Modified guide RNA

JP7899270B2Active Publication Date: 2026-08-03INTELLIA THERAPEUTICS INC
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
INTELLIA THERAPEUTICS INC
Filing Date
2024-09-12
Publication Date
2026-08-03

AI Technical Summary

Benefits of technology

【0005】 一部の実施形態では、修飾ガイドRNAを含む治療用ゲノム編集ツールが提供される。 本明細書に記載される修飾ガイドRNAは、ガイドRNAおよびガイドRNA/Cas9 複合体の安定性を改善し、かつ標的DNAを切断するCas9(例えば、SpyCas9 および同等物)の活性を改善し得る。一部の実施形態では、ガイドRNAはsgRNAで ある。一部の実施形態では、ガイドRNAはdgRNAである。一部の実施形態では、ガ イドRNAはtracrRNAである。一部の実施形態では、ガイドRNAはcrRNA である。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007899270000037
    Figure 0007899270000037
  • Figure 0007899270000038
    Figure 0007899270000038
  • Figure 0007899270000039
    Figure 0007899270000039
Patent Text Reader

Abstract

To provide modified single and dual guide RNAs having improved in vitro and in vivo activity in gene editing methods.SOLUTION: The present invention provides a single guide RNA (sgRNA) comprising a 5' end modification and one or more modification in one or more of a. the upper stem region, b. the hairpin 1 region, and c. the hairpin 2 region, wherein the 5' end modification comprises at least two phosphorothioate (PS) linkages within the first seven nucleotides at the 5' end of the 5' terminus.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application includes a Sequence Listing electronically submitted in ASCII format, which is incorporated herein by reference in its entirety. The ASCII copy was created on December 7, 2017, has the name 01155 - 0004 - 00PCT_SeqList.txt, and is 118,877 bytes in size. and is incorporated herein by reference in its entirety. The ASCII copy was created on December 7, 2017, has the name 01155 - 0004 - 00PCT_SeqList.txt, and is 118,877 bytes in size.

[0002] Cross - Reference to Related Applications This application claims the benefit of priority of U.S. Provisional Patent Application No. 62 / 431,756, filed on December 8, 2016, which is incorporated herein by reference in its entirety.

[0003] This disclosure relates to the field of gene editing using the CRISPR / Cas system, which is part of a prokaryotic immune system that recognizes and cleaves exogenous genetic elements. The CRISPR / Cas system relies on a single nuclease called CRISPR - associated protein 9 (Cas9) to induce site - specific cleavage of DNA. Cas9 is guided to a specific DNA sequence by a short - chain RNA molecule called guide RNA (gRNA). The guide RNA includes trans - activating CRISPR RNA (tracrRNA, also known as tracrRNA) and CRISPR RNA (crRNA). The tracrRNA and crRNA may be contained within a single guide RNA (sgRNA), or may be included in two separate RNA molecules of a dual - guide RNA (dgRNA). Cas9 in combination with tracrRNA and crRNA or sgRNA is called a Cas9 ribonucleoprotein complex (RNP).

[0004] ​​​​​​​​​​Oligonucleotides, especially RNA, are sometimes cleaved by endonucleases or exonucleases. It may be degraded in cells and serum by clease cleavage. To prevent such degradation... To stop the process, improve gRNA stability, and enhance gene editing efficiency, an improved method has been developed. The method and composition are particularly desirable for therapeutic applications. [Overview of the project] [Means for solving the problem]

[0005] In some embodiments, a therapeutic genome editing tool is provided that includes a modification guide RNA. The modified guide RNAs described herein are guide RNA and guide RNA / Cas9 Cas9 (e.g., SpyCas9) improves the stability of the complex and cleaves the target DNA. The activity of (and equivalents) may be improved. In some embodiments, the guide RNA is sgRNA. Yes. In some embodiments, the guide RNA is dgRNA. In some embodiments, The id RNA is tracrRNA. In some embodiments, the guide RNA is crRNA. That is the case.

[0006] The guide RNA described herein contains at least one modified nucleotide. The ornaments are 2'-O-methyl (2'-O-Me), 2'-O-(2-methoxyethyl)(2' -O-moe), 2'-fluoro(2'-F), phosphorothioate between nucleotides ( PS) binding, GC substitution, and inverse debase linkage between nucleotides and their equivalents It may include. Embodiments of the present invention include the following:

[0007] In some embodiments, single guide RNA (sgRNA) undergoes 5' terminal modification and One or more of the upper stem area; hairpin 1 area; and hairpin 2 area It includes and encompasses one or more modifications, and the 5' terminal modification is the final 5' terminal at the 5' terminal. The first seven nucleotides contain at least two phosphorothioate linkages. In this example, the modification is a 2'-O-methyl (2'-O-Me) modified nucleotide. In this embodiment, the modification is a 2'-fluoro(2'-F) modified nucleotide.

[0008] In some embodiments, the sgRNA includes modifications in US1-US12 and / or or includes modifications in H1-1 and / or includes modifications in H2-1. Partial implementation Morphologically, sgRNAs are found in H1-1 to H1-12 and / or H2-1 to H2-15. This includes modifications. In some embodiments, the sgRNA has an upper stem region and a hairpin region. Each of the two hairpin regions contains one or more modifications. Some implementation forms In this state, the sgRNA contains modified nucleotides between hairpin 1 region and hairpin 2 region. In some embodiments, the sgRNA contains modifications in the lower stem region.

[0009] In some embodiments, the sgRNA is modified at its 5' and / or 3' ends. Includes. In some embodiments, the sgRNA includes a 3' terminal modification within the 3' terminus. In this embodiment, the sgRNA has the last four nucleotides at the 3' end of the 3' terminus. It includes modifications in at least two of the embodiments. In some embodiments, the sgRNA has a 5' end Includes 5' terminal modification within the end. In some embodiments, sgRNA has a 5' terminal. Includes modification in at least two of the first four nucleotides in. Some implementations In this state, the sgRNA contains a 3' end modification within the 3' end and a 5' end modification within the 5' end. In some embodiments, the sgRNA contains modifications at least at two of the last four nucleotides at the 3' end of the 3' end and at least at two of the first four nucleotides at the 5' end of the 5' end. In some cases, these modifications are 2'-O-Me, 2'-F, 2'-O-moe, or phosphorothioate (PS) bonds that link nucleotides. In some embodiments, the sgRNA contains at least two of the last four nucleotides at the 3' end of the 3' end and / or at least two of the first four nucleotides at the 5' end of the 5' end and contains PS bonds between them. In some cases, the sgRNA contains 5' and 3' ends with more than one modification as described herein, such as PS bonds and 2'-O-Me modifications. In some embodiments, the sgRNA contains modifications in the bulge region. In some embodiments, 50% of the nucleotides in the bulge region are modified, and the modifications are 2'-O-Me or 2'-F. In some embodiments, the sgRNA contains modifications in the nexus region. In some embodiments, the sgRNA contains modifications at N15, N16, N17, and / or N18 in the nexus region, and the modifications are 2'-O-Me or 2'-F. In some cases, N16, N17, and N18 are linked by PS bonds. In some embodiments, the sgRNA contains at least at the 5' end of the modified 5' end.

[0010]

[0011]

[0012] ​​​​​​The first three nucleotides, and the last three nucleotides at the 3' end of the 3' terminus. Includes Ochido.

[0013] In some embodiments, the sgRNA is modified at its 3' and / or 5' ends. Includes. In some cases, the first four nucleotides at the 5' end of the 5' terminus, and The last four nucleotides at the 3' end of the 3' terminus are phosphorothioates (PS). They are linked by bonding. In some embodiments, the 5' and 3' modifications are 2'-O-Me or includes 2'-O-moe. In some embodiments, the 5' and 3' modifications include 2'-F. Includes. In some embodiments, the 5' and / or 3' modifications are P nucleotides that link together. Includes an S bond. In some embodiments, the 5' and / or 3' modifications are 2'-O-Me. One of the PS bonds that link 2'-O-moe, 2'-F, and nucleotides This includes multiple entries.

[0014] In some embodiments, sgRNA has the first four nuclei at the 5' end of the 5' terminus. Otide and modifications in the last four nucleotides at the 3' end of the 3' terminus. In some cases, these modifications connect the PS bonds (i.e., the first four nuclei) This is a PS bond that links the ocide and the last four nucleotides. In some embodiments, sgRNA consists of the first three nucleotides at the 5' end and the 3' end. The last three nucleotides at the 3' end of the molecule further contain 2'-O-Me modifications. nothing.

[0015] In some embodiments, sgRNA has the first four nuclei at the 5' end of the 5' terminus. The ocide and the last four nucleotides at the 3' end of the 3' terminus include modifications. The modification is a PS bond linking at least four nucleotides, and furthermore, the 5' terminus. The first three nucleotides at the 5' end and the last nucleotide at the 3' end The three nucleotides contain 2'-O-Me, 2'-O-moe, or 2'-F modifications. .

[0016] In some embodiments, sgRNA is modified LS1, LS6, LS7, LS8, LS11 It includes , and LS12, and the modification is 2'-O-Me or 2'-F.

[0017] In some embodiments, the sgRNA is present in each of the nucleotides in the bulge region. It includes modifications, the modifications being 2'-O-Me or 2'-F.

[0018] In some embodiments, the sgRNA is such that each of the nucleotides in the upper stem region It includes modifications, and the modifications are 2'-O-Me or 2'-F.

[0019] In some embodiments, the sgRNA is located in each of the nucleotides within the hairpin region. It includes modifications, and the modifications are 2'-O-Me or 2'-F.

[0020] In some embodiments, the sgRNA is located in each of the nucleotides within the hairpin 2 region. It includes modifications, and the modifications are 2'-O-Me or 2'-F.

[0021] In some embodiments, the following location: a. The first three nucleotides at the 5' end of the 5' terminus, b. LS1, LS6, LS7, LS8, LS11, and / or in the lower stem region LS12 and, c. B1 and / or B2 in the bulge region, d. Each nucleotide in the upper stem region, e. N16, N17, and / or N18 in the nexus region, f. Each nucleotide in hairpin 1 region, g. Each nucleotide in the hairpin 2 region, The last four nucleotides at the 3' end of the 3' terminus, and in the 2'-OM This includes sgRNAs containing e-modified nucleotides. In some embodiments, B3 to B6 are modified with 2'-O-Me. sgRNA consists of three nucleotides that ligate the first four nucleotides at the 5' end. The phosphorothioate (PS) bond and the last four nuclei at the 3' end of the 3' terminus It further includes three PS bonds that link the rheotide. In some embodiments, the sgRNA is LS9 and LS10 include 2'-F modifications. In some embodiments, sgRNA , including 2'F modification in N15, N16, N17, and N18. In some embodiments sgRNAs are H2-9, H2-10, H2-11, H2-12, H2-13, H2 -14 and H2-15 include 2'F modifications. In some embodiments, sgRNA These are the second to last, third to last, and fourth to last at the 3' end of the 3' terminology. The nucleotides of the eye contain a 2'F modification.

[0022] In some embodiments, the following location: a. LS9 and LS10 in the lower stem region, b. N15, N16, N17, and N18 in the nexus region, c. H2-9, H2-10, H2-11, H2-12, H2-13 in hairpin 2 region , H2-14, and H2-15, and sgRN containing 2'-F modified nucleotides A is included. In some embodiments, the sgRNA is located at the second to last and third to last positions at the 3' end. It contains a 2'-F modified nucleotide at the 1st and 4th to last nucleotide. In one embodiment, the sgRNA has the first four nucleotides at the 5' end of the 5' terminus. Three phosphorothioate (PS) bonds linking the dots and at the 3' end of the 3' terminus It includes three PS bonds that link the last four nucleotides. In some embodiments, sg RNA has a 2'-OM structure in the first three nucleotides at the 5' end of the 5' terminus. Contains e or 2'-F modified nucleotides, and the last four at the 3' end of the 3' terminus Three of the nucleotides contain 2'-O-Me or 2'-F modified nucleotides.

[0023] In some embodiments, a. 2'-O-Me compound in the first three nucleotides at the 5' end of the 5' terminus Decorative nucleotides, b. Optional 2'-O-Me modified nucleotides in LS1 and / or LS6 and, c. 2'-O-Me modified nucleotides in US1~US12, d. 2'-O-Me modified nucleotides in H1-1 to H1-12 e. An optional 2'-O-Me modified nucleotide between hairpin 1 and hairpin 2, 2'-O-Me modified nucleotides in f.H2-1~H2-15, g. In the last four nucleotides at the 3' end of the 3' terminus, a 2'-O-Me modification is performed. Includes decorative nucleotides, and optionally, Three phosphorothiocyanates link the first four nucleotides at the 5' end of the 5' terminus. nucleotide (PS) bond and ligation of the last four nucleotides at the 3' end of the 3' terminus. The sgRNA is further enclosed by three PS bonds.

[0024] In some embodiments, a. 2'-O-Me compound in the first three nucleotides at the 5' end of the 5' terminus Decorative nucleotides, b. 2'-F modified nucleotides in LS1~LS6, c. 2'-O-Me modified nucleotides in US1~US12, d. 2'-O-Me modified nucleotides in H1-1 to H1-12, e. The 2'-O-Me modified nucleotide between hairpin 1 and hairpin 2, 2'-O-Me modified nucleotides in f.H2-1~H2-15, g. 2'-O-Me compound in the last four nucleotides at the 3' end of the 3' terminus Includes decorative nucleotides, and optionally, Three phosphorothiocyanates link the first four nucleotides at the 5' terminal end. EAT (PS) bond and ligation of the last four nucleotides at the 3' end of the 3' terminus. The sgRNA is further enclosed by three PS bonds.

[0025] In some embodiments, a. 2'-O-Me modified nucleo in the first three nucleotides at the 5' terminus Chido and, b. 2'-F modified nucleotides in LS2~LS5, c. 2'-O-Me modified nucleotides in LS1 and LS6, d. 2'-O-Me modified nucleotides in US1~US12, e. 2'-O-Me modified nucleotides in H1-1 to H1-12, f. The 2'-O-Me modified nucleotide between hairpin 1 and hairpin 2, g. 2'-O-Me modified nucleotides in H2-1 to H2-15, 2'-O-Me modified nucleo at the last four nucleotides of the 3' terminus Includes Chido and, optionally, Three phosphorothiocyanates link the first four nucleotides at the 5' end of the 5' terminus. nucleotide (PS) bond and ligation of the last four nucleotides at the 3' end of the 3' terminus. The sgRNA is further enclosed by three PS bonds.

[0026] In some embodiments, a. 2'-O-Me modified nucleo in the first three nucleotides at the 5' terminus Chido and, b. 2'-O-Me modified nucleotides in US1~US12, c. 2'-O-Me modified nucleos in LS7, LS8, LS11, and LS12 Chido and, d. 2'-O-Me modified nucleotides in H1-1 to H1-12, e. The 2'-O-Me modified nucleotide between hairpin 1 and hairpin 2, 2'-O-Me modified nucleotides in f.H2-1~H2-15, g. 2'-O-Me modified nucleo in the last four nucleotides at the 3' terminus Chido and, And optionally, three nucleotides that ligate the first four nucleotides at the 5' end of the 5' terminus. The phosphorothioate (PS) bond and the last four nuclei at the 3' end of the 3' terminus The sgRNA is further enclosed, including three PS bonds that link the rheotide.

[0027] In some embodiments, a. 2'-O-Me modified nucleo in the first three nucleotides at the 5' terminus Chido and, b. 2'-O-Me modified nucleotides in US1~US12, c. 2'-O-Me modified nucleos in LS7, LS8, LS11, and LS12 Chido and, d. 2'-F modified nucleotides in LS9 and LS10, e. 2'-O-Me modified nucleotides in H1-1 to H1-12, f. The 2'-O-Me modified nucleotide between hairpin 1 and hairpin 2, g. 2'-O-Me modified nucleotides in H2-1 to H2-15, 2'-O-Me modified nucleo at the last four nucleotides of the 3' terminus Chido and, And optionally, three nucleotides that ligate the first four nucleotides at the 5' end of the 5' terminus. The phosphorothioate (PS) bond and the last four nuclei at the 3' end of the 3' terminus The sgRNA is further enclosed, including three PS bonds that link the rheotide.

[0028] In some embodiments, a. 2'-O-Me modified nucleo in the first three nucleotides at the 5' terminus Chido and, b. 2'-O-Me modified nucleotides in US1~US12, c. 2'-O-Me modified nucleotides in LS8, LS10, and LS12, d. 2'-OF modified nucleotides in LS7, LS9, and LS11, e. 2'-O-Me modified nucleotides in H1-1 to H1-12, f. The 2'-O-Me modified nucleotide between hairpin 1 and hairpin 2, g. 2'-O-Me modified nucleotides in H2-1 to H2-15, 2'-O-Me modified nucleo at the last four nucleotides of the 3' terminus Includes Chido and, optionally, Three phosphorothiocyanates link the first four nucleotides at the 5' end of the 5' terminus. nucleotide (PS) bond and ligation of the last four nucleotides at the 3' end of the 3' terminus. The sgRNA is further enclosed by three PS bonds.

[0029] In some embodiments, a. 2'-O-Me modified nucleo in the first three nucleotides at the 5' terminus Chido and, b. 2'-O- in LS1, LS6, LS7, LS8, LS11, and LS12 Me-modified nucleotides, c. 2'-O-Me modified nucleotides in US1~US12, d. 2'-O-Me modified nucleotides in H1-1 to H1-12, e. The 2'-O-Me modified nucleotide between hairpin 1 and hairpin 2, 2'-O-Me modified nucleotides in f.H2-1~H2-15, g. 2'-O-Me modified nucleo in the last four nucleotides at the 3' terminus Includes Chido and, optionally, Three phosphorothiocyanates link the first four nucleotides at the 5' end of the 5' terminus. nucleotide (PS) bond and ligation of the last four nucleotides at the 3' end of the 3' terminus. The sgRNA is further enclosed by three PS bonds.

[0030] In some embodiments, a. 2'-O-Me modified nucleo in the first three nucleotides at the 5' terminus Chido and, b. 2'-O- in LS1, LS6, LS7, LS8, LS11, and LS12 Me-modified nucleotides, c. 2'-F modified nucleotides in LS9 and LS10, d. 2'-O-Me modified nucleotides in US1~US12, e. 2'-O-Me modified nucleotides in H1-1 to H1-12, f. The 2'-O-Me modified nucleotide between hairpin 1 and hairpin 2, g. 2'-O-Me modified nucleotides in H2-1 to H2-15, 2'-O-Me modified nucleo at the last four nucleotides of the 3' terminus Includes Chido and, optionally, Three phosphorothiocyanates link the first four nucleotides at the 5' end of the 5' terminus. nucleotide (PS) bond and ligation of the last four nucleotides at the 3' end of the 3' terminus. The sgRNA is further enclosed by three PS bonds.

[0031] In some embodiments, a. 2'-O-Me compound in the first three nucleotides at the 5' end of the 5' terminus Decorative nucleotides, b. 2'-O-Me modified nucleotides in US1~US12, c. 2'-O-Me modified nucleotides in H1-1 to H1-12, d. The 2'-O-Me modified nucleotide between hairpin 1 and hairpin 2, e. 2'-O-Me modified nucleotides in H2-1 to H2-8, 2'-F modified nucleotides in f.H2-9~H2-15, g. The second to last, third to last, and fourth to last nuclei at the 3' terminus 2'-F modified nucleotides in rheotides, The 2'-O-Me modified nucleotide at the last nucleotide in the h3' terminus and , including, and optionally, Three phosphorothiocyanates link the first four nucleotides at the 5' end of the 5' terminus. nucleotide (PS) bond and ligation of the last four nucleotides at the 3' end of the 3' terminus. The sgRNA is further enclosed by three PS bonds.

[0032] In some embodiments, a. 2'-O-Me compound in the first three nucleotides at the 5' end of the 5' terminus Decorative nucleotides, b. 2'-O-Me modified nucleotides in US1~US12, c. In H1-2, H1-4, H1-6, H1-8, H1-10, and H1-12 2'-O-Me modified nucleotide; and, d. In H1-1, H1-3, H1-5, H1-7, H1-9, and H1-11 2'-F modified nucleotides, e. The 2'-F modified nucleotide between hairpin 1 and hairpin 2, f. H2-2, H2-4, H2-6, H2-8, H2-10, H2-12; and H2 -14 2'-F modified nucleotide and, g.H2-1, H2-3, H2-5, H2-7, H2-9, H2-11; H2-13, and the 2'-O-Me modified nucleotide in H2-15, At the second to last and fourth to last nucleotides at the h.3' terminus 2'-F modified nucleotides, i. The third to last and last nucleotide at the 3' end of the 3' terminus '-O-Me modified nucleotides and, And optionally, three nucleotides that ligate the first four nucleotides at the 5' end of the 5' terminus. The phosphorothioate (PS) bond and the last four nuclei at the 3' end of the 3' terminus The sgRNA is further enclosed, including three PS bonds that link the rheotide.

[0033] In some embodiments, a. 2'-O-Me modified nucleotides LS8, LS10, LS12, H1-2, H1- 4, H1-6, H1-8, H1-10, H1-12, H2-1, H2-3, H2-5, H 2-7, H2-9, H2-11, H2-13, and H2-15, b.LS7, LS9, LS11; H1-1, H1-3, H1-5, H1-7, H1-9 , H1-11, H1-13, H2-2, H2-4, H2-6, H2-8, H2-10, H It includes 2'-F modified nucleotides in 2-12 and H2-14, and optionally selected In the selection, Three phosphorothiocyanates link the first four nucleotides at the 5' end of the 5' terminus. nucleotide (PS) bond and ligation of the last four nucleotides at the 3' end of the 3' terminus. It further includes three PS bonds, and optionally, c. At the 3' end of the 3' terminal, the last and third to last nucleotides are 2 '-O-Me modified nucleotides; and / or d. The second to last, fourth to last, and / or last at the 3' end of the 3' terminology. The sgRNA further includes 2'-F modified nucleotides in the subsequent nucleotides. It will be done.

[0034] In some embodiments, any of the nuclei among Sequence IDs 228-353, including the modifications in Table 4. The sgRNA is contained by an acid. In some embodiments, SEQ ID NO: 2 includes the modifications shown in Table 4. The sgRNA is included, containing one of 28-332. In some embodiments, Table 4 contains the modified sequences 235-240, 265-285, and 309-329. The sgRNA is contained in which one of the following is included. In some embodiments, SEQ ID NO: 240 The sgRNA is included. In some embodiments, the SEQ ID NO: 240 includes the modifications shown in Table 4. The sgRNA is included in the following embodiment. In some embodiments, sgR includes SEQ ID NO: 242. NA is included. In some embodiments, sgRNA is included, including sequence number 358. In additional embodiments, see Sequence IDs 235-240, 265-285, and 309-3 For any one of the 29 nucleic acids, at least 99, 98, 97, 96, 95, 9 Nucleic acids having 4, 93, 92, 91, 90, 85, 80, 75, or 70% identity Including each nucleotine of the sgRNA corresponding to the nucleotide of the reference sequence identifier in Table 4. The modification in D is the same as or equivalent to the modification shown in the reference sequence identifier in Table 4. The gRNA optionally ligates the first four nucleotides at the 5' end of the 5' terminus. Three phosphorothioate (PS) bonds and the last four at the 3' end of the 3' terminus It further includes three PS bonds linking nucleotides. In some embodiments, sgR NA further has at least three PS bonds that link nucleotides in the hairpin 1 region Includes. In some embodiments, the sgRNA ligates nucleotides in the hairpin 2 region. It further includes at least three PS bonds. In some embodiments, the sgRNA is located at the top. It further includes at least three PS bonds that link nucleotides in the region. Morphologically, sgRNA is a compound of Cas9 and ribonucleoprotein in S. pyogenes. It forms a qualitative complex. [Brief explanation of the drawing]

[0035] [Figure 1] Figure 1 shows the editing percentage of the mouse transthyretin (TTR) gene measured by next-generation sequencing (NGS) after transfection of Neuro2A cells with modified crRNA along with Cas9 mRNA and unmodified trRNA (TR000002). [Figure 2] Figure 2 shows the editing percentage of the mouse TTR gene measured by NGS after transfection of Neuro2A cells with modified trRNA along with unmodified crRNA (CR000686) and Cas9 mRNA. [Figure 3] Figure 3 shows the editing percentage of the mouse TTR gene measured by NGS after transfection of Neuro2A cells with Cas9 mRNA and crRNA and trRNA having GC pairing not observed in the parent sequence. [Figure 4] Figure 4 shows the editing percentage of the mouse TTR gene measured by NGS after transfection of Neuro2A cells with modified crRNA and trRNA along with Cas9 mRNA. The standard deviation is shown after the value. [Figure 5] Figure 5 shows the editing percentage of the mouse TTR gene measured by NGS after transfection of Neuro2A cells with modified sgRNA along with Cas9 mRNA. [Figure 6] Figure 6 shows the editing percentage of the mouse TTR gene measured by NGS after transfection of Neuro2A cells with modified crRNA and unmodified trRNA (TR000002) along with Cas9 mRNA. Asterisks indicate dual guides that did not show activity in this experiment for technical reasons. These dual guides were tested again in the experiment shown in Figure 9 and showed editing activity in that test. [Figure 7] Figure 7 shows the editing percentage of the mouse TTR gene measured by NGS after transfection of Neuro2A cells with Cas9 mRNA along with unmodified crRNA (CR000686) and modified trRNA. [Figure 8] Figure 8 shows the editing percentage of the mouse TTR gene measured by NGS after transfection of Neuro2A cells using Cas9 mRNA and crRNA and trRNA pairings with GC pairing or GU mismatches not observed in the parent sequence. [Figure 9] Figure 9 shows the editing percentage of the mouse TTR gene measured by NGS after transfection of Neuro2A cells with modified crRNA and modified trRNA along with Cas9 mRNA. The standard deviation is shown after the value. [Figure 10] Figure 10 shows the editing percentage of the mouse TTR gene measured by NGS after transfection of Neuro2A cells with modified sgRNA along with Cas9 mRNA. [Figure 11] Figure 11 shows the editing percentage of the mouse factor VII (FVII) gene measured by NGS after transfection of Neuro2A cells with modified sgRNA along with Cas9 mRNA. [Figure 12A] Figure 12A shows the edit percentage of mouse TTR measured by NGS after transfection of Neuro2A cells with modified crRNA and unmodified trRNA along with Cas9 mRNA. [Figure 12B] Figure 12B shows the edit percentage of FVII measured by NGS after transfection of Neuro2A cells with modified crRNA and unmodified trRNA along with Cas9 mRNA. [Figure 13A] Figure 13A shows the edit percentage of mouse TTR measured by NGS after transfection of Neuro2A cells with modified and unmodified crRNA along with Cas9 mRNA. [Figure 13B] Figure 13B shows the edit percentage of FVII measured by NGS after transfection of Neuro2A cells with modified trRNA and unmodified crRNA along with Cas9 mRNA. [Figure 14A]Figure 14A shows serum interferon-alpha (IFN-alpha) levels after in vivo administration of LNPs containing Cas9 mRNA and sgRNA. [Figure 14B] Figure 14B shows serum interleukin-6 (IL-6) levels after in vivo administration of LNPs containing Cas9 mRNA and sgRNA. [Figure 14C] Figure 14C shows serum monocyte chemotactic protein 1 (MCP-1) levels after in vivo administration of LNPs containing Cas9 mRNA and sgRNA. [Figure 14D] Figure 14D shows serum tumor necrosis factor alpha (TNF-alpha) levels after in vivo administration of LNPs containing Cas9 mRNA and sgRNA. [Figure 15A] Figure 15A shows the in vivo results after administration of LNPs containing Cas9 mRNA and sgRNA. Figure 15A shows the total editing percentage in the liver. [Figure 15B] Figure 15B shows in vivo results after administration of LNPs containing Cas9 mRNA and sgRNA. Figure 15B shows serum TTR levels. [Figure 15C] Figure 15C shows the in vivo results after administration of LNPs containing Cas9 mRNA and sgRNA. Figure 15C shows the mean and standard deviation of the results in Figure 15A. [Figure 15D] Figure 15D summarizes the modifications to G000209 sgRNA (SEQ ID NO: 228). Nucleotides in bold are 2'-O-Me modified. [Figure 15E] Figure 15E summarizes the modifications to G000267 sgRNA (SEQ ID NO: 234). Nucleotides in bold are 2'-O-Me modified. [Figure 16A] Figure 16A shows serum interferon-alpha (IFN-alpha) levels after in vivo administration of LNPs containing Cas9 mRNA and sgRNA. [Figure 16B]Figure 16B shows serum tumor necrosis factor alpha (TNF-alpha) levels after in vivo administration of LNPs containing Cas9 mRNA and sgRNA. [Figure 16C] Figure 16C shows serum interleukin-6 (IL-6) levels after in vivo administration of LNPs containing Cas9 mRNA and sgRNA. [Figure 16D] Figure 16D shows serum monocyte chemotactic protein 1 (MCP-1) levels after in vivo administration of LNPs containing Cas9 mRNA and sgRNA. [Figure 17A] Figure 17A shows the in vivo results after administration of LNPs containing Cas9 mRNA and sgRNA. Figure 17A shows the total editing percentage in the liver. [Figure 17B] Figure 17B shows the in vivo results after administration of LNPs containing Cas9 mRNA and sgRNA. Figure 17B shows the mean and standard deviation of the results in Figure 17A. [Figure 17C] Figure 17C shows the in vivo results after administration of LNPs containing Cas9 mRNA and sgRNA. Figure 17C shows serum TTR levels. [Figure 17D] Figure 17D shows the in vivo results after administration of LNPs containing Cas9 mRNA and sgRNA. Figure 17D shows the mean and standard deviation of the results in Figure 17B. [Figure 18A] Figure 18A shows in vivo results after administration of LNPs containing Cas9 mRNA and sgRNA. Figure 18A shows the percentage of total editing in the liver. MPK = milligrams / kilogram; BLOD = below detection level. [Figure 18B] Figure 18B shows in vivo results after administration of LNPs containing Cas9 mRNA and sgRNA. Figure 18B summarizes the liver editing data. MPK = milligrams / kilogram; BLOD = below detection level. [Figure 18C]Figure 18C shows in vivo results after administration of LNPs containing Cas9 mRNA and sgRNA. Figure 18C shows serum TTR levels. MPK = milligrams / kilogram; BLOD = below detection level. [Figure 19A] Figure 19A shows serum interferon-alpha (IFN-alpha) levels after in vivo administration of LNPs containing Cas9 mRNA and sgRNA. [Figure 19B] Figure 19B shows serum monocyte chemotactic protein 1 (MCP-1) levels after in vivo administration of LNPs containing Cas9 mRNA and sgRNA. [Figure 19C] Figure 19C shows serum interleukin-6 (IL-6) levels after in vivo administration of LNPs containing Cas9 mRNA and sgRNA. [Figure 19D] Figure 19D shows serum tumor necrosis factor alpha (TNF-alpha) levels after in vivo administration of LNPs containing Cas9 mRNA and sgRNA. [Figure 20A] Figure 20A shows editing of the FVII locus in the liver after in vivo administration of LNPs containing Cas9 mRNA and sgRNA. [Figure 20B] Figure 20B shows editing of the TTR locus in the liver after in vivo administration of LNPs containing Cas9 mRNA and sgRNA. [Figure 21A] Figure 21A shows a diagram of the annotated sgRNA (SEQ ID NO: 341). [Figure 21B] Figure 21B shows diagrams of dgRNA CR000686 (SEQ ID NO: 1) and TR000002 (SEQ ID NO: 188) without annotations. [Figure 21C] Figure 21C shows diagrams of the annotated dgRNAs CR000686 (SEQ ID NO: 1) and TR000002 (SEQ ID NO: 188). [Figure 22A] Figure 22A shows the in vivo results after administration of LNPs containing Cas9 mRNA and sgRNA. Figure 22A shows the percentage of total editing of TTR loci in the liver. [Figure 22B] Figure 22B shows the in vivo results after administration of LNPs containing Cas9 mRNA and sgRNA. Figure 22B summarizes the liver editing data. [Figure 22C] Figure 22C shows in vivo results after administration of LNPs containing Cas9 mRNA and sgRNA. Figure 22C shows serum TTR levels. [Figure 23A] Figure 23A shows the in vivo results after administration of LNPs containing Cas9 mRNA and sgRNA. Figure 23A shows the percentage of total editing of TTR loci in the liver. [Figure 23B] Figure 23B shows the in vivo results after administration of LNPs containing Cas9 mRNA and sgRNA. Figure 23B summarizes the liver editing data. [Figure 23C] Figure 23C shows in vivo results after administration of LNPs containing Cas9 mRNA and sgRNA. Figure 23C shows serum TTR levels. [Figure 24A] Figure 24A shows editing in primary mouse hepatocytes after administration of LNPs containing Cas9 mRNA and sgRNA. Figure 24A shows the editing percentage of total editing at the TTR locus. [Figure 24B] Figure 24B shows editing in primary mouse hepatocytes after administration of LNPs containing Cas9 mRNA and sgRNA. Figure 24B also shows the normalized transformation of the editing percentage as a function of mRNA dose used to calculate EC50. [Figure 24C] Figure 24C shows editing in primary mouse hepatocytes after administration of LNPs containing Cas9 mRNA and sgRNA. Figure 24C shows the EC50 values ​​for the LNPs tested. [Modes for carrying out the invention]

[0036] Dual guide RNA and single guide RNA for use in gene editing methods Modification guide RNAs containing NA are provided herein. The modification guides are their unmodified counterparts Compared to the original, it is more stable and has improved in vitro efficacy and in vitro efficacy. The efficacy of ivo is demonstrated. The sequences of the manipulated and tested guide RNAs are shown in Table 4. [Table 1] JPEG0007899270000002.jpg255157JPEG0007899270000003.jpg255156JPEG0007899270000004.jpg255157JPE G0007899270000005.jpg255156JPEG0007899270000006.jpg255156JPEG0007899270000007.jpg255157JPEG000 7899270000008.jpg255157JPEG0007899270000009.jpg255157JPEG0007899270000010.jpg255157JPEG0007899 270000011.jpg255157JPEG0007899270000012.jpg255157JPEG0007899270000013.jpg255157JPEG00078992700 00014.jpg255156JPEG0007899270000015.jpg255156JPEG0007899270000016.jpg255156JPEG00078992700000 17.jpg255148JPEG0007899270000018.jpg255148JPEG0007899270000019.jpg255153JPEG0007899270000020.j pg255153JPEG0007899270000021.jpg255153JPEG0007899270000022.jpg255153JPEG0007899270000023.jpg25 5153JPEG0007899270000024.jpg255153JPEG0007899270000025.jpg255152JPEG0007899270000026.jpg255139

[0037] "Guide RNA" and "gRNA" are collectively referred to as sgRNA and trRNA (trac). (also known as rRNA) or crRNA (also known as CRISPR RNA) The terms crRNA and trRNA are used interchangeably in this specification to refer to either one. They often associate with a single RNA molecule (single guide RNA [sgRNA]), and These may be present in two separate RNA molecules (dual guide RNA [dgRNA]). "Guide RNA" or "gRNA" refers to each type.

[0038] The trRNA sequence may be naturally occurring, or the trRNA sequence may be naturally occurring It may include modifications or variations compared to the existing sequence.

[0039] In this specification, the terms "editing efficiency," "editing percentage," or "editing percentage" are used in a different sense. "Point" is the number of sequence reads relative to the target region after cleavage by Cas RNP. This is the total number of sequence reads that contain nucleotide insertions or deletions.

[0040] As used herein, "hairpin" refers to a nucleic acid chain folding into another section of the same chain. A hairpin represents a loop of nucleic acid formed when it forms a base pair with a base. They may form structures that include shape. In some embodiments, the hairpin includes an RNA loop. That's fine. A hairpin is a single nucleic acid molecule that has been bound together, and the molecular folds Formed by two complementary sequences, along with a wrinkling or link ring. This is possible. In some embodiments, the hairpin includes a stem or stem-loop structure.

[0041] As used herein, “region” refers to a conserved group of nucleic acids. A region is also called a “module.” These are sometimes called "domains" or "regions" of gRNA. These regions of gRNA are areas that perform specific functions. There are such cases, for example, described in Briner AE et al., Molecular Cell 56: 333-339 (2014). To do this, the endonuclease activity of RNP is directed. The gRNA regions are shown in Tables 1-3. It will be listed.

[0042] As used herein, “ribonucleoprotein” (RNP) or “RNP complex” refers to, for example, For example, it represents gRNA that has been combined with nucleases such as Cas proteins. Morphologically, RNPs contain Cas9 and gRNA.

[0043] As used herein, “stem-loop” refers to a salt ending in a loop of non-paired nucleic acid. This shows the secondary structure of nucleotides that form a "stem" by forming a base pair. The stem is the same nucleus If the sequences of two regions of the acid chain are at least partially complementary when read in opposite directions. It may form in the following place. As used herein, "loop" refers to the place where the stem caps. This represents a region of nucleotides that do not form a base pair (i.e., are not complementary). "Tetraloop" refers to a loop of four nucleotides. As used herein, s The upper stem of the gRNA may contain a tetraloop.

[0044] In certain embodiments involving dgRNA, the “stem” region as used herein is: A specific region of crRNA and a specific region of trRNA (for example, the lower part of each RNA) Two nucleotides that form a region by forming a base pair between the stem region and the upper stem region. The following structure is shown. The "stem" region of dgRNA is referred to as the "flagpole" in this technical field. It may also be called the "domain."

[0045] As used herein, “treatment” refers to any therapeutic administration for a disease in the subject or It includes topical application and also suppresses disease, inhibits its progression, and alleviates one or more symptoms of the disease. This includes alleviating symptoms, curing a disease, or preventing the recurrence of one or more symptoms of a disease. nothing.

[0046] 1. Types of Modifications A. 2'-O-methyl modification Modified sugars have oligonucleotide binding affinity for the complementary chain and a duplex form. The sugar ring of a nucleotide is a physical property that affects its formation and interaction with nucleases. It is thought that substitutions on the sugar ring control the puckering of these sugars. The confirmation and puckering can be altered. For example, 2'-O-methyl(2' -O-Me) modification increases oligonucleotide binding affinity and nuclease stability. This can be done, but as shown in the examples, at a given position in the oligonucleotide The effect of any modification in this case must be determined empirically.

[0047] The terms "mA", "mC", "mU", or "mG" are modified by 2'-O-Me. It is sometimes used to represent a nucleotide.

[0048] The modification of ribonucleotides as 2'-O-methylribonucleotides is described below. Can be copied: [ka]

[0049] B. 2'-O-(2-methoxyethyl) modification In some embodiments, the modification is 2'-O-(2-methoxyethyl)(2'-O-moe) It may also be the case that the modification of the ribonucleotide as a 2'-O-moe ribonucleotide is It can be described as follows: [ka]

[0050] The terms "moeA", "moeC", "moeU", or "moeG" are 2' It is sometimes used to represent nucleotides modified with -O-moe.

[0051] C.2'-Fluoromodification Another chemical modification that has been shown to affect the sugar ring of nucleotides is halogen substitution. Yes. For example, a 2'-fluoro(2'-F) substitution on the sugar ring of a nucleotide is an oligonucleotide. This can increase the binding affinity and nuclease stability of rheotides.

[0052] In this application, the terms "fA", "fC", "fU", or "fG" are defined as 2' It is sometimes used to represent nucleotides substituted with -F.

[0053] The 2'-F substitution can be described as follows: [ka]

[0054] D. Phosphothioate modification Phosphothioate (PS) linkage or binding occurs in phosphodiester linkage, for example, nucleation This refers to a bond in which one non-crosslinked phosphate oxygen atom in the bond between rheotide bases is substituted by sulfur. When phosphorothioates are used to generate oligonucleotides, modified oligonucleotides Nucleotides are sometimes referred to as S-oligonucleotides.

[0055] "*" may be used to describe PS modifications. In this application, A*, C The terms *, U*, or G* refer to the following (e.g., 3') nucleotide linked by a PS bond. It is sometimes used to represent linked nucleotides.

[0056] In this application, the terms "mA*", "mC*", "mU*", or "mG*" are defined as follows: Substituted with 2'-O-Me and linked to the next (e.g., 3') nucleotide by a PS bond. It is sometimes used to represent a nucleotide. Similarly, "fA*", "fC*" The terms "fU*" or "fG*" are replaced with 2'-F, and the following (e.g., 3 It is sometimes used to represent a nucleotide linked to a nucleotide by a PS bond. Yes. PS linkages or equivalents are included in the embodiments described herein.

[0057] The following diagram illustrates the de-binding by S- that generates a PS bond instead of a phosphodiester bond. This shows substitution with bridged phosphate oxygen: [ka]

[0058] EG-C substitution In some embodiments, the gRNA is modified by sequence substitutions that do not involve chemical modifications. In some embodiments, the modified gRNA is not found in the parent gRNA sequence (for example). , operated using GC pairing (in the lower stem region and / or upper stem region) In some embodiments, the modified gRNA is not found in the parent gRNA sequence. Operated by GU mismatch ("GU wobble" or mismatch pairing) ru.

[0059] F. Inverse debase modification Debasic nucleotides refer to nucleotides that lack a nitrogenous base. The diagram below shows a nucleotide lacking a base. Describe an oligonucleotide having a debasement site (also known as a depurinement site): [ka]

[0060] Inverted bases are a reversed linkage from the usual 5' to 3' linkage (i.e., 5' to 5'). This refers to a base that has either a linkage to or a 3'-to-3' linkage. For example: [ka]

[0061] Debasic nucleotides can be joined by inverse linkage. For example, debasic nuclei Otide is bound to the terminal 5' nucleotide via a 5'-to-5' linkage. There is a debasal nucleotide, or the terminal 3' nucleus is connected via a 3'-to-3' linkage. It may bind to a rheotide. Either the 5' or 3' nucleotide at the terminal end. In this context, inverted debasic nucleotides are sometimes also called inverted debasic terminal caps. In the application, the term "invd" refers to inverted debasalized nucleotide ligation.

[0062] The above modifications and their equivalents are included within the scope of the embodiments described herein. ru.

[0063] 2. Guide RNA composition The composition includes a guide RNA. In some embodiments, the guide RNA is trR Contains NA. In some embodiments, the guide RNA includes crRNA. In some embodiments In some embodiments, the guide RNA includes crRNA and trRNA. NA contains both crRNA and trRNA on a single RNA molecule as sgRNA. In one embodiment, the guide RNA is placed on two RNA molecules as dgRNA and crRNA and trRNA. In dgRNA, two RNA molecules interact via base pairing. You may meet.

[0064] In some embodiments, the guide RNA includes a 5' terminal region. The doRNA does not contain a 5' terminal region. In some embodiments, the 5' terminal region is sgRNA. Regarding (however, applicable to all guide RNAs in this specification) Briner AE It includes the “spacer” region described in et al., Molecular Cell 56: 333-339 (2014). In some embodiments, the 5' terminal region includes a 5' terminal modification. It also has a spacer region. The 5' terminal region that does not contain crRNA, trRNA, sgRNA, and / or dg It may be associated with RNA. The spacer region is sometimes referred to herein as its It is also referred to by others as the "guide area," "guide domain," or "targeting domain." As used herein, "target sequence" refers to a nucleus for cleavage of a guide region / domain. This refers to the nucleic acid sequence that directs the enzyme toward it. In some embodiments, spyCas9 Proteins use nucleotides present in the spacer region to target the target sequence of the target nucleic acid molecule. It may be directed by a guide region / domain. In some embodiments, the guide RN A does not include the spacer area.

[0065] In some embodiments, the guide RNA described herein is a sequence of the type shown in Table 4. It includes or consists of any of the following. However, the array is a guide / spacer region. When indicating this, acknowledge that the composition may or may not include this region. It should be noted that this should be done. Furthermore, as shown in Table 4, in Table 4, the sequence number is particularly The guide RNA contains one of the modifications among the defined sequences. That is, the nucleus The rheotides may be the same or different, but the modification pattern shown is The modification pattern of the guide sequence in Table 4 may be the same as or similar to that of the guide sequence in Table 4. The ornamentation pattern is determined by the relative position and identity of the gRNA modification or the region of the gRNA (e.g., 5' terminal region, lower stem region, bulge region, upper stem region, nexus region, hairpin It includes region 1, hairpin region 2, and 3' terminal region. In some embodiments, the modification pattern is , any one modification of the sequences shown in the sequence column of Table 4, or one or more of those sequences This is at least 50%, 55%, 60%, 70%, 75%, and 80% of the modifications across multiple domains. Contains %, 85%, 90%, 95%, 96%, 97%, 98%, and 99%. In this embodiment, the modification pattern is one of the sequences shown in the sequence column of Table 4. For modification patterns, at least 50%, 55%, 60%, 70%, 75%, 80%, 8 5%, 90%, 95%, 96%, 97%, 98%, and 99% are identical. Some implementations Morphologically, the modification pattern is one or more regions of the sequence shown in Table 4, for example, 5' Terminal region, lower stem region, bulge region, upper stem region, nexus region, hairpin 1 region At least 50% and 55% across the region, hairpin 2 region, and / or 3' terminal region. 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% , and are 99% identical. For example, in some embodiments, the modification pattern is in the 5' terminal region. For modification patterns of sequences spanning, at least 50%, 55%, 60%, 70%, 75% %, 80%, 85%, 90%, 95%, 96%, 97%, 98%, and 99% are identical. A guide RNA is included. In some embodiments, the modification pattern extends to the lower stem. at least 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95% This includes guide RNAs that are identical by %, 96%, 97%, 98%, and 99%. In this embodiment, the modification pattern covers at least 50%, 55%, 60% of the bulge. 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, and 9 Guide RNAs that are 9% identical are included. In some embodiments, the modification pattern is upper At least 50%, 55%, 60%, 70%, 75%, 80%, 85% across the system. Includes guide RNAs that are 90%, 95%, 96%, 97%, 98%, and 99% identical. In some embodiments, the modification pattern covers at least 50% of the nexus, 5 5%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 9 Guide RNAs that are 8% and 99% identical are included. In some embodiments, modified The turn spans at least 50%, 55%, 60%, 70%, 75%, and 8% of the hairpin 1. Guys who are 0%, 85%, 90%, 95%, 96%, 97%, 98%, and 99% identical The dry RNA is included. In some embodiments, the modification pattern is minimal across the hairpin 2. At least 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 9 Guide RNAs that are 6%, 97%, 98%, and 99% identical are included. Morphologically, the modification pattern is at least 50%, 55%, 60%, 70% across the 3' terminology. %, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, and 99% The same guide RNA is included. In some embodiments, the modification pattern is 0, 1 The sequences in Table 4 for 1, 2, 3, 4, 5, or 6 nucleotides, or Such regions of the sequence (e.g., 5' terminus, lower stem, bulge, upper stem, nexus) The modification pattern differs from that of hairpin 1, hairpin 2, and 3' end. In some embodiments, gRNA consists of 0, 1, 2, 3, 4, 5, or 6 nucleotides. This includes modifications different from the sequence modifications shown in Table 4. In some embodiments, the gRNA has 0, 1 Regions of the sequences in Table 4 in 1, 2, 3, 4, 5, or 6 nucleotides (e.g.) For example, 5' end, lower stem, bulge, upper stem, nexus, hairpin 1, hairpin 2 This includes modifications different from those of the 3' terminology.

[0066] In some embodiments, the gRNA is a 2'-O-methyl (2'-O-Me) modified nucleoty It contains. In some embodiments, the gRNA is 2'-O-(2-methoxyethyl)(2'- It contains O-moe) modified nucleotides. In some embodiments, the gRNA is 2'-fluoro It contains (2'-F) modified nucleotides. In some embodiments, the gRNA is internucleotide It contains a phosphorothioate (PS) bond.

[0067] In some embodiments, the gRNA has 5'-terminal modifications, 3'-terminal modifications, or 5'-terminal modifications. and 3' terminal modifications. In some embodiments, 5' terminal modifications are internucleotide phosphatase. Contains a holothioate (PS) bond. In some embodiments, the 5'-terminus modification is 2'-O- Methyl (2'-O-Me), 2'-O-(2-methoxyethyl)(2'-O-moe), and / or 2'-fluoro(2'-F) modified nucleotides. In some embodiments, The 5' terminal modification consists of at least one phosphorothioate (PS) bond and 2'-O- Methyl (2'-O-Me), 2'-O-(2-methoxyethyl)(2'-O-moe), and / or one or more of the 2'-fluoro(2'-F) modified nucleotides , includes. Terminal modifications include phosphorothioate (PS), 2'-O-methyl (2'-OM). e) 2'-O-(2-methoxyethyl)(2'-O-moe), and / or 2'- Fluoro(2'-F) modifications may be included. Equivalent terminal modifications are also described herein. This is included in the embodiments. In some embodiments, the gRNA is one or more gRNAs. Includes terminal modifications in combination with region modifications.

[0068] A. sgRNA composition In some embodiments, the compositions and methods of the present invention use a nuclease such as Cas9 as a target. It contains gRNAs, including crRNAs and trRNAs that direct the DNA sequence to a target DNA sequence. In this application, the gRNA described herein is a single RNA molecule (single guide RNA). Alternatively, it may be associated with sgRNA.

[0069] In some embodiments, the present invention relates to the sequences described in sequence numbers 228 to 332. Contains either one of the above or an sgRNA consisting of either one.

[0070] In some embodiments, sequence numbers 235-240, 265-285, and 309-32 An sgRNA containing any one of the nine modified sequences is provided. In some embodiments, Among the modified sequences of sequence numbers 235-240, 265-285, and 309-329 An sgRNA containing one of the following, which is complementary to the target sequence, and which has Cas9 It further includes a 5' "spacer" array ("guide array") that directs the cutting towards the target. sgRNA is included. In some cases, the present invention relates to sequence numbers 235-240, 265 For any one nucleic acid of ~285 and 309~329, at least 99, 98, 97, 96, 95, 94, 93, 92, 91, 90, 85, 80, 75, or 70% It contains nucleic acids of the same identity, and its modification pattern is the same as the modification pattern shown in the reference sequence identifier. It contains sgRNA, which is a single entity.

[0071] 1. sgRNA domain Briner AE et al., Molecular Cell 56: 333-339 (2014) describes the "s" involved in targeting. Pacer domain, lower stem, bulge, upper stem (including tetraloop) (In some cases) "Nexus", as well as the "Hairpin 1" domain and "Hairpin 2" Functional domains of sgRNA such as domains (referred to as "domains" in this specification) ) is described. See Briner et al., p. 334, Figure 1A.

[0072] Table 1 and Figure 21A provide a description of the sgRNA domains used herein. In Table 1, "n" between regions represents a variable number of nucleotides, for example, from 0 to 1, 2, 3 , 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, Represents 19, 20, or more nucleotides. In some embodiments, n is 0. They are equal. In some embodiments, n is equal to 1. [Table 2]

[0073] a) 5’ end edge area In some embodiments, the sgRNA has a nucleo at its 5' end as shown in Table 1. Contains cytoplasm. In some embodiments, the 5' end of the sgRNA targets the Cas protein. Includes a spacer or guide region that functions to orient the creotide sequence. In some embodiments, the 5' end does not include a spacer or guide region. The 5' terminus functions to direct the Cas protein towards the target nucleotide region. Includes no spacers and additional nucleotides.

[0074] In some embodiments, the guide region is the first 1 to 10 at the 5' end of the sgRNA. , 11, 12, 13, 14, 15, 16, 17, 18, 19, or It contains 20 nucleotides. In some embodiments, the guide region contains 20 nucleotides. In some embodiments, the guide area has 5, 6, 7, 8, 9, 10, and 11 sections. pieces, 12 pieces, 13 pieces, 14 pieces, 15 pieces, 16 pieces, 17 pieces, 18 pieces, 19 pieces, 20 pieces, 21 pieces Contains 1, 22, 23, 24, or 25 or more nucleotides However, in some embodiments, the guide region may contain 17 nucleotides. In some embodiments, the guide region may contain 18 nucleotides. Therefore, the guide region may contain 19 nucleotides.

[0075] In some embodiments, the selection of a guide region is based on a target sequence within the gene of interest for editing. Determined based on the following. For example, in some embodiments, the sgRNA is a target of the gene in question. The sequence includes a complementary guide region.

[0076] In some embodiments, the target sequence in the gene of interest is complementary to the guide region of the sgRNA. It may be present. In some embodiments, the guide region of the sgRNA and its pair in the target gene The degree of complementarity or identity with the corresponding target sequence is approximately 50%, 55%, 60%, and 65%. 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, Or it may be 100%. In some embodiments, the guide region and pair of sgRNA The target regions of elephant genes may be 100% complementary or identical. In other embodiments, The guide region of the sgRNA and the target region of the target gene must have at least one mismatch. It may contain. For example, the guide region of sgRNA and the target sequence of the target gene may be The total length of the target sequence is at least approximately 17, 18, 19, 20 or more bases. If they are in pairs, there can be 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. It may contain a mismatch of the sgRNA guide region and target. In some embodiments, the sgRNA guide region and target The target region of the gene may contain 1 to 6 mismatches when the guide sequence contains at least about 17, 18, 19, 20 or more nucleotides. In some embodiments, when the guide region of the sgRNA and the target region of the target gene contain about 20 nucleotides, the guide sequence may contain 1, 2, 3, 4, 5, or 6 mismatches. The 5' end may contain nucleotides that are not considered part of the guide region (i.e., do not function to direct the Cas 9 protein to the target nucleic acid). 9 protein to the target nucleic acid).

[0077] b) Lower stem In some embodiments, the sgRNA contains a lower stem (LS) region that is separated from the bulge and upper stem regions when viewed linearly. See Table 1.

[0078] In some embodiments, the lower stem region contains 1 to 12 nucleotides. For example, in one embodiment, the lower stem region contains LS1-LS12. In some embodiments, the lower stem region contains fewer nucleotides than shown in Table 1 and FIG. 21A. In some embodiments, the lower stem region contains more nucleotides than shown in Table 1 and FIG. 21A. When the lower stem region contains fewer or more nucleotides than shown in the schematics of Table 1 and FIG. 21A, the modification pattern should be maintained, as will be apparent to those skilled in the art.

[0079] In some embodiments, the lower stem region has nucleotides whose nucleic acid sequences are complementary when read in the opposite direction. In some embodiments, the complementarity in the nucleic acid sequence of the lower stem leads to the secondary structure of the stem in the sgRNA (e.g., when the regions base pair with each other in the sgRNA).​​​​​​​​ (There is). In some embodiments, the lower stem regions are completely adjacent to each other when read in opposite directions. They do not need to be complementary.

[0080] c) Bulge In some embodiments, the sgRNA has a bulge region containing six nucleotides B1-B6. This includes the bulge region, which, when viewed linearly, is separated into two regions. See Table 1. In some embodiments, the bulge region contains six nucleotides, with the first two nucleotides being... The do is followed by the upper stem region, which contains the last four nucleotides of the bulge. This is followed. In some embodiments, the bulge region is larger than shown in Table 1 and Figure 21A. It contains a small number of nucleotides. In some embodiments, the bulge region is shown in Table 1 and Figure 21A. It contains more nucleotides than indicated. The bulge region is shown in Table 1 and the diagram in Figure 21A. If it contains fewer or more nucleotides than the modified nucleotides, as will be obvious to those skilled in the art, The pattern should be maintained.

[0081] In some embodiments, the presence of a bulge indicates that the upper stem module and lower stem module in the sgRNA are separated. This results in a directional kink between the Tem module and the other modules.

[0082] d) Upper stem In some embodiments, the sgRNA includes an upper stem region containing 12 nucleotides. In some embodiments, the upper stem region includes a loop array. In some cases, the loop This is a tetraloop (a loop consisting of four nucleotides).

[0083] In some embodiments, the upper stem region is smaller than shown in Table 1 and Figure 21A. It contains nucleotides. In some embodiments, the upper stem region contains more nucleotides than shown in Table 1 and FIG. 21A. If the upper stem region contains fewer or more nucleotides than shown in the schematic of Table 1 and FIG. 21A, as will be apparent to those skilled in the art, the modification pattern should be maintained.

[0084] In some embodiments, the upper stem region has nucleotides whose nucleic acid sequences are complementary when read in the opposite direction. In some embodiments, the complementarity in the nucleic acid sequence of the upper stem leads to the secondary structure of the stem in the sgRNA (e.g., if the regions base pair with each other). In some embodiments, the upper stem region may not be completely complementary to each other when read in the opposite direction.

[0085] e) Nexus In some embodiments, the sgRNA contains a nexus region located between the lower stem region and the hairpin 1 region. In some embodiments, the nexus contains 18 nucleotides. In some embodiments, the nexus region contains nucleotides N1 to N18, as shown in Table 1 and FIG. 21A.

[0086] In some embodiments, the nexus region contains fewer nucleotides than shown in Table 1 and FIG. 21A. In some embodiments, the nexus region contains more nucleotides than shown in Table 1 and FIG. 21A. If the nexus region contains fewer or more nucleotides than shown in the schematic of Table 1 and FIG. 21A, as will be apparent to those skilled in the art, the modification pattern should be maintained.

[0087] In some embodiments, the nexus region is such that when read in the opposite direction, the nucleic acid sequence is complementary to the nexus region. It contains a creotide. In some embodiments, complementarity in nucleic acid sequences is found in sgRNA. Connects to the secondary structure of the stem and / or stem loop (for example, a certain in the nexus region) Certain nucleotides may form base pairs with each other. In some embodiments, nexa The S regions do not need to be completely complementary to each other when read in opposite directions.

[0088] f) hairpin In some embodiments, the sgRNA includes one or more hairpin regions. In some embodiments, the hairpin region is located downstream of the nexus region (e.g., 3'). So, the nucleotide region immediately downstream of the nexus region is called "hairpin 1" or "H1" It is referred to as "hairpin 2". In some embodiments, the nucleotide region at 3' of hairpin 1 is called "hairpin 2". It is referred to as "H2". In some embodiments, the hairpin region is hairpin 1 and H Contains hairpin 2. In some embodiments, sgRNA contains only hairpin 1 or hairpin 2. include.

[0089] In some embodiments, the hairpin 1 region contains 12 nucleic acids immediately downstream of the nexus region. In some embodiments, the hairpin 1 region is as shown in Table 1 and Figure 21A. Contains creotides H1-1 to H1-12.

[0090] In some embodiments, hairpin 2 region contains 15 nucleic acids downstream of hairpin 1 region. In some embodiments, the hairpin 2 region is as shown in Table 1 and Figure 21A. Contains leotide H2-1 to H2-15.

[0091] In some embodiments, one or more nucleotides are hairpin 1 region and hairpin 2 region It exists between the two regions. One or more nuclei between hairpin region 1 and hairpin region 2. Otid may be modified or unmodified. In some embodiments, Hairpin 1 and hairpin 2 are separated by a single nucleotide. Partial implementation Morphologically, the hairpin region has fewer nucleotides than shown in Table 1 and Figure 21A. Includes. In some embodiments, the hairpin region is larger than shown in Table 1 and Figure 21A. Contains nucleotides. The hairpin region is less than shown in Table 1 and the diagram in Figure 21A. If it contains one or more nucleotides, as will be obvious to those skilled in the art, the modification pattern is maintained. It should be done.

[0092] In some embodiments, the hairpin region is a nucleic acid sequence that is complementary when read in the opposite direction. It contains creotide. In some embodiments, the hairpin region is mutual when read in opposite directions. They do not necessarily have to be perfectly complementary (for example, the top or loop of a hairpin may form a pair). (Contains nucleotides that have not been identified).

[0093] In some embodiments, the sgRNA includes a hairpin 1 substitution at the nucleotide "n". "n" is between 1 and 50, 40, 30, 20, 15, 10, 5, 4, 3, and 2. It is an integer. In some embodiments, the hairpin 1 region of sgRNA consists of 2 nucleotides. It will be replaced.

[0094] g) 3’ end edge area In some embodiments, the sgRNA contains a nucleotide after the hairpin region(s). In some embodiments, the 3' terminal region does not associate with the secondary structure of the hairpin, for example. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or 20 or more nucleotides. In some embodiments, the 3' terminal region is hair Contains one, two, three, or four nucleotides that do not associate with the secondary structure of the pin. In this embodiment, the 3' terminal region consists of four nucleotides that do not associate with the secondary structure of the hairpin. Includes. In some embodiments, the 3' terminal region is a single region that does not associate with the secondary structure of the hairpin. It contains two or three nucleotides.

[0095] 2. Modification of sgRNA In some embodiments, the present invention relates to the following regions: nucleotides at the 5' terminus; lower part Tem region; bulge region; upper stem region; nexus region; hairpin 1 region; hairpin 2 region Region; and one or more nucleotides within one or more nucleotides at the 3' terminus Contains sgRNA with modifications.

[0096] In some embodiments, the modification is a 2'-O-methyl (2'-O-Me) modified nucleotide. Includes. In some embodiments, the modification is 2'-O-(2-methoxyethyl)(2'-O-mo e) Contains modified nucleotides. In some embodiments, the modification is 2'-fluoro(2'-F) Contains modified nucleotides. In some embodiments, the modification is between nucleotides. Includes PS bonds.

[0097] In some embodiments, the sgRNA is the first four nucleotides at its 5' end. The modification is included in one, two, three, or four of the following. In some embodiments, 5' The first three or four nucleotides at the terminal, and the last three nucleotides at the 3' terminal. Or four nucleotides are modified. In some embodiments, the last nucleotide at the 5' end The first four nucleotides and the last four nucleotides at the 3' terminus are phosphorothiocyanate. They are linked by eth (PS) bonds. In some embodiments, the modification is 2'-O-Me Includes. In some embodiments, the modification includes 2'-F. In some embodiments, the modification is 2' -Includes O-moe

[0098] In some embodiments, the sgRNA has a capsule of the first four nucleotides at its 5' end. The modifier includes one, two, three, or four modifications. In some embodiments, sgRN A is one, two, three, or four of the first four nucleotides at the 3' end. In some embodiments, the first four nucleotides at the 5' terminus The last four nucleotides at the do and 3' ends are linked by PS bonds. and the first three nucleotides at the 5' terminus and the last three nucleotides at the 3' terminus Cleotides contain 2'-O-Me or 2'-O-moe modifications.

[0099] In some embodiments, the first four nucleotides at the 5' end and the 3' end The last four nucleotides are linked by PS bonds, and at the 5' terminus The first three nucleotides and the last three nucleotides at the 3' end are 2'-F Includes modifications.

[0100] In some embodiments, LS1, LS6, LS7, LS8, LS11, and LS12 are sgRNA modified with 2'-O-Me is provided. In some embodiments, sgR Each nucleotide in the bulge region of NA is modified with 2'-O-Me. In this embodiment, each nucleotide in the upper stem region of the sgRNA is 2'-O- It is modified with Me. In some embodiments, N16,N in the nexus region of the sgRNA. 17 and N18 are modified with 2'-O-Me. In some embodiments, sgRN Each nucleotide in the hairpin 1 region of A is modified with 2'-O-Me. In one embodiment, each of the nucleotides in the hairpin 2 region of the sgRNA is 2'-O It is modified with -Me.

[0101] In some embodiments, the sgRNA consists of the following nucleotides: the first three at the 5' end. Nucleotides; LS1, LS6, LS7, LS8, LS11, and LS12; B1 and B2 in the di region; each of the nucleotides in the upper stem region of the sgRNA; Nucleotides N16, N17, and N18 in the nexus region; Nucleotides in the hairpin 1 region Each of the nucleotides in the hairpin 2 region; and the last 4 at the 3' terminus. Each nucleotide contains a 2'-O-Me modified nucleotide.

[0102] In some embodiments, the sgRNA has the first four nucleotides linked at its 5' end. The three phosphorothioate (PS) bonds that connect and the last four nuclei at the 3' terminus It further includes three PS bonds that link the rheotide. In some embodiments, the sgRNA is 2'-O-Me or 2'-F modification in the first three nucleotides at the 5' terminus. Nucleic acids, and the last four nucleotides at the 3' terminus contain 2'-O-Me or The present invention further comprises 2'-F modified nucleic acids. In some embodiments, LS9 and LS10 are 2'-F It is modified by. In some embodiments, N15, N16, N17, and N18 are 2' Modified with -F. In some embodiments, H2-9, H2-10, H2-11, H2 -12, H2-13, HS-14, and H2-15 are modified with 2'-F. In this embodiment, the second to last, third to last, and fourth to last at the 3' end The first nucleotide is modified with 2'-F.

[0103] In some embodiments, the following nucleotides: LS9 and LS10 in the lower stem region ;N15, N16, N17, and N18 in the nexus region; and in the hairpin 2 region H2-9, H2-10, H2-11, H2-12, H2-13, HS-14, and H In section 2-15, a single guide RNA (sgRNA) containing 2'-F modified nucleic acid is provided. In some embodiments, the sgRNA is located at the second to last position at the 3' end, and from the end. The third and fourth to last nucleotides further modify the 2'-F nucleotide. It includes. In some embodiments, sgRNA has the first four nucleotides at its 5' end. Three phosphorothioate (PS) bonds linking the dots and the last four at the 3' terminus It further includes three PS bonds that link the nucleotides. In some embodiments, sgRN A has 2'-O-Me or 2'- It further contains F-modified nucleic acids, and three of the last four nucleotides at the 3' end Further comprising 2'-O-Me or 2'-F modified nucleic acids.

[0104] In some embodiments, the first three nucleotides at the 5' terminus are 2'-O- Me-modified nucleotides and 2'-O-Me-modified nucleotides in LS1 and LS6 And, 2'-O-Me modified nucleotides in US1~US12, and H1-1~H1-1 2'-O-Me modified nucleotide in 2, and between hairpin 1 and hairpin 2 2'- O-Me modified nucleotides and 2'-O-Me modified nuclei at H2-1 to H2-15 Otide and the 2'-O-Me modified nucleotides in the last four nucleotides at the 3' terminus A single guide RNA (sgRNA) is provided, containing rheotide. Morphologically, sgRNA consists of three nucleotides that ligate the first four nucleotides at the 5' end. Phosphothioate (PS) bond and the last four nucleotides at the 3' terminus It further contains three PS bonds.

[0105] In some embodiments, the first three nucleotides at the 5' terminus are 2'-O- Me-modified nucleotides, 2'-F modified nucleotides in LS1-LS6, and US1 2'-O-Me modified nucleotides in ~US12 and in H1-1~H1-12 2'-O-Me modified nucleotide and 2 in "n" between hairpin 1 and hairpin 2 '-O-Me modified nucleotides and 2'-O-Me modified nucleotides in H2-1~H2-15 Cleotide and 2'-O-Me modification in the last four nucleotides at the 3' terminus. A single guide RNA (sgRNA) is provided, containing nucleotides. In this embodiment, the sgRNA has three nucleotides linked at the 5' end. Two phosphorothioate (PS) bonds and the last four nucleotides at the 3' terminus It further includes three PS bonds that connect them.

[0106] In some embodiments, the first three nucleotides at the 5' terminus are 2'-O- Me-modified nucleotides, 2'-F-modified nucleotides in LS2-LS5, and LS1 and 2'-O-Me modified nucleotides in LS6, and 2 in US1~US12 '-O-Me modified nucleotides and 2'-O-Me modified nucleotides in H1-1~H1-12 Cleotide and the 2'-O-Me modified nucleus at "n" between hairpin 1 and hairpin 2 The rheotide, the 2'-O-Me modified nucleotides at H2-1 to H2-15, and the 3' terminus. Includes 2'-O-Me modified nucleotides in the last four nucleotides at the end, Then, a single guide RNA (sgRNA) is provided. In some embodiments, sgR NA consists of three phosphorothioates that link the first four nucleotides at the 5' end. PS bond and three PS linking the last four nucleotides at the 3' terminus Further includes bonding.

[0107] In some embodiments, the first three nucleotides at the 5' terminus are 2'-O- Me-modified nucleotides and 2'-O-Me-modified nucleotides in US1-US12 , 2'-O-Me modified nucleotides in LS7, LS8, LS11, and LS12 And, the 2'-O-Me modified nucleotides in H1-1~H1-12, and hairpin 1 and The 2'-O-Me modified nucleotide at "n" between apin 2 and H2-1~H2- 15 is a 2'-O-Me modified nucleotide, and the last four nuclei are at the 3' terminus. The 2'-O-Me modified nucleotide in the ocide contains a single guide RNA ( An sgRNA is provided. In some embodiments, the sgRNA has the first at its 5' end. Three phosphorothioate (PS) bonds and a 3' terminus link the four nucleotides. It further includes three PS bonds that link the last four nucleotides in the given structure.

[0108] In some embodiments, the first three nucleotides at the 5' terminus are 2'-O- Me-modified nucleotides and 2'-O-Me-modified nucleotides in US1-US12 , 2'-O-Me modified nucleotides in LS8, LS10, and LS12, and LS 7, LS9, and LS11 2'-OF modified nucleotides, and H1-1~H1 -12 2'-O-Me modified nucleotide, and 2 between hairpin 1 and hairpin 2 '-O-Me modified nucleotides and 2'-O-Me modified nucleotides in H2-1~H2-15 Cleotide and 2'-O-Me modification in the last four nucleotides at the 3' terminus. A single guide RNA (sgRNA) is provided, containing nucleotides. In this embodiment, the sgRNA has three nucleotides linked at the 5' end. Two phosphorothioate (PS) bonds and the last four nucleotides at the 3' terminus It further includes three PS bonds that connect them.

[0109] In some embodiments, the first three nucleotides at the 5' terminus are 2'-O- Me-modified nucleotides and LS1, LS6, LS7, LS8, LS11, and LS12 2'-O-Me modified nucleotides in and 2'-O-Me in US1~US12 Modified nucleotides and 2'-O-Me modified nucleotides in H1-1 to H1-12 , 2'-O-Me modified nucleotide between hairpin 1 and hairpin 2, and H2-1~H2 -15 is a 2'-O-Me modified nucleotide, and the last four nuclei are at the 3' terminus. The 2'-O-Me modified nucleotide in the rheotide, and the single guide RNA (sgRNA) is provided. In some embodiments, the sgRNA has a 5' terminus. The first four nucleotides are linked by three phosphorothioate (PS) bonds and a 3' terminus. It further includes three PS bonds that link the last four nucleotides at the ends.

[0110] In some embodiments, the first three nucleotides at the 5' terminus are 2'-O- Me-modified nucleotides and LS1, LS6, LS7, LS8, LS11, and LS12 2'-O-Me modified nucleotides in and 2'-F modified nucleotides in LS9 and LS10 Modified nucleotides, 2'-O-Me modified nucleotides in US1-US12, and H1 2'-O-Me modified nucleotides in -1~H1-12, and hairpin 1 and hairpin 2 2'-O-Me modified nucleotides between and , and 2'-O- in H2-1~H2-15 Me-modified nucleotides and 2'-O at the last four nucleotides at the 3' terminus A single guide RNA (sgRNA) is provided, containing -Me-modified nucleotides. In some embodiments, the sgRNA has the first four nucleotides at its 5' end. Three phosphorothioate (PS) bonds are linked and the last four nuclei are at the 3' terminus. It further contains three PS bonds that link the creotides.

[0111] In some embodiments, the first three nucleotides at the 5' terminus are 2'-O- Me-modified nucleotides and 2'-O-Me-modified nucleotides in US1-US12 , 2'-O-Me modified nucleotides in H1-1~H1-12, and hairpin 1 and hair 2'-O-Me modified nucleotides between pin 2 and 2'- O-Me modified nucleotides and 2'-F modified nucleotides at H2-9 to H2-15 And the second to last, third to last, and fourth to last nuclei at the 3' terminus. In the ocide, the 2'-F modified nucleotide and the last nucleotide at the 3' terminus are It contains a 2'-O-Me modified nucleotide and a single guide RNA (sgRNA). ) is provided. In some embodiments, the sgRNA has the first four nuclei at the 5' end. Three phosphorothioate (PS) bonds linking the creotide and the 3' terminus It further includes three PS bonds that link the following four nucleotides.

[0112] In some embodiments, the first three nucleotides at the 5' terminus are 2'-O- Me-modified nucleotides and 2'-O-Me-modified nucleotides in US1-US12 , in H1-2, H1-4, H1-6, H1-8, H1-10, and H1-12 '-O-Me modified nucleotides and H1-1, H1-3, H1-5, H1-7, H1-9 , and the 2'-F modified nucleotide in H1-11, and hairpin 1 and hairpin 2 The 2'-F modified nucleotides in between, and H2-2, H2-4, H2-6, H2-8, H2-1 2'-F modified nucleotides at 0, H2-12, and H2-14, and H2-1, H For 2-3, H2-5, H2-7, H2-9, H2-11, H2-13, and H2-15 The 2'-O-Me modified nucleotides, the second to last at the 3' terminus, and the last The 2'-F modified nucleotide at the fourth nucleotide from the end, and the last nucleotide at the 3' end. The third to last and final nucleotide is a 2'-O-Me modified nucleotide, A single guide RNA (sgRNA) is provided, which includes s gRNA consists of three phosphorothiocyanates that ligate the first four nucleotides at the 5' end. EAT (PS) bond and three nucleotides linking the last four nucleotides at the 3' terminus Further includes PS bonding.

[0113] In some embodiments, nucleotides LS8, LS10, LS12, H1-2, H1-4 , H1-6, H1-8, H1-10, H1-12, H2-1, H2-3, H2-5, H2 -7, H2-9, H2-11, H2-13, and H2-15: 2'-O-Me modification Including ornaments, and LS7, LS9, LS11; H1-1, H1-3, H1-5, H1-7, H1-9, H1-11, H1-13, H2-2, H2-4, H2-6, H2-8, H2- Single guide RNA containing 2'-F modification in H2-10, H2-12, and H2-14 (sgRNA) is disclosed herein. In some embodiments, the sgRNA has a 5' terminus. Three phosphorothioate (PS) bonds link the first four nucleotides in It further includes three PS bonds that link the last four nucleotides at the 3' terminus. In some embodiments, the sgRNA has the last and third-to-last nucleotides at its 3' end. The creotide further contains a 2'-O-Me modified nucleotide, and at the 3' terminus The second to last and third to last nucleotides have 2'-F modified nucleotides. It also includes "do".

[0114] In some embodiments, sg contains any one nucleic acid from sequence numbers 228 to 232. RNA is disclosed herein. In some embodiments, SEQ ID NOs. 235-240, 265 This specification includes an sgRNA containing one of the nucleic acids ~285 and 309~329. Disclosed in the book. In some embodiments, sequence numbers 235-240, 265-285, and For any one nucleic acid among 309-329, at least 99, 98, 97, 9 6, 95, 94, 93, 92, 91, 90, 85, 80, 75, or 70% identity It contains nucleic acids, and its modification pattern is identical to the modification pattern shown in the reference sequence identifier. sgRNA is disclosed herein. In some embodiments, the sgRNA has a 5' end. The three phosphorothioate (PS) bonds that link the first four nucleotides It further includes three PS bonds that ligate the last four nucleotides at the 3' terminus.

[0115] In some embodiments, the 5' end modification and the upper stem region; hairpin 1 region; and hair sgRNA containing one or more modifications in one or more of the two pin regions The 5' terminal modification is provided, and there are at least two nucleotides within the first seven nucleotides of the 5' terminal. It contains phosphorothioate linkages.

[0116] In some embodiments, the 5' end modification and the upper stem region; hairpin 1 region; and hair sgRNA containing one or more modifications in one or more of the two pin regions Provided, the 5' terminal modification is one or more phosphorothiocyanates at the 5' end of the RNA. Includes ethyl ethyl linkage. In some embodiments, one or more phosphorothioate links (ph Orphorothioate bonds ligate nucleotides at their 5' ends.

[0117] In some embodiments, the 5' end modification and the upper stem region; hairpin 1 region; and hair An sgRNA is provided that includes one or more modifications in one or more of the PIN2 regions. Therefore, 5' terminal modification involves one or more phosphate groups within the first seven nucleotides of the 5' terminus. Includes holothioate linkage.

[0118] In some embodiments, any of the modified sgRNA sequences of sequence numbers 228-332 An sgRNA containing one is provided.

[0119] In some embodiments, sequence numbers 235-240, 265-285, and 309-32 An sgRNA containing or consisting of one of the nine modified sgRNA sequences is proposed. To be served.

[0120] In some embodiments, the present invention relates to Sequence IDs 235-240, 265-285, and 3 It contains an sgRNA that includes one of the modified sequences 09-329, and the sgRNA is It is at least partially complementary to the target sequence and is intended to cleave Cas9 to its target. Further includes a oriented 5' spacer arrangement.

[0121] In some embodiments, the present invention relates to Sequence IDs 235-240, 265-285, and 3 For any one nucleotide between 09 and 329, at least 99, 98, and 97 , 96, 95, 94, 93, 92, 91, 90, 85, 80, 75, or 70% identical Modification pattern containing a nucleotide having sex, where the modification pattern is indicated in the reference sequence identifier It contains sgRNA, which is identical to that of the nucleotides A, U, C, and G. Compared to those shown in the column, 99, 98, 97, 96, 95, 94, 93, 92, 91, They may differ by 90%, 85%, 80%, 75%, or 70%, but the modifiers remain unchanged. be.

[0122] In some embodiments, the present invention relates to the following regions: nucleotides at the 5' terminus; lower part Tem region; bulge region; upper stem region; nexus region; hairpin 1 region; hairpin 2 region region; and one or more nucleotides within one or more of the nucleotides at the 3' terminus Contains sgRNA with modifications.

[0123] In some embodiments, the modification is a 2'-O-methyl (2'-O-Me) modified nucleotide. Includes. In some embodiments, the modification includes a 2'-fluoro(2'-F) modified nucleotide. In some embodiments, the modification involves phosphorothioate (PS) bonds between nucleotides. In some embodiments, the modification includes an inverted debasic nucleotide.

[0124] In some embodiments, the first three nucleotides in the 5' terminus and the LS in the lower stem are present. 1, LS6, LS7, LS8, LS11, and LS12, and B1 and in the bulge region B2, each of the nucleotides in the upper stem region, and N16 and N1 in the nexus region 7, and N18, and each of the nucleotides in the hairpin 1 region, and hairpin 1 and hair One nucleotide between pin 2 and the other, and each of the nucleotides in the hairpin 2 region, The last four nucleotides at the 3' terminus, and the 2'-O-Me modified nucleoty An sgRNA is provided, containing a . In one embodiment, the sgRNA has a 5' terminus. The three PS bonds between the first four nucleotides and the last four at the 3' end It further includes three PS bonds between nucleotides.

[0125] In some embodiments, the first three nucleotides in the 5' terminus and the LS in the lower stem are present. 1, LS6, LS7, LS8, LS11, and LS12, and B1-B6 in the bulge region And each of the nucleotides in the upper stem region, and N16, N17 in the nexus region, and N18, each of the nucleotides in the hairpin 1 region, and hairpin 1 and hairpin One nucleotide between 2 and each of the nucleotides in the hairpin 2 region, and 3' The last four nucleotides at the terminal, and the 2'-O-Me modified nucleotides The sgRNA is provided, including the 5' terminus. In one embodiment, the sgRNA has a 5' terminus. The first four nucleotides have three PS bonds between them and the last four nucleotides at the 3' terminus. It further includes three PS bonds between the rheotides.

[0126] In some embodiments, LS9 and LS10 are located in the lower stem, and 15 is located in the nexus region. ~N18, H2-9~HS-15 in the hairpin 2 region, and the last 2 in the 3' terminal region The 2'-F modification occurs at the third to last and fourth nucleotides from the end. The sgRNA is provided, containing nucleotides.

[0127] In some embodiments, each nucleotide in the lower stem and 15-N1 in the nexus region 8, H2-9 to HS-15 in the hairpin 2 region, and the second to last in the 3' terminal region, The third to last and fourth to last nucleotides, and the 2'-F modified nuclei The sgRNA is provided along with the ocid.

[0128] In some embodiments, LS8, LS10, LS12, H1-2, H1-4, H1-6, H1-8, H1-10, H1-12, H2-1, H2-3, H2-5, H2-7, H2- 9, H2-11, H2-13, H2-15, and the last and last three at the 3' terminus The nucleotide in the eye contains a 2'-O-Me modified nucleotide, and LS7, L S9, LS11, H1-1, H1-3, H1-5, H1-7, H1-9, H1-11, H 1-13, H2-2, H2-4, H2-6, H2-8, H2-10, H2-12, H2- 14, and the second to last and fourth to last nucleotides at the 3' terminus, odor A single guide RNA (sgRNA) is provided, including a 2'-F modification.

[0129] Each of the following embodiments is included: Embodiment 01. A single guide RNA (sgRNA) with the following region: a. 5' terminus, b. Lower stem region and, c. Bulge region and, d. Upper stem region and, e. Nexus area and, f. Hairpin 1 region and g. Hairpin 2 area and, h.3' termination and sg, which includes one or more modifications in one or more of the following RNA. Embodiment 02. The modification includes a 2'-O-methyl (2'-O-Me) modified nucleotide in Embodiment 1. gRNA. Embodiment 03. sgRNA of Embodiment 1, which includes a 2'-fluoro(2'-F) modified nucleotide. . Embodiment 04. The sgR of Embodiment 1, in which the modification includes phosphorothioate (PS) bonding between nucleotides. NA. Embodiment 05. The first three or four nucleotides at the 5' end, and the last one at the 3' end. Three or four nucleotides are modified in any one of the embodiments 1 to 3 gRNA. Embodiment 06. The first four nucleotides at the 5' terminus, and the last four nucleotides at the 3' terminus. In embodiments 1 to 5, the cleotide is linked by a phosphorothioate (PS) bond. Any one of the sgRNAs. Embodiment 07. sgRNA of Embodiment 5, wherein the modification includes 2'-O-Me. Embodiment 08. The sgRNA of Embodiment 5, wherein the modification includes 2'-F. Embodiment 09. The first four nucleotides at the 5' terminus and the last four nucleotides at the 3' terminus The rheotide is linked by PS bonds, and the first three nucleos at the 5' terminus The last three nucleotides at the tide and 3' terminus contain 2'-O-Me modifications. One sgRNA from any of the application forms 1-7. Embodiment 10. The first four nucleotides at the 5' terminus and the last four nucleotides at the 3' terminus The rheotide is linked by PS bonds, and the first three nucleos at the 5' terminus Embodiments in which the last three nucleotides at the tide and 3' terminus include 2'-F modifications. One sgRNA from 1 to 8. Embodiment 11. LS1, LS6, LS7, LS8, LS11, and LS12 are modified with 2'-O-Me. One of the sgRNAs described in Embodiments 1 to 10. Embodiment 12. Each of the nucleotides in the bulge region is modified with 2'-O-Me in one embodiment. One sgRNA from 1 to 11. Embodiment 13. Each nucleotide in the upper stem region is modified with 2'-O-Me, One sgRNA from any of the morphologies 1-12. Embodiment 14. N16, N17, and N18 in the nexus region are modified with 2'-O-Me. One sgRNA from any of Embodiments 1 to 13. Embodiment 15. Each nucleotide in the hairpin region is modified with 2'-O-Me, One sgRNA from any of the morphologies 1-14. Embodiment 16. Each of the nucleotides in the hairpin 2 region is modified with 2'-O-Me, One sgRNA from any of the morphologies 1-15. Embodiment 17. A single guide RNA (sgRNA) with the following nucleotides: a. The first three nucleotides at the 5' terminus, b. LS1, LS6, LS7, LS8, LS11, and LS12 in the lower stem region Domain and, c. B1 and B2 in the bulge region, d. Each nucleotide in the upper stem region, e. N16, N17, and N18 in the nexus region, f. Each nucleotide in hairpin 1 region, g. Each nucleotide in the hairpin 2 region, The last four nucleotides at the 3' terminus and the 2'-O-Me modified nucleic acid. sgRNA, including Embodiment 18. sgRNA of embodiment 17, in which B3-B6 are modified with 2'-O-Me. Embodiment 19. Three phosphorothioates (P) link the first four nucleotides at the 5' terminus. S) bond and three PS bonds linking the last four nucleotides at the 3' terminus Furthermore, the sgRNA of Embodiment 17 is also included. Embodiment 20. Any one of embodiments 1 to 10, wherein LS9 and LS10 are modified with 2'-F. sgRNA. Embodiment 21. Embodiments 1-1 in which N15, N16, N17, and N18 are modified with 2'-F One sgRNA, either 0 or 20. Embodiment 22. H2-9, H2-10, H2-11, H2-12, H2-13, H2-14, and H Any one of embodiments 1-10 and 20-21, in which 2-15 is modified by 2'-F Two sgRNAs. Embodiment 23. The second to last, third to last, and fourth to last nucleos at the 3' terminus. Any one of embodiments 1-10 and 21-22, in which the cydo is modified with 2'-F sgRNA. Embodiment 24. A single guide RNA (sgRNA) located at the following position: a. LS9 and LS10 in the lower stem region, b. N15, N16, N17, and N18 in the nexus region, c. H2-9, H2-10, H2-11, H2-12, H2-13 in hairpin 2 region H2-14 and H2-15, and containing a 2'-F modified nucleotide, single sgRNA (straight guide RNA). Embodiment 25. The second to last, third to last, and fourth to last nucleos at the 3' terminus. sgRNA of Embodiment 24, further comprising a 2'-F modified nucleotide in the tide. Embodiment 26. Three phosphorothioates (P) link the first four nucleotides at the 5' terminus. S) bond and three PS bonds linking the last four nucleotides at the 3' terminus Furthermore, the sgRNA further includes either one of Embodiments 24 or 25. Embodiment 27. The first three nucleotides at the 5' terminus are modified with either 2'-O-Me or 2'-F. It further contains decorative nucleotides, and three of the last four nucleotides at the 3' terminus Embodiments 24-2 further include 2'-O-Me or 2'-F modified nucleotides. One of the six sgRNAs. Embodiment 28. It is a single guide RNA (sgRNA), a. 2'-O-Me modified nucleo in the first three nucleotides at the 5' terminus Chido and, b. 2'-O-Me modified nucleotides in LS1 and LS6, c. 2'-O-Me modified nucleotides in US1~US12, d. 2'-O-Me modified nucleotides in H1-1 to H1-12, e. The 2'-O-Me modified nucleotide between hairpin 1 and hairpin 2, 2'-O-Me modified nucleotides in f.H2-1~H2-15, g. 2'-O-Me modified nucleo in the last four nucleotides at the 3' terminus sgRNA containing citrate. Embodiment 29. Three phosphorothioates (P) link the first four nucleotides at the 5' terminus. S) bond and three PS bonds linking the last four nucleotides at the 3' terminus Furthermore, the sgRNA of Embodiment 28 is included. Embodiment 30. It is a single guide RNA (sgRNA), a. 2'-O-Me modified nucleo in the first three nucleotides at the 5' terminus Chido and, b. 2'-F modified nucleotides in LS1~LS6, c. 2'-O-Me modified nucleotides in US1~US12, d. 2'-O-Me modified nucleotides in H1-1 to H1-12, e. The 2'-O-Me modified nucleotide between hairpin 1 and hairpin 2, 2'-O-Me modified nucleotides in f.H2-1~H2-15, g. 2'-O-Me modified nucleo at the last four nucleotides of the 3' terminus sgRNA containing citrate. Embodiment 31. Three phosphorothioates (P) link the first four nucleotides at the 5' terminus. S) bond and three PS bonds linking the last four nucleotides at the 3' terminus Furthermore, the sgRNA of embodiment 30 is also included. Embodiment 32. It is a single guide RNA (sgRNA), a. 2'-O-Me modified nucleo at the first three nucleotides of the 5' terminus Chido and, b. 2'-F modified nucleotides in LS2~LS5, c. 2'-O-Me modified nucleotides in LS1 and LS6, d. 2'-O-Me modified nucleotides in US1~US12, e. 2'-O-Me modified nucleotides in H1-1 to H1-12, f. The 2'-O-Me modified nucleotide between hairpin 1 and hairpin 2, g. 2'-O-Me modified nucleotides in H2-1 to H2-15, 2'-O-Me modified nucleo at the last four nucleotides of the 3' terminus A single guide RNA (sgRNA) containing cytoplasm. Embodiment 33. Three phosphorothioates (P) link the first four nucleotides at the 5' terminus. S) bond and three PS bonds linking the last four nucleotides at the 3' terminus Furthermore, the sgRNA of Embodiment 32 is also included. Embodiment 34. It is a single guide RNA (sgRNA), a. 2'-O-Me modified nucleo in the first three nucleotides at the 5' terminus Chido and, b. 2'-O-Me modified nucleotides in US1~US12, c. 2'-O-Me modified nucleos in LS7, LS8, LS11, and LS12 Chido and, d. 2'-O-Me modified nucleotides in H1-1 to H1-12, e. The 2'-O-Me modified nucleotide between hairpin 1 and hairpin 2, 2'-O-Me modified nucleotides in f.H2-1~H2-15, g. 2'-O-Me modified nucleo in the last four nucleotides at the 3' terminus sgRNA containing citrate. Embodiment 35. Three phosphorothioates (P) link the first four nucleotides at the 5' terminus. S) bond and three PS bonds linking the last four nucleotides at the 3' terminus Furthermore, the sgRNA of embodiment 34 is included. Embodiment 36. It is a single guide RNA (sgRNA), a. 2'-O-Me modified nucleo in the first three nucleotides at the 5' terminus Chido and, b. 2'-O-Me modified nucleotides in US1~US12, c. 2'-O-Me modified nucleos in LS7, LS8, LS11, and LS12 Chido and, d. 2'-F modified nucleotides in LS9 and LS10, e. 2'-O-Me modified nucleotides in H1-1 to H1-12, f. The 2'-O-Me modified nucleotide between hairpin 1 and hairpin 2, g. 2'-O-Me modified nucleotides in H2-1 to H2-15, 2'-O-Me modified nucleo at the last four nucleotides of the 3' terminus sgRNA containing citrate. Embodiment 37. Three phosphorothioates (P) link the first four nucleotides at the 5' terminus. S) bond and three PS bonds linking the last four nucleotides at the 3' terminus Furthermore, the sgRNA of embodiment 36 is also included. Embodiment 38. It is a single guide RNA (sgRNA), a. 2'-O-Me modified nucleo in the first three nucleotides at the 5' terminus Chido and, b. 2'-O-Me modified nucleotides in US1~US12, c. 2'-O-Me modified nucleotides in LS8, LS10, and LS12, d. 2'-OF modified nucleotides in LS7, LS9, and LS11, e. 2'-O-Me modified nucleotides in H1-1 to H1-12, f. The 2'-O-Me modified nucleotide between hairpin 1 and hairpin 2, g. 2'-O-Me modified nucleotides in H2-1 to H2-15, 2'-O-Me modified nucleo at the last four nucleotides of the 3' terminus sgRNA containing citrate. Embodiment 39. Three phosphorothioates (P) link the first four nucleotides at the 5' terminus. S) bond and three PS bonds linking the last four nucleotides at the 3' terminus Furthermore, the sgRNA of Embodiment 32 is also included. Embodiment 40. It is a single guide RNA (sgRNA), a. 2'-O-Me modified nucleo in the first three nucleotides at the 5' terminus Chido and, b. 2'-O- in LS1, LS6, LS7, LS8, LS11, and LS12 Me-modified nucleotides, c. 2'-O-Me modified nucleotides in US1~US12, d. 2'-O-Me modified nucleotides in H1-1 to H1-12, e. The 2'-O-Me modified nucleotide between hairpin 1 and hairpin 2, 2'-O-Me modified nucleotides in f.H2-1~H2-15, g. 2'-O-Me modified nucleo in the last four nucleotides at the 3' terminus sgRNA containing citrate. Embodiment 41. Three phosphorothioates (P) link the first four nucleotides at the 5' terminus. S) bond and three PS bonds linking the last four nucleotides at the 3' terminus Furthermore, the sgRNA of Embodiment 40 is also included. Embodiment 42. It is a single guide RNA (sgRNA), a. 2'-O-Me modified nucleo in the first three nucleotides at the 5' terminus Chido and, b. 2'-O- in LS1, LS6, LS7, LS8, LS11, and LS12 Me-modified nucleotides, c. 2'-F modified nucleotides in LS9 and LS10, d. 2'-O-Me modified nucleotides in US1~US12, e. 2'-O-Me modified nucleotides in H1-1 to H1-12, f. The 2'-O-Me modified nucleotide between hairpin 1 and hairpin 2, g. 2'-O-Me modified nucleotides in H2-1 to H2-15, 2'-O-Me modified nucleo at the last four nucleotides of the 3' terminus sgRNA containing citrate. Embodiment 43. Three phosphorothioates (P) link the first four nucleotides at the 5' terminus. S) bond and three PS bonds linking the last four nucleotides at the 3' terminus Furthermore, the sgRNA of Embodiment 43 is included. Embodiment 44. It is a single guide RNA (sgRNA), a. 2'-O-Me modified nucleo in the first three nucleotides at the 5' terminus Chido and, b. 2'-O-Me modified nucleotides in US1~US12, c. 2'-O-Me modified nucleotides in H1-1 to H1-12, d. The 2'-O-Me modified nucleotide between hairpin 1 and hairpin 2, e. 2'-O-Me modified nucleotides in H2-1 to H2-8, 2'-F modified nucleotides in f.H2-9~H2-15, g. The second to last, third to last, and fourth to last nuclei at the 3' terminus 2'-F modified nucleotides in rheotides, The 2'-O-Me modified nucleotide at the last nucleotide in the h3' terminus and sgRNA, including , Embodiment 45. Three phosphorothioates (P) link the first four nucleotides at the 5' terminus. S) bond and three PS bonds linking the last four nucleotides at the 3' terminus Furthermore, the sgRNA of Embodiment 44 is included. Embodiment 46. It is a single guide RNA (sgRNA), a. 2'-O-Me modified nucleo in the first three nucleotides at the 5' terminus Chido and, b. 2'-O-Me modified nucleotides in US1~US12, c. In H1-2, H1-4, H1-6, H1-8, H1-10, and H1-12 2'-O-Me modified nucleotides, d. In H1-1, H1-3, H1-5, H1-7, H1-9, and H1-11 2'-F modified nucleotides, e. The 2'-F modified nucleotide between hairpin 1 and hairpin 2, f. H2-2, H2-4, H2-6, H2-8, H2-10, H2-12; and H2 -14 2'-F modified nucleotide and, g.H2-1, H2-3, H2-5, H2-7, H2-9, H2-11; H2-13, and the 2'-O-Me modified nucleotide in H2-15, At the second to last and fourth to last nucleotides at the h.3' terminus 2'-F modified nucleotides, i. The third to last nucleotide at the 3' terminus, and the 2'-O- at the last nucleotide. sgRNA containing Me-modified nucleotides. Embodiment 47. Three phosphorothioates (P) link the first four nucleotides at the 5' terminus. S) bond and three PS bonds linking the last four nucleotides at the 3' terminus Furthermore, the sgRNA of Embodiment 46 is included. Embodiment 48. It is a single guide RNA (sgRNA), a. 2'-O-Me modified nucleotides LS8, LS10, LS12, H1-2, H1- 4, H1-6, H1-8, H1-10, H1-12, H2-1, H2-3, H2-5, H 2-7, H2-9, H2-11, H2-13, and H2-15, b.LS7, LS9, LS11, H1-1, H1-3, H1-5, H1-7, H1-9 , H1-11, H1-13, H2-2, H2-4, H2-6, H2-8, H2-10, H sgRNA containing 2'-F modified nucleotides at 2-12 and H2-14. . Embodiment 49. Three phosphorothioates (P) link the first four nucleotides at the 5' terminus. S) bond and three PS bonds linking the last four nucleotides at the 3' terminus Furthermore, the sgRNA of Embodiment 48 is included. Embodiment 50. a. 2'-OM at the last and third-to-last nucleotides at the 3' terminus e-modified nucleotides and, b. At the 3' terminus, the second to last and third to last nucleotides are 2 A sgR from any one of embodiments 48 to 49, further comprising a nucleotide modified with -F. NA. Embodiment 51. An sgRNA containing one of the nucleic acids from sequence numbers 228 to 332. Embodiment 52. One of the sequence numbers 235-240, 265-285, and 309-329 sgRNA, which contains two nucleic acids. Embodiment 53. One of the sequence numbers 235-240, 265-285, and 309-329 For each nucleic acid, at least 99, 98, 97, 96, 95, 94, 93, 92, 91, It contains nucleic acids with 90, 85, 80, 75, or 70% identity, and the modification pattern is sgRNA with the same modification pattern as indicated by the traceable sequence identifier. Embodiment 54. Three phosphorothioates (P) link the first four nucleotides at the 5' terminus. S) bond and three PS bonds linking the last four nucleotides at the 3' terminus Furthermore, the sgRNA further includes any one of embodiments 51 to 53.

[0130] B.dgRNA composition In some embodiments, the compositions and methods of the present invention use a nuclease such as Cas9 as a target. It contains gRNAs, including crRNAs and trRNAs that direct the DNA sequence to a target DNA sequence. In the application morphology, gRNAs are associated, but two separate RNA molecules (dual-guide RNs) are present. (Located on A or dgRNA)

[0131] Table 2 and Figure 21C provide a description of the crRNA domains used herein. The 5' terminal region includes a spacer region at or near the 5' end of the crRNA. In some cases, Cas9 may be used to target a region in DNA as described herein. It may function to direct the region. In Table 2, "n" between regions is a variable number, for example, 0 to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 1 2, 13, 14, 15, 16, 17, 18, 19, 20, or that Represents a larger number of nucleotides. In some embodiments, n is equal to 0. Any dgRNA can contain "n" between any domains.

[0132] Table 3 and Figure 21C provide a description of the domains of trRNA used herein. In Table 3, "n" between regions is a variable number, for example, from 0 to 1, 2, 3, 4, 5 pieces, 6 pieces, 7 pieces, 8 pieces, 9 pieces, 10 pieces, 11 pieces, 12 pieces, 13 pieces, 14 pieces, 15 pieces, 1 Represents 6, 17, 18, 19, 20, or more nucleotides. In the embodiments of this part, n is equal to 0. Any dgRNA described herein is any It may include "n" between domains.

[0133] 1. Domain of dgRNA As described in Briner 2014, dgRNA has a spacer domain involved in targeting. , lower stem domain, bulge domain, upper stem domain, nexus domain, and Examples include hairpin domains and other specific domains referred to herein as “domains”. It can be developed based on the functional domain. In dgRNA, crRNA is g It contains some components of RNA, and trRNA also contains some components of gRNA.

[0134] The crRNA region is shown in Table 2 and Figure 21C. The trRNA region is shown in Table 3 and Figure 21C. Provided in 21C. Figure 21C shows an exemplary dgRNA schema. [Table 3] [Table 4]

[0135] a) 5' terminal region In some embodiments, dgRNA is cr RNA and trRNA contain nucleotides at their 5' ends.

[0136] In some embodiments, the 5' end of crRNA targets the Cas protein via a nucleotide. Includes spacer or guide regions that function to orient the array. In some embodiments In some embodiments, the 5' termination does not include a spacer or guide region. This is a spacer that does not function to orient the Cas protein to the target nucleotide region. and includes additional nucleotides.

[0137] In some embodiments, the guide region is the first 1 to 10 cells at the 5' end of the crRNA. , 11, 12, 13, 14, 15, 16, 17, 18, 19, or It contains 20 nucleotides. In some embodiments, the guide region contains 20 nucleotides. Includes. In some embodiments, the guide regions are 5, 6, 7, 8, 9, 10, 11 pieces, 12 pieces, 13 pieces, 14 pieces, 15 pieces, 16 pieces, 17 pieces, 18 pieces, 19 pieces, 20 pieces, 21, 22, 23, 24, or 25 or more nucleotides It may include. In some embodiments, the guide region may contain 17 nucleotides. In some embodiments, the guide region may contain 18 nucleotides. Morphologically, the guide region may contain 19 nucleotides.

[0138] In some embodiments, the selection of a guide region is based on a target sequence within the gene of interest for editing. It is determined based on the following. For example, in some embodiments, the crRNA is a target of the gene in question. The sequence includes a complementary guide region.

[0139] In some embodiments, the target sequence in the gene in question is relative to the guide region of the crRNA. They may be complementary. In some embodiments, the guide region of the crRNA and the target gene The degree of complementarity or identity with its corresponding target sequence is approximately 50%, 55%, and 60%. 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, It may be 99% or 100%. In some embodiments, the guide region of crRNA. The target regions of the target gene may be 100% complementary or identical. Other implementations In this state, the guide region of the crRNA and the target region of the target gene have at least one error. Matches may be included, for example, the guide region of crRNA and the target region of the gene in question. The region contains at least approximately 17, 18, 19, 20, or more target sequences in total length. In the case of a base pair, there can be 1, 2, 3, 4, 5, 6, 7, 8, 9, and It may contain 10 mismatches. In some embodiments, the guide region of crRNA And the target region of the target gene has at least approximately 17, 18, or 19 guide sequences. If it contains 20 or more nucleotides, it contains 1 to 6 mismatches. Good. In some embodiments, the guide region of the crRNA and the target region of the gene of interest are If the guide sequence contains approximately 20 nucleotides, then 1, 2, 3, 4, 5, and It may contain 6 mismatches.

[0140] In some embodiments, trRNA includes a 5' terminus. It contains a 5' terminus that partially forms the upper stem of the dgRNA. The 5' terminus of the trRNA. It is not complementary to the region of the target gene.

[0141] b) Lower stem In some embodiments, the dgRNA includes a lower stem (LS) region. The lower stem region is The lower stem region of crRNA and the lower part of trRNA associate as depicted in Figure 21C. Includes the stem region. In some embodiments, the lower stem region of crRNA is below trRNA. It is at least partially complementary to the stem region. In some embodiments, crRN The lower stem region of A is generally complementary to the lower stem region of trRNA.

[0142] In some embodiments, the lower stem regions of crRNA and trRNA each have 6 Contains nucleotides. In some embodiments, the lower stem region of crRNA and trRNA. Each region contains fewer nucleotides than those shown in Tables 2 and 3 and Figure 21C. Includes. In some embodiments, the lower stem region is shown in Tables 2 and 3 and Figure 21C. It contains more nucleotides than can be found. The lower stem region is shown in Tables 2 and 3 and Figure 21. If the nucleotides are fewer or more than those shown in diagram C, it will be obvious to those skilled in the art. Thus, the modification pattern is maintained. In some embodiments, in the lower stem of crRNA The number of nucleotides differs from the number of nucleotides in the lower stem of the trRNA.

[0143] c) Bulge In some embodiments, the dgRNA includes a bulge (B) region. In some embodiments, c rRNA contains one bulge region, and trRNA also contains one bulge region. In some embodiments, each bulge region contains 1 to 4 nucleotides. In some embodiments, c The bulge region of rRNA contains 2 nucleotides, while the bulge region of trRNA contains 4 nucleotides. It contains [number] nucleotides.

[0144] In some embodiments, the bulge region of crRNA is the lower stem region and the upper region of crRNA. It is located between the stem region and the bulge region of crRNA. In some embodiments, the bulge region of crRNA has two nuclei. Contains a creotide. In some embodiments, the bulge region of the crRNA is shown in Table 2 and Figure 21. It contains nucleotides B1 and B2, as shown in C.

[0145] In some embodiments, the bulge region of trRNA is the upper stem region and the lower region of trRNA. It is located between the stem region and the bulge region of trRNA. In some embodiments, the bulge region of trRNA has four nuclei. Contains creotide. In some embodiments, the bulge region of trRNA is shown in Table 3 and Figure 21. As shown in C, it contains nucleotides B1 to B4.

[0146] In some embodiments, the presence of a bulge indicates that the upper stem module and lower stem module in the dgRNA are This results in a directional kink between the tem module and the crRNA bulge and The bulge of crRNA may be partially complementary. The bulge of NA does not need to be complementary.

[0147] In some embodiments, the bulge regions of crRNA and trRNA are as shown in Tables 2 and 3. Furthermore, it contains more nucleotides than shown in Figure 21C. The bulge region is shown in Table 2 and Table If the nucleotides are fewer or more than those shown in diagrams 3 and 21C, As will be apparent to those skilled in the art, the modification pattern is maintained. In some embodiments, crRNA The number of nucleotides in the bulge of is different from the number of nucleotides in the bulge of trRNA. .

[0148] d) Upper stem In some embodiments, the dgRNA includes an upper stem (US) region. The upper stem region is The crRNA upper stem region and the trRNA upper region associate as depicted in Figure 21C. Includes a stem region. In some embodiments, the upper stem region of crRNA is part of trRNA. It is at least partially complementary to the upper stem region. In some embodiments, crR The upper stem region of NA is generally complementary to the upper stem region of trRNA.

[0149] In some embodiments, the upper stem region of crRNA contains 14 nucleotides. In some embodiments, the upper stem region of the trRNA contains 11 nucleotides. In this embodiment, the upper stem regions of crRNA and trRNA are shown in Table 2 and Table 2, respectively. It contains fewer nucleotides than those shown in Figure 3 and Figure 21C. In some embodiments, The upper stem regions of crRNA and trRNA are shown in Tables 2 and 3 and Figure 21C. It contains more nucleotides than is shown in Tables 2 and 3 and Figure 2. If the nucleotides are fewer or more than those shown in the diagram of 1C, it will be obvious to those skilled in the art. Thus, the modification pattern is maintained.

[0150] In some embodiments, the upper stem of the crRNA is as shown in Table 2 and Figure 21C. It contains nucleotides US1 to US14.

[0151] In some embodiments, the upper stem of the trRNA is as shown in Table 3 and Figure 21C. It contains nucleotides US1 to US11.

[0152] e) Nexus In some embodiments, the dgRNA includes a trRNA containing a nexus region. Morphologically, the nexus is located between the lower stem region and the hairpin 1 region of the trRNA. In some embodiments, the nexus is located immediately downstream of the lower stem of the trRNA. In some embodiments, the nexus contains 18 nucleotides. In some embodiments, trRN The nexus region of A consists of nucleotides N1-N18, as shown in Table 3 and Figure 21C. This includes. In some embodiments, the nexus is less than shown in Table 3 and Figure 21C. It contains nucleotides. In some embodiments, the nexus region of trRNA is shown in Table 3 and Figure It contains more nucleotides than shown in 21C. The nexus region is shown in Table 3 and Figure 21C. If it contains fewer or more nucleotides than shown, as will be obvious to those skilled in the art, The modification pattern is preserved.

[0153] In some embodiments, the nexus region is such that when read in the opposite direction, the nucleic acid sequence is complementary to the nexus region. It contains a cleotide. In some embodiments, the complementarity in the nucleic acid sequence is a st in the sgRNA. Connecting to the secondary structure of the m and / or stem loop (for example, a certain in the nexus region) The nucleotides may form base pairs with each other. In some embodiments, the nexus region The domains do not need to be completely complementary to each other when read in opposite directions.

[0154] f) hairpin In some embodiments, the hairpin region of the trRNA is located downstream of the nexus region. In this embodiment, the nucleotide region immediately downstream of the nexus region is referred to as "hairpin 1". In some embodiments, the nucleotide region immediately downstream of the hairpin 1 region is called "hairpin It is referred to as "2". In some embodiments, the hairpin region includes hairpin 1 and hairpin 2. In some cases, hairpin 1 and hairpin 2 are one or more nucleotides It is separated by n. In some embodiments, n=1. In some embodiments, The trRNA contains only hairpin 1 or hairpin 2.

[0155] Substitution of a hairpin region of trRNA with two nucleotides is a modification of Cas RNP. It has been shown that activation is possible (U.S. Patent Publication No. 20150376586, Figure) (See 16). In some embodiments, trRNA is hair by nucleotide "n". Including the substitution of pin 1, "n" is 1 and 50, 40, 30, 20, 15, 10, 5, 4, 3 It is an integer between , and 2. In some embodiments, the hairpin 1 region of trRNA is 2 It is substituted by nucleotides.

[0156] In some embodiments, the hairpin 1 of the trRNA is 12 immediately downstream of the nexus region. Contains nucleotides. In some embodiments, the hairpin 1 region of trRNA is as shown in Table 3 and As shown in Figure 21C, it contains nucleotides H1-1 to H1-12.

[0157] In some embodiments, non-hairpin nucleotides are the hairpin 1 region of trRNA and hairpin It exists between the n2 region. In some embodiments, 1-2 non-hairpin nucleotides It is located between hairpin 1 and hairpin 2.

[0158] In some embodiments, the trRNA hairpin 2 has 15 nuclei behind hairpin 1 (3'). Contains a creotide. In some embodiments, the hairpin 2 region of the trRNA is shown in Table 3 and Figure As shown in 21C, it includes nucleotides H2-1 to H2-15. Some embodiments So, the hairpin 2 region of trRNA is, as shown in Table 3, nucleotide H2-1 or It includes H2-15, and the "n" between hairpin 1 and hairpin 2 is 1 or 2. .

[0159] In some embodiments, the hairpin region of trRNA is as shown in Table 3 and Figure 21C. It contains more nucleotides than shown in Table 3 and Figure 21C. If there are no or many nucleotides, the modification pattern is maintained, as will be obvious to those skilled in the art. It will be done.

[0160] In some embodiments, the hairpin region is a nucleic acid sequence that is complementary when read in the opposite direction. It contains creotide. In some embodiments, the hairpin region is mutual when read in opposite directions. They do not necessarily have to be perfectly complementary (for example, the top or loop of a hairpin may form a pair). (Contains nucleotides that are not included.)

[0161] In some embodiments, the trRNA includes a hairpin 1 substitution with the nucleotide "n". "n" is between 1 and 50, 40, 30, 20, 15, 10, 5, 4, 3, and 2. It is an integer. In some embodiments, the hairpin 1 region of trRNA is composed of 2 nucleotides. It has been replaced.

[0162] g) 3' end In some embodiments, the dgRNA has an additional nucleotide after the hairpin region (3') The trRNA contains a 3' terminal region containing a creotide. In some embodiments, the 3' terminal region The regions consist of 1, 2, 3, 4, 5, 6, and 7 elements that do not associate with the secondary structure of the hairpin. It contains 8, 9, 10, 15, 20, or more nucleotides. In some embodiments, the 3' terminal region consists of one, two, or three hairpins that do not associate with the secondary structure of the hairpin. It contains one or four nucleotides. In some embodiments, the 3' terminal region is a hairpin It contains four nucleotides that do not associate with the secondary structure. In some embodiments, the 3' terminal region It contains one, two, or three nucleotides that do not associate with the secondary structure of the hairpin.

[0163] 2. Modification of dgRNA In some embodiments, dgRNA includes modified crRNA and unmodified trRNA. In some embodiments, dgRNA includes unmodified crRNA and modified trRNA. In this embodiment, both the crRNA and trRNA of the dgRNA are modified.

[0164] In some embodiments, the gRNA described herein is two separate RNA molecules ( This will be a dual guide or dgRNA. See Table 2, Table 3, and Figure 21C.

[0165] In some embodiments, the present invention relates to a) among the crRNA sequences of sequence numbers 1 to 187 one of the following; and b) one of the trRNA sequences described in SEQ ID NOs. 188-227 It contains either one of these or a dgRNA consisting of either one.

[0166] In some embodiments, d includes any one of 1 to 187 modified crRNA sequences. gRNA is provided.

[0167] In some embodiments, it includes one of the modified trRNA sequences 188 to 227. MudgRNA is provided.

[0168] In some embodiments, the modifications of sequence numbers 19-31, 53-73, and 104-130 A dgRNA containing any one of the crRNA sequences is provided. In some embodiments, The present invention relates to the modified sequences of sequence numbers 19-31, 53-73, and 104-130. The dgRNA contains one of the following, and the crRNA contains at least a partial portion of the target sequence. A 5' spacer array that is complementary to and directs Cas9 towards its target for cleavage. It also includes.

[0169] In some embodiments, the present invention relates to any of the sequences described in sequence numbers 1 to 187. It contains crRNA containing one of the following. In some embodiments, the present invention relates to sequence numbers 19-31. It contains one of the sequences described in 53-73 and 104-130 or It includes crRNA consisting of the same. In some embodiments, the present invention relates to sequence numbers 19-31, One of the sequences described in 53-73 and 104-130 and a space Contains crRNA including the sur region.

[0170] In some embodiments, the present invention relates to the sequence of sequences described in sequence numbers 188 to 277. Contains trRNA that includes or consists of one of the following.

[0171] In some embodiments, the present invention relates to any one of the nucleos from Sequence IDs 1 to 187 For Chido, at least 99, 98, 97, 96, 95, 94, 93, 92, 91, 90 containing crRNA with nucleotides having 85, 80, 75, or 70% identity. Furthermore, the modification pattern is the same as the modification pattern shown in the reference sequence identifier. That is, Nu Cleotides A, U, C, and G are 99, 98, and 97 compared to those shown in the sequence. 96, 95, 94, 93, 92, 91, 90, 85, 80, 75, or 70% different It is acceptable to include it, but the modifier remains unchanged.

[0172] In some embodiments, the present invention relates to any one of the sequences 188 to 277. For leotide, at least 99, 98, 97, 96, 95, 94, 93, 92, 91, trRNA containing nucleotides with 90, 85, 80, 75, or 70% identity It includes, and the modification pattern is the same as the modification pattern shown in the reference sequence identifier. Nucleotides A, U, C, and G are 99, 98, and 99, respectively, compared to those shown in the sequence. 7, 96, 95, 94, 93, 92, 91, 90, 85, 80, 75, or 70% different This is acceptable, but the modifications on each nucleotide should remain unchanged.

[0173] 3. Modified crRNA, trRNA, and dgRNA In some embodiments, the crRNA has a 5' end, lower stem, bulge, upper stem, and It contains one or more modified nucleotides within one or more of its 3' and 3' ends.

[0174] In some embodiments, the modification includes 2'-O-Me.

[0175] In some embodiments, the modification includes 2'-F.

[0176] In some embodiments, the modification involves linking one or more nucleotides to a phosphorothio Includes eth (PS) bonds. In some embodiments, the modification is the first four at the 5' terminus. Three PS bonds linking the nucleotides and the last four nucleos at the 3' terminus These are three PS bonds that connect the cydops.

[0177] In some embodiments, the modification includes an inverted debasic nucleotide.

[0178] In some embodiments, each nucleotide in the upper stem is modified with 2'-O-Me A crRNA containing a rheotide is provided. In some embodiments, the crRNA is US-1 or US-14 is modified with 2'-O-Me, respectively. In some embodiments, crR LS1 and LS6 of NA are modified with 2'-O-Me. In some embodiments, c The LS5 tag of rRNA is modified with 2'-O-Me.

[0179] In some embodiments, each of the nucleotides in the upper stem, and in the lower stem crRNA containing 2'-O-Me modified nucleotides in LS1 and LS6 is provided. In some embodiments, the crRNA is located in the 5' and / or 3' terminal regions, for example. If, during the 5' and / or 3' terminal modifications, one or more 2'-O-Me or 2' - Further contains O-moe modified nucleotides.

[0180] In some embodiments, each of the nucleotides in the upper stem, LS1 in the lower stem crRNA containing 2'-O-Me modified nucleotides was found in LS5 and LS6. In some embodiments, the crRNA is provided in the 5' and / or 3' terminal regions, for example. For example, during the 5' and / or 3' terminal modifications, one or more 2'-O-Me or 2 Further contains -O-moe modified nucleotides.

[0181] In some embodiments, the present invention relates to the odor of LS1, LS2, and LS6 in the lower stem. The crRNA contains a 2'-F modified nucleotide. In some embodiments, the crRNA This further modifies the 2'-F modified nucleotides in B1 and B2 in the bulge region. In some embodiments, the present invention includes LS1, LS2, and LS6 in the lower stem. In this region, and in B1 and B2 in the bulge region, the 2'-F modified nucleus Contains crRNA containing rheotide. In some embodiments, the crRNA is 5' and / or Or in the 3' terminal region, for example, in the 5' and / or 3' terminal modifications, one or more Further includes 2'-O-Me or 2'-O-moe modified nucleotides.

[0182] In some embodiments, crRNA has nucleotides LS1 and L in the lower stem region. S6; each nucleic acid in the bulge region; and each nucleic acid in the upper stem region It contains 2'-O-Me modified nucleotides. In some embodiments, the LS5 nucleotide of crRNA The creotide is also modified with 2'-O-Me. In some embodiments, the LS of crRNA 2, LS3 and LS4 are unmodified. In some embodiments, crRNA is 5 In the 'and / or 3' terminal region, for example, in the 5' and / or 3' terminal modification, one or further comprising multiple 2'-O-Me or 2'-O-moe modified nucleotides.

[0183] In some embodiments, crRNA is located in the lower stem region, specifically in LS1, LS2, and LS 6, and in each of the nucleotides in the bulge region, 2'-fluoro(2'-F ) Contains modified nucleotides. In some embodiments, the crRNA has L in the lower stem region. S1, LS2, and LS6, as well as B2 and 2'-F in B2 within the bulge region. It contains a ruolo(2'-F) modified nucleotide. In some embodiments, the crRNA is located at the bottom In each of the nucleotides in the stem region (LS1-LS6) and the bulge region Contains 2'-fluoro(2'-F) modified nucleotides. In some embodiments, crRNA This occurs in the 5' and / or 3' terminal region, for example, during 5' and / or 3' terminal modifications. further comprising one or more 2'-O-Me or 2'-O-moe modified nucleotides nothing.

[0184] In some embodiments, the present invention relates to the following regions: 5' end, upper stem region; bulge region Lower stem region; Nexus region; Hairpin 1 region; Hairpin 1 region and Hairpin 2 region Intervening region between; hairpin 2 region; and one within one or more of the 3' terminal region Or it contains trRNA with multiple modified nucleotides.

[0185] In some embodiments, the modification includes 2'-O-Me.

[0186] In some embodiments, the modification includes 2'-F.

[0187] In some embodiments, the modification involves linking one or more nucleotides to a phosphorothio Includes eth (PS) bonds. In some embodiments, the modification is the first four at the 5' terminus. Three PS bonds linking the nucleotides and the last four nucleos at the 3' terminus These are three PS bonds that connect the cydops.

[0188] In some embodiments, the modification includes an inverted debasic nucleotide.

[0189] In some embodiments, trRNA is each nucleic acid in the upper stem; B1 in the bulge region and B2; LS1 and LS2 in the lower stem region; N3, N4, N5 in the nexus region N15, N16, N17, and N18; each nucleotide in the hairpin 1 region; hairpin One nucleotide between region 1 and hairpin region 2; and each nucleotide in hairpin region 2 The rheotide contains a 2'-O-Me modified nucleotide. In some embodiments, trR NA is in the 5' and / or 3' terminal region, for example, 5' and / or 3' terminal modification. Inside, one or more 2'-O-Me or 2'-O-moe modified nucleotides It is included in.

[0190] In some embodiments, trRNA is composed of each nucleic acid in the upper stem; each nucleus in the bulge region. Otid; LS1, LS2, LS5, and LS6 in the lower stem region; in the nexus region N3-N5, N10-N18; each nucleotide in hairpin region 1; hairpin region 1 and One nucleotide between the apin 2 region and the hairpin 2 region; and each nucleotide in the hairpin 2 region The nucleotides include 2'-O-Me modified nucleotides. In some embodiments, the crRNA is 5 In the 'and / or 3' terminal region, for example, in the 5' and / or 3' terminal modification, one or further comprising multiple 2'-O-Me or 2'-O-moe modified nucleotides.

[0191] In some embodiments, the trRNA is located at 2' from N15 to N18 in the nexus region. - Contains F-modified nucleotides. In some embodiments, trRNA contains 5' and / or In the 3'-terminal region, for example, in the 5' and / or 3'-terminal modifications, one or more 2' -F-modified nucleotides are further included.

[0192] In some embodiments, the trRNA is located in LS4 and LS5 in the lower stem region, and The nexus region contains 2'-F modified nucleotides at N13-N18. In the application morphology, trRNA is located in the 5' and / or 3' terminal regions, for example, 5' and / Alternatively, the 3'-terminal modification may further include one or more 2'-F modified nucleotides.

[0193] In some embodiments, trRNA is located in LS1, LS3, and LS5 in the lower stem. The 2'-F modified nucleotides in and LS2, LS4, and LS6 in the lower stem It contains a 2'-O-Me modified nucleotide.

[0194] In some embodiments, the following region: the first five nucleotides at the 5' end; bottom Stem region; bulge region; upper stem region; and the last five nuclei at the 3' end. Crispr RNA containing one or more modifications within one or more of the ocides ( crRNA) is disclosed herein. In some embodiments, the modification is 2'-O-methyl ( It contains a 2'-O-Me) modified nucleotide. In some embodiments, the modification is 2'-fluoro The nucleotides include (2'-F) modified nucleotides. In some embodiments, the modification is between nucleotides. Includes sulfrothioate (PS) bonds. In some embodiments, the first three at the 5' terminus The nucleotides and the last three nucleotides at the 3' end are modified. In some embodiments, the first four nucleotides at the 5' end, and at the 3' end The last four nucleotides are linked by phosphorothioate (PS) bonds. In some embodiments, the modification includes 2'-O-Me. In some embodiments, the modification is 2 '-F is included. In some embodiments, the first four nucleotides at the 5' terminus and The last four nucleotides at the 3' terminus are linked by PS bonds, and the 5' terminus The first three nucleotides at the terminal and the last three nucleotides at the 3' terminal The 'do' includes a 2'-O-Me modification. In some embodiments, the first four 'nu's at the 5' terminus The creotide and the last four nucleotides at the 3' term are linked by a PS bond. It is also the first three nucleotides at the 5' end and the last at the 3' end. The three nucleotides contain a 2'-F modification. In some embodiments, LS1 and LS6 are Modified with 2'-O-Me. In some embodiments, the nucleoty in the upper stem region Each of the dos is modified by 2'-O-Me.

[0195] In some embodiments, the present invention relates to the following nucleotides: LS1 in the lower stem region and LS6; and 2'-O-Me modified nucleic acids in each nucleotide in the upper stem region It contains crispr RNA (crRNA). In some embodiments, crRNA is Three phosphorothioates (PS) link the first four nucleotides at the 5' terminus. ) The bond and the three PS bonds that link the last four nucleotides at the 3' terminus It also includes. In some embodiments, the crRNA has the first three nucleos at the 5' end. 2'-O-Me or 2'-F modified nucleic acids at the tide, and the last three at the 3' end Nucleic acids with 2'-O-Me or 2'-F modifications in the nucleotide, and further comprising some In the embodiment, LS1, LS2, and LS6 are modified with 2'-F. Morphologically, each nucleotide in the bulge region is modified with a 2'-F molecule.

[0196] In some embodiments, the following nucleotides: LS1, LS2, and in the lower stem region LS6 and each nucleotide in the bulge region, and cri containing 2'-F modified nucleic acids. sprRNA (crRNA) is disclosed herein. In some embodiments, crRN A consists of three phosphorothioates that link the first four nucleotides at the 5' terminus. (PS) bond and three PS bonds that link the last four nucleotides at the 3' terminus The combination further includes. In some embodiments, the crRNA has the first three nuclei at its 5' end. In creotides, 2'-O-Me or 2'-F modified nucleic acids, and the 3' terminus The following three nucleotides further contain 2'-O-Me or 2'-F modified nucleic acids.

[0197] In some embodiments, a crRN containing any one nucleic acid from SEQ ID NOs: 1 to 187 is included. A is provided. In some embodiments, sequence numbers 19-31, 53-73, 104-13 A crRNA containing nucleic acid 0 and one of the nucleic acids from 161 to 187 is provided. In some embodiments, sequence numbers 19-31, 53-73, 104-130, and 161 For any one of the ~187 nucleic acids, at least 99, 98, 97, 96, or 95 nuclei with 94, 93, 92, 91, 90, 85, 80, 75, or 70% identity crR containing acid and having a modification pattern identical to the modification pattern shown in the reference sequence identifier. NA is provided. In some embodiments, the crRNA has the first four at the 5' end Three phosphorothioate (PS) bonds linking nucleotides and at the 3' terminus It further includes three PS bonds that link the last four nucleotides.

[0198] The following regions: the first five nucleotides at the 5' terminus; the upper stem region; the bulge region. Region; lower stem region; nexus region; hairpin 1 region; hairpin 2 region; and 3' termination. One or more modifications within one or more of the last five nucleotides in This also includes tracr RNA (trRNA). In some embodiments, the modification is 2' The nucleotides include -O-methyl(2'-O-Me) modified nucleotides. In some embodiments, the modification is Contains 2'-fluoro(2'-F) modified nucleotides. In some embodiments, the modification is nucleotide Includes phosphorothioate (PS) bonds between rheotides. In some embodiments, the 5' terminus is The first four nucleotides and the last four nucleotides at the 3' terminus are They are linked by phosphorothioate (PS) bonds. In some embodiments, the 5' terminus is used. The first three nucleotides at the 3' terminology, and the last three nucleotides at the 3' terminology. It is modified. In some embodiments, the modification includes 2'-O-Me. Then the modification includes 2'-F. In some embodiments, the first four nuclei at the 5' terminator The rheotide and the last four nucleotides at the 3' terminus are linked by a PS bond. Furthermore, the first three nucleotides at the 5' end and the last three at the 3' end The nucleotides include a 2'-O-Me modification at the 5' terminus. In some embodiments, The first four nucleotides and the last four nucleotides at the 3' terminus are PS-bonded. They are linked by the first three nucleotides at the 5' end and the 3' end. The last three nucleotides in include a 2'-F modification. In some embodiments, the upper part Each nucleotide in the TEM region is modified with 2'-O-Me. In some embodiments, B1 and B2 within the bulge region are modified with 2'-O-Me. In some embodiments, N3, N4, N5, N15, N16, N17, and N18 in the nexus region are 2'- Modified with O-Me, in some embodiments, each nucleotide in the hairpin 1 region is Modified with 2'-O-Me. In some embodiments, each nucleo in the hairpin 2 region The cydo is modified by 2'-O-Me.

[0199] In some embodiments, the present invention relates to the following nucleotides: each nucleotide in the upper stem ;B1 and B2 in the bulge region;N3, N4, N5, N15, N16 in the nexus region , N17, and N18; each nucleotide in hairpin 1 region; and in hairpin 2 region tracr RNA (trRN) containing 2'-O-Me modified nucleic acids at each nucleotide A) includes. In some embodiments, the trRNA has the first four nuclei at the 5' end. Three phosphorothioate (PS) bonds linking the ocide and the last at the 3' terminus It further includes three PS bonds linking four nucleotides. In some embodiments, tr RNA has 2'-O-Me or 2 in the first three nucleotides at the 5' end. '-F modified nucleotides and 2'- at the last three nucleotides at the 3' terminus The further comprises O-Me or 2'-F modified nucleic acids. In some embodiments, N15, N1 6, N17, and N18 are modified with 2'-F. In some embodiments, LS1, LS3 and LS5 are modified with 2'-F, and LS2, LS4, and LS6 It is modified with 2'-O-Me. In some embodiments, the trRNA has a 5' terminus. Three phosphorothioate (PS) bonds link the first four nucleotides and It further includes three PS bonds that ligate the last four nucleotides at the 3' terminus. In one embodiment, the trRNA has the first three nucleotides at its 5' terminus. 2'-O-Me or 2'-F modified nucleic acids and the last three nucleotides at the 3' terminus The present invention further includes 2'-O-Me or 2'-F modified nucleic acids in the present invention.

[0200] In some embodiments, the tr includes one nucleic acid from sequence numbers 188 to 227. RNA is provided. In some embodiments, any one of sequence numbers 188-227 is provided. For each nucleic acid, at least 99, 98, 97, 96, 95, 94, 93, 92, 91, It contains nucleic acids with 90, 85, 80, 75, or 70% identity, and the modification pattern is A trRNA is provided that has the same modification pattern as indicated by the trace sequence identifier. In its morphological form, trRNA consists of three nucleotides that ligate the first four nucleotides at the 5' end. The phosphorothioate (PS) bond and the last four nucleotides at the 3' terminus It further includes three connecting PS bonds.

[0201] In some cases, a dual guide containing crRNA and trRNA is provided, and cr RNA contains one nucleic acid from sequence numbers 1 to 187, and trRNA is distributed Contains one nucleic acid from column numbers 188 to 227.

[0202] A dua comprising crRNA and trRNA disclosed herein. This includes a guide and includes the crRNA and unmodified trRNA disclosed herein. Dual guides are also included. In some embodiments, unmodified crRNA and the information provided herein are included. A dual guide containing the modified trRNA shown is provided.

[0203] In some embodiments, the following are included: Embodiment 55. crispr RNA (crRNA), specifically in the following region: a. The first five nucleotides at the 5' terminus, b. Lower stem region and, c. Bulge region and, d. Upper stem region and, e. The last five nucleotides at the 3' terminus, and one of them within one or more or crRNA containing multiple modifications. Embodiment 56. Embodiment 55, in which the modification includes a 2'-O-methyl (2'-O-Me) modified nucleotide crRNA. Embodiment 57. The crRN of Embodiment 55, in which the modification includes a 2'-fluoro(2'-F) modified nucleotide. A. Embodiment 58. The modification involves a phosphorothioate (PS) bond between nucleotides in embodiment 55 of cr RNA. Embodiment 59. The first three nucleotides at the 5' terminus and the last three nucleotides at the 3' terminus A crRNA modified with a rheotide, one of any of embodiments 55 to 58. Embodiment 60. The first four nucleotides at the 5' terminus, and the last four nucleotides at the 3' terminus. Embodiments 55-5 in which the cleotide is linked by phosphorothioate (PS) bonds. One of the 8 crRNAs. Embodiment 61. crRNA of Embodiment 59, wherein the modification includes 2'-O-Me. Embodiment 62. crRNA of Embodiment 59, wherein the modification includes 2'-F. Embodiment 63. The first four nucleotides at the 5' terminus and the last four nucleotides at the 3' terminus The rheotide is linked by a PS bond, and the first three nucleotides are at the 5' terminus. And the last three nucleotides at the 3' terminus contain 2'-O-Me modifications. One crRNA from any of the application forms 55-62. Embodiment 64. The first four nucleotides at the 5' terminus and the last four nucleotides at the 3' terminus The rheotide is linked by PS bonds, and the first three nucleos at the 5' terminus Embodiments in which the last three nucleotides at the tide and 3' terminus include 2'-F modifications. One of the crRNAs from 55 to 62. Embodiment 65. Any of embodiments 55 to 60 in which LS1 and LS6 are modified with 2'-O-Me Or one crRNA. Embodiment 66. Each nucleotide in the upper stem region is modified with 2'-O-Me, One crRNA from morphology 55-60 and 65. Embodiment 67. crispr RNA (crRNA), a. LS1 and LS6 in the lower stem region, b. Each nucleotide in the upper stem region and a 2'-O-Me modified nucleotide crRNA, including Embodiment 68. Three phosphorothioates (P) link the first four nucleotides at the 5' terminus. S) bond and three PS bonds linking the last four nucleotides at the 3' terminus Furthermore, the crRNA of embodiment 67 is also included. Embodiment 69. The first three nucleotides at the 5' terminus are modified with either 2'-O-Me or 2'-F. Decorative nucleotides, and the last three nucleotides at the 3' terminus have 2'-O- crRN of Embodiment 67 or 68, further comprising Me or 2'-F modified nucleotide. A. Embodiment 70. Embodiments 55-60, in which LS1, LS2, and LS6 are modified with 2'-F One of the crRNAs. Embodiment 71. Each nucleotide in the bulge region is modified with 2'-F, as in Embodiments 55-60. One of the 70 crRNAs. Embodiment 72. crispr RNA (crRNA), a. LS1, LS2, and LS6 in the lower stem region, b. Each nucleotide in the bulge region contains a 2'-F modified nucleotide, c rRNA. Embodiment 73. Three phosphorothioates (P) link the first four nucleotides at the 5' terminus. S) bond and three PS bonds linking the last four nucleotides at the 3' terminus Furthermore, the crRNA includes any one of embodiments 70 to 72. Embodiment 74. 2'-O-Me or 2'-F modifier in the first three nucleotides at the 5' terminus Decorative nucleotides and 2'-O-Me in the last three nucleotides at the 3' terminus Or a crRN of Embodiment 72 or 73, further comprising a 2'-F modified nucleotide. A. Embodiment 75. crRNA containing one of the nucleic acids from sequence numbers 1 to 187. Embodiment 76. Among sequence numbers 19-31, 53-73, 104-130, and 161-187 crRNA containing either one nucleic acid. Embodiment 77. Among sequence numbers 19-31, 53-73, 104-130, and 161-187 For any one nucleic acid, at least 99, 98, 97, 96, 95, 94, 93, 92 , containing nucleic acids having 91, 90, 85, 80, 75, or 70% identity, modified pattern crRNA whose sequence has the same modification pattern as that shown in the reference sequence identifier. Embodiment 78. Three phosphorothioates (P) link the first four nucleotides at the 5' terminus. S) bond and three PS bonds linking the last four nucleotides at the 3' terminus Furthermore, the crRNA includes any one of embodiments 75 to 77. Embodiment 79. tracr RNA (trRNA), The following areas: a. The first five nucleotides at the 5' terminus, b. Upper stem region and, c. Bulge region and, d. Lower stem region and, e. Nexus area and, f. Hairpin 1 region and g. Hairpin 2 area and, The last five nucleotides at the 3' end, and one of them within one or more Or trRNA containing multiple modifications. Embodiment 80. Embodiment 79, in which the modification includes a 2'-O-methyl (2'-O-Me) modified nucleotide trRNA. Embodiment 81. trRN of Embodiment 79, in which the modification includes a 2'-fluoro(2'-F) modified nucleotide. A. Embodiment 82. In embodiment 79, the modification involves phosphorothioate (PS) bonding between nucleotides. RNA. Embodiment 83. The first four nucleotides at the 5' terminus, and the last four nucleotides at the 3' terminus. Embodiments 79-8, in which the cleotide is linked by phosphorothioate (PS) bonds. One of the two trRNAs. Embodiment 84. The first three nucleotides at the 5' end, and the last three nucleotides at the 3' end A trRNA from any one of embodiments 79 to 82, which is modified with a creotide. Embodiment 85. trRNA of Embodiment 84, wherein the modification includes 2'-O-Me. Embodiment 86. The trRNA of Embodiment 84, wherein the modification includes 2'-F. Embodiment 87. The first four nucleotides at the 5' terminus and the last four nucleotides at the 3' terminus The rheotide is linked by PS bonds, and the first three nucleos at the 5' terminus The last three nucleotides at the tide and 3' terminus contain 2'-O-Me modifications. One trRNA from any of the application forms 79-86. Embodiment 88. The first four nucleotides at the 5' terminus and the last four nucleotides at the 3' terminus The rheotide is linked by PS bonds, and the first three nucleos at the 5' terminus Embodiments in which the last three nucleotides at the tide and 3' terminus include 2'-F modifications. One of the trRNAs from 79 to 86. Embodiment 89. Embodiment 79, in which each nucleotide in the upper stem region is modified with 2'-O-Me One of the following 84 trRNAs. Embodiment 90. Embodiments 79-8 in which B1 and B2 within the bulge region are modified with 2'-O-Me One of either trRNAs 4 or 89. Embodiment 91. N3, N4, N5, N15, N16, N17, and N18 in the nexus region are 2'- One tr from any of embodiments 79-84 and 89-90, modified with O-Me RNA. Embodiment 92. Embodiment 79, in which each nucleotide in the hairpin 1 region is modified with 2'-O-Me One trRNA from either ~84 or 89~91. Embodiment 93. Embodiment 79, in which each nucleotide in the hairpin 2 region is modified with 2'-O-Me One trRNA from either ~84 or 89~92. Embodiment 94. tracr RNA (trRNA), a. Each nucleotide in the upper stem, b. B1 and B2 within the bulge region, c. N3, N4, N5, N15, N16, N17, and N18 in the nexus region, d. Each nucleotide in the hairpin 1 region, e. Each nucleotide in the hairpin 2 region and the 2'-O-Me modified nucleotide trRNA, including Embodiment 95. Three phosphorothioates (P) link the first four nucleotides at the 5' terminus. S) bond and three PS bonds linking the last four nucleotides at the 3' terminus Furthermore, the trRNA of Embodiment 94 is included. Embodiment 96. 2'-O-Me or 2'-F modifier in the first three nucleotides at the 5' terminus Decorative nucleotides and 2'-O-Me in the last three nucleotides at the 3' terminus or crRNA of Embodiment 94 or 95, further comprising a 2'-F modified nucleic acid. Embodiment 97. Embodiments 79~ in which N15, N16, N17, and N18 are modified with 2'-F One of the 84 trRNAs. Embodiment 98. LS1, LS3, and LS5 are modified with 2'-F, and LS2, LS4, And LS6 is modified with 2'-O-Me, trRNA according to any of embodiments 79-84 and 97. Embodiment 99. Three phosphorothioates (P) link the first four nucleotides at the 5' terminus. S) bond and three PS bonds linking the last four nucleotides at the 3' terminus Furthermore, the trRNA includes any one of embodiments 87 to 98. Embodiment 100. The first three nucleotides at the 5' terminus are modified with either 2'-O-Me or 2'-F. Decorative nucleotides, and the last three nucleotides at the 3' terminus have 2'-O- trRN of Embodiment 98 or 99, further comprising a Me or 2'-F modified nucleotide A. Embodiment 101. A trRNA containing one of the nucleic acids from sequence numbers 188 to 227. Embodiment 102. For any one nucleic acid among sequence numbers 188-227, at least 99, 98, 97, 96, 95, 94, 93, 92, 91, 90, 85, 80, 75, or 70% It contains nucleic acids of the same identity, and its modification pattern is the same as the modification pattern shown in the reference sequence identifier. trRNA is one of them. Embodiment 103. Three phosphorothioates (P) link the first four nucleotides at the 5' terminus. S) bond and three PS bonds linking the last four nucleotides at the 3' terminus Furthermore, the trRNA includes any one of embodiments 101 to 102. Embodiment 104. A dual guide containing crRNA and trRNA, wherein the crRNA is sequence number 1 It contains one of the nucleotides ~187 and the trRNA is sequence number 18 A dual guide containing one nucleic acid from 8 to 227. Embodiment 105. Any one crRNA from Embodiments 55-78 and the crRNA from Embodiments 79-103 A dual guide containing one of the trRNAs. Embodiment 106. The crRNA and unmodified trRNA included in any one of embodiments 55 to 78. Dual guides. Embodiment 107. It comprises unmodified crRNA and one trRNA from any one of embodiments 79 to 103. Hmm, dual guides.

[0204] C. Modification of terminal nucleotides In some embodiments, the 5' or 3' of any of the guide RNAs described herein The terminal nucleotide is modified. In some embodiments, for example, sgRNA, dg RNA, crRNA, trRNA, or both crRNA and trRNA, etc. 1, 2, 3, 4, 5 at the terminal (i.e., last) portion of the 3' terminal region of the id RNA. One, six, or seven nucleotides are modified. In some embodiments, guide R The terminal (i.e., last) part of the 3' terminal region of NA: 1, 2, 3, 4, 5, 6 Each or seven nucleotides contains one or more modifications. In some embodiments, the 3' In the terminal region, the terminal part (i.e., the last) has 1, 2, 3, 4, 5, 6, In some embodiments, at least one of the seven nucleotides is modified. , 1, 2, 3, 4, 5, 6 at the end (i.e., last) of the 3' terminal region, Or at least two of the seven nucleotides are modified. In some embodiments These are the 1st, 2nd, 3rd, 4th, 5th, and 6th elements at the end (i.e., the last) of the 3'-terminated region. or at least three of the seven nucleotides are modified. Some embodiments And the modifications include PS linking.

[0205] In some embodiments, the 5' end of the 5' terminal region is modified, for example, sgRNA dgRNA, crRNA, trRNA, or the most extreme form of both crRNA and trRNA The first one, two, three, four, five, six, or seven nucleotides are modified. In some embodiments, the first one, two, three, or four molecules in the 3' terminal region of the guide RNA , 5, 6, or 7 nucleotides contain one or more modifications. Some embodiments So, at the 5' end, the terminal part (i.e., the first) has 1, 2, 3, 4, 5, and 6 At least one of the seven nucleotides is modified. Some implementations In this state, the terminal portion at the 5' end has 1, 2, 3, 4, 5, 6, or 7 At least two of the nucleotides are modified. In some embodiments, the 5' end The terminal portion of the nucleotide capsule contains 1, 2, 3, 4, 5, 6, or 7 nucleotides. At least three of these are modified. In some embodiments, the modifications include PS linking.

[0206] In some embodiments, guide RNA, e.g., sgRNA, dgRNA, crRNA, trRNA, or the 5' and 3' ends of both crRNA and trRNA (for example) In some embodiments, both the terminal and guide RNA are modified. RNA, dgRNA, crRNA, trRNA, or both crRNA and trRNA Only the 5' end of the RNA is modified. In some embodiments, a guide RNA, e.g., sg RNA, dgRNA, crRNA, trRNA, or both crRNA and trRNA Only the 3' terminology is modified.

[0207] In some embodiments, the gRNA has the first seven nucleos at the 5' end of the gRNA. The modifier includes modifications in one, two, three, four, five, six, or seven of the terms. In one embodiment, the gRNA has one of the seven nucleotides in its terminal portion at the 3' end. Includes modifications in 1, 2, 3, 4, 5, 6, or 7. In some embodiments This involves two, three, or four of the first four nucleotides at the 5' end. two, three, or any of the four nucleotides at the terminal end of the 3' end Four are modified. In some embodiments, the first four nucleotides at the 5' end Two, three, or four of the dots are linked by phosphorothioate (PS) bonds. It is.

[0208] In some embodiments, modifications to the 5' and / or 3' terminology result in two nucleotides being added to the nucleotide. '-O-methyl (2'-O-Me) or 2'-O-(2-methoxyethyl)(2'-O This includes -moe) modifications. In some embodiments, the modification involves a 2'-fluoro change to the nucleotide. The modification includes (2'-F) modification. In some embodiments, the modification is a phosphorothiocyanate between nucleotides. Includes eth (PS) linkage. In some embodiments, the modification includes inverted debasal nucleotides. In some embodiments, the modification is 2'-O-Me, 2'-O-moe, 2'-fluoro( 2'-F), phosphorothioate (PS) linkage between nucleotides, and inverse debasing nuclei It includes one or more modifications selected from rheotides. In some embodiments, equivalent modifications are It is included.

[0209] In some embodiments, guide RNA, e.g., sgRNA, dgRNA, crRNA, trRNA, or both crRNA and trRNA, are the first ones at the 5' end. , one or more nucleotides between 2, 3, 4, 5, 6, or 7 nucleotides Includes scholothioate (PS) linkage. In some embodiments, a guide RNA, e.g., s gRNA, dgRNA, crRNA, trRNA, or crRNA and trRNA Both are the last 1, 2, 3, 4, 5, 6, or 7 Nu at the 3' end. The creotides contain one or more PS linkages. In some embodiments, guide RNA is included. For example, sgRNA, dgRNA, crRNA, trRNA, or crRNA and Both trRNAs have the last 1, 2, or 3 at both the 5' and 3' ends. It contains one or more PS linkages between 4, 5, 6, or 7 nucleotides. In some embodiments, in addition to PS linkage, the 5' and 3' terminal nucleotides are 2'-O It may contain -Me, 2'-O-moe, or 2'-F modified nucleotides.

[0210] In some embodiments, guide RNA, e.g., sgRNA, dgRNA, crRNA, trRNA, or both crRNA and trRNA, have 5' and 3' ends. Modified nucleotides, as well as one of the following listed in Tables 1-3 and Figure 21A or Figure 21C or it contains modified nucleotides in multiple other regions.

[0211] In some embodiments, crRNA, trRNA, or crRNA and trRNA Both contain modified nucleotides that are not at the 5' or 3' end. The turns are listed below and in Table 4.

[0212] 3. Delivery of gRNA and Cas proteins In some embodiments, in addition to at least one gRNA, the composition provided herein is used. The substance further contains a nuclease. In some embodiments, the nuclease is a Cas protein. In some embodiments, the gRNA combined with the Cas protein is called Cas RN. In some embodiments, the Cas protein is called type II CRISPR / Cas It originates from the system. In some embodiments, the Cas protein is Cas9. In some embodiments, the Cas9 protein is wild-type Cas9. The Cas9 protein is produced by Streptococcus pyogenes. Cas9 proteins, such as those derived from Cas9 in S. pyogenes. In some embodiments, the Cas9 protein is derived from S. pyogenes. However, it functions similarly to Cas9 in S. pyogenes. Cas9-specific gRNAs in *S. pyogenes* are found in non-*S. pyogenes* species. Cas9 is directed to its target site. In some embodiments, Cas is directed to the target DNA. It induces chain breaks. The Cas9 protein equivalent of S. pyogenes is This is included in the embodiments described herein.

[0213] Cas9 includes its variants and mutants. Inactive, RuvC or HNH A modified version of Cas9 that has either one catalytic domain is called "nickase". Nickase cuts only one strand on the target DNA, thus creating a single-strand break. A single-strand break is sometimes also known as a "nick". In some embodiments, a combination The product and method include nickase. In some embodiments, the composition and method target D It contains Cas9, a nickase that induces nicks rather than double-strand breaks in NA.

[0214] In some embodiments, the Cas protein has only one functional nuclease domain. It may be modified to include the following: For example, the Cas protein may contain the nuclease dome. By mutating or completely or partially deleting one of the nucleic acids, its nucleic acid cleavage activity is reduced. It may be modified to reduce the activity. In some embodiments, RuvC has reduced activity. A nickase Cas having a domain is used. In some embodiments, inactive RuvC A niccase Cas having a domain is used. In some embodiments, reduced activity is used. A nicasse Cas having an HNH domain is used. In some embodiments, A nicasse Cas having an active HNH domain is used.

[0215] In some embodiments, the conserved amino acids within the nuclease domain of the Cas protein The acid is substituted to reduce or alter the nuclease activity. In some embodiments, The Cas protein has amino acids in the RuvC or RuvC-like nuclease domain. This may include substitutions. Exemplary amino acids in RuvC or RuvC-like nuclease domains. As for acid substitution, D10A (based on the Cas9 protein of S. pyogenes) Examples include (and). In some embodiments, the Cas protein is HNH or HNH-like. The nuclease domain may contain amino acid substitutions. HNH or HNH-like nuclease Exemplary amino acid substitutions in the -ze domain include E762A, H840A, and N863A. , H983A, and D986A (Cas9 protein of S. pyogenes) (Quality-based) are cited as examples.

[0216] In some embodiments, the RNP complex described herein is used to target nickase and target The sequence contains a pair of guide RNAs complementary to both the sense strand and the antisense strand. In this embodiment, the guide RNA directs the nickase to the target sequence and the opposite strand of the target sequence. By generating nicks on top (i.e., double nick formation), double-strand breaks (DSBs) are created. To introduce. In some embodiments, the use of double nick formation improves specificity and off The GET effect can be reduced. In some embodiments, nickase Cas acts in opposition to DNA. Used with two separate guide RNAs that target strands, it double-nicks the target DNA. It generates. In some embodiments, nickase Cas is two selected to be in close proximity. Used with separate guide RNAs, it generates a double nick in the target DNA.

[0217] In some embodiments, one domain or region of a protein is a different part of the protein. A chimeric Cas protein substituted by the same component is used. In some embodiments, Cas Nuclease domains are derived from domains of different nucleases, such as Fok1. It may be substituted. In some embodiments, the Cas protein is a modified nuclease. It's okay to have it.

[0218] In some embodiments, the Cas protein is catalytically inactive, linked to heterologous functional domains. A fusion protein containing Cas9 (for example, International Patent Publication No. 20141524) (See No. 32). In some embodiments, catalytically inactive Cas9 is S. pyogenes ( It is from S. Pyogenes. In some embodiments, catalytically inactive Cas9 is Ca This includes a mutation that inactivates s9. In some embodiments, the heterologous functional domain is used in gene expression These are domains that modify histones or DNA. In some embodiments, heterogeneous functionalities are used. The domain is either a transcriptional activator domain or a transcriptional repressor domain.

[0219] A.PAM In some embodiments, the target sequence may be adjacent to the PAM. In some embodiments, PA M is adjacent to one, two, three, or four nucleotides at the 3' end of the target sequence. or they may be among those nucleotides. The length and sequence of PAM are used It may depend on the Cas protein. For example, PAM is described in Ran et al., Nature 520: Including those disclosed in Figure 1 of 186-191 (2015) (incorporated herein by reference), Consensus sequence of a specific Cas9 protein or Cas9 orthologue or specific P The AM sequence may be selected from the AM sequence. In some embodiments, the PAM sequence may consist of 2, 3, 4, or 5 elements. It may contain lengths of 1, 6, 7, 8, 9, or 10 nucleotides. Typical example PAM sequences include NGG, NAG, NGA, NGAG, NGCG, and N NGRRT, TTN, NGGNG, NG, NAAAAN, NNAAAAW, NNNNAC A, GNNNCNNA, and NNNNGATT (wherein N is any nucleotide) W is defined as either A or T, and R is defined as either A or G. Examples include (as defined). In some embodiments, the PAM sequence may be NGG. In some embodiments, the PAM sequence may be NGGNG. In some embodiments, P The AM sequence may also be NNAAAAW.

[0220] B. Delivery of modified gRNA Lipid nanoparticles (LNPs) are well known for the delivery of nucleotides and protein cargoes. The means of delivery of gRNA, mRNA, Cas9, and RNP disclosed herein. It may be used for the following purposes. In some embodiments, LNPs are nucleic acids, proteins, or It delivers nucleic acids along with proteins.

[0221] In some embodiments, the present invention targets any one of the gRNAs disclosed herein. A method of delivery, wherein the gRNA is associated with an LNP. Partial implementation In this state, gRNA / LNP also associates with Cas9 or the mRNA encoding Cas9. It is.

[0222] In some embodiments, the present invention includes one of the disclosed gRNAs and an LNP. The composition includes Cas9 or encoding Cas9. In some embodiments, the composition includes Cas9 or encoding Cas9. It also contains an EDM.

[0223] In some embodiments, the LNP contains a cationic lipid. In some embodiments, the LNP is ,3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-( Diethylamino)propoxy)carbonyl)oxy)methyl)propyl(9Z,12Z) Also known as (9Z,12Z)-3-((4 ,4-Bis(octyloxy)butanoyl)oxy)-2-((((3-(Diethylamine (N)propoxy)carbonyl)oxy)methyl)propyloctadeca-9,12-dieno Contains ethyl ester. In some embodiments, LNPs are catethio to RNA phosphates of about 4.5. Includes the molar ratio (N:P) of ionized lipid amines.

[0224] In some embodiments, LNPs associated with the gRNA disclosed herein are associated with disease It is intended for use in the preparation of drugs for treating disorders.

[0225] Electroporation is a well-known method for cargo delivery and is disclosed herein. Any electroporation method for the delivery of any one of the gRNAs The theory may be used. In some embodiments, electroporation is disclosed herein. One of the gRNAs to be processed and Cas9 or the mRN encoding Cas9. It may be used to deliver A.

[0226] In some embodiments, the present invention relates to any one of the gRNAs disclosed herein. A method for delivering ex vivo cells, wherein the gRNA is associated with LNPs, or methods that do not associate with LNPs. In some embodiments, gRNA / LNP or The gRNA also associates with Cas9 or the mRNA encoding Cas9.

[0227] 4. Methods of gene modulation In some embodiments, the present invention is disclosed herein together with a pharmaceutically acceptable carrier. The present invention includes a pharmaceutical formulation containing any one of the gRNAs. In some embodiments, the present invention is Any one of the gRNAs disclosed herein, together with a pharmaceutically acceptable carrier The invention includes pharmaceutical formulations containing LNPs. In some embodiments, the present invention provides pharmaceutically acceptable formulations. Along with the body, one of the gRNAs disclosed herein, the Cas9 protein, or This includes pharmaceutical formulations containing mRNA encoding the Cas9 protein and LNPs. In this embodiment, the pharmaceutical preparation is used in the preparation of a drug for treating a disease or disorder. This invention is intended to achieve the following. In some embodiments, the present invention relates to the gRNA described herein. A method of treating a human patient, which includes administering one of the pharmaceutical formulations. include.

[0228] In some embodiments, the present invention relates to Cas protein or Cas mRNA and the present invention To administer or deliver one or more of the gRNAs disclosed in the details This includes methods or uses that modify target DNA.

[0229] In some embodiments, the present invention relates to Cas protein or Cas mRNA and the present invention To administer or deliver one or more of the gRNAs disclosed in the details This includes methods or uses for the modulation of target genes. In some embodiments, Modulation is the editing of a target gene. In some embodiments, modulation This refers to a change in the expression of the protein encoded by the target gene.

[0230] In some embodiments, the method or use results in gene editing. In terms of form, the method or use results in a double-strand break within the target gene. In application, the method or use leads to the formation of indel mutations between non-homologous end joinings of DSBs. It results in the following: In some embodiments, the method or use involves the nucleotide in the target gene. This results in the insertion or deletion of a nucleotide in the target gene. In some embodiments, this results in the insertion or deletion of a nucleotide in the target gene. Otide insertion or deletion results in a frameshift change that causes a non-functional protein. Leads to a different or immature stop codon. In some embodiments, nucleotides in the target gene Insertion or deletion leads to knockdown or removal of target gene expression. Some embodiments The method or use involves homologous recombination repair of DSBs. In some embodiments, the method or The use further includes delivering a template to the cell, and at least a portion of the template is Cas At or near the protein-induced double-strand break site, the target DNA It will be incorporated into the system.

[0231] In some embodiments, the method or use results in gene modulation. In some embodiments, gene modulation involves increasing or decreasing gene expression, D This involves a change in the methylation state of NA, or modification of a histone subunit. (Some embodiments) So, the method or use involves increasing the expression of the protein encoded by the target gene or This results in a decrease.

[0232] In some embodiments, any of the gRNAs disclosed herein may be associated with disease or It may be useful in the preparation of drugs to treat disorders.

[0233] A. Measurement of gene modulation The effectiveness of modified g RNA can be tested in vitro and in vivo. In some embodiments, the present invention uses one or more of the gRNAs disclosed herein. Including gRNA, when provided to cells along with Cas9, it results in gene modulation. This results in the following: In some embodiments, the effectiveness of gRNA is demonstrated in vitro or in vitro. It can be measured in a vivo assay.

[0234] 1. In vitro measurement of Cas effectiveness In some embodiments, the activity of CasRNPs containing modified sgRNAs is compared with that of unmodified sgRNAs. It is compared to the activity of Cas RNPs containing [specific component].

[0235] In some embodiments, the activity of Cas RNPs containing modified trRNA and dgRNA is This is compared to the activity of Cas RNPs containing dgRNA, including unmodified trRNA.

[0236] In some embodiments, the activity of Cas RNPs containing modified crRNA and dgRNA is This is compared to the activity of Cas RNPs containing dgRNA, including unmodified crRNA.

[0237] In some embodiments, C includes modified crRNA and dgRNA containing modified trRNA. The activity of as RNPs includes Cas RNPs containing unmodified crRNA and unmodified trRNA. Its activity is compared to that of [another entity].

[0238] In some embodiments, the effectiveness of gRNA in increasing or decreasing the expression of the target protein The sex is determined by measuring the amount of the target protein. In some embodiments, The gRNA comprises one of the gRNAs described herein, and the gRNA is targeted To increase or decrease the amount of protein produced from the gene. In some embodiments The present invention involves administering any one of the gRNAs disclosed herein to the target. The method includes modulating protein expression, wherein the gRNA is a target protein. Cas9 is directed to the gene encoding the target protein, and the expression of the target protein is directed to Cas9 Compared to a gRNA control that does not target that gene, it may increase or decrease.

[0239] In some embodiments, the effectiveness of editing using specific gRNAs is demonstrated by Cas9 and gRN Delivery of A (either sgRNA or dgRNA containing crRNA and trRNA) This is determined by the editing present at the target site in the genome later. In some embodiments, The effectiveness of editing using specific gRNAs is measured by next-generation sequencing. In some embodiments, the editing percentage of the target region is determined. This involves the insertion or deletion of nucleotides into the target region relative to the total number of sequence reads. The total number of sequence reads is measured after delivery of gRNA and Cas9. In some embodiments, The present invention involves administering any one of the modified gRNAs described herein to a cell. The method includes a method for increasing the effectiveness of gene editing, including delivery of the gene editing process. - Centesse levels increase compared to similarly unmodified control gRNA.

[0240] In some embodiments, the efficiency of editing using a specific gRNA is determined by the success of gene editing. This is measured by the presence or absence of inserted or deleted nucleotides. In some embodiments, this is measured by the presence or absence of inserted or deleted nucleotides. The present invention involves administering or delivering any one of the modified gRNAs described herein to cells. The method includes, including, creating an insertion or deletion of a nucleotide in a gene, The rheotide is inserted or deleted compared to an unmodified control gRNA. In some embodiments, the activity of Cas9 and gRNA is tested in a biochemical assay. In some embodiments, the activity of Cas9 and gRNA is measured in a cell-free cleavage assay. It is tested. In some embodiments, the activity of Cas9 and gRNA is tested in Neuro2 The test will be conducted in A cells.

[0241] In some embodiments, Cas9 and sgRNA or modified crRNA and / or dgRNAs containing trRNAs are unmodified sgRNAs or unmodified crRNAs and trR It exhibits similar, greater, or reduced activity compared to dgRNA containing NA. In this embodiment, Cas9 and modified sgRNA or modified crRNA and / or dgRNA containing trRNA is unmodified sgRNA or unmodified crRNA and tr It shows enhanced activity compared to dgRNA containing RNA.

[0242] 2. In vivo measurement of Cas effectiveness In some embodiments, the activity of the modified gRNA is determined by the modified gRNA and the Cas protein. Alternatively, measurement after in vivo administration of LNPs containing mRNA encoding the Cas protein. It will be done.

[0243] In some embodiments, the gRNA or composition provided herein is used in vivo. The efficacy was determined by extracting gRNA and Cas9 from tissues (e.g., liver tissue) after administration. It is determined by the effectiveness of the editing measured in the DNA.

[0244] 3. In vivo measurement of immune system activation The gRNA modifications disclosed herein are targets for in vivo administration of gRNA. This may reduce the immune response. In some embodiments, activation of the target immune response sgRN together with Cas9 mRNA or protein (for example, incorporated in LNPs) Site after in vivo administration of dgRNA containing A or trRNA and crRNA It is measured by the serum concentration of cytokines. In some embodiments, cytokines are Interferon-alpha (IFN-alpha), interleukin-6 (IL-6), Monocyte chemotactic protein 1 (MCP-1), and / or tumor necrosis factor alpha (TNF) -alpha) In some embodiments, the present invention relates to the gRNA disclosed herein This involves reducing the target immune response to gRNA delivery, including administering one of the following: The method includes the production of a reduced response by the target immune system after administration of the gRNA. In some embodiments, the present invention provides a similarly modified gRNA compared to an unmodified control gRNA after administration. This includes methods for reducing the activation of the target immune system.

[0245] In some embodiments, modified gRNA (e.g., sgRNA or dgRNA) is used along with C Administration of as RNP or Cas9 mRNA is superior to administration of unmodified sgRNA. To generate lower serum concentrations (or more) of epidemic cytokines. In some embodiments, the present invention This includes administering any one of the gRNAs disclosed herein, which is an immunotherapy. The method includes reducing the target serum concentration of itokine, wherein the gRNA is similarly modified. It produces lower concentrations of immune cytokines in the target serum compared to a control gRNA without it. .

[0246] This description and exemplary embodiments should not be construed as limiting. For the purposes of the attached claims, unless otherwise indicated, this specification and the claims All quantities, percentages, or proportions used within a given range, and all other numerical values. The number, in all cases, is equivalent to the term "approximately" unless it is already modified to mean otherwise. It should be understood as something more modified. Therefore, it should indicate that it is not. Unless otherwise specified, the numerical parameters described in the following specification and attached claims are not applicable. This is an approximate value that can vary depending on the desired characteristic to be obtained. At least, This is not an attempt to limit the application of the doctrine of equivalents to the scope of the claims, but rather an attempt to limit each numerical parameter This is at least in light of the number of significant figures reported and by applying standard rounding techniques. It should be interpreted in this way.

[0247] As used herein and in the appended claims, the singular form "a (one)" "an (one)" and "the (that)" as well as any singular form of any word Use in this context may include multiple referents unless explicitly and clearly limited to a single referent. It should be noted that, as used herein, the term "includes" and its grammatical meaning The transformations are intended to be non-restrictive, and the entries in the list are alternatives to the listed items. Or, do not exclude other similar matters that may be added. [Examples]

[0248] The following embodiments are provided to illustrate a particular disclosed embodiment. This disclosure should not be interpreted as limiting the scope in any way.

[0249] Example 1 - Materials and Methods A. Synthetic guide RNA (gRNA) Dual (dgRNA, i.e., crRNA and trRNA) and single g In both formats of sgRNA, the modified nuclei provided by the vendor in Table 4 gRNA was chemically synthesized using ocidal and ligatures.

[0250] In vitro transcription of B.Cas9 mRNA ("IVT") In vitro using linearized plasmid DNA template and T7 RNA polymerase Capped and polyadenylated Ca containing N1-methyl pseudo-U via ro transfer S9 mRNA was generated. T7 promoter and 100 nucleotide (nt) poly( Plasmid DNA containing the A / T region is linearized with XbaI and then used for commercial production. Obtained from the creator. IVT reaction mixture for generating modified Cas9 mRNA was incubated at 37°C for 4 hours. The following conditions: 50 ng / μL linearized plasmid; 2 mM each of GTP, ATP, and CTP , and N1-methyl pseudo-UTP (Trilink); 10 mM ARCA (Tri link); 5U / μL of T7 RNA polymerase (NEB); 1U / μL of mouse lysate Bonuclease inhibitors (NEBs); 0.004 U / μL of inorganic E. coli pyrophosph The mixture was incubated with NEB (Neuro-Edible Atase) and 1x reaction buffer for 4 hours. After vaping, administer 0.01 U / μ of TURBO DNase (ThermoFisher). Add L to reach the final concentration, then incubate the reaction mixture for another 30 minutes to create a DNA template. Removed. MegaClear Transcription Clean-up k Silica-bonded columns such as it (ThermoFisher) or NaO after LiCl The enzyme uses a standard protocol that includes a precipitation step using EtOH containing Ac. Cas9 mRNA was purified from nucleotides. Absorbance at 260 nm was measured. The transfer concentration is determined by using Nanodrop, and Bioanlayzer (Ag The transcript was analyzed by capillary electrophoresis using iLent.

[0251] Transfection of Cas9 mRNA and gRNA in C. Neuro2A cells Yon Mouse cell line Neuro2A was cultured in DMEM medium supplemented with 10% fetal bovine serum. Then, 24 hours before transfection, 15,000 cells / well are placed in a 96-well plate. Plated with a medium density. On the day of transfection, aspirate the medium from the cells and remove fresh cells. The culture medium was replaced with Lipofectamine-2000 (Invitrogen). It was diluted to 1:50 (v / v) in Opti-MEM (Invitrogen). Ca s9 mRNA and single guide RNA were diluted separately in Opti-MEM. Regarding the dual guide format, crRNA and trRNA should be placed together in Opti- Diluted in MEM at a 1:1 molar ratio. Both Cas9 mRNA and gRNA were separated. Mix diluted Lipofectamine-2000 with two of the following: A lipoplex was generated. After a 5-minute incubation, 100 ng of Cas9 was added. To achieve the final concentration of mRNA / well and 0.4 μL of total lipofection reagent. Lipoplex was continuously added to the cells. For each experiment, 25 nM and 2.5 nM solutions were used. 16.7nM and 1.67nM, 10nM and 1nM, 8.3nM and 0.83n The guide was tested at two dose levels, including M, 3nM, and 0.3nM. Regarding the guide, this concentration is based on equimolar amounts of crRNA and trRNA, for example, 2 25nM crRNA and 25nM trRNA generate 5nM total dual guides. It includes. Cells are lysed 24 hours after transfection, and the lysate is directly subjected to PCR. The reaction was used, and the editing was analyzed by NGS.

[0252] Cas9 mRNA with 1xNLS (SEQ ID NO: 359): GGGUCCCGCAGUCGGCGUCCAGCGGCUCUGCUUGUUCGUGUGUGUCGUUGCAGGCCUUAUUCGGAUCCAUGGAUAAGA AGUACUCAAUCGGGCUGGAUAUCGGAACUAAUUCCGUGGGUUGGGCAGUGAUCACGGAUGAAUACAAAGUGCCGUCCAAG AAGUUCAAGGUCCUGGGGAACACCGAUAGACACAGCAUCAAGAAAAAUCUCAUCGGAGCCCUGCUGUUUGACUCCGGCGA AACCGCAGAAGCGACCCGGCUCAAACGUACCGCGAGGCGACGCUACACCCGGCGGAAGAAUCGCAUCUGCUAUCUGCAAG AGAUCUUUUCGAACGAAAUGGCAAAGGUCGACGACAGCUUCUUCCACCGCCUGGAAGAAUCUUUCCUGGUGGAGGAGGAC AAGAAGCAUGAACGGCAUCCUAUCUUUGGAAACAUCGUCGACGAAGUGGCGUACCACGAAAAGUACCCGACCAUCUACCA UCUGCGGAAGAAGUUGGUUGACUCAACUGACAAGGCCGACCUCAGAUUGAUCUACUUGGCCCUCGCCCAUAUGAUCAAAU UCCGCGGACACUUCCUGAUCGAAGGCGAUCUGAACCCUGAUAACUCCGACGUGGAUAAGCUUUUCAUUCAACUGGUGCAG ACCUACAACCAAGUUCGAAAACCCAAUCAAUGCUAGCGGCGUCGAUGCCAAGGCCAUCCUGUCCCGCCGGCUGUC GAAGUCGCGGCGCCUCGAAAACCUGAUCGCACAGCUGCCGGGAGAGAAAAAGAACGGACUUUCGGCAACUUGAUCGCUC UCUCACUGGGACUCACUCCCAAUUUUUGACCUGGCCGAGGACCGGAAGCUGCAACUCUCAAAGGACACC UACGACGACGACUUGGACAAUUUGCUGGCACAAAUUGGCGAUCAGUACGCGAUCUGUUCCUUGCCGCUAAGAACCUUUC GGACGCAAUCUUGCUGUCCGAUAUCCUGCGCGUGAACACCGAAAUACCAAAGCGCCGCUUAGCGCCUCGAUAUUAAGC GGUACGACGAGCAUCACCAGGAUCUCACGCUGCUCAAAGCGCUCGUGAGACAGCAACUGCCUGAAAAGUACAAGGAGAUC UUCUUCGACCAGUCCAAGAAUGGGUACGCAGGUACAUCGAUGGAGGCCGCUAGCCAGGAAGAUGUUCUAUAAGUUCAUCAA GCCAAUCCUGGAAAGAUGGACGGAACCGAAGAACUGCUGGUCAAGCUGAACGGGAGGAUCUGCUCCGGAAACAGAGAA CCUUUGAACGGAUCCAUUCCCCACCAGAUCCAUCUGGGUGAGCUGCACGCCAUCUUGCGGCCCAGGAGGACUUUUAC CCAUUCCUCAAGGACAACCGGGAAAAGAUCGAGAAAAUUCUGACGUUCCGCAUCCCGUAUUACGUGGGCCCACUGGCGCG CGGCAAUUCGCGCUUCGCGUGGAUGACUAGAAAUCAGAGGAAACCAUCUCCUUGGAAUUUCGAGGAAGUUGUGGAUA AGGGAGCUUCGGCACAAAGCUUCAUCGAACGAAUGACCAACUUCGACAAGAAUCUCCCAAACGAGAAGGUGCUUCCUAAG CACAGCCUCCUUUACGAAUACUACUGUGCUACGAACUGACUAAGUGAAAUACGUACUGACGAAGGAAGGAAGCC GGCCUUUCUGUCCGGAGAACAGAGAAAGCAAUUGUCGAUCUGCUGUUCAAGACCAACGCAAGGUGACCGUCAAGCAGC UUAAAAGGACUACUUCAAGAAGAUCGAGUGUUUCGACUCAGUGGAAAUCAGCGGGGUGGAGGACAGAUUCAACGCUUCG CUGGGAACCUAUCAUGAUCUCCUGAGAUAUCAAGGACAAGGACUUCCUUGACAACGAGGAGAACAGGACAUCCUUGGA AGAUAUCGUCCUGACCUUGACCCUUUCGAGGAUCGCGAGAUGAUCGAGGAGAGGCUUAAGACCUACGCCUAUCUCUUCG ACGAUAAGGUCAUGAAAACAACUCAAGCGCCCGCGGGUACACUGGUUGGGGCCCGCCUCUCCCGCAAGCUGAUCAACGGUAU CGCGAUAAACAGAGCGGUAAAACUAUCCUGGAUUUCCUCAAAUCGGAUGGCUUCCGCUAAUCGUAACUUCAUGCCAAUUGAU CCACGACGACAGCCUGACCUUUAAGGAGGACAUCCAAAAAGCACAAGUGUCCGGACAGGGAGACUCACUCCAUGAACACA UCGCGAAUCUGGCCGGUUCGCCGGCGAUUAAGAAGGGAAUUCUGCAAACUGUGAAGGUGGUCGACGAGCUGGGUAGGUC AUGGGACGGCACAAACCGGAGAAUAUCGUGAUUGAAAUGGCCCGAGAAACCAGACUACCCCAGAAGGGCCAGAAAACUC CCGCGAAAGGAUGAAGCGGAUCGAAGAAGGAAUCAGGAGCUGGCAGCCAGCAGUCCUGAAAGAGCACCCGGUGGAAAAC CGCAGCUGCAGAACGAAGCUCUACCUGUAUUUGCAAAAUGGACGGGACAUGUACGUGGACCAAGAGCUGGACAUC AAUCGGUUCUGAUACGACGUGGACCACAUCGUUCCCACAGUCCUUUCUGAGGAUGACGUACGAUCGUAACAAGGGUUG GACUCGCAGCGACAAGAACAGAGGGAAGUCAGAUAAUGUGCCAUCGGAGGAGGUGUCGUGAAGAGAUGAAGAAUUACUGGC GGCAGCUCCUGAAUGCGAAGCUGUAUACCCAGAGAAAGUAAUGACAAUCUCACUAAAGCCGAGCGCGGCGGACUCUCAGAG CUGGAUAAGGCUGGAUUCAUCAAACGGCAGCUGGUCGGAGACUCGGCAGAUUACCAAGCACGUGGCGCAGAUCUUGGACUC CCGCAUGAACAUAAAUACGACGAGAACGAUAAAGCUCAUCCGGGAAGUGAAGGUGUAUUACCCUGAAAAGCAAACUUGUGU CGGACUUUCGGAAGGACUUUCAGUUUUACAAAGUGAGAGAAUACAACACUACCAUCCACGCGCAUGACCGAUACCUCAAC GCUGUGGUCGGUACCGCCCUGAUCAAAAAGUCCCUAAAACUGAAUCGGAGUUUGUGUACGGAGACUACAAGGUCUACGA CGUGAGGAAGAUGAUAGCCAAGUCCGAACAGGAAAUCGGGAAAGCAACUGCGAAAUACUUUUUAUCUCAAACAUCAUGA ACUUUUUCAAGACUGAAAUUACGCUGGCCAAUGGAGAAAUCAGGAAGGGCCACUGAUCGAACUAACGGAAGAAACGGGGC GAAAUCGUGUGGGACAAGGGCAGGACUUCGCAACUGUUCGCAAAGUGCUCUCUAUGCCGCAAGUCAAUAUUGUGAAGAA AACCGAAGUGCAAACCGGCGGAUUUUCAAAGGAAUCGAUCCUCCCCAAAGAGAAUAGCGACAAGCUCAUUGCACGCAAGA AAGACUGGGACCCGAAGAAGUACGGAGGAUUCGAUUCGCCGACUGUCGCAUACUCCGUCCUCGUGGUGGGCCAAGGUGGGAG AAGGGAAAGAGCAAAAAGCUCAAAUCCGUCAAAGAGCUGCUGGGGAUUACCAUCAUGGAACGAUCCUCGUUCGAGAAGAA CCCGAUUGAUUCCUCGAGGCGAAGGGUACAAGGAGGUGAAGAGGAUCUGAUCAUAACUCCCCAAGUACUCACUGU UCGAACUGGAAAAUGGUCGGGAAGCGCAUGCUGGCUUCGGCCGGAGAAACUCCAAAAAGGAAAUGAGCUGGCCUUGCCUAGC AAGUACGUCAACUUCCUCUAUCUUGCUUCGCACUACGAAAAACUCAAAGGGUCACCGGAAGAUAACGAACAGAAGCAGCU UUUCGUGGAGCAGCACAAGCAUUAUCUGGAUGAAAUCAUCGAACAAAUCUCCGAGUUUUCAAAGCGCGUGAUCCUCGCCG ACGCCAACCUCGACAAAGUCCUGUCGGCCUACAAUAAGCAUAGAGAUAAGCCGAUCAGAGAACAGGCCGAGAACAUUAUC CACUUGUUCACCCUGACUAACCUGGGAGCCCCAGCCGCCUUCAAGUACUUCGAUACUACUAUCGAUCGCAAAAGAUACAC GUCCACCAAGGAAGUUCUGGACGCGACCCUGAUCCACCAAAGCAUCACUGGACUCUACGAAACUAGGAUCGAUCUGUCGC AGCUGGGUGGCGAUGGCGGUGGAUCUCCGAAAAAAGAAGAGAAAGGUGUAAUGAGCUAGCCAUCACAUUAAAAGCAUCUC AGCCUACCAUGAGAAUAAGAGAAAGAAAAUGAAGAUCAAUAGCUUAUUCAUCUCUUUUUCUUUUUCGUUGGUGUAAAGCC AACACCCUGUCUAAAAAACAUAAAUUUUUUAAUCAUUUUGCCUCUUUUCUCUGUGCUUCAAUUAAUAAAAAAUGGAAAG AACCUCGAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAUCUAG

[0253] Cas9 mRNA with 2xNLS and HA tag (SEQ ID NO: 360): GGGUCCCGCAGUCGGCGUCCAGCGGCUCUGCUUGUUCGUGUGUGUCGUUGCAGGCCUUAUUCGGAUCCAUGGAUAAGA AGUACUCAAUCGGGCUGGAUAUCGGAACUAAUUCCGUGGGUUGGGCAGUGAUCACGGAUGAAUACAAAGUGCCGUCCAAG AAGUUCAAGGUCCUGGGGAACACCGAUAGACACAGCAUCAAGAAAAAUCUCAUCGGAGCCCUGCUGUUUGACUCCGGCGA AACCGCAGAAGCGACCCGGCUCAAACGUACCGCGAGGCGACGCUACACCCGGCGGAAGAAUCGCAUCUGCUAUCUGCAAG AGAUCUUUUCGAACGAAAUGGCAAAGGUCGACGACAGCUUCUUCCACCGCCUGGAAGAAUCUUUCCUGGUGGAGGAGGAC AAGAAGCAUGAACGGCAUCCUAUCUUUGGAAACAUCGUCGACGAAGUGGCGUACCACGAAAAGUACCCGACCAUCUACCA UCUGCGGAAGAAGUUGGUUGACUCAACUGACAAGGCCGACCUCAGAUUGAUCUACUUGGCCCUCGCCCAUAUGAUCAAAU UCCGCGGACACUUCCUGAUCGAAGGCGAUCUGAACCCUGAUAACUCCGACGUGGAUAAGCUUUUCAUUCAACUGGUGCAG ACCUACAACCAACUGUUCGAAGAAAACCCAAUCAAUGCUAGCGGCGUCGAUGCCAAGGCCAUCCUGUCCGCCCGGCUGUC GAAGUCGCGGCGCCUCGAAAACCUGAUCGCACAGCUGCCGGGAGAGAAAAAGAACGGACUUUUCGGCAACUUGAUCGCUC UCUCACUGGGACUCACUCCCAAUUUCAAGUCCAAUUUUGACCUGGCCGAGGACGCGAAGCUGCAACUCUCAAAGGACACC UACGACGACGACUUGGACAAUUUGCUGGCACAAAUUGGCGAUCAGUACGCGAUCUGUUCCUUGCCGCUAAGAACCUUUC GGACGCAAUCUUGCUGUCCGAUAUCCUGCGCGUGAACACCGAAAUACCAAAGCGCCGCUUAGCGCCUCGAUAUUAAGC GGUACGACGAGCAUCACCAGGAUCUCACGCUGCUCAAAGCGCUCGUGAGACAGCAACUGCCUGAAAAGUACAAGGAGAUC UUCUUCGACCAGUCCAAGAAUGGGUACGCAGGUACAUCGAUGGAGGCCGCUAGCCAGGAAGAUGUUCUAUAAGUUCAUCAA GCCAAUCCUGGAAAGAUGGACGGAACCGAAGAACUGCUGGUCAAGCUGAACGGGAGGAUCUGCUCCGGAAACAGAGAA CCUUUGAACGGAUCCAUUCCCCACCAGAUCCAUCUGGGUGAGCUGCACGCCAUCUUGCGGCCCAGGAGGACUUUUAC CCAUUCCUCAAGGACAACCGGGAAAAGAUCGAGAAAAUUCUGACGUUCCGCAUCCCGUAUUACGUGGGCCCACUGGCGCG CGGCAAUUCGCGCUUCGCGUGGAUGACUAGAAAUCAGAGGAAACCAUCUCCUUGGAAUUUCGAGGAAGUUGUGGAUA AGGGAGCUUCGGCACAAAGCUUCAUCGAACGAAUGACCAACUUCGACAAGAAUCUCCCAAACGAGAAGGUGCUUCCUAAG CACAGCCUCCUUUACGAAUACUACUGUGCUACGAACUGACUAAGUGAAAUACGUACUGACGAAGGAAGGAAGCC GGCCUUUCUGUCCGGAGAACAGAGAAAGCAAUUGUCGAUCUGCUGUUCAAGACCAACGCAAGGUGACCGUCAAGCAGC UUAAAAGGACUACUUCAAGAAGAUCGAGUGUUUCGACUCAGUGGAAAUCAGCGGGGUGGAGGACAGAUUCAACGCUUCG CUGGGAACCUAUCAUGAUCUCCUGAGAUAUCAAGGACAAGGACUUCCUUGACAACGAGGAGAACAGGACAUCCUUGGA AGAUAUCGUCCUGACCUUGACCCUUUCGAGGAUCGCGAGAUGAUCGAGGAGAGGCUUAAGACCUACGCCUAUCUCUUCG ACGAUAAGGUCAUGAAAACAACUCAAGCGCCCGCGGGUACACUGGUUGGGGCCCGCCUCUCCCGCAAGCUGAUCAACGGUAU CGCGAUAAACAGAGCGGUAAAACUAUCCUGGAUUUCCUCAAAUCGGAUGGCUUCCGCUAAUCGUAACUUCAUGCCAAUUGAU CCACGACGACAGCCUGACCUUUAAGGAGGACAUCCAAAAAGCACAAGUGUCCGGACAGGGAGACUCACUCCAUGAACACA UCGCGAAUCUGGCCGGUUCGCCGGCGAUUAAGAAGGGAAUUCUGCAAACUGUGAAGGUGGUCGACGAGCUGGGUAGGUC AUGGGACGGCACAAACCGGAGAAUAUCGUGAUUGAAAUGGCCCGAGAAACCAGACUACCCCAGAAGGGCCAGAAAACUC CCGCGAAAGGAUGAAGCGGAUCGAAGAAGGAAUCAGGAGCUGGCAGCCAGCAGUCCUGAAAGAGCACCCGGUGGAAAAC CGCAGCUGCAGAACGAAGCUCUACCUGUAUUUGCAAAAUGGACGGGACAUGUACGUGGACCAAGAGCUGGACAUC AAUCGGUUCUGAUACGACGUGGACCACAUCGUUCCCACAGUCCUUUCUGAGGAUGACGUACGAUCGUAACAAGGGUUG GACUCGCAGCGACAAGAACAGAGGGAAGUCAGAUAAUGUGCCAUCGGAGGAGGUGUCGUGAAGAGAUGAAGAAUUACUGGC GGCAGCUCCUGAAUGCGAAGCUGUAUACCCAGAGAAAGUAAUGACAAUCUCACUAAAGCCGAGCGCGGCGGACUCUCAGAG CUGGAUAAGGCUGGAUUCAUCAAACGGCAGCUGGUCGGAGACUCGGCAGAUUACCAAGCACGUGGCGCAGAUCUUGGACUC CCGCAUGAACAUAAAUACGACGAGAACGAUAAAGCUCAUCCGGGAAGUGAAGGUGUAUUACCCUGAAAAGCAAACUUGUGU CGGACUUUCGGAAGGACUUUCAGUUUUACAAAGUGAGAGAAUACAACACUACCAUCCACGCGCAUGACCGAUACCUCAAC GCUGUGGUCGGUACCGCCCUGAUCAAAAAGUCCCUAAAACUGAAUCGGAGUUUGUGUACGGAGACUACAAGGUCUACGA CGUGAGGAAGAUGAUAGCCAAGUCCGAACAGGAAAUCGGGAAAGCAACUGCGAAAUACUUUUUAUCUCAAACAUCAUGA ACUUUUUCAAGACUGAAAUUACGCUGGCCAAUGGAGAAAUCAGGAAGGGCCACUGAUCGAACUAACGGAAGAAACGGGGC GAAAUCGUGUGGGACAAGGGCAGGACUUCGCAACUGUUCGCAAAGUGCUCUCUAUGCCGCAAGUCAAUAUUGUGAAGAA AACCGAAGUGCAAACCGGCGGAUUUUCAAAGGAAUCGAUCCUCCCCAAAGAGAAUAGCGACAAGCUCAUUGCACGCAAGA AAGACUGGGACCCGAAGAAGUACGGAGGAUUCGAUUCGCCGACUGUCGCAUACUCCGUCCUCGUGGUGGGCCAAGGUGGGAG AAGGGAAAGAGCAAAAAGCUCAAAUCCGUCAAAGAGCUGCUGGGGAUUACCAUCAUGGAACGAUCCUCGUUCGAGAAGAA CCCGAUUGAUUCCUCGAGGCGAAGGGUACAAGGAGGUGAAGAGGAUCUGAUCAUAACUCCCCAAGUACUCACUGU UCGAACUGGAAAAUGGUCGGGAAGCGCAUGCUGGCUUCGGCCGGAGAAACUCCAAAAAGGAAAUGAGCUGGCCUUGCCUAGC AAGUACGUCAACUUCCUCUAUCUUGCUUCGCACUACGAAAAACUCAAAGGGUCACCGGAAGAUAACGAACAGAAGCAGCU UUUCGUGGAGCAGCACAAGCAUUAUCUGGAUGAAAUCAUCGAACAAAUCUCCGAGUUUUCAAAGCGCGUGAUCCUCGCCG ACGCCAACCUCGACAAAGUCCUGUCGGCCUACAAUAAGCAUAGAGAUAAGCCGAUCAGAGAACAGGCCGAGAACACUUAUC CACUUGUUCACCCCUGACUAACCUGGGAGCCCCAGCCGCCUUCAAGUACUUCGAUACUACUAUCGAUCGCAAAAAGAUACAC GUCCACCAAGGAAGUUCUGGACGCGACCCUGAUCCACCAAAGCAUCACUGGACUCUACGAAACUAGGAUCGAUCUGUCGC AGCUGGGUGGCGAUGGCUCGGCUUACCCAUACGACGUGCCUGACUACGCCUCGCUCGGAUCGGGCUCCCCCAAAAAGAAA CGGAAGGUGGACGGAUCCCCGAAAAAAGAAGAGAAAGGUGGACUCCGGAUGAGAAUUAUGCAGUCUAGCCAUCACAUUUAA AAGCAUCUCAGCCUACCAUGAGAAUAAGAGAAAGAAAAUGAAGAUCAAUAGCUUAUUCAUCUCUUUUUCUUUUUCGUUGG UGUAAAGCCAACACCCUGUCUAAAAAACAUAAAUUUCUUUAAUCAUUUUGCCUCUUUUCUCUGUGCUUCAAUUAAUAAAA AAUGGAAAGAACCUCGAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAUCUAG

[0254] D. Primary hepatocytes Primary mouse hepatocytes (PMH) (Gibco) were used according to the manufacturer's protocol (Invitro The cells were cultured according to the gen protocol (11.28.2012). In short, The cells were thawed and placed in hepatocyte thawing medium containing additives (Gibco, product number CM7000). After resuspending, the cells were centrifuged at 100g for 10 minutes. The supernatant was discarded, and the pelleted cells were removed. Liver cell plating medium with additive pack (Invitrogen, product number A1) The cells were resuspended in 217601 and CM3000. The cells were counted and Bio-coat was used. 96-well plate coated with Lagen I (ThermoFisher, product number) Plate at a density of 15,000 cells / well (No. 877272) at 37°C and 5% humidity. The material was incubated in a CO2 atmosphere for 5 hours to form a monolayer. After 5 hours, plating was performed. Remove the culture medium and add 3% mouse serum in addition to Cas9 mRNA and guide RNA. Supplemented hepatocyte culture medium containing LNP (Invitrogen, product number A121) Replaced with 7601 and CM4000). LNPs were replaced with 100 ng of Ca per well. Dilute from the starting dose level of s9 mRNA and guide RNA at approximately 30 nM per well. Serial dilutions were performed using 0.1 ng of mRNA and 0.03 nM guide cells. After incubation at 37°C and a 5% CO2 atmosphere for approximately 48 hours, as described herein... Cell lysis and NGS analysis were performed.

[0255] E. Formulation of lipid nanoparticles ("LNPs") LNPs are processed with a molar ratio (N:P) of cationic lipid amines to RNA phosphate of approximately 4.5. The following molar ratio was used to dissolve the lipid nanoparticle component in 100% ethanol: 4 5 mol% (12.7 mM) of cationic lipids (e.g., 3-((4,4-bis(octyl) Oxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)cal Bonyl(oxy)methyl)propyl(9Z,12Z)-octadeca-9,12-dienoe (9Z,12Z)-3-((4,4-bis(octyloxy)butano) Iyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy Methylpropyloctadeca-9,12-dienoate); 44 mol% (12.4 mM) ) Helper lipids (e.g., cholesterol); 9 mol% (2.53 mM) of neutral lipids ( For example, DSPC; and 2 mol% (0.563 mM) of PEG (for example, PEG2k -DMG). Prepare RNA cargo in 25 mM sodium acetate buffer at pH 4.5. The RNA cargo concentration was set to approximately 0.45 mg / mL.

[0256] Precision Nanosystems NanoAssemblr(TM)B Use the enchtop instrument according to the manufacturer's protocol. LNPs were formed by microfluidic mixing of nitrate and RNA solutions. Mixing was performed using a difference in flow velocity. During the experiment, a 2:1 ratio of aqueous solvent to organic solvent was maintained.

[0257] LNP formulation procedure A: After mixing, collect the LNPs and dissolve them in phosphate-buffered saline (PBS, approximately 1:1 After diluting in ) 10kDa Slide-a-Lyzer™ G2 Dialys Using is Cassette (ThermoFisher Scientific) Then, while gently stirring, leave at 4°C overnight, and add the remaining buffer (100 times the volume of the sample) to PBS. Replaced the inside. Enriched LNPs using a 10kDa Amicon spin filter (4 The desired concentration was achieved by centrifugation at 4000g (°C). Next, the resulting mixture was... The mixture was filtered using a 0.2 μm sterile filter. The resulting filtrate was then 2- Stored at 8°C.

[0258] LNP formulation procedure B: After mixing, the LNP was collected and diluted in 50 mM Tris at pH 7.5. Afterwards (approximately 1:1), 10kDa Slide-a-Lyzer™ G2 Daily Using is Cassette (ThermoFisher Scientific) Then, while gently stirring, leave the LNP in 50 mM Tris solution at pH 7.5n overnight. It was replaced during the process (100 times excess product). A 10kDa Amicon spin filter was used. The LNPs were then concentrated (centrifugation at 4°C and 4000g) to achieve twice the desired concentration. These concentrated LNPs were mixed at pH 7.5 with 50 mM Tris, 90 mM NaCl, and 10 It was mixed with % sucrose (2X TSS) in a 1:1 ratio. Next, the resulting mixture was obtained. The solution was filtered using a 0.2 μm sterile filter. The resulting filtrate was then stored at -80°C. It was stored there.

[0259] LNP formulation procedure C: In 25 mM sodium citrate and 100 mM sodium chloride, p RNA cargo was prepared using H5 to a concentration of approximately 0.45 mg / mL. Next, the LNPs were collected in water in a 3:1 ratio. The LNPs were incubated at room temperature for 1 hour, and then... They were mixed in a 1:1 ratio. Then they were processed using the manufacturer's protocol on a PD-10 column. (GE Healthcare) 1X TSS (50mM Tris, 45mM Na) The buffer solution was changed to Cl, 5% sucrose, pH 7.5. 10kDa Amicon The LNPs were concentrated using a pin filter (centrifugation at 4°C and 4000g) to obtain the desired concentration. The degree was achieved. Next, the resulting mixture was filtered using a 0.2 μm sterile filter. The sample was filtered. The resulting filtrate was stored at -80°C.

[0260] F. Analysis of next-generation sequencing ("NGS") and on-target cutting efficiency To quantitatively determine the efficiency of editing at target locations in the genome, deep sequencing is used. Using this method, we identified the presence of insertions and deletions introduced by gene editing.

[0261] Design PCR primers around the target site (e.g., TTR, FVII) and target geno The 'mu' compartment was amplified. The primer sequences are provided in Table 5 below. [Table 5] Add the necessary chemicals for sequencing according to the manufacturer's protocol (Il Additional PCR was performed according to the Illumina MiSeq i protocol. The amplicons were sequenced using an instrument. It has a low quality score. After removing unwanted elements, the reads are aligned to a human reference genome (e.g., hg38). The result file containing the reads was referenced as a genome (BAM file). ) Map to the target region, select the reads that overlap with the target region, and insert, replace, or The number of wild-type reads was calculated relative to the number of reads containing deletions.

[0262] Edit percentages (e.g., "edit efficiency" or "edit percentage") are wild types. Defined as the total number of sequence reads with insertions or deletions relative to the total number of sequence reads containing them. It can be done.

[0263] LNP delivery in vivo in G. japonica CD-1 female mice aged 6-10 weeks were used in each experiment. The animals were weighed and... Grouped by body weight to prepare the dosage solution based on the average weight of the loops. The volume is 0.2 mL per animal (approximately 10 mL per kilogram of body weight) via the lateral caudal vein. LNP was administered. Adverse effects were observed in the animals approximately 6 hours after administration. After a certain period, the patient's weight was measured, and blood loss was detected via cardiac puncture under isoflurane anesthesia. The animals were euthanized at various points in time. Blood was placed in a serum separator tube. The plasma is collected in a tube containing buffered sodium citrate for plasma as described herein. For studies involving in vivo editing, each animal was used for DNA extraction and analysis. Liver tissue was collected from the middle lobe of the animal.

[0264] H. Cytokine induction analysis For this analysis, approximately 50-100 μL of blood was collected by making an incision in the tail vein. The fluid was collected for serum cytokine measurement. The blood was allowed to coagulate at room temperature for about 2 hours, and then 1 After centrifugation at 000xg for 10 minutes, serum was collected. IL-6, TNF-alpha Luminex-based magnetic bead measuring IFN-Alpha and MCP-1 Luciplex assay (Affymetrix ProcartaPlus, product number) For cytokine analysis in samples collected using Exp040-00000-801) Used. Prepared the kit reagents and standards as instructed in the manufacturer's protocol. 25 μL of diluted antibody coated magnetic beads were placed in the well containing 25 μL of the antibody. Mouse serum L was added. The plate was incubated at room temperature for 2 hours, then washed. The dissolved biotin antibody (50 μL) was added to beads and incubated at room temperature for 1 hour. After washing the wells again, add 50 μL of diluted streptavidin-PE to each well. The beads were incubated for 30 minutes. After washing the beads again, 100 μL of washing buffer was added. Suspend in it and read with a Bio-Plex 200 instrument (Bio-Rad). It was obtained. It was calculated from the standard curve using a 5-parameter logistic curve fit. Using the cytokine concentration, Bioplex Manager ver.6.1 analysis package We used a cage to analyze the data.

[0265] I. Isolation of Genomic DNA For in vivo research, the bead-based extraction kit MagMAX-96 D NA Multi-Sample Kit (ThermoFisher, Item No. 441) 3020) Homogenize the tissue in lysis buffer (approximately 400 μL per 10 mg of tissue). Use according to the manufacturer's protocol, including saturating, from tissue. Genomic DNA was extracted. PCR and subsequent NGS analysis were performed as described herein. For analysis, all DNA samples were normalized to a concentration of 100 ng / μL.

[0266] ELISA analysis of J. transthyretin (TTR) Blood was collected and serum was isolated as instructed. Mouse Prealbum n(Transthyretin)ELISA Kit(Aviva Systems The total TTR serum level was determined using Biology (product number OKIA00111). The reagents and standards in the kit were prepared according to the manufacturer's protocol. 1× Mouse serum was diluted to a final 10,000-fold dilution using an assay diluent. Two sequential dilutions were performed. This was done by performing a subsequent 50-fold dilution, resulting in a 2500-fold dilution. The final 4-fold dilution step was performed to achieve a total sample dilution of 10,000 times. Both standards The curve diluents (100 μL each) and diluted serum samples were pre-coated with the capture antibody. The solution was added to each well of the ELISA plate. The plate was incubated at room temperature for 30 minutes. Afterward, the wells were washed. Enzyme-antibody conjugate (100 μL per well) was applied for 20 minutes. Added for incubation. Removed the unbound antibody conjugate and the plate. After washing again, the chromogenic substrate solution was added. After incubating the plate for 10 minutes, 1 00 μL of stop solution, for example, sulfuric acid (approximately 0.3 M), was added. The absorbance at 450 nm was measured. The plate was read using a SpectraMax M5 plate reader. 4 parameters Using logistic curve fitting with SoftMax Pro software Serum TTR levels were calculated from the standard curve according to r.6.4.2. The final serum values ​​were aggregated. The dilution was adjusted.

[0267] Example 2 - Manipulation of modified gRNA and in vitro testing As shown in Table 4, modified gRNA in dual guide format (dgRNA) Designed. As a result, both modified crRNA and trRNA were designed and chemically synthesized. Modified and unmodified components that form dgRNA were paired together. Transfect Neuro2A cells at the concentrations indicated in the diagram, as described in Example 1. To achieve this, editing efficiency (e.g., editing percentage) was measured using NGS.

[0268] Table 4 shows specific modified crRNAs that target the mouse TTR gene, and Cas9 mRN Transfected with A and unmodified trRNA (TR000002). Tested. The guide included sequence numbers 1-18, as shown in Figure 1 (along with unmodified trRNA). Some of the modified crRNAs conferred similar or enhanced activity compared to the unmodified control. However, other modified crRNAs reduced activity.

[0269] In parallel, the modified trRNAs in Table 4 are targeted to the same sequence in the mouse TTR gene, while the unmodified trRNAs are targeted to the same sequence. Transfect together with Cas9 mRNA along with crRNA (CR000686) The guides tested included sequence numbers 188-200 and 204, as shown in Figure 2. Thus, many modified trRNAs (along with unmodified crRNAs) are similar to unmodified controls. While some modified trRNAs conferred similar or enhanced activity, others reduced it.

[0270] In addition to chemically modified nucleotide substitutions, the pairing of the tested crRNA and trRNA Some of the ng is also manipulated by sequence substitution, for example, GC pairings not found in the parent sequence. This resulted in success. The tested guides were SEQ ID NOs. 15 and 201; 16 and 201. Includes 02;1 and 188. One such pairing is shown in Figure 3. Sequence IDs 16 and 202) show similar or enhanced activity compared to unmodified controls. While this resulted in some activity, the two pairings reduced activity.

[0271] Next, the pairings of modified crRNAs and modified trRNAs shown in Table 4 were tested. (Figure 4) As such, some of the pairing of modified crRNAs with modified trRNAs is performed with unmodified controls. Compared to, it conferred similar or enhanced activity, but some pairings reduced activity. In Figure 4, the column headings represent the different trRNAs used in the experiment, and the row headings represent the used This represents different crRNAs. To determine the combination used in the experiment, match the columns to the rows. To make it happen. TR000002 and CR000686 are unqualified targets (see the bottom right column). (Referring to Teru).

[0272] Based on the dgRNA design, modified crRNs are depicted in Table 4 and Figure 15D. Characterized by certain aspects of A and trRNA, the corresponding single guide RNA (sgR) The NA) was manipulated. These sgRNAs, numbered 228-234, were also found in Neuro2A cells. The tests were conducted in the following locations, and as shown in Figure 5, each of the modified sgRNAs was 5' and 3' It exhibited activity equivalent to that of the control (G0000209; SEQ ID NO: 228) containing only terminal modifications. Ta.

[0273] Similar sets of experiments were performed for the additional dgRNA guides described in Table 4 and Figure 6. The procedure was performed. The guides tested included sequence numbers 32-47 and 1. This was also a mouse T. Modified crRNAs that target the TR gene are Cas9 mRNA and unmodified trRNAs. It was transfected together with TR000002). As shown in Figure 6, unmodified trR Some of the modified crRNAs (along with NA) are similar to the unmodified control (CR000686). The modified crRNA conferred either or enhanced activity, while other modified crRNAs decreased activity.

[0274] In parallel, as shown in Figure 7, the modified trRNAs in Table 4 were used in the same mouse TTR gene. Cas9 mRNA and sequence-targeting unmodified crRNA (CR000686) They were both transfected. The guides tested included sequence numbers 205-222 and 1. As shown in Figure 7, many modified trRNAs (along with unmodified crRNAs) are unmodified. Compared to the control (TR000002), it conferred similar or enhanced activity, but the modified t Some of the rRNA showed reduced activity.

[0275] In addition to chemically modified nucleotide substitutions, the tested crRNAs and trRNs from Table 4 were also examined. Some of the pairings in A are also manipulated by array substitution, for example, those not found in the parent array. This resulted in GC pair formation or GU mismatch ("GU wobble"). Figure As shown in 8, some of the modifications and pairings are similar to the unmodified counterparts. It imparted enhanced activity, but some (for example, "GU Wobble" or mismatched pairings) The activity of crRN (as shown in sequence numbers 48-52 and 1) was reduced. Figure 8 shows the crRNs shown in sequence numbers 48-52 and 1. Use the trRNA guides shown in SEQ ID NOs. 223-227 and 188 along with the A guide. The results are shown below.

[0276] Next, the selected pairings of modified crRNA and modified trRNA from Table 4 are shown in Figure 9. The tests were conducted as shown. Some of the pairing of modified crRNA with modified trRNA was, Compared to the unmodified control, it conferred similar or enhanced activity, but some of the pairings were not active. This reduced [the value]. In Figure 9, the column headings represent the different trRNAs used in the experiment. The row headings represent the different crRNAs used. Determine the combinations used in the experiment. To do this, the columns are matched to the rows. The unqualified targets are TR000002 and CR0006. It is 86.

[0277] Some of the modified gRNAs (dgRNA and sgRNA) from Table 4 are purely biochemical. It was also tested in a ssey (i.e., a cell-free dissection assay). Interestingly, Neu Many of the modified gRNAs that were generally inactive in ro2A cells were found to be inactive in biochemical assays. It is active, and such biochemical assays do not predict the activity of modified gRNA in cells. This indicates a possibility (without providing data).

[0278] Example 3. Further testing of modified gRNA against other targets Since it has been established that certain modifications affect gRNA activity, (1) the same gene When different sequences within are targeted, or (2) when sequences in different genes are targeted, Next, we tested whether these modifications would affect activity. The results showed that mouse TT The target is not only another sequence in the R gene, but also a sequence in the mouse factor VII (FVII) gene. The gRNA that undergoes modification is manipulated to have a specific modification pattern, as tested in Example 2. These gRNAs were synthesized in sea urchin (see Table 4). Neuron was used to process these gRNAs at the concentrations indicated in the figure. Transfect into 2A cells and edit by NGS as described in Example 1 ( For example, we measured the editing percentage.

[0279] Mouse TTR gene (a different sequence from the one targeted in Example 2) or mouse Table 4 shows modified crRNAs that target one of the FVII genes, and Cas9 mRNA... The guide was transfected with unmodified trRNA (TR000002). This included those shown in Figures 12A and 12B. Modified c (along with unmodified trRNA) Some rRNAs conferred similar or enhanced activity compared to unmodified controls, but others Modified crRNA reduced activity.

[0280] In parallel, modified trRNAs from Table 4 were used in the same sequence (CR000) of the mouse TTR gene. 705; a different sequence from the one targeted in Example 2) or mouse FVII gene Cas9 mR Transfected with NA. As shown in Figures 13A and 13B, (unmodified) Many modified trRNAs (along with crRNA) are similar to or enhanced compared to unmodified controls. While some modified trRNAs confeded activity, others decreased it. This data suggests that certain types of modified trRNAs may have been particularly effective. This indicates that certain modification patterns tended to have similar effects across different sequences.

[0281] Based on the design of the dgRNA described above, some states of modified crRNA and trRNA Based on these characteristics, the corresponding single guide RNA (sgRNA) was manipulated. See Table 4. These sgRNAs were also tested in Neuro2A cells. The results are shown in Figure 10 (Ma (UsTTR) and Figure 11 (UsFVII) are shown. Some modification patterns are different. These experiments show that similar effects can be achieved even when targeting genes.

[0282] Example 4. Testing of modified gRNA in vivo After in vitro testing, the modification provides any benefit for editing in vivo. In six separate studies, modified sgRNA was delivered to animals to determine whether or not it would be beneficial. did.

[0283] As described in Example 1, targeting chemically modified sgRNA (TTR or FVII) The LNP was formulated with IVT Cas9 mRNA along with (ru). mRNA: sgRN The ratio of A was approximately 1:1 based on the mass of RNA components. Unless otherwise indicated, this is the actual The Cas9 mRNA used in the study described in the examples has the sequence of SEQ ID NO: 360 Then, LNP was incorporated using the LNP formulation procedure A described above.

[0284] In one experiment, mice (n=5 per group) were administered a single dose of 2 mg / kg of LNP. Blood was collected 4 hours after administration for serum cytokine analysis. 7 days after administration In the autopsy, the liver and blood were subjected to NGS measurement of editing efficiency and analysis of serum TTR, respectively. They were collected for this purpose. Each of the sgRNAs in this experiment had the same sequence in the TTR gene. Targeting was successful, and the only difference between the sgRNAs was the modifications performed on each (Figure 14A). ~D and 15A~E; see Table 4, Sequence IDs 228~234). G000209 (Two lots were tested) served as a less modified control, and the 5' terminus of the sgRNA was And in the three terminal nucleotides at each of the 3' ends, and Among them, only 2'-O-methyl modification and phosphorothioate linkage were present (Figure 15D). (See reference).

[0285] The results shown in Figures 14A-D indicate that more heavily modified sgRNAs are associated with less modified G0 Compared to the control group, it induces a lower response for each cytokine assayed. This indicates a tendency for more heavily modified sgRNAs to be less modified than those with less modification. Compared to approximately 44-47% for Il (G000209 lot), it was more heavily modified. For two of the sgRNAs (for example, G000263 and G000267), approximately 6 With an editing percentage reaching 0%, higher editing efficiency was achieved in the liver of the treated animals. The modification was applied (Figure 15A). Importantly, knockdown of serum TTR levels is less likely to occur with modifications. Since editing efficiency was comparable to or significantly higher than that of the control group, it correlated with phenotypic change. (For example, in Figures 15A-15B, lot G000209 is G000263) (See also G000267). Terminal modification G000209 and advanced modification G00026 The differences from 7 are summarized in Figures 15D and 15E (2'-O-Me modified nucleotides are shown in bold). (These are shown in letters, with * representing phosphorothioate linkage.)

[0286] In another in vivo study, three different sequences in the mouse TTR gene were targeted. One sgRNA was tested at 2 mg / kg, 1 mg / kg, or 0.3 mg / kg. LNP was administered as a single dose to mice (n=5 per group). Serum cytokameters were measured 4 hours after administration. Blood was collected for analysis. In the autopsy 7 days after administration, the liver and blood were examined. These were collected for NGS measurement of editing efficiency and analysis of serum TTR. Each of the sgRNAs is completely unmodified (G000201(sequence) Number 243), another sgRNA, both the 5' and 3' ends of the sgRNA In each of the three terminal nucleotides, and between them, 2'-O-methyl Having only terminal modifications with modifications and phosphorothioate linkages (G000211(sequence) Number 241), the third sgRNA was G000 in previous in vivo studies. Having the same modification pattern as 267 (G000282 (SEQ ID NO: 242)), TTR gene The same sequence within the egg (a different sequence from the one targeted in previous in vivo studies) They targeted it.

[0287] As shown in Figures 16A-16D, each of the sgRNAs corresponds to the cytokine tested. Each of these resulted in a dose-dependent similar response. Therefore, unmodified sgRNA (G000201 (SEQ ID NO: 243)) is in vivo Although little editing was applied, heavily modified sgRNA (G000282(sequence number) No. 242)) gives a level that reaches approximately 60% at a dose of 2 mg / kg, which is modified A significant improvement over the level achieved with fewer sgRNAs (G000211 (SEQ ID NO: 241)). The level of editing was very high (Figures 17A and B). Similar to previous in vivo studies, the level of editing was high. This correlated with the amount of serum TTR knockdown (Figure 17C and D).

[0288] Targeting yet different TTR sequences in the mouse TTR gene (two preceding in Three different sets of sequences (targeting sequences different from those targeted in vivo studies) Next, we performed a study similar to the second in vivo study using sgRNA. (Mouse) Each group (n=5) received a single dose of 2 mg / kg, 1 mg / kg, or 0.3 mg / kg. LNP was administered. Four hours after administration, blood was collected for serum cytokine analysis. In the autopsy performed 7 days later, the liver and blood were examined using NGS measurement to determine editing efficiency and serum, respectively. Samples were collected for TTR analysis. In this study, each sgRNA was found to be one s The gRNA is completely unmodified (G000285; (SEQ ID NO: 332)), and another sgRNA is , the three terminal nucleos at both the 5' and 3' ends of the sgRNA 2'-O-methyl modification and phosphorothioate linkage occur in and between these thios. Having only terminal modifications accompanied by (G000269 (SEQ ID NO: 330)), the third sgRN A is G000267 and G000282 in two preceding in vivo studies. Having the same modification pattern as (G000283 (SEQ ID NO: 331)), in the TTR gene The same sequence (different from the sequence targeted in the two preceding in vivo studies) They targeted it.

[0289] In this study, unmodified sgRNA (G000285 (SEQ ID NO: 332)) was found to be in viv Although little editing was applied to o, heavily modified sgRNA (G000283( SEQ ID NO: 331)) gives a level that reaches approximately 60% at a dose of 2 mg / kg, which is Level achieved with less modified sgRNA (G000269 (SEQ ID NO: 330)) The levels were significantly higher (Figures 18A-18B). Similar to previous in vivo studies, the editorial... The levels correlated with the amount of serum TTR knockdown (Figure 18C).

[0290] In the fourth in vivo study, the effect of modification on gRNA was examined on another gene (FVII We evaluated the following. For intra-study comparisons, we tested in the first in vivo study. Includes two of the sgRNAs (G000209 and G000267). Mouse (group) Each of the five (n=5) received a single dose of 2 mg / kg, 1 mg / kg, or 0.3 mg / kg of L. NP was administered, and blood was collected 4 hours after administration for serum cytokine analysis. Six days later, during autopsy, the liver was collected for NGS measurement of editing efficiency. In this study, Each sgRNA targets the same sequence in the TTR or FVII gene, and each Therefore, one sgRNA has both the 5' and 3' ends of the sgRNA. In the three terminal nucleotides, and between them, a 2'-O-methyl modification It has only terminal modifications that have both phosphorothioate linkages (G0 for FVII) 00208 (Sequence ID 286), G000209 for TTR, second sgRNA This is based on G000267, G000282, and G0 in previous in vivo studies. It has the same modification pattern as 00283 (for FVII, G000373 (Sequence ID 28 7); Regarding TTR, G000267 (Sequence ID 234).

[0291] As shown in Figures 19A-19D, each of the sgRNAs corresponds to the cytokine tested. Each of these resulted in a dose-dependent similar response. Therefore, a more heavily modified sgRNA (G000373(sequence) that targets FVII Number 287)) is a less modified version across each of the doses tested. Compared to G000208 (Sequence ID 286), it showed an increase in editing efficiency (Figure 18A). These results were also observed for sgRNAs that target TTR (Figures 20A-20). B).

[0292] In another in vivo study, the same sequence in the mouse TTR gene as G000282 was found to be present in the same mouse TTR gene. Ten additional sgRNAs targeting were tested. G000282 was also tested for comparison. The study included a single dose of 1 mg / kg or 0.5 mg / kg to mice (n=5 per group). The LNP was administered. The LNP used in this study followed the LNP formulation procedure B described above. It was formulated using [specific method / tool]. In an autopsy 7 days after administration, the liver and blood were analyzed for their respective editing efficiency. Samples were collected for NGS measurement and serum TTR analysis. In this study, sgRNA was used. Each of them targeted the same sequence in the TTR gene. The modification patterns of each sgRNA tested The sgRNA can be of various types, including the 5' end, 3' end, hairpin 1, hairpin 2, and nexa The lower stem, bulge, and upper stem are modified with 2'-OMe, 2'-F, and PS repairs. Includes decoration. Editing percentage (Figure 22A), mean and standard deviation of editing (Figure 22B), and blood The results of this study, including the clear TTR levels (Figure 22C), are shown in Figures 22A-22C. These same sgRNAs were tested in primary mouse hepatocytes according to the method described. The experiment was conducted. Edited percentage (Figure 24A), dose-response curve (Figure 24B), and EC50 value (Figure 24C). The results of this dose-response TTR editing study, including ), are shown in Figures 24A-24C.

[0293] In another in vivo study, 13 additional sgRNAs targeting the same sequence as G000282 in the mouse TTR gene were tested. G000282 was also included in the study for comparison. Mice (n=5 per group) were administered a single dose of 1 mg / kg of LNP. The LNP used in this study was formulated using the LNP formulation procedure C described above. The Cas9 mRNA used in this study had the sequence of SEQ ID NO: 359. Blood was collected 4 hours after administration for serum cytokine analysis. At dissection 7 days after administration, liver and blood were collected for NGS measurement of editing efficiency and analysis of serum TTR, respectively. In this study, each sgRNA targeted the same sequence in the TTR gene. The tested sgRNAs contained additional 2'-OMe and PS modifications in the 5' end, 3' end, hairpin 1, hairpin 2, and upper stem of the sgRNA. The results of this study, including edit percentage (Figure 23A), mean edit percentage (Figure 23B), and serum TTR levels (Figure 23C), are shown in Figures 23A-23C. The following embodiments may be included. [1] Single guide RNA (sgRNA) having 5' terminal modification, a. Upper stem region, b. Hairpin 1 area, and c. Hairpin 2, including one or more modifications in one or more of the regions, The sgRNA wherein the 5' terminal modification includes at least two phosphorothioate (PS) linkages in the first seven nucleotides at the 5' end of the 5' terminus. [2] The sgRNA described in [1] above, wherein at least one modification comprises a 2'-O-methyl (2'-O-Me) modified nucleotide. [3] The sgRNA described in [1] or [2] above, wherein at least one modification comprises a 2'-fluoro(2'-F) modified nucleotide. [4] The sgRNA described in any one of the above [1] to [3], wherein at least one modification involves a phosphorothioate (PS) bond between nucleotides. [5] The sgRNA according to any one of the above [1] to [4], comprising one or more modifications in the upper stem region. [6] The sgRNA described in [5] above, including modifications in US1 to US12. [7] The sgRNA according to any one of the above [1] to [6], wherein the hairpin region contains one or more modifications. [8] The sgRNA described in [7] above, which includes modifications at H1-1. [9] The sgRNA according to any one of the above [1] to [8], comprising one or more modifications in the hairpin 2 region.

[10] The sgRNA described in [9] above, which includes modifications at H2-1.

[11] sgRNA as described in any one of the above [1] to

[10] , including modifications in H1-1 to H1-12.

[12] sgRNA as described in any one of the above [1] to

[11] , including modifications in H2-1 to H2-15.

[13] The sgRNA according to any one of the above [1] to

[12] , wherein the upper stem region, the hairpin 1 region, and the hairpin 2 region each contain one or more modifications.

[14] The sgRNA described in any one of the above [1] to

[13] , wherein a modified nucleotide is included between the hairpin 1 region and the hairpin 2 region.

[15] The sgRNA described in any one of the above [1] to

[14] , further comprising a lower stem region including modifications.

[16] The sgRNA described in any one of the above [1] to

[15] , further comprising a 3' terminal region including modifications.

[17] The sgRNA described in

[16] above, further comprising a 3' terminal modification in the 3' terminal.

[18] The sgRNA described in

[17] above, wherein at least two of the last four nucleotides at the 3' end of the 3' terminus are modified.

[19] The sgRNA according to

[17] above, wherein at least two of the last four nucleotides at the 3' end of the 3' terminus are modified with 2'-O-Me, 2'-F, or 2'-O-moe.

[20] The sgRNA according to any one of the above

[17] to

[19] , further comprising a phosphorothioate (PS) bond between one or more of the last four nucleotides at the 3' end of the 3' terminus.

[21] The sgRNA described in any one of the above [1] to

[20] , further comprising a bulge region containing modifications.

[22] The sgRNA described in any one of the above [1] to

[21] , further comprising a modified nexus region.

[23] The sgRNA according to any one of the above [1] to

[22] , wherein at least the first three nucleotides at the 5' end of the 5' terminal and the last three nucleotides at the 3' end of the 3' terminal are modified.

[24] The sgRNA according to any one of the above [1] to

[23] , wherein the first four nucleotides at the 5' end of the 5' terminus and the last four nucleotides at the 3' end of the 3' terminus are linked by phosphorothioate (PS) bonds.

[25] The sgRNA described in

[24] above, wherein the terminal modification includes 2'-O-Me.

[26] The sgRNA according to

[24] above, wherein the terminal modification includes 2'-F.

[27] The sgRNA according to any one of the above [1] to

[26] , wherein the first four nucleotides at the 5' end of the 5' terminus and the last four nucleotides at the 3' end of the 3' terminus are linked by a PS bond, and the first three nucleotides at the 5' end of the 5' terminus and the last three nucleotides at the 3' end of the 3' terminus contain a 2'-O-Me modification.

[28] The sgRNA according to any one of the above [1] to

[26] , wherein the first four nucleotides at the 5' terminus and the last four nucleotides at the 3' terminus are linked by a PS bond, and the first three nucleotides at the 5' terminus and the last three nucleotides at the 3' terminus contain 2'-O-Me, 2'-F, and / or 2'-O-moe modifications.

[29] The sgRNA described in any one of the above [1] to

[28] , wherein LS1, LS6, LS7, LS8, LS11, and / or LS12 are modified with 2'-O-Me.

[30] The sgRNA according to any one of the above [1] to

[29] , wherein each of the nucleotides in the bulge region is modified with 2'-O-Me.

[31] The sgRNA according to any one of the above [1] to

[29] , wherein at least 50% of the nucleotides in the bulge region are modified with 2'-O-Me.

[32] The sgRNA according to any one of the above [1] to

[31] , wherein each of the nucleotides in the upper stem region is modified with 2'-O-Me.

[33] The sgRNA described in any one of the above [1] to

[32] , wherein N16, N17, and / or N18 in the nexus region are modified with 2'-O-Me.

[34] The sgRNA described in any one of the above [1] to

[32] , wherein the N15, N16, N17, and / or N18 in the nexus region are modified.

[35] The sgRNA according to

[33] or

[34] above, wherein the modification in the nexus region is selected from 2'-O-Me and 2'F.

[36] The sgRNA described in any one of the above

[32] to

[35] , wherein N16, N17, and N18 are linked by PS bonds.

[37] The sgRNA according to any one of the above [1] to

[36] , wherein each of the nucleotides in the hairpin 1 region is modified with 2'-O-Me.

[38] The sgRNA according to any one of the above [1] to

[37] , wherein each of the nucleotides in the hairpin 2 region is modified with 2'-O-Me.

[39] Single guide RNA (sgRNA) having a 2'-O-Me modified nucleotide at the following position: a. The first three nucleotides at the 5' end of the 5' terminus, b. LS1, LS6, LS7, LS8, LS11, and / or LS12 in the lower stem region, c. B1 and / or B2 in the bulge region; d. Each nucleotide in the upper stem region, e. N16, N17, and / or N18 in the nexus region, f. Each nucleotide in hairpin 1 region, g. Each nucleotide in the hairpin 2 region, The last four nucleotides at the 3' end of the h. sgRNA, and the sgRNA contained therein.

[40] The sgRNA described above in

[39] , in which B3-B6 are modified with 2'-O-Me.

[41] The sgRNA according to

[39] , further comprising three phosphorothioate (PS) bonds linking the first four nucleotides at the 5' end of the 5' terminus and three PS bonds linking the last four nucleotides at the 3' end of the 3' terminus.

[42] sgRNAs described in any one of the preceding [1] to

[41] above, wherein LS9 and LS10 are modified, for example, with 2'-F or 2'-OMe.

[43] The sgRNA described in any one of the above [1] to

[42] , wherein N15, N16, N17, and N18 are modified, for example, with 2'-F or 2'-OMe.

[44] sgRNA as described in any one of the above [1] to

[43] , wherein H2-9, H2-10, H2-11, H2-12, H2-13, H2-14, and H2-15 are modified with 2'-F.

[45] The sgRNA described in any one of the above [1] to

[44] , wherein the second to last, third to last, and fourth to last nucleotides at the 3' term are modified with 2'-F.

[46] Single guide RNA (sgRNA) having a 2'-F modified nucleotide at the following position: a. LS9 and LS10 in the lower stem region, b. N15, N16, N17, and N18 in the nexus region, c. sgRNA contained in H2-9, H2-10, H2-11, H2-12, H2-13, H2-14, and H2-15 in the hairpin 2 region.

[47] The sgRNA described in

[46] above, further comprising 2'-F modified nucleotides at the second to last, third to last, and fourth to last nucleotides at the 3' terminus.

[48] ​​The sgRNA according to

[46] or

[47] , further comprising three phosphorothioate (PS) bonds linking the first four nucleotides at the 5' end of the 5' terminus and three PS bonds linking the last four nucleotides at the 3' end of the 3' terminus.

[49] The sgRNA according to any one of the above

[46] to

[48] , further comprising 2'-O-Me or 2'-F modified nucleotides in the first three nucleotides at the 5' end of the 5' terminus, and further comprising 2'-O-Me or 2'-F modified nucleotides in three of the last four nucleotides at the 3' end of the 3' terminus.

[50] Single guide RNA (sgRNA), a. In the first three nucleotides at the 5' end of the 5' terminus, 2'-O-Me modified nucleotides, b. 2'-O-Me modified nucleotides in US1~US12, c. 2'-O-Me modified nucleotides in H1-1 to H1-12, d. 2'-O-Me modified nucleotides in H2-1 to H2-15, e. sgRNA containing 2'-O-Me modified nucleotides in the last four nucleotides at the 3' end of the 3' terminus.

[51] The sgRNA described in

[50] above, further comprising a 2'-O-Me modified nucleotide in LS1 and / or LS6.

[52] The sgRNA according to

[50] or

[51] above, further comprising a 2'-O-Me modified nucleotide between hairpin 1 and hairpin 2.

[53] Single guide RNA (sgRNA), a. 2'-O-Me modified nucleotides in the first three nucleotides at the 5' end of the 5' terminus, b. 2'-F modified nucleotides in LS1~LS6, c. 2'-O-Me modified nucleotides in US1~US12, d. 2'-O-Me modified nucleotides in H1-1 to H1-12, e. The 2'-O-Me modified nucleotide between hairpin 1 and hairpin 2, 2'-O-Me modified nucleotides in f.H2-1~H2-15, g.sgRNA containing 2'-O-Me modified nucleotides in the last four nucleotides at the 3' end of the 3' terminus.

[54] Single guide RNA (sgRNA), a. 2'-O-Me modified nucleotides in the first three nucleotides at the 5' end of the 5' terminus, b. 2'-F modified nucleotides in LS2~LS5, c. 2'-O-Me modified nucleotides in LS1 and LS6, d. 2'-O-Me modified nucleotides in US1~US12, e. 2'-O-Me modified nucleotides in H1-1 to H1-12, f. The 2'-O-Me modified nucleotide between hairpin 1 and hairpin 2, g. 2'-O-Me modified nucleotides in H2-1 to H2-15, sgRNA containing 2'-O-Me modified nucleotides in the last four nucleotides at the 3' end of the 3' terminus.

[55] Single guide RNA (sgRNA), a. 2'-O-Me modified nucleotides in the first three nucleotides at the 5' end of the 5' terminus, b. 2'-O-Me modified nucleotides in US1~US12, c. 2'-O-Me modified nucleotides in LS7, LS8, LS11, and LS12, d. 2'-O-Me modified nucleotides in H1-1 to H1-12, e. The 2'-O-Me modified nucleotide between hairpin 1 and hairpin 2, 2'-O-Me modified nucleotides in f.H2-1~H2-15, g.sgRNA containing 2'-O-Me modified nucleotides in the last four nucleotides at the 3' end of the 3' terminus.

[56] Single guide RNA (sgRNA), a. 2'-O-Me modified nucleotides in the first three nucleotides at the 5' end of the 5' terminus, b. 2'-O-Me modified nucleotides in US1~US12, c. 2'-O-Me modified nucleotides in LS7, LS8, LS11, and LS12, d. 2'-F modified nucleotides in LS9 and LS10, e. 2'-O-Me modified nucleotides in H1-1 to H1-12, f. The 2'-O-Me modified nucleotide between hairpin 1 and hairpin 2, g. 2'-O-Me modified nucleotides in H2-1 to H2-15, sgRNA containing 2'-O-Me modified nucleotides in the last four nucleotides at the 3' end of the 3' terminus.

[57] Single guide RNA (sgRNA), a. 2'-O-Me modified nucleotides in the first three nucleotides at the 5' end of the 5' terminus, b. 2'-O-Me modified nucleotides in US1~US12, c. 2'-O-Me modified nucleotides in LS8, LS10, and LS12, d. 2'-OF modified nucleotides in LS7, LS9, and LS11, e. 2'-O-Me modified nucleotides in H1-1 to H1-12, f. The 2'-O-Me modified nucleotide between hairpin 1 and hairpin 2, g. 2'-O-Me modified nucleotides in H2-1 to H2-15, sgRNA containing 2'-O-Me modified nucleotides in the last four nucleotides at the 3' end of the 3' terminus.

[58] Single guide RNA (sgRNA), a. 2'-O-Me modified nucleotides in the first three nucleotides at the 5' end of the 5' terminus, b. 2'-O-Me modified nucleotides in LS1, LS6, LS7, LS8, LS11, and LS12, c. 2'-O-Me modified nucleotides in US1~US12, d. 2'-O-Me modified nucleotides in H1-1 to H1-12, e. The 2'-O-Me modified nucleotide between hairpin 1 and hairpin 2, 2'-O-Me modified nucleotides in f.H2-1~H2-15, g.sgRNA containing 2'-O-Me modified nucleotides in the last four nucleotides at the 3' end of the 3' terminus.

[59] Single guide RNA (sgRNA), a. 2'-O-Me modified nucleotides in the first three nucleotides at the 5' end of the 5' terminus, b. 2'-O-Me modified nucleotides in LS1, LS6, LS7, LS8, LS11, and LS12, c. 2'-F modified nucleotides in LS9 and LS10, d. 2'-O-Me modified nucleotides in US1~US12, e. 2'-O-Me modified nucleotides in H1-1 to H1-12, f. The 2'-O-Me modified nucleotide between hairpin 1 and hairpin 2, g. 2'-O-Me modified nucleotides in H2-1 to H2-15, sgRNA containing 2'-O-Me modified nucleotides in the last four nucleotides at the 3' end of the 3' terminus.

[60] Single guide RNA (sgRNA), a. 2'-O-Me modified nucleotides in the first three nucleotides at the 5' end of the 5' end, b. 2'-O-Me modified nucleotides in US1~US12, c. 2'-O-Me modified nucleotides in H1-1 to H1-12, d. The 2'-O-Me modified nucleotide between hairpin 1 and hairpin 2, e. 2'-O-Me modified nucleotides in H2-1 to H2-8, 2'-F modified nucleotides in f.H2-9~H2-15, g. 2'-F modified nucleotides at the second to last, third to last, and fourth to last nucleotides at the 3' terminus, sgRNA containing a 2'-O-Me modified nucleotide at the last nucleotide of the 3' end of the 3' terminus.

[61] Single guide RNA (sgRNA), a. 2'-O-Me modified nucleotides in the first three nucleotides at the 5' end of the 5' terminus, b. 2'-O-Me modified nucleotides in US1~US12, c. 2'-O-Me modified nucleotides in H1-2, H1-4, H1-6, H1-8, H1-10, and H1-12, d. 2'-F modified nucleotides in H1-1, H1-3, H1-5, H1-7, H1-9, and H1-11, e. The 2'-F modified nucleotide between hairpin 1 and hairpin 2, f. 2'-F modified nucleotides in H2-2, H2-4, H2-6, H2-8, H2-10, H2-12; and H2-14, g. 2'-O-Me modified nucleotides in H2-1, H2-3, H2-5, H2-7, H2-9, H2-11; H2-13, and H2-15, The 2'-F modified nucleotides at the second to last and fourth to last nucleotides at the 3' terminus, i. sgRNA containing a 2'-O-Me modified nucleotide at the third-to-last nucleotide of the 3' end and the last nucleotide of the 3' terminus.

[62] The sgRNA according to any one of the above

[50] to

[61] , further comprising three phosphorothioate (PS) bonds linking the first four nucleotides at the 5' end of the 5' terminus and three PS bonds linking the last four nucleotides at the 3' end of the 3' terminus.

[63] The sgRNA according to any one of the above

[50] to

[61] , further comprising at least one phosphorothioate (PS) bond in the first seven nucleotides at the 5' end of the 5' terminus.

[64] Single guide RNA (sgRNA), a. 2'-O-Me modified nucleotides LS8, LS10, LS12, H1-2, H1-4, H1-6, H1-8, H1-10, H1-12, H2-1, H2-3, H2-5, H2-7, H2-9, H2-11, H2-13, and H2-15, b. sgRNA containing 2'-F modified nucleotides in LS7, LS9, LS11; H1-1, H1-3, H1-5, H1-7, H1-9, H1-11, H1-13, H2-2, H2-4, H2-6, H2-8, H2-10, H2-12, and H2-14.

[65] The sgRNA according to

[64] , further comprising three phosphorothioate (PS) bonds linking the first four nucleotides at the 5' end of the 5' terminus and three PS bonds linking the last four nucleotides at the 3' end of the 3' terminus.

[66] a. 2'-O-Me modified nucleotides at the last and third-to-last nucleotides at the 3' end of the 3' terminus, b. The sgRNA described in

[64] or

[65] above, further comprising 2'-F modified nucleotides at the second to last and fourth to last nucleotides at the 3' end of the 3' terminus.

[67] sgRNA containing any of sequence numbers 228-332, including the modifications in Table 4.

[68] sgRNA containing any of sequence numbers 235-240, 265-285, and 309-329, including the modifications shown in Table 4.

[69] sgRNA including sequence number 240.

[70] sgRNA containing sequence number 240 with the modifications shown in Table 4.

[71] sgRNA containing sequence number 242 with modifications as shown in Table 4.

[72] sgRNA, including the modification of sequence number 242, as depicted in Table 4.

[73] sgRNA including sequence number 358.

[74] sgRNA comprising nucleic acids having at least 99, 98, 97, 96, 95, 94, 93, 92, 91, 90, 85, 80, 75, or 70% identity with respect to any one of the nucleic acids among sequence numbers 235-240, 265-285, and 309-329, wherein the modifications at each nucleotide of the sgRNA corresponding to the nucleotide of the reference sequence identifier in Table 4 are identical or equivalent to the modifications shown for the reference sequence identifier in Table 4.

[75] The sgRNA according to any one of the above

[66] to

[74] , further comprising three phosphorothioate (PS) bonds linking the first four nucleotides at the 5' terminus and three PS bonds linking the last four nucleotides at the 3' terminus.

[75] The sgRNA according to any one of the above [1] to

[74] , further comprising at least three PS bonds linking the nucleotides in the hairpin 1 region.

[76] The sgRNA according to any one of the above [1] to

[75] , further comprising at least three PS bonds linking the nucleotides in the hairpin 2 region.

[77] The sgRNA according to any one of the above [1] to

[76] , further comprising at least three PS bonds linking the nucleotides in the upper stem region.

[78] The sgRNA described in any one of the above [1] to

[77] that forms a ribonucleoprotein complex with Cas9 of S. pyogenes.

[79] A guide RNA containing a 2'-O-Me modification at each nucleotide in the upper stem region.

[80] Guide RNA containing 2'-O-Me modifications at one, two, three, or four, five, six, seven, eight, nine, ten, or eleven of the following nucleotides: US1, US2, US3, US4, US5, US6, US7, US8, US9, US10, US11, and US12.

[81] A guide RNA having 2'-O-Me modifications in 50% or more of the nucleotides in the hairpin 1 region and the hairpin 2 region.

[82] A guide RNA having a 2'-O-Me modification in each nucleotide in the upper stem region, and 50% or more of the nucleotides in the hairpin 1 region and the hairpin 2 region having a 2'-O-Me modification.

[83] Guide RNA having or consisting of a 2'-O-Me modification at each nucleotide, starting with H2-1 or H2-2 and ending at the last nucleotide at the 3' terminus.

[84] Guide RNA having or consisting of a 2'-O-Me modification in LS1 and / or LS6, and no modification in LS2-LS5.

[85] Guide RNA containing 2'-O-Me modified nucleotides in two or more of LS8, LS9, LS10, LS11, and / or LS12.

[86] The guide RNA described in

[85] above, wherein at least LS8 and LS10 are modified with 2'-O-Me.

[87] The guide RNA according to any one of the above

[79] to

[86] , further comprising 2'-O-Me modifications in 50% or more of the nucleotides in the nexus region.

[88] The guide RNA according to

[87] , wherein at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the nucleotides in the nexus region are modified with 2'-O-Me.

[89] A guide RNA containing 2'-O-Me modifications in up to 50% of the nucleotides in the nexus region.

[90] A guide RNA containing 2'-O-Me modifications at four or more nucleotides in the nexus region.

[91] The guide RNA according to

[90] above, wherein at least one, two, three, four, or five nucleotides N2 to N6 in the nexus region are modified with 2'-O-Me.

[92] A guide RNA containing 10 or more nucleotides with 2'-O-Me modification in the nexus region.

[93] The guide RNA described in

[92] above, wherein at least N2-N6 is modified with 2'-O-Me.

[94] A guide RNA having 2'-O-Me modifications in 50% or more of the nucleotides in the bulge region.

[95] The guide RNA according to

[94] , wherein at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the nucleotides in the bulge region are modified with 2'-O-Me.

[96] The guide RNA described above in

[94] , wherein B2, B3, and / or B4 are modified with 2'-O-Me.

[97] Guide RNA containing 2'-O-Me modified nucleotides in three or more nucleotides within the bulge region.

[98] The guide RNA described above in

[97] , wherein B2, B3, and / or B4 are modified with 2'-O-Me.

[99] A guide RNA comprising the nucleotide of SEQ ID NO: 357 having the modification pattern of the guide RNA described in any one of the above items [1] to

[98] .

[0100] A guide RNA comprising the nucleotide of SEQ ID NO: 356 having the modification pattern of the guide RNA described in any one of the above items [1] to

[99] .

[0101] The guide RNA according to any one of the above

[79] to

[0100] , further comprising a 2'-O-Me modification in the first three, four, or five nucleotides at the 5' end of the 5' terminal region.

[0102] The guide RNA according to any one of the above

[79] to

[0100] , further comprising a 2'-O-Me modification in the last three, last four, or last five nucleotides at the 3' end of the 3' terminal region.

[0103] The guide RNA described in

[0102] above, wherein the last nucleotide at the 3' end of the 3' terminal region is not modified.

[0104] The guide RNA according to

[0102] above, wherein only the second to last and third to last nucleotides at the 3' end of the 3' terminal region are modified.

[0105] The guide RNA described in

[0102] above, wherein only the second to last, third to last, and fourth to last nucleotides in the 3' terminal region are modified.

[0106] The guide RNA according to any one of the above

[79] to

[0100] , further comprising a PS bond between the first three, four, or five nucleotides at the 5' end of the 5' terminus.

[0107] The guide RNA described in

[0106] above, wherein the first four nucleotides at the 5' end of the 5' terminus are linked by a PS bond.

[0108] The guide RNA according to any one of the above

[79] to

[0100] , further comprising a PS bond between the last three, four, or five nucleotides at the 3' end of the 3' terminus.

[0109] The guide RNA described in

[0108] above, wherein the last four nucleotides at the 3' end of the 3' terminus are linked by a PS bond.

[0110] The guide RNA according to any one of the above

[79] to

[0100] , wherein the first three or four nucleotides at the 5' end of the 5' terminus and the last three or four nucleotides at the 3' end of the 3' terminus contain a 2'-O-Me modification.

[0111] The guide RNA according to any one of the above

[79] to

[0100] , wherein the first three or four nucleotides at the 5' end of the 5' terminal are linked by PS bonds, and the last three or four nucleotides at the 3' end of the 3' terminal are linked by PS bonds.

[0112] The guide RNA according to any one of the above

[79] to

[0100] , wherein the first three or four nucleotides at the 5' end of the 5' terminus include a 2'-O-Me modification and are linked by a PS bond, and the last three or four nucleotides at the 3' end of the 3' terminus include a 2'-O-Me modification and are linked by a PS bond.

[0113] A guide RNA according to any one of the above

[79] to

[0100] , wherein at least two of the nucleotides LS8, LS9, LS10, LS11, and LS12 include a 2'-O-Me modification.

[0114] A guide RNA according to any one of the above

[79] to

[0100] , wherein at least LS8 and LS10 are modified with 2'-O-Me.

[0115] A guide RNA according to any one of the above

[79] to

[0100] , wherein at least 50% of the nucleotides in the nexus region are modified with 2'-O-Me.

[0116] The guide RNA according to

[0115] , wherein at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the nucleotides in the nexus region are modified with 2'-O-Me.

[0117] The guide RNA described in

[0115] above, wherein at least N2 to N6 are modified with 2'-O-Me.

[0118] A guide RNA according to any one of the above

[79] to

[0100] , wherein at least 10 of the nucleotides in the nexus region are modified with 2'-O-Me.

[0119] The guide RNA described in

[0115] above, wherein at least N2 to N6 are modified with 2'-O-Me.

[0120] The guide RNA according to any one of the above

[79] to

[0100] , wherein at least 50% of the nucleotides in the bulge region are modified with 2'-O-Me.

[0121] The guide RNA according to

[0120] , wherein at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the nucleotides in the bulge region are modified with 2'-O-Me.

[0122] The guide RNA described in

[0121] above, wherein B2, B3, and / or B4 are modified with 2'-O-Me.

[0123] The guide RNA according to any one of the above

[79] to

[0100] , wherein at least three of the nucleotides in the bulge region are modified with 2'-O-Me.

[0124] The guide RNA described in

[0123] above, wherein B2, B3, and / or B4 are modified with 2'-O-Me.

[0125] A guide RNA which is an sgRNA, as described in any one of the above items

[79] to

[0124] .

[0126] A guide RNA, which is a dgRNA, as described in any one of the above items

[79] to

[0125] .

[0127] The guide RNA according to

[81] or

[82] , wherein at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the nucleotides in the hairpin 1 region and the hairpin 2 region are modified with 2'-OMe.

[0128] A guide RNA described in any one of the above

[79] to

[0127] that forms a ribonucleoprotein complex with Cas9 of S. pyogenes.

[0129] Single guide RNA (sgRNA), a. The first three nucleotides at the 5' end of the 5' terminus, b. Each nucleotide in the upper stem region, c. Each nucleotide in hairpin region 1 and d. Nucleotides between hairpin 1 and hairpin 2, e. Each nucleotide in the hairpin 2 region, sgRNA containing or consisting of a 2'-O-Me modified nucleotide in the last four nucleotides at the 3' end of the f.3' terminus.

[0130] The sgRNA according to

[0129] , further comprising a PS bond linking the first four nucleotides at the 5' end of the 5' terminus and a PS bond linking the last four nucleotides at the 3' end of the 3' terminus.

[0131] sgRNA having the modification pattern shown in SEQ ID NOs. 350, 351, 352, or 353 as described in Table 4.

[0132] Single guide RNA (sgRNA), a. The first 3, 4, 5, or 7 nucleotides at the 5' end of the 5' terminus, b. Each nucleotide in the upper stem region, c. Each nucleotide in hairpin region 1 and d. Nucleotides between hairpin 1 and hairpin 2, e. Each nucleotide in the hairpin 2 region, sgRNA containing or consisting of a 2'-O-Me modified nucleotide in the last four nucleotides at the 3' end of the f.3' terminus.

[0133] Single guide RNA (sgRNA), a. The first 3, 4, 5, or 7 nucleotides at the 5' end of the 5' terminus, b. Each of the nucleotides US1, US2, US3, US4, US5, US6, US7, US8, US9, US10, US11, and US12, c. Each of the nucleotides H1-1, H1-2, H1-3, H1-4, H1-5, H1-6, H1-7, H1-8, H1-9, H1-10, H1-11, and H1-12, d. Nucleotides between hairpin 1 and hairpin 2, e. Nucleotides H2-1, H2-2, H2-3, H2-4, H2-5, H2-6, H2-7, H2-8, H2-9, H2-10, H2-11, H2-12, H2-13, H2-14, and H2-15, respectively, sgRNA containing or consisting of a 2'-O-Me modified nucleotide in the last four nucleotides at the 3' end of the f.3' terminus.

[0134] The sgRNA according to any one of

[0129] to

[0133] above, further comprising a PS bond linking the first four nucleotides at the 5' end of the 5' terminus and a PS bond linking the last four nucleotides at the 3' end of the 3' terminus.

[0135] sgRNA having the modification pattern of SEQ ID NOs. 350, 351, 352, or 353 as shown in Table 4.

[0136] The sgRNA described in any one of the above items

[0129] to

[0135] that forms a ribonucleoprotein complex with Cas9 of S. pyogenes.

[0137] crispr RNA (crRNA), The following areas, namely, a. The first five nucleotides at the 5' end of the 5' terminus, b. Lower stem region and, c. Bulge region and, d. Upper stem region; and e. A crRNA having one or more modifications in the last five nucleotides at the 3' end of the crRNA and in one or more regions of those nucleotides.

[0138] The crRNA according to

[0136] , further comprising a 5' terminal modification, wherein the 5' terminal modification includes one or more phosphorothioate linkages within the first seven nucleotides at the 5' end of the 5' terminal.

[0139] The crRNA according to

[0136] , further comprising a 5' terminal modification, wherein the 5' terminal modification includes at least two phosphorothioate linkages within the first seven nucleotides at the 5' end of the 5' terminus.

[0140] The crRNA described in any one of the above items

[0137] to

[0139] , wherein at least one modification comprises a 2'-O-methyl (2'-O-Me) modified nucleotide.

[0141] A crRNA according to any one of the above items

[0137] to

[0140] , wherein at least one modification comprises a 2'-fluoro(2'-F) modified nucleotide.

[0142] The crRNA described in any one of the above

[0137] to

[0141] , wherein at least one modification involves a phosphorothioate (PS) bond between nucleotides.

[0143] The crRNA according to any one of

[0137] to

[0142] above, wherein the first three nucleotides at the 5' end of the 5' terminal and the last three nucleotides at the 3' end of the 3' terminal are modified.

[0144] The crRNA according to any one of

[0137] to

[0143] above, wherein the first four nucleotides at the 5' end of the 5' terminal and the last four nucleotides at the 3' end of the 3' terminal are linked by phosphorothioate (PS) bonds.

[0145] The crRNA described in

[0143] above, wherein the modification includes 2'-O-Me.

[0146] The crRNA described in

[0143] above, wherein the modification includes 2'-F.

[0147] The crRNA according to any one of

[0137] to

[0146] above, wherein the first four nucleotides at the 5' end of the 5' terminal and the last four nucleotides at the 3' end of the 3' terminal are linked by a PS bond, and the first three nucleotides at the 5' end of the 5' terminal and the last three nucleotides at the 3' end of the 3' terminal contain a 2'-O-Me modification.

[0148] The crRNA according to any one of

[0137] to

[0146] above, wherein the first four nucleotides at the 5' end of the 5' terminal and the last four nucleotides at the 3' end of the 3' terminal are linked by a PS bond, and the first three nucleotides at the 5' end of the 5' terminal and the last three nucleotides at the 3' end of the 3' terminal include a 2'-F modification.

[0149] The crRNA described in any one of the above items

[0137] to

[0148] , wherein LS1 and LS6 are modified with 2'-O-Me.

[0150] A crRNA as described in any one of the above items

[0137] to

[0149] , wherein each nucleotide in the upper stem region is modified with 2'-O-Me.

[0151] crispr RNA (crRNA), a. LS1 and LS6 in the lower stem region, b. A crRNA in which each nucleotide in the upper stem region contains a 2'-O-Me modified nucleotide.

[0152] The crRNA according to

[0151] , further comprising three phosphorothioate (PS) bonds linking the first four nucleotides at the 5' end of the 5' terminus and three PS bonds linking the last four nucleotides at the 3' end of the 3' terminus.

[0153] The crRNA according to

[0151] or

[0152] above, further comprising 2'-O-Me or 2'-F modified nucleotides in the first three nucleotides at the 5' end of the 5' terminal, and further comprising 2'-O-Me or 2'-F modified nucleotides in the last three nucleotides at the 3' end of the 3' terminal.

[0154] A crRNA as described in any one of the above items

[0137] to

[0153] , wherein LS1, LS2, and LS6 are modified with 2'-F.

[0155] The crRNA described in any one of the above

[0137] to

[0154] , wherein each nucleotide in the bulge region is modified with 2'-F.

[0156] crispr RNA (crRNA), a. LS1, LS2, and LS6 in the lower stem region, b. crRNA containing a 2'-F modified nucleotide in each nucleotide within the bulge region.

[0157] The crRNA according to any one of

[0137] to

[0156] above, further comprising three phosphorothioate (PS) bonds linking the first four nucleotides at the 5' end of the 5' terminus and three PS bonds linking the last four nucleotides at the 3' end of the 3' terminus.

[0158] The crRNA according to any one of

[0137] to

[0157] above, further comprising 2'-O-Me or 2'-F modified nucleotides in the first three nucleotides at the 5' end of the 5' terminal, and further comprising 2'-O-Me or 2'-F modified nucleotides in the last three nucleotides at the 3' end of the 3' terminal.

[0159] A crRNA containing one of the sequence numbers 1-187, which include the modifications shown in Table 4.

[0160] A crRNA containing one of the following sequence numbers: 19-31, 53-73, 104-130, and 161-187, which include the modifications shown in Table 4.

[0161] A crRNA comprising nucleic acids having at least 99, 98, 97, 96, 95, 94, 93, 92, 91, 90, 85, 80, 75, or 70% identity with any one of sequence numbers 19-31, 53-73, 104-130, and 161-187, wherein the modifications in each nucleotide of the crRNA corresponding to the nucleotide of the reference sequence identifier in Table 4 are identical or equivalent to the modifications shown for the reference sequence identifier in Table 4.

[0162] The crRNA according to any one of

[0159] to

[0161] above, further comprising three phosphorothioate (PS) bonds linking the first four nucleotides at the 5' end of the 5' terminus and three PS bonds linking the last four nucleotides at the 3' end of the 3' terminus.

[0163] The crRNA described in any one of the above

[0137] to

[0162] , wherein the crRNA combined with trRNA forms a ribonucleoprotein complex with Cas9 of S. pyogenes.

[0164] tracr RNA (trRNA), The following areas: a. The first five nucleotides at the 5' end of the 5' terminus, b. Upper stem region and, c. Bulge region and, d. Lower stem region and, e. Nexus area and, f. Hairpin 1 region and g. Hairpin 2 area and, A trRNA having one or more modifications in one or more regions of the last five nucleotides at the 3' end of the 3' terminus.

[0165] The trRNA described in

[0164] above, wherein at least one modification comprises a 2'-O-methyl (2'-O-Me) modified nucleotide.

[0166] The trRNA described in

[0164] or

[0165] above, wherein at least one modification comprises a 2'-fluoro(2'-F) modified nucleotide.

[0167] The trRNA according to any one of the above items

[0164] to

[0166] , wherein at least one modification involves a phosphorothioate (PS) bond between nucleotides.

[0168] The trRNA according to any one of

[0164] to

[0167] above, wherein the first four nucleotides at the 5' end of the 5' terminal and the last four nucleotides at the 3' end of the 3' terminal are linked by phosphorothioate (PS) bonds.

[0169] The trRNA according to any one of

[0164] to

[0168] above, wherein the first three nucleotides at the 5' end of the 5' terminal and the last three nucleotides at the 3' end of the 3' terminal are modified.

[0170] The trRNA described in

[0169] above, wherein the modification includes 2'-O-Me.

[0171] The trRNA described in

[0169] above, wherein the modification includes 2'-F.

[0172] The trRNA according to any one of

[0164] to

[0171] above, wherein the first four nucleotides at the 5' end of the 5' terminus and the last four nucleotides at the 3' end of the 3' terminus are linked by a PS bond, and the first three nucleotides at the 5' end of the 5' terminus and the last three nucleotides at the 3' end of the 3' terminus contain a 2'-O-Me modification.

[0173] The trRNA according to any one of

[0164] to

[0171] above, wherein the first four nucleotides at the 5' end of the 5' terminus and the last four nucleotides at the 3' end of the 3' terminus are linked by a PS bond, and the first three nucleotides at the 5' end of the 5' terminus and the last three nucleotides at the 3' end of the 3' terminus contain a 2'-F modification.

[0174] The trRNA according to any one of the above

[0164] to

[0173] , wherein each nucleotide in the upper stem region is modified with 2'-O-Me.

[0175] The trRNA according to any one of the above

[0164] to

[0174] , wherein B1 and B2 in the bulge region are modified with 2'-O-Me.

[0176] The trRNA according to any one of

[0164] to

[0175] above, wherein N3, N4, N5, N15, N16, N17, and / or N18 in the nexus region are modified with 2'-O-Me.

[0177] The trRNA according to any one of the above

[0164] to

[0176] , wherein each nucleotide in the hairpin 1 region is modified with 2'-O-Me.

[0178] The trRNA according to any one of the above

[0164] to

[0177] , wherein each nucleotide in the hairpin 2 region is modified with 2'-O-Me.

[0179] tracr RNA (trRNA), a. Each nucleotide in the upper stem, b. B1 and / or B2 within the bulge region, c. N3, N4, N5, N15, N16, N17, and / or N18 in the nexus region, d. Each nucleotide in the hairpin 1 region, e. trRNA containing a 2'-O-Me modified nucleotide in each of the hairpin 2 regions.

[0180] The trRNA according to

[0179] above, further comprising three phosphorothioate (PS) bonds linking the first four nucleotides at the 5' end of the 5' terminus and three PS bonds linking the last four nucleotides at the 3' end of the 3' terminus.

[0181] The trRNA according to

[0179] or

[0180] above, further comprising 2'-O-Me or 2'-F modified nucleotides in the first three nucleotides at the 5' end of the 5' terminus, and further comprising 2'-O-Me or 2'-F modified nucleic acid in the last three nucleotides at the 3' end of the 3' terminus.

[0182] A trRNA as described in any one of the above items

[0164] to

[0181] , wherein N15, N16, N17, and N18 are modified with 2'-F.

[0183] The trRNA described in any one of the above

[0164] to

[0182] , wherein LS1, LS3, and LS5 are modified with 2'-F, and LS2, LS4, and LS6 are modified with 2'-O-Me.

[0184] The trRNA according to any one of

[0164] to

[0183] , further comprising three phosphorothioate (PS) bonds linking the first four nucleotides at the 5' end of the 5' terminus and three PS bonds linking the last four nucleotides at the 3' end of the 3' terminus.

[0185] The trRNA according to any one of

[0164] to

[0184] above, further comprising 2'-O-Me or 2'-F modified nucleotides in the first three nucleotides at the 5' end of the 5' terminal, and further comprising 2'-O-Me or 2'-F modified nucleotides in the last three nucleotides at the 3' end of the 3' terminal.

[0186] A trRNA containing one of the sequence numbers 188-227, which include the modifications shown in Table 4.

[0187] A trRNA comprising nucleic acids having at least 99, 98, 97, 96, 95, 94, 93, 92, 91, 90, 85, 80, 75, or 70% identity with any one of sequence numbers 188 to 227, wherein the modifications in each nucleotide of the trRNA corresponding to the nucleotide of the reference sequence identifier in Table 4 are identical or equivalent to the modifications shown for the reference sequence identifier in Table 4.

[0188] The trRNA according to any one of

[0186] to

[0187] above, further comprising three phosphorothioate (PS) bonds linking the first four nucleotides at the 5' end of the 5' terminus and three PS bonds linking the last four nucleotides at the 3' end of the 3' terminus.

[0189] The trRNA described in any one of the above items

[0164] to

[0188] , wherein the trRNA combined with crRNA forms a ribonucleoprotein complex with Cas9 of S. pyogenes.

[0190] A dual guide comprising crRNA and trRNA, wherein the crRNA comprises one of sequence numbers 1 to 187 described in Table 4, and the trRNA comprises one nucleic acid from sequence numbers 188 to 227 described in Table 4.

[0191] A dual guide containing the crRNA described in any one of the above items

[0137] to

[0163] and the trRNA described in any one of the above items

[0164] to

[0189] .

[0192] A dual guide containing the crRNA and unmodified trRNA described in any one of the above items

[0137] to

[0163] .

[0193] A dual guide containing unmodified crRNA and any one of the trRNAs described in items

[0137] to

[0189] above.

[0194] A dual guide described in any one of the above items

[0190] to

[0193] , which forms a ribonucleoprotein complex with Cas9 of S. pyogenes.

[0195] An LNP composition comprising the sgRNA described in any one of the above items [1] to

[78] and

[0129] to

[0136] .

[0196] An LNP composition comprising the RNA described in any one of the above items [1] to

[0193] or a gRNA consisting thereof.

[0197] A composition comprising the sgRNA described in any one of the above [1] to

[78] and

[0129] to

[0136] associated with lipid nanoparticles (LNPs).

[0198] A composition comprising the crRNA described in any one of the above items

[0137] to

[0163] associated with lipid nanoparticles (LNPs).

[0199] A composition comprising the trRNA described in any one of the above items

[0164] to

[0189] associated with lipid nanoparticles (LNPs).

[0200] A composition comprising the sgRNA described in any one of items [1] to

[78] and

[0129] to

[0136] above, the gRNA described in any one of items

[79] to

[0128] above, the crRNA described in any one of items

[0137] to

[0163] above, the trRNA described in any one of items

[0164] to

[0189] above, the dgRNA described in any one of items

[0190] to

[0194] above, or the composition described in any one of items

[0195] to

[0199] above, further comprising a nuclease or mRNA encoding the nuclease.

[0201] The composition according to

[0200] above, wherein the nuclease is a Cas protein.

[0202] The composition according to

[0201] above, wherein the Cas protein is Cas9.

[0203] The composition according to

[0202] , wherein the Cas9 is Cas9 of S. pyogenes.

[0204] The composition according to any one of the above items

[0200] to

[0203] , wherein the nuclease is nicasse.

[0205] The composition according to any one of the above items

[0200] to

[0204] , wherein the nuclease is modified.

[0206] The composition according to

[0205] , wherein the modified nuclease comprises a nuclear localization signal (NLS).

[0207] The composition according to any one of the above items

[0200] to

[0206] , comprising mRNA encoding the nuclease.

[0208] A pharmaceutical preparation comprising an sgRNA described in any one of items [1] to

[78] and

[0129] to

[0136] above, a gRNA described in any one of items

[79] to

[0128] above, a crRNA described in any one of items

[0137] to

[0163] above, a trRNA described in any one of items

[0164] to

[0189] above, a dgRNA described in any one of items

[0190] to

[0194] above, or a composition described in any one of items

[0195] to

[0207] above, and a pharmaceutically acceptable carrier.

[0209] A method for modifying target DNA, The following: a. sgRNA as described in any one of the above items [1] to

[78] and

[0129] to

[0136] ; b. gRNA as described in any one of the above items

[79] to

[0128] ; c. crRNA as described in any one of the above items

[0137] to

[0163] ; d. trRNA as described in any one of the above items

[0164] to

[0189] ; e. dgRNA as described in any one of the above items

[0190] to

[0194] ; f. A composition described in any one of the above items

[0195] to

[0207] ; or g. A method comprising delivering one or more of the pharmaceutical preparations described in

[0208] above to cells.

[0210] The method according to

[0209] above, which results in an insertion or deletion in a gene.

[0211] The method according to

[0209] , further comprising delivering a template to the cells, wherein at least a portion of the template is incorporated into target DNA at or near a double-strand break site induced by the Cas protein.

[0212] sgRNA as described in any one of the above items [1] to

[78] and

[0129] to

[0136] , for use in the preparation of a drug for the treatment of a disease or disorder.

[0213] A crRNA as described in any one of the above items

[0737] to

[0163] , for use in the preparation of a drug for treating a disease or disorder.

[0214] trRNA as described in any one of the above items

[0164] to

[0189] , for use in the preparation of a drug for treating a disease or disorder.

[0215] A crRNA according to any one of items

[0137] to

[0163] above, combined with a trRNA according to any one of items

[0164] to

[0189] above, for use in the preparation of a drug for treating a disease or disorder.

[0216] A pharmaceutical preparation as described in

[0208] above, for use in the preparation of a drug for treating a disease or disorder.

Claims

1. A single guide RNA (sgRNA) having a 5' to 3' portion, (i) A 5' terminus containing a guide region with 20 nucleotides, (ii) The lower stem region, which consists of nucleotides LS1 to LS6, (iii) The bulge region, which consists of nucleotides B1 to B2, (iv) The upper stem region, which consists of nucleotides US1 to US12, (v) The bulge region, which consists of nucleotides B3 to B6, (vi) The lower stem region, which consists of nucleotides LS7 to LS12, (vii) The nexus region, which consists of nucleotides N1 to N18, (viiii) Hairpin 1 region which is nucleotide H1-1 to H1-12, (ix) nucleotides and, (x) Hairpin 2 regions which are nucleotides H2-1 to H2-15, (xi) 3' terminus containing at least four nucleotides Includes, The aforementioned sgRNA, a. Upper stem region, b. Hairpin 1 region, and c. Hairpin 2 area, Each of these includes one or more modifications, The sgRNA contains 2'-O-methyl (2'-O-Me) modifications in 10, 11, or all of the following nucleotides: US1, US2, US3, US4, US5, US6, US7, US8, US9, US10, US11, or US12, The aforementioned sgRNA, A 5' terminal modification that includes at least two phosphorothioate (PS) links in the first seven nucleotides at the 5' end of the 5' terminal, A 3'-terminus modification is one in which at least two of the last four nucleotides at the 3' end of the 3' terminus are modified, Includes, The sgRNA is an sgRNA in which 50% or more of the nucleotides in the hairpin 1 region and the hairpin 2 region contain a 2'-O-Me modification.

2. The sgRNA according to claim 1, wherein the sgRNA is modified at H1-1 to H1-12 and / or at H2-1 to H2-15.

3. The sgRNA according to any one of claims 1 to 2, comprising a modification in the lower stem region.

4. The sgRNA according to any one of claims 1 to 3, wherein at least two of the last four nucleotides at the 3' end of the 3' terminus are modified with 2'-O-Me, 2'-F, or 2'-O-moe.

5. The sgRNA according to claim 4, further comprising a phosphorothioate (PS) bond between one or more of the last four nucleotides at the 3' end of the 3' terminus.

6. The sgRNA according to any one of claims 1 to 5, further comprising modifications in the bulge region.

7. The sgRNA according to any one of claims 1 to 6, comprising a modification in the nexus region.

8. The sgRNA according to any one of claims 1 to 7, wherein the first three nucleotides at the 5' end of the 5' terminus and the last three nucleotides at the 3' end of the 3' terminus are modified.

9. The sgRNA according to any one of claims 1 to 8, wherein LS1, LS6, LS7, LS8, LS11, and / or LS12 are modified with 2'-O-Me.

10. The sgRNA according to any one of claims 7 to 9, wherein the modification in the nexus region is selected from 2'-O-Me and 2'F.

11. The sgRNA according to any one of claims 1 to 10, wherein LS9 and LS10 are modified, for example, with 2'-F or 2'-OMe.

12. The sgRNA according to any one of claims 1 to 11, wherein LS1 contains a 2'-O-Me modification and LS2 to LS5 does not contain any modifications.

13. The sgRNA according to any one of claims 1 to 12, comprising two or more 2'-O-Me modified nucleotides among LS8, LS9, LS10, LS11, and LS12.

14. The sgRNA according to claim 13, wherein at least LS8 and LS10 are modified with 2'-O-Me.

15. The sgRNA according to any one of claims 1 to 14, comprising a 2'-O-Me modification in four or more nucleotides in the nexus region.

16. The sgRNA according to claim 15, wherein at least one, two, three, four, or five nucleotides N2 to N6 in the nexus region are modified with 2'-O-Me.

17. The sgRNA according to any one of claims 1 to 16, wherein at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the nucleotides in the hairpin 1 region and the hairpin 2 region are modified with 2'-OMe.

18. A single guide RNA (sgRNA) having a 5' to 3' portion, (i) A 5' terminus containing a guide region with 20 nucleotides, (ii) The lower stem region, which consists of nucleotides 1-6 of sequence number 355, (iii) The bulge region portion, which is nucleotides 7-8 of sequence number 355, (iv) The upper stem region, which consists of nucleotides 9-20 of sequence number 355, (v) The bulge region portion, which consists of nucleotides 21-24 of sequence number 355, (vi) The lower stem region, which consists of nucleotides 25-30 of sequence number 355, (vii) The nexus region consisting of nucleotides 31-48 of sequence number 355, (viiii) The hairpin 1 region, which consists of nucleotides 49-60 of sequence number 355, (ix) The nucleotide that is nucleotide 61 of sequence number 355, (x) The hairpin 2 region, which consists of nucleotides 62-76 of sequence number 355, (xi) 3' terminus containing at least four nucleotides Includes, The aforementioned sgRNA, a. Upper stem region, b. Hairpin 1 region, and c. Hairpin 2 area, Each of these includes one or more modifications, The sgRNA contains a 2'-O-methyl (2'-O-Me) modification in at least 10 nucleotides in the upper stem region. The aforementioned sgRNA, A 5' terminal modification that includes at least two phosphorothioate (PS) links in the first seven nucleotides at the 5' end of the 5' terminal, A 3'-terminus modification is one in which at least two of the last four nucleotides at the 3' end of the 3' terminus are modified, Includes, The sgRNA is an sgRNA in which 50% or more of the nucleotides in the hairpin 1 region and the hairpin 2 region contain a 2'-O-Me modification.

19. The following: 1) 2'-O-Me modification in the first three, four, or five nucleotides at the 5' end of the 5' terminus; 2) 2'-O-Me modification in the last three, last four, or last five nucleotides at the 3' terminus of the 3' terminus; 3) Phosphothioate (PS) linkage between the first three, four, or five nucleotides at the 5' end of the 5' terminus; or 4) PS bonding between the last three, four, or five nucleotides at the 3' end of the 3' terminus; The sgRNA according to claim 1 or 18, further comprising one or more of the above.

20. A lipid nanoparticle (LNP) composition comprising the sgRNA described in any one of claims 1 to 19.

21. A composition comprising sgRNA according to any one of claims 1 to 19, associated with lipid nanoparticles (LNPs).

22. A composition comprising the sgRNA according to any one of claims 1 to 19, or the composition according to claim 20 or 21, further comprising a nuclease or mRNA encoding the nuclease.

23. The composition according to claim 22, wherein the nuclease is Cas9 of S. pyogenes (SpyCas9).

24. The composition according to any one of claims 22 to 23, wherein the nuclease is nicasse.

25. The composition according to any one of claims 22 to 24, wherein the nuclease is modified.

26. The composition according to claim 25, wherein the modified nuclease comprises a nuclear localization signal (NLS).

27. ​​The composition according to any one of claims 22 to 26, comprising mRNA encoding the nuclease.

28. A pharmaceutical formulation comprising sgRNA according to any one of claims 1 to 19, or a composition according to any one of claims 20 to 27, and a pharmaceutically acceptable carrier.

29. A method for modifying target DNA, Cas protein or nucleic acid encoding Cas protein, and the following: a. The sgRNA according to any one of claims 1 to 19; or b. The composition according to any one of claims 20 to 27; or c. The pharmaceutical preparation according to claim 28 A method comprising delivering one or more of the following to in vitro or ex vivo cells.

30. The method according to claim 29, wherein the method results in an insertion or deletion in a gene.

31. The method of claim 29, further comprising delivering a template to the cell, wherein at least a portion of the template is incorporated into target DNA at or near a double-strand break site induced by the Cas protein.

32. An sgRNA according to any one of claims 1 to 19, a composition according to any one of claims 20 to 27, or a pharmaceutical formulation according to claim 28, for use in modifying target DNA.

33. A composition comprising the sgRNA according to any one of claims 1 to 19 for use in the treatment of a disease or disorder.

34. The pharmaceutical preparation according to claim 28, for use in the treatment of a disease or disorder.