Methods for assessing the risk of cerebral infarction
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- NAT CEREBRAL & CARDIOVASCULAR CENT
- Filing Date
- 2019-12-11
- Publication Date
- 2026-08-05
AI Technical Summary
【0007】 本発明によれば、アテローム血栓性脳梗塞と相関のあるRNF213 p.R4810K多型を、患者から採取した生体試料から、前処理としてDNA抽出をすることなく迅速に、かつ特異的に検出することができる。これにより、被検者が発症した脳梗塞の種類を迅速に判定することができる。
Smart Images

Figure 0007900757000001
Abstract
Description
Technical Field
[0001] The present invention relates to a method for risk assessment of cerebral infarction by detecting the p.R4810K polymorphism in the RNF213 gene and a kit for performing the method.
Background Art
[0002] The number of stroke deaths in Japan reaches 110,000 annually. Cerebral infarction, which accounts for 70-80% of them, is a major cause of hemiplegia, dementia, etc. Cerebral infarction is a disease in which the blood vessels that supply blood to brain cells are blocked and the brain cells die. It is classified into atherosclerotic thrombotic cerebral infarction mainly due to arteriosclerosis of relatively thick blood vessels in the brain, lacunar infarction in which many thin blood vessels in the brain are blocked, cardiogenic cerebral embolism in which a thrombus formed in the heart flows out of the heart and blocks the large blood vessels in the brain, etc. Generally, atherosclerotic thrombotic cerebral infarction and lacunar infarction are related to lifestyle diseases such as hypertension and diabetes, and cardiogenic cerebral embolism is considered to be related to arrhythmias such as atrial fibrillation.
[0003] As a treatment for patients who have developed cerebral infarction, based on MRI (Magnetic Resonance Imaging) images or CT (Computed Tomography) images, the type of cerebral infarction (atherosclerotic thrombotic cerebral infarction, lacunar infarction or cardiogenic cerebral embolism) is estimated and the location of the thrombus is specified. Also, tPA (Tissue Plasminogen Activator) is administered to the patient to dissolve the thrombus clogged in the blood vessels. If necessary, catheter treatment (endovascular treatment) is performed on the patient. In catheter treatment, an appropriate treatment method is selected from treatments using a thrombus retrieval device or a thrombus aspiration device and percutaneous transluminal angioplasty including stent placement, depending on the type of developed cerebral infarction.
Summary of the Invention
Problems to be Solved by the Invention
[0004] For the treatment of cardiogenic cerebral embolism, thrombectomy devices, thrombus aspiration devices, and percutaneous transluminal angioplasty can all be used. However, in the treatment of atherothrombotic cerebral infarction, the use of thrombectomy devices can cause endothelial damage to the occluded vessel, increasing the risk of reocclusion due to in-situ thrombosis (thrombus formation in site). Therefore, in the treatment of atherothrombotic cerebral infarction, it is necessary to choose either the use of a thrombus aspiration device or percutaneous transluminal angioplasty. When using MRI or CT images in these procedures for patients who have suffered a stroke, the practitioner must visually determine the type of stroke and the appropriate treatment method.
[0005] In actual stroke treatment settings, these decisions need to be made within a short time (approximately 1 to 1.5 hours after the patient is transported to the hospital). However, these decisions are difficult to make based solely on imaging information, and there is a need for a method that can quickly and easily identify the type of stroke separately from imaging information. Therefore, the objective of the present invention is to provide a method that allows practitioners to identify the type of stroke in a short time. [Means for solving the problem]
[0006] In other words, the objective of the present invention is achieved by the following invention. [1] A method for assessing the risk of cerebral infarction, characterized by detecting the p.R4810K polymorphism (RNF213 p.R4810K polymorphism) in the RNF213 gene present in genomic DNA in a sample collected from a subject, (1) A step of mixing the sample with a PCR buffer containing a surfactant and proteinase K; (2) A step of performing PCR by mixing the mixture obtained in step (1) with DNA polymerase, a pair of PCR primers for amplifying a base sequence containing a gene mutation corresponding to the RNF213 p.R4810K polymorphism, and a set of oligonucleotide fluorescently labeled probes, which include a mutant base sequence containing a gene mutation corresponding to the RNF213 p.R4810K polymorphism and an oligonucleotide fluorescently labeled probe set, wherein the fluorescent dyes that bind to the oligonucleotides are different from each other; and (3) A step of detecting the PCR product; A method that includes this. [2] The method according to [1], wherein the RNF213 p.R4810K polymorphism is homozygous for the mutant or heterozygous for the mutant and the wild type. [3] The method according to [1] or [2], wherein the specimen is blood or saliva. [4] The method according to any one of [1] to [3], wherein in step (1) above, the surfactant is sodium dodecyl sulfate. [5] The method according to any one of [1] to [4], wherein in step (1) above, the PCR buffer is a Tris buffer containing KCl, MgCl2 and a dNTP mix (a mixture consisting of dATP, dGTP, dCTP, and dTTP). [6] The method according to any one of [1] to [5], wherein in step (1), the PCR buffer contains a biologically derived negatively charged substance that adsorbs to DNA polymerase and a biologically derived positively charged substance that adsorbs to DNA and inhibits PCR, and contains a substance that neutralizes the PCR-inhibiting effect of the negatively charged substance and the positively charged substance. [7] The method according to any one of [1] to [6], wherein in step (2) above, the PCR primer pair for amplifying a base sequence containing a gene mutation corresponding to the RNF213 p.R4810K polymorphism is indicated by SEQ ID NO: 1 (forward) and SEQ ID NO: 2 (reverse). [8] The method according to any one of [1] to [7], wherein in step (2), the sequence of an oligonucleotide fluorescently labeled probe that binds to a mutant base sequence containing a gene mutation corresponding to the RNF213 p.R4810K polymorphism is shown in SEQ ID NO: 3, and the sequence of an oligonucleotide fluorescently labeled probe that binds to a wild-type base sequence corresponding to the mutant base sequence is shown in SEQ ID NO: 4. [9] The method according to any one of [1] to [8], wherein, in step (3) above, if an increase in fluorescence intensity originating from an oligonucleotide fluorescently labeled probe bound to the mutant base sequence is observed, it is determined that the RNF213 p.R4810K polymorphism has been detected.
[10] The method described in any of [1] to [9], which determines that there is a high risk of developing cerebral infarction when the RNF213 p.R4810K polymorphism is detected.
[11] The method according to any one of [1] to
[10] , wherein the cerebral infarction is moyamoya disease and atherothrombotic cerebral infarction.
[12] A kit for detecting the p.R4810K polymorphism (RNF213 p.R4810K polymorphism) in the RNF213 gene present in genomic DNA in a sample collected from a subject, comprising: a pair of PCR primers for amplifying a base sequence containing a gene mutation corresponding to the RNF213 p.R4810K polymorphism; and a set of oligonucleotide fluorescently labeled probes that bind to a mutant base sequence containing a gene mutation corresponding to the RNF213 p.R4810K polymorphism; and an oligonucleotide fluorescently labeled probe set that binds to a wild-type base sequence corresponding to the mutant base sequence, wherein the set of oligonucleotide fluorescently labeled probes comprises oligonucleotides that bind to each other with different fluorescent dyes.
[13] The kit according to
[12] , wherein the PCR primer pair is indicated by SEQ ID NO: 1 (forward) and SEQ ID NO: 2 (reverse).
[14] The kit according to
[12] or
[13] , wherein the sequence of an oligonucleotide fluorescently labeled probe that binds to a mutant base sequence containing a gene mutation corresponding to the RNF213 p.R4810K polymorphism is shown in SEQ ID NO: 3, and the sequence of an oligonucleotide fluorescently labeled probe that binds to a wild-type base sequence corresponding to the mutant base sequence is shown in SEQ ID NO: 4.
[15] Furthermore, the kit according to any one of
[12] to
[14] comprises a PCR buffer containing a surfactant and proteinase K.
[16] The kit according to
[15] , wherein the surfactant is sodium dodecyl sulfate.
[17] The kit according to
[15] or
[16] , wherein the PCR buffer is a Tris buffer containing KCl, MgCl2, and a dNTP mix (a mixture consisting of dATP, dGTP, dCTP, and dTTP).
[18] The kit according to any one of
[15] to
[17] , wherein the PCR buffer contains a biologically derived negatively charged substance that adsorbs to DNA polymerase and a biologically derived positively charged substance that adsorbs to DNA and binds to a substance that inhibits PCR, and a substance that neutralizes the PCR-inhibiting effect of the negatively charged substance and the positively charged substance. [Effects of the Invention]
[0007] According to the present invention, the RNF213 p.R4810K polymorphism, which is correlated with atherothrombotic cerebral infarction, can be rapidly and specifically detected from biological samples taken from patients without the need for DNA extraction as a pretreatment. This allows for rapid determination of the type of cerebral infarction the subject has suffered. [Brief explanation of the drawing]
[0008] [Figure 1]This figure shows the results of (A) analysis of a mutant gene containing a gene mutation corresponding to the artificially synthesized RNF213 p.R4810K polymorphism and the wild-type gene corresponding to the mutant gene, and (B) analysis of human blood and saliva samples using the method and kit of the present invention. For the PCR primer pair, the primer pair indicated by SEQ ID NO: 1 (forward) and SEQ ID NO: 2 (reverse) was used. For the oligonucleotide fluorescently labeled probe set, a fluorescently labeled probe having the base sequence indicated by SEQ ID NO: 3 and SEQ ID NO: 4 was used. (A) In A1, which contains the wild-type gene (homozygous), the fluorescence intensity for the wild-type gene (solid line) was enhanced, but the fluorescence intensity for the mutant gene (dashed line) was not enhanced. In A2, which contains the mutant gene (homozygous), the fluorescence intensity for the mutant gene (dashed line) was enhanced, but the fluorescence intensity for the wild-type gene (solid line) was not enhanced. In A3, which contains both the wild-type gene and the mutant gene (heterozygous), the fluorescence intensity for the wild-type gene and the mutant gene (solid and dashed lines, respectively) were enhanced. (B) In blood and saliva samples (B1 and B2, respectively), the fluorescence intensity for the wild-type gene (solid line) was enhanced, but the fluorescence intensity for the mutant gene (dashed line) was not enhanced. Both samples were determined to be homozygous for the wild type. No enhancement of fluorescence intensity was observed in the negative control (B3), which did not contain a blood or saliva sample. [Modes for carrying out the invention]
[0009] The present invention provides a method for risk assessment of cerebral infarction, which is characterized by detecting the p.R4810K polymorphism (RNF213 p.R4810K polymorphism) in the RNF213 gene present in genomic DNA in a specimen collected from a subject. The method of the present invention includes: (1) a step of mixing the specimen with a PCR buffer containing a surfactant and proteinase K; (2) a step of mixing the mixture obtained in step (1) with a DNA polymerase, a pair of PCR primers for amplifying a nucleotide sequence containing a gene mutation corresponding to the RNF213 p.R4810K polymorphism, and an oligonucleotide fluorescently labeled probe set that binds to a mutant nucleotide sequence containing a gene mutation corresponding to the RNF213 p.R4810K polymorphism and a wild-type nucleotide sequence corresponding to the mutant nucleotide sequence, wherein the fluorescent dyes binding to the oligonucleotides are different from each other, and performing PCR; and (3) a step of detecting the PCR product.
[0010] In the method of the present invention, in order to detect the RNF213 p.R4810K polymorphism, genomic DNA in a specimen collected from a subject can be used. The specimen collected from a subject is not particularly limited as long as it contains genomic DNA. Examples of the specimen include blood and blood-related samples such as whole blood, plasma, and serum, lymph, saliva, nasal discharge, sweat, tears, urine, feces, tissue fluid (interstitial fluid, intercellular fluid, and stromal fluid), body cavity fluid (ascites, pleural effusion, pericardial fluid, cerebrospinal fluid, synovial fluid, and aqueous humor), exudate (pleural effusion or ascites, etc.) in the thoracic cavity, abdominal cavity, cranial cavity, or spinal canal, and crushed products and extracts of cells, tissues, or organs. Among these specimens, peripheral blood and saliva are preferred because of the low invasiveness to the subject during collection, and saliva is more preferred because of the lower invasiveness. The amount of the specimen used in the method of the present invention depends on the amount of genomic DNA contained in the specimen. If the specimen is saliva or peripheral blood, 0.1 to 10 μL is preferred, and 0.5 to 2 μL is more preferred.
[0011] The RNF213 p.R4810K polymorphism is a polymorphism in which the 4810th arginine in the protein encoded by the RNF213 gene is replaced with lysine. This gene polymorphism is a single nucleotide polymorphism (SNP) in which the 14576th base of the RNF213 gene is adenine (A) in the mutant, whereas in the wild type it is guanine (G) (Liu W, Morito D, Takashima S, et al. PLoS One. 2011;6:e22542.). The method of the present invention can assess the risk of cerebral infarction by detecting this SNP. The RNF213 p.R4810K polymorphism detected by the present invention is either homozygous for the mutant or heterozygous for the mutant and wild type.
[0012] A sample collected from a subject is mixed with a PCR buffer containing a surfactant and proteinase K, which dissolves the sample and releases nucleic acids. The surfactant in the PCR buffer dissolves cells and biological tissues, and can be an anionic surfactant, a cationic surfactant, an amphoteric surfactant, or a nonionic surfactant. Preferably, it is sodium dodecyl sulfate, which is an anionic surfactant, and is preferably 0.1-0.5% (w / v) when mixed with the sample. Proteinase K has the effect of inactivating DNA and RNA degrading enzymes, and is preferably 100-300 μg / mL when mixed with the sample. In one embodiment of the present invention, the PCR buffer contains KCl, MgCl2, and a dNTP mix (deoxyribonucleotide 5'-triphosphate; a mixture consisting of dATP, dGTP, dCTP, and dTTP). The PCR buffer is preferably Tris-HCl, but is not limited thereto. Those skilled in the art can set appropriate concentrations for dNTP, MgCl2, KCl, and the buffer. For example, the PCR buffer contains 1.5 mM MgCl2, 35 mM KCl, 200 μM dNTPs, and 10 mM Tris-HCl. In one embodiment of the present invention, the PCR buffer contains a biologically derived negatively charged substance (e.g., certain sugars and dyes) that adsorbs to DNA polymerase and a biologically derived positively charged substance (e.g., certain proteins) that adsorbs to DNA and binds to a substance that inhibits PCR, thereby neutralizing the PCR-inhibiting effects of the negatively charged and positively charged substances. The gene amplification reagent Ampdirect (registered trademark, Shimadzu Corporation) can be used as the PCR buffer.
[0013] The mixture of the sample and the PCR buffer can initiate PCR by mixing with a pair of PCR primers that amplify a base sequence containing a gene mutation corresponding to DNA polymerase and the RNF213 p.R4810K polymorphism. The DNA polymerase is a heat-resistant DNA polymerase derived from thermophilic bacteria, and Taq, Tth, KOD, Pfu, and their mutants can be used, but are not limited thereto. To avoid non-specific amplification by DNA polymerase, a hot start DNA polymerase may be used. Examples of the hot start DNA polymerase include BIOTAQ (registered trademark) hot start DNA polymerase. The hot start DNA polymerase includes a DNA polymerase bound to an anti-DNA polymerase antibody and a DNA polymerase in which the enzyme active site is thermally sensitively chemically modified, and either can be used in the present invention.
[0014] The pair of PCR primers used in the present invention uses genomic DNA in a sample collected from a subject as a template and can amplify a nucleic acid fragment containing the single nucleotide polymorphism site of the RNF213 p.R4810K polymorphism to be analyzed by polymerase chain reaction (PCR). The amplification site is the same for the wild-type RNF213 gene. The length of the nucleic acid fragment to be amplified is preferably 80 to 100 bases including the single nucleotide polymorphism site of the RNF213 p.R4810K polymorphism. Such a pair of PCR primers is preferably an oligonucleotide (forward primer and reverse primer) that hybridizes under stringent conditions to a region consisting of the base sequence shown in SEQ ID NO: 5. The stringent conditions here refer to conditions where the binding between the template DNA and the primer is specific in annealing in PCR, which is the step where the primer binds to the template DNA. The pair of PCR primers of the present invention preferably has a base length of 15 to 25 bases. The most preferred base sequence of the pair of PCR primers in the present invention is shown below. (Forward) 5'- TTCCAGAACGTCCAGCAAGT -3' (SEQ ID NO: 1) (Reverse) 5'- ACAGTCCTGGTCCTGTCAGA -3'(Sequence No. 2)
[0015] The following Sequence ID No. 5 is the nucleotide sequence of the region containing the single nucleotide polymorphism (SNP) of the RNF213 p.R4810K polymorphism in the RNF213 gene. Any nucleotide sequence of Sequence ID No. 5 can be amplified as long as it includes the SNP region. 5'-CCCAATAACATTTTTTAGGTAAATAAAAATTGTTACTGGGTGGTCTTCCC TTCTCCAGGAAGCAGAGCTGAGGCTGGTAAAGTTCCTGCCTGAGATTTTG GCCTTGCAAAGGGATCTAGTGAAGCAGTTCCAGAACGTCCAGCAAGTTGA ATACAGCTCCATCAGAGGCTTCCTCAGCAAGCACAGCTCAGGTGTGGCTC TGCTCTGACAGGACCAGGACTGTCCCGCATTTGGCGGTTCGAAAGGATCA CTGCATAGGGGAACAGGGTGGGGCGGAGGGGAGGAGGCGCTGATGGGTGC TCTATAGCCTAAGCCCTTACCATGCGGTGAAGGGTGCTTGAACCCCAAAA -3'(Sequence ID 5)
[0016] The oligonucleotide fluorescently labeled probe set used in the present invention is a combination of an oligonucleotide fluorescently labeled probe that binds to a mutant base sequence containing a gene mutation corresponding to the RNF213 p.R4810K polymorphism and an oligonucleotide fluorescently labeled probe that binds to a wild-type base sequence corresponding to the mutant base sequence. The mutant base sequence containing a gene mutation corresponding to the RNF213 p.R4810K polymorphism refers to a base sequence containing the 14576th SNP of the RNF213 gene (where G is replaced with A), and the wild-type base sequence corresponding to the mutant base sequence refers to a base sequence containing the 14576th base (G) of the unmutated RNF213 gene. An oligonucleotide fluorescently labeled probe that binds to a mutant base sequence hybridizes under stringent conditions to a nucleic acid fragment containing the single nucleotide polymorphism site of the RNF213 p.R4810K polymorphism amplified by PCR, but does not hybridize under stringent conditions to a nucleic acid fragment having a wild-type base sequence amplified by PCR using the wild-type RNF213 gene as a template. On the other hand, an oligonucleotide fluorescently labeled probe that binds to the wild-type base sequence hybridizes under stringent conditions to a nucleic acid fragment having a wild-type base sequence amplified by PCR using the wild-type RNF213 gene as a template, but does not hybridize under stringent conditions to a nucleic acid fragment containing the single nucleotide polymorphism site of the RNF213 p.R4810K polymorphism amplified by PCR. Here, stringent conditions refer to conditions in which a specific hybrid is formed between the nucleic acid fragment amplified by PCR and the oligonucleotide fluorescently labeled probe during annealing, and no nonspecific hybrid is formed.
[0017] The oligonucleotide fluorescently labeled probe of the present invention preferably has a base length of 10 to 25 bases, and more preferably 15 to 20 bases. The base sequence of the most preferred oligonucleotide fluorescently labeled probe set in the present invention is shown below. Fluorescently labeled probe that binds to mutant nucleotide sequences: 5'- CTCCATCAAAGGCTTCCT-3' (SEQ ID NO: 3) Fluorescently labeled probe that binds to the wild-type nucleotide sequence: 5'- CTCCATCAGAGGCTTCCT-3' (SEQ ID NO: 4)
[0018] In this invention, PCR is used to detect the RNF213 p.R4810K polymorphism. Setting the PCR conditions (temperature, time, and number of cycles) is easily done by those skilled in the art. In this invention, the PCR product can be detected by real-time measurement. Real-time measurement of PCR products is also called real-time PCR. In this invention, an oligonucleotide fluorescently labeled probe is used to detect the PCR product by fluorescence. Examples of fluorescently labeled probes include, but are not limited to, hydrolysis probes, molecular beacons, and cycling probes. A hydrolysis probe is an oligonucleotide modified with a fluorescent dye at its 5' end and a quencher substance at its 3' end. The hydrolysis probe specifically hybridizes to the template DNA during PCR annealing, but because a quencher is present on the probe, fluorescence generation is suppressed even when irradiated with excitation light. In the subsequent extension reaction step, the hydrolysis probe hybridized to the template DNA is degraded by the 5'→3' exonuclease activity of Taq DNA polymerase, releasing the fluorescent dye from the probe and releasing the quencher's suppression of fluorescence generation, causing fluorescence to be emitted. By measuring the intensity of this fluorescence, the amount of amplification product produced can be measured. Examples of the fluorescent dyes include, but are not limited to, FAM (6-carboxyfluorescein), ROX (6-carboxy-X-rhodamine), Cy3 and Cy5 (cyanine-based dyes), and HEX (4,7,2',4',5',7'-hexachloro-6-carboxyfluorescein). Examples of the quenchers include, but are not limited to, TAMRA®, BHQ (Black Hole Quencher®), BHQ2, MGB-Eclipse®, and DABCYL.
[0019] In this invention, two types of fluorescently labeled probes are used to distinguish and detect two types of DNA target sequences: an oligonucleotide fluorescently labeled probe that binds to a mutant base sequence containing a gene mutation corresponding to the RNF213 p.R4810K polymorphism, and an oligonucleotide fluorescently labeled probe that binds to a wild-type base sequence corresponding to the mutant base sequence. For this reason, the two types of fluorescently labeled probes are labeled with different fluorescent dyes. The combination of different fluorescent dyes is not particularly limited as long as they have different fluorescence properties and do not interfere with each other in fluorescence measurements.
[0020] In real-time measurement of PCR products, the amplification curve of the PCR product is monitored using a fluorescent filter corresponding to the fluorescent dye used. If the fluorescence intensity increases with the number of PCR cycles, it is determined that the presence of the DNA to be analyzed in the sample is positive; on the other hand, if the fluorescence intensity does not increase during PCR, it is determined to be negative. In one embodiment of the present invention, the presence of the RNF213 p.R4810K polymorphism can be determined by comparing the increase in fluorescence intensity from a fluorescently labeled probe that binds to the mutant base sequence and a fluorescently labeled probe that binds to the wild-type base sequence. If the RNF213 p.R4810K polymorphism is homozygous, an increase in fluorescence intensity from the fluorescently labeled probe that binds to the mutant base sequence is observed, but no increase in fluorescence intensity from the fluorescently labeled probe that binds to the wild-type base sequence is observed. If the RNF213 p.R4810K polymorphism is heterozygous for both the mutant and wild-type, an increase in fluorescence intensity from both the fluorescently labeled probe that binds to the mutant base sequence and the fluorescently labeled probe that binds to the wild-type base sequence is observed. On the other hand, in the wild-type RNF213 gene (homozygous), only an increase in fluorescence intensity originating from the fluorescently labeled probe that binds to the wild-type base sequence is observed. When an increase in fluorescence intensity originating from the fluorescently labeled probe that binds to the mutant base sequence is observed, it is determined that the RNF213 p.R4810K polymorphism has been detected.
[0021] In another embodiment, the presence of the RNF213 p.R4810K polymorphism can be determined based on the number of PCR cycles (Cq value) at which the amplification curve of the PCR product intersects a certain threshold line. Generally, a small Cq value indicates a large amount of template DNA, i.e., high gene expression, while a large Cq value indicates a small amount of template DNA, i.e., low gene expression level. When a predetermined Cq value is assigned to the use of a fluorescently labeled probe that binds to the mutant base sequence, it is determined that the RNF213 p.R4810K polymorphism has been detected. If the RNF213 p.R4810K polymorphism is heterozygous for both the mutant and wild-type, a certain Cq value is assigned to the use of both fluorescently labeled probes, but these values are not necessarily identical. For the wild-type RNF213 gene (homozygous), a certain Cq value is assigned only to the use of a fluorescently labeled probe that binds to the wild-type base sequence. If the amplification curve of the PCR product does not intersect a certain threshold line with the fluorescently labeled probe used, i.e., if no Cq value is assigned, it indicates that there is no nucleotide sequence to which the fluorescently labeled probe binds.
[0022] The RNF213 gene is a disease susceptibility gene for cerebral infarction, and the presence of the RNF213 p.R4810K polymorphism has been reported to correlate with the development of moyamoya disease and atherothrombotic cerebral infarction in East Asians, including people of Japanese descent (Non-Patent Literature 1 and 2). Therefore, if the RNF213 p.R4810K polymorphism is detected, it can be determined that there is a high risk of developing moyamoya disease and atherothrombotic cerebral infarction, which are types of cerebral infarction.
[0023] The present invention provides a kit for detecting the p.R4810K polymorphism (RNF213 p.R4810K polymorphism) in the RNF213 gene present in genomic DNA in a sample collected from a subject. The kit of the present invention comprises a PCR primer pair for amplifying a nucleotide sequence containing a gene mutation corresponding to the RNF213 p.R4810K polymorphism, and an oligonucleotide fluorescently labeled probe set that binds to a mutant nucleotide sequence containing a gene mutation corresponding to the RNF213 p.R4810K polymorphism and a wild-type nucleotide sequence corresponding to the mutant nucleotide sequence, wherein the oligonucleotide fluorescently labeled probe set contains fluorescent dyes that bind to each other that are different from each other.
[0024] The PCR primer pair and the oligonucleotide fluorescently labeled probe set provided in the kit of the present invention are identical to the PCR primer pair and fluorescently labeled probe set used in the stroke risk assessment method of the present invention. The kit of the present invention can be used in a rapid genotyping system that performs simple and rapid genetic testing in a clinical setting. An example of a rapid genotyping system is the Shimadzu GTS-7000.
[0025] In one embodiment, the kit of the present invention may include a PCR buffer containing a surfactant and proteinase K for sample pretreatment to facilitate application to a rapid genotyping system. The surfactant is preferably an anionic surfactant, and more preferably sodium dodecyl sulfate. In one embodiment, the PCR buffer may be a Tris buffer containing KCl, MgCl2, and a dNTP mix (a mixture consisting of dATP, dGTP, dCTP, and dTTP). In one embodiment, the PCR buffer may also contain a biologically derived negatively charged substance that adsorbs to DNA polymerase and a biologically derived positively charged substance that adsorbs to DNA and binds to a substance that inhibits PCR, thereby neutralizing the PCR-inhibiting effects of the negatively charged and positively charged substances. In one embodiment, the kit of the present invention may include the gene amplification reagent Ampdirect or Ampdirect Plus (both registered trademarks, Shimadzu Corporation).
[0026] When applying the kit of the present invention to a rapid genotype determination system, automated genotype determination becomes possible by incorporating a mutant gene containing a gene mutation corresponding to the artificially synthesized RNF213 p.R4810K polymorphism and a wild-type gene corresponding to the mutant gene into the system as a positive control. [Examples]
[0027] The present invention will now be described in detail with reference to examples, but the scope of the present invention is not limited thereto. [Examples]
[0028] [Confirmation test using artificially synthesized genes] Using a mutant gene containing a gene mutation corresponding to the artificially synthesized RNF213 p.R4810K polymorphism and a wild-type gene corresponding to the mutant gene, the accuracy of distinguishing between the mutant gene and the wild-type gene was confirmed based on the kit and method of the present invention. (method) The samples used were the wild-type gene (homozygous), the mutant gene (homozygous), or the wild-type gene and the mutant gene (heterozygous). The PCR reaction mixture was prepared by mixing Ampdirect Plus reagent (registered trademark, Shimadzu Corporation), PCR primer pairs indicated by SEQ ID NO: 1 (forward) and SEQ ID NO: 2 (reverse), fluorescently labeled probes indicated by SEQ ID NO: 3 and SEQ ID NO: 4 (fluorescent dyes FAM and ROX, respectively), and purified water. 1 μL of any of the above samples, 24 μL of the PCR reaction mixture, and 0.25 μL of BIOTAQ (registered trademark) DNA polymerase (Bioline, UK) were added to a PCR reaction tube and mixed. The PCR reaction was immediately measured using a real-time PCR instrument (GTS-7000, Shimadzu Corporation). PCR was performed for 50 cycles at 95°C / 10 seconds - 60°C / 30 seconds. (result) The measurement results are shown in Figure 1(A). Approximately 90 minutes after the start of the reaction, in A1, which contains the wild-type gene (homozygous), the fluorescence intensity for the wild-type gene (solid line) increased, but the fluorescence intensity for the mutant gene (dashed line) did not increase. In A2, which contains the mutant gene (homozygous), the fluorescence intensity for the mutant gene (dashed line) increased, but the fluorescence intensity for the wild-type gene (solid line) did not increase. In A3, which contains both the wild-type gene and the mutant gene (heterozygous), the fluorescence intensity for the wild-type gene and the mutant gene (solid and dashed lines, respectively) increased. These results demonstrate that the PCR primer pair and fluorescently labeled probe of the present invention can accurately distinguish between the RNF213 p.R4810K polymorphism and the wild type. [Examples]
[0029] [Validation test using samples from test subjects] Human blood samples were examined for RNF213 p.R4810K polymorphism using the kit and method of the present invention. (method) Human blood samples (whole blood) or human saliva samples provided by the National Cerebral and Cardiovascular Center were diluted 10-fold with a blood solvent containing a surfactant. 1 μL of this dilution was mixed in a PCR reaction tube with 24 μL of the same PCR reaction solution as in Example 1 and 0.25 μL of BIOTAQ® DNA polymerase (Bioline, UK). The PCR reaction was immediately measured using a real-time PCR instrument (GTS-7000, Shimadzu Corporation). PCR was performed for 50 cycles at 95°C / 10 seconds - 60°C / 30 seconds. (result) The measurement results are shown in Figure 1(B). Both the blood sample (B1) and the saliva sample (B2) showed enhanced fluorescence intensity for the wild-type gene (solid line), but not for the mutant gene (dashed line). Therefore, both samples were determined to be homozygous for the wild type. No enhancement of fluorescence intensity was observed in the negative control (B3), which did not contain a blood or saliva sample. [Examples]
[0030] The results obtained using the kit and method of the present invention for 22 human blood (whole blood) samples (16 wild-type homozygous samples and 6 wild-type / mutant heterozygous samples) provided by the National Cerebral and Cardiovascular Center, were compared with the results of sequence analysis using DNA sequencing. As a result, the determination of whether or not the RNF213 p.R4810K polymorphism was present was consistent for all cases. Therefore, it was demonstrated that the kit and method of the present invention have extremely high accuracy in determining mutant and wild-type from samples obtained from test subjects.
Claims
1. A method for assessing the risk of cerebral infarction, characterized by detecting the p.R4810K polymorphism (RNF213 p.R4810K polymorphism) in the RNF213 gene present in genomic DNA in a sample collected from a subject, (1) A step of mixing the sample with a PCR buffer containing a surfactant and proteinase K to obtain a mixture; (2) A step of performing PCR by mixing the mixture obtained in step (1) with DNA polymerase, a pair of PCR primers for amplifying a base sequence containing a gene mutation corresponding to the RNF213 p.R4810K polymorphism, and a set of oligonucleotide fluorescently labeled probes, which include a mutant base sequence containing a gene mutation corresponding to the RNF213 p.R4810K polymorphism and an oligonucleotide fluorescently labeled probe set that binds to a wild-type base sequence corresponding to the mutant base sequence, wherein the fluorescent dyes that bind to the oligonucleotides are different from each other; and (3) A step of detecting the PCR product; Includes, The aforementioned sample is blood or saliva. The PCR buffer contains KCl, MgCl 2 A Tris-HCl buffer comprising a dNTP mix (a mixture consisting of dATP, dGTP, dCTP, and dTTP), wherein the buffer contains a bio-derived negatively charged substance that adsorbs to DNA polymerase and a bio-derived positively charged substance that adsorbs to DNA, and contains a substance that binds to a substance that inhibits PCR and neutralizes the PCR-inhibiting effects of the negatively charged and positively charged substances, and is Ampdirect® or Ampdirect Plus®. A method wherein the PCR primer pair is shown by SEQ ID NO: 1 (forward) and SEQ ID NO: 2 (reverse), the base sequence of an oligonucleotide fluorescently labeled probe that binds to the mutant base sequence is shown by SEQ ID NO: 3, and the base sequence of an oligonucleotide fluorescently labeled probe that binds to the wild-type base sequence corresponding to the mutant base sequence is shown by SEQ ID NO:
4.
2. The method according to claim 1, wherein the RNF213 p.R4810K polymorphism is homozygous for the mutant or heterozygous for the mutant and the wild type.
3. The method according to claim 1 or 2, wherein in step (1) above, the surfactant is sodium dodecyl sulfate.
4. The method according to any one of claims 1 to 3, wherein, in step (3), if an increase in fluorescence intensity originating from an oligonucleotide fluorescently labeled probe bound to the mutant base sequence is observed, it is determined that the RNF213 p.R4810K polymorphism has been detected.
5. The method according to any one of claims 1 to 4, wherein it is determined that there is a high risk of developing cerebral infarction when the RNF213 p.R4810K polymorphism is detected.
6. The method according to any one of claims 1 to 5, wherein the cerebral infarction is moyamoya disease and atherothrombotic cerebral infarction.
7. A kit for detecting the p.R4810K polymorphism (RNF213 p.R4810K polymorphism) in the RNF213 gene present in genomic DNA in a sample collected from a subject, A PCR primer pair for amplifying a nucleotide sequence containing a gene mutation corresponding to the RNF213 p.R4810K polymorphism, and a set of oligonucleotide fluorescently labeled probes that bind to a mutant nucleotide sequence containing a gene mutation corresponding to the RNF213 p.R4810K polymorphism and a set of oligonucleotide fluorescently labeled probes that bind to a wild-type nucleotide sequence corresponding to the mutant nucleotide sequence, wherein the set of oligonucleotide fluorescently labeled probes has different fluorescent dyes that bind to the oligonucleotides, and a PCR buffer containing a surfactant and proteinase K. The aforementioned sample is blood or saliva. The PCR buffer is a Tris-HCl buffer containing KCl, MgCl2, and a dNTP mix (a mixture consisting of dATP, dGTP, dCTP, and dTTP), and is Ampdirect® or Ampdirect Plus®, which contains a biologically derived negatively charged substance that adsorbs to DNA polymerase and a biologically derived positively charged substance that adsorbs to DNA, and which binds to a substance that inhibits PCR, and neutralizes the PCR-inhibiting effects of the negatively charged substance and the positively charged substance. The PCR primer pair is indicated by SEQ ID NO: 1 (forward) and SEQ ID NO: 2 (reverse), The kit is characterized by a base sequence of an oligonucleotide fluorescently labeled probe that binds to a mutant base sequence containing a gene mutation corresponding to the RNF213 p.R4810K polymorphism, as shown in SEQ ID NO: 3, and a base sequence of an oligonucleotide fluorescently labeled probe that binds to a wild-type base sequence corresponding to the mutant base sequence, as shown in SEQ ID NO:
4.
8. The kit according to claim 7, wherein the surfactant is sodium dodecyl sulfate.