SEQ ID NO: 72. In some embodiments of any of the above-described embodiments, the second nucleic acid vector includes a polynucleotide sequence comprising, or consisting of, the sequence of nucleotides 12 to 4655 of SEQ ID NO: 82.

[0038] In some embodiments of any of the above-described aspects, the first and second nucleic acid vectors include reverse-terminal repeats (ITRs) at both ends of the nucleic acid sequence. In some embodiments, the first vector includes a first reverse-terminal repeat (ITR) sequence at 5' of the promoter, an ITR sequence at 3' of the recombinant region, and a second ITR sequence at 3' of the poly(A) sequence. In some embodiments, the ITRs in the first and second vectors are AAV2 ITRs. In some embodiments, the ITRs in the first and second vectors have at least 80% sequence identity with respect to AAV2 ITRs (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity).

[0039] In some embodiments of any of the above-described aspects, the poly(A) sequence is a bovine growth hormone (bGH) poly(A) signaling sequence. In some embodiments of any of the aforementioned aspects, the second nucleic acid vector includes a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE). In some embodiments, the WPRE includes or consists of the sequence of SEQ ID NO: 23 or SEQ ID NO: 61.

[0040] In some embodiments of any of the aforementioned aspects, the nucleic acid vector is a duplicated double vector. In some embodiments of any of the aforementioned aspects, the nucleic acid vector is a trans-splicing double vector.

[0041] In some embodiments of any of the aforementioned aspects, the nucleic acid vector is a double hybrid vector. In some embodiments of any of the above-described embodiments, the nucleic acid vector is an adeno-associated virus (AAV) vector. In some embodiments, the AAV vector has an AAV1, AAV2, AAV2quad(YF), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, rh10, rh39, rh43, rh74, Anc80, Anc80L65, DJ / 8, DJ / 9, 7m8, PHP.B, PHP.eb, or PHP.S capsid. In some embodiments, the AAV vector has an AAV1 capsid. In some embodiments, the AAV vector has an AAV9 capsid. In some embodiments, the AAV vector has an AAV6 capsid. In some embodiments, the AAV vector has an Anc80 capsid. In some embodiments, the AAV vector has an Anc80L65 capsid. In some embodiments, the AAV vector has a DJ / 9 capsid. In some embodiments, the AAV vector has a 7m8 capsid. In some embodiments, the AAV vector has an AAV2 capsid. In some embodiments, the AAV vector has an AAV2quad(YF) capsid. In some embodiments, the AAV vector has a PHP.B capsid. In some embodiments, the AAV vector has an AAV8 capsid.

[0042] In some embodiments of any of the embodiments described above, the first and second nucleic acid vectors have the same capsid (for example, both the first and second nucleic acid vectors are AAV vectors having either an AAV1 capsid or an AAV9 capsid). In some embodiments of any of the embodiments described above, the first and second nucleic acid vectors have different capsids (for example, the first nucleic acid vector is an AAV having an AAV1 capsid, and the second nucleic acid vector is an AAV having an AAV9 capsid).

[0043] In some embodiments of any of the aforementioned aspects, the target group is 30 years of age or older. In some embodiments of any of the aforementioned aspects, the target group is 35 years of age or older. In some embodiments of any of the aforementioned aspects, the target population is 40 years of age or older.

[0044] In some embodiments of any of the aforementioned aspects, the target population is 45 years of age or older. In some embodiments of any of the aforementioned aspects, the target is 50 years of age or younger. In some embodiments of any of the aforementioned aspects, the subject is identified as having a biallelic OTOF mutation.

[0045] In some embodiments of any of the aforementioned aspects, the method further includes the step of identifying a subject as having a biallelic OTOF mutation before administering the biallelic vector system. In some embodiments of any of the aforementioned aspects, the object is identified as having detectable otoacoustic emissions.

[0046] In some embodiments of any of the aforementioned aspects, the method further includes the step of identifying a subject that has detectable otoacoustic emissions before administering the dual vector system. In some embodiments of any of the aforementioned aspects, the object is identified as having a detectable cochlear microphone potential.

[0047] In some embodiments of any of the aforementioned aspects, the method further includes the step of identifying a subject to have a detectable cochlear microphone potential before administering the dual vector system.

[0048] In some embodiments of any of the aforementioned aspects, the object is identified as having a detectable aggregate potential. In some embodiments of any of the aforementioned aspects, the method further includes the step of identifying a subject to have a detectable collective potential before administering the dual vector system.

[0049] In some embodiments of any of the aforementioned aspects, the method further includes the step of evaluating the subject's hearing before administering the dual-vector system. In some embodiments of any of the aforementioned aspects, the subject is identified as having, or being identified as having, hearing loss, autosomal recessive 9 (DFNB9).

[0050] In some embodiments of any of the aforementioned aspects, the method further includes the step of evaluating the subject's hearing before administering the dual-vector system. In some embodiments of any of the aforementioned aspects, the dual-vector system is administered locally to the middle or inner ear. In some embodiments, the dual-vector system is administered by injection through a round window, injection into the semicircular canals, canotomy, catheter insertion through a round window, transtympanic injection, or intratympanic injection.

[0051] In some embodiments of any of the aforementioned aspects, the method further includes the step of evaluating the subject's hearing after administering the dual-vector system. In some embodiments of any of the embodiments described above, the method enhances OTOF expression in cochlear hair cells. In some embodiments of any of the embodiments described above, the cochlear hair cells are inner hair cells.

[0052] In some embodiments of any of the aforementioned aspects, the dual-vector system increases OTOF expression in cells (e.g., cochlear hair cells), improving hearing (e.g., as assessed by standard tests such as audiometry, auditory brainstem response (ABR), electrocochleography (ECOG), and otoacoustic emissions), preventing or mitigating hearing loss, delaying the onset of hearing loss, slowing the progression of hearing loss, improving speech discrimination, or improving hair cell function.

[0053] In some embodiments of any of the foregoing aspects, the dual vector system is administered in an amount sufficient to increase OTOF expression in cochlear hair cells, prevent or reduce hearing loss, delay the onset of hearing loss, slow the progression of hearing loss, improve hearing (e.g., as evaluated by standard tests such as audiometry, ABR, ECOG, and otoacoustic emissions), improve speech discrimination ability, or improve hair cell function.

[0054] In some embodiments of any of the foregoing aspects, the first vector and the second vector are administered simultaneously. In some embodiments of any of the foregoing aspects, the first vector and the second vector are administered sequentially.

[0055] In some embodiments of any of the foregoing aspects, the first vector and the second vector are 1×10 8 , 8 , 8 , 9 , 9 , 9 , 8 , 8 , 8 , 9 , 8 , 9 , 8 , 9 vector genomes (VG) / ear to about 2×10 15 VG / ear (e.g., 1×10 7 VG / ear, 2×10 7 VG / ear, 3×10 7 VG / ear, 4×10 7 VG / ear, 5×10 7 VG / ear, 6×10 7 VG / ear, 7×10 7 VG / ear, 8×10 7 VG / ear, 9×10 7 VG / ear, 1×10 8 VG / ear, 2×10 8 VG / ear, 3×10 8 VG / ear, 4×10 8 VG / ear, 5×10 8 VG / ear, 6×10 8 VG / ear, 7×10 8 VG / ear, 8×10 8 VG / ear, 9×10 8 VG / ear, 1×10 9 VG / ear, 2×10 [[ID=5​​​​​​​​​9 VG / ear, 8×10 9 VG / ear, 9×10 9 VG / ear, 1×10 10 VG / ear, 2×10 10 VG / ear, 3×10 10 VG / ear, 4×10 10 VG / ear, 5×10 10 VG / ear, 6×10 10 VG / ear, 7×10 10 VG / ear, 8×10 10 VG / ear, 9×10 10 VG / ear, 1×10 11 VG / ear, 2×10 11 VG / ear, 3×10 11 VG / ear, 4×10 11 VG / ear, 5×10 11 VG / ear, 6×10 11 VG / ear, 7×10 11 VG / ear, 8×10 11 VG / ear, 9×10 11 VG / ear, 1×10 12 VG / ear, 2×10 12 VG / ear, 3×10 12 VG / ear, 4×10 12 VG / ear, 5×10 12 VG / ear, 6×10 12 VG / ear, 7×10 12 VG / ear, 8×10 12 VG / ear, 9×10 12 VG / ear, 1×10 13 VG / ear, 2×10 13 VG / ear, 3×10 13 VG / ear, 4×10 13 VG / ear, 5×10 13 VG / ear, 6×10 13 VG / ear, 7×10 13 VG / ear, 8×10 13 VG / ear, 9×10 13 VG / ear, 1×10 14 VG / ear, 2×10 14 VG / ear, 3×10 14 VG / ear, 4×10 14 VG / ear, 5×10 14 VG / ear, 6×10 14 VG / ear, 7×10 14VG / ear, 8×10 14 VG / ear, 9×10 14 VG / ear, 1×10 15 VG / ear, or 2×10 15 It is administered at a concentration of VG / ear.

[0056] In some embodiments of any of the aforementioned aspects, the first vector and the second vector are administered in an amount sufficient to transduce at least 20% of the target inner hair cells with both the first and second vectors (for example, transduce at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more of the target inner hair cells with both vectors).

[0057] In some embodiments of any of the aforementioned aspects, the dual vector is administered in a composition containing pharmaceutically acceptable excipients. In some embodiments of any of the aforementioned aspects, the Myo15 promoter includes the sequences of SEQ ID NO: 26 and / or SEQ ID NO: 27 operably coupled to a first region having at least 85% sequence identity with SEQ ID NO: 24 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity), or a second region having at least 85% sequence identity with SEQ ID NO: 25 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity), The present invention includes, or comprises, a functional part or derivative thereof of sequence number 31 and / or sequence number 32, which optionally includes a linker containing 1 to 100 nucleotides between the first and second regions (for example, 1 to 5, 1 to 10, 1 to 15, 1 to 20, 1 to 25, 1 to 30, 1 to 35, 1 to 40, 1 to 45, 1 to 50, 1 to 60, 1 to 70, 1 to 80, 1 to 90, 10 to 20, 10 to 30, 10 to 40, 10 to 50, 10 to 60, 10 to 70, 10 to 80, 10 to 90, 10 to 100, 20 to 30, 20 to 40, 20 to 50, 20 to 60, 20 to 70, 20 to 80, 20 to 90, or 20 to 100 nucleotides). In some embodiments, the first region includes or consists of the sequence of sequence number 24. In some embodiments, the second region includes or consists of the sequence of sequence number 25.

[0058] In some embodiments of any of the embodiments described above, the Myo15 promoter has at least 85% sequence identity with respect to SEQ ID NO: 36 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity). In some embodiments of any of the embodiments described above, the Myo15 promoter includes or consists of the sequence of SEQ ID NO: 36. In some embodiments of any of the embodiments described above, the Myo15 promoter has at least 85% sequence identity with respect to SEQ ID NO: 38 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity). In some embodiments of any of the embodiments described above, the Myo15 promoter includes or consists of the sequence of SEQ ID NO: 38. In some embodiments of any of the embodiments described above, the Myo15 promoter has at least 85% sequence identity with respect to SEQ ID NO: 39 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity). In some embodiments of any of the embodiments described above, the Myo15 promoter includes or consists of the sequence of SEQ ID NO: 39. In some embodiments of any of the embodiments described above, the Myo15 promoter has at least 85% sequence identity with respect to SEQ ID NO: 53 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity). In some embodiments of any of the embodiments described above, the Myo15 promoter includes or consists of the sequence of SEQ ID NO: 53. In some embodiments of any of the embodiments described above, the Myo15 promoter has at least 85% sequence identity with respect to SEQ ID NO: 54 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity).In some embodiments of any of the embodiments described above, the Myo15 promoter includes or consists of the sequence of SEQ ID NO: 54. In some embodiments of any of the embodiments described above, the Myo15 promoter has at least 85% sequence identity with respect to SEQ ID NO: 59 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity). In some embodiments of any of the embodiments described above, the Myo15 promoter includes or consists of the sequence of SEQ ID NO: 59. In some embodiments of any of the embodiments described above, the Myo15 promoter has at least 85% sequence identity with respect to SEQ ID NO: 60 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity). In some embodiments of any of the embodiments described above, the Myo15 promoter includes or consists of the sequence of SEQ ID NO: 60.

[0059] In some embodiments of any of the aforementioned aspects, the Myo15 promoter includes sequences of sequence numbers 31 and / or 32 operably coupled to a first region having at least 85% sequence identity with respect to sequence number 25 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity), or a second region having at least 85% sequence identity with respect to sequence number 24 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity), The functional portion or derivative thereof, or the functional portion or derivative thereof containing the sequence of SEQ ID NO: 26 and / or SEQ ID NO: 27, optionally including the functional portion or derivative thereof, or the functional portion or derivative thereof containing the sequence of SEQ ID NO: 26 and / or SEQ ID NO: 27, which optionally includes the functional portion or derivative thereof, or the functional portion or derivative thereof containing the sequence of SEQ ID NO: 26 and / or SEQ ID NO: 27, which optionally includes a linker containing 1 to 100 nucleotides (e.g., 1 to 5, 1 to 10, 1 to 15, 1 to 20, 1 to 25, 1 to 30, 1 to 40, 1 to 50, 1 to 60, 1 to 70, 1 to 80, 1 to 50, 1 to 60, 1 to 70, 1 to 80, 1 to 90, 1 to 100 nucleotides) between the first region and the second region. In some embodiments, the first region includes or consists of the sequence of sequence number 25. In some embodiments, the second region includes or consists of the sequence of sequence number 24.

[0060] In some embodiments of any of the embodiments described above, the Myo15 promoter has at least 85% sequence identity with respect to SEQ ID NO: 37 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity). In some embodiments of any of the embodiments described above, the Myo15 promoter includes or consists of the sequence of SEQ ID NO: 37. In some embodiments of any of the embodiments described above, the Myo15 promoter has at least 85% sequence identity with respect to SEQ ID NO: 58 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity). In some embodiments of any of the above-described aspects, the Myo15 promoter includes or consists of SEQ ID NO: 58.

[0061] In some embodiments of any of the above-described aspects, the Myo15 promoter includes or comprises a region having at least 85% sequence identity with respect to SEQ ID NO: 24 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity), or a functional portion or derivative thereof containing the sequence of SEQ ID NO: 26 and / or SEQ ID NO: 27. In some embodiments, this region contains or comprises the sequence of SEQ ID NO: 24.

[0062] In some embodiments of any of the above-described aspects, the Myo15 promoter includes or comprises a region having at least 85% sequence identity with SEQ ID NO: 25 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity), or a functional portion or derivative thereof containing the sequences of SEQ ID NO: 31 and / or SEQ ID NO: 32. In some embodiments, this region contains or comprises the sequence of SEQ ID NO: 25.

[0063] In some embodiments of any of the aforementioned embodiments, the functional portion of SEQ ID NO: 24 includes the sequence of SEQ ID NO: 26. In some embodiments of any of the aforementioned embodiments, the functional portion of SEQ ID NO: 24 includes the sequence of SEQ ID NO: 27. In some embodiments of any of the aforementioned embodiments, the functional portion of SEQ ID NO: 24 includes the sequence of SEQ ID NO: 26 and the sequence of SEQ ID NO: 27. In some embodiments of any of the aforementioned embodiments, the functional portion of SEQ ID NO: 24 includes the sequence of SEQ ID NO: 28. In some embodiments of any of the aforementioned embodiments, the functional portion of SEQ ID NO: 24 includes the sequence of SEQ ID NO: 29. In some embodiments of any of the aforementioned embodiments, the functional portion of SEQ ID NO: 24 includes the sequence of SEQ ID NO: 30. In some embodiments of any of the aforementioned embodiments, the functional portion of SEQ ID NO: 24 includes the sequence of SEQ ID NO: 50.

[0064] In some embodiments of any of the aforementioned embodiments, the functional portion of SEQ ID NO: 25 includes the sequence of SEQ ID NO: 31. In some embodiments of any of the aforementioned embodiments, the functional portion of SEQ ID NO: 25 includes the sequence of SEQ ID NO: 32. In some embodiments of any of the aforementioned embodiments, the functional portion of SEQ ID NO: 25 includes the sequence of SEQ ID NO: 51. In some embodiments of any of the aforementioned embodiments, the functional portion of SEQ ID NO: 25 includes the sequence of SEQ ID NO: 51. In some embodiments of any of the aforementioned embodiments, the functional portion of SEQ ID NO: 25 includes the sequence of SEQ ID NO: 31 and the sequence of SEQ ID NO: 32. In some embodiments of any of the aforementioned embodiments, the functional portion of SEQ ID NO: 25 includes the sequence of SEQ ID NO: 33. In some embodiments of any of the aforementioned embodiments, the functional portion of SEQ ID NO: 25 includes the sequence of SEQ ID NO: 34. In some embodiments of any of the aforementioned embodiments, the functional portion of SEQ ID NO: 25 includes the sequence of SEQ ID NO: 35. In some embodiments of any of the aforementioned embodiments, the functional portion of SEQ ID NO: 25 includes the sequence of SEQ ID NO: 55.

[0065] In some embodiments of any of the above-described aspects, the Myo15 promoter has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher) with respect to any one of the nucleic acid sequences of SEQ ID NO: 50 to 58. In some embodiments, the Myo15 promoter includes or consists of the sequence of SEQ ID NO: 50. In some embodiments, the Myo15 promoter includes or consists of the sequence of SEQ ID NO: 51. In some embodiments, the Myo15 promoter includes or consists of the sequence of SEQ ID NO: 52. In some embodiments, the Myo15 promoter includes or consists of the sequence of SEQ ID NO: 53. In some embodiments, the Myo15 promoter includes or consists of the sequence of SEQ ID NO: 54. In some embodiments, the Myo15 promoter includes or consists of the sequence of SEQ ID NO: 55. In some embodiments, the Myo15 promoter includes or consists of the sequence of sequence number 56. In some embodiments, the Myo15 promoter includes or consists of the sequence of sequence number 57. In some embodiments, the Myo15 promoter includes or consists of the sequence of sequence number 58.

[0066] In some embodiments of any of the above-described aspects, the Myo15 promoter has a first region having at least 85% sequence identity with respect to SEQ ID NO: 40 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity), or a first region having at least 85% sequence identity with respect to SEQ ID NO: 41 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%) A functional portion or derivative thereof containing the sequence of Sequence ID No. 42 ligated (e.g., operably bound) to a second region having sequence identity of 96%, 97%, 98%, 99%, or higher, or optionally, 1 to 400 nucleotides between the first and second regions (e.g., 1 to 5, 1 to 10, 1 to 15, 1 to 20, 1 to 25, 1 to 30, 1 to 35, 1 to 40, 1 to 45, 1 to 50, 1 to 60, 1 to 70, 1 to 80, 1 to 90, 1 to 100, 1 to 125, 1 to 150, 1 to 175, 1 to 200 , 1~225, 1~250, 1~275, 1~300, 1~325, 1~350, 1~375, 1~400, 10~20, 10~30, 10~40, 10~50, 10~60, 10~70, 10~80, 10~90, 10~100, 20~30, 20~40, 20~50, 20~60, 20~70, 20~80, 20~90, 20~100, 30~100, 40~100, 50~100, 50~150, 50~200, 50~250, 50~300, 50~350, 50~400, 100~150, 1 The linker includes a linker containing 00-200, 100-250, 100-300, 100-350, 100-400, 150-200, 150-250, 150-300, 150-350, 150-400, 200-250, 200-300, 200-350, 200-400, 250-300, 250-350, 250-400, 300-400, or 350-400 nucleotides), the sequence of SEQ ID NO: 43 and / or SEQ ID NO: 44, the functional portion or derivative thereof, or comprising them. In some embodiments, the first region includes or comprises the sequence of SEQ ID NO: 40. In some embodiments, the second region includes or comprises the sequence of SEQ ID NO: 41.

[0067] In some embodiments of any of the embodiments described above, the Myo15 promoter has at least 85% sequence identity with respect to SEQ ID NO: 48 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity). In some embodiments of any of the embodiments described above, the Myo15 promoter includes or consists of the sequence of SEQ ID NO: 48.

[0068] In some embodiments of any of the embodiments described above, the Myo15 promoter has at least 85% sequence identity with respect to SEQ ID NO: 49 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity). In some embodiments of any of the embodiments described above, the Myo15 promoter includes or consists of the sequence of SEQ ID NO: 49.

[0069] In some embodiments of any of the above-described aspects, the Myo15 promoter has a first region having at least 85% sequence identity with respect to SEQ ID NO: 41 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity), or a first region having at least 85% sequence identity with respect to SEQ ID NO: 40 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 9 A functional portion or derivative thereof containing the sequences of SEQ ID NOs. 43 and SEQ ID NOs. 44 linked (e.g., operably bound) to a second region having sequence identity of 5%, 96%, 97%, 98%, 99%, or more, or optionally, 1 to 400 nucleotides between the first and second regions (e.g., 1 to 5, 1 to 10, 1 to 15, 1 to 20, 1 to 25, 1 to 30, 1 to 35, 1 to 40, 1 to 45, 1 to 50, 1 to 60, 1 to 70, 1 to 80, 1 to 90, 1 to 100, 1 to 125, 1 to 150, 1-175, 1-200, 1-225, 1-250, 1-275, 1-300, 1-325, 1-350, 1-375, 1-400, 10-20, 10-30, 10-40, 10-50, 10-60, 10-70, 10-80, 10-90, 10-100, 20-30, 20-40, 20-50, 20-60, 20-70, 20-80, 20-90, 20-100, 30-100, 40-100, 50-100, 50-150, 50-200, 50-250, 50-300, 50-350, 50-4 The linker includes a linker containing 00, 100-150, 100-200, 100-250, 100-300, 100-350, 100-400, 150-200, 150-250, 150-300, 150-350, 150-400, 200-250, 200-300, 200-350, 200-400, 250-300, 250-350, 250-400, 300-400, or 350-400 nucleotides), and includes or comprises a functional portion or derivative thereof containing the sequence of SEQ ID NO: 42. In some embodiments, the first region includes or comprises the sequence of SEQ ID NO: 41. In some embodiments, the second region includes or comprises the sequence of SEQ ID NO: 40.

[0070] In some embodiments of any of the above-described aspects, the Myo15 promoter includes, or comprises, a region having at least 85% sequence identity with SEQ ID NO: 40 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity), or a functional portion or derivative thereof containing the sequence of SEQ ID NO: 42. In some embodiments, the region includes, or comprises, the sequence of SEQ ID NO: 40.

[0071] In some embodiments of any of the above-described aspects, the Myo15 promoter includes, or comprises, a region having at least 85% sequence identity with SEQ ID NO: 41 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity), or a functional portion or derivative thereof containing the sequence of SEQ ID NO: 43 and / or SEQ ID NO: 44. In some embodiments, the region includes, or comprises, the sequence of SEQ ID NO: 41.

[0072] In some embodiments of any of the aforementioned aspects, the functional portion of sequence number 40 includes the sequence of sequence number 42. In some embodiments of any of the aforementioned embodiments, the functional portion of SEQ ID NO: 41 includes the sequence of SEQ ID NO: 43. In some embodiments of any of the aforementioned embodiments, the functional portion of SEQ ID NO: 41 includes the sequence of SEQ ID NO: 44. In some embodiments of any of the aforementioned embodiments, the functional portion of SEQ ID NO: 41 includes the sequence of SEQ ID NO: 43 and the sequence of SEQ ID NO: 44. In some embodiments of any of the aforementioned embodiments, the functional portion of SEQ ID NO: 41 includes the sequence of SEQ ID NO: 45. In some embodiments of any of the aforementioned embodiments, the functional portion of SEQ ID NO: 41 includes the sequence of SEQ ID NO: 46. In some embodiments of any of the aforementioned embodiments, the functional portion of SEQ ID NO: 41 includes the sequence of SEQ ID NO: 47.

[0073] In some embodiments of any of the aforementioned models, the Myo15 promoter is operably bound to the transgene and induces transgene expression when introduced into hair cells. definition As used herein, the term "approximately" refers to a value within 10% above or below the stated value.

[0074] As used herein, “administration” means providing or giving a subject a therapeutic agent (for example, a composition comprising a first nucleic acid vector containing a polynucleotide encoding the N-terminal portion of the otoferrin protein, and a second nucleic acid vector containing a polynucleotide encoding the C-terminal portion of the otoferrin protein) by any effective route. Exemplary routes of administration are described herein below.

[0075] As used herein, the term “bialleletic OTOF mutation” refers to a condition in which the mutation is present in both alleles (copies) of the OTOF gene. A subject with a bialleletic OTOF mutation may have two OTOF alleles with the same mutation, or each allele may have a different mutation.

[0076] As used herein, the phrase “administered to the inner ear” means providing or administering the therapeutic agent described herein to a target by any route that enables the transduction of inner ear cells. Exemplary routes of administration to the inner ear include the perilymph or endolymph, e.g., or the oval window, round window, or semicircular canals (e.g., the horizontal semicircular canal), or transtympanic or intratympanic injection, e.g., administration to hair cells.

[0077] As used herein, the term “cell type” refers to a group of cells that share a statistically separable phenotype based on gene expression data. For example, cells of a common cell type may share similar structural and / or functional features, such as similar gene activation patterns and antigen-presenting characteristics. Cells of a common cell type may include cells isolated from common tissues in vivo (e.g., epithelial tissue, nerve tissue, connective tissue, or muscle tissue) and / or common organs, tissue systems, blood vessels, or other structures and / or regions.

[0078] As used herein, the term "cochlear hair cells" refers to a specialized group of cells in the inner ear that are involved in sound perception. There are two types of cochlear hair cells: inner hair cells and outer hair cells. Damage to cochlear hair cells and gene mutations that disrupt the function of cochlear hair cells are associated with hearing loss and deafness.

[0079] As used herein, the terms “conservative mutation,” “conservative substitution,” and “conservative amino acid substitution” refer to the substitution of one or more amino acids with one or more different amino acids that exhibit similar physicochemical properties, such as polarity, static charge, and stereovolume. These properties are summarized in Table 1 below for each of the 20 naturally occurring amino acids.

[0080] [Table 1]

[0081] According to this table, the family of conserved amino acids is understood to include (i) G, A, V, L, and I; (ii) D and E; (iii) C, S, and T; (iv) H, K, and R; (v) N and Q; and (vi) F, Y, and W. Therefore, a conserved mutation or substitution is a mutation or substitution that replaces an amino acid with a member of the same amino acid family (for example, substituting Thr with Ser, or Arg with Lys).

[0082] As used herein, the term “degradation signal sequence” refers to a sequence (e.g., a nucleotide sequence that can be translated into an amino acid sequence) that mediates the degradation of a polypeptide containing it. By including a degradation signal sequence in the nucleic acid vector of the present invention, the expression of otoferrin protein in regions that have not been recombined and / or spliced ​​can be reduced or prevented. An exemplary degradation signal sequence used in the present invention is GCCTGCAAGAACTGGTTCAGCAGCCTGAGCCACTTCGTGATCCACCTG (SEQ ID NO: 22).

[0083] As used herein, the terms “effective amount,” “therapeutically effective amount,” and “sufficient amount” of any composition, vector construct, or viral vector described herein refer to an amount sufficient to produce a beneficial or desirable outcome, including a clinical outcome, when administered to a subject in need, such as a mammal, including a human. Therefore, the “effective amount” or its synonyms depends on the context in which it is applied. For example, in relation to the treatment of sensorineural hearing loss, it is the amount of the composition, vector construct, or viral vector sufficient to achieve a therapeutic response compared to a response obtained without administration of the composition, vector construct, or viral vector. The amount of a given composition described herein corresponding to such an amount will vary depending on various factors such as a given drug, pharmaceutical formulation, route of administration, type of disease or disorder, characteristics of the subject (e.g., age, sex, weight), or host of the subject being treated, but can nevertheless be routinely determined by those skilled in the art. Also, as used herein, the “therapeutically effective amount” of any composition, vector construct, or viral vector disclosed herein refers to an amount that produces a beneficial or desired outcome in a subject compared to a control. When active ingredients are administered in combination, it should be noted that the effective dose of the combination may or may not include the amount of each ingredient that would have been effective if administered individually. As defined herein, the therapeutic effective dose of the compositions, vector constructs, or viral vectors of this disclosure can be readily determined by routine methods known in the art to those skilled in the art. The administration plan may be adjusted to provide an optimal therapeutic response.

[0084] As used herein, the term “endogenous” means a molecule (e.g., polypeptide, nucleic acid, or cofactor) that is found naturally in a particular organism (e.g., human) or in a particular location within an organism (e.g., an organ, tissue, or cell, e.g., a human cell, e.g., a human cochlear hair cell).

[0085] As used herein, the term “expression” means one or more of the following events: (1) production of an RNA template from a DNA sequence (e.g., by transcription); (2) processing of an RNA transcript (e.g., splicing, editing, 5' cap formation, and / or 3' end processing); (3) translation of RNA into a polypeptide or protein; and (4) post-translational modification of a polypeptide or protein.

[0086] As used herein, the term “exogenous” refers to a molecule (e.g., polypeptide, nucleic acid, or cofactor) that is not found in nature in a particular organism (e.g., human) or in a particular location within an organism (e.g., an organ, tissue, or cell, e.g., a human cell, e.g., a human cochlear hair cell). Exogenous substances include substances supplied from an external source to an organism or a culture extracted therefrom.

[0087] As used herein, the term “hair cell-specific expression” refers primarily to the production of RNA transcripts or polypeptides within hair cells (e.g., cochlear tidal cells) compared to other cell types of the inner ear (e.g., spiral ganglion neurons, glia, or other inner ear cell types). Hair cell-specific expression of a transgene can be confirmed by comparing the expression of the transgene (e.g., RNA or protein expression) among various cell types of the inner ear (e.g., hair cells versus non-hair cells) using any standard technique (e.g., quantitative RT-PCR, immunohistochemistry, Western blot analysis, or fluorescence measurement of a reporter (e.g., GFP) operably bound to a promoter). Hair cell-specific promoters induce the expression of the transgene (e.g., RNA or protein) to which they are operably bound, and the induced expression is at least 50% (e.g., 50%, 75%, 100%, 125%, 150%, 175%, 200% or more) greater in hair cells (e.g., cochlear hair cells) compared to at least three of the following inner ear cell types: border cells, internal drug cells, internal column cells, external column cells, first row Deiters cells, second row Deiters cells, third row Deiters cells, Hensens cells, Claudius cells, internal groove cells, external groove cells, spiral ridge cells, root cells, interdental cells, basal cells of the striae dendrites, intermediate cells of the striae dendrites, marginal cells of the striae dendrites, spiral ganglion neurons, and Schwann cells (e.g., 3, 4, 5, 6, 7, 8, 9, 10, or more).

[0088] As used herein, the terms “increase” and “decrease” mean adjustments that result in a greater or lesser amount of function, expression, or activity, respectively, compared to a reference value. For example, following administration of a composition according to the method herein, the amount of a metric marker described herein (e.g., OTOF expression or auditory brainstem response) may be increased or decreased in a subject by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98% or more, compared to the amount of the marker before administration. Generally, the reference value is measured at the time when the effects described are obtained by administration, for example, at least one week, one month, three months, or six months after the start of the treatment plan.

[0089] As used herein, the term "intron" refers to a region within the coding region of a gene whose nucleotide sequence is not translated into the amino acid sequence of the corresponding protein. The term intron also refers to the corresponding region of RNA transcribed from a gene. Introns are transcribed into mRNA precursors but are removed during processing and are not present in mature mRNA.

[0090] As used herein, “topical” or “topical administration” means administration to a specific site of the body intended for a local effect rather than a systemic effect. Examples of topical administration include administration onto the skin, by inhalation, into joints, into the spinal cavity, into the vagina, into the vitreous cavity, into the uterus, into lesions, into lymph nodes, into tumors, into the inner ear, and into mucous membranes, in which case the administration is intended to produce a local effect rather than a systemic effect.

[0091] As used herein, the term “operatably bound” means a first molecule that can bind to a second molecule, in which case the molecules are positioned such that the first molecule influences the function of the second molecule. The term “operatably bound” includes juxtaposing two or more components (e.g., a promoter and another sequence element) so that both components function properly and at least one component can mediate a function that acts on at least one other component. The two molecules may or may not be parts of a single, continuous molecule, and may or may not be adjacent. For example, if a promoter regulates the transcription of a transcriptionable polynucleotide molecule of interest within a cell, the promoter is operatably bound to the transcriptionable polynucleotide molecule. In further embodiments, two parts of a transcriptional regulatory element are operatably bound to each other if they are bound in such a way that the transcriptional activation function of one part is not adversely affected by the presence of the other part. The two transcriptional regulatory elements may be operatably bound to each other via a linker nucleic acid (e.g., an intervening non-coding nucleic acid), or they may be operatably bound to each other in the absence of an intervening nucleotide.

[0092] As used herein, the terms "otoferrin" and "OTOF" refer to the gene associated with non-symptomatic recessive hearing loss DNFB9. Furthermore, the terms "otoferrin" and "OTOF" refer to variants of the wild-type OTOF protein and the nucleic acid sequences they encode. For example, provided that the encoding OTOF analogue retains the therapeutic function of wild-type OTOF, the variant protein exhibits at least 85% sequence identity (e.g., 85%, 86%, 87%, 8%) to the amino acid sequence of the wild-type OTOF protein (e.g., any one of sequence numbers 1-5). This refers to a polynucleotide having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 99%, or 99.9% or more identity) to the nucleic acid sequence of the wild-type OTOF gene. As used herein, OTOF may, depending on the context, refer to a protein localized in inner hair cells or the gene encoding this protein, as will be understood by those skilled in the art.

[0093] As used herein, the terms “otoferrin isoform 5” and “OTOF isoform 5” refer to isoforms of the gene associated with non-symptomatic recessive hearing loss DFNB9. The human isoform of the gene is associated with reference sequence NM_001287489, and its transcript contains exons 1-45 and 47 of human otoferrin, but not exon 46 of the OTOF gene. The human OTOF isoform 5 protein is also known as otoferrin isoform e. The terms "otoferrin isoform 5" and "OTOF isoform 5" refer to variants of the wild-type OTOF isoform 5 protein and the polynucleotides encoding them, for example, those exhibiting at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9% or higher identity) with respect to the amino acid sequence of the wild-type OTOF isoform 5 protein (e.g., SEQ ID NO: 1). This refers to polynucleotides having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9% or more identity) to the polynucleotide sequence of the mutant protein or wild-type OTOF isoform 5 gene, provided that the encoded OTOF isoform 5 analog retains the therapeutic function of wild-type OTOF isoform 5. OTOF isoform 5 protein variants may have one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more) conserved amino acid substitutions compared to wild-type OTOF isoform 5 (e.g., SEQ ID NO: 1), provided that the OTOF isoform 5 variant retains the therapeutic function of wild-type OTOF isoform 5, does not have more than 10% amino acid substitutions in the N-terminal portion of its amino acid sequence, and does not have more than 10% amino acid substitutions in the C-terminal portion of its amino acid sequence.As used herein, OTOF isoform 5 may, as those skilled in the art will understand, refer, as the context may, to a protein localized in inner hair cells, or to the gene encoding this protein. OTOF isoform 5 may refer to human OTOF isoform 5, or a homologue of another mammalian species. Mouse otoferrin contains one additional exon compared to human otoferrin (48 exons in mouse otoferrin), and the exons of mouse otoferrin corresponding to those encoding human OTOF isoform 5 are 1-5, 7-46, and 48. The exon numbering rules used herein are based on the exons currently understood to be present in the consensus transcript of human OTOF.

[0094] As used herein, the term “plasmid” refers to an extrachromosomal circular double-stranded DNA molecule that can ligate additional DNA segments. A plasmid is a type of vector, a nucleic acid molecule capable of transporting another nucleic acid it is linked to. Certain plasmids can self-replicate in the host cell into which they are introduced (e.g., bacterial plasmids with bacterial origins of replication and episomal mammalian plasmids). Other vectors (e.g., non-episomal mammalian vectors) can be integrated into the host cell's genome upon introduction into the host cell, thereby replicating with the host genome. Certain plasmids can induce the expression of the gene to which they are operably linked.

[0095] As used herein, the terms “nucleic acid” and “polynucleotide,” as used interchangeably herein, refer to polymeric forms of nucleosides of any length. Generally, polynucleotides consist of nucleosides naturally found in DNA or RNA (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine) linked by phosphodiester bonds. However, the term also includes molecules containing nucleosides or nucleoside analogs having chemically or biologically modified bases, modified skeletons, etc., whether or not they are found in natural nucleic acids, and such molecules may be preferred for certain applications. When this application refers to polynucleotides, it is understood that both DNA and RNA, and both single-stranded and double-stranded forms in each case (and complements of each single-stranded molecule) are provided. As used herein, “polynucleotide sequence” may refer to the sequence information (i.e., a series of letters used as abbreviations for bases) that biochemically characterizes the polynucleotide substance itself and / or a particular nucleic acid. Unless otherwise specified, the polynucleotide sequences presented herein are shown in the 5' to 3' direction.

[0096] As used herein, the terms “complementarity” or “complementary” of nucleic acids mean that, due to the orientation of their nucleic acid bases, the nucleotide sequence of one strand of nucleic acid forms hydrogen bonds with another sequence on the opposite nucleic acid strand. The complementary bases of DNA are typically A and T, and C and G. In RNA, they are typically C and G, and U and A. Complementarity can be complete or substantial / sufficient. Complete complementarity between two nucleic acids means that the two nucleic acids can form a double helix, in which case all the bases of the double helix bond to complementary bases by Watson-Crick pairing. “Substantially” or “sufficiently” complementary means that the sequence of one strand is not completely and / or perfectly complementary to the sequence of the opposite strand, but sufficient bonding occurs between the bases of the two strands under a set of hybridization conditions (e.g., salt concentration and temperature) to form a stable hybrid complex. Such conditions can be predicted by predicting the Tm (melting temperature) of the hybridized strands using sequences and standard mathematical calculations, or by empirically determining Tm using routine methods. Tm is the temperature at which 50% of the population of hybridization complexes formed between two nucleic acid strands denatures (i.e., half of the population of double-stranded nucleic acid molecules dissociates into single strands). Below Tm, the formation of hybridization complexes is favored, while above Tm, the melting or separation of strands in the hybridization complex is favored. The Tm of nucleic acids may be estimated using known G+C content in 1M NaCl aqueous solution, for example, Tm = 81.5 + 0.41 (%G+C), but other known Tm calculations take into account the structural properties of the nucleic acid.

[0097] As used herein, the term "promoter" refers to a recognition site on DNA to which RNA polymerase binds. Polymerase promotes the transcription of a transgene. Exemplary promoters suitable for use in the compositions and methods described herein include promoters referred to as ubiquitous promoters (e.g., CAG promoter, cytomegalovirus (CMV) promoter, and deletion versions of the chimeric CMV-chicken β-actin promoter (CBA), and in the hybrid chicken β-actin / rabbit β-globin intron, smCBA), cochlear hair cell-specific promoters (e.g., myosin 15 (Myo15) promoter, myosin 7A (Myo7A) promoter, myosin 6 (Myo6) promoter, POU class 4 homeobox 3 (POU4F3) promoter), and inner hair cell-specific promoters (e.g., fibroblast growth factor 8 (FGF8) promoter, vesicle glutamate transporter 3 (VGLUT3) promoter, and OTOF promoter) that have undergone significant deletions to produce smaller versions.

[0098] The “percentage of amino acid sequence identity (%)” with respect to a reference polynucleotide sequence or reference polypeptide sequence is defined as the percentage of nucleic acids or amino acids in a candidate sequence that are identical to the nucleic acids or amino acids in the reference polynucleotide sequence or reference polypeptide sequence, after the sequences have been aligned and gaps introduced as necessary to achieve the maximum percentage of sequence identity. Alignment for the purpose of measuring the percentage of nucleic acid or amino acid sequence identity can be achieved in various ways within the capabilities of a person skilled in the art using commonly available computer software, such as BLAST, BLAST-2, or Megalign software. A person skilled in the art can determine appropriate parameters for aligning the sequences, including any algorithm required to obtain the maximum alignment over the full length of the sequences being compared. For example, the percentage of sequence identity value can be generated using the sequence comparison computer program BLAST. As an example, the percentage of sequence identity of a given nucleic acid or amino acid sequence A with respect to, or with, a given nucleic acid or amino acid sequence B (which can also be called a given nucleic acid or amino acid sequence A having a specific percentage of identity with, or with, a given nucleic acid or amino acid sequence B) is calculated as follows:

[0099] 100×(fraction X / Y) In the formula, X is the number of nucleotides or amino acids scored as identical by a sequence alignment program (e.g., BLAST) in the program alignment of A and B, and Y is the total number of nucleic acids in B. If the length of nucleic acid or amino acid sequence A is not equal to the length of nucleic acid or amino acid sequence B, the ratio of sequence identity of A to B is considered to be not equal to the ratio of sequence identity of B to A.

[0100] As used herein, the term “derivative” refers to a nucleic acid, peptide, or protein, or a variant or analog thereof, that contains one or more mutations and / or chemical modifications compared to the corresponding full-length wild-type nucleic acid, peptide, or protein. Non-exclusive examples of chemical modifications involving nucleic acids include modifications to base moieties, sugar moieties, phosphate moieties, phosphate-sugar backbone, or combinations thereof.

[0101] As used herein, the term “pharmaceutical composition” means a mixture comprising a therapeutic agent to be administered to a mammalian subject, such as a human, in combination, optionally with one or more pharmaceutically acceptable excipients, diluents, and / or carriers, for the purpose of preventing, treating, or controlling a particular disease or condition that affects or may affect a subject.

[0102] As used herein, the term “pharmaceutically acceptable” means a compound, substance, composition, and / or dosage form that is free from excessive toxicity, irritation, allergic reactions, and other problematic ailments, has a reasonable benefit-to-risk ratio, and is suitable for contact with the tissues of a subject, such as those of a mammal (e.g., human). Preferably, the term “pharmaceutically acceptable” means that it is approved by a federal or state regulatory agency or listed in the United States Pharmacopeia or other generally accepted pharmacopoeias for use in mammals, more specifically in humans.

[0103] As used herein, the term “recombination induction region” refers to a region of homology that mediates recombination between two different sequences. As used herein, the term “regulatory sequence” includes promoters, enhancers, and other expression regulatory elements (e.g., polyadenylation signals) that control the transcription or translation of the polynucleotide encoding OTOF. Such regulatory sequences are described, for example, in Goeddel, Gene Expression Technology: Methods in Enzymology 185 (Academic Press, San Diego, CA, 1990), which is incorporated herein by reference.

[0104] As used herein, the term “sample” means a specimen separated from a subject (e.g., blood, blood components (e.g., serum or plasma), urine, saliva, amniotic fluid, cerebrospinal fluid, tissue (e.g., placenta or skin), pancreatic juice, chorionic villi specimens, and cells).

[0105] As used herein, the term “transfer” refers to any and all of the diverse techniques commonly used for introducing foreign DNA into prokaryotic or eukaryotic host cells, such as electroporation, lipofection, calcium phosphate precipitation, DEAE-dextran transferation, nucleofection, squeezeporation, sonoporation, phototransferation, magnetofection, imparefection, and the like.

[0106] As used herein, the terms “subject” and “patient” refer to animals (e.g., mammals such as humans), veterinary subjects (e.g., cats, dogs, cattle, horses, sheep, pigs, etc.), and experimental animal models of diseases (e.g., mice, rats). Subjects treated according to the methods described herein may be subjects diagnosed with hearing loss (e.g., hearing loss associated with OTOF mutations) or subjects at risk of developing these conditions. Diagnosis may be performed by any method or technique known in the art. Those skilled in the art will understand that subjects treated according to this disclosure may have undergone standard tests or may have been identified as subjects at risk due to the presence of one or more risk factors associated with the disease or condition, even if they have not been tested.

[0107] As used herein, the terms “transduction” and “transduction” refer to a method of introducing a vector construct or a portion thereof into a cell. If the vector construct is contained in a viral vector, such as an AAV vector, transduction refers to the viral infection of the cell and the subsequent transfer and integration of the vector construct or a portion thereof into the cell genome.

[0108] As used herein, “treatment” and “to treat” a condition, disorder, or pathology may include: (1) preventing, delaying, or reducing the incidence and / or likelihood of developing at least one clinical or asymptomatic symptom of a condition, disorder, or pathology in a subject who is already suffering from or predisposed to a condition, disorder, or pathology but has not yet experienced or exhibited any clinical or asymptomatic symptoms; or (2) inhibiting a condition, disorder, or pathology, i.e., preventing, mitigating, or delaying the onset or recurrence of the disease or the onset of at least one clinical or asymptomatic symptom thereof; or (3) reducing the disease, i.e., regressing the condition, disorder, or pathology or at least one of its clinical or asymptomatic symptoms. The benefit to the subject being treated must be statistically significant or at least perceptible to the patient or physician.

[0109] As used herein, the term “vector” includes nucleic acid vectors (e.g., DNA vectors such as plasmids), RNA vectors, viruses, or other suitable replicons (e.g., viral vectors). Various vectors have been developed for delivering polynucleotides encoding exogenous proteins to prokaryotic or eukaryotic cells. Examples of such expression vectors are disclosed, for example, in WO94 / 011026, which is incorporated herein by reference as relating to vectors suitable for the expression of the gene of interest. Expression vectors suitable for use in the compositions and methods described herein include polynucleotide sequences and additional sequence elements used, for example, for protein expression and / or integration of these polynucleotide sequences into the genome of mammalian cells. Specific vectors that can be used for OTOF expression as described herein include vectors that include regulatory sequences such as promoter and enhancer regions that direct gene transcription. Other vectors useful for OTOF expression include polynucleotide sequences that increase the translation rate of these genes or improve the stability or nuclear export of mRNA resulting from gene transcription. These sequence elements include, for example, 5' and 3' untranslated regions and polyadenylation signaling sites to direct the efficient transcription of genes incorporated into the expression vector. Expression vectors suitable for use in the compositions and methods described herein may also include polynucleotides encoding markers for selecting cells containing such vectors. Examples of suitable markers include genes encoding resistance to antibiotics such as ampicillin, chloramphenicol, kanamycin, or noseoslysin.

[0110] As used herein, the term "wild type" refers to the most frequently occurring genotype for a particular gene in a given organism. [Brief explanation of the drawing]

[0111] [Figure 1]This graph shows the recovery of the ABR threshold in homozygous OTOF-Q828X mutant mice treated at 32 weeks or 52 weeks of age. The animals were administered either a vehicle (n=5 / age group) or a dual-hybrid AAV-Myo15-hOTOF vector (n=10 / age group) through a circular window under isoflurane anesthesia. Four weeks after the completion of treatment, ABR recovery was observed in 10 / 10 of the 32-week-old animals treated with the OTOF dual vector and in 9 / 10 of the 52-week-old animals. [Figure 2A-1] This is a series of graphs showing the number of inner and outer hair cells over time in homozygous (Otof-Q828X hom) and heterozygous (Otof-Q828X het) Otof-Q828X mice. IHC counts were recorded in the ears of 50 mice between 5 and 42 weeks of age. Counts are shown for cochlear regions corresponding to 5.6 kHz, 8 kHz, 11.3 kHz, 16 kHz, 22.6 kHz, 32 kHz, and 45.2 kHz. In Otof-Q828X hom mice, IHC counts decreased statistically significantly with age at all frequencies tested. A similar trend in IHC counts was observed in het mice at even lower frequencies (Kendall's rank correlation). IHC counts in Otof-Q828X hom and het animals remained stable for 16 weeks. After 16 weeks, Otof-Q828X hom animals began to show a decline in IHC counts at 22.6–45.2 kHz, and a decrease at lower frequencies (8–16 kHz) was observed after 24 weeks. In Otof-Q828X het mice, the decline in IHC counts at 16 and 32 kHz began after 24 weeks. After 32 weeks, IHC remained above 75% at most tested frequencies (<45.2 kHz). [Figure 2A-2] Same as above. [Figure 2B-1]Graphs A and B show a series of graphs illustrating the number of inner and outer hair cells over time in homozygous (Otof-Q828X hom) and heterozygous (Otof-Q828X het) Otof-Q828X mice. OHC counts were recorded in the ears of 50 mice between 5 and 42 weeks of age. Counts are shown for the cochlear regions corresponding to 5.6 kHz, 8 kHz, 11.3 kHz, 16 kHz, 22.6 kHz, 32 kHz, and 45.2 kHz. Outer hair cell counts in Otof-Q828X hom and het mice remained constant over the 6-month study period at all frequencies except 8 kHz, where het mice showed a decrease in counts with age (Kendall's rank correlation). OHC counts at 5.6 kHz and 45.2 kHz were associated with greater variability, indicating scattered differences in counts between het and hom mice at the ages tested. The majority of OHC remained even after 32 weeks. [Figure 2B-2] Same as above. [Figure 3] This graph shows the ABR threshold recovery rate in homozygous OTOF-Q828X mutant mice. The ABR threshold, measured at 22.6 kHz, was plotted against the percentage of otoferrin-expressing inner hair cells (IHCs) for multiple studies of adult homozygous OTOF-Q828X mutant mice treated with an OTOF dual vector system. Measurements were taken ≥4 weeks after treatment. [Modes for carrying out the invention]

[0112] By administering a first nucleic acid vector containing a promoter and a polynucleotide encoding the N-terminal portion of the otoferrin (OTOF) protein (e.g., wild-type (WT) OTOF protein), and a second nucleic acid vector containing a polynucleotide encoding the C-terminal portion of the OTOF protein and a polyadenylated (poly(A)) sequence to a subject, it is possible to increase the age of at least 25 years (e.g., 25-50, 25-45, 25-40, 25-35, 25-30, 30-50, 30-45, Compositions and methods for treating sensorineural hearing loss or auditory neuropathy caused by biallelic otoferrin (OTOF) mutations in human subjects aged 30-40, 30-35, 35-50, 35-45, 35-40, 40-50, 40-45, or 45-50 years (for example, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 years) are described herein. When introduced into mammalian cells such as cochlear hair cells, the polynucleotides encoded by the two nucleic acid vectors can combine to form a polynucleotide encoding a full-length OTOF protein. Therefore, the compositions and methods described herein can be used to induce or increase the expression of WT OTOF in cochlear hair cells of subjects suffering from OTOF deficiency (e.g., homozygous or compound heterozygous mutations in OTOF). The compositions and methods described herein can also be used to treat subjects identified as having a biallelic OTOF mutation and possessing detectable otoacoustic emissions, detectable cochlear microphone potentials, and / or detectable collect potentials.

[0113] Otoferin OTOF is a 230 kDa membrane protein containing at least six C2 domains involved in calcium, phospholipid, and protein binding. Human OTOF is encoded by a gene containing 48 exons, and the full-length protein consists of 1,997 amino acids. Located in the ribbon synapses of inner hair cells, OTOF is thought to function as a calcium sensor in synaptic vesicle fusion, inducing the fusion of neurotransmitter-containing vesicles with the cell membrane. It is also involved in vesicle replenishment and clathrin-mediated endocytosis, and has been shown to interact with myosin VI, Rab8b, SNARE proteins, calcium channels Cav1.3, Ergic2, and AP-2. The mechanism by which OTOF mediates exocytosis and the physiological importance of its interactions with binding partners are still not fully understood.

[0114] Otoferin-related hearing loss OTOF was first identified in a study investigating the genetics of autosomal recessive hearing loss 9 (DFNB9), a type of non-symptomatic hearing loss. Since then, mutations in OTOF have been shown to cause sensorineural hearing loss in patients worldwide. Many patients with OTOF mutations suffer from auditory neuropathy, a disorder in which the inner ear detects sound but fails to properly transmit it from the ear to the brain. These patients exhibit abnormal auditory brainstem response (ABR) and speech discrimination ability that initially presents with normal otoacoustic emissions. Patients with homozygous or compound heterozygous mutations often develop hearing loss in infancy, and the severity of hearing impairment is known to vary depending on the location and type of OTOF mutation. At least 220 mutations have been identified in OTOF, including deletion-leading and non-deletion-leading mutations.

[0115] This invention is partly based on the discovery that administering a first nucleic acid vector containing a polynucleotide encoding the N-terminal portion of the OTOF protein, and a second nucleic acid vector containing a polynucleotide encoding the C-terminal portion of the OTOF protein, to adult (32 weeks old) and middle-aged (52 weeks old) otoferrin-deficient mice is effective in treating hearing loss. These data demonstrate that delivery of otoferrin to adult and middle-aged otoferrin-deficient mice can restore hearing regardless of age-related hair cell loss in otoferrin-deficient mice, and suggest that otoferrin gene therapy can also be used to treat human subjects of similar age (32-week-old and 52-week-old mice correspond to human subjects approximately 30-50 years old). Furthermore, humans experience age-dependent hair cell loss, which is thought to limit the effectiveness of gene therapy methods in the elderly. However, the inventors have also discovered that when approximately 20% of the inner hair cells expressed otoferrin, hearing was restored in otoferrin-deficient mice. This indicates that hearing can be treated even when a relatively small percentage of inner hair cells are transduced. In summary, these data indicate that adult human subjects with biallele OTOF mutations (e.g., those aged 25 and older, e.g., 25-50, 25-45, 25-40, 25-35, 25-30, 30-50, 30-45, 30-40, 30-35, 35-50, 35-45, 35-40, 40-50, 40-45, or 45-50 years, e.g., 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 years) can be treated using a dual vector system encoding OTOF.

[0116] The compositions and methods described herein can be used to treat sensorineural hearing loss or auditory neuropathy caused by biallelic OTOF mutations by administering a first nucleic acid vector containing a polynucleotide encoding the N-terminal portion of the OTOF protein and a second nucleic acid vector containing a polynucleotide encoding the C-terminal portion of the OTOF protein. The full-length OTOF coding sequence is too large to be included in the types of vectors commonly used in gene therapy (e.g., adeno-associated virus (AAV) vectors, which are thought to have a 5kb packaging limit). The compositions and methods described herein overcome this problem by splitting the OTOF coding sequence between two different nucleic acid vectors that can bind in cells to reconstruct the full-length OTOF sequence. These compositions and methods can be used to treat subjects with one or more mutations in the OTOF gene, e.g., OTOF mutations that reduce OTOF expression, reduce OTOF function, or are associated with hearing loss. When the first nucleic acid vector and the second nucleic acid vector are administered in a composition, the polynucleotides encoding the N-terminal and C-terminal portions of OTOF bind within a cell (e.g., a human cell, e.g., a cochlear hair cell) to form a single nucleic acid molecule containing the full-length OTOF coding sequence (e.g., via homologous recombination and / or splicing).

[0117] The nucleic acid vectors used in the compositions and methods described herein include nucleic acid sequences encoding wild-type OTOF or its variants, for example, nucleic acid sequences encoding proteins that, when combined, have at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity) to the amino acid sequence of wild-type human or mouse OTOF. The polynucleotides used in the nucleic acid vectors described herein can encode the N-terminal and C-terminal portions of the OTOF amino acid sequences in Table 2 below (for example, two portions that, when combined, encode the full-length OTOF amino acid sequences in Table 2, e.g., any one of sequence numbers 1 to 5).

[0118] According to the method described herein, a polynucleotide sequence encoding an amino acid sequence described in any one of SEQ ID NOs: 1 to 5, or a polynucleotide sequence encoding an amino acid sequence having at least 85% sequence identity to the amino acid sequence described in any one of SEQ ID NOs: 1 to 5 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity), or any one of SEQ ID NOs: 1 to 5 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) is provided for the target. A composition comprising a first nucleic acid vector and a second nucleic acid vector, each comprising the N-terminal and C-terminal portions of a polynucleotide sequence encoding an amino acid sequence containing one or more conserved amino acid substitutions (or more conserved amino acid substitutions), provided that the encoded OTOF analogue retains the therapeutic function of wild-type OTOF (e.g., the ability to modulate ribbon synapse exocytosis, or the ability to rescue or improve the ABR response in animal models of hearing loss associated with otoferrin gene deficiency (e.g., OTOF mutation)). Less than 10% of the amino acids in the N-terminal portion of the OTOF protein and less than 10% of the amino acids in the C-terminal portion of the OTOF protein may be replaced with conserved amino acid substitutions. The OTOF protein may be encoded by a polynucleotide having any one of the sequences of SEQ ID NOs. 10-14. The OTOF protein may also be encoded by a polynucleotide having a single nucleotide variant (SNV) that has been shown to be nonpathogenic in human subjects. The OTOF protein may be a human OTOF protein or a homolog of a human protein from another mammalian species (e.g., mouse, rat, cattle, horse, goat, sheep, donkey, cat, dog, rabbit, guinea pig, or other mammal). In some embodiments, the encoding OTOF protein has the sequence of SEQ ID NO: 1 (OTOF isoform 1). In some embodiments, the encoding OTOF protein has the sequence of SEQ ID NO: 5 (OTOF isoform 5).

[0119] Table 2-1

[0120] Table 2-2

[0121] Table 2-3

[0122] Table 2-4

[0123] Table 2-5

[0124] Table 2-6

[0125] Table 2-7

[0126] Table 2-8

[0127] Table 2-9

[0128] Table 2-10

[0129] Table 2-11

[0130] Table 2-12

[0131] Table 2-13

[0132] Table 2-14

[0133] Table 2-15

[0134] Table 2-16

[0135] Table 2-17

[0136] Table 2-18

[0137] Table 2-19

[0138] Table 2-20

[0139] Table 2-21

[0140] Table 2-22

[0141] Table 2-23

[0142] Table 2-24

[0143] Table 2-25

[0144] Table 2-26

[0145] Table 2-27

[0146] Table 2-28

[0147] Table 2-29

[0148] Table 2-30

[0149] Table 2-31

[0150] Table 2-32

[0151] Table 2-33

[0152] Table 2-34

[0153] Table 2-35

[0154] Table 2-36

[0155] Table 2-37

[0156] Table 2-38

[0157] Table 2-39

[0158] Table 2-40

[0159] Table 2-41

[0160] [Table 2-42]

[0161] [Table 2-43]

[0162] Expression of OTOF in mammalian cells Mutations in OTOF are associated with sensorineural hearing loss and auditory neuropathy. The compositions and methods described herein increase the expression of WT OTOF protein by administering a first nucleic acid vector containing a polynucleotide encoding the N-terminal portion of the OTOF protein and a second nucleic acid vector containing a polynucleotide encoding the C-terminal portion of the OTOF protein. To utilize nucleic acid vectors for therapeutic applications in the treatment of sensorineural hearing loss and auditory neuropathy, they can be directed into cells, particularly into specific cell types. A wide range of methods have been established for delivering proteins to mammalian cells and for the stable expression of protein-coding genes in mammalian cells.

[0163] Polynucleotide encoding OTOF One platform that can be used to achieve therapeutically effective intracellular concentrations of OTOF in mammalian cells is by stably expressing the gene encoding OTOF (e.g., by integration into the nuclear or mitochondrial genome of mammalian cells, or by episomal chain formation in the nucleus of mammalian cells). The gene is a polynucleotide that encodes the primary amino acid sequence of the corresponding protein. To introduce an exogenous gene into mammalian cells, the gene can be incorporated into a vector. Vectors can be introduced into cells by a variety of methods, including transformation, translocation, transduction, direct uptake, particle impaction, and encapsulation of the vector into liposomes. Examples of suitable methods for translocation or transformation of cells include calcium phosphate precipitation, electroporation, microinjection, infection, lipofection, and direct uptake. Such methods are described in more detail, for example, Green, et al., Molecular Cloning: A Laboratory Manual, Fourth Edition (Cold Spring Harbor University Press, New York 2014), and Ausubel, et al., Current Protocols in Molecular Biology (John Wiley & Sons, New York 2015), the disclosures of which are incorporated herein by reference.

[0164] OTOF can also be introduced into mammalian cells by targeting cell membrane phospholipids with a vector containing a portion of the gene encoding the OTOF protein. For example, the vector can be targeted to phospholipids on the extracellular surface of the cell membrane by conjugating the vector molecule to the VSV-G protein, a viral protein that has affinity for all cell membrane phospholipids. Such constructs can be produced using methods well known to those skilled in the art.

[0165] For gene expression, the recognition and binding of polynucleotides encoding OTOF proteins by mammalian RNA polymerase is crucial. Therefore, the polynucleotide may contain sequence elements that exhibit high affinity for transcription factors that recruit RNA polymerase and promote the assembly of transcription complexes at the transcription initiation site. Such sequence elements include, for example, mammalian promoters, whose sequences can be recognized and bound by specific transcription initiation factors and ultimately by RNA polymerase.

[0166] Polynucleotides suitable for use in the compositions and methods described herein include those encoding the OTOF protein downstream of a mammalian promoter (e.g., polynucleotides encoding the N-terminal portion of the OTOF protein downstream of a mammalian promoter). Useful promoters for OTOF protein expression in mammalian cells include ubiquitous promoters, cochlear hair cell-specific promoters, and inner hair cell-specific promoters. Ubiquitous promoters include the CAG promoter, cytomegalovirus (CMV) promoter (e.g., CMV early enhancer and promoter, CMV mini-promoter, minCMV promoter, CMV-TATA+INR promoter, or min CMV-T6 promoter), chicken β-actin promoter, smCBA promoter, CB7 promoter, hybrid CMV enhancer / human β-actin promoter, CASI promoter, dihydrofolate reductase (DHFR) promoter, human β-actin promoter, β-globin promoter (e.g., minimal β-globin promoter), HSV promoter (e.g., minimal HSV ICP0 promoter, or deletion-type HSV ICP0 promoter), SV40 promoter (e.g., minimal SV40 promoter), EF1α promoter, and PGK promoter. Cochlear hair cell-specific promoters include the myosin 15 (Myo15) promoter, myosin 7A (Myo7A) promoter, myosin 6 (Myo6) promoter, POU4F3 promoter, asymmetric BHLH transcription factor 1 (ATOH1) promoter, LIM homeobox 3 (LHX3) promoter, α9 acetylcholine receptor (α9AChR) promoter, and α10 acetylcholine receptor (α10AChR) promoter. Intrahair cell-specific promoters include the FGF8 promoter, VGLUT3 promoter, OTOF promoter, and calcium-binding protein 2 (CABP2) promoter (described in International Patent Application Publication No. WO2021 / 091940, incorporated herein by reference). Alternatively, promoters derived from viral genomes can be used to achieve stable expression of these drugs in mammalian cells.Examples of activatable viral promoters that can be used to enhance the mammalian expression of these drugs include the adenovirus late promoter, the baccinia virus 7.5K promoter, the SV40 promoter, the HSV tk promoter, the mouse mammary tumor virus (MMTV) promoter, the HIV LTR promoter, the Moloney virus promoter, the Epstein-Barr virus (EBV) promoter, and the Ruth sarcoma virus (RSV) promoter.

[0167] Mouse myosin 15 promoter In some embodiments, the Myo15 promoter for use in the compositions and methods described herein includes nucleic acid sequences from a region of the mouse Myo15 locus that can specifically express a transgene in hair cells, or variants thereof, such as nucleic acid sequences having at least 85% sequence identity to a region of the mouse Myo15 locus (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity) to the region of the mouse Myo15 locus that can specifically express a transgene in hair cells. These regions include a nucleic acid sequence immediately preceding the mouse Myo15 translation initiation site and upstream regulatory elements located at least 5 kb away from the mouse Myo15 translation initiation site. The Myo15 promoters for use in the compositions and methods described herein may optionally include a linker that activatably binds a region of the mouse Myo15 locus that can specifically express the transgene in hair cells, or the region of the mouse Myo15 locus can be directly bound without an intervening linker.

[0168] In some embodiments, the Myo15 promoter for use in the compositions and methods described herein has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher) with respect to the region containing the first non-coding exon of the mouse Myo15 gene (a nucleic acid from -6755 to -7209 relative to the mouse Myo15 translation initiation site, the sequence of which is described in SEQ ID NO: 24) or its functional portion or derivative. The functional portion of SEQ ID NO: 24 includes a first region (upstream regulatory element) and a second region having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher) with respect to the nucleic acid sequence immediately preceding the mouse Myo15 translation initiation site (a nucleic acid sequence of -1 to -1157 relative to the mouse Myo15 translation initiation site, the sequence of which is described in SEQ ID NO: 25) or its functional portion or derivative. The functional portion of SEQ ID NO: 24 may have a nucleic acid sequence of -7166 to -7091 relative to the mouse Myo15 translation initiation site (described in SEQ ID NO: 26) and / or a nucleic acid sequence of -7077 to -6983 relative to the mouse Myo15 translation initiation site (described in SEQ ID NO: 27). The first region may include the nucleic acid sequence of Sequence ID No. 26 fused to the nucleic acid sequence of Sequence ID No. 27 without the intervening nucleic acid described in Sequence ID No. 28, or the first region may include the nucleic acid sequence of Sequence ID No. 27 fused to the nucleic acid sequence of Sequence ID No. 26 without the intervening nucleic acid described in Sequence ID No. 29. Alternatively, the first region may include the sequences of Sequence ID No. 26 and Sequence ID No. 27 linked by an endogenous intervening nucleic acid sequence (for example, the first region may have, or include, a nucleic acid sequence from -7166 to -6983 relative to the mouse Myo15 translation initiation site, as described in Sequence ID No. 30 and Sequence ID No. 50) or a nucleic acid linker.In a mouse Myo15 promoter where the first region includes both SEQ ID NO: 26 and SEQ ID NO: 27, the two sequences may be included in any order (for example, SEQ ID NO: 26 may be linked to SEQ ID NO: 27 (e.g., preceded), or SEQ ID NO: 27 may be linked to SEQ ID NO: 26 (e.g., preceded). The functional portion of SEQ ID NO: 25 may have a nucleic acid sequence of -590 to -509 relative to the mouse Myo15 translation initiation site (described in SEQ ID NO: 31) and / or a nucleic acid sequence of -266 to -161 relative to the mouse Myo15 translation initiation site (described in SEQ ID NO: 32). In some embodiments, the sequence including SEQ ID NO: 31 has the sequence of SEQ ID NO: 51. In some embodiments, the sequence including SEQ ID NO: 32 has the sequence of SEQ ID NO: 52. The second region may include the nucleic acid sequence of SEQ ID NO: 31 fused to the nucleic acid sequence of SEQ ID NO: 32 without the intervening nucleic acid described in SEQ ID NO: 33, or the second region may include the nucleic acid sequence of SEQ ID NO: 32 fused to the nucleic acid sequence of SEQ ID NO: 31 without the intervening nucleic acid described in SEQ ID NO: 34. The second region may include the nucleic acid sequence of Sequence ID No. 51 fused to the nucleic acid sequence of Sequence ID No. 52 without the intervening nucleic acid described in Sequence ID No. 55, or the second region may include the nucleic acid sequence of Sequence ID No. 52 fused to the nucleic acid sequence of Sequence ID No. 51 without the intervening nucleic acid. Alternatively, the second region may include the sequences of Sequence ID No. 31 and Sequence ID No. 32, bound by an endogenous intervening nucleic acid sequence (for example, the second region may have a nucleic acid sequence from -590 to -161 relative to the mouse Myo15 translation initiation site, as described in Sequence ID No. 35) or by a nucleic acid linker. In a mouse Myo15 promoter in which the second region includes both Sequence ID No. 31 and Sequence ID No. 32, the two sequences may be included in any order (for example, Sequence ID No. 31 may be bound to Sequence ID No. 32 (e.g., preceded), or Sequence ID No. 32 may be bound to Sequence ID No. 31 (e.g., preceded).

[0169] The first and second regions of the mouse Myo15 promoter can be bound directly or by a nucleic acid linker. For example, the mouse Myo15 promoter may include the sequence of Sequence ID No. 25 or its functional part or derivative (for example, one or more of Sequence IDs 31-35, 51, 52, and 55, for example, Sequence IDs 31 and 32) fused to the sequence of Sequence ID No. 24 or its functional part or derivative (for example, one or more of Sequence IDs 26-30 and 50, for example, Sequence IDs 26 and 27) without intervening nucleic acids. For example, the nucleic acid sequence of the mouse Myo15 promoter resulting from the direct fusion of Sequence ID No. 24 to Sequence ID No. 25 is shown in Sequence ID No. 36. Alternatively, a linker can be used to link the sequence or functional part or derivative of SEQ ID NO: 24 (e.g., one or more of SEQ ID NOs: 26-30 and 50, e.g., SEQ ID NOs: 26 and 27) to the sequence or functional part or derivative of SEQ ID NO: 25 (e.g., one or more of SEQ ID NOs: 31-35, 51, 52 and 55, e.g., SEQ ID NOs: 31 and 32). Exemplary Myo15 promoters containing functional parts of both SEQ ID NOs: 24 and 25 are provided in SEQ ID NOs: 38, 39, 53, 54, 59, and 60.

[0170] The length of the nucleic acid linker for use with the mouse Myo15 promoter described herein may be about 5kb or less (for example, about 5kb, 4.5kb, 4kb, 3.5kb, 3kb, 2.5kb, 2kb, 1.5kb, 1kb, 900bp, 800bp, 700bp, 600bp, 500bp, 450bp, 400bp, 350bp, 300bp, 250bp, 200bp, 150bp, 100bp, 90bp, 80bp, 70bp, 60bp, 50bp, 40bp, 30bp, 25bp, 20bp, 15bp, 10bp, 5bp, 4bp, 3bp, 2bp, or less). The nucleic acid linkers that can be used with the mouse Myo15 promoter described herein do not interfere with the ability of the mouse Myo15 promoter of the present invention to induce transgene expression in hair cells.

[0171] In some embodiments, the sequence of SEQ ID NO: 24 or its functional portion or derivative (e.g., one or more of SEQ ID NOs: 26-30 and 50, e.g., SEQ ID NOs: 26 and 27) is linked (e.g., operably linked) to the sequence of SEQ ID NO: 25 or its functional portion or derivative (e.g., one or more of SEQ ID NOs: 31-35, 51, 52 and 55, e.g., SEQ ID NOs: 31 and 32), and in some embodiments, the order of the regions is reversed (e.g., the sequence of SEQ ID NO: 25 or its functional portion or derivative (e.g., one or more of SEQ ID NOs: 31-35, 51, 52 and 55, e.g., SEQ ID NOs: 31 and 32) is linked to the sequence of SEQ ID NO: 24 or its functional portion or derivative (e.g., one or more of SEQ ID NOs: 26-30 and 50, e.g., SEQ ID NOs: 26 and 27) (e.g., operably linked)). For example, the nucleic acid sequence of the mouse Myo15 promoter resulting from the direct fusion of SEQ ID NO: 25 to SEQ ID NO: 24 is shown in SEQ ID NO: 37. An example of a mouse Myo15 promoter in which the functional portion or derivative of SEQ ID NO: 25 precedes the functional portion or derivative of SEQ ID NO: 24 is provided in SEQ ID NO: 58. Regardless of the order, the sequences of SEQ ID NO: 24 or its functional portion or derivative, and SEQ ID NO: 25 or its functional portion or derivative can be linked by direct fusion or nucleic acid linker, as described above.

[0172] In some embodiments, the mouse Myo15 promoter for use in the compositions and methods described herein comprises a region having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or greater sequence identity) to the first non-coding exon of the mouse Myo15 gene (which is nucleic acid -6755 to -7209 relative to the mouse Myo15 translation start site, the sequence of which is shown in SEQ ID NO: 24), or a functional portion or derivative thereof. The functional portion of SEQ ID NO: 24 can have a nucleic acid sequence of -7166 to -7091 (described in SEQ ID NO: 26) and / or a nucleic acid sequence of -7077 to -6983 (described in SEQ ID NO: 27) relative to the mouse Myo15 translation start site. The mouse Myo15 promoter can comprise the nucleic acid sequence of SEQ ID NO: 26 fused to the nucleic acid sequence of SEQ ID NO: 27 without the intervening nucleic acid described in SEQ ID NO: 28, or the mouse Myo15 promoter can comprise the nucleic acid sequence of SEQ ID NO: 27 fused to the nucleic acid sequence of SEQ ID NO: 26 without the intervening nucleic acid described in SEQ ID NO: 29. Alternatively, the mouse Myo15 promoter can comprise the sequences of SEQ ID NO: 26 and SEQ ID NO: 27 joined by an endogenous intervening nucleic acid sequence (e.g., the first region can have, or can comprise, a nucleic acid sequence of -7166 to -6983 relative to the mouse Myo15 translation start site, as described in SEQ ID NO: 30 and SEQ ID NO: 50) or a polynucleotide linker. In a mouse Myo15 promoter comprising both SEQ ID NO: 26 and SEQ ID NO: 27, the two sequences can be included in any order (e.g., SEQ ID NO: 26 can be joined to (e.g., precede) SEQ ID NO: 27, or SEQ ID NO: 27 can be joined to (e.g., precede) SEQ ID NO: 26).

[0173] In some embodiments, the mouse Myo15 promoter for using the compositions and methods described herein includes a region having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher) with respect to the upstream nucleic acid sequence immediately preceding the mouse Myo15 translation initiation site (the nucleic acid sequence 1 to 1157 relative to the mouse Myo15 translation initiation site, the sequence of which is shown in SEQ ID NO: 25) or its functional portion or derivative thereof. The functional portion of SEQ ID NO: 25 may have a nucleic acid sequence of -590 to -509 relative to the mouse Myo15 translation initiation site (described in SEQ ID NO: 31) and / or a nucleic acid sequence of -266 to -161 relative to the mouse Myo15 translation initiation site (described in SEQ ID NO: 32). In some embodiments, the sequence including SEQ ID NO: 31 has the sequence of SEQ ID NO: 51. In some embodiments, the sequence containing SEQ ID NO: 32 has the sequence of SEQ ID NO: 52. The mouse Myo15 promoter may include the nucleic acid sequence of SEQ ID NO: 31 fused to the nucleic acid sequence of SEQ ID NO: 32 without the intervening nucleic acid described in SEQ ID NO: 33, or the mouse Myo15 promoter may include the nucleic acid sequence of SEQ ID NO: 32 fused to the nucleic acid sequence of SEQ ID NO: 31 without the intervening nucleic acid described in SEQ ID NO: 34. The mouse Myo15 promoter may include the nucleic acid sequence of SEQ ID NO: 51 fused to the nucleic acid sequence of SEQ ID NO: 52 without the intervening nucleic acid described in SEQ ID NO: 55, or the mouse Myo15 promoter may include the nucleic acid sequence of SEQ ID NO: 52 fused to the nucleic acid sequence of SEQ ID NO: 51 without the intervening nucleic acid. Alternatively, the mouse Myo15 promoter may include the sequences of SEQ ID NO: 31 and SEQ ID NO: 32 by being linked by an endogenous intervening nucleic acid sequence (for example, the second region may have a nucleic acid sequence from -590 to -161 relative to the mouse Myo15 translation initiation site, as described in SEQ ID NO: 35) or a nucleic acid linker. In a mouse Myo15 promoter containing both SEQ ID NO: 31 and SEQ ID NO: 32, the two sequences may be included in any order (for example, SEQ ID NO: 31 may be concatenated to SEQ ID NO: 32 (e.g., preceded by it), or SEQ ID NO: 32 may be concatenated to SEQ ID NO: 31 (e.g., preceded by it)).

[0174] In some embodiments, the mouse Myo15 promoter for use in the compositions and methods described herein has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher) with respect to the nucleic acid sequence upstream of the mouse Myo15 translation initiation site (the nucleic acid sequence -1 to -1157 relative to the mouse Myo15 translation initiation site, the sequence of which is described in SEQ ID NO: 24). The functional portion or derivative of a region having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity) to the region containing the first non-coding exon of the Myo15 gene (a nucleic acid from -6755 to -7209 relative to the mouse Myo15 translation initiation site, the sequence of which is described in SEQ ID NO: 25), flanked on both sides by functional portions or derivatives of the region, is a functional portion or derivative of a region having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity). For example, a functional portion or derivative of SEQ ID NO: 25, such as SEQ ID NO: 31 or 51, may be directly fused or bound by a nucleic acid linker to a portion of SEQ ID NO: 24, such as one of SEQ ID NOs: 26-30 and 50, which is directly fused or bound by a nucleic acid linker to a different functional portion of SEQ ID NO: 25, such as SEQ ID NO: 32 or 52. In other embodiments, a functional portion or derivative of SEQ ID NO: 25, such as SEQ ID NO: 32 or 52, may be directly fused or bound by a nucleic acid linker to a portion of SEQ ID NO: 24, such as one of SEQ ID NOs: 26-30 and 50, which is directly fused or bound by a nucleic acid linker to a different functional portion of SEQ ID NO: 25, such as SEQ ID NO: 31 or 51. For example, a polynucleotide having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity) may be fused to the nucleic acid sequence of SEQ ID NO: 56, such as a polynucleotide having at least 85% sequence identity (e.g., 85%, 86%, 87%).It is possible to generate polynucleotides having sequence identity of 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher. In some embodiments, polynucleotides having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity) can be fused to the nucleic acid sequences of SEQ ID NO: 52, 50, and 51 to generate polynucleotides having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity) to the nucleic acid sequence of SEQ ID NO: 57.

[0175] Human myosin 15 promoter In some embodiments, the Myo15 promoter for use in the compositions and methods described herein also includes nucleic acid sequences derived from a region of the human Myo15 locus capable of specifically expressing a transgene in hair cells, or variants thereof, such as nucleic acid sequences having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity) to a region of the human Myo15 locus capable of specifically expressing a transgene in hair cells. The Myo15 promoter for use in the compositions and methods described herein may optionally include a linker that operably binds a region of the human Myo15 locus capable of specifically expressing a transgene in hair cells, or the region of the human Myo15 locus can be directly bound without an intervening linker.

[0176] In some embodiments, the Myo15 promoter used in the methods and compositions described herein includes a first region having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher) to the sequence or functional portion or derivative described in SEQ ID NO: 40, and a second region that binds thereto (e.g., operably binds thereto) and has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher) to the sequence or functional portion or derivative described in SEQ ID NO: 41. The functional portion of SEQ ID NO: 40 may have the sequence shown in SEQ ID NO: 42. The functional portion of SEQ ID NO: 41 may have the sequence shown in SEQ ID NO: 43 and / or the sequence shown in SEQ ID NO: 44. The second region may include the nucleic acid sequence of SEQ ID NO: 43 fused to the nucleic acid sequence of SEQ ID NO: 44 without the intervening nucleic acid described in SEQ ID NO: 45, or the second region may include the nucleic acid sequence of SEQ ID NO: 44 fused to the nucleic acid sequence of SEQ ID NO: 43 without the intervening nucleic acid described in SEQ ID NO: 46. Alternatively, the second region may include the sequences of SEQ ID NO: 43 and SEQ ID NO: 44 linked by an endogenous intervening nucleic acid sequence (as described in SEQ ID NO: 47) or a nucleic acid linker. In a human Myo15 promoter in which the second region includes both SEQ ID NO: 43 and SEQ ID NO: 44, the two sequences may be included in any order (for example, SEQ ID NO: 43 may be linked to SEQ ID NO: 44 (e.g., preceded), or SEQ ID NO: 44 may be linked to SEQ ID NO: 43 (e.g., preceded).

[0177] The first and second regions of the human Myo15 promoter can be directly bound or bound by a nucleic acid linker. For example, the human Myo15 promoter may include the sequence of SEQ ID NO: 40 or its functional part or derivative (e.g., SEQ ID NO: 42) fused to the sequence of SEQ ID NO: 41 or its functional part or derivative (e.g., one or more of SEQ ID NOs: 43-47, e.g., SEQ ID NO: 43 and / or 44) without intervening nucleic acid. Alternatively, a linker can be used to bind the sequence of SEQ ID NO: 40 or its functional part or derivative (e.g., SEQ ID NO: 42) to the sequence of SEQ ID NO: 41 or its functional part or derivative (e.g., one or more of SEQ ID NOs: 43-47, e.g., SEQ ID NO: 43 and / or 44). Exemplary human Myo15 promoters containing the functional parts of both SEQ ID NO: 40 and SEQ ID NO: 41 are provided in SEQ ID NOs: 48 and 49.

[0178] In some embodiments, the sequence of SEQ ID NO: 40 or its functional part or derivative (e.g., SEQ ID NO: 42) is linked (e.g., operably linked) to the sequence of SEQ ID NO: 41 or its functional part or derivative (e.g., one or more of SEQ ID NOs: 43-47, e.g., SEQ ID NOs: 43 and 44), and in some embodiments, the order of the regions is reversed (e.g., the sequence of SEQ ID NO: 41 or its functional part or derivative (e.g., one or more of SEQ ID NOs: 43-47, e.g., SEQ ID NOs: 43 and / or 44) is linked to the sequence of SEQ ID NO: 40 or its functional part or derivative (e.g., SEQ ID NO: 42) (e.g., operably linked)). Regardless of the order, the sequences of SEQ ID NO: 40 or its functional part or derivative and the sequences of SEQ ID NO: 41 or its functional part or derivative can be linked by direct fusion or nucleic acid linkers as described above.

[0179] In some embodiments, the human Myo15 promoter for use in the compositions and methods described herein includes a region having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher) to a region containing the sequence shown in SEQ ID NO: 40 or its functional portion or a derivative thereof. The functional portion of SEQ ID NO: 40 may have the nucleic acid sequence shown in SEQ ID NO: 42.

[0180] In some embodiments, the human Myo15 promoter for use in the compositions and methods described herein includes a region having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher) with respect to the sequence shown in SEQ ID NO: 41 or its functional portion or derivative thereof. The functional portion of SEQ ID NO: 41 may have the sequence shown in SEQ ID NO: 43 and / or the sequence shown in SEQ ID NO: 44. The human Myo15 promoter may include the nucleic acid sequence of SEQ ID NO: 43 fused to the nucleic acid sequence of SEQ ID NO: 44 without the intervening nucleic acid described in SEQ ID NO: 45, or the human Myo15 promoter may include the nucleic acid sequence of SEQ ID NO: 44 fused to the nucleic acid sequence of SEQ ID NO: 43 without the intervening nucleic acid described in SEQ ID NO: 46. Alternatively, the human Myo15 promoter may include sequences of SEQ ID NO: 43 and SEQ ID NO: 44, linked by an endogenous intervening nucleic acid sequence (e.g., as shown in SEQ ID NO: 47) or a nucleic acid linker. In a human Myo15 promoter containing both SEQ ID NO: 43 and SEQ ID NO: 44, the two sequences may be included in any order (e.g., SEQ ID NO: 43 may be linked to SEQ ID NO: 44 (e.g., preceded), or SEQ ID NO: 44 may be linked to SEQ ID NO: 43 (e.g., preceded).

[0181] The length of the nucleic acid linker for use with the human Myo15 promoter described herein may be about 5kb or less (for example, about 5kb, 4.5kb, 4kb, 3.5kb, 3kb, 2.5kb, 2kb, 1.5kb, 1kb, 900bp, 800bp, 700bp, 600bp, 500bp, 450bp, 400bp, 350bp, 300bp, 250bp, 200bp, 150bp, 100bp, 90bp, 80bp, 70bp, 60bp, 50bp, 40bp, 30bp, 25bp, 20bp, 15bp, 10bp, 5bp, 4bp, 3bp, 2bp, or less). The nucleic acid linker that can be used with the human Myo15 promoter described herein does not interfere with the ability of the Myo15 promoter of the present invention to induce transgene expression in hair cells.

[0182] The Myo15 promoters mentioned above are summarized in Table 3 below.

[0183] [Table 3-1]

[0184] [Table 3-2]

[0185] [Table 3-3]

[0186] [Table 3-4]

[0187] [Table 3-5]

[0188] [Table 3-6]

[0189] [Table 3-7]

[0190] [Table 3-8]

[0191] [Table 3-9]

[0192] [Table 3-10]

[0193] [Table 3-11]

[0194] [Table 3-12]

[0195] Further Myo15 promoters useful in combination with the compositions and methods described herein include nucleic acid molecules having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher) to the nucleic acid sequences and functional portions or derivatives of the nucleic acid sequences shown in Table 3. The Myo15 promoters described in Table 3 are characterized in International Patent Application Publications WO2019210181A1 and WO2020163761A1, which are incorporated herein by reference.

[0196] In embodiments in which the smCBA promoter is included in the dual vector system described herein (for example, in the first vector of the dual vector system), the smCBA promoter may have the sequence of the smCBA promoter described in U.S. Patent No. 8,298,818, which is incorporated herein by reference. In some embodiments, the smCBA promoter has the following sequence:

[0197] GGTACCTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTCGAGGTGAGCCCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACCCCCAATTTTGTATTTATTTATTTTTTAATTATTTTGTGCAGCGATGGGGGCGGGGGGGGGGGGGGGGCGCGCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCGAGGCGGAGAGGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCGGCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCGGGAGTCGCTGCGCGCTGCCTTCGCCCCGTGCCCCGCTCCGCCGCCGCCTCGCGCCGCCCGCCCCGGCTCTGACTGACCGCGTTACTCCCACAGGTGAGCGGGCGGGACGGCCCTTCTCCTCCGGGCTGTAATTAGCGCTTGGTTTAATGACGGCTTGTTTCTTTTCTGTGGCTGCGTGAAAGCCTTGAGGGGCTCCGGGAGCTAGAGCCTCTGCTAACCATGTTCATGCCTTCTTCTTTTTCCTACAGCTCCTGGGCAACGTGCTGGTTATTGTGCTGTCTCATCATTTTGGCA (SEQ ID NO: 70).

[0198] In some embodiments, the smCBA promoter has the following sequence: AATTCGGTACCCTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGACTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTCGAGGTGAGCCCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACCCCCAATTTTGTATTTATTTATTTTTTAATTATTTTGTGCAGCGATGGGGGCGGGGGGGGGGGGGGGGCGCGCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCGAGGCGGAGAGGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCGGCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCGGGAGTCGCTGCGACGCTGCCTTCGCCCCGTGCCCCGCTCCGCCGCCGCCTCGCGCCGCCCGCCCCGGCTCTGACTGACCGCGTTACTCCCACAGGTGAGCGGGCGGGACGGCCCTTCTCCTCCGGGCTGTAATTAGCGCTTGGTTTAATGACGGCTTGTTTCTTTTCTGTGGCTGCGTGAAAGCCTTGAGGGGCTCCGGGAGCTAGAGCCTCTGCTAACCATGTTCATGCCTTCTTCTTTTTCCTACAGCTCCTGGGCAACGTGCTGGTTATTGTGCTGTCTCATCATTTTGGCAAAG(SEQ ID NO: 84).

[0199] Once a polynucleotide encoding OTOF is incorporated into the nuclear DNA of a mammalian cell or stabilized with an episomal monomer or concatemer, the transcription of this polynucleotide can be induced by methods known in the art. For example, expression can be induced by exposing mammalian cells to external chemical reagents, such as agents that regulate the binding of transcription factors and / or RNA polymerase to a mammalian promoter, and thus modulate gene expression. The chemical reagent may function to promote the binding of RNA polymerase and / or transcription factors to the mammalian promoter, for example, by removing a repressor protein bound to the promoter. Alternatively, the chemical reagent may function to increase the affinity of the mammalian promoter for RNA polymerase and / or transcription factors, thereby increasing the transcription rate of genes located downstream of the promoter in the presence of the chemical reagent. Examples of chemical reagents that enhance polynucleotide transcription by the above mechanisms include tetracycline and doxycycline. These reagents are commercially available (Life Technologies, Carlsbad, CA) and can be administered to mammalian cells to promote gene expression according to established protocols.

[0200] Other DNA sequence elements that may be included in nucleic acid vectors for use in the compositions and methods described herein include enhancer sequences. Enhancers represent another class of regulatory elements that induce conformational changes in polynucleotides containing the gene of interest so that the DNA adopts a three-dimensional orientation favorable for the binding of transcription factors and RNA polymerase at the transcription start site. Therefore, polynucleotides for use in the compositions and methods described herein include polynucleotides encoding OTOF, and further include mammalian enhancer sequences. Many enhancer sequences derived from mammalian genes are currently known, for example, enhancers for genes encoding mammalian globin, elastase, albumin, α-fetoprotein, and insulin. Enhancers for use in the compositions and methods described herein also include enhancers derived from the genetic material of viruses that can infect eukaryotic cells. For example, SV40 enhancers (bp100-270) on the posterior side of the origin of replication, cytomegalovirus early promoter enhancers, polyoma enhancers on the posterior side of the origin of replication, and adenovirus enhancers. Additional enhancer sequences that induce activation of eukaryotic gene transcription are disclosed in Yaniv, et al., Nature 297:17 (1982). The enhancer may be spliced, for example, at the 5' or 3' position of the gene within a vector containing the polynucleotide encoding the OTOF protein. In a preferred orientation, the enhancer is positioned 5' to the promoter, and then the promoter is positioned 5' to the polynucleotide encoding the OTOF protein.

[0201] The nucleic acid vectors described herein may include a Woodchuck post-transcriptional regulatory element (WPRE). WPREs act at the mRNA level and increase the total amount of mRNA in the cell by promoting nuclear export of transcripts and / or by increasing the efficiency of polyadenylation of nascent transcripts. Addition of WPREs to a vector can result in substantial improvements in the level of transgene expression from several different promoters, both in vitro and in vivo. WPREs can be located in a second nucleic acid vector between the polynucleotide encoding the C-terminal portion of the OTOF protein and the poly(A) sequence. In some embodiments of the compositions and methods described herein, the WPRE has the following sequence:

[0202] (Sequence ID 23).

[0203] In other embodiments, WPRE has the following sequence. AATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTCTCCTGTGTATAAATCCTGGTTAGTTCTTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGCTGTGGGCACTGACAATTCCGTGGTGTTATTTGTGGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTCATGCTTATTTGTGTAAATTTGTGTAATTGCTATTGCTTTATTGTTAACCATTATAAGCTGCAATAAACAAGTTAACAACAATTGCATTCATTTTATGTTCAGGTTCAGGGGAGAGTGTGGAGGTTTTTTAAA (SEQ ID NO: 61).

[0204] In some embodiments, nucleic acid vectors for use in the compositions and methods described herein include a reporter sequence, which may be useful, for example, for verifying the expression of the OTOF gene in specific cells and tissues (e.g., cochlear hair cells). Examples of reporter sequences that may be provided in the transgene include DNA sequences encoding β-lactamase, β-galactosidase (LacZ), alkaline phosphatase, thymidine kinase, green fluorescent protein (GFP), chloramphenicol acetyltransferase (CAT), luciferase, and other reporters well known in the art. When the reporter sequence is associated with a regulatory element driving their expression, it provides a signal detectable by conventional means, including enzyme assays, radioisotopestheses, colorimetric assays, fluorescence assays or other spectroscopic assays, fluorescence-activated cell sorting assays, and immunological assays including enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), and immunohistochemistry. For example, if the marker sequence is the LacZ gene, the presence of a vector incorporating the signal can be detected by an assay for β-galactosidase activity. If the transgene is green fluorescent protein or luciferase, the vector incorporating the signal may be visually measured by the generation of color or light using a luminometer.

[0205] Duplicate double vector One technique for expressing large proteins in mammalian cells involves the use of duplicated double vectors. This technique is based on the use of two nucleic acid vectors, each containing a portion of the polynucleotide encoding the protein of interest and a defined region of the sequence that overlaps with the other polynucleotides. Homologous recombination occurs in the overlapping region and can result in the formation of a single nucleic acid molecule encoding the full-length protein of interest.

[0206] The duplicated double vectors used in the methods and compositions described herein contain at least 1 kilobase (kb) of duplicated sequences (e.g., 1kb, 1.5kb, 2kb, 2.5kb, 3kb, or more). The nucleic acid vector is designed so that the duplicated region is centered on the OTOF exon boundary, with equal amounts of duplicate on both sides of the boundary. The boundary is selected based on the size of the promoter and the position of the polynucleotide portion encoding the OTOF C2 domain. The duplicated region is centered on the exon boundary that occurs outside the polynucleotide portion encoding the C2C domain (e.g., after the polynucleotide portion encoding the C2C domain). An exon boundary within the polynucleotide portion encoding the C2D domain can be selected as the center of the duplicated region, or an exon boundary located after the polynucleotide portion encoding the C2D domain and before the polynucleotide portion encoding the C2E domain can function as the center of the duplicated region. Furthermore, the nucleic acid vectors used in the methods and compositions described herein are designed so that approximately half of the OTOF gene is contained within each vector (for example, each vector contains a polynucleotide encoding approximately half of the OTOF protein).

[0207] One exemplary duplicated double vector system includes a first nucleic acid vector (e.g., human OTOF, e.g., SEQ ID NO: 1 or SEQ ID NO: 5, or mouse OTOF, e.g., SEQ ID NO: 6) containing a CAG promoter operably bound to exons 1-28 and 500 base pairs (bp) near the 3' end of exon 28 / 29 of the polynucleotide encoding the OTOF protein; a second nucleic acid vector (e.g., exons 29-48 for mouse OTOF, exons 29-45 and 47 or exons 29-46 for human OTOF) containing 500 bp near the 5' end of the exon 28 / 29 boundary and the remaining exons of the polynucleotide encoding the OTOF protein (e.g., human OTOF, e.g., SEQ ID NO: 1 or SEQ ID NO: 5, or mouse OTOF, e.g., SEQ ID NO: 6); and a poly(A) sequence (e.g., bovine growth hormone (bGH) poly(A) signal sequence). In this duplicated double vector system, the duplicated sequence is centered on the exon 28 / 29 boundary following the portion of the polynucleotide encoding the C2D domain. Another exemplary duplicated double vector system includes a first nucleic acid vector containing a CAG promoter operably bound to exons 1-24 and 500 bp near the 3' end of exon 24 / 25 of a polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO: 1 or SEQ ID NO: 5, or mouse OTOF, e.g., SEQ ID NO: 6); a second nucleic acid vector containing 500 bp near the 5' end of the exon 24 / 25 boundary and the remaining exons of the polynucleotide encoding an OTOF protein (e.g., exons 25-48 for mouse OTOF, exons 25-45 and 47 for human OTOF, or exons 25-46); and a poly(A) sequence (e.g., bGH poly(A) signal sequence). In this duplicated double vector system, the duplicated sequence is centered on the exon 24 / 25 boundary within the polynucleotide portion encoding the C2D domain.These two exon boundaries described above can be used with any promoter of a similar size to the CAG promoter (e.g., the CMV promoter or the smCBA promoter), such as promoters with a length of 1kb or less (e.g., approximately 1kb, 950bp, 900bp, 850bp, 800bp, 750bp, 700bp, 650bp, 600bp, 550bp, 500bp, 450bp, 400bp, 350bp, 300bp, or less). For example, in any of the dual vector systems described above, the CMV promoter or the smCBA promoter can be used instead of the CAG promoter. A Myo15 promoter having a sequence of 1kb or less (e.g., the Myo15 promoters described herein, for example, a Myo15 promoter having any one of the sequences of SEQ ID NOs. 38, 39, or 49-60) can also be used instead of the CAG promoter. Alternatively, different exon boundaries can be selected, located within or after the polynucleotide portion encoding the C2D domain, and before the polynucleotide portion encoding the C2E domain. A nucleic acid vector containing a promoter of this size can optionally contain an OTOF UTR. For example, in the aforementioned double-vector system with the overlapping region centered at the exon 28 / 29 boundary of OTOF, the second nucleic acid vector can contain a full-length OTOF 3'UTR (e.g., a 1035 bp human OTOF 3'UTR in a double-vector system encoding human OTOF, or a 1001 bp mouse OTOF 3'UTR in a double-vector system encoding mouse OTOF). In the aforementioned double-vector system with the overlapping region centered at the exon 24 / 25 boundary of OTOF, neither the first nor the second nucleic acid vector contains an OTOF UTR.

[0208] In some embodiments, the first nucleic acid vector in the overlapping double vector system includes a long promoter (e.g., a promoter longer than 1 kb, e.g., 1.1 kb, 1.25 kb, 1.5 kb, 1.75 kb, 2 kb, 2.5 kb, 3 kb, or longer). In such an overlapping double vector system, the overlapping region can be centered around an exon boundary located after the polynucleotide portion encoding the C2C domain and before the polynucleotide portion encoding the C2D domain. For example, a duplicate double vector system for use in the methods and compositions described herein comprises a first nucleic acid vector containing a Myo15 promoter longer than 1 kb operably bound to exons 1-21 (e.g., SEQ ID NO: 36), and 500 bp near the 3' of exon 21 / 22 of a polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO: 1 or SEQ ID NO: 5, or mouse OTOF, e.g., SEQ ID NO: 6); and a second nucleic acid vector containing 500 bp near the 5' of the exon 21 / 22 boundary, and the remaining exons of the polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO: 1 or SEQ ID NO: 5, or mouse OTOF, e.g., SEQ ID NO: 6) (exons 29-48 for mouse OTOF, exons 22-45 and 47 for human OTOF, or exons 25-46) and a poly(A) sequence (e.g., bGH poly(A) signal sequence). The exon 20 / 21 boundary may also be selected as the center of the duplicate region. In such overlapping dual-vector systems, neither the first nor the second nucleic acid vector can contain the OTOF UTR. Short promoters (e.g., CMV promoter, CAG promoter, smCBA promoter, or Myo15 promoter with a sequence of 1kb or less, e.g., Myo15 promoter with any one of sequence numbers 38, 39, or 49-60) can also be used in these dual-vector systems (e.g., dual-vector systems where the overlapping region is centered around the exon 21 / 22 or exon 20 / 21 boundary).When using a short promoter, additional elements such as the 5' OTOF UTR can be included in the first vector (e.g., a vector containing exons 1-21 of the polynucleotide encoding the OTOF protein, and 500 bp near the 3' end of the exon 21 / 22 boundary, or exons 1-20, and 500 bp near the 3' end of the exon 20 / 21 boundary).

[0209] Trans-splicing double vector A second method for expressing large proteins in mammalian cells involves the use of trans-splicing dual vectors. This method uses two nucleic acid vectors containing distinct nucleic acid sequences, and the polynucleotide encoding the N-terminal portion of the target protein and the polynucleotide encoding the C-terminal portion of the target protein do not overlap. Instead, the first nucleic acid vector contains the 3' splice donor sequence of the polynucleotide encoding the N-terminal portion of the target protein, and the second nucleic acid vector contains the 5' splice donor sequence of the polynucleotide encoding the C-terminal portion of the target protein. When the first and second nucleic acids are present in the same cell, their ITRs can ligate to form a single nucleic acid structure in which the ligated ITRs are positioned between the splice donor and splice acceptor. Trans-splicing then occurs during transcription, producing adjacent nucleic acid molecules with the polynucleotides encoding the N-terminal and C-terminal portions of the target protein, thereby forming the full-length coding sequence.

[0210] The trans-splicing double vectors for use in the methods and compositions described herein are designed so that approximately half of the OTOF gene is contained within each vector (for example, each vector contains a polynucleotide encoding approximately half of the OTOF protein). The method for splitting the polynucleotide sequence between the two nucleic acid vectors is determined based on the size of the promoter and the position of the portion of the polynucleotide encoding the OTOF C2 domain. In a transsplicing bivector system, when using a short promoter (e.g., a promoter of 1 kb or less (e.g., 1 kb, 950 bp, 900 bp, 850 bp, 800 bp, 750 bp, 700 bp, 650 bp, 600 bp, 550 bp, 500 bp, 450 bp, 400 bp, 350 bp, 300 bp, or less)), such as a CAG promoter, CMV promoter, smCBA promoter, or Myo15 promoter of 1 kb or less in length (e.g., the Myo15 promoter described above herein, e.g., a Myo15 promoter having the sequence described in any one of SEQ ID NOs. 38, 39, or 49-60), the OTOF polynucleotide sequence can be split between the two nucleic acid vectors at the exon boundary that occurs after the polynucleotide portion encoding the C2D domain and before the polynucleotide portion encoding the C2E domain, e.g., the exon 26 / 27 boundary. A nucleic acid vector containing a promoter of this size may optionally include an OTOF UTR (e.g., both 5' and 3' OTOF UTRs, e.g., a full-length UTR).In trans-splicing bivector systems, when using long promoters such as the Myo15 promoter (SEQ ID NO: 36) which is longer than 1 kb (e.g., promoters longer than 1 kb, e.g., 1.1 kb, 1.25 kb, 1.5 kb, 2 kb, 2.5 kb, 3 kb, or longer), the OTOF polynucleotide sequence can be split between the two nucleic acid vectors at exon boundaries that occur either after the polynucleotide portion encoding the C2C domain and before the polynucleotide portion encoding the C2D domain, such as the exon 19 / 20 boundary, exon 20 / 21 boundary, or exon 21 / 22 boundary, or within the polynucleotide portion encoding the C2D domain, such as the exon 25 / 26 boundary. Short promoters (e.g., CMV promoter, smCBA promoter, CAG promoter, or Myo15 promoter with a sequence of 1kb or less, e.g., Myo15 promoter with any one of sequence numbers 38, 39, or 49-60) can also be used in dual vector systems designed for larger promoters, in which case additional elements (e.g., OTOF UTR sequences) may be included in the first vector (e.g., a vector containing a portion of a polynucleotide encoding a C2C domain).

[0211] One exemplary trans-splicing double vector system using a short promoter comprises a first nucleic acid vector containing a CAG promoter operably bound to exons 1-26 of the polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO: 1 or SEQ ID NO: 5, or mouse OTOF, e.g., SEQ ID NO: 6) and a 3' splice donor sequence of the polynucleotide sequence; and a second nucleic acid vector containing a 5' splice acceptor sequence of the remaining exons (e.g., exons 27-48 for mouse OTOF, or exons 27-45 or exons 27-46 for human OTOF) of the polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO: 1 or SEQ ID NO: 5, or mouse OTOF, e.g., SEQ ID NO: 6) and a poly(A) sequence (e.g., bGH poly(A) signal sequence). Another trans-splicing bivector system comprises a first nucleic acid vector containing a CAG promoter operably bound to exons 1-28 of a polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO: 1 or SEQ ID NO: 5, or mouse OTOF, e.g., SEQ ID NO: 6), and the 3' of a splice donor sequence of the polynucleotide sequence; and a second nucleic acid vector containing the 5' of a splice acceptor sequence of the remaining exons (e.g., exons 29-48 for mouse OTOF, or exons 29-45 and 47 for human OTOF, or exons 29-46) of the polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO: 1 or SEQ ID NO: 5, or mouse OTOF, e.g., SEQ ID NO: 6) and a poly(A) sequence (e.g., bGH poly(A) signal sequence). A CMV promoter, an smCBA promoter, or a Myo15 promoter having a sequence of 1kb or less in length (for example, the Myo15 promoters described herein, for example, a Myo15 promoter having any one of the sequences of SEQ ID NOs. 38, 39, or 49-60) can be used in place of any of the CAG promoters in the dual vector systems described above.These nucleic acid vectors may also contain full-length 5' and 3' OTOF UTRs in the first and second nucleic acid vectors, respectively (for example, the first nucleic acid vector may contain a 5' human OTOF UTR (127 bp) in a dual vector system encoding human OTOF, or a 5' mouse UTR (134 bp) in a dual vector system encoding mouse OTOF, and the second nucleic acid vector may contain a 3' human OTOF UTR (1035 bp) in a dual vector system encoding human OTOF, or a 3' mouse OTOF UTR (1001 bp) in a dual vector system encoding mouse OTOF).

[0212] One exemplary trans-splicing double vector system using a long promoter comprises a first nucleic acid vector containing a Myo15 promoter of over 1 kb (e.g., SEQ ID NO: 36) operably bound to exons 1-19 of the polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO: 1 or SEQ ID NO: 5, or mouse OTOF, e.g., SEQ ID NO: 6) and the 3' of the splice donor sequence of the polynucleotide sequence; and a second nucleic acid vector containing the 5' of the splice acceptor sequence of the remaining exons (e.g., exons 20-48 for mouse OTOF, or exons 20-45 and 47 for human OTOF, or exons 20-46) of the polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO: 1 or SEQ ID NO: 5, or mouse OTOF, e.g., SEQ ID NO: 6) and a poly(A) sequence (e.g., bGH poly(A) signal sequence). Another trans-splicing dual vector system may include a first nucleic acid vector containing a Myo15 promoter of over 1 kb (e.g., SEQ ID NO: 36) operably bound to exons 1-20 of the polynucleotide encoding the OTOF protein (e.g., human OTOF, e.g., SEQ ID NO: 1 or SEQ ID NO: 5, or mouse OTOF, e.g., SEQ ID NO: 6), and the 3' of the splice donor sequence of the polynucleotide sequence; and a second nucleic acid vector containing the 5' of the splice acceptor sequence and a poly(A) sequence (e.g., bGH poly(A) signal sequence) of the remaining exons of the polynucleotide encoding the OTOF protein (e.g., human OTOF, e.g., SEQ ID NO: 1 or SEQ ID NO: 5, or mouse OTOF, e.g., SEQ ID NO: 6) (e.g., exons 21-48 for mouse OTOF, or exons 21-45 and 47 for human OTOF, or exons 21-46 for human OTOF). Neither the first nor the second nucleic acid vector contains the OTOF UTR in any of the Myo15 promoter trans-splicing dual vector systems described above.Short promoters (e.g., CMV promoter, smCBA promoter, CAG promoter, or Myo15 promoter with a sequence of 1kb or less, e.g., Myo15 promoter with any one of sequence numbers 38, 39, or 49-60) can also be used in the dual-vector systems described above that were designed for larger promoters. These dual-vector systems, when containing a short promoter, may also include a 5'OTOF UTR or another element of similar size in the first vector.

[0213] To support OTOF UTR, the OTOF coding array can be split into different positions. For example, in a trans-splittering bivector system in which the first nucleic acid vector contains a Myo15 promoter longer than 1kb (e.g., SEQ ID NO: 36) operably bound to exons 1-25 of the polynucleotide encoding the OTOF protein (e.g., human OTOF, e.g., SEQ ID NO: 1 or SEQ ID NO: 5, or mouse OTOF, e.g., SEQ ID NO: 6), and the 3' splice donor sequence of the polynucleotide sequence, and the second nucleic acid vector contains the 5' splice acceptor sequence of the remaining exons (e.g., exons 26-48 for mouse OTOF, or exons 26-45 and 47, or 26-46 for human OTOF) of the polynucleotide encoding the OTOF protein (e.g., human OTOF, e.g., SEQ ID NO: 1 or SEQ ID NO: 5, or mouse OTOF, e.g., SEQ ID NO: 6) and a poly(A) sequence (e.g., bGH poly(A) signal sequence), the second nucleic acid is the full-length OTOF 3'UTR (e.g., 1035bp human OTOF The trans-splicing dual vector system can also include the 3'UTR. In mouse OTOF, the trans-splicing dual vector system can also include the 3'UTR if the first nucleic acid vector contains a Myo15 promoter longer than 1kb (e.g., SEQ ID NO: 36) and a splice donor sequence of the polynucleotide sequence operably bound to exons 1-24 of the polynucleotide encoding the OTOF protein (e.g., mouse OTOF, e.g., SEQ ID NO: 6), and the second nucleic acid vector contains the splice acceptor sequence of exons 25-48 of the polynucleotide encoding the OTOF protein (e.g., mouse OTOF, e.g., SEQ ID NO: 6), and a poly(A) sequence (e.g., bGH poly(A) signal sequence). In this dual vector system, the second nucleic acid can also include the full-length OTOF 3'UTR (e.g., 1001bp mouse OTOF 3'UTR).Short promoters (e.g., CMV promoter, smCBA promoter, CAG promoter, or Myo15 promoter with a sequence of 1kb or less, e.g., Myo15 promoter with any one of sequence numbers 38, 39, or 49-60) can also be used in the dual vector systems designed for large promoters. Including short promoters in these dual vector systems may also include a 5'OTOF UTR in the first vector.

[0214] Dual hybrid vector A third method for expressing large proteins in mammalian cells involves the use of a dual hybrid vector. This method combines elements of the dual-vector and trans-splicing strategies, characterized by both a redundant region capable of homologous recombination and splice donor and splice acceptor sequences. In the dual hybrid vector system, the redundant region is not a part of the polynucleotide sequence encoding the protein of interest, but rather a recombination-inducing region present in both the first and second nucleic acid vectors, and the polynucleotide encoding the N-terminal portion of the protein of interest and the polynucleotide encoding the C-terminal portion of the protein of interest do not overlap in this method. The recombination-inducing region is the 3' of the splice donor sequence in the first nucleic acid vector and the 5' of the splice acceptor sequence in the second nucleic acid vector. The first and second polynucleotide sequences can then combine to form a single sequence based on one of two mechanisms: 1) recombination at the redundant region, or 2) concatemerization of the ITR. The remaining recombination induction region(s) and / or concatemerized ITRs can be removed by splicing, resulting in the formation of a continuous polynucleotide sequence encoding the desired full-length protein.

[0215] Recombinant regions usable in the compositions and methods described herein include the F1 phage AK gene having the following sequence:GGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAAT (SEQ ID NO: 19), and the alkaline phosphatase (AP) gene fragment described in U.S. Patent No. 8,236,557, which is incorporated herein by reference. In some embodiments, the AP gene fragment has the following sequence:

[0216] CCCCGGGTGCGCGGCGTCGGTGGTGCCGGCGGGGGGCGCCAGGTCGCAGGCGGTGTAGGGCTCCAGGCAGGCGGCGAAGGCCATGACGTGCGCTATGAAGGTCTGCTCCTGCACGCCGTGAACCAGGTGCGCCTGCGGGCCGCGCGCGAACACCGCCACGTCCTCGCCTGCGTGGGTCTCTTCGTCCAGGGGCACTGCTGACTGCTGCCGATACTCGGGGCTCCCGCTCTCGCTCTCGGTAACATCCGGCCGGGCGCCGTCCTTGAGCACATAGCCTGGACCGTTTCCGTATAGGAGGACCGTGTAGGCCTTCCTGTCCCGGGCCTTGCCAGCGGCCAGCCCGATGAAGGAGCTCCCTCGCAGGGGGTAGCCTCCGAAGGAGAAGACGTGGGAGTGGTCGGCAGTGACGAGGCTCAGCGTGTCCTCCTCGCTGGTGAGCTGGCCCGCCCTCTCAATGGCGTCGTCGAACATGATCGTCTCAGTCAGTGCCCGGTAAGCCCTGCTTTCATGATGACCATGGTCGATGCGACCACCCTCCACGAAGAGGAAGAAGCCGCGGGGGTGTCTGCTCAGCAGGCGCAGGGCAGCCTCTGTCATCTCCATCAGGGAGGGGTCCAGTGTGGAGTCTCGGTGGATCTCGTATTTCATGTCTCCAGGCTCAAAGAGACCCATGAGATGGGTCACAGACGGGTCCAGGGAAGCCTGCATGAGCTCAGTGCGGTTCCACACGTACCGGGCACCCTGGCGTTCGCCGAGCCATTCCTGCACCAGATTCTTCCCGTCCAGCCTGGTCCCACCTTGGCTGTAGTCATCTGGGTACTCAGGGTCTGGGGTTCCCATGCGAAACATGTACTTTCGGCCTCCA (SEQ ID NO: 62).

[0217] In some embodiments, the AP gene fragment has the following sequence: CCCCGGGTGCGCGGCGTCGGTGGTGCCGGCGGGGGGCGCCAGGTCGCAGGCGGTGTAGGGCTCCAGGCAGGCGGCGAAGGCCATGACGTGCGCTATGAAGGTCTGCTCCTGCACGCCGTGAACCAGGTGCGCCTGCGGGCCGCGCGCGAACACCGCCACGTCCTCGCCTGCGTGGGTCTCTTCGTCCAGGGGCACTGCTGACTGCTGCCGATACTCGGGGCTCCCGCTCTCGCTCTCGGTAACATCCGGCCGGGCGCCGTCCTTGAGCACATAGCCTGGACCGTTTCCGTATAGGAGGACCGTGTAGGCCTTCCTGTCCCGGGCCTTGCCAGCGGCCAGCCCGATGAAGGAGCTCCCTCGCAGGGGGTAGCCTCCGAAGGAGAAGACGTGGGAGTGGTCGGCAGTGACGAGGCTCAGCGTGTCCTCCTCGCTGGTGA (SEQ ID NO: 63).

[0218] In some embodiments, the AP gene fragment has the following sequence. GCTGGCCCGCCCTCTCAATGGCGTCGTCGAACATGATCGTCTCAGTCAGTGCCCGGTAAGCCCTGCTTTCATGATGACCATGGTCGATGCGACCACCCTCCACGAAGAGGAAGAAGCCGCGGGGGTGTCTGCTCAGCAGGCGCAGGGCAGCCTCTGTCATCTCCATCAGGGAGGGGTCCAGTGTGGAGTCTCGGTGGATCTCGTATTTCATGTCTCCAGGCTCAAAGAGACCCATGAGATGGGTCACAGACGGGTCCAGGGAAGCCTGCATGAGCTCAGTGCGGTTCCACACGTACCGGGCACCCTGGCGTTCGCCGAGCCATTCCTGCACCAGATTCTTCCCGTCCAGCCTGGTCCCACCTTGGCTGTAGTCATCTGGGTACTCAGGGTCTGGGGTTCCCATGCGAAACATGTACTTTCGGCCTCCA (SEQ ID NO: 64).

[0219] In some embodiments, the AP gene fragment has the following sequence. CCCCGGGTGCGCGGCGTCGGTGGTGCCGGCGGGGCGCCAGGTCGCAGGCGGTGTAGGGCTCCAGGCAGGCGGCGAAGGCCATGACGTGCGCTATGAAGGTCTGCTCCTGCACGCCGTGAACCAGGTGCGCCTGCGGGCCGCGCGCG AACACCGCCACGTCCTCGCCTGCGTGGGTCTCTTCGTCCAGGGGCACTGCTGACTGCTGCCGATACTCGGGGCTCCCGCTCTCGCTCTCGGTAACATCCGGCCGGGCGCCGTCCTTGAGCACATAGCCTGGACCGTTTC (SEQ ID NO: 65).

[0220] In some embodiments, the AP gene fragment has the following sequence. CGTATAGGAGGACCGTGTAGGCCTTCCTGTCCCGGGCCTTGCCAGCGGCCAGCCCGATGAAGGAGCTCCCTCGCAGGGGGTAGCCTCCGAAGGAGAAGACGTGGGAGTGGTCGGCAGTGACGAGGCTCAGCGTGTCCTCCTCGCTGGTG AGCTGGCCCGCCCTCTCAATGGCGTCGTCGAACATGATCGTCTCAGTCAGTGCCCGGTAAGCCCTGCTTTCATGATGACCATGGTCGATGCGACCACCCTCCACGAAGAGGAAGAAGCCGCGGGGGTGTCTGCTCAGCAGG (SEQ ID NO: 66).

[0221] In some embodiments, the AP gene fragment has the following sequence. CGCAGGGCAGCCTCTGTCATCTCCATCAGGGAGGGGTCCAGTGTGGAGTCTCGGTGGATCTCGTATTTCATGTCTCCAGGCTCAAAGAGACCCATGAGATGGGTCACAGACGGGTCCAGGGAAGCCTGCATGAGCTCAGTGCGGTTCC ACACGTACCGGGCACCCTGGCGTTCGCCGAGCCATTCCTGCACCAGATTCTTCCCGTCCAGCCTGGTCCCACCTTGGCTGTAGTCATCTGGGTACTCAGGGTCTGGGGTTCCCATGCGAAACATGTACTTTCGCCTCCA (SEQ ID NO: 67).

[0222] An exemplary splice donor sequence for use in the methods and compositions described herein (e.g., trans-splicing and double-hybrid methods) is:GTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCTTGTCGAGACAGAGAAGACTCTTGCGTTTCT (SEQ ID NO: 20). An exemplary splice acceptor sequence for use in the methods and compositions described herein (e.g., trans-splicing and double-hybrid methods) is:GATAGGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACAG (SEQ ID NO: 21). The splice donor sequence GTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCTTGTCGAGACAGAGAAGACTCTTGCGTTTCTGA (SEQ ID NO: 68) and the splice acceptor sequence TAGGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACAG (SEQ ID NO: 69) can also be used in the methods and compositions described herein. Further examples of splice donor and splice acceptor sequences are known in the art.

[0223] The dual hybrid vectors for use in the methods and compositions described herein are designed so that approximately half of the OTOF gene is contained within each vector (for example, each vector contains a polynucleotide encoding approximately half of the OTOF protein). The decision on how to split the polynucleotide sequence between the two nucleic acid vectors is based on the size of the promoter and the position of the portion of the polynucleotide encoding the OTOF C2 domain. In a dual hybrid vector system, when using short promoters such as CAG, CMV, smCBA, or Myo15 promoters with sequences of 1kb or less (e.g., Myo15 promoters having any one of the above-mentioned Myo15 promoters, e.g., sequence numbers 38, 39, or 49-60) (e.g., promoters of 1kb or less, e.g., approximately 1kb, 950bp, 900bp, 850bp, 800bp, 750bp, 700bp, 650bp, 600bp, 550bp, 500bp, 450bp, 400bp, 350bp, 300bp, or less), the OTOF polynucleotide sequence is split between the two nucleic acid vectors at an exon boundary, e.g., the exon 26 / 27 boundary, occurring after the polynucleotide portion encoding the C2D domain and before the polynucleotide portion encoding the C2E domain. Nucleic acid vectors containing promoters of this size may optionally include OTOF UTRs (e.g., full-length 5' and 3' UTRs). In a dual hybrid vector system, when using a long promoter (e.g., a Myo15 promoter longer than 1kb, e.g., SEQ ID NO: 36), the OTOF polynucleotide sequence is split between the two nucleic acid vectors at an exon boundary occurring either after the polynucleotide portion encoding the C2C domain and before the polynucleotide portion encoding the C2D domain, e.g., at the exon 19 / 20 boundary, exon 20 / 21 boundary, or exon 21 / 22 boundary, or within the polynucleotide portion encoding the C2D domain, e.g., at the exon 25 / 26 boundary.Short promoters (e.g., CMV promoter, CAG promoter, smCBA promoter, or Myo15 promoter with a sequence of 1kb or less, e.g., Myo15 promoter with any one of sequence numbers 38, 39, or 49-60) can also be used in dual-vector systems designed for large promoters. In this case, additional elements (e.g., OTOF UTR sequences) can be included in the first vector (e.g., a vector containing a portion of a polynucleotide encoding the C2C domain).

[0224] One exemplary dual hybrid vector system using a short promoter comprises: a first nucleic acid vector comprising: a CAG promoter operably bound to exons 1-26 of a polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO: 1 or SEQ ID NO: 5, or mouse OTOF, e.g., SEQ ID NO: 6), a 3' splice donor sequence of the polynucleotide sequence, and a recombination induction region of the 3' splice donor sequence; and a second nucleic acid vector comprising: a recombination induction region, a 3' splice acceptor sequence of the recombination induction region, a 3' polynucleotide of the splice acceptor sequence containing the remaining exons of the polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO: 1 or SEQ ID NO: 5, or mouse OTOF, e.g., SEQ ID NO: 6) (e.g., exons 27-48 of mouse OTOF, or exons 27-45 and 47 of human OTOF, or exons 27-46), and a poly(A) sequence (e.g., bGH poly(A) signal sequence). The first and second nucleic acid vectors may also contain full-length 5' and 3' OTOF UTRs, respectively (for example, a 127 bp human OTOF 5' UTR may be included in the first nucleic acid vector, and a 1035 bp human OTOF 3' UTR may be included in the second nucleic acid vector).Another exemplary dual hybrid vector system using a short promoter comprises: a first nucleic acid vector comprising: a CAG promoter operably bound to exons 1-28 of a polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO: 1 or SEQ ID NO: 5, or mouse OTOF, e.g., SEQ ID NO: 6), a 3' splice donor sequence of the polynucleotide sequence, and a recombination induction region of the 3' splice donor sequence; and a second nucleic acid vector comprising: a recombination induction region, a 3' splice acceptor sequence of the recombination induction region, a 3' polynucleotide of the splice acceptor sequence containing the remaining exons of the polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO: 1 or SEQ ID NO: 5, or mouse OTOF, e.g., SEQ ID NO: 6) (e.g., exons 29-48 of mouse OTOF, or exons 29-45 and 47 of human OTOF, or exons 29-46), and a poly(A) sequence (e.g., bGH poly(A) signal sequence). The first and second nucleic acid vectors may also contain full-length 5' and 3' OTOF UTRs, respectively (for example, a 134 bp mouse OTOF 5' UTR may be included in the first nucleic acid vector, and a 1001 bp mouse OTOF 3' UTR may be included in the second nucleic acid vector). A CMV promoter, an smCBA promoter, or a Myo15 promoter having a sequence of 1 kb or less (for example, the Myo15 promoters described herein, e.g., a Myo15 promoter having the sequence described in any one of SEQ ID NOs. 38, 39, or 49-60) may be used in place of either CAG promoter in the dual vector system described above.

[0225] One exemplary dual hybrid vector system using a long promoter comprises a first nucleic acid vector comprising a Myo15 promoter of 1 kb or longer (e.g., SEQ ID NO: 36) operably bound to exons 1-19 of a polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO: 1 or SEQ ID NO: 5, or mouse OTOF, e.g., SEQ ID NO: 6), a splice donor sequence at 3' of the polynucleotide sequence, and a recombination induction region at 3' of the splice donor sequence, and a recombination induction region, recombination induction The vector comprises a 3' splice acceptor sequence of the leading region, a 3' polynucleotide of the splice acceptor sequence containing the remaining exons of a polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO: 1 or SEQ ID NO: 5, or mouse OTOF, e.g., SEQ ID NO: 6) (e.g., exons 20-48 of mouse OTOF and exons 20-45 and 47, or 20-46 of human OTOF), and a second nucleic acid vector containing a poly(A) sequence (e.g., bGH poly(A) signal sequence). Another exemplary dual hybrid vector system using a long promoter comprises a first nucleic acid vector containing a Myo15 promoter of 1 kb or longer (e.g., SEQ ID NO: 36) operably bound to exons 1-20 of the polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO: 1 or SEQ ID NO: 5, or mouse OTOF, e.g., SEQ ID NO: 6), a splice donor sequence at 3' of the polynucleotide sequence, and a recombination induction region at 3' of the splice donor sequence, and a recombination induction region, recombination induction The vector comprises a 3' splice acceptor sequence of the region, a 3' polynucleotide of the splice acceptor sequence containing the remaining exons of a polynucleotide encoding an OTOF protein (e.g., mouse OTOF, e.g., SEQ ID NO: 6, or human OTOF, e.g., SEQ ID NO: 1 or SEQ ID NO: 5) (e.g., exons 21-48 of mouse OTOF and exons 21-45 and 47, or 21-46 of human OTOF), and a second nucleic acid vector containing a poly(A) sequence (e.g., bGH poly(A) signal sequence).In the Myo15 promoter dual hybrid vector system described above, neither the first nor the second nucleic acid vector contains an OTOF UTR. Short promoters (e.g., CMV promoter, smCBA promoter, CAG promoter, or Myo15 promoters with sequences of 1kb or less (e.g., Myo15 promoters with sequences described in SEQ ID NOs. 38, 39, or any one of 49-60)) can also be used in the dual vector system described above, which was designed for large promoters. If these dual vector systems contain short promoters, they may also contain additional elements (e.g., a 5'OTOF UTR) in the first vector.

[0226] To accommodate OTOF UTR, the OTOF coding sequence can be split to a different position. For example, in a dual hybrid vector system, the first nucleic acid vector contains a Myo15 promoter (SEQ ID NO: 36) of more than 1kb that operably binds to exons 1-25 of the polynucleotide encoding the OTOF protein (e.g., human OTOF, e.g., SEQ ID NO: 1 or SEQ ID NO: 5, or mouse OTOF, e.g., SEQ ID NO: 6), a splice donor sequence at 3' of the polynucleotide sequence, and a recombination induction region at 3' of the splice donor sequence. A second nucleic acid vector comprising a scepter sequence, a 3' polynucleotide of a splice acceptor sequence containing the remaining exons of a polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO: 1 or SEQ ID NO: 5, or mouse OTOF, e.g., SEQ ID NO: 6) (e.g., exons 26-48 of mouse OTOF and exons 26-45 and 47, or 26-46 of human OTOF), and a poly(A) sequence (e.g., bGH poly(A) signal sequence), wherein the second nucleic acid may also contain a full-length OTOF 3'UTR (e.g., a 1035 bp human OTOF UTR). In mouse OTOF, the dual hybrid vector system may include a 3'UTR if the first nucleic acid vector is a Myo15 promoter (e.g., SEQ ID NO: 36) longer than 1 kb operably bound to exons 1-24 of the polynucleotide encoding the OTOF protein (e.g., mouse OTOF, e.g., SEQ ID NO: 6), and includes the 3' of the splice donor sequence of the polynucleotide sequence and the 3' of the recombination induction region of the splice donor sequence; and the second nucleic acid vector includes the 3' of the splice acceptor sequence of exons 25-48 of the polynucleotide encoding the OTOF protein (e.g., mouse OTOF, e.g., SEQ ID NO: 6), and a poly(A) sequence (e.g., bGH poly(A) signal sequence).In this dual hybrid vector system, the second nucleic acid vector may also contain a full-length OTOF 3'UTR (e.g., a 1001bp mouse OTOF UTR). Short promoters (e.g., CMV promoter, smCBA promoter, or Myo15 promoter with a sequence of 1kb or less, e.g., a Myo15 promoter with the sequence described in SEQ ID NOs. 38, 39, or 49-60) can also be used in the dual vector systems described above designed for large promoters. If these dual vector systems contain a short promoter, the first vector may also contain additional elements (e.g., a 3'OTOF UTR).

[0227] The dual hybrid vectors used in the methods and compositions described herein may optionally include degradation signal sequences in both the first and second nucleic acid vectors. The degradation signal sequences may be included to prevent or reduce the expression of the OTOF protein portion derived from polynucleotides that do not recombine and / or splice. The degradation signal sequence is located at 3' of the recombinant region in the first nucleic acid vector and between the recombinant region and the splicing acceptor in the second nucleic acid vector. The degradation signal sequence that can be used in the compositions and methods described herein has the sequence GCCTGCAAGAACTGGTTCAGCAGCCTGAGCCACTTCGTGATCCACCTG (SEQ ID NO: 22).

[0228] Exemplary pairs of duplicate, trans-spliced, and dual hybrid vectors are shown in Table 4 below.

[0229] [Table 4-1]

[0230] [Table 4-2]

[0231] [Table 4-3]

[0232] In some embodiments, the polynucleotide sequence encoding the OTOF protein may be a cDNA sequence (e.g., a sequence without introns). In some embodiments, the first and / or second nucleic acid vectors of a dual-vector system may contain intron sequences. The intron sequences may be contained between one or more exons of the OTOF coding sequence, or between an exon of the coding sequence and another component of the nucleic acid vector (e.g., between an exon of the OTOF coding sequence and a splice donor sequence in the first nucleic acid vector, or between an exon of the OTOF coding sequence and a splice acceptor sequence in the second nucleic acid vector).

[0233] In some embodiments, the polynucleotide encoding the OTOF protein is split at the exon 20 / 21 boundary between a first nucleic acid vector and a second nucleic acid vector (e.g., an AAV vector) in a dual-vector system. When the polynucleotide encoding the OTOF protein encodes OTOF isoform 5 and is split at the exon 20 / 21 boundary between a first nucleic acid vector and a second nucleic acid vector (e.g., an AAV vector), the polynucleotide sequence encoding the N-terminal portion of OTOF has the following sequence:

[0234]

[0235] The sequences described above correspond to exons 1-20 of OTOF isoform 1. In an embodiment where the polynucleotide encoding the OTOF protein encodes OTOF isoform 5 and is split between the first and second nucleic acid vectors (e.g., an AAV vector) at the exon 20 / 21 boundary, the polynucleotide encoding the C-terminal portion of OTOF has the following sequence:

[0236] In an embodiment in which the polynucleotide encodes OTOF isoform 5 and is split between a first and second nucleic acid vector (e.g., an AAV vector) at the exon 20 / 21 boundary, the C-terminal portion of the OTOF polypeptide has the following sequence: (Sequence ID 73).

[0237] The sequence described above corresponds to the N-terminal region of the OTOF isoform 1 protein encoded by exons 1-20. In an embodiment in which the polynucleotide encodes OTOF isoform 5 and is split between a first and second nucleic acid vector (e.g., an AAV vector) at the exon 20 / 21 boundary, the C-terminal portion of the OTOF polypeptide has the following sequence:

[0238] Table 5 provides transfer plasmids that can be used to produce nucleic acid vectors for use in the compositions and methods described herein. These transfer plasmids are designed for the expression of OTOF isoform 5. The transfer plasmid (e.g., a plasmid containing a DNA sequence, delivered by a nucleic acid vector, e.g., AAV) is co-delivered into producer cells together with a helper plasmid (e.g., a plasmid providing the proteins necessary for AAV production) and a rep / cap plasmid (e.g., a plasmid providing the AAV capsid protein and a protein inserting the transfer plasmid DNA sequence into the capsid shell) to generate a nucleic acid vector for administration. Nucleic acid vectors containing polynucleotides encoding the N-terminal portion of OTOF (e.g., nucleic acid vectors) and nucleic acid vectors containing polynucleotides encoding the C-terminal portion of OTOF can be combined before administration (e.g., into a single formulation). The following transfer plasmids—SEQ ID NOs. 75 and 76; SEQ ID NOs. 77 and 78; SEQ ID NOs. 79 and 76; SEQ ID NOs. 80 and 78; SEQ ID NOs. 81 and 82; and SEQ ID NOs. 83 and 82—are designed to produce nucleic acid vectors (e.g., AAV vectors) for simultaneous formulation or administration (e.g., simultaneous or sequential administration) in a dual hybrid vector system.

[0239] [Table 5-1]

[0240] [Table 5-2]

[0241] [Table 5-3]

[0242] Table 5-4

[0243] Table 5-5

[0244] Table 5-6

[0245] Table 5-7

[0246] Table 5-8

[0247] Table 5-9

[0248] Table 5-10

[0249] Table 5-11

[0250] Table 5-12

[0251] Table 5-13

[0252] Table 5-14

[0253] Table 5-15

[0254] Table 5-16

[0255] Table 5-17

[0256] Table 5-18

[0257] Table 5-19

[0258] Table 5-20

[0259] Table 5-21

[0260] Table 5-22

[0261] Table 5-23

[0262] Table 5-24

[0263] Table 5-25

[0264] Table 5-26

[0265] Table 5-27

[0266] Table 5-28

[0267] Table 5-29

[0268] Table 5-30

[0269] Table 5-31

[0270] Table 5-32

[0271] Table 5-33

[0272] Table 5-34

[0273] Table 5-35

[0274] Table 5-36

[0275] Table 5-37

[0276] Table 5-38

[0277] Table 5-39

[0278] Table 5-40

[0279] Table 5-41

[0280] Table 5-42

[0281] Table 5-43

[0282] Table 5-44

[0283] [Table 5-45]

[0284] [Table 5-46]

[0285] [Table 5-47]

[0286] [Table 5-48]

[0287] [Table 5-49]

[0288] [Table 5-50]

[0289] [Table 5-51]

[0290] [Table 5-52]

[0291] [Table 5-53]

[0292] Vector for OTOF expression In addition to achieving rapid transcription and translation, stable expression of exogenous genes in mammalian cells can be achieved by incorporating the polynucleotide containing the gene into the nuclear genome of the mammalian cell. Various vectors have been developed for delivering and incorporating polynucleotides encoding exogenous proteins into the nuclear DNA of mammalian cells. An example of an expression vector is disclosed, for example, in WO1994 / 011026, which is incorporated herein by reference. Expression vectors for use in the compositions and methods described herein include a polynucleotide sequence encoding a portion of OTOF, as well as additional sequence elements used, for example, for the expression of these drugs and / or for the incorporation of these polynucleotide sequences into the genome of a mammalian cell. Specific vectors that can be used for OTOF expression include plasmids containing regulatory sequences such as promoter and enhancer regions that direct gene transcription. Other vectors useful for OTOF expression include polynucleotide sequences that increase the translation rate of these genes or improve the stability or nuclear export of mRNA resulting from gene transcription. These sequence elements include, for example, 5' and 3' untranslated regions and polyadenylation signaling sites to direct the efficient transcription of the gene incorporated on the expression vector. Expression vectors suitable for use in the compositions and methods described herein may also include polynucleotides encoding markers for selecting cells containing such vectors. Examples of suitable markers include genes encoding resistance to antibiotics such as ampicillin, chloramphenicol, kanamycin, or noseoslysin.

[0293] AAV vectors for nucleic acid delivery In some embodiments, the nucleic acids of the compositions and methods described herein are incorporated into recombinant AAV (rAAV) vectors and / or viral particles to facilitate their introduction into cells. A useful rAAV vector in the compositions and methods described herein is a recombinant nucleic acid construct comprising (1) a heterologous sequence to be expressed (e.g., a polynucleotide encoding the N-terminal or C-terminal portion of the OTOF protein) and (2) a viral sequence that promotes the stability and expression of the heterologous gene. The viral sequence may include the AAV sequence required in cis for DNA replication and packaging into viral particles (e.g., an activatable ITR). Such an rAAV vector may also include a marker or reporter gene. In a useful rAAV vector, one or more AAV WT genes, in whole or in part, are deleted, but an activatable adjacent ITR sequence is retained. The AAV ITR can be any serotype suitable for a particular application. For use in the methods and compositions described herein, the ITR may be an AAV2 ITR. Methods of using rAAV vectors are described, for example, in Tal et al., J. Biomed. Sci. 7:279 (2000) and Monahan and Samulski, Gene Delivery 7:24 (2000), and each of these disclosures is incorporated herein by reference as they pertain to AAV vectors for gene delivery.

[0294] The nucleic acids and vectors described herein can be incorporated into rAAV virus particles to facilitate the introduction of nucleic acids or vectors into cells. The AAV capsid protein constitutes the non-nucleic acid portion outside the virus particle and is encoded by the AAV cap gene. The cap gene encodes three viral coat proteins VP1, VP2, and VP3, which are necessary for the assembly of the virus particle. Construction of rAAV virus particles is described, for example, in US5,173,414, US5,139,941, US5,863,541, US5,869,305, US6,057,152, and US6,376,237, as well as in Rabinowitz et al., J.Virol.76:791 (2002) and Bowles et al., J.Virol.77:423 (2003), each of which disclosures are incorporated herein by reference as they belong to AAV vectors for gene delivery.

[0295] Examples of rAAV virus particles useful in combination with the compositions and methods described herein include those derived from various AAV serotypes, including nucleic acid, AAV2, AAV2quad(YF), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, nucleic acid 0, nucleic acid 1, rh10, rh39, rh43, rh74, Anc80, Anc80L65, DJ / 8, DJ / 9, 7m8, PHP.B, PHP.eb, and PHP.S. When targeting cochlear hair cells, nucleic acid, AAV2, AAV6, AAV9, Anc80, Anc80L65, DJ / 9, 7m8, and PHP.B may be particularly useful. Serotypes evolved for retinal transduction may also be used in the methods and compositions described herein. The first and second nucleic acid vectors of the compositions and methods described herein may have the same or different serotypes. The construction and use of AAV vectors and AAV proteins of different serotypes are described, for example, in Chao et al., Mol.Ther.2:619(2000); Davidson et al., Proc.Natl.Acad.Sci.USA 97:3428 (2000); Xiao et al., J.Virol.72:2224(1998); Halbert et al., J.Virol.74:1524(2000); Halbert et al., J.Virol.75:6615(2001); and Auricchio et al., Hum.Molec.Genet.10:3075(2001), and each of these disclosures is incorporated herein by reference as they pertain to AAV vectors for gene delivery.

[0296] Pseudotyped rAAV vectors are useful in combination with the compositions and methods described herein. Pseudotyped vectors include AAV vectors of a given serotype (e.g., AAV9) that have been pseudotyped with a capsid gene derived from a serotype other than the given serotype (e.g., nucleic acids, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, etc.). Techniques including the construction and use of pseudotyped rAAV virus particles are known in the art and are described, for example, in Duan et al., J. Virol. 75:7662 (2001); Halbert et al., J. Virol. 74:1524 (2000); Zolotukhin et al., Methods, 28:158 (2002); and Auricchio et al., Hum. Molec. Genet. 10:3075 (2001).

[0297] AAV virus particles with mutations within the capsid of the virus particle can be used to more effectively infect specific cell types than non-mutated capsid virus particles. For example, a suitable AAV variant may have ligand insertion mutations to facilitate AAV targeting of specific cell types. The construction and characterization of AAV capsid variants, including insertion variants, alanine screening variants, and epitope tag variants, are described in Wu et al., J. Virol. 74:8635 (2000). Other rAAV virus particles that can be used in the methods described herein include capsid hybrids produced by molecular breeding of viruses and by exon shuffling. See, for example, Soong et al., Nat. Genet., 25:436 (2000) and Kolman and Stemmer, Nat. Biotechnol. 19:423 (2001).

[0298] In some embodiments, the use of an AAV vector to deliver the operable OTOF protein requires the use of a dual vector system, where the first member of the dual vector system encodes the N-terminal portion of the OTOF protein and the second member encodes the C-terminal portion of the OTOF protein. As a result, when the dual vector system is administered to cells, the polynucleotide sequences contained within the two vectors can combine to form a single sequence, resulting in the production of a full-length OTOF protein. In some embodiments, the protein is the OTOF isoform 5 protein. In some embodiments, the protein is the OTOF isoform 1 protein.

[0299] In some embodiments, the first member of the dual vector system also includes, in 5' to 3' order, a first inverted terminal repeat ("ITR"), a promoter (e.g., Myo15 promoter), a Kozak sequence, the N-terminal portion of the OTOF coding sequence, a splice donor sequence, an AP gene fragment (e.g., AP prefix sequence), and a second ITR, while the second member of the dual vector system includes, in 5' to 3' order, the first ITR, an AP gene fragment (e.g., AP prefix sequence), a splice acceptor sequence, the C-terminal portion of the OTOF coding sequence, a poly-A sequence, and a second ITR. In some embodiments, the N-terminal portion of the OTOF coding sequence and the C-terminal portion of the OTOF coding sequence do not overlap and bind intracellularly (e.g., by recombination at the overlapping region (AP gene fragment) or by concatemerization of the ITR) to generate a full-length OTOF amino sequence (e.g., OTOF isoform 1, the sequence described in SEQ ID NO: 1, or OTOF isoform 5, the sequence described in SEQ ID NO: 5). In certain embodiments, the N-terminal portion of the OTOF coding sequence encodes amino acids 1-802 of OTOF (for example, amino acids 1-802 of SEQ ID NO: 1 or SEQ ID NO: 5, corresponding to SEQ ID NO: 73), and the C-terminal portion of the OTOF coding sequence encodes the C-terminal portion of the OTOF coding sequence that encodes amino acids 803-1997 of OTOF (for example, amino acids 803-1997 of SEQ ID NO: 1, or amino acids 803-1997 of SEQ ID NO: 5, corresponding to SEQ ID NO: 74).

[0300] In some embodiments, the first member of the dual vector system comprises the Myo15 promoter of SEQ ID NO: 38 (also represented by nucleotides 235-1199 of SEQ ID NO: 81), operably bound to the nucleotide encoding the N-terminal 802 amino acids of the OTOF isoform 5 protein (amino acids 1-802 of SEQ ID NO: 5), which is encoded by exons 1-20 of the native polynucleotide sequence encoding that protein. In certain embodiments, the nucleotide sequence encoding the N-terminal amino acids of the OTOF isoform 5 protein is nucleotides 1222-3627 of SEQ ID NO: 81. In some embodiments, the nucleotide sequence encoding the N-terminal amino acids of the OTOF isoform 5 N protein is any nucleotide sequence encoding amino acids 1-802 of SEQ ID NO: 5, due to genetic code redundancy. The nucleotide sequence encoding the OTOF isoform 5 protein can be partially or completely codon-optimized for expression. In some embodiments, the first member of the dual vector system comprises the Kozak sequence corresponding to nucleotides 1216-1225 of SEQ ID NO: 81. In some embodiments, the first member of the dual vector system contains a splice donor sequence corresponding to nucleotides 3628-3711 of SEQ ID NO: 81. In some embodiments, the first member of the dual vector system contains an AP prefix sequence corresponding to nucleotides 3718-4004 of SEQ ID NO: 81. In certain embodiments, the first member of the dual vector system contains nucleotides 235-4004 of SEQ ID NO: 81, adjacent to the 5' and 3' ends, respectively, by an inverted terminal repeat. In some embodiments, the adjacent inverted terminal repeat is any variant of the AAV2 inverted terminal repeat that can be capsid-formed by a plasmid containing the AAV2 Rep gene. In certain embodiments, the 5' adjacent inverted terminal repeat has a sequence corresponding to nucleotides 12-141 of SEQ ID NO: 81, or a sequence having at least 80% sequence identity thereto (at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity); and.The 3' adjacent inverted terminal repeat has a sequence corresponding to nucleotides 4098–4227 of SEQ ID NO: 81, or a sequence having at least 80% sequence identity to it (at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity). For any given pair of inverted terminal repeat sequences in a transfer plasmid used to create a viral vector (typically by introducing that plasmid into cells along with other plasmids containing the AAV gene necessary for viral vector formation) (e.g., any of SEQ ID NOs: 75, 77, 79, 80, 81, or 83), it will be understood by those skilled in the art that, during recombination, the ITR may take a "flip" or "flop" direction, so the corresponding sequence in the viral vector may change. Therefore, the sequence of the ITR in the transfer plasmid is not necessarily the same as the sequence found in the viral vector prepared therefrom. However, in some very specific embodiments, the first member of the dual vector system contains nucleotides 12-4227 of SEQ ID NO: 81.

[0301] In some embodiments, the second member of the dual vector system contains nucleotides encoding the C-terminal 1195 amino acids (amino acids 803-1997 of SEQ ID NO: 5) of the OTOF isoform 5 protein, followed immediately by a stop codon. In certain embodiments, the nucleotide sequence encoding the C-terminal amino acids of the OTOF isoform 5 protein is nucleotides 587-4174 of SEQ ID NO: 82. In some embodiments, the nucleotide sequence encoding the C-terminal amino acids of the OTOF isoform 5 protein is any nucleotide sequence encoding amino acids 803-1997 of SEQ ID NO: 5, due to genetic code redundancy. The nucleotide sequence encoding the OTOF isoform 5 protein can be partially or completely codon-optimized for expression. In some embodiments, the second member of the dual vector system contains splice acceptor sequences corresponding to nucleotides 538-586 of SEQ ID NO: 82. In some embodiments, the second member of the dual vector system contains AP prefix sequences corresponding to nucleotides 229-515 of SEQ ID NO: 82. In some embodiments, the second member of the dual vector system contains a poly(A) sequence corresponding to nucleotides 4217–4438 of SEQ ID NO: 82. In certain embodiments, the second member of the dual vector system contains nucleotides 229–4438 of SEQ ID NO: 82, adjacent to the 5' and 3' ends, respectively, by an inverted terminal repeat. In some embodiments, the adjacent inverted terminal repeat is any variant of the AAV2 inverted terminal repeat that can be capsid-formed by a plasmid containing the AAV2 Rep gene.In certain embodiments, the 5' adjacent inverted terminal repeat has a sequence corresponding to nucleotides 12-141 of SEQ ID NO: 82, or a sequence having at least 80% sequence identity thereto (at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity). The 3' adjacent inverted terminal repeat has a sequence corresponding to nucleotides 4526-4655 of SEQ ID NO: 82, or a sequence having at least 80% sequence identity thereto (at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity). For any given pair of inverted terminal repeat sequences in a transfer plasmid used to create a viral vector (usually by introducing that plasmid into cells together with other plasmids containing the AAV gene necessary for viral vector formation) (e.g., any of SEQ ID NOs: 76, 78, or 82), it will be understood that the corresponding sequence in the viral vector may change because the ITR takes a "flip" or "flop" direction during recombination. Therefore, the sequence of the ITR in the transfer plasmid is not necessarily the same as the sequence found in the viral vector prepared therefrom. However, in some very specific embodiments, the first member of the dual vector system contains nucleotides 12-4655 of SEQ ID NO: 82.

[0302] In some embodiments, the dual-vector system is the AAV1 dual-vector system. In some embodiments, the dual-vector system is the AAV9 dual-vector system. Pharmaceutical composition Nucleic acid vectors described herein (e.g., AAV vectors) may be incorporated into vehicles for administration to patients, such as human patients suffering from biallelic OTOF mutations, as described herein. Pharmaceutical compositions comprising vectors, such as viral vectors, containing polynucleotides encoding a portion of the OTOF protein, can be prepared using methods known in the art. For example, such compositions may be prepared in desired forms, such as lyophilized formulations or aqueous solutions, using, for example, physiologically acceptable carriers, excipients, or stabilizers (remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980); incorporated herein by reference).

[0303] Mixtures of nucleic acid vectors (e.g., AAV vectors) described herein can be prepared in water appropriately mixed with one or more excipients, carriers, or diluents. Dispersions can also be prepared in glycerol, liquid polyethylene glycol, and mixtures thereof, and in oil. These formulations may contain preservatives to inhibit microbial growth under normal storage and use conditions. Under normal storage and use conditions, these preparations may contain antiseptics to prevent microbial growth. Suitable pharmaceutical forms for injection include sterile aqueous solutions or dispersions and sterile powders for immediate preparation of injectable sterile solutions or dispersions (described in US 5,466,468, the disclosure of which is incorporated herein by reference). In any case, formulations may be sterile and may have sufficient fluidity for easy injection. Formulations may be stable under manufacturing and storage conditions and may be protected from contamination by microorganisms such as bacteria and fungi. The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), suitable mixtures thereof, and / or vegetable oils. Appropriate fluidity can be maintained, for example, by the use of a coating agent such as lecithin, by maintaining the required particle size in the case of a dispersion, and by the use of a surfactant. Inhibition of microbial activity can be achieved by various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid, and thimerosal. In many cases, it is preferable to include an isotonic agent, such as sugar or sodium chloride. Extension of absorption of the injectable composition can be achieved by using absorption-delaying agents in the composition, such as aluminum monostearate and gelatin.

[0304] For example, solutions containing the pharmaceutical compositions described herein may be appropriately buffered as needed, and the liquid diluent may first be isotonicized with sufficient saline or glucose. These particular aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous, and intraperitoneal administration. In this regard, sterile aqueous media that can be employed are known to those skilled in the art in light of this disclosure. For example, one dose may be dissolved in 1 ml of isotonic NaCl solution and added to 1000 ml of subcutaneous injection solution, or injected into the intended injection site. Depending on the condition of the target being treated, some variation in dose is inevitable. For local administration to the inner ear, the composition may be formulated to contain a synthetic perilymphatic solution. An example of a synthetic perilymphatic solution contains 20–200 mM NaCl, 1–5 mM KCl, 0.1–10 mM CaCl2, 1–10 mM glucose, and 2–50 mM HEPES, with a pH between approximately 6 and 9 and an osmolality of approximately 300 mOsm / kg. In any case, the person administering the drug will determine the appropriate dose for each individual. Furthermore, for administration to humans, the formulation may meet the sterility, pyrogenicity, general safety, and purity standards required by the FDA Office of Biologics.

[0305] Treatment method The compositions described herein may be administered to subjects with biallelic OTOF mutations by various routes, such as local administration to the inner ear (e.g., administration to the perilymph or endolymph, e.g., the oval window, round window, or horizontal semicircular canal, e.g., administration to the cochlear hair cells), intravenous, parenteral, intradermal, intramuscular, intranasal, subcutaneous, percutaneous, intratracheal, intraperitoneal, intra-arterial, intravascular, inhalation, perfusion, lavage, and oral administration. The most appropriate route of administration in a given case depends on the specific composition to be administered, the patient, the pharmaceutical formulation method, the method of administration (e.g., time of administration and route of administration), the patient's age, weight, sex, the severity of the disease being treated, the patient's diet, and the patient's excretion rate. The compositions may be administered once or more times (e.g., once a year, twice a year, three times a year, every other month, monthly, or every other week). In some embodiments, the first nucleic acid vector and the second nucleic acid vector are administered simultaneously (e.g., in a single composition). In some embodiments, the first nucleic acid vector and the second nucleic acid vector are administered sequentially (e.g., the second nucleic acid vector is administered immediately after the first nucleic acid vector, or 5 minutes, 10 minutes, 15 minutes, 20 minutes, 25 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 8 hours, 12 hours, 1 day, 2 days, 7 days, 2 weeks, 1 month, or longer after the first nucleic acid vector). The first nucleic acid vector and the second nucleic acid vector may have the same serotype or different serotypes (e.g., AAV serotype).

[0306] The subjects who may be treated as described herein are those aged 25 years or older (for example, 25-50 years, 25-45 years, 25-40 years, 25-35 years, 25-30 years, 30-50 years, 30-45 years, 30-40 years, 30-35 years, 35-50 years, 35-45 years, 35-40 years, 40-50 years, 40-45 years, or 45-50 years, for example, 25 years, 26 years, 2 The subjects are those who have, or are at risk of developing, sensorineural hearing loss or auditory nerve damage caused by a bialleletic OTOF mutation at the age of 7, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 years. Furthermore, if a subject has a bialleletic OTOF mutation and is identified as having detectable indicators of outer hair cell integrity (presence of otoacoustic emissions and / or cochlear microphone potentials) and / or inner hair cell integrity (presence of collection potentials) (for example, if identified prior to treatment as having detectable otoacoustic emissions, cochlear microphone potentials, and / or collection potentials), the subject may be treated as described herein. Therefore, the methods described herein may include a step of evaluating the integrity of outer and inner hair cells before treating the subject. The compositions and methods described herein can be used to treat subjects with OTOF mutations (e.g., mutations that reduce the function or expression of OTOF, or OTOF mutations associated with sensorineural hearing loss or auditory neuropathy), subjects with a family history of autosomal recessive sensorineural hearing loss or auditory neuropathy (e.g., a family history of OTOF-associated hearing loss), or subjects whose OTOF mutation status and / or OTOF activity level is unknown. The methods described herein may include a step of screening the subject for OTOF mutations before treatment or administration with the compositions described herein. Subjects can be screened for OTOF mutations using standard methods known to those skilled in the art (e.g., genetic testing). The methods described herein may also include a step of evaluating the subject's hearing before administration or treatment with the compositions described herein.Hearing can be evaluated using standard tests such as audiometry, ABR, electrocochleography (ECOG), and otoacoustic emissions. Also, the compositions and methods described herein can be administered as prophylactic treatment to patients at risk of developing deafness or auditory neuropathy, such as patients with a family history of hereditary deafness, or patients with OTOF mutations who still do not show deafness or auditory impairment.

[0307] Treatment can include administration of a composition containing a nucleic acid vector (e.g., an AAV viral vector) as described herein in various unit doses. Each unit dose typically contains a predetermined amount of the therapeutic composition. The amount to be administered, as well as the specific route of administration and formulation, are within the skill of those in the clinical arts. The unit dose need not be administered as a single injection, but can include continuous infusion over a set period. Administration may be carried out using a syringe pump to control the infusion rate in order to minimize damage to the cochlea. When the nucleic acid vector is an AAV vector (e.g., AAV1, AAV2, AAV2quad(Y-F), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, rh10, rh39, rh43, rh74, Anc80, Anc80L65, DJ / 8, DJ / 9, 7m8, PHP.B, PHP.eb, or PHP.S vector), the AAV vector is, for example, about 1×10 9 vector genomes (VG) / mL to 1×10 16 VG / mL (e.g., 1×10 9 VG / mL, 2×10 9 VG / mL, 3×10 9 VG / mL, 4×10 9 VG / mL, 5×10 9 VG / mL, 6×10 9 VG / mL, 7×10 9 VG / mL, 8×10 9 VG / mL, 9×10 9 VG / mL, 1×10 10 VG / mL, 2×10 10 VG / mL, 3×10 10 VG / mL, 4×10 10 VG / mL, 5×1010 VG / mL、6×10 10 VG / mL、7×10 10 VG / mL、8×10 10 VG / mL、9×10 10 VG / mL、1×10 11 VG / mL、2×10 11 VG / mL、3×10 11 VG / mL、4×10 11 VG / mL、5×10 11 VG / mL、6×10 11 VG / mL、7×10 11 VG / mL、8×10 11 VG / mL、9×10 11 VG / mL、1×10 12 VG / mL、2×10 12 VG / mL、3×10 12 VG / mL、4×10 12 VG / mL、5×10 12 VG / mL、6×10 12 VG / mL、7×10 12 VG / mL、8×10 12 VG / mL、9×10 12 VG / mL、1×10 13 VG / mL、2×10 13 VG / mL、3×10 13 VG / mL、4×10 13 VG / mL、5×10 13 VG / mL、6×10 13 VG / mL、7×10 13 VG / mL、8×10 13 VG / mL、9×10 13 VG / mL、1×10 14 VG / mL、2×10 14 VG / mL、3×10 14 VG / mL、4×10 14 VG / mL、5×10 14 VG / mL、6×10 14 VG / mL、7×10 14 VG / mL、8×10 14 VG / mL、9×10 14 VG / mL、1×10 15 VG / mL、2×10 15 VG / mL、3×10 15VG / mL, 4 x 10 15 VG / mL, 5 x 10 15 VG / mL, 6 x 10 15 VG / mL, 7×10 15 VG / mL, 8 x 10 15 VG / mL, 9×10 15 VG / mL, or 1 × 10 16 The titer (VG / mL) can be present in quantities from 1 μL to 200 μL (e.g., 1, 2, 3, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 μL). The AAV vector has a titer of approximately 1 × 10⁶. 7 VG / ear ~ approx. 2 x 10 15 VG / ear (for example, 1 x 10) 7 VG / ear, 2×10 7 VG / ear, 3×10 7 VG / ear, 4×10 7 VG / ear, 5×10 7 VG / ear, 6×10 7 VG / ear, 7×10 7 VG / ear, 8×10 7 VG / ear, 9×10 7 VG / ear, 1×10 8 VG / ear, 2×10 8 VG / ear, 3×10 8 VG / ear, 4×10 8 VG / ear, 5×10 8 VG / ear, 6×10 8 VG / ear, 7×10 8 VG / ear, 8×10 8 VG / ear, 9×10 8 VG / ear, 1×10 9 VG / ear, 2×10 9 VG / ear, 3×10 9 VG / ear, 4×10 9 VG / ear, 5×10 9 VG / ear, 6×10 9 VG / ear, 7×10 9 VG / ear, 8×10 9 VG / ear, 9×10 9 VG / ear, 1×10 10 VG / ear, 2×1010 VG / ear, 3×10 10 VG / ear, 4×10 10 VG / ear, 5×10 10 VG / ear, 6×10 10 VG / ear, 7×10 10 VG / ear, 8×10 10 VG / ear, 9×10 10 VG / ear, 1×10 11 VG / ear, 2×10 11 VG / ear, 3×10 11 VG / ear, 4×10 11 VG / ear, 5×10 11 VG / ear, 6×10 11 VG / ear, 7×10 11 VG / ear, 8×10 11 VG / ear, 9×10 11 VG / ear, 1×10 12 VG / ear, 2×10 12 VG / ear, 3×10 12 VG / ear, 4×10 12 VG / ear, 5×10 12 VG / ear, 6×10 12 VG / ear, 7×10 12 VG / ear, 8×10 12 VG / ear, 9×10 12 VG / ear, 1×10 13 VG / ear, 2×10 13 VG / ear, 3×10 13 VG / ear, 4×10 13 VG / ear, 5×10 13 VG / ear, 6×10 13 VG / ear, 7×10 13 VG / ear, 8×10 13 VG / ear, 9×10 13 VG / ear, 1×10 14 VG / ear, 2×10 14 VG / ear, 3×10 14 VG / ear, 4×10 14 VG / ear, 5×10 14 VG / ear, 6×10 14 VG / ear, 7×10 14 VG / ear, 8×10 14 VG / ear, 9×10 14 VG / ear, 1×10 15 VG / ear, or 2×1015 It can be administered to the subject in doses of VG / ear. In some embodiments, the nucleic acid vector (e.g., AAV vector) is administered in an amount sufficient to transduce at least 20% of the subject's inner hair cells using both the first and second vectors (e.g., at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more of the subject's inner hair cells are transduce by both vectors in the dual-vector system).

[0308] The compositions described herein are administered in amounts sufficient to improve hearing, improve speech discrimination, increase WT OTOF expression (e.g., expression in cochlear hair cells, e.g., inner hair cells), or increase OTOF function. Hearing may be assessed using standard audiometry (e.g., audiometry, ABR, electrocochleography (ECOG), and otoacoustic emissions) and may improve by 5% or more (e.g., 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or more) compared to pre-treatment hearing measurements. In some embodiments, the compositions are administered in amounts sufficient to improve the ability to understand the subject's speech. Furthermore, the compositions described herein can also be administered in amounts sufficient to delay or prevent the onset or progression of sensorineural hearing loss or auditory neuropathy (for example, in subjects who have a mutation in OTOF or a family history of autosomal recessive hearing loss but do not exhibit hearing impairment, or in subjects exhibiting mild to moderate hearing loss). OTOF expression may be evaluated using immunohistochemistry, Western blotting, quantitative real-time PCR, or other methods known in the art for detecting proteins or mRNA, and may increase OTOF expression by 5% or more (e.g., 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or more) compared to OTOF expression before administration of the compositions described herein. OTOF function can be evaluated directly (e.g., by assessing exocytosis using electrophysiological or imaging methods) or indirectly based on audiometry, and may increase by 5% or more (e.g., 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or more) compared to OTOF function before administration of the compositions described herein. These effects may occur within, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25 weeks or more after administration of the compositions described herein. Depending on the dose and route of administration used in treatment, patients may be evaluated 1, 2, 3, 4, 5, 6 months or more after administration of the compositions.Depending on the evaluation results, the patient may be given additional treatment.

[0309] kit The compositions described herein can provide a kit for use in the treatment of subjects aged 25 years or older having a bialleletic OTOF mutation (e.g., for the treatment of sensorineural hearing loss or auditory neuropathy in such subjects), or a kit for use in treating subjects having a bialleletic OTOF mutation identified as having detectable otoacoustic emissions, detectable cochlear microphone potentials, and / or detectable cluster potentials (e.g., for the treatment of sensorineural hearing loss or auditory neuropathy in such subjects). The compositions may include the nucleic acid vectors described herein (e.g., AAV vectors) (e.g., a first nucleic acid vector comprising a polynucleotide encoding the N-terminal portion of the OTOF protein, and a second nucleic acid vector comprising a polynucleotide encoding the C-terminal portion of the OTOF protein), and may optionally include those packaged in an AAV virus capsid (e.g., AAV1, AAV9, AAV2, AAV8, Anc80, Anc80L65, DJ / 9, or 7m8). The kit may further include a package insert instructing the user of the kit, for example, a physician, to carry out the methods described herein. The kit may optionally include a syringe or other device for administering the composition. [Examples]

[0310] The following examples are provided to those skilled in the art to illustrate how the compositions and methods described herein may be used, manufactured, and evaluated, and are intended purely to illustrate the present invention and not to limit the scope of what the inventors consider to be their invention.

[0311] Example 1 - Restoration of ABR in OTOF-deficient mice aged 32 weeks and 52 weeks treated with OTOF dual vectors Animals gradually lose hearing with age, partly due to the loss of function of outer hair cells. Otoferrin-deficient animals lack ABR (inner hair cell function) but exhibit distortion component otoacoustic emissions (DPOAE) (outer hair cell function). Like other aging animals, otoferrin-nurous animals lose outer hair cell function and DPOAE with age.

[0312] In aged OTOF homozygous mutant animals (OTOF-Q828X) up to 52 weeks of age, the double hybrid AAV1-Myo15-hOTOF vector was administered in 3.9 × 10⁻¹⁴ units. 10 The drug was administered at a dose of vg / ear, and the therapeutic window of efficacy was tested, taking into account the potential loss of outer hair cells and subsequent age-related increases in DPOAE. The first vector contained the Myo15 morphotor of SEQ ID NO: 38 operably bound to a polynucleotide (SEQ ID NO: 71) containing exons 1-20 of the polynucleotide encoding the OTOF isoform 5 protein, the 3' splice donor sequence of the said polynucleotide sequence, and the 3' AP recombinant gene region (SEQ ID NO: 65) of the splice donor sequence. The second vector contained the AP recombinant gene region (SEQ ID NO: 65), the 3' splice acceptor sequence of the recombinant gene region, the 3' polynucleotide of the splice acceptor sequence containing exons 21-45 and 47 of the polynucleotide encoding the OTOF isoform 5 protein (SEQ ID NO: 72), and a poly(A) sequence.

[0313] Baseline DPOAE was recorded in animals at 32 weeks of age (n=15) and 52 weeks of age (n=15). In the 32-week-old animals, 4 out of 15 showed elevated baseline DPOAE, while in the 52-week-old animals, 7 out of 15 showed elevated baseline DPOAE.

[0314] Animals were administered either a vehicle (n=5 / age group) or a dual hybrid AAV1-Myo15-hOTOF (n=10 / age group) via a round window under isoflurane anesthesia. Animals were allowed to recover postoperatively according to the protocol. DPOAE and ABR were tested 4 and 8 weeks after birth.

[0315] ABR recovery was observed in 10 / 10 of 32-week-old virus-treated animals and in 9 / 10 of 52-week-old virus-treated animals, including animals that showed elevated baseline DPOAE at both 4 and 8 weeks post-surgery. ABR recovery 4 weeks after treatment is shown in Figure 1. Maximum recovery was observed with a 22.6 kHz frequency sound and was similar to that observed in younger animals.

[0316] Example 2 - Characterization of hair cell loss in the OTOF-Q828X mouse model To mimic human congenital hearing loss caused by otoferrin loss, we developed the OTOF-Q828X mouse model. The human otoferrin Q829X mutation (standard SNP rs80356593) is a well-studied stop-gain mutation in exon 22, which cleaves the otoferrin protein after 828 amino acids in a 1997-amino acid coding sequence. Using CRISPR-mediated knock-in, we created the Otof-Q828X mouse strain with a target mutation in the mouse OTOF (mOtof) that mimics this human allele, against an FVB strain background.

[0317] Experiments were conducted to evaluate hair cell loss in homozygous Otof-Q828X (Otof-Q828X hom) and heterozygous (Otof-Q828X het) mice. The number of IHCs (Figure 2A) and OHCs (Figure 2B) was counted over 5–42 weeks in the cochlear regions corresponding to 5.6 kHz, 8 kHz, 11.3 kHz, 16 kHz, 22.6 kHz, 32 kHz, and 45.2 kHz in Otof-Q828X het or hom mice. Individual IHCs and OHCs were counted after staining with hair cell-specific markers. Five ears were evaluated in this analysis.

[0318] In Otof-Q828X hom mice, the number of IHCs decreased statistically significantly with age at all frequencies tested. A similar trend in IHC counts was observed in het mice at lower frequencies (Kendall's rank correlation). IHC counts in Otof-828X hom and het animals remained stable up to 16 weeks (Figure 2A). After 16 weeks, the decrease in IHC counts in Otof-Q828X hom animals began at 22.6–45.2 kHz and, at 24 weeks, was observed at lower frequencies (8–16 kHz). In Otof-Q828X het mice, the decrease in IHC counts began at 16 and 32 kHz at 24 weeks. After 32 weeks, more than 75% of IHCs were retained for most frequencies tested (<45.2 kHz) (Figure 2A).

[0319] The number of outer hair cells in Otof-Q828X hom and het mice remained constant over the 6-month study period at all frequencies except 8 kHz, where het mice showed age-related decline (Kendall's rank correlation). OHC counts at 5.6 kHz and 45.2 kHz were associated with significant variability, indicating scattered differences in counts between het and hom mice across the ages tested. The majority of OHCs remained after 32 weeks (Figure 2B).

[0320] Example 3 - Relationship between ABR threshold recovery and otoferrin-expressing cell number in homozygous OTOF-Q828X mutant mice The relationship between ABR threshold recovery and the number of otoferrin-expressing cells was investigated in several studies using n=76 homozygous OTOF-Q828X mutant mice aged >4 weeks (4 to 34 weeks). Furthermore, using an otoferrin dual hybrid vector system containing either an AAV1 or AAV2quadYF capsid and either an smCBA or Myo15 promoter, the number of cells expressing 1.0 × 10⁶ cells was examined. 9 and 6.4 × 10 10The dose was vg / ear. The ABR threshold was measured at 4–34 weeks of age when the mice were between 10 and 44 weeks old. The dual hybrid vector systems administered during these studies included AAV2quadYF-smCBA(SEQ ID NO: 70)-mOTOF (administered to mice between 34 and 29 weeks of age), AAV2quadYF-Myo15(SEQ ID NO: 38)-mOTOF (administered to 29-week-old mice), AAV2quadYF-Myo15(SEQ ID NO: 48)-mOTOF (administered to 29-week-old mice), AAV1-smCBA(SEQ ID NO: 70)-hOTOF (administered to 4 and 8-week-old mice), AAV1-Myo15(SEQ ID NO: 38)-hOTOF (administered to 4 and 5-week-old mice), and AAV1-Myo15(SEQ ID NO: 38)-mOTOF (administered to 9-week-old mice).

[0321] At 22 kHz, when approximately 20% of IHCs expressed otoferrin, the ABR threshold fell within the normal range (mean ± 2 SD) (Figure 3). The threshold did not improve further even as the proportion of IHCs expressing otoferrin increased.

[0322] Example 4 - Administration of the OTOF dual vector system to subjects aged 25 years or older with biallelic OTOF mutations. According to the method disclosed herein, a specialist can identify a patient aged 25 or older with a biallele OTOF mutation (for example, 25-50 years, 25-45 years, 25-40 years, 25-35 years, 25-30 years, 30-50 years, 30-45 years, 30-40 years, 30-35 years, 35-50 years, 35-45 years, 35-40 years, 40-50 years, 40-45 years, or 45-50 years). For example, it can be used to treat hearing loss or auditory nerve disorders in patients aged 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 years old, in order to prevent, alleviate, or treat them. For this purpose, a specialist may administer to a human patient a composition comprising: a first nucleic acid vector (e.g., AAV1 or AAV9 vector) comprising a promoter operably bound to a polynucleotide encoding the N-terminal portion of the OTOF protein (e.g., the N-terminal portion of human OTOF, e.g., SEQ ID NO: 1 or SEQ ID NO: 5); and a second nucleic acid vector (e.g., AAV1 or AAV9 vector) comprising a polynucleotide encoding the C-terminal portion of the OTOF protein (e.g., the C-terminal portion of human OTOF, e.g., the C-terminal portion of SEQ ID NO: 1 or SEQ ID NO: 5) and a poly(A) sequence. The dual vector may be a duplicate dual vector, a trans-splicing dual vector, or a dual hybrid vector as described herein.For example, these vectors can be made into a dual hybrid vector, which consists of a Myo15 promoter (e.g., SEQ ID NOs. 36, 38, 39, 48, or 49) operably bound to exons 1-20 of a polynucleotide encoding an OTOF isoform 5 protein (e.g., human OTOF isoform 5, e.g., SEQ ID NOs. 5, e.g., a polynucleotide having the sequence of SEQ ID NOs. 71), the 3' of the splice donor sequence of the polynucleotide sequence, and the AP recombination induction region of the splice donor sequence (e.g., any one of SEQ ID NOs. 62-67, e.g., SEQ ID NOs. 65). The present invention comprises a first vector containing the 3' of the AP gene fragment, and a second vector containing the AP recombination induction region (e.g., any one of SEQ ID NOs. 62-67, e.g., the AP gene fragment of SEQ ID NO. 65), the 3' of the splicing acceptor sequence of the recombination induction region, the 3' of the polynucleotide of the splice acceptor sequence containing exons 21-45 and 47 of the polynucleotide encoding the OTOF isoform 5 protein (e.g., human OTOF isoform 5, e.g., polynucleotide having the sequence of SEQ ID NO. 72), and a bGH poly(A) sequence. A composition containing the duplicated double AAV vector may be administered to a patient, for example, by local administration to the inner ear (e.g., injection through a round window membrane), to treat or prevent the development of sensorineural hearing loss or auditory neuropathy associated with biallelic OTOF mutations.

[0323] After administering the composition to a patient, a specialist can monitor the occurrence of OTOF and the patient's improvement in response to treatment in various ways. For example, a physician can monitor the patient's hearing by performing standard tests such as audiometry, ABR, electrocochleography (ECOG), and otoacoustic emissions after administration of the composition. If improvement in the patient's hearing is found in one or more tests after administration of the composition compared to the audiometry results before administration of the composition (e.g., improved ABR), it indicates that the patient is responding favorably to the treatment. Subsequent doses can then be determined and administered as needed.

[0324] Exemplary embodiments of the present invention are described in the following paragraphs. E1. A method for treating human subjects aged 25 years or older who have a bialleleotic otoferrin (OTOF) mutation, comprising administering a therapeutically effective dose of a dual vector system to the subject, wherein the dual vector system is A first nucleic acid vector comprising a promoter operably bound to a first coding polynucleotide encoding the N-terminal portion of the OTOF protein, and The invention comprises a second nucleic acid vector containing a second coding polynucleotide encoding the C-terminal portion of the OTOF protein, and a poly(A) sequence located at the 3' position of the second coding polynucleotide. The method wherein neither the first nor the second nucleic acid vector encodes a full-length OTOF protein.

[0325] E2. Method E1, wherein the first coding polynucleotide and the second coding polynucleotide do not overlap.

[0326] E3. The E1 or E2 method, wherein the first nucleic acid vector comprises a splice donor signal sequence located at the 3' position of the first coding polynucleotide, and the second nucleic acid vector comprises a splice acceptor signal sequence located at the 5' position of the second coding polynucleotide.

[0327] E4. The method of E3, wherein the first nucleic acid vector comprises a first recombination induction region located at the 3' position of the splice donor signal sequence, and the second nucleic acid vector comprises a second recombination induction region located at the 5' position of the splice acceptor signal sequence.

[0328] E5. The method of E4, wherein the first and second recombinant induction regions are the same. E6. The E4 or E5 method wherein the first or second recombination induction region is an AP gene fragment or an F1 phage AK gene.

[0329] E7. The method of E6, characterized in that the F1 phage AK gene contains or consists of the sequence of sequence number 19.

[0330] E8. The E6 method wherein the AP gene fragment contains or consists of one of the sequences of sequence numbers 62 to 67.

[0331] E9. The method of E8, characterized in that the AP gene fragment contains or consists of the sequence of Sequence ID No. 65.

[0332] E10. The splice donor sequence contains or consists of the sequence of sequence number 20 or sequence number 68, in any one of the methods E3 to E9.

[0333] E11. The splicing acceptor sequence comprises or consists of the sequence of sequence number 21 or sequence number 69, one of the methods E3 to E10.

[0334] E12. One of the methods E4 to E11, wherein the first nucleic acid vector further comprises a degradation signal sequence located at 3' of the recombination induction region, and the second nucleic acid vector further comprises a degradation signal sequence located between the recombination induction region and the splicing acceptor signal sequence.

[0335] E13. The method of E12, characterized in that the decomposition signal sequence includes or consists of the sequence of sequence number 22.

[0336] E14. The first and second coding polynucleotides are split at the OTOF exon boundary in one of the following ways: E1 to E13.

[0337] E15. The E14 method wherein the OTOF exon boundary is not located inside the first coding polynucleotide or the second coding polynucleotide encoding the C2 domain.

[0338] E16. Method E1, wherein the first coding polynucleotide partially overlaps with the second coding polynucleotide.

[0339] E17. The first coding polynucleotide overlaps the second coding polynucleotide by at least 1 kilobase (kb) in the E16 method.

[0340] E18. The E16 or E17 method, wherein the overlapping region between the first and second coding polynucleotides is centered on the OTOF exon boundary.

[0341] E19. The method of E18, wherein the first coding polynucleotide encodes the N-terminal portion of the OTOF protein and includes the OTOF N-terminus 500 bp to the 3' of the exon boundary at the center of the overlapping region, and the second coding polynucleotide encodes the C-terminal portion of the OTOF protein and includes the OTOF C-terminus 500 bp to the 5' of the exon boundary at the center of the overlapping region.

[0342] E20. The E18 or E19 method wherein the OTOF exon boundary at the center of the overlapping region is not inside the first coding polynucleotide or the second coding polynucleotide encoding the C2 domain.

[0343] E21. The OTOF exon boundary is selected in any one of the following ways: E14, E15, and E18-E20, such that the first coding polynucleotide encodes the entire C2C domain and the second coding polynucleotide encodes the entire C2D domain.

[0344] E22. The OTOF exon boundary is either an exon 19 / 20 boundary, an exon 20 / 21 boundary, or an exon 21 / 22 boundary, in one of the methods E14, E15, and E18-E21.

[0345] E23. The OTOF exon boundary is selected in one of the following ways: E14, E15, and E18-E20, such that the first coding polynucleotide encodes the entire C2D domain and the second coding polynucleotide encodes the entire C2E domain.

[0346] E24. The OTOF exon boundary is either an exon 26 / 27 boundary or an exon 28 / 29 boundary, in one of the following ways: E14, E15, E18-E20, and E23.

[0347] E25. One of E14, E18, and E19, wherein the OTOF exon boundary is located in part of the first coding polynucleotide and in part of the second coding polynucleotide encoding the C2D domain.

[0348] E26. The OTOF exon boundary is either an exon 24 / 25 boundary or an exon 25 / 26 boundary, in one of the following ways: E14, E18, E19, and E25.

[0349] E27. One of the methods E1 to E26, wherein each of the first and second coding polynucleotides codes for approximately half of the OTOF protein sequence.

[0350] E28. The first nucleic acid vector and the second nucleic acid vector are one of the methods E1 to E27, and do not contain an OTOF untranslated region (UTR).

[0351] E29. The first nucleic acid vector is one of the methods E1 to E27, wherein the first nucleic acid vector contains OTOF 5'UTR.

[0352] E30. The second nucleic acid vector comprises OTOF 3'UTR, according to one of the methods E1-E27 and E29.

[0353] E31. The first and second coding polynucleotides encoding the OTOF protein are intron-free, in any one of the methods E1 to E30.

[0354] E32. One of the methods E1 to E31, wherein the OTOF protein in question is a mammalian OTOF protein.

[0355] E33. The method of E32, wherein the OTOF protein in question is a human OTOF protein. E34. One of the methods E1 to E33 wherein the OTOF protein has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity) to the sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5.

[0356] E35. The method of E34 wherein the OTOF protein has the sequence of SEQ ID NO: 1. E36. The method of E34 wherein the OTOF protein has the sequence of SEQ ID NO: 5.

[0357] E37. One of the methods E1 to E33 wherein the OTOF protein comprises the sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5, or a variant thereof, having one or more conserved amino acid substitutions.

[0358] E38. The E37 method, wherein less than 10% of the amino acids in the OTOF protein mutant (e.g., 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less) are conservative amino acid substitutions.

[0359] E39. The OTOF protein is one of the methods E1 to E33 encoded by one of sequence numbers 10 to 14.

[0360] E40. The first coding polynucleotide codes for amino acids 1-802 of SEQ ID NO: 1 or SEQ ID NO: 5, and the second coding polynucleotide codes for amino acids 803-1997 of SEQ ID NO: 1 or SEQ ID NO: 5, in any one of the methods E1-E33.

[0361] E41. One of the methods E1 to E33, wherein the N-terminal portion of the OTOF protein consists of the sequence of SEQ ID NO: 73 or a variant thereof having one or more conserved amino acid substitutions.

[0362] E42. Method E41, in which 10% or less (e.g., 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less) of the amino acids in the N-terminal region of the OTOF protein mutant are conservative amino acid substitutions.

[0363] E43. The method of E41, wherein the N-terminal portion of the OTOF protein in question consists of the sequence of SEQ ID NO: 73.

[0364] E44. The N-terminal portion of the OTOF protein is one of the three methods E1-E33 and E43 encoded by the sequence of SEQ ID NO: 71.

[0365] E45. One of the methods E1-E33 and E41-E44, wherein the C-terminal portion of the OTOF protein consists of the sequence of SEQ ID NO: 74 or a variant thereof having one or more conserved amino acid substitutions.

[0366] E46. The E45 method, wherein 10% or less of the amino acids in the C-terminal region of the OTOF protein mutant (e.g., 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less) are conservative amino acid substitutions.

[0367] E47. The E45 method wherein the C-terminal portion of the OTOF protein in question consists of the sequence of SEQ ID NO: 74.

[0368] E48. The C-terminal portion of the OTOF protein is one of the following methods encoded by the sequence of Sequence ID No. 72: E1-E33, E41-E44, and E47.

[0369] E49. The first nucleic acid vector comprises a Kozak sequence located at 3' of the promoter and the 5' of the first coding polynucleotide encoding the N-terminal portion of the OTOF protein, in any one of the methods E1 to E48.

[0370] E50. The promoter is a ubiquitous promoter, one of the methods E1 to E49.

[0371] E51. The E50 method, wherein the ubiquitous promoter is the CAG promoter, cytomegalovirus (CMV) promoter, chicken β-actin promoter, deletion CMV-chicken β-actin promoter (smCBA), CB7 promoter, hybrid CMV enhancer / human β-actin promoter, human β-actin promoter, elongation factor-1α (EF1α) promoter, or phosphoglycerate kinase (PGK) promoter.

[0372] E52. One of the methods E1-49, wherein the promoter is a cochlear hair cell-specific promoter.

[0373] E53. The E52 method, wherein the cochlear hair cell-specific promoter is the myosin 15 (Myo15) promoter, the myosin 7A (Myo7A) promoter, the myosin 6 (Myo6) promoter, the POU class 4 homeobox 3 (POU4F3) promoter, the asynthetic BHLH transcription factor 1 (ATOH1) promoter, the LIM homeobox 3 (LHX3) promoter, the α9 acetylcholine receptor (α9AChR) promoter, or the α10 acetylcholine receptor (α10AChR) promoter.

[0374] E54. One of the methods E1 to E49, wherein the promoter is an inner hair cell-specific promoter.

[0375] E55. The E54 method, wherein the hair cell-specific promoter is the fibroblast growth factor 8 (FGF8) promoter, the vesicle glutamate transporter 3 (VGLUT3) promoter, the OTOF promoter, or the calcium-binding protein 2 (CABP2) promoter.

[0376] E56. The first nucleic acid vector comprises a polynucleotide sequence including the sequence of nucleotides 2272-6041 of SEQ ID NO: 75, according to method E1.

[0377] E57. The first nucleic acid vector comprises the sequence of nucleotides 2049-6264 of SEQ ID NO: 75, or a polynucleotide sequence consisting thereof, by the E1 or E56 method.

[0378] E58. The first nucleic acid vector contains a polynucleotide sequence including the sequence of nucleotides 182-3849 of sequence number 77. Method E1.

[0379] E59. The first nucleic acid vector comprises the sequence of nucleotides 19-4115 of sequence number 77, or a polynucleotide sequence consisting thereof, by the E1 or E58 method.

[0380] E60. The first nucleic acid vector comprises a polynucleotide sequence including the sequence of nucleotides 2267-6014 of SEQ ID NO: 79, according to method E1.

[0381] E61. The first nucleic acid vector comprises the sequence of nucleotides 2049-6237 of SEQ ID NO: 79, or a polynucleotide sequence comprising the same, by the E1 or E60 method.

[0382] E62. The first nucleic acid vector comprises a polynucleotide sequence including the sequence of nucleotides 177-3924 of sequence number 80, according to method E1.

[0383] E63. The 19th nucleic acid vector comprises the sequence of nucleotides 19-4090 of SEQ ID NO: 80, or a polynucleotide sequence consisting thereof, by the E1 or E62 method.

[0384] E64. The second nucleic acid vector comprises a polynucleotide sequence including the sequence of nucleotides 2267-6476 of SEQ ID NO: 76, according to one of the methods E1, E56, E57, E60, and E61.

[0385] E65. The second nucleic acid vector comprises the sequence of nucleotides 2049-6693 of SEQ ID NO: 76, or a polynucleotide sequence consisting thereof, according to one of the methods E1, E56, E57, E60, E61, and E64.

[0386] E66. The second nucleic acid vector comprises a polynucleotide sequence including the sequence of nucleotides 187-4396 of SEQ ID NO: 78, according to one of the methods E1, E58, E59, E62, and E63.

[0387] E67. The second nucleic acid vector comprises the sequence of nucleotides 19-4589 of SEQ ID NO: 78, or a polynucleotide sequence consisting thereof, according to one of the methods E1, E58, E59, E62, E63, and E66.

[0388] E68. The first nucleic acid vector contains a polynucleotide sequence including the sequence of nucleotides 235-4004 of SEQ ID NO: 81, by method E1. E69. The first nucleic acid vector comprises the sequence of nucleotides 12-4227 of SEQ ID NO: 81, or a polynucleotide sequence comprising the same, by the E1 or E62 method.

[0389] E70. The first nucleic acid vector comprises a polynucleotide sequence including the sequence of nucleotides 230-3977 of sequence number 83, according to method E1.

[0390] E71. The first nucleic acid vector comprises the sequence of nucleotides 12 to 4200 of sequence number 83, or a polynucleotide sequence consisting thereof, by the E1 or E70 method.

[0391] E72. The second nucleic acid vector comprises a polynucleotide sequence including the sequence of nucleotides 229-4438 of SEQ ID NO: 82, according to one of the methods E1 and E68-E71.

[0392] E73. The second nucleic acid vector comprises the sequence of nucleotides 12-4655 of SEQ ID NO: 82, or a polynucleotide sequence consisting thereof, according to one of the methods E1 and E68-E72.

[0393] E74. The first and second nucleic acid vectors are provided by any one of the methods E1 to E73, wherein each nucleic acid sequence contains an inverse terminal repeat (ITR) at its respective end.

[0394] E75. The method according to E74, wherein the ITR is an AAV2 ITR or has at least 80% sequence identity with respect to an AAV2 ITR (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity).

[0395] E76. One of the E1-E75 methods wherein the poly(A) sequence is a bovine growth hormone (bGH) poly(A) signaling sequence.

[0396] E77. The second nucleic acid vector comprises one of the methods E1 to E76, wherein the second nucleic acid vector contains a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE).

[0397] E78. The method of E77 wherein the WPRE includes or consists of the sequence of sequence number 23 or sequence number 61.

[0398] E79. One of the methods E1 to E78, wherein the first and second nucleic acid vectors are adeno-associated virus (AAV) vectors.

[0399] E80. The E79 method wherein the AAV vector has the capsids AAV1, AAV2, AAV2quad(YF), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, rh10, rh39, rh43, rh74, Anc80, Anc80L65, DJ / 8, DJ / 9, 7m8, PHP.B, PHP.eb, or PHP.S.

[0400] E81. The subject is 30 years of age or older, and one of the methods E1 to E80 is used. E82. The subject is 35 years of age or older, and one of the methods E1 to E81 is used.

[0401] E83. The subject is 40 years of age or older, and one of the methods E1 to E82 is used. E84. The subject is 45 years of age or older, and one of the methods E1 to E83 is used.

[0402] E85. The subject is 50 years of age or younger, and one of the methods E1 to E84 is used. E86. One of the methods E1 to E85, which identifies the subject as having a biallelic OTOF mutation.

[0403] E87. Any one of the methods E1 to E85, further comprising identifying the subject for the presence or absence of a biallelic OTOF mutation before administering the biallelic vector system.

[0404] E88. The object is identified as having detectable otoacoustic emissions by any one of the methods E1 to E87.

[0405] E89. One of the methods E1 to E88, which identifies the target as having a detectable cochlear microphone potential.

[0406] E90. The object in question is identified as having a detectable aggregate potential by one of the methods E1 to E89.

[0407] E91. The subject is a method described in one of the following E1 to E90, relating to hearing loss, autosomal recessive 9 (DFNB9), or being identified as having such a condition.

[0408] E92. The method further includes evaluating the hearing of the subject before administering the dual vector system, one of the methods E1 to E91.

[0409] E93. One of the following methods, E1 to E92, for administering the dual-vector system to the inner ear. E94. The dual-vector system is administered by injection through a round window, injection into the semicircular canals, canal incision, catheter insertion through the round window membrane, transtympanic injection, or intratympanic injection. (Method E93).

[0410] E95. The method further comprises one of the methods E1 to E94, wherein the hearing of the subject is evaluated after administration of the dual vector system.

[0411] E96. One of the methods E1 to E95 involves administering the dual-vector system in an amount sufficient to prevent or reduce hearing loss, delay the onset of hearing loss, delay the progression of hearing loss, improve hearing, improve speech discrimination ability, or improve hair cell function.

[0412] E97. One of the methods E1 to E96, in which the first vector and the second vector are administered simultaneously.

[0413] E98. One of the methods E1 to E96, in which the first vector and the second vector are administered sequentially.

[0414] E99. The first vector and the second vector are approximately 1 × 10 7 Vector genome (VG) / ear ~ approximately 2 x 10 15 Administer in one of the following methods, E1 to E98, at a VG / ear concentration.

[0415] E100. One of the methods E1 to E99, wherein the first vector and the second vector are administered in a combined amount sufficient to transduce at least 20% of the target inner hair cells using both the first and second vectors.

[0416] Other embodiments Various modifications and variations described herein will be apparent to those skilled in the art without departing from the scope and technical spirit of the invention. Although the invention has been described in relation to specific embodiments, it should be understood that the claimed invention should not be limited beyond such specific embodiments. In fact, various moduli of the form described for carrying out the invention, which will be apparent to those skilled in the art, are intended to be within the scope of the invention. Other embodiments are found in the claims.

Claims

1. A pharmaceutical composition used for the treatment of sensorineural hearing loss in human subjects aged 25 years or older who have a bialleleotic otoferrin (OTOF) mutation, A first nucleic acid vector comprising a promoter operably bound to a first coding polynucleotide encoding the N-terminal portion of the OTOF protein, A second nucleic acid vector comprising a second coding polynucleotide encoding the C-terminal portion of the OTOF protein, and a poly(A) sequence located at 3' of the second coding polynucleotide. Includes a dual vector system, The pharmaceutical composition wherein neither the first nucleic acid vector nor the second nucleic acid vector codes for a full-length OTOF protein, and when introduced into mammalian cells, the first coding polynucleotide and the second coating polynucleotide combine to form a polynucleotide that codes for a full-length OTOF protein.

2. The pharmaceutical composition according to claim 1, wherein the first coding polynucleotide and the second coding polynucleotide do not overlap.

3. The pharmaceutical composition according to claim 1 or 2, wherein the first nucleic acid vector comprises a splice donor signal sequence located at the 3' position of the first coding polynucleotide, and the second nucleic acid vector comprises a splice acceptor signal sequence located at the 5' position of the second coding polynucleotide.

4. The pharmaceutical composition according to claim 3, wherein the first nucleic acid vector includes a first recombination induction region located at the 3' position of the splice donor signal sequence, and the second nucleic acid vector includes a second recombination induction region located at the 5' position of the splice acceptor signal sequence.

5. The pharmaceutical composition according to claim 4, wherein the first recombinant induction region and the second recombinant induction region are the same.

6. The pharmaceutical composition according to claim 4 or 5, wherein the first recombination induction region or the second recombination induction region is an AP gene fragment or an F1 phage AK gene.

7. The pharmaceutical composition according to any one of claims 1 to 6, wherein the first coding polynucleotide and the second coding polynucleotide are separated at an OTOF exon boundary.

8. The pharmaceutical composition according to claim 7, wherein the OTOF exon boundary is an exon 19 / 20 boundary, an exon 20 / 21 boundary, or an exon 21 / 22 boundary.

9. The pharmaceutical composition according to any one of claims 1 to 8, wherein each of the first coding polynucleotide and the second coding polynucleotide codes for about half of the OTOF protein sequence.

10. The pharmaceutical composition according to any one of claims 1 to 9, wherein the first coding polynucleotide and the second coding polynucleotide encoding the OTOF protein are intron-free.

11. The pharmaceutical composition according to any one of claims 1 to 10, wherein the promoter is a cochlear hair cell-specific promoter.

12. The pharmaceutical composition according to claim 11, wherein the cochlear hair cell-specific promoter is a myosin 15 (Myo15) promoter.

13. The pharmaceutical composition according to any one of claims 1 to 12, wherein the first nucleic acid vector and the second nucleic acid vector are adeno-associated virus (AAV) vectors.

14. The pharmaceutical composition according to any one of claims 1 to 13, wherein the subject is 50 years of age or younger.

15. The pharmaceutical composition according to any one of claims 1 to 14, wherein the subject is identified as having detectable otoacoustic emissions.

16. The pharmaceutical composition according to any one of claims 1 to 15, wherein the subject is identified as having a detectable cochlear microphone potential.

17. The pharmaceutical composition according to any one of claims 1 to 16, wherein the subject is identified as having a detectable collective potential.

18. The subject is a pharmaceutical composition according to any one of claims 1 to 17, having or being identified as having hearing loss and autosomal recessive 9 (DFNB9).

19. The pharmaceutical composition according to any one of claims 1 to 18, wherein the dual vector system is administered to the inner ear.

20. The pharmaceutical composition according to any one of claims 1 to 19, wherein the first nucleic acid vector and the second nucleic acid vector are administered together in a sufficient amount to transduce at least 20% of the target inner hair cells with both the first nucleic acid vector and the second nucleic acid vector.