AAV-based regulation of gene expression

Abstract

Aspects of the present disclosure relate to compositions and methods for positively or negatively regulating the expression of a gene therapy (e.g., a therapeutic protein expressed from an AAV vector). The present disclosure is based, in part, on specific nucleic acids, e.g., antisense oligonucleotides (ASOs), configured to bind to specific regions of an expression cassette (or mRNA transcribed from such an expression cassette).

Description

Technical Field

[0001] Related Applications This application claims the benefit of U.S. Provisional Application No. 63 / 141,110, filed January 25, 2021, titled "MODULATION OF AAV-BASED GENE EXPRESSION", under 35 U.S.C. § 119(e), the entire content of which is incorporated herein by reference.

Background Art

[0002] Background The ability to regulate the expression of therapeutic transgenes introduced into patients via AAV transduction will revolutionize the field of gene therapy. The biology underlying current viral approaches to gene therapy ensures long-term expression of therapeutic transgenes. This continuous expression of therapeutic genes is suitable for many applications, particularly those resulting from loss-of-function gene mutations in the patient's genome. However, from the perspective of therapeutic administration or safety, there are several scenarios where the ability to increase / decrease or turn on / off the expression of therapeutic genes is highly desirable; the present invention describes multiple methods for achieving such control of gene expression through the use of specific ASOs.

Disclosure of Invention

[0003] Summary Aspects of the present disclosure relate to compositions and methods for positively or negatively regulating the expression of gene therapy agents (e.g., therapeutic proteins expressed from AAV vectors) through the use of specific nucleic acids, such as antisense oligonucleotides (ASOs). In some embodiments, the methods described by the present disclosure enable the regulation of gene expression from expression cassettes consisting of commonly used broadly acting cis-acting DNA or RNA regulatory elements, or expression cassettes having cis-acting DNA or RNA elements, through the interaction of a nucleic acid (e.g., an ASO) with an element within the expression cassette or within an mRNA transcribed from such an expression cassette. Accordingly, in several respects, the present disclosure provides a method for modulating the expression of a transgene in cells, the method comprising contacting cells containing an rAAV vector containing a transgene positioned aside an AAV reverse terminal repeat (ITR) with one or more antisense oligonucleotides (ASOs) that specifically bind to at least one of the AAV ITRs, where the binding of one or more ASOs to the AAV ITR results in altered transgene expression compared to cells not containing one or more ASOs.

[0004] In some embodiments, each of the one or more ASOs has a length ranging from about 10 to about 30 nucleotides. In some embodiments, each ASO contains one or more chemical modifications. In some embodiments, one or more chemical modifications are selected from nucleic acid base modifications or backbone modifications. In some embodiments, all nucleic acid bases and / or the entire backbone of the ASO are modified. In some embodiments, the nucleic acid base modifications include 2'-O-methyl (2'OMe) modifications. In some embodiments, the backbone modifications include phosphorothioate bonds. In some embodiments, the ASO contains one or more locked nucleic acids (LNAs). In some embodiments, the AAV ITR is an AAV2 ITR. In some embodiments, the AAV2 ITR comprises a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence described in SEQ ID NO: 1. In some embodiments, the AAV2 ITR consists of the nucleic acid sequence described in SEQ ID NO: 1 or a complement thereof. In some embodiments, the ASO is bound to at least three consecutive nucleotides of the AAV ITR.

[0005] In some embodiments, at least one ASO comprises a nucleic acid sequence that is at least 90% identical to the sequence described in any one of SEQ ID NOs: 2-8, or a complement thereof. In some embodiments, at least one ASO comprises a nucleic acid sequence that is at least 90% identical to the sequence described in any one of SEQ ID NOs: 2-8, or a complement thereof, and each of the at least one ASO comprises one or more chemical modifications selected from nucleic acid base modifications or backbone modifications. In some embodiments, all nucleic acid bases and / or the entire backbone of the ASO are modified. In some embodiments, the nucleic acid base modification includes a 2'-O-methyl (2'OMe) modification. In some embodiments, the backbone modification includes a phosphorothioate bond. In some embodiments, the ASO comprises one or more locked nucleic acids (LNAs). In some embodiments, the change in expression is an increase in the expression of the transgene (e.g., an increase in expression compared to cells that do not contain one or more ASOs). In some embodiments, the change in expression is a decrease in the expression of the transgene (e.g., a decrease in expression compared to cells that do not contain one or more ASOs).

[0006] In some embodiments, the cells are mammalian cells. In some embodiments, the mammalian cells are human cells. In some embodiments, the cells are within the object. In some embodiments, the transgene is a therapeutic protein. In some embodiments, the therapeutic protein is β-glucocerebrosidase (GBA). In some embodiments, GBA is encoded by a codon-optimized nucleic acid sequence. In some embodiments, the transgene encoding GBA comprises the nucleic acid sequence described in SEQ ID NO: 40 or its complement. In some embodiments, the rAAV vector comprises the nucleic acid sequences described in SEQ ID NOs: 1, 9, 25, 40, 51, and 80. In several respects, this disclosure provides a method for regulating the expression of a transgene in cells, the method comprising contacting cells containing an rAAV vector containing a transgene with one or more antisense oligonucleotides (ASOs) that specifically bind to the transcriptional regulatory region sequence of the transgene, wherein the binding of one or more ASOs to the transcriptional regulatory region sequence results in altered transgene expression compared to cells not containing one or more ASOs.

[0007] In some embodiments, each of the one or more ASOs has a length ranging from about 10 to about 30 nucleotides. In some embodiments, each ASO contains one or more chemical modifications. In some embodiments, all nucleic acid bases and / or the entire backbone of the ASO are modified. In some embodiments, one or more chemical modifications are selected from nucleic acid base modifications or backbone modifications. In some embodiments, the nucleic acid base modification includes a 2'-O-methyl (2'OMe) modification. In some embodiments, the backbone modification includes a phosphorothioate bond. In some embodiments, the ASO contains one or more locked nucleic acids (LNAs). In some embodiments, the transcriptional regulatory region sequence includes an enhancer sequence and / or a promoter sequence. In some embodiments, the enhancer sequence is a cytomegalovirus (CMV) enhancer sequence, and / or the promoter sequence is a chicken β-actin (CBA) promoter sequence. In some embodiments, the CMV enhancer sequence includes a nucleic acid sequence or its complement that is at least 90% identical to the nucleic acid sequence described in SEQ ID NO: 9. In some embodiments, the chicken β-actin (CBA) promoter sequence includes a nucleic acid sequence or its complement that is at least 90% identical to the nucleic acid sequence described in SEQ ID NO: 25.

[0008] In some embodiments, the ASO binds to at least three consecutive nucleotides of the transcriptional regulatory region sequence. In some embodiments, at least one ASO comprises a nucleic acid sequence that is at least 90% identical to the sequence described in any one of SEQ ID NOs. 10-24 and 26-39, or a complement thereof. In some embodiments, at least one ASO comprises a nucleic acid sequence that is at least 90% identical to the sequence described in any one of SEQ ID NOs. 10-24 and 26-39, or a complement thereof, and each of the at least one ASO comprises one or more chemical modifications selected from nucleic acid base modifications or backbone modifications. In some embodiments, all nucleic acid bases and / or the entire backbone of the ASO are modified. In some embodiments, the nucleic acid base modification includes a 2'-O-methyl (2'OMe) modification. In some embodiments, the backbone modification includes a phosphorothioate bond. In some embodiments, the ASO comprises one or more locked nucleic acids (LNAs).

[0009] In some embodiments, the change in expression is an increase in the expression of the transgene (e.g., an increase in expression compared to cells that do not contain one or more ASOs). In some embodiments, the change in expression is a decrease in the expression of the transgene (e.g., a decrease in expression compared to cells that do not contain one or more ASOs). In some embodiments, the cells are mammalian cells. In some embodiments, the mammalian cells are human cells. In some embodiments, the cells are within the object. In some embodiments, the transgene is a therapeutic protein. In some embodiments, the therapeutic protein is β-glucocerebrosidase (GBA). In some embodiments, GBA is encoded by a codon-optimized nucleic acid sequence. In some embodiments, the transgene encoding GBA comprises the nucleic acid sequence described in SEQ ID NO: 40 or its complement. In some embodiments, the rAAV vector comprises the nucleic acid sequences described in SEQ ID NOs: 1, 9, 25, 40, 51, and 80.

[0010] In several respects, this disclosure provides a method for regulating the expression of a transgene in cells, the method comprising contacting cells containing an rAAV vector containing a transgene with one or more antisense oligonucleotides (ASOs) that specifically bind to the protein-coding region of mRNA transcribed from the transgene, wherein the binding of one or more ASOs to the protein-coding region results in altered transgene expression compared to cells not containing one or more ASOs. In some embodiments, each of one or more ASOs has a length ranging from about 10 to about 30 nucleotides. In some embodiments, each ASO contains one or more chemical modifications. In some embodiments, one or more chemical modifications are selected from nucleic acid base modifications or backbone modifications. In some embodiments, all nucleic acid bases and / or the entire backbone of the ASO are modified. In some embodiments, the nucleic acid base modification includes a 2'-O-methyl (2'OMe) modification. In some embodiments, the backbone modification includes a phosphorothioate bond. In some embodiments, the ASO contains one or more locked nucleic acids (LNAs). In some embodiments, the ASO contains a gapmer structure. In some embodiments, the ASO is bound to at least three consecutive nucleotides in a protein-coding region.

[0011] In some embodiments, at least one ASO includes a nucleic acid sequence that is at least 90% identical to the sequence described in any one of sequence numbers 41-50, any one of sequence numbers 91-95, or any one of sequence numbers 106-110, or a complement thereof. In some embodiments, the protein-coding region encodes a β-glucocerebrosidase (GBA) protein. In some embodiments, the protein-coding region comprises a nucleic acid sequence or its complement that is at least 90% identical to the nucleic acid sequence described in SEQ ID NO: 40. In some embodiments, the change in expression is an increase in the expression of the transgene (e.g., an increase in expression compared to cells without one or more ASOs). In some embodiments, the change in expression is a decrease in the expression of the transgene (e.g., a decrease in expression compared to cells without one or more ASOs). In some embodiments, the decrease in transgene expression results from RNaseH-mediated degradation of mRNA transcripts bound by one or more ASOs.

[0012] In some embodiments, the cells are mammalian cells. In some embodiments, the mammalian cells are human cells. In some embodiments, the cells are within the object. In some embodiments, the rAAV vector comprises the nucleic acid sequences described in SEQ ID NOs: 1, 9, 25, 40, 51, and 80. In several respects, this disclosure provides a method for regulating the expression of a transgene in cells, the method comprising contacting cells containing an rAAV vector containing a transgene with one or more antisense oligonucleotides (ASOs) that specifically bind to the woodchuck post-translational regulatory element (WPRE) of mRNA transcribed from the transgene, wherein the binding of one or more ASOs to the WPRE results in altered transgene expression compared to cells not containing one or more ASOs.

[0013] In some embodiments, each of the one or more ASOs has a length ranging from about 10 to about 30 nucleotides. In some embodiments, each ASO contains one or more chemical modifications. In some embodiments, one or more chemical modifications are selected from nucleic acid base modifications or backbone modifications. In some embodiments, all nucleic acid bases and / or the entire backbone of the ASO are modified. In some embodiments, the nucleic acid base modification includes a 2'-O-methyl (2'OMe) modification. In some embodiments, the backbone modification includes a phosphorothioate bond. In some embodiments, the ASO contains one or more locked nucleic acids (LNAs). In some embodiments, the WPRE comprises a nucleic acid sequence or its complement that is at least 90% identical to the nucleic acid sequence described in Sequence ID No. 51. In some embodiments, the ASO binds to at least three consecutive nucleotides of the WPRE sequence.

[0014] In some embodiments, at least one ASO includes a nucleic acid sequence that is at least 90% identical to the sequence described in any one of sequence numbers 52-79, any one of sequence numbers 96-100, or any one of sequence numbers 111-115, or a complement thereof. In some embodiments, the change in expression is an increase in the expression of the transgene (e.g., an increase in expression compared to cells that do not contain one or more ASOs). In some embodiments, the change in expression is a decrease in the expression of the transgene (e.g., a decrease in expression compared to cells that do not contain one or more ASOs). In some embodiments, the cells are mammalian cells. In some embodiments, the mammalian cells are human cells. In some embodiments, the cells are within the object. In some embodiments, the transgene is a therapeutic protein. In some embodiments, the therapeutic protein is β-glucocerebrosidase (GBA). In some embodiments, GBA is encoded by a codon-optimized nucleic acid sequence. In some embodiments, the transgene encoding GBA comprises the nucleic acid sequence described in SEQ ID NO: 40 or its complement. In some embodiments, the rAAV vector comprises the nucleic acid sequences described in SEQ ID NOs: 1, 9, 25, 40, 51, and 80.

[0015] In several respects, this disclosure provides a method for regulating the expression of a transgene in cells, the method comprising contacting cells containing an rAAV vector containing a transgene with one or more antisense oligonucleotides (ASOs) that specifically bind to polyadenylated elements of mRNA transcribed from the transgene, wherein the binding of one or more ASOs to the polyadenylated elements results in altered transgene expression compared to cells not containing one or more ASOs. In some embodiments, each of one or more ASOs has a length ranging from about 10 to about 30 nucleotides. In some embodiments, each ASO contains one or more chemical modifications. In some embodiments, one or more chemical modifications are selected from nucleic acid base modifications or backbone modifications. In some embodiments, all nucleic acid bases and / or the entire backbone of the ASO are modified. In some embodiments, the nucleic acid base modification includes a 2'-O-methyl (2'OMe) modification. In some embodiments, the backbone modification includes a phosphorothioate bond. In some embodiments, the ASO contains one or more locked nucleic acids (LNAs). In some embodiments, the ASO contains a gapmer structure. In some embodiments, the ASO is bound to at least three consecutive nucleotides of a polyadenylated element.

[0016] In some embodiments, the polyadenylated element comprises the nucleic acid sequence described in SEQ ID NO: 80 or a complement thereof. In some embodiments, at least one ASO comprises a nucleic acid sequence that is at least 90% identical to the sequence described in any one of SEQ ID NOs. 81-90, any one of SEQ ID NOs. 101-104, or any one of SEQ ID NOs. 116-120, or a complement thereof. In some embodiments, the change in expression is an increase in the expression of the transgene (e.g., an increase in expression compared to cells without one or more ASOs). In some embodiments, the change in expression is a decrease in the expression of the transgene (e.g., a decrease in expression compared to cells without one or more ASOs). In some embodiments, the decrease in transgene expression results from RNaseH-mediated degradation of mRNA transcripts bound by one or more ASOs.

[0017] In some embodiments, the expression of the transgene changes (i.e., increases or decreases) regardless of the nature of the expressed transgene. In some embodiments, one or more ASOs are delivered to the cells simultaneously with transgene transfection. In some embodiments, one or more ASOs are delivered to the cells several hours, e.g., 3 hours, after transfecting the cells with a plasmid containing an rAAV vector encoding the transgene. In some embodiments, one or more ASOs are delivered to the cells several weeks after transfecting the cells with a plasmid containing an rAAV vector encoding the transgene. In some embodiments, the cells are mammalian cells. In some embodiments, the mammalian cells are human cells. In some embodiments, the cells are within a subject. In some embodiments, the transgene is a therapeutic protein. In some embodiments, the therapeutic protein is β-glucocerebrosidase (GBA). In some embodiments, GBA is encoded by a codon-optimized nucleic acid sequence. In some embodiments, the transgene encoding GBA comprises the nucleic acid sequence set forth in SEQ ID NO: 40 or its complement. In some embodiments, the rAAV vector comprises the nucleic acid sequences set forth in SEQ ID NOs: 1, 9, 25, 40, 51, and 80.

[0018] In some aspects, the disclosure provides an isolated nucleic acid comprising a sequence set forth in any one of SEQ ID NOs: 2-8, 10-24, 26-39, 41-50, 52-79, 81-120, or its complement. In some embodiments, the isolated nucleic acid comprises one or more chemical modifications. In some embodiments, the one or more chemical modifications comprise 2'-O-methyl (2'OMe) modifications, phosphorothioate linkages, locked nucleic acids (LNAs), or any combination of the foregoing. In some embodiments, the isolated nucleic acid is an antisense oligonucleotide (ASO). In some embodiments, all of the nucleobases and / or the entire backbone of the ASO are modified. In some embodiments, the isolated nucleic acid has a gapmer structure. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] [Figure 1] Figure 1 shows the effect of GBA-directed ASO on GBA expression in HEK293T cells transfected with a plasmid encoding GBA and the designated ASO. Cells were harvested after 72 hours, and GBA expression was quantified using qRT-PCR. [Figure 2] Figure 2 shows the effect of WPRE-directed ASO on GBA expression in HEK293T cells transfected with a plasmid encoding GBA and the designated ASO. Cells were harvested after 72 hours, and GBA expression was quantified using qRT-PCR. [Figure 3] Figure 3 shows the effect of BGH polyA-directed ASO on GBA expression in HEK293T cells transfected with a plasmid encoding GBA and the designated ASO. Cells were harvested after 72 hours, and GBA expression was quantified using qRT-PCR.

[0020] [Figure 4] Figure 4 shows the effect of ASO polyA ASO-2 on Trem2 expression in HEK293T cells transfected with a plasmid encoding Trem2 and the designated ASO. Cells were harvested after 72 hours, and GBA expression was quantified using qRT-PCR. [Figure 5] Figure 5 shows the effect of ASO on GBA expression in sequential transfection. HEK293T cells were transfected with a plasmid encoding GBA expression. After 3 hours, the plasmid transfection mixture was removed, and the cells were transfected with the designated ASO. Cells were harvested after 72 hours, and GBA expression was quantified using qRT-PCR. [Figure 6] Figure 6 shows the ASO target sequence of the PR001 construct. [Figure 7]Figure 7 shows the GBA mRNA levels in the livers of mice that received AAV-GBA injection followed by treatment with GBA ASO 1, WPRE ASO 2, or poly(A) ASO 2.

[0021] Detailed explanation In several aspects, this disclosure relates to compositions and methods for regulating (e.g., positively or negatively) the expression of gene therapies (e.g., therapeutic proteins expressed from AAV vectors) through the use of specific nucleic acids, such as antisense oligonucleotides (ASOs). In some embodiments, the nucleic acids described herein (e.g., ASOs) regulate gene expression from expression cassettes consisting of commonly used cis-acting DNA or RNA regulatory elements, from expression cassettes having cis-acting DNA or RNA elements, or mRNA transcribed from such expression cassettes.

[0022] Isolated nucleic acids The isolated nucleic acid may be DNA or RNA. In some embodiments, the proteins and nucleic acids of this disclosure are isolated. As used herein, the term “isolated” means artificially produced. As used herein with respect to nucleic acids, the term “isolated” means: (i) amplified in vitro, e.g., by polymerase chain reaction (PCR); (ii) recombinantly produced by cloning; (iii) purified, e.g., by cleavage and gel separation; or (iv) synthesized, e.g., by chemical synthesis. Isolated nucleic acids are readily manipulable by recombinant DNA techniques well known in the art. Thus, nucleotide sequences contained in vectors where the 5' and 3' restriction sites are known or polymerase chain reaction (PCR) primer sequences are disclosed are considered isolated, but nucleic acid sequences that exist in their native state within a native host are not isolated. Isolated nucleic acids may, but do not need to be substantially purified. For example, nucleic acids isolated in a cloning vector or expression vector may not be pure, as they may contain only a fraction of the material in the cell in which they exist. However, such nucleic acids are readily manipulated by standard techniques known to those skilled in the art and are therefore isolated as used herein. Where used herein with respect to proteins or peptides, the term “isolated” refers to proteins or peptides isolated from the natural environment or produced artificially (e.g., by chemical synthesis, recombinant DNA techniques, etc.).

[0023] Those skilled in the art will also understand that conservative amino acid substitutions can be performed to provide functionally equivalent variants or homologs of capsid proteins. In some respects, this disclosure encompasses sequence changes resulting in conservative amino acid substitutions. As used herein, a conservative amino acid substitution means an amino acid substitution that does not alter the relative charge or size properties of the protein being substituted. Variants can be prepared according to methods for modifying polypeptide sequences known to those skilled in the art, such as those found in references that compile such methods; for example, Molecular Cloning: A Laboratory Manual, J. Sambrook, et al., eds., Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989, or Current Protocols in Molecular Biology, FM Ausubel, et al., eds., John Wiley & Sons, Inc., New York. Conservative amino acid substitutions include substitutions made between amino acids within the following groups: (a) M, I, L, V; (b) F, Y, W; (c) K, R, H; (d) A, G; (e) S, T; (f) Q, N; and (g) E, D. Therefore, conservative amino acid substitutions can be made to the amino acid sequences of proteins and polypeptides disclosed herein. This disclosure relates in part to isolated nucleic acids (e.g., artificial or synthetic isolated nucleic acids) that include a region complementary to a target nucleotide sequence, such as a sequence from an rAAV vector or expression construct, or a sequence of mRNA transcribed from an expression construct. In some embodiments, the isolated nucleic acid is an antisense oligonucleotide (ASO).

[0024] Antisense oligonucleotides As used herein, the terms “antisense nucleic acid” or “ASO” refer to a nucleic acid that is sequence-complementary to a target sequence and is specifically hybridizable to the nucleic acid having the target sequence, for example, under stringent conditions. An antisense nucleic acid is specifically hybridizable if its binding to the target nucleic acid is sufficient to generate complementary-based pair formation between the antisense nucleic acid and the target nucleic acid, and if there is sufficient complementarity to avoid nonspecific binding of the antisense nucleic acid to non-target nucleic acids under conditions where specific binding is desired, such as physiological conditions in the case of in vivo assays or therapeutic procedures, and under the conditions under which the assay is performed in the case of in vitro assays. An ASO may include one or more DNA nucleic acid bases, one or more RNA nucleic acid bases, or a combination of DNA nucleic acid bases and RNA nucleic acid bases.

[0025] Complementarity refers to the ability of two nucleotides to form precise pairs. For example, if a nucleotide at a specific position in an antisense nucleic acid can form a hydrogen bond with a nucleotide at a corresponding position in a target nucleic acid (e.g., a target nucleic acid sequence), then the antisense nucleic acid and the target nucleic acid are considered complementary at that position. Antisense nucleic acids and target nucleic acids are complementary if a sufficient number of corresponding positions within each molecule are occupied by nucleotides that can form hydrogen bonds with each other via bases. Therefore, "complementary" is a term used to indicate a sufficient degree of complementarity or precise pairing that results in a stable and specific bond between the antisense nucleic acid and the target nucleic acid. However, it should be understood that 100% complementarity is not required. For example, in some embodiments, antisense nucleic acids (e.g., oligonucleotides such as ASOs) may be at least 80% complementary to the consecutive nucleotides of the target nucleic acid sequence (e.g., at least 85%, 90%, 91%, 92%, 93%, 940%, 95%, 96%, 97%, 98%, 99%, or 100% complementary).

[0026] In some embodiments, an antisense nucleic acid (ASO) is used, wherein the ASO has a complementary region that is perfectly complementary (e.g., 100% complementary) to a portion of a target nucleic acid (e.g., the target sequence of an rAAV vector, the target sequence of an expression construct, the mRNA sequence transcribed from an expression construct). In some embodiments, an antisense nucleic acid oligonucleotide includes a complementary region complementary to the sequence described in any one of SEQ ID NOs: 1, 9, 25, 40, 51, and 80. The complementary region of the antisense nucleic acid may be complementary to at least three, at least four, at least five, at least six, for example, at least seven, at least eight, at least nine, at least ten, at least fifteen, at least sixteen, at least seven, at least nineteen, at least tenteen, at least fifteen Furthermore, to minimize the possibility of off-target effects, ASOs may be designed to ensure that they do not contain sequences complementary to off-target nucleic acids (e.g., five or more consecutive nucleotides).

[0027] However, it should be understood that in some embodiments, antisense nucleic acids having less than 100% sequence complementarity with the target nucleic acid may be used. Therefore, in the art, it is understood that a complementary nucleotide sequence does not need to be 100% complementary to its target nucleotide sequence in order to be specifically hybridizable. For example, in some embodiments, an isolated nucleic acid contains at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mismatches with its target sequence. In some embodiments, a complementary nucleic acid sequence for the purposes of this disclosure is specifically hybridizable if the binding of the sequence to the target nucleic acid produces a desired change in gene expression (e.g., increased gene expression or increased translation, or decreased gene expression or decreased translation), and if there is sufficient complementarity to avoid nonspecific binding to non-target nucleic acids under conditions where avoidance of nonspecific binding is desirable, such as physiological conditions in the case of in vivo assays or therapeutic treatments, and under conditions in the case of in vitro assays where the assay is performed under appropriate stringency conditions.

[0028] Sequence identity, including the determination of sequence complementarity of nucleic acid sequences, can be determined by sequence comparison and alignment algorithms known in the art. To determine the identity percentage of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (for example, gaps can be introduced into the first or second sequence for optimal alignment). Then, nucleotides at corresponding nucleotide positions are compared. If a position in the first sequence is occupied by the same residue as the corresponding position in the second sequence, the molecules are identical at that position. In some embodiments, the identity percentage between two sequences is a function of the number of identical positions shared by the sequences (e.g., homology % = number of identical positions / total number of positions × 100), and optionally, a penalty is imposed on the score for the number and / or length of introduced gaps.

[0029] In some embodiments, the oligonucleotides of this disclosure (e.g., ASOs) are in the range of 5–40 nucleotides, 5–30 nucleotides, 10–30 nucleotides, 10–25 nucleotides, or 15–25 nucleotides in length. In some embodiments of this disclosure, the length of the oligonucleotide is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 or more. In some embodiments, the oligonucleotide includes a complementary region that is complementary to a region within 5, 10, 15, 25 or more nucleotides of the rAAV vector sequence, expression cassette sequence, or mRNA sequence transcribed from the expression cassette or rAAV vector described herein. In some embodiments, antisense nucleic acids (e.g., oligonucleotides) are provided in homogeneous preparations in which, for example, at least 85%, at least 90%, at least 95%, or at least 99% of the oligonucleotides are identical. In some embodiments, the compositions described herein are heterogeneous with respect to the ASO (for example, the composition may contain two, three, four, five, six, seven, or more different sequences of the ASO).

[0030] The antisense nucleic acids of this disclosure may be modified to achieve one or more desired properties, such as improved cellular uptake, improved stability, reduced immunogenicity, improved potency, improved targeted hybridization, and sensitivity to RNAse cleavage. Antisense nucleic acids may be modified in the base moiety, sugar moiety, and / or phosphate backbone. Therefore, antisense nucleic acids may have one or more modified nucleotides (e.g., nucleotide analogs) and / or one or more backbone modifications (e.g., modified internucleotide bonds). Antisense nucleic acids may have combinations of modified and unmodified nucleotides. Antisense nucleic acids may also have combinations of modified and unmodified internucleotide bonds. Antisense nucleic acids may also consist only of modified nucleotides and / or modified internucleotide bonds.

[0031] Antisense nucleic acids may include ribonucleotides, deoxyribonucleotides, and combinations thereof. Examples of modified nucleotides that can be used in antisense nucleic acids include, for example: 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl)uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrolauracil, β-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, β-D-mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid(v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid(v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl)uracil, and 2,6-diaminopurine.

[0032] In some embodiments, the modified nucleotide is a 2'-modified nucleotide. For example, a 2'-modified nucleotide may be a 2'-deoxy, 2'-fluoro, 2'-O-methyl, 2'-O-methoxyethyl, 2'-amino, or 2'-aminoalkoxy modified nucleotide. In some embodiments, the 2'-modified nucleotide includes a 2'-O-4'-C methylene bridge, such as a locked nucleic acid (LNA) nucleotide. In some embodiments of the 2'-modified nucleotide, the 2'-hydroxyl group is linked to the 3' or 4' carbon atom of the sugar ring, thereby forming a bicyclic sugar moiety. In such embodiments, the bond is a methylene(-CH2-) bridge between the 2' oxygen atom and the 3' or 4' carbon atom. n It may be a base, and n is either 1 or 2. Antisense nucleic acids may include combinations of LNA nucleotides and unmodified nucleotides. Antisense nucleic acids may include combinations of LNA nucleotides and RNA nucleotides. Antisense nucleic acids may include combinations of LNA nucleotides and DNA nucleotides. A more preferred oligonucleotide modification is locked nucleic acid (LNA) in which a 2'-hydroxyl group is linked to the 3' or 4' carbon atom of a sugar ring, thereby forming a bicyclic sugar moiety.

[0033] Antisense nucleic acids may also include nucleic acid base-modified nucleotides, such as nucleotides containing nucleic acid bases that do not naturally exist in place of naturally occurring nucleic acid bases. For example, base modification can block the activity of adenosine deaminase. Suitable examples of modified nucleic acid bases include, but are not limited to, uridine and / or cytidine modified at position 5, e.g., 5-(2-amino)propyluridine, 5-bromouridine; adenosine and / or guanosine modified at position 8, e.g., 8-bromoguanosine; deazanucleotides, e.g., 7-deaza-adenosine; and O- and N-alkylated nucleotides, e.g., N6-methyladenosine. Note that combinations of the above modifications may also be used. Within the antisense nucleic acids (e.g., oligonucleotides) of this disclosure, modifications can range from at least one nucleotide to the entire nucleotide spectrum. For example, an oligonucleotide (e.g., an oligonucleotide of length 20 nucleotides) may contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 modified nucleotides. In some embodiments, the modified oligonucleotide will contain the minimum number of modified nucleotides necessary to achieve a desired level of in vivo stability and / or bioaccessibility or other desired properties.

[0034] Certain antisense nucleic acids may include nonionic DNA analogs, such as alkyl phosphates and aryl phosphates (where the charged phosphonate oxygen is substituted with an alkyl or aryl group), phosphodiesters and alkylphosphotriesters in which the charged oxygen moiety is alkylated. Nucleic acids containing diols such as tetraethylene glycol or hexaethylene glycol at one or both ends have also been shown to be substantially resistant to nuclease degradation and can be used herein. In some embodiments, antisense nucleic acids may include at least one lipophilic substituted nucleotide analog and / or pyrimidine-purine dinucleotide. In some embodiments, antisense nucleic acids (e.g., oligonucleotides) may have one or two accessible 5' ends. For example, modified oligonucleotides having two such 5' ends can be produced by attaching two oligonucleotides via a 3'-3' bond to generate oligonucleotides having one or two accessible 5' ends. The 3'-3' bond may be a phosphodiester, phosphorothioate, or other modified nucleoside crosslink. Furthermore, 3'-3' bond oligonucleotides where the bond between the 3' terminal nucleosides is not a phosphodiester, phosphorothioate, or other modified crosslink can be prepared using additional spacers such as tri- or tetraethylene glycol phosphate moieties.

[0035] The phosphodiester nucleotide bonds of antisense nucleic acids can be replaced with modifying bonds. These modifying bonds can be selected from, for example, phosphorothioate, phosphorodithioate, NR1R2-phosphoramidate, boranophosphate, α-hydroxybenzylphosphonate, phosphate-(C1~C21)-O-alkyl ester, phosphate-[(C6~C12)aryl-(C1~C21)-O-alkyl] ester, (C1~C8)alkylphosphonate and / or (C6~C12)arylphosphonate bridge, and (C7~C12)-α-hydroxymethyl-aryl. Peptide nucleic acid molecules can be generated by modifying the phosphate backbone of antisense nucleic acids. As used herein, the terms “peptide nucleic acid” or “PNA” refer to nucleic acid mimes, such as DNA mimes, in which the deoxyribose phosphate backbone is replaced by a pseudopeptide backbone and only four native nucleic acid bases are retained. The neutral backbone of PNA has been shown to enable specific hybridization to DNA and RNA under low ionic strength conditions. The synthesis of PNA oligomers can be carried out, for example, using standard solid-phase peptide synthesis protocols.

[0036] Antisense nucleic acids can also be formulated as morpholino oligonucleotides. In this embodiment, the riboside portion of each subunit of the oligonucleotide in the oligonucleotide reagent is converted to the morpholine portion. The morpholino can also be modified, for example, as peptide-bonded morpholino. In other embodiments, antisense nucleic acids (e.g., oligonucleotides) can be linked to functional groups such as peptides (e.g., to target host cell receptors in vivo) or to agents that facilitate transport across the cell membrane or blood-brain barrier. The oligonucleotide reagents of this disclosure may be modified with chemical moieties (e.g., cholesterol) that improve the in vivo pharmacological properties of the oligonucleotide reagent.

[0037] Aspects of this disclosure relate to ASOs having a “gapmer” structure. In this specification, “gapmer” means a chimeric nucleic acid sequence containing DNA bases and RNA bases, hereinafter: (modified RNA nucleic acid bases) N -(unmodified DNA nucleic acid bases) A -(modified RNA nucleic acid base) N This refers to an arrangement such as , where each "N" is an integer from 1 to 20 and "A" is an integer from 2 to 10. Examples of ASOs having a "gapmer" structure include: an ASO with a "5-10-5" structure containing five ribonucleotides (starting from the 5' end) with 2'-O-methoxyethyl modification, followed by 10 deoxynucleotides, followed by five ribonucleotides with 2'-O-methoxyethyl modification, all of which have phosphorothioate internucleotide bonds. In some embodiments, the cytidine nucleotides of the gapmer may be methylated. In some embodiments, the uridine nucleotides of the gapmer may be methylated. In some embodiments, the gapmer structure contains 15 nucleotides in which LNA-type nucleotides and deoxy-type nucleotides alternate, all of which have phosphorothioate internucleotide bonds. In some embodiments, the two central nucleotides of the gapmer are deoxynucleotides. In some embodiments, isolated nucleic acids having any one of the sequences described in SEQ ID NOs: 2-8, 10-24, 26-39, 41-50, 52-79, and 81-90 contain a “gapmer” structure (those skilled in the art will recognize that in any of the nucleic acid sequences described herein, one or more “T”DNA nucleic acid bases may be substituted by “U”RNA nuclei or vice versa to generate an ASO having a gapmer structure).

[0038] Nucleic acids targeting AAV ITR Aspects of this disclosure relate to methods for regulating transgene expression (e.g., transgene expression mediated by an rAAV vector or expression cassette), wherein the method involves contacting a cell configured to express a transgene with one or more isolated nucleic acids (e.g., 1, 2, 3, 4, 5, or more) that bind to AAV reverse terminal repeats (ITRs) (e.g., nucleic acid sequences encoding AAV ITRs). In some embodiments, binding of the isolated nucleic acids described herein to AAV ITR sequences increases the expression of an ITR-containing rAAV vector or increases the transduction efficiency of an ITR-containing rAAV vector. The isolated nucleic acid may specifically bind to the 5'ITR, 3'ITR, or both the 5'ITR and 3'ITR of the rAAV vector. In some embodiments, the isolated nucleic acid binds to (e.g., hybridizes with) the AAV2 ITR. In some embodiments, the AAV2 ITR contains or consists of the sequence described in SEQ ID NO: 1. In some embodiments, the isolated nucleic acid specifically binds to (e.g., hybridizes with) at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides of the AAV2 ITR (e.g., having the sequence described in SEQ ID NO: 1). In some embodiments, the isolated nucleic acid contains or consists of the nucleic acid sequence described in any one of SEQ ID NOs: 2-8.

[0039] The regulation (e.g., increase or decrease) of transgene expression caused by the binding of one or more isolated nucleic acids (e.g., ASO) to the AAV ITR may be altered. In some embodiments, the binding of one or more isolated nucleic acids (e.g., ASO) to the AAV ITR results in an increase of approximately 1%, 5%, 10%, 20%, 50%, 100%, 500%, 1000%, or more in transgene expression compared to transgene expression of an rAAV vector that has not been in contact with one or more isolated nucleic acids. In some embodiments, the binding of one or more isolated nucleic acids (e.g., ASO) to the AAV ITR results in an increase in transduction efficiency of approximately 1%, 5%, 10%, 20%, 50%, 100%, 500%, 1000%, or more compared to transgene expression of an rAAV vector that has not been in contact with one or more isolated nucleic acids. In some embodiments, binding of one or more isolated nucleic acids (e.g., ASO) to an AAV ITR results in a reduction of approximately 1%, 5%, 10%, 20%, 50%, 100%, 500%, or 1000% of transgene expression compared to transgene expression in an rAAV vector that is not in contact with one or more isolated nucleic acids.

[0040] Nucleic acids that target transcriptional regulator regions Aspects of this disclosure relate to methods for regulating transgene expression (e.g., transgene expression mediated by an rAAV vector or expression cassette), wherein a cell configured to express a transgene is brought into contact with one or more isolated nucleic acids (e.g., 1, 2, 3, 4, 5, or more) bound to a transcriptional regulatory region sequence (e.g., a nucleic acid sequence encoding one or more transcriptional regulators). Examples of transcriptional regulatory region sequences include promoter sequences, enhancer sequences, repressor sequences, and Kozak sequences. In some embodiments, the transcriptional regulatory region sequence includes a promoter sequence. In some embodiments, the transcriptional regulatory region sequence includes an enhancer sequence. In some embodiments, binding of the isolated nucleic acids described herein to the transcriptional regulator sequence increases the expression of the rAAV vector or decreases the transduction efficiency of the rAAV vector.

[0041] The isolated nucleic acid may specifically bind to the promoter sequence of the rAAV vector. The promoter sequence may be a constitutive promoter sequence, an inducible promoter sequence, a tissue-specific promoter sequence, or a native promoter sequence. In some embodiments, the isolated nucleic acid binds (e.g., hybridizes) to the chicken β-actin (CBA) promoter sequence. In some embodiments, the CBA promoter sequence includes or consists of the sequence described in SEQ ID NO: 9. In some embodiments, the isolated nucleic acid specifically binds (e.g., hybridizes) to at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides of the CBA promoter sequence (e.g., having the sequence described in SEQ ID NO: 9). In some embodiments, the isolated nucleic acid includes or consists of the nucleic acid sequence described in any one of SEQ ID NOs: 10-24.

[0042] The isolated nucleic acid may specifically bind to the enhancer sequence of the rAAV vector. In some embodiments, the isolated nucleic acid binds (e.g., hybridizes) to the cytomegalovirus (CMV) enhancer sequence. In some embodiments, the CMV enhancer sequence includes or comprises the sequence described in SEQ ID NO: 25. In some embodiments, the isolated nucleic acid specifically binds (e.g., hybridizes) to at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides of the CMV promoter sequence (e.g., having the sequence described in SEQ ID NO: 25). In some embodiments, the isolated nucleic acid includes or comprises the nucleic acid sequence described in any one of SEQ ID NOs: 26-39. The regulation (e.g., increase or decrease) of transgene expression caused by the binding of one or more isolated nucleic acids (e.g., ASOs) to the transcriptional regulatory region sequence may be altered. In some embodiments, the binding of one or more isolated nucleic acids (e.g., ASOs) to the transcriptional regulatory region sequence results in an increase of approximately 1%, 5%, 10%, 20%, 50%, 100%, 500%, 1000%, or more in transgene expression compared to the transgene expression of an rAAV vector that is not in contact with one or more isolated nucleic acids. In some embodiments, the binding of one or more isolated nucleic acids (e.g., ASOs) to the transcriptional regulatory region sequence results in a decrease of approximately 1%, 5%, 10%, 20%, 50%, 100%, 500%, or 1000% in transgene expression compared to the transgene expression of an rAAV vector that is not in contact with one or more isolated nucleic acids.

[0043] Nucleic acids targeting coding sequences Aspects of this disclosure relate to methods for regulating transgene expression (e.g., transgene expression mediated by an rAAV vector or expression cassette), wherein the method involves contacting cells configured to express a transgene with one or more isolated nucleic acids (e.g., 1, 2, 3, 4, 5, or more) that bind to a protein-coding region (e.g., DNA or mRNA sequence) encoding one or more therapeutic genes (e.g., PD-related genes), such therapeutic genes being, for example, Gcase (e.g., the gene product of the GBA1 gene) or a portion thereof, progranulin (e.g., the gene product of the PGRN gene) or a portion thereof, prosaposin (e.g., the gene product of the PSAP gene) or a portion thereof, a trigger receptor expressed on bone marrow cells (e.g., the gene product of the TREM2 gene) or a portion thereof, apolipoprotein (e.g., the gene product of the APOE gene), C9Orf72 protein (e.g., the gene product of the C9Orf72 gene) or a portion thereof. In some embodiments, the gene product is encoded by a naturally occurring gene coding portion (e.g., cDNA). In some embodiments, the coding region encodes a protein fragment of a naturally occurring gene. The protein fragment may contain about 50%, 60%, 70%, 80%, 90%, or 99% of the naturally occurring protein. In some embodiments, the protein fragment contains 50% to 99.9% (e.g., any value between 50% and 99.9%) of the naturally occurring protein. In some embodiments, binding of the isolated nucleic acid described herein to a transcription factor sequence reduces protein expression from the rAAV vector.

[0044] The isolated nucleic acid may specifically bind to the protein-coding region of an rAAV vector (e.g., mRNA transcribed from an rAAV vector). In some embodiments, the isolated nucleic acid binds (e.g., hybridizes) to the protein-coding region (e.g., DNA or mRNA sequence) encoding any one of the aforementioned transgenes, or its gene product, or the codon-optimized region of the transgene, or the codon-optimized region of the gene product. In some embodiments, the isolated nucleic acid binds (e.g., hybridizes) to the protein-coding region (e.g., hybridizes) encoding β-glucocerebrosidase or GBA. β-glucocerebrosidase, also known as GBA, refers to a lysosomal protein that cleaves the β-glucosidic bond of chemical glucocerebrosides, intermediates in glycolipid metabolism. In humans, Gcase is encoded by the GBA1 gene located on chromosome 1. In some embodiments, GBA1 encodes a peptide represented by the NCBI reference sequence NP_000148.2.

[0045] In some embodiments, the isolated nucleic acid specifically binds to a codon-optimized nucleic acid sequence encoding the GBA protein (e.g., codon-optimized for expression in mammalian cells, e.g., human cells), such as the sequence described in SEQ ID NO: 40. In some embodiments, the isolated nucleic acid specifically binds (e.g., hybridizes) to at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides of the GBA protein coding sequence (e.g., having the sequence described in SEQ ID NO: 40). In some embodiments, the isolated nucleic acid contains or consists of the nucleic acid sequences described in any one of SEQ ID NOs: 41-50 or any one of SEQ ID NOs: 91-95. In some embodiments, isolated nucleic acids that specifically bind to a protein-coding region (e.g., nucleic acid sequences encoding a GBA protein, such as mRNA sequences encoding a GBA protein) include a gapmer structure. In some embodiments, isolated nucleic acids having a gapmer structure include at least three consecutive nucleotides of the sequence described in any one of SEQ ID NOs: 41-50, any one of SEQ ID NOs: 91-95, or any one of SEQ ID NOs: 106-110.

[0046] The regulation (e.g., increase or decrease) of transgene expression caused by the binding of one or more isolated nucleic acids (e.g., ASOs) to a protein-coding sequence may be altered. In some embodiments, the binding of one or more isolated nucleic acids (e.g., ASOs) to a transcriptional regulatory region sequence results in an increase of approximately 1%, 5%, 10%, 20%, 50%, 100%, 500%, 1000%, or more in transgene expression compared to transgene expression of an rAAV vector that is not in contact with one or more isolated nucleic acids. In some embodiments, the binding of one or more isolated nucleic acids (e.g., ASOs) to a protein-coding sequence results in a decrease of approximately 1%, 5%, 10%, 20%, 50%, 100%, 500%, or 1000% in transgene expression compared to transgene expression of an rAAV vector that is not in contact with one or more isolated nucleic acids.

[0047] Nucleic acids that target post-transcriptional regulatory elements Aspects of this disclosure relate to methods for regulating transgene expression (e.g., transgene expression mediated by an rAAV vector or expression cassette), wherein a cell configured to express a transgene is brought into contact with one or more isolated nucleic acids (e.g., 1, 2, 3, 4, 5, or more) that bind to a post-transcriptional regulatory element sequence (e.g., a nucleic acid sequence such as mRNA containing a post-transcriptional regulatory element sequence). Examples of polyadenylated element sequences include hepatitis B virus (HPRE) and woodchuck hepatitis virus (WPRE). In some embodiments, the post-transcriptional regulatory element sequence is a woodchuck post-transcriptional regulatory element sequence (WPRE). In some embodiments, the binding of the isolated nucleic acids described herein to the post-transcriptional regulatory element sequence increases the expression of the rAAV vector or decreases the transduction efficiency of the rAAV vector.

[0048] The isolated nucleic acid may specifically bind to the WPRE of the rAAV vector. In some embodiments, the WPRE element sequence includes or consists of the sequence described in SEQ ID NO: 51. In some embodiments, the isolated nucleic acid specifically binds (e.g., hybridizes) to at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides of the WPRE sequence (e.g., having the sequence described in SEQ ID NO: 51). In some embodiments, the isolated nucleic acid includes or consists of the nucleic acid sequences described in any one of SEQ ID NOs. 52-79, any one of SEQ ID NOs. 96-100, or any one of SEQ ID NOs. 111-115. The regulation (e.g., increase or decrease) of transgene expression caused by the binding of one or more isolated nucleic acids (e.g., ASOs) to post-transcriptional regulatory element sequences (e.g., WPREs) may be altered. In some embodiments, the binding of one or more isolated nucleic acids (e.g., ASOs) to post-transcriptional regulatory element sequences results in an increase of approximately 1%, 5%, 10%, 20%, 50%, 100%, 500%, 1000%, or more transgene expression compared to the transgene expression of an rAAV vector that is not in contact with one or more isolated nucleic acids. In some embodiments, the binding of one or more isolated nucleic acids (e.g., ASOs) to post-transcriptional regulatory element sequences results in a decrease of approximately 1%, 5%, 10%, 20%, 50%, 100%, 500%, or 1000% transgene expression compared to the transgene expression of an rAAV vector that is not in contact with one or more isolated nucleic acids.

[0049] Nucleic acids that target polyadenylated elements Aspects of this disclosure relate to methods for regulating transgene expression (e.g., transgene expression mediated by an rAAV vector or expression cassette), wherein a cell configured to express a transgene is brought into contact with one or more isolated nucleic acids (e.g., 1, 2, 3, 4, 5, or more) that bind to a polyadenylated element sequence (e.g., a nucleic acid sequence such as DNA encoding a poly-A tail or mRNA containing a poly-U tail). Examples of polyadenylated element sequences include the SV40 polyadenylated element and the bovine growth hormone (BGH) polyadenylated element. In some embodiments, the polyadenylated element is the BGH poly-A element. In some embodiments, binding of the isolated nucleic acids described herein to the transcription factor sequence increases the expression of the rAAV vector or decreases the transduction efficiency of the rAAV vector. The isolated nucleic acid may specifically bind to the BGH poly-A element of the rAAV vector. In some embodiments, the BGH polyadenylated element sequence includes or comprises the sequence described in SEQ ID NO: 80. In some embodiments, the isolated nucleic acid specifically binds (e.g., hybridizes) to at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides of the BGH polyadenylated element sequence (e.g., having the sequence described in SEQ ID NO: 80). In some embodiments, the isolated nucleic acid includes or comprises the nucleic acid sequences described in any one of SEQ ID NOs: 81-90 or any one of SEQ ID NOs: 101-104.

[0050] In some embodiments, isolated nucleic acids that specifically bind to polyadenylated element sequences (e.g., nucleic acid sequences encoding BGH polyadenylated elements, such as mRNA sequences encoding BGH polyadenylated elements) include a gapmer structure. In some embodiments, isolated nucleic acids having a gapmer structure include at least three consecutive nucleotides of the sequence described in any one of SEQ ID NOs: 81-90, any one of SEQ ID NOs: 101-104, or any one of SEQ ID NOs: 116-120. The regulation (e.g., increase or decrease) of transgene expression caused by the binding of one or more isolated nucleic acids (e.g., ASO) to a BGH polyadenylated element sequence may vary. In some embodiments, the binding of one or more isolated nucleic acids (e.g., ASO) to a BGH polyadenylated element sequence results in an increase of approximately 1%, 5%, 10%, 20%, 50%, 100%, 500%, 1000%, or more in transgene expression compared to transgene expression in an rAAV vector that is not in contact with one or more isolated nucleic acids. In some embodiments, the binding of one or more isolated nucleic acids (e.g., ASO) to a BGH polyadenylated element sequence results in a decrease of approximately 1%, 5%, 10%, 20%, 50%, 100%, 500%, or 1000% in transgene expression compared to transgene expression in an rAAV vector that is not in contact with one or more isolated nucleic acids.

[0051] Pharmaceutical composition In some respects, this disclosure provides pharmaceutical compositions comprising isolated nucleic acids or rAAVs described herein and pharmaceutically acceptable carriers. As used herein, the term “pharmaceutically acceptable” means a material, such as a carrier or diluent, that does not negate the biological activity or properties of a compound and is relatively non-toxic, such that the material can be administered to an individual without causing undesirable biological effects or interacting in a harmful manner with any component of the composition containing it. As used herein, the term “pharmaceutically acceptable carrier” means a pharmaceutically acceptable material, composition, or carrier, such as a liquid or solid filler, stabilizer, dispersant, suspending agent, diluent, excipient, thickener, solvent, or encapsulating material, relating to the delivery or transport of a compound useful in the present invention into or to a patient so that it can perform its intended function. Further components that may be included in the pharmaceutical compositions used in the practice of the present invention are known in the art and are described, for example, in Remington's Pharmaceutical Sciences (Genaro, Ed., Mack Publishing Co., 1985, Easton, PA); which is incorporated herein by reference.

[0052] The compositions provided herein (e.g., pharmaceutical compositions) may be administered by any route, including: enteral (e.g., oral), parenteral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, subcutaneous, intraventricular, percutaneous, intradermal, rectal, vaginal, intraperitoneal, topical (by powder, ointment, cream, and / or drops), mucosal, nasal, buccal, sublingual; intratracheal infusion, bronchial infusion, and / or inhalation; and / or as oral spray, nasal spray, and / or aerosol. Specifically intended routes include oral administration, intravenous administration (e.g., systemic intravenous injection), topical administration by blood and / or lymphatic supply, and / or direct administration to the site of the disease. Generally, the most appropriate route of administration will depend on various factors, such as the properties of the drug (e.g., its stability in the gastrointestinal environment) and / or the condition of the subject (e.g., whether the subject can tolerate oral administration). In one embodiment, the compounds or pharmaceutical compositions described herein are suitable for topical administration to the eye of a target.

[0053] rAAV vectors and rAAV The isolated nucleic acids described herein may exist on their own or as part of a vector. Generally, vectors are plasmids, cosmids, phagemids, bacterial artificial chromosomes (BACs), or viral vectors (e.g., adenovirus vectors, adeno-associated virus (AAV) vectors, retroviral vectors, baculovirus vectors, etc.). In some embodiments, the vector is a plasmid (e.g., a plasmid containing the isolated nucleic acids described herein). In some embodiments, the rAAV vector is single-stranded (e.g., single-stranded DNA). In some embodiments, the vector is a recombinant AAV (rAAV) vector. In some embodiments, the vector is a baculovirus vector (e.g., Autographa californica nuclear polyhedron disease (AcNPV) vector). Typically, an rAAV vector (e.g., an rAAV genome) contains a transgene (for example, an expression construct containing one or more of the following: promoter, intron, enhancer sequence, protein-coding sequence, inhibitory RNA-coding sequence, poly-A tail sequence, etc.) positioned alongside two AAV reverse terminal repeat (ITR) sequences. In some embodiments, the transgene of an rAAV vector contains the isolated nucleic acid described herein. In some embodiments, each of the two ITR sequences in an rAAV vector is a full-length ITR (e.g., approximately 145 bp in length and containing a functional Rep-binding site (RBS) and terminal degradation sites (trs)). In some embodiments, one of the ITRs in an rAAV vector is cleaved (e.g., shortened or not full-length). In some embodiments, the cleaved ITR lacks a functional terminal degradation site (trs) and is used for the creation of a self-complementary AAV vector (scAAV vector). In some embodiments, the cleavage-type ITR is, for example, the ΔITR described by McCarty et al. (2003) Gene Ther. 10(26):2112-8.

[0054] In some aspects, this disclosure relates to recombinant AAV (rAAV) including transgenes encoding nucleic acids described herein (e.g., rAAV vectors described herein). The term “rAAV” generally refers to a viral particle comprising an rAAV vector capsidized by one or more AAV capsid proteins. The rAAV described herein may include capsid proteins having serotypes selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, and AAV10. In some embodiments, the rAAV includes capsid proteins derived from a non-human host, such as rhesus monkey AAV capsid proteins such as AAVrh.10 and AAVrh.39. In some embodiments, the rAAV described herein comprises a capsid protein that is a variant of the wild-type capsid protein, which is a capsid protein variant that, for example, contains at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 (e.g., 15, 20, 25, 50, 100, etc.) amino acid substitutions (e.g., mutations) relative to the wild-type AAV capsid protein from which it is derived. In some embodiments, the AAV capsid protein variant is, for example, the AAV1RX capsid protein described in Albright et al. Mol Ther. 2018 Feb 7;26(2):510-523. In some embodiments, the capsid protein variant is, for example, the AAV TM6 capsid protein described in Rosario et al. Mol Ther Methods Clin Dev. 2016; 3: 16026.

[0055] In some embodiments, the rAAVs described herein spread readily through the CNS, particularly when introduced into the CSF space or directly into the brain parenchyma. Therefore, in some embodiments, the rAAVs described herein comprise a capsid protein capable of crossing the blood-brain barrier (BBB). For example, in some embodiments, the rAAV comprises a capsid protein having the AAV9 or AAVrh.10 serotype. The production of rAAVs is described, for example, in Samulski et al. (1989) J Virol. 63(9):3822-8 and Wright (2009) Hum Gene Ther. 20(7):698-706. In some embodiments, the rAAV comprises a capsid protein that specifically or preferentially targets bone marrow cells, such as microglia cells. In some embodiments, the rAAV described herein (e.g., comprising a recombinant rAAV genome capsidized by an AAV capsid protein to form rAAV capsid particles) is generated in a baculovirus vector expression system (BEVS). Generation of rAAV using BEVS is described, for example, in: Urabe et al. (2002) Hum Gene Ther 13(16):1935-43, Smith et al. (2009) Mol Ther 17(11):1888-1896, U.S. Patent No. 8,945,918, U.S. Patent No. 9,879,282, and International PCT Publication WO 2017 / 184879. However, rAAV may be generated using any suitable method (e.g., using recombinant rep and cap genes).

[0056] Regulation of gene expression Aspects of this disclosure relate to compositions and methods for positively or negatively modulating the expression of gene therapy drugs (e.g., therapeutic proteins expressed from AAV vectors), through the use of antisense oligonucleotides (ASOs) that specifically bind (e.g., hybridize) to one or more of the following: the use of specific nucleic acids, e.g., viral vector regions (e.g., AAV ITRs), DNA or RNA regulatory elements (e.g., promoter sequences, enhancer sequences, post-transcriptional regulatory element sequences, etc.), and protein-coding sequences of mRNA transcribed from rAAV vectors. The isolated nucleic acids may be administered to cells or subjects simultaneously with or at different time points (e.g., before or after administration of the expression cassette or rAAV vector) to which they specifically bind. In some embodiments, rAAV is administered to a subject, and then one or more doses of the isolated nucleic acids (or multiple isolated nucleic acids) described herein are administered. In some embodiments, one or more isolated nucleic acids are administered to a subject based on the detection of transgene expression levels in cells or subjects prior to administration of the isolated nucleic acids.

[0057] In some embodiments, the rAAV vector is located within a cell, such as a host cell. The host cell may be a prokaryotic or eukaryotic cell. For example, the host cell may be a mammalian cell, a bacterial cell, a yeast cell, an insect cell, etc. In some embodiments, the host cell is a mammalian cell, e.g., a HEK293T cell. In some embodiments, the host cell is a bacterial cell, e.g., an E. coli cell. In some embodiments, the cell is in vitro. In some embodiments, the cell is located within a subject, e.g., a mammalian subject such as a human, mouse, dog, or cat. In some embodiments, one isolated nucleic acid that specifically binds to an rAAV vector or expression cassette is provided to a cell or subject. In some embodiments, one or more (e.g., two, three, four, five, or more) isolated nucleic acids are provided to a cell or subject. One or more different isolated nucleic acids (e.g., ASOs) may bind to the same region or sequence (e.g., two ASOs, each binding to an AAV ITR) or they may bind to different regions or sequences (e.g., a first ASO that specifically binds to an AAV ITR and a second ASO that binds to a post-transcriptional regulatory element sequence).

[0058] The delivery of one or more isolated nucleic acids described herein to a cell or subject results in, in some embodiments, a regulation (e.g., increase or decrease) of transgene expression caused by the binding of one or more isolated nucleic acids (e.g., ASOs) to the sequence of an rAAV vector or expression construct contained in the cell or subject. In some embodiments, the binding of one or more isolated nucleic acids (e.g., ASOs) to an rAAV vector or expression construct results in an increase of approximately 1%, 5%, 10%, 20%, 50%, 100%, 500%, 100%, or more of transgene expression compared to the transgene expression of an rAAV vector or expression construct that has not been in contact with one or more isolated nucleic acids. In some embodiments, the binding of one or more isolated nucleic acids (e.g., ASOs) to an rAAV vector or expression construct results in an increase of approximately 1%, 5%, 10%, 20%, 50%, 100%, 500%, 100%, or more in transgene expression compared to transgene expression of an rAAV vector or expression construct that is not in contact with one or more isolated nucleic acids. In some embodiments, the binding of one or more isolated nucleic acids (e.g., ASOs) to an rAAV vector or expression construct results in a decrease of approximately 1%, 5%, 10%, 20%, 50%, 100%, 500%, or 100% in transgene expression compared to transgene expression of an rAAV vector or expression construct that is not in contact with one or more isolated nucleic acids. In some embodiments, one or more isolated nucleic acids are delivered to cells simultaneously with transfecting cells with a plasmid containing an rAAV vector encoding a transgene. In some embodiments, one or more isolated nucleic acids are delivered to cells after transfecting the cells with a plasmid containing an rAAV vector encoding a transgene. In some embodiments, one or more isolated nucleic acids are delivered to cells 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 22, or 24 hours after transfecting the cells with a plasmid containing an rAAV vector encoding a transgene.In some embodiments, one or more isolated nucleic acids are delivered to cells 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 days after transfecting cells with a plasmid containing an rAAV vector encoding a transgene. In some embodiments, one or more isolated nucleic acids are delivered to cells 1, 2, 3, 4, 10, 15, 20, 26, or 52 weeks after transfecting cells with a plasmid containing an rAAV vector encoding a transgene. In some embodiments, one or more isolated nucleic acids are delivered to cells 1, 2, 3, or 5 years after transfecting cells with a plasmid containing an rAAV vector encoding a transgene.

[0059] Aspects of this disclosure relate to compositions for treating CNS-related diseases by modulating the expression of one or more CNS disease-related gene products in a subject. One or more CNS disease-related gene products may be encoded by one or more isolated nucleic acids or rAAV vectors. In some embodiments, the subject is administered a single vector (e.g., isolated nucleic acid, rAAV, etc.) encoding one or more (1, 2, 3, 4, 5, or more) gene products. In some embodiments, the subject is administered multiple (e.g., 2, 3, 4, 5, or more) vectors (e.g., isolated nucleic acids, rAAV, etc.), each vector encoding a different CNS disease-related gene product. CNS-related disorders can include neurodegenerative diseases, synucleinopathies, tauopathies, or lysosomal storage disorders. Examples of neurodegenerative diseases and their associated genes are shown in Table 1.

[0060] A "synucleinopathy" refers to a disease or disorder characterized by reduced expression or activity of α-synuclein (the gene product of SCNA) in a subject (e.g., compared to a healthy subject, e.g., a subject without a synucleinopathy). Examples of synucleinopathy and related genes are shown in Table 2. "Tauopathy" refers to a disease or disorder characterized by reduced expression or activity of tau protein in a subject (e.g., a healthy subject without tauopathy). Examples of tauopathy and related genes are shown in Table 3. "Lysosomal storage disorders" refer to diseases characterized by the abnormal accumulation of toxic cell products in the lysosomes of a particular group. Examples of lysosomal storage disorders and related genes are shown in Table 4.

[0061] [Table 1-1] [Table 1-2] [Table 2]

[0062] [Table 3]

[0063] [Table 4-1] [Table 4-2]

[0064] As used herein, “to treat” or “to treat” means (a) to prevent or delay the onset of a CNS disorder; (b) to reduce the severity of a CNS disorder; (c) to reduce or prevent the onset of symptoms characteristic of a CNS disorder; and / or (d) to prevent the exacerbation of symptoms characteristic of a CNS disorder in a subject. Symptoms of a CNS disorder may include, for example, motor impairment (e.g., tremors, rigidity, bradykinesia, difficulty walking, paralysis), cognitive impairment (e.g., dementia, depression, anxiety, psychosis), memory impairment, and emotional and behavioral impairments. The subjects are typically mammals, preferably humans. In some embodiments, the subjects are between 1 month and 10 years of age (e.g., 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 13 months, 14 months, 15 months, 16 months, 17 months, 18 months, 19 months, 20 months, 21 months, 22 months, 23 months, 24 months, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years, or any age in between). In some embodiments, the subjects are between 2 and 20 years of age. In some embodiments, the subjects are between 30 and 100 years of age. In some embodiments, the subjects are older than 55 years of age.

[0065] In some embodiments, the composition is administered directly to the target CNS, for example, by direct injection into the target brain and / or spinal cord. Examples of direct CNS administration methods include, but are not limited to, intracerebral injection, intraventricular injection, intracisional injection, intraparenchymal injection, intrathecal injection, and any combination thereof. In some embodiments, direct injection into the target CNS results in transgene expression (e.g., expression of the first gene product, the second gene product, and, if applicable, the third gene product) in the target midbrain, striatum, and / or cerebral cortex. In some embodiments, direct injection into the CNS results in transgene expression (e.g., expression of the first gene product, the second gene product, and, if applicable, the third gene product) in the target spinal cord and / or CSF. In some embodiments, direct injection into the target CNS includes convection-enhanced delivery (CED). Convection-enhanced delivery is a therapeutic strategy that involves surgical exposure of the brain and direct placement of a small-diameter catheter into a target region of the brain, followed by direct injection of a therapeutic agent (e.g., the compositions described herein or rAAV) into the target brain. CED is described, for example, in Devinski et al. (2009) Expert Rev Neurother. 9(10):1519-27.

[0066] In some embodiments, the composition is administered peripherally to the target, for example, by peripheral injection. Examples of peripheral injection include subcutaneous injection, intravenous injection, intra-arterial injection, intraperitoneal injection, or any combination thereof. In some embodiments, the peripheral injection is intra-arterial injection, for example, into the carotid artery of the target. In some embodiments, the compositions described herein (e.g., isolated nucleic acids or vectors or rAAV, and / or compositions comprising isolated nucleic acids as described herein) are administered both peripherally and directly to the CNS of the subject. For example, in some embodiments, the subject is administered the composition by intra-arterial injection (e.g., injection into the carotid artery) and intraparenchymal injection (e.g., intraparenchymal injection via CED). In some embodiments, direct injection into the CNS and peripheral injection occur simultaneously (e.g., at the same time). In some embodiments, direct injection is performed before peripheral injection (e.g., between 1 minute and 1 week, or earlier). In some embodiments, direct injection is performed after peripheral injection (e.g., between 1 minute and 1 week, or later).

[0067] In some embodiments, the subject is administered an immunosuppressant before (e.g., from one month to one minute before) or concurrently with the composition described herein. In some embodiments, the immunosuppressant is a corticosteroid (e.g., prednisone, budesonide, etc.), an mTOR inhibitor (e.g., sirolimus, everolimus, etc.), an antibody (e.g., adalimumab, etanercept, natalizumab, etc.), or methotrexate. The amount of the composition described herein (e.g., a composition containing isolated nucleic acids or vectors or rAAV) administered to a subject will vary depending on the method of administration. The compositions described herein (e.g., compositions comprising isolated nucleic acids or vectors or rAAV) may be administered to a subject once or multiple times (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, or more). In some embodiments, the composition may be administered to the subject continuously (e.g., chronically), for example, via an infusion pump. [Examples]

[0068] Examples 1-5: Cell-based assays of viral transduction into GBA-deficient cells GBA1-deficient cells can be obtained, for example, as fibroblasts, monocytes, or hES cells from GD patients, or as patient-derived induced pluripotent stem cells (iPSCs), or HEK293T cells. These cells accumulate substrates such as glucosylceramide and glucosylsphingosine (GlcCer and GlcSph). Treatment of wild-type or mutant cultured cell lines with Gcase inhibitors such as CBE is also used to obtain GBA-deficient cells. Cells are administered rAAV containing an AAV9 capsid protein encapsulating an rAAV vector containing the nucleic acid sequence described in SEQ ID NOs: 1, 9, 25, 40, 51, and 80 (e.g., PR001). Transduction efficiency and GBA expression levels are monitored intracellularly. One or more isolated nucleic acids targeting the PR001 vector (e.g., ASO) are administered to the cells. Therapeutic endpoints (e.g., reduction of PD-related pathology in in vivo assays) are measured in the context of transduction expression of the AAV vector to confirm and quantify the increase or decrease in PR001 activity and function. GBA expression is quantified using qRT-PCT, through Gcase level measurement using protein ELISA, or by a standard Gcase activity assay.

[0069] Example 1: The effect of ASO directed towards GBA HEK293T cells were transfected with a plasmid containing an rAAV vector encoding the GBA protein (e.g., PR001), and ASOs directed to the GBA coding portion of the rAAV vector (PR001) were administered. The levels and types of ASOs administered in the eight experimental groups were as follows: 20 nM GBA ASO1 modified (SEQ ID NO: 91), 100 nM GBA ASO1 modified (SEQ ID NO: 91), 20 nM GBA ASO2 modified (SEQ ID NO: 92), 100 nM GBA ASO2 modified (SEQ ID NO: 92), 20 nM GBA ASO3 modified (SEQ ID NO: 93), 100 nM GBA ASO3 modified (SEQ ID NO: 93), 20 nM GBA ASO4 modified (SEQ ID NO: 94), and 100 nM GBA ASO4 modified (SEQ ID NO: 94). Negative and positive control groups were also included in the experimental design. In the negative control group, cells were not transfected with a plasmid encoding GBA, nor were any ASOs administered. In the positive control group, cells were transfected with a plasmid encoding GBA expression, and 100 nM of GFP (green fluorescent protein)-directed ASO containing the nucleic acid sequence described in SEQ ID NO: 105 was administered. Cells were harvested after 72 hours, and GBA expression was quantified using qRT-PCR. All experimental groups showed a significant decrease in GBA expression compared to the positive control group (Figure 1).

[0070] Example 2: The effect of ASO directed towards WPRE HEK293T cells were transfected with a plasmid containing an rAAV vector encoding the GBA protein (e.g., PR001), and ASO targeted to the WPRE encoding portion of the rAAV vector (PR001) was administered. The levels and types of ASO administered in the 10 experimental groups were as follows: 20 nM WPRE ASO 1 modifier (SEQ ID NO: 96), 100 nM WPRE ASO 1 modifier (SEQ ID NO: 96), 20 nM WPRE ASO 2 modifier (SEQ ID NO: 97), 100 nM WPRE ASO 2 modifier (SEQ ID NO: 97), 20 nM WPRE ASO 3 modifier (SEQ ID NO: 98), 100 nM WPRE ASO 3 modifier (SEQ ID NO: 98), 20 nM WPRE ASO 4 modifier (SEQ ID NO: 99), 100 nM WPRE ASO 4 modifier (SEQ ID NO: 99), 20 nM WPRE ASO 5 modifier (SEQ ID NO: 100), and 100 nM WPRE ASO 5 modifier (SEQ ID NO: 100). Four control groups were also included in the experimental design: in the negative control group, cells were not transfected with a GBA-encoding plasmid and were not administered any ASO; in the positive control group, cells were transfected with a GBA-encoding plasmid and administered 100 nM GFP-directed ASO (SEQ ID NO: 105); in two groups, cells were transfected with a GBA-encoding plasmid and administered 20 nM GBA ASO 1 modifier (SEQ ID NO: 91) and 100 nM GBA ASO 1 modifier (SEQ ID NO: 91), respectively. Cells were harvested after 72 hours, and GBA expression was quantified using qRT-PCR. Surprisingly, an increase in GBA expression compared to the positive control was observed in several experimental groups, particularly those administered 100 nM WPRE ASO 1 modifier (SEQ ID NO: 96), WPRE ASO 4 modifier (SEQ ID NO: 99), or WPRE ASO 5 modifier (SEQ ID NO: 100) (Figure 2).

[0071] Example 3: Effects of ASO directed towards bovine growth hormone polyadenylation elements (BGH polyA) HEK293T cells were transfected with a plasmid containing an rAAV vector encoding the GBA protein (e.g., PR001), and an ASO targeted to the BGH polyadenylated element (polyA) encoding portion of the rAAV vector (PR001) was administered. The levels and types of ASO administered in the eight experimental groups were as follows: 20 nM poly(A) ASO1 modified (SEQ ID NO: 101), 100 nM poly(A) ASO1 modified (SEQ ID NO: 101), 20 nM poly(A) ASO2 modified (SEQ ID NO: 102), 100 nM poly(A) ASO2 modified (SEQ ID NO: 102), 20 nM poly(A) ASO3 modified (SEQ ID NO: 103), 100 nM poly(A) ASO3 modified (SEQ ID NO: 103), 20 nM poly(A) ASO5 modified (SEQ ID NO: 104), and 100 nM poly(A) ASO5 modified (SEQ ID NO: 104). Four control groups were also included in the experimental design: in the negative control group, cells were not transfected with a GBA-encoding plasmid and were not administered any ASO; in the positive control group, cells were transfected with a GBA-encoding plasmid and administered 100 nM of GFP-directed ASO (SEQ ID NO: 105); in two groups, cells were transfected with a GBA-encoding plasmid and administered either 20 nM of GBA ASO1-modified (SEQ ID NO: 91) or 100 nM of GBA ASO1-modified (SEQ ID NO: 91), respectively. Cells were harvested after 72 hours, and GBA expression was quantified using qRT-PCR. Surprisingly, all experimental groups showed comparable or significantly increased GBA expression compared to the positive control. Notably, a 20-fold increase in GBA expression compared to the positive control was observed in cells administered 100 nM of poly(A) ASO2-modified (SEQ ID NO: 102) (Figure 3).

[0072] Example 4: Effect of poly(A) ASO2 modified compound (SEQ ID NO: 102) on Trem2 expression HEK293T cells were transfected with a plasmid containing an rAAV vector encoding the Trem2 protein, and administered with either 20 nM or 100 nM of polyAASO2-modified protein (sequence number 102). Two control groups were also included in the design: in the negative control group, cells were not transfected with the Trem2-encoding plasmid and were not administered any ASO; in the positive control group, cells were transfected with a plasmid encoding Trem2 expression and administered with 100 nM of GFP-directed ASO (sequence number 105). Cells were harvested after 72 hours, and Trem2 expression was quantified using qRT-PCR. Both experimental groups showed a significant increase in Trem2 expression compared to the positive control. Notably, cells administered with 100 nM of polyAASO2-modified protein (sequence number 102) showed a 13-fold increase in Trem2 expression compared to the positive control (Figure 4).

[0073] Example 5: Effect of ASO administration in sequential transfection HEK293T cells were transfected with a plasmid containing an rAAV vector encoding the GBA protein. After 3 hours, the plasmid transfection mixture was removed, and cells in four experimental groups were transfected with either 20 nM GBA ASO1 modified (SEQ ID NO: 91), 100 nM GBA ASO1 modified (SEQ ID NO: 91), 20 nM poly(A) ASO2 modified (SEQ ID NO: 102), or 100 nM modified poly(A) ASO2 (SEQ ID NO: 102). Two control groups were also included in the design: in the negative control group, cells were not transfected with a GBA-encoding plasmid and received no ASO; in the positive control group, cells were transfected with a plasmid encoding GBA expression and received 100 nM GFP-directed ASO (SEQ ID NO: 105). Cells were harvested after 72 hours, and GBA expression was quantified using qRT-PCR. Both experimental groups administered with the GBA ASO1 modifier (SEQ ID NO: 91) showed a significant decrease in GBA expression compared to the positive control. The group administered with 20 nM of the poly(A) ASO2 modifier (SEQ ID NO: 102) showed similar levels of GBA expression to the positive group. Cells administered with 100 nM of the poly(A) ASO2 modifier (SEQ ID NO: 102) showed the most significant changes, with GBA expression increasing 7-8 times compared to the positive control (Figure 5).

[0074] Example 6: in vivo assay In C57 / BL6J male mice, AAV expressing GBA (AAV-GBA) was introduced in 1 × 10⁻¹⁶ mice. 12 Intravenous infusions were administered at vg / kg or with an excipient control. Mice in the excipient group were then given a saline control, while mice given AAV-GBA received intravenous infusions of saline or ASO on days 7, 14, and 21 after AAV-GBA infusion, as detailed in Table 5. Plasma was collected by submandibular blood collection before AAV-GBA infusion and on days 7 and 21 after AAV-GBA infusion. Mice were euthanized 30 days after AAV infusion, and tissues were collected for analysis. [Table 5]

[0075] The results show that GBA ASO 1 and WPRE ASO 2 significantly reduced GBA mRNA levels in the liver, and poly(A) ASO 2 tended to reduce GBA mRNA in the liver (Figure 7). In vivo assays of AAV vectors are performed using mutant mice. Vehicle controls and AAV vectors (e.g., PR001) are used in 2 × 10⁻¹⁶ assays. 11 Intrathecal or intraventricular delivery (at a dose per mouse) is performed using enriched AAV stock, for example, in injection volumes of 5–10 μL. Intraparenchymal delivery is performed via convection-enhanced delivery. One or more isolated nucleic acids (e.g., ASOs) targeting the PR001 vector are administered to cells. Therapeutic endpoints (e.g., reduction of PD-related symptoms) are measured in the context of AAV vector transduction expression to confirm and quantify increases or decreases in PR001 activity and function. Endpoints measured include substrate accumulation in the CNS and CSF, accumulation of Gcase enzyme and enzyme activity by ELISA, motor and cognitive endpoints, lysosomal dysfunction, and accumulation of α-synuclein monomer, protofibril, or fibril.

[0076] array In some embodiments, the isolated nucleic acids described herein (e.g., ASOs) specifically bind (e.g., hybridize) to the sequences shown below, or their complements, or their reverse complements. In some embodiments, the isolated nucleic acids described herein (e.g., ASOs) include or consist of one of the sequences shown below, or its complement, its reverse complement, or its gapmer, or a modified version thereof including one or more chemical modifications, where one or more chemical modifications are selected from nucleic acid base modifications or backbone modifications. In some embodiments, all nucleic acid bases and / or the entire backbone of the ASO are modified. In some embodiments, the nucleic acid base modifications include 2'-O-methyl (2'OMe) modifications, and the backbone modifications include phosphorothioate bonds. In some embodiments, the ASO includes one or more locked nucleic acids (LNAs). In the sequences shown below, the letter "m" before a nucleic acid base letter indicates a 2'-O-methyl (2'OMe) modification, and the "*" between two nucleic acid bases indicates a phosphorothioate bond.

[0077] >AAV2 ITR nucleic acid sequence (SEQ ID NO: 1) cctgcaggcagctgcgcgctcgctcgctcactgaggccgcccggggcaaagcccgggcgtcgggcgacctttggtcgcccggcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcct >ITR ASO 1 (Sequence ID 2) Wicgcgcagctgcctgcagg >ITR ASO 2 (Sequence ID 3) cggcctcagtgagcgagcga >ITR ASO 3 (Sequence ID 4) acgcccgggctttgcccggg >ITR ASO 4 (Sequence ID 5) cgggcgaccaaaggtcgcccg

[0078] >ITR ASO 5 (Sequence ID 6) Wictcgctcgctcactgaggc >ITR ASO 6 (Sequence ID 7) tggccactccctctctgcgc >ITR ASO 7 (Sequence ID 8) aggaacccctagtgatggagt >CMV enhancer nucleic acid sequence (SEQ ID NO: 9) Cgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccact tggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatg

[0079] >CMV ASO 1 (Sequence ID 10) tttaccgtaagttatgtaacg >CMV ASO 2 (Sequence ID 11) ggcggtcagccaggcgggcca >CMV ASO 3 (Sequence ID 12) Gtcaatgggcgggggtcgttg >CMV ASO 4 (SEQ ID NO: 13) ggaacatacgtcattattgac >CMV ASO 5 (SEQ ID NO: 14) gtccctattggcgttactatg

[0080] >CMV ASO 6 (SEQ ID NO: 15) acccattgacgtcaatggaaa >CMV ASO 7 (Sequence ID 16) gcagtttaccgtaaatactcc >CMV ASO 8 (Sequence ID 17) acttgatgt actgccaagtgg >CMV ASO 9 (Sequence ID 18) ggcgt acttggcatatgatac >CMV ASO 10 (Sequence ID 19) ccgtcattgacgtcaataggg

[0081] >CMV ASO 11 (Sequence ID 20) taatgccaggcgggccattta >CMV ASO 12 (Sequence ID 21) cataaggtcatgtactgggca >CMV ASO 13 (Sequence ID 22) tactgccaagtaggaaagtcc >CMV ASO 14 (SEQ ID NO: 23) gcgatgactaatacgtagatg >CMV ASO 15 (SEQ ID NO: 24) ccatggtaatagcgatgac

[0082] >CBA promoter nucleic acid sequence (SEQ ID NO: 25) tcgaggtgagccccacgttctgcttcactctccccatctcccccccctccccaccccaattttgtatttatttatttttaattattttgtgcagcgatgggggcggggggggggggggcgcgcgccaggcggggc ggggcggggcgaggggcggggcggggcgaggcggagaggtgcggcggcagccaatcagagcggcgcgctccgaaagtttccttttatggcgaggcggcggcggcggcggccctataaaaagcgaagcgcgcggcgggcg >CB ASO 1 (Sequence ID 26) agaacgtggggctcacctcga >CB ASO 2 (Sequence ID 27) gggagatggggagagtgaagc >CB ASO 3 (Sequence ID 28) caaattgggggtggggaggggg

[0083] >CB ASO 4 (Sequence ID 29) attaaaaaataaataaataca >CB ASO 5 (Sequence ID 30) cccccatcgctgcacaaaata >CB ASO 6 (Sequence ID 31) cgcgccccccccccccccccg >CB ASO 7 (Sequence ID 32) cccgccccgccccgcctggcg >CB ASO 8 (Sequence ID 33) tcgccccgcccccccccctcgc

[0084] >CB ASO 9 (Sequence ID 34) ctgccgccgcacctctccgcc >CB ASO 10 (Sequence ID 35) ggagcgcgccgctctgattgg >CB ASO 11 (Sequence ID 36) tcgccataaaaggaaactttc >CB ASO 12 (Sequence ID 37) areggccgccgccgccgccgcc >CB ASO 13 (Sequence ID 38) gccgcgcgcttcgctttttat >CB ASO 14 (Sequence ID 39) agcgcgcagcgactcccgccc

[0085] >GBA codon-optimized nucleic acid sequence (SEQ ID NO: 40)

[0086] >GBA ASO 1 (Sequence ID 41) gcugcugaauuccaugguggc >GBA ASO 2 (Sequence ID 42) ggggcauuccucucugcuggg >GBA ASO 3 (Sequence ID 43) ugacacccggcucagaggcuu >GBA ASO 4 (Sequence ID 44) ugucagagauccggccaugau >GBA ASO 5 (Sequence ID 45) ggccugaagcagcagcagucc

[0087] >GBA ASO 6 (Sequence ID 46) agcgccagaagcccaagacac >GBA ASO 7 (Sequence ID 47) gcucuuggggaugcaaggucu >GBA ASO 8 (Sequence ID 48) cacgacgcugcuguagccgaa >GBA ASO 9 (Sequence ID 49) guagguggcauugcacacgca >GBA ASO 10 (Sequence ID 50) aggagggucgaagcugucgca

[0088] >WPRE nucleic acid sequence (sequence number 51) Aaucaaccucuggauuacaaaauuugugaaagauugacugguauucuuaacuauguugcuccuuuuacgcuauguggauacgcugcuuuaaugccuuuguaucaugcuauugcuucccguauggcuuucauuuucuccuccuuguauaaauccugguugcugucucuuuaugaggaguuguggcccguugucaggcaacguggcguggugugcacuguguuugcugacgcaacccccacugguuggggcauugccaccaccugucagcuccuuuccgggacuuucgcuuucccccucccuauugccacggcggaacucaucgccgccugccuugcccgcugcuggacaggggcucggcuguugggcacugacaauuccgugguguugucggggaaaucaucguccuuuccuuggcugcucgccuguguugccaccuggauucugcgcgggacguccuucugcuacgucccuucggcccucaauccagcggaccuuccuucccgcggccugcugccggcucugcggccucuuccgcgucuucgccuucgcccucagacgagucggaucucccuuugggccgccuccccgc

[0089] >WPRE ASO 1 (SEQ ID NO: 52) uuuguaauccagagguugauu >WPRE ASO 2 (SEQ ID NO: 53) accagucaaucuuucacaaau >WPRE ASO 3 (SEQ ID NO: 54) aggagcaacauaguuaagaau >WPRE ASO 4 (SEQ ID NO: 55) agcguauccacauagcguaaa >WPRE ASO 5 (SEQ ID NO: 56) augauacaaaggcauuaaagc

[0090] >WPRE ASO 6 (Sequence ID 57) agccauacgggaagcaauagc >WPRE ASO 7 (Sequence ID 58) auacaaggaggagaaaaugaa >WPRE ASO 8 (Sequence ID 59) aagagacagcaaccaggauuu >WPRE ASO 9 (Sequence ID 60) aacgggccacaacuccucaua >WPRE ASO 10 (Sequence ID 61) caccacgccacguugccugac

[0091] >WPRE ASO 11 (Sequence ID 62) ugcgucagcaaacacagugca >WPRE ASO 12 (Sequence ID 63) aaugccccaaccagugggggu >WPRE ASO 13 (Sequence ID 64) aaggagcugacaggugguggc >WPRE ASO 14 (SEQ ID NO: 65) ggggaaagcgaaagucccgga >WPRE ASO 15 (Sequence ID 66) uuccgccguggcaauagggag

[0092] >WPRE ASO 16 (Sequence ID 67) ggcaaggcaggcggcgaugag >WPRE ASO 17 (Sequence ID 68) ccgagccccuguccagcagcg >WPRE ASO 18 (Sequence ID 69) ggaauugucagugcccaacag >WPRE ASO 19 (Sequence ID 70) ugauuuccccgacaacaccac >WPRE ASO 20 (Sequence ID 71) gagcagccaaggaaaggacga

[0093] >WPRE ASO 21 (Sequence ID 72) aauccagguggcaacacaggc >WPRE ASO 22 (Sequence ID 73) gcagaaggacgucccgcgcag >WPRE ASO 23 (Sequence ID 74) auugagggccgaagggacgua >WPRE ASO 24 (Sequence ID 75) gcgggaaggaagguccgcugg >WPRE ASO 25 (Sequence ID 76) ccgcagagccggcagcaggcc

[0094] >WPRE ASO 26 (Sequence ID 77) aaggcgaagacgcggaagagg >WPRE ASO 27 (Sequence ID 78) gauccgacucgucugagggcg >WPRE ASO 28 (Sequence ID 79) cggggaggcggcccaaaggga >Bovine growth hormone polyadenylation additive (SEQ ID NO: 80) cugugccuucuaguugccagccaucuguuguuugccccucccgugccuuccuugacccuggaaggugccacucccacuguccuuuccuaauaaaaugaggaaauugcaucgcauugucugaguaggugucauucuauucuggggggugggguggggcaggacagcaagggggaggauugggaagacaauagcaggcaugcugggga

[0095] >PolyA ASO 1 (Sequence ID 81) gcuggcaacuagaaggcacag >PolyA ASO 2 (Sequence ID 82) gggaggggcaaacaacagaug >PolyA ASO 3 (Sequence ID 83) ccagggucaaggaaggcacgg >PolyA ASO 4 (Sequence ID 84) ggacagugggaguggcaccuu >PolyA ASO 5 (Sequence ID 85) uuuccucauuuuuauuaggaaa

[0096] >PolyA ASO 6 (Sequence ID 86) uacucagacaaugcgaugcaa >PolyA ASO 7 (Sequence ID 87) cccccagaauagaaugacacc >PolyA ASO 8 (Sequence ID 88) ugcuguccugccccaccccac >PolyA ASO 9 (Sequence ID 89) ugucuucccaauccucccccu >PolyA ASO 10 (Sequence ID 90) ucuccccagcaugccugcuau

[0097] >GBA ASO 1 modifier (sequence number 91) mG*mG*mG*mG*mC*A*T*T*C*C*T*C*T*C*T*mG*mC*mU*mG*mG >GBA ASO 2 modifier (sequence number 92) mU*mG*mC*mA*mG*T*G*T*C*A*G*C*A*G*C*mA*mG*mG*mC*mC >GBA ASO 3 modifier (SEQ ID NO: 93) mG*mG*mU*mG*mG*A*G*A*C*A*G*A*G*C*C*mA*mG*mG*mA*mU >GBA ASO 4 modifier (sequence number 94) mG*mC*mC*mU*mU*C*C*T*C*G*C*T*G*A*A*mG*mU*mA*mG*mC >GBA ASO 5 modifier (sequence number 95) mC*mG*mC*mA*mG*C*T*G*G*C*C*A*T*G*G*mG*mC*mA*mC*mU

[0098] >WPRE ASO 1 modifier (sequence number 96) mC*mU*mU*mU*mC*A*C*A*A*A*T*T*T*T*G*T*mA*mA*mU*mC*mC >WPRE ASO 2 modifier (sequence number 97) mG*mG*mC*mA*mU*T*A*A*A*G*C*A*G*C*G*mU*mA*mU*mC*mC >WPRE ASO 3 modifier (sequence number 98) mC*mC*mC*mC*mG*A*C*A*A*C*A*C*C*A*C*G*G*mA*mA*mU*mU*mG >WPRE ASO 4 modifier (sequence number 99) mG*mG*mG*mC*mC*G*A*A*G*G*G*A*C*G*T*mA*mG*mC*mA*mG >WPRE ASO 5 modifier (sequence number 100) mG*mC*mG*mG*mG*G*A*G*G*C*G*G*C*C*C*A*mA*mA*mG*mG*mG

[0099] >Poly-A ASO 1 modified form (SEQ ID NO: 101) mG*mG*mC*mU*mG*G*C*A*A*C*T*A*G*A*A*mG*mG*mC*mA*mC >Poly-A ASO 2 modified form (SEQ ID NO: 102) mG*mG*mU*mC*mA*A*G*G*A*A*G*G*C*A*C*mG*mG*mG*mG*mG >Polypodium A ASO3 modified compound (SEQ ID NO: 103) mC*mC*mC*mC*mC*C*A*G*A*A*T*A*G*A*A*T*G*mA*mC*mA*mC*mC >Polypodium A ASO 5 modified form (SEQ ID NO: 104) mG*mG*mA*mC*mA*mG*mU*mG*mG*mG*mA*mG*mU*mG*mG*mC*mA*mC*mC

[0100] >GFP ASO-1 modified (SEQ ID NO: 105) mU*mG*mU*mG*mG*C*C*G*T*T*T*A*C*G*T*mC*mG*mC*mC*mG >GBA ASO 1 Unmodified (SEQ ID NO: 106) Ggggcauuccucucugcugg >GBA ASO 2 unmodified (SEQ ID NO: 107) ugcagugucagcagcaggcc >GBA ASO 3 Unmodified (SEQ ID NO: 108) gguggagacagagccaggau >GBA ASO 4 unmodified (SEQ ID NO: 109) gccuuccucgcugaaguagc

[0101] >GBA ASO 5 unmodified (SEQ ID NO: 110) cgcagcuggccaugggcacu >WPRE ASO 1 Unmodified (SEQ ID NO: 111) Cuuucacaaauuuuguaaucc >WPRE ASO 2 unmodified (SEQ ID NO: 112) Ggcauuaaagcagcguaucc >WPRE ASO 3 unmodified (SEQ ID NO: 113) Ccccgacaacaccacggaauug >WPRE ASO 4 unmodified (SEQ ID NO: 114) Gggccgaagggacguagcag

[0102] >WPRE ASO 5 unmodified (SEQ ID NO: 115) Gcggggaggcggcccaaaggg >Poly-A ASO-1 unmodified (SEQ ID NO: 116) ggcuggcaacuagaaggcac >Poly-A ASO-2 unmodified (SEQ ID NO: 117) ggucaaggaaggcacggggg >Poly-A ASO-3 unmodified (SEQ ID NO: 118) ccccccagaauagaaugacacc >Poly-A ASO-4 unmodified (SEQ ID NO: 119) ccauagagcccaccgcaucccc >Poly-A ASO-5 unmodified (SEQ ID NO: 120) ggacagugggaguggcacc

Claims

1. A pharmaceutical composition for use in a method for regulating the expression of a transgene in isolated cells, comprising a transgene sequence encoding β-glucocerebrosidase (GBA), a woodchuck post-transcriptional regulatory element sequence (WPRE), and / or one or more antisense oligonucleotides (ASOs) that specifically bind to at least one of bovine growth hormone (BGH) polyA, wherein the method comprises contacting isolated cells containing a recombinant adeno-associated virus (rAAV) vector comprising a transgene positioned alongside an adeno-associated virus (AAV) reverse terminal repeat (ITR) with the one or more antisense oligonucleotides (ASOs), Here, the transgene comprises a transgene sequence encoding GBA, WPRE, and BGH polyA. The pharmaceutical composition wherein the binding of one or more ASOs to a transgene sequence encoding GBA, a WPRE, and / or at least one BGH polyA results in a change in transgene expression compared to isolated cells not containing one or more ASOs, wherein the ASO that binds to the transgene sequence encoding GBA includes one of SEQ ID NOs. 91 to 94, the ASO that binds to the WPRE includes one of SEQ ID NOs. 96 to 100, and the ASO that binds to BGH polyA includes one of SEQ ID NOs. 101 to 104.

2. The pharmaceutical composition according to claim 1, wherein each ASO comprises one or more chemical modifications.

3. The pharmaceutical composition according to claim 2, wherein each of the one or more chemical modifications is selected from nucleic acid base modifications or main chain modifications.

4. The pharmaceutical composition according to claim 3, wherein all nucleic acid bases and / or the entire main chain of each ASO are modified.

5. The pharmaceutical composition according to claim 3 or 4, wherein the nucleic acid base modification includes a 2'-O-methyl (2'OMe) modification.

6. The pharmaceutical composition according to claim 3 or 4, wherein the main chain modification includes a phosphorothioate linkage.

7. The pharmaceutical composition according to claim 3 or 4, wherein at least one of the one or more ASOs comprises one or more locked nucleic acids (LNAs).

8. The pharmaceutical composition according to any one of claims 1 to 7, wherein the change in expression is an increase in the expression of the transgene when the ASO is sequence number 96, 99, 100, 101, 102, 103, or 104.

9. The pharmaceutical composition according to any one of claims 1 to 7, wherein the change in expression is a decrease in the expression of the transgene when the ASO is sequence number 91, 92, 93, or 94.

10. The pharmaceutical composition according to any one of claims 1 to 9, wherein the cells are mammalian cells.

11. The pharmaceutical composition according to any one of claims 1 to 10, wherein the cells are human cells.

12. A pharmaceutical composition according to any one of claims 1 to 11, wherein cells are located within the target area.

13. The pharmaceutical composition according to claim 1, wherein GBA is encoded by a codon-optimized nucleic acid sequence.

14. The pharmaceutical composition according to claim 13, wherein the transgene encoding GBA comprises the nucleic acid sequence described in SEQ ID NO: 40 or its complement.

15. The pharmaceutical composition according to any one of claims 1 to 14, wherein the rAAV vector comprises the nucleic acid sequences described in SEQ ID NOs: 1, 9, 25, 40, 51, and 80.

Images