Viral vectors and nucleic acids for the treatment of ILD, PF-ILD, and IPF

Abstract

A viral vector comprising a capsid and a packaged nucleic acid, wherein the nucleic acid either increases an miRNA that is downregulated in a bleomycin-induced pulmonary fibrosis model or an AAV-TGFβ1-induced pulmonary fibrosis model, or inhibits an miRNA that is upregulated in a bleomycin-induced pulmonary fibrosis model or an AAV-TGFβ1-induced pulmonary fibrosis model.

Description

[Background technology]

[0001] The term interstitial lung disease (ILD) encompasses a broad and heterogeneous group of over 200 lung diseases, most of which are classified as rare. The primary abnormality in ILD is the destruction of the distal lung parenchyma, resulting in impaired gas exchange and restrictive ventilation. Generally, several forms of damage to alveolar epithelial cells are thought to trigger an inflammatory response paired with repair mechanisms. The wound healing process is pathologically reflected as inflammation, fibrosis, or a combination of both. Regardless of the underlying pathophysiology, the resulting alteration of the interstitial space leads to clinical symptoms such as dyspnea and cough, and results in restricted ventilation and impaired gas exchange on pulmonary function tests (Schwartz MI et al., 2011). There is no single, generally accepted classification of ILD. They can usually be classified based on their etiology (idiopathic disease or ILD with a known cause or association), clinical course (acute, subacute, or chronic ILD), and primary pathological features (inflammatory or fibrotic ILD). Fibrotic interstitial lung diseases (ILDs) are classified into three groups based on their longitudinal disease activity (Wells AU, 2004). ● Some cases of essentially non-progressive conditions, such as drug-induced lung disease after drug withdrawal or hypersensitivity pneumonitis (HP) after trigger removal; ● Progressive but stabilizable with immunomodulation, for example, several cases of connective tissue disease (CTD)-ILD (Tashkin DP et al., 2006; Fischer A et al., 2013; Morisset J et al., 2017; Adegunsoye A et al., 2017); ● Progression despite appropriate treatment for individual ILDs, such as idiopathic pulmonary fibrosis (IPF).

[0002] While IPF is the most well-known basic form of progressive fibrosis-associated intrapulmonary disease (PF-ILD), there is a group of patients with different ILD clinical diagnoses other than IPF who develop a progressive fibrotic phenotype during the course of their disease. These patients show many similarities to patients with IPF, including the fact that the disease is defined by an increasing degree of pulmonary fibrosis on imaging, decreased lung function, worsening respiratory symptoms and quality of life despite appropriate management for their respective ILDs, and ultimately, premature death (Flaherty KR et al., 2017; Wells AU et al., 2018; Cotton V et al., 2019; Kolb M et al., 2019). Similar to IPF, decreased FVC predicts patient mortality in patients with these other fibrotic ILDs (Jegal Y et al., 2005; Solomon JJ et al., 2016; Gimenez A et al., 2017; Goh NS et al., 2017; Volkmann ER et al., 2019). With the exception of patients with IPF, there are no approved palliative drug therapies for patients with ILD with progressive fibrosis, leaving many unmet medical needs. Following their clinical similarities, ILD with progressive fibrosis shares a common pathophysiological mechanism that exhibits a common fibrotic response to tissue damage (see Figure 3) (Thannickal VJ et al., 2014; Bagnato G ate al., 2015; Wollin L et al., 2019; Luckhardt TR et al., 2015). These mechanisms are multifactorial and complex. The pro-fibrotic and pro-proliferative environment in the lungs of ILD patients leads to an increase and proliferation of smooth muscle cells and endothelial cells. The resulting muscularization of distal pulmonary arterioles and increased capillary growth likely contribute to increased vascular resistance.

[0003] According to scientific literature, interstitial lung diseases (ILDs) that can be complicated by progressive fibrosis include, but are not limited to, autoimmune ILDs such as idiopathic nonspecific interstitial pneumonia (iNSIP) (Kim MY et al., 2012), unclassifiable idiopathic interstitial pneumonia (IIP) (Guler SA et al., 2018), hypersensitivity pneumonitis (HP) (Sadeleer LJ et al., 2019), rheumatoid arthritis-associated ILD (RA-ILD) (Doyle TJ & Dellaripa PF 2017) and SSc-ILD (Guler SA et al., 2018), sarcoidosis (Walsh SL et al., 2014), and occupational lung disease (Khalil N et al., 2007). The etiology of ILDs with progressive fibrosis, such as IPF, remains unclear. However, various irritants, including smoking, occupational hazards, viral and bacterial infections, as well as radiotherapy and chemotherapy agents (such as bleomycin), have been described as potential risk factors for the progression of IPF. Due to changes in the diagnostic criteria for IPF over the past few years, the prevalence of IPF varies considerably in the literature. Recent data show that the prevalence of IPF fluctuates between 14.0 and 63.0 cases per 100,000 people, while its incidence is between 6.8 and 17.4 new cases per 100,000 people per year (Ley B et al., 2013). IPF is usually diagnosed in older adults, with an average age of disease onset of 66 years (Hopkins RB et al., 2016). After initial diagnosis, IPF progresses rapidly within 3 to 5 years, with a mortality rate of approximately 60%. In contrast to IPF, the variable portion of patients with CTD (including rheumatoid arthritis (RA), Sjögren's syndrome, and systemic sclerosis (SSc)) or sarcoidosis exhibits a progressive fibrotic phenotype, with pulmonary fibrosis developing in approximately 10–20% of RA patients, 9–24% of Sjögren's syndrome patients, >70% of SSc patients (Mathai SC and Danoff SK, 2016), and 20–25% of sarcoidosis patients (Spagnolo P et al., 2018).

[0004] Two main histopathological features are observed in PF-ILD: nonspecific interstitial pneumonia (NSIP) and usual interstitial pneumonia (UIP). The histopathological features of IPF are progressive interstitial fibrosis caused by UIP and excessive extracellular matrix deposition. UIP is characterized by a heterogeneous appearance in which subpleural and parapleural fibrotic areas alternate with less affected or normal lung parenchymal tissue areas. Active fibrotic areas, so-called fibroblastic foci, are characterized by fibroblast accumulation and excessive collagen deposition. Fibroblastic foci are often located between the vascular endothelium and alveolar epithelium, thereby disrupting the lung structure and forming a characteristic "honeycomb structure." Clinical symptoms of IPF include dramatic oxygen diffusion impairment, progressive pulmonary dysfunction, cough, and severe quality of life impairment.

[0005] UIP is also one of the major histopathological features of RA-ILD and late sarcoidosis. However, other CTDs such as SSc or Sjögren's disease are primarily characterized by nonspecific interstitial pneumonia (NSIP).

[0006] NSIP is characterized by minimal spatial heterogeneity, meaning the pathological abnormalities are spread somewhat uniformly across the lungs. In the cellular NSIP subtype, the histopathology is characterized by inflammatory cells, while in the more common fibrotic subtype, the addition of significant fibrotic areas is evident. However, the pathological manifestations are highly diverse, which complicates accurate diagnosis and differentiation from other fibrotic types such as UIP / IPF.

[0007] Because the etiology of IPF is unknown, our knowledge of its pathological mechanisms at the cellular and molecular levels remains limited. However, recent advances in translational research using disease experimental models (in vitro and in vivo) for functional studies, as well as tissue samples from IPF patients for genomics / proteomics analysis, have enabled valuable insights into key disease mechanisms. Current understanding suggests that IPF begins with recurrent microinjuries to alveolar epithelial cells (AECs), ultimately leading to an uncontrolled and persistent wound-healing response. More specifically, AEC injury induces abnormal activation of adjacent epithelial cells, thereby leading to the recruitment of immune cells and stem cells or progenitor cells to the injury site. By secreting various cytokines, chemokines, and growth factors, the infiltrating cells create a pro-inflammatory environment, ultimately leading to the expansion and activation of fibroblasts. Under physiological conditions, these so-called myofibroblasts produce extracellular matrix (ECM) components, stabilizing and repairing the damaged tissue. Furthermore, in the later stages of the wound healing process, myofibroblasts contribute to tissue contraction and wound closure through their intrinsic contractile function. In contrast to physiological wound healing, inflammation and ECM production are not self-restricted in IPF. As a result, this leads to continuous deposition of ECM, ultimately resulting in progressive pulmonary sclerosis and destruction of lung structure. In fact, ECM biomarkers can be used in deciding when to initiate treatment for PF-ILD. See WO2017 / 207643. At the molecular level, the pathogenesis of IPF is organized by numerous pro-fibrosis mediators and signaling pathways. In addition to TGFβ, which plays a central role in IPF due to its potent fibrotic effect, tyrosine kinase signaling and elevated levels of various corresponding growth factors, such as platelet-derived growth factor (PDGF) and fibroblast growth factor (FGF), contribute to the development of IPF.

[0008] In recent years, several drugs have been clinically tested for the treatment of IPF. However, to date, only two drugs, pirfenidone (Esbriet®, Roche / Genentech) and nintedanib (Ofev®, Boehringer Ingelheim), have demonstrated a convincing therapeutic effect in slowing disease progression by demonstrating a reduction in the rate of lung function decline. Despite these promising results, the medical need for IPF remains high, and there is an urgent need for further treatments that are more effective and, ideally, have the potential to modify the disease. Nintedanib is also approved for the treatment of systemic sclerosis-associated interstitial lung disease (ILD) and chronic fibrotic interstitial pneumonia with a progressive phenotype. Generally, current ILD management is primarily based on suppressing inflammation with corticosteroids or immunomodulatory therapy. The latter is based on case reports and uncontrolled treatment responses in small case series using azathioprine, cyclosporine, cyclophosphamide, mycophenolate mofetil, rituximab, and tacrolimus. Some ILDs, such as some cases of CTD-ILD, can be stabilized by immunomodulation (Tashkin DP et al., 2006; Fischer A et al., 2013; Morisset J et al., 2017; Adegunsoye A et al., 2017), while others remain progressive despite appropriate (pharmacological and / or non-pharmacological) treatments for their respective ILDs (Wells AU 2004), further demonstrating the remaining high demand for innovative therapeutic approaches.

[0009] Pulmonary hypertension (PH) is one of the most frequent complications of interstitial lung disease (ILD) and can be an independent driving factor of early mortality (Galie N et al., 2015). PH is defined as a disease characterized by elevated right ventricular systolic pressure (RVSP), right ventricular pressure overload, and right atrial and ventricular dilation (Smith et al. (2013), Am J Med Sci, 346(3):221-225).

[0010] Chronic fibrotic silicosis belongs to the ILD family. It is caused by chronic and repeated inhalation of crystalline silica, which damages epithelial cells in the alveolar space and activates macrophages, leading to an inflammatory response. Both factors result in the activation of resident fibroblasts and the massive deposition of associated extracellular matrix in these lung regions. [Technical Field]

[0011] Given the vast number of pathways involved in the development of IPF and other fibrotic ILDs, multi-target therapies aimed at simultaneously modulating various disease mechanisms are likely to be the most effective. However, classical pharmacological strategies using small molecule compounds (NCEs) or biomaterials (NBEs), such as monoclonal antibodies, are difficult to implement in each approach because both are typically designed to specifically inhibit or activate a single drug target or a small set of closely related molecules. To enable multi-target therapies for PF-ILD, microRNAs (miRNAs) represent a novel and highly attractive class of targets based on their ability to control and fine-tune entire signaling pathways or cellular mechanisms by regulating mRNA expression levels of specific target gene sets under physiological and pathophysiological conditions. miRNAs are small non-coding RNAs that are transcribed as precursor molecules (pri-miRNAs). In the nucleus, pri-miRNAs undergo a first maturation process, producing so-called pre-miRNAs characterized by a small hairpin structure. Following nuclear export, pre-miRNAs undergo a second processing step mediated by the Dicer enzyme, generating fully matured, double-stranded miRNAs approximately 22 nucleotides long. To exert their gene regulatory function, mature miRNAs are integrated into the RNA-induced silencing complex (RISC), enabling them to bind to the miRNA-binding site located at the 3'-UTR of target mRNA. Upon binding, miRNAs regulate gene expression by inducing destabilization and cleavage of the target mRNA and / or inhibiting protein translation of each mRNA. To date, more than 2000 miRNAs have been identified in humans, potentially regulating up to 30% of the transcriptome (Hammond SM, 2015).

[0012] This invention discloses the identification of miRNAs involved in the pathogenesis of fibrotic lung disease, and the treatment of lung diseases such as PF-ILD in patients with intravascular lung disease (ILD), preferably PF-ILD patients, and especially IPF patients, by regulating the function of each miRNA using viral vectors, particularly adeno-associated virus (AAV). While this invention focuses on the treatment of humans, any mammal, particularly companion mammals such as horses, dogs, and cats, is also within the scope of the invention. [Overview of the project]

[0013] Ofev is not recommended for patients with moderate (Childpew B) or severe (Childpew C) hepatic impairment (see EPAR). Esbriet should not be used in patients already taking fluvoxamine (a drug used to treat depression and obsessive-compulsive disorder) or in patients with severe hepatic or renal abnormalities (see EPAR). Therefore, there is still a high medical need for PF-ILD patients, particularly IPF patients with severe hepatic and renal abnormalities. An object of the present invention is to provide an alternative treatment. Another object of the present invention is to provide a qualified alternative treatment even for patient groups who cannot benefit from existing treatments.

[0014] While Esbriet and Ofev demonstrate reliable efficacy, they also have side effects that may limit the option of combination therapy with both drugs (see both EPARs). Therefore, combination therapy with either Ofev or Esbriet could be an option to increase overall therapeutic efficacy, given the high medical need for ILD treatment, such as PF-ILD and especially IPF treatment, with fewer side effects, or at least different side effects than those of Ofev or Esbriet. Another object of the present invention is to provide an alternative treatment option with a different risk / benefit profile compared to established treatment options, for example, with fewer or different side effects compared to established treatment options. While Ofev and Esbriet are intended for oral, i.e., systemic use, there is still a need for a treatment option that can be administered locally or via both local and systemic routes. Another object of the present invention is to provide a treatment option that can be administered locally or via both local and systemic routes.

[0015] Another object of the present invention is, - Treatment options for ILD, PF-ILD, or IPF involving single or limited-number administration of an active ingredient, and / or - Treatment options for ILD, PF-ILD, or IPF that address multiple aspects of the ILD and / or IPF phenotype, and / or - Treatment options for ILD, PF-ILD, or IPF that also address multiple aspects of the ILD and / or IPF phenotype, and / or - Treatment options for ILD, PF-ILD, or IPF that may have a beneficial effect on diseases that cause significant comorbidities with ILD, PF-ILD, and / or IPF, and / or Compositions of tool compounds that reduce one or more aspects of the ILD, PF-ILD, or IPF phenotype in animal and cell models of ILD, PF-ILD, or IPF. The objective is to provide.

[0016] In one aspect, the present invention generally relates to therapeutic agents for the treatment of ILD, and particularly for the treatment of PF-ILD and IPF, namely viral vectors or miRNA mimics.

[0017] The viral vectors according to the present invention prevent or delay the decrease in vital capacity seen in these diseases by preventing or delaying one or more aspects of tissue remodeling such as ECM deposition seen in ILD, preferably PF-ILD, more preferably IPF, by miRNA functional regulation (see WO2017 / 207643 and references). The viral vectors described in the present invention can be administered to patients via local (intranasal, intratracheal, inhalation) or systemic (intravenous) routes. In particular, AAV vectors can target the lungs extremely efficiently and have low antigenicity, so they are particularly suitable for systemic administration.

[0018] From a therapeutic perspective, miRNA function can be regulated by increasing the effect of endogenous miRNAs that are downregulated in a fibrotic state by delivering miRNA mimics, or by delivering molecules that block miRNAs or so-called anti-miRs or miRNA sponges to reduce their availability and inhibit the functionality of endogenous miRNAs that are upregulated under pathological conditions.

[0019] Furthermore, the miRNAs described in the present invention that are upregulated may also exert a protective function as part of the natural anti-fibrotic response. However, it is clear that this effect alone is not sufficient to resolve the disease state. Therefore, in certain cases, delivery of miRNA mimics of sequences that are already elevated in a fibrotic state may further enhance their anti-fibrotic efficacy, thereby providing an additional model for therapeutic intervention.

[0020] Based on the fact that miRNAs direct the simultaneous regulation of multiple target genes, regulating miRNA function via viral vectors presents an attractive strategy that enables multi-target therapies by influencing different disease pathways. The pulmonary fibrosis-related miRNAs described in this invention are distinguished from previously identified miRNAs by regulating different sets of target genes, thereby offering the potential for enhanced therapeutic efficacy.

[0021] In this invention, a set of pulmonary fibrosis-associated miRNAs was identified through detailed characterization and computational analysis of two disease-related animal models, particularly bleomycin-induced lung injury characterized by a patchy acute inflammation-induced fibrosis phenotype, and AAV-TGFβ1-induced fibrosis reminiscent of a more homogeneous NSIP pattern. To enable the identification of disease-associated miRNAs, longitudinal transcriptional profiles and functional data of miRNAs and mRNAs were created. Furthermore, highly reliable miRNA-mRNA regulatory relationships were constructed based on the inverse correlation between sequence and expression, and it was possible to characterize miRNAs in the context of the disease model based on their target sets. To further elaborate on these findings, synthetic RNA oligonucleotide mimes of selected miRNA candidates (mir-29a-3p, mir-10a-5p, mir-181a-5p, mir-181b-5p, mir-212-5p) were constructed and used in transient transfection experiments in cellular fibrosis models of human primary lung fibroblasts, human primary bronchial airway epithelial cells, and A549 cells. The effects of transiently transfected miRNAs were investigated in key aspects of TGFβ-induced fibrotic remodeling (inflammation, proliferation, fibroblast-to-myofibroblast transition (FMT), epithelial-to-mesenchymal transition (EMT)), confirming the predicted anti-fibrotic effects of the selected miRNAs. Finally, to translate these findings into clinical applications, we describe a novel therapeutic method for fibrotic lung disease that enables the regulation of PF-ILD-related miRNAs using adeno-associated virus (AAV) vector-based gene delivery.

[0022] The miRNA mimes according to the present invention inhibit or delay one or more aspects of tissue alteration, such as ECM deposition, seen in ILDS like PF-ILD and IPF, by regulating miRNA function, thereby stopping or delaying the decline in forced vital capacity seen in these diseases (see WO2017 / 207643 and references). Compared to viral vectors according to the present invention, they have a different side effect profile, such as potentially lower antigenicity, thereby potentially enabling multiple therapies without the use of immunosuppressant combination therapy.

[0023] Longitudinal detailed analysis in two disease-associated animal models, namely bleomycin and AAV-TGFβ1-induced pulmonary fibrosis models in mice, identified 28 novel miRNA sets. To select the most relevant miRNAs, we developed a hit selection strategy based on systematic correlation analysis between gene expression profile data and fundamental functional disease parameters. Considering the chronic nature of PF-ILD, we describe the expression of miRNAs, anti-miRs, or miRNA sponges using viral vectors, particularly adeno-associated virus (AAV)-based vectors, as a novel therapeutic concept enabling the long-term sustained expression of therapeutic nucleic acids for functional modulation of fibrosis-associated miRNAs. [Brief explanation of the drawing]

[0024] [Figure 1] The study design is illustrated. A total of 130 C57Bl / 6 mice were administered intratracheally with either NaCl, 1 mg / kg bleomycin, or a 2.5 x 10¹¹ vector genome (vg) of either AAV6.2-Stuffer control or AAV6.2-CMV-TGFβ1 vector. Pulmonary function measurements were performed and wet lung weight was measured at each readout and sampling (RS) time shown in the scheme. The left lung was then used for histological evaluation of fibrosis progression, and the right lung was lysed for isolation of whole lung RNA. The RNA was used for next-generation sequencing to profile gene expression changes correlated with disease onset. [Figure 2]Data regarding the functional characterization of lung pathology are presented. Mice were treated as shown in Figure 1, and the progression of fibrosis was measured. (A) Masson trichrome-stained histological lung sections showed clear signs of fibrosis from 21 days post-administration, including alveolar septal thickening, increased extracellular matrix deposition, and the presence of immune cells. The lower panel image shows a 10x magnified view of the micrograph from the upper panel. (B) Increased wet lung weight in AAV-TGFβ1 and bleomycin-treated animals indicated increased ECM deposition, and (C) severe impairment of lung function in fibrotic animals. Mean + / -SD, **p<0.01, ***p<0.001, compared to each control treatment. [Figure 3] The results of the gene expression analysis are summarized below. By performing parallel sequencing of mRNA and miRNA, upregulated and downregulated mRNA(A) and miRNA(B) were identified at all time points analyzed in both models. The cutoff criteria for identifying differentially expressed genes were P adj.(FDR)≦0.05, abs(log2FC)≧0.5(FC≧1.414). (C) mRNAs showing differential expression in only one model were isolated at each time point from mRNAs differentially expressed in both models (commonly DE), and KEGG pathway enrichment analysis was performed. The data showed enrichment for acute inflammation ("cytokine-cytokine interaction") at the early time point in the bleomycin model, but not in the AAV model. On the other hand, enrichment for fibrosis progression (ECM receptor interaction) was observed in a time-dependent manner in both models. [Figure 4]This report provides an overview of the filtering process applied to the identification of fibrosis-related miRNAs. In the first stage, miRNAs (C) correlated with lung function and / or lung weight, or inversely correlated miRNAs (AC), were identified in at least one of the two models. Subsequently, correlated and inversely correlated miRNAs were filtered to search for candidates exhibiting differential gene expression. By definition, a miRNA was considered to be differentially expressed if its expression level changed (P adj.(FDR) ≤ 0.05, abs(log2FC) ≥ 0.5; upregulation or downregulation) in at least one animal model over one or more time points. In the final stage, the filtered miRNAs were evaluated for species conservation. miRNAs showing sequence identity in the seed region and having an alignment score of at least 20 against the mature miRNA sequence between mouse and human were considered homologs, while the remaining miRNAs were classified as mouse-specific and therefore non-conserved. Finally, the resulting hit list was manually curated by excluding candidates with different or strongly variable expression profiles, patented miRNAs, and upregulated non-conserved miRNAs that are not targeted in humans. [Figure 5A] Figure 4 shows fibrosis-related miRNAs identified by filtering. With the exception of mmu-miR-30f and mmu-miR-7656-3p, for which no human homologs were identified, all displayed miRNAs are species-conserved (very similar or identical). Mismatches to human homologs are indicated in bold and underlined. The displayed sequences represent processed and fully matured miRNAs. [Figure 5B] Figure 5B shows the closest human homologs of the mouse sequence that are very similar (but not identical). The sequences shown are also compiled in the sequence listing. In case of any inconsistencies between the sequence listing and Figures 5A and 5B, Figure 5 represents the true sequence. [Figure 6]The target prediction workflow is schematically shown. For the miRNA candidates shown in Figure 5, mRNA targets were predicted by matching them with the DIANA, MiRanda, PicTar, TargetScan, and miRDB databases. The mRNAs predicted in at least two of the five databases were examined and further filtered by the inverse correlation of expression between miRNAs and mRNA measurements in animal models. Predicted mRNAs whose longitudinal expression was inversely correlated (rho ≤ -0.6) with the corresponding miRNA expression were called putative targets. Subsequently, the target list was subjected to pathway enrichment analysis for the functional characteristics of the miRNA target spectrum. [Figure 7] The characteristics of miRNA function are described based on the enrichment of the predicted target set. For each miRNA, the predicted target set underwent enrichment testing against reference gene sets from different sources. The table shows the -log(p adj) values ​​of a subset of selected miRNA sets against a small subset of selected gene sets relevant in the context of pulmonary fibrosis. Higher values ​​indicate stronger enrichment. [Figure 8]This document describes vector designs to enable the expression of miRNAs or miRNA-targeted constructs. (A) Single miRNAs or miRNA combinations that are downregulated under fibrotic conditions can be expressed from vectors using polymerase II (Pol-II) or polymerase III (Pol-III) promoters. miRNA sequences can be expressed using the native backbone of each miRNA or by embedding them in an exogenous miRNA backbone, thereby producing artificial miRNAs. In both cases, the miRNAs are expressed as precursor miRNAs (pre-miRNAs) and processed into mature miRNAs within the cell. Mechanistically, the processed miRNAs selectively bind to the miRNA-binding site located at the 3'-UTR of the target gene, thereby resulting in a reduction in the expression level of fibrosis-related genes through mRNA degradation and / or inhibition of protein translation. (B) Inhibition of endogenous miRNAs that are upregulated under fibrotic conditions can be achieved by expressing antisense-like molecules, so-called anti-miRs. Each sequence can be expressed using a Pol-II or Pol-III promoter from an shRNA backbone or an artificial miRNA backbone. After intracellular processing, anti-miRs bind to profibrosis-promoting target miRNAs, thereby inhibiting their functionality. (C) Another approach to inhibiting profibrosis-promoting miRNAs is the expression of miRNA-specific target sequences, so-called sponges. Expression using the Pol-II promoter causes the miRNA sponge to block profibrosis-promoting miRNAs, thereby inhibiting their pathological function. [Figure 9] The generation of adeno-associated virus (AAV) vectors for miRNA expression or pulmonary delivery of miRNA-targeted constructs is illustrated. Flanking of the expression construct by AAV reverse terminal repeats (ITRs) at the 5' and 3' ends enables packaging into AAV vectors. Various native serotypes (AAV5, AAV6) or modified capsid mutations (AAV2-L1, AAV6.2) have been described in the past as highly potent vectors enabling efficient gene delivery to the lungs via both local (intranasal, intratracheal, inhalation) or systemic (intravenous) administration routes. [Figure 10] This paper provides examples of AAV-mediated gene delivery to the lung by different AAV serotypes or capsid variants. (A) Immunohistochemical staining of green fluorescent protein (GFP) expression in C57BL / 6J mouse lung sections two weeks after intravenous injection of AAV2-L1-GFP (3 x 10¹¹vg / mouse), a recently described AAV2 mutation containing a peptide insertion motif that enables lung-specific gene delivery via systemic administration (Korbelin J et al., 2016). No specific signal beyond background staining was observed in the PBS control group. Representative images from 2 mice (ms1, ms2) out of n=6 animals per group. (B) Evaluation of AAV2-L1 in vivo distribution in FVB / N mice by in vivo imaging (published data, Korbelin J et al., 2016). Lung-specific expression of firefly luciferase (fLuc) was observed 2 weeks after intravenous injection of fLuc-expressing AAV2-L1 vector at a dose of 5 x 10¹⁰ vg / mouse. (C) Ex vivo imaging of mouse lungs prepared from C57BL / 6J mice 2 weeks after intratracheal infusion of fLuc-expressing AAV5 vector (2.9 x 10¹⁰ vg / mouse) or PBS as a negative control. Quantitative pulmonary transduction was observed by detecting luminescence from fLuc-positive cells in AAV5-fLuc-treated animals using a luminescence (Lum) channel. Bright-field (BF) images of the prepared lungs are shown in the upper panel. Representative images of 2 mice (ms1, ms2) out of 4 animals per group are shown. (D) Analysis of AAV6.2 intermediated lung delivery in Balb / c mice 3 weeks after intratracheal administration of GFP-expressing AAV6.2 vector at a dose of 3 x 10¹¹ vg / mouse. Microscopic images of histological lung sections show direct GFP fluorescence (right) and immunohistochemical analysis of GFP expression (left). No specific signals beyond background staining were observed in the PBS control group. Representative images from n=5 animals per group are shown. [Figure 11]Examples of different miRNA expression cassettes are provided. A) Vector maps of CMV-mir181a-scAAV (double-stranded AAV vector genome for co-expression of cDNA (eGFP) and miRNA) and CMV-mir181a-mir181b-mir10a-scAAV (double-stranded AAV vector genome for co-expression of three miRNAs). B) Illustrations of different miRNA designs in the miR-E backbone using mir-181b-5p as an example. The first two examples show mir-181b-5p incorporated as a fully mature miRNA (23nt) in a passenger or guide position in the miR-E backbone using perfectly matched complementary strands. The second example shows a construct design incorporating mir-181b-5p in the miR-E backbone as a native pre-miRNA. Predicted 2D structure of mir-181b-5p from mirBase (http: / / mirbase.org / ). [Figure 12] This study demonstrates the knockdown efficiency of miR181a-5p and miR212-5p on a mir-E backbone in a GFP expression construct with a target sequence corresponding to the 3'UTR. HEK-293 cells were transiently transfected with a GFP expression construct along with a plasmid encoding a single miRNA. GFP fluorescence was measured 72 hours after transfection. The positive control was the optimal mir-E construct, while the negative control was a GFP construct without a target sequence in the 3'UTR. Experiments for mir181a-5p were performed using constructs based on the guide position and miR-E backbone according to SEQ ID NOs. 49 and 47. Experiments for miR212-5p were based on constructs (miR-E backbone, guide position) according to SEQ ID NOs. 61 and 59, respectively. See also Figure 25. Experiments for miR29a-3p used the construct according to SEQ ID NO. 86, and similarly, the control used the construct according to SEQ ID NO. 83. In particular, sequence numbers 49 and 61 contain miRNAs that are 1 nt shorter at the 3' end than the respective reference sequences miRNA212-5p and miRNA181a-5p, respectively, based on sequence numbers 15 and 17. [Figure 13] This shows the basal miRNA expression of human orthologues of mouse miRNA candidates in human normal lung fibroblasts (NHLF) measured using small RNA sequencing with n=6 replications. Expression levels are shown in counts per million (cpm). Arrows indicate miRNA candidates of particular interest that were selected for further functional characterization. [Figure 14] This study demonstrates the effect of miRNAs on inflammatory IL-6 expression in unstimulated or TGFβ1-stimulated A549 cells. IL-6 is a major inflammatory cytokine in various fibrous diseases, such as IPF or systemic sclerosis. This cytokine is produced, among other things, by activated epithelial cells and can stimulate fibroblasts and immune cells, thereby inducing fibrotic reactions / transformations. Therefore, TGFβ-treated A549 lung epithelial cells are a good alternative model to mimic the pathophysiological aspects of inflammation in IPF. (A) IL-6 expression was evaluated by transfecting cells with a miRNA control construct (Ctrl) or a mimetic of the displayed miRNA candidate at a concentration of 2 nM. 24 hours after transfection, cells were stimulated with 5 ng / mL TGFβ1 for a further 24 hours. Extracted RNA was then reverse transcribed to cDNA, and IL-6 gene expression was measured by qPCR. (B) Cells were transfected and stimulated as described in (A), and secreted IL-6 protein in the cell supernatant was detected by ELISA. Expression levels are expressed relative to the unstimulated miRNA control construct (Ctrl). Triple = simultaneous transfection of miR-10a-5p, miR-181a-5p, and miR-181b-5p. Experiment n=3, mean ±SD, *p<0.05, **p<0.01, ***p<0.001 (miRNA candidate vs. Ctrl). [Figure 15A]This paper demonstrates the effects of individual miRNAs and their combinations on epithelial-mesenchymal transition (EMT) in normal human bronchial epithelial cells (NHBECs). EMT is considered a key initiating factor in the development of fibrous lung remodeling. Recurrent epithelial cell damage leads to chronic secretion of the growth factor TGFβ, inducing the transformation of epithelial cells into mesenchymal (or mesenchymal) cells. These cells lose their epithelial function / integrity, resulting in decreased barrier function and air exchange capacity, and an increase in extracellular matrix deposition begins. All three aspects are characteristic of IPF disease. The cellular marker E-cadherin is a marker for functional and complete epithelial cells. The disappearance of E-cadherin is considered a marker of EMT. An increase in E-cadherin indicates the maintenance of epithelial properties and is therefore considered anti-fibrotic. EMT was evaluated by transfecting cells with a miRNA control construct (Ctrl), a 2nM mimite concentration of the miRNA candidate shown, or a combination thereof at 4nM or 12nM, as shown in the figure, followed by stimulation with 5ng / mL TGFβ1. E-cadherin (an epithelial cell marker) was immunostained after 72 hours and quantified by high-content cell imaging, normalized by the number of cells detected, and the doubling between miRNA candidate and control is shown here. Repeats n=4, mean ± SD, *p<0.05, **p<0.01 (miRNA candidate vs. Ctrl). SSMD: Strictly standardized mean difference; #:|SSMD|>2, ##:|SSMD|>3, ###:|SSMD|>5. [Figure 15B]This study provides dose / response experiments on epithelial-mesenchymal transition (EMT) in human normal bronchial epithelial cells (NHBECs) for individual miRNAs (miR181a-5p, miR-181b-5p, miR-10a-5p, miR-212-3p, and miR-212-5p, respectively) and their combinations. EMT was evaluated by transfecting cells with either a miRNA control construct (Ctrl) or increasing concentrations of mimetic E-cadherin (a marker for epithelial cells) was immunostained after 72 hours, quantified by high-content cell imaging, and normalized by the number of detected cells. Hereinafter, a twofold change was observed between miRNA candidates and controls. The increase in E-cadherin indicates the maintenance of epithelial characteristics and is therefore considered to be anti-fibrotic. Repeats n=4, mean ± SD, *p<0.05, **p<0.01 (miRNA candidate vs. Ctrl). [Figure 16]This study demonstrates the effect of miRNAs on inflammatory IL-6 expression in unstimulated or TGFβ1-stimulated human normal lung fibroblasts (NHLF). IL-6 is a major inflammatory cytokine in various fibrotic diseases, such as IPF or systemic sclerosis. This cytokine, among others, is produced by activated epithelial cells and can stimulate fibroblasts and immune cells, leading to fibrotic reactions / transformations. However, activated pro-fibrotic fibroblasts, especially those with an aging phenotype, also produce many inflammatory cytokines, with IL-6 being one of the most prominent. Therefore, TGFβ-treated human primary lung fibroblasts (NHLF) are a good alternative model for mimicking the pathophysiological aspects of inflammation in IPF. IL-6 expression was evaluated by transfection of cells with a miRNA control construct (Ctrl) or a 2 nM mimetic concentration of the indicated miRNA candidate. 24 hours after transfection, cells were further stimulated with 5 ng / mL TGFβ1 for another 24 hours. The extracted RNA was then reverse transcribed into cDNA, and IL6 gene expression was measured by qPCR. Repeats n=3, mean ±SD, *p<0.05, **p<0.01, ***p<0.001 (miRNA candidate vs. Ctrl). [Figure 17]This study demonstrates the effects of miRNAs on the proliferation of unstimulated or TGFβ1-stimulated human normal pulmonary fibroblasts (NHLF). Regulated fibroblast proliferation is a crucial aspect of any injury healing process. Fibrotic diseases, including pulmonary fibrosis, are abnormal injury healing processes with abnormal and unregulated fibroblast proliferation. This, too, is partially driven by the growth factor TGFβ. Therefore, measuring the proliferation of TGFβ-activated pulmonary fibroblasts is an important analysis for mimicking this pathophysiological aspect. A decrease in fibroblast proliferation is considered an anti-fibrotic effect. Proliferation was assessed by transfecting cells with a miRNA control construct (Ctrl) or a mimite of the displayed miRNA candidate at a concentration of 2 nM, followed by stimulation with 5 ng / mL TGFβ1. Proliferation was measured using spectrophotometric enzymatic WST-1 proliferation analysis, which measures cellular metabolic activity (mitochondrial dehydrogenase) as a direct correlation with cell number. Repeats n=3, mean ± SD, *p<0.05, **p<0.01 (miRNA candidate vs. Ctrl). [Figure 18]This study demonstrates the effects of individual miRNAs and combinations thereof on the transition from fibroblasts to myofibroblasts (FMT) in normal human lung fibroblasts (NHLF). FMT is considered another important initiating factor in the development of fibropulmonary remodeling. Recurrent epithelial cell injury leads to chronic secretion of the growth factor TGFβ, which induces the activation of normal resident lung fibroblasts into myofibroblasts. The expression of α-smooth muscle actin makes myofibroblasts highly contractile, initiating increased deposition of many extracellular matrix components, including collagen. Myofibroblasts are considered the main driving factors of the scarring process in fibrotic diseases. Two markers for myofibroblasts are increased cellular levels of deposited collagen detected through α-smooth muscle actin and the subunit Col1a1. Increased E-cadherin indicates the maintenance of epithelial properties and is therefore considered anti-fibrotic. Decreased collagen indicates the loss of myofibroblast properties and is therefore considered anti-fibrotic. FMT was evaluated by transfecting cells with a miRNA control construct (Ctrl), a 2nM mimetic concentration of the miRNA candidate shown, or a combination thereof at 4nM or 12nM, as shown in the figure, followed by stimulation with 5ng / mL TGFβ1. Collagen type 1 α1 (a marker for myofibroblasts) was immunostained after 72 hours and quantified by high-content cell imaging, normalized by the number of cells detected, and the fold change between miRNA candidate and control is shown here. Donor n=2 (4 repetitions each), mean ± SD, *p<0.05, **p<0.01 (miRNA candidate vs. Ctrl). SSMD: Strictly Standardized Mean Difference; #:|SSMD|>2. [Figure 19]This study demonstrates the effects of miRNA-181a-5p and miR-212-5p alone on collagen 1 deposition in normal and IPF lung fibroblasts. Collagen 1 deposition was assessed by transfecting cells with either a miRNA control construct (Ctrl) or increased concentrations of mimetic miminants of the candidate miRNAs (0.25 nM, 0.5 nM, 1 nM, 2 nM, 4 nM, 8 nM, 16 nM). Cells were stimulated with 5 ng / ml TGFβ1. Collagen type 1 α1 was immunostained after 72 hours and quantified by high-content cell imaging, normalized by the number of cells detected, and the fold change between candidate miRNAs and controls is shown here. The decrease in collagen indicates the loss of myofibroblast characteristics and is therefore considered anti-fibrotic. Donor n=7, mean ± SD. Two-way ANOVA, Dunnett's multiple comparisons. [Figure 20]This study demonstrates the effects of miRNA-181a-5p and miR212-5p on the expression of different collagen subtypes in lung fibroblasts. FMT is considered another important initiating factor in the development of fibrous lung remodeling. Recurrent epithelial cell injury leads to chronic secretion of the growth factor TGFβ, which induces the activation of normal resident lung fibroblasts into myofibroblasts. Myofibroblasts are considered the main driving factors of the scarring process in fibrous diseases because they produce many extracellular matrix components, such as different types of collagen. Collagen 1, 3, and 5 in particular are considered components of the fibrous scar matrix. Detection of collagen subunits (Col1a1, 3a1, and 5a1) in fibroblasts after TGFβ activation is considered a good surrogate for this pathophysiological aspect in fibrous diseases. A decrease in collagen subunits is considered anti-fibrotic. A) Col1a1 and B) Col5a1 protein expression, and C) Col3a1 mRNA expression were evaluated by transfecting cells with a miRNA control construct (Ctrl), 2nM mimetic miminants of the displayed miRNA candidates (single-stranded miRNAs), or a 2+2nM combination of miRNAs. Cells were stimulated with 5 ng / ml TGFβ1. After 72 hours, collagen types 1α1 and 5α1 were immunostained by Western blotting and quantified by densitometry. Collagen expression was normalized to GAPDH expression. Col3a1 was quantified by RT-qPCR after 24 hours. Col3a1 mRNA expression was normalized to HPRT mRNA using the delta / delta cT method. A decrease in collagen indicates a decrease in fibrosis. A(n=5) and B(n=3) show the fold change between miRNA candidates and control + TGFβ1, and C(n=4) shows the fold change between miRNA candidates and miRNA control + TGFβ1. Mean ± SD, *p<0.05, **p<0.01, one-way ANOVA, Tukey's multiple comparison test. [Figure 21]This study demonstrates the effects of miRNA-181a-5p and miR212-5p on Col1a1 mRNA expression on lung fibroblasts in A549 epithelial-fibroblast co-culture. Col1a1 mRNA expression was evaluated by transfection of cells with either a miRNA control construct (Ctrl) or a 2nM mimetic of the indicated miRNA candidate. A549 cells were seeded to 100% confluence on a permeable induction cell filter together with subcultured lung fibroblasts. Although A549 cells and fibroblasts were separated by the filter, A549 secreted factors could still flow into the fibroblasts. Only A549 cells were stimulated with 5 ng / ml TGFβ1, while subseeded lung fibroblasts were not stimulated with exogenous TGFβ1. After 24 hours, collagen type 1a1 mRNA in lung fibroblasts was quantified by RT-qPCR. Col1a1 mRNA expression was normalized with HPRT mRNA using the delta / delta cT method. A decrease in collagen indicates a decrease in fibrosis. This shows the magnification change between miRNA candidates and miRNA control + TGFβ1 (n=3). Mean ± SD, *p<0.05, **p<0.01, one-way ANOVA, Tukey's multiple comparison test. [Figure 22]The effects of miRNA-29a-3p, miRNA-181a-5p, and miR-212-5p individually, as well as combinations of these miRNAs, on collagen 1 deposition in normal and IPF lung fibroblasts are also shown. FMT is considered another important initiating factor in the development of fibropulmonary remodeling. Recurrent epithelial cell injury leads to chronic secretion of the growth factor TGFβ, which induces the activation of normal resident lung fibroblasts into myofibroblasts. With the expression of α-smooth muscle actin, myofibroblasts become highly contractile, initiating increased massive deposition of many extracellular matrix components, including collagen. Myofibroblasts are considered the main driving factors of the scarring process in fibrotic diseases. Two markers for myofibroblasts are α-smooth muscle actin and increased cellular levels of deposited collagen detected through the subunit Col1a1. A decrease in collagen indicates a loss of myofibroblast characteristics and is therefore considered anti-fibrotic. Collagen 1 deposition was evaluated by transfecting cells with either a miRNA control construct (Ctrl) or increased concentrations of mimetic miminants of the indicated miRNA candidates (single miRNA: 1nM, 2nM, 4nM; combination of two: 0.5nM, 1nM, 2nM each; combination of three: 0.33nM, 0.66nM, 1.33nM each). Cells were stimulated with 5ng / ml TGFβ1. Collagen type 1 α1 was immunostained after 72 hours and quantified by high-content cell imaging, normalized by the number of detected cells, and the magnification changes between miRNA candidates and controls are shown here. The decrease in collagen indicates the loss of myofibroblast characteristics and is therefore considered anti-fibrotic. For single miRNA experiments, n=7 donors; for miRNA combination experiments, n=4; mean ± SD. Two-way ANOVA, Dunnett's multiple comparisons. [Figure 23]The effects of individual miRNA-29a-3p, miRNA181a-5p, and miR212-5p, as well as combinations of these miRNAs, on the expression of different collagens in lung fibroblasts (healthy individuals and IPF) are also shown. FMT is considered another important initiating factor in the development of fibrous lung remodeling. Recurrent epithelial cell injury leads to chronic secretion of the growth factor TGFβ, which induces the activation of normal resident lung fibroblasts into myofibroblasts. Myofibroblasts are considered the main driving factors of the scarring process in fibrotic diseases because they produce many extracellular matrix components, such as different types of collagen. Collagen 1, 3, and 5 in particular are considered components of the fibrotic scar matrix. Detection of collagen subunits (Col1a1, 3a1, and 5a1) in fibroblasts after TGFβ activation is considered a good surrogate for this pathophysiological aspect in fibrotic diseases. A decrease in collagen subunits is considered anti-fibrotic. A) Col1a1 and B) Col5a1 protein expression, and C) Col3a1 mRNA expression were evaluated by transfecting cells with one of three combinations: a miRNA control construct (Ctrl), 2nM mimetic miminals of candidate miRNAs to be expressed (single miRNA), or 2nM+2nM miRNA combinations, and 1.3nM miRNA per combination. Cells were stimulated with 5 ng / ml TGFβ1. After 72 hours, collagen types 1α1 and 5α1 were immunostained by Western blotting and quantified by densitometry. Collagen expression was normalized by GAPDH expression. Col3a1 was quantified by RT-qPCR after 24 hours. Col3a1 mRNA expression was normalized by HPRT mRNA using the delta / delta cT method. A decrease in collagen indicates a decrease in fibrosis. For A(n=5) and B(n=3), the multiplier change between miRNA candidate and control + TGFβ1 is shown, and for C(n=4), the multiplier change between miRNA candidate and miRNA control + TGFβ1 is shown. Mean ± SD, *p<0.05, **p<0.01, one-way ANOVA, Tukey's multiple comparison test. [Figure 24] Figure 23 shows some of the results. [Figure 25]This shows the pulmonary expression of 22nt miR-212-5p after expression of AAV-miR-212-5p from a 22nt cassette. Mice were intratracheally infused with either a Staffer-negative control AAV or three increasing doses (9 x 10⁹vg, 10 x 10¹⁰vg, and 1 x 10¹¹vg) of miR-212-5p-AAV(22nt). Mice were euthanized 7, 14, and 28 days after AAV administration. Lungs were flash-frozen in liquid nitrogen and processed into frozen lung powder for total RNA isolation. The multiplier changes in miR-212-5p(22nt) between different AAV doses are shown compared to the respective Staffer control at each time point. Values ​​are shown as mean ± SD. Staffer group n=6-7, miR-212-5p AAV group n=7, p<0.05, **p<0.01, ***p<0.001, one-way ANOVA, Dunnett's multiple comparison test at different time points. The experiment was based on the construct according to SEQ ID NO: 61 to express miR-212-5p, 22nt according to SEQ ID NO: 99. See SEQ ID NO: 91 for the corresponding plasmid. [Modes for carrying out the invention]

[0025] The present invention relates to a viral vector comprising a capsid and packaged nucleic acid, wherein the packaged nucleic acid encodes two or more miRNAs, and the two or more miRNAs include the miRNA of SEQ ID NO: 92 and the miRNA of SEQ ID NO: 15 or a fragment thereof having the sequence of SEQ ID NO: 99. The present invention also relates to a viral vector comprising a capsid and packaged nucleic acid, wherein the packaged nucleic acid encodes two or more miRNAs, and the two or more miRNAs include the miRNA of SEQ ID NO: 92 and the miRNA of SEQ ID NO: 17 or a fragment thereof having the sequence of SEQ ID NO: 100. In a particularly preferred embodiment, the present invention relates to a viral vector comprising a capsid and packaged nucleic acid, wherein the packaged nucleic acid encodes two or more miRNAs, and the miRNAs include the miRNA of SEQ ID NO: 92 and a fragment thereof having the sequence of SEQ ID NO: 15 or a fragment thereof having the sequence of SEQ ID NO: 17 or a fragment thereof having the sequence of SEQ ID NO: 100. Accordingly, the present invention means the use of selected miRNAs whose effectiveness has been confirmed when used in combination with each other. The miRNAs include combinations of the mir-29a-3p miRNA (sequence number 92) with either the mir-212-5p miRNA (sequence number 15) or the mir-181a-5p miRNA (sequence number 17). It was also found that the mir-29a-3p miRNA can be combined with fragments of the mir-212-5p and mir-181a-5p miRNAs that lack the 3' terminal nucleotide of the molecule. These fragments of the mir-212-5p and mir-181a-5p miRNAs are shown here as sequence numbers 99 and 100, respectively. The RNA molecules of sequence numbers 99 and 100 are considered self-contained miRNAs in the context of this invention. Compared to the true mRNA of SEQ ID NOs. 15 and 17, respectively, the 3' deletions in SEQ ID NOs. 99 and 100 are far from the miRNA seed region and the nucleotide region 13-16, thus allowing for the miRNA specificity provided by SEQ ID NOs. 99 and 100 (Grimson et al., 2007).Chen, T. et al. demonstrated that increased miR-212-5p in a mouse model of pulmonary hypertension can reduce RVSP and pulmonary vascular wall remodeling (Chen, T. et al., 2018; Chen, T. et al., 2019). For the context of silicosis, see Jiang, R. et al., 2019 and Yang, X. et al., 2018.

[0026] Accordingly, the present invention relates to a viral vector comprising a capsid and a packaged nucleic acid, wherein the nucleic acid increases (i) the miRNA of SEQ ID NO: 92, or (ii) a miRNA that is downregulated in a bleomycin-induced pulmonary fibrosis model or an AAV-TGFβ1-induced pulmonary fibrosis model, comprising the miRNA of SEQ ID NO: 15 or a fragment thereof having the sequence of SEQ ID NO: 99, or the miRNA of SEQ ID NO: 17 or a fragment thereof having the sequence of SEQ ID NO: 100, or (iii) both of (i) and (ii). In one embodiment, the miRNA(s) that are downregulated in a bleomycin-induced pulmonary fibrosis model or an AAV-TGFβ1-induced pulmonary fibrosis model and increased by the packaged nucleic acid further comprises the miRNA of SEQ ID NO: 19. In another embodiment, the one or more miRNAs increased by the packaged nucleic acid include the miRNA of SEQ ID NO: 92, the miRNA of SEQ ID NO: 15 or a fragment thereof having the sequence of SEQ ID NO: 99, and the miRNA of SEQ ID NO: 19. In another embodiment, one or more miRNAs augmented by the packaged nucleic acid include the miRNA of SEQ ID NO: 92, a fragment thereof having the sequence of SEQ ID NO: 17 or SEQ ID NO: 100, and the miRNA of SEQ ID NO: 19.

[0027] In this context, the increase means that the level of each miRNA in the transductioned cells increases as a result of the transduction of target cells, preferably lung cells.

[0028] The present invention further relates to a viral vector comprising a capsid and a packaged nucleic acid, wherein the nucleic acid increases (i) the miRNA of SEQ ID NO: 92, or (ii) a miRNA that is downregulated in a bleomycin-induced pulmonary fibrosis model or an AAV-TGFβ1-induced pulmonary fibrosis model, comprising the miRNA of SEQ ID NO: 15 or a fragment thereof having the sequence of SEQ ID NO: 99, or the miRNA of SEQ ID NO: 17 or a fragment thereof having the sequence of SEQ ID NO: 100, or (iii) both (i) and (ii), and the nucleic acid further inhibits the miRNAs of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, and 16, or, in the case of a miRNA with a partially conserved sequence, a miRNA selected from the group consisting of the closest human homolog of each sequence.

[0029] Inhibition in this context means that, as a result of transduction of target cells, the function of each miRNA is reduced or lost in the transductioned cells via complementary binding.

[0030] In one embodiment, the present invention relates to a viral vector comprising a capsid and a packaged nucleic acid encoding one or more miRNAs that are downregulated in a bleomycin-induced pulmonary fibrosis model or an AAV-TGFβ1-induced pulmonary fibrosis model: a) In one preferred embodiment, one or more miRNAs encoded by the packaged nucleic acid include miRNA SEQ ID NO: 92. In another embodiment, one or more miRNAs encoded by the packaged nucleic acid include: (i) the miRNA of sequence number 92 and a fragment thereof having the sequence of the miRNA of sequence number 15 or sequence number 99, or (ii) the miRNA of sequence number 92 and a fragment thereof having the sequence of the miRNA of sequence number 17 or sequence number 100, (iii) the miRNA of SEQ ID NO: 92, the miRNA of SEQ ID NO: 15 or a fragment thereof having the sequence of SEQ ID NO: 99, and the miRNA of SEQ ID NO: 17 or a fragment thereof having the sequence of SEQ ID NO: 100, or (iv) miRNA of sequence number 92, miRNA of sequence number 15 or a fragment thereof having the sequence of sequence number 99, and miRNA of sequence number 19, or (v) miRNA of sequence number 92, miRNA of sequence number 17 or a fragment thereof having the sequence of sequence number 100, and miRNA of sequence number 19.

[0031] b) In one embodiment, one or more miRNAs encoded by the packaged nucleic acid include: (i) miRNA of sequence number 92, miRNA of sequence number 15 or a fragment thereof having the sequence of sequence number 99, and miRNA of sequence number 18, or (ii) miRNA of sequence number 92, miRNA of sequence number 17 or a fragment thereof having the sequence of sequence number 100, and miRNA of sequence number 18.

[0032] Nucleic acids typically contain coding and non-coding regions, and coding miRNAs that are upregulated or downregulated in bleomycin-induced pulmonary fibrosis models or AAV-TGFβ1-induced pulmonary fibrosis models are understood to be the result of transcription and subsequent maturation processes in target cells transduction by viral vectors.

[0033] Nucleic acids typically contain coding and non-coding regions, and coding RNAs that inhibit the function of one or more miRNAs upregulated in bleomycin-induced pulmonary fibrosis models or AAV-TGFβ1-induced pulmonary fibrosis models are understood to be the result of transcription in target cells transduction by the viral vector, and potentially, but not necessarily, subsequent maturation processes.

[0034] The viral vectors according to the present invention are selected to have the potential to transduce lung cells. Non-limiting examples of viral vectors that transduce lung cells include, but are not limited to, lentiviral vectors, adenovirus vectors, adeno-associated virus vectors (AAV vectors), and paramyxovirus vectors. Of these, AAV vectors are particularly preferred, and those having AAV-2, AAV-5, or AAV-6.2 serotypes are particularly preferred. AAV vectors having recombinant capsid proteins including SEQ ID NOs. 29, 30, or 31 are particularly preferred (see WO2015 / 018860). In one embodiment, the AAV vector is of the AAV-6.2 serotype and contains a capsid protein of the sequence of SEQ ID NOs. 82.

[0035] The sequence encoding a miRNA and thereby increasing its function, and the sequence encoding RNAs that inhibit the function of one or more miRNAs, may or may not be present in the same transgene.

[0036] In one embodiment, the present invention relates to a viral vector comprising a capsid and a packaged nucleic acid comprising one or more transgene expression cassettes including: - A transgene encoding two or more miRNAs, wherein the two or more miRNAs include the miRNA of SEQ ID NO: 92 and a fragment thereof having the sequence of SEQ ID NO: 15 or SEQ ID NO: 99, or the transgene includes the miRNA of SEQ ID NO: 92 and a fragment thereof having the sequence of SEQ ID NO: 17 or SEQ ID NO: 100. -and a transgene encoding an RNA that inhibits the function of one or more miRNAs selected from the group consisting of miRNAs SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 34, 35, and 36.

[0037] Therefore, transgenes that encode miRNAs and increase their levels, and transgenes that encode RNAs that inhibit the function of one or more miRNAs, belong to different expression cassettes.

[0038] In one embodiment, the present invention relates to a viral vector comprising a capsid and a packaged nucleic acid comprising one or more transgene expression cassettes containing a transgene, wherein the transgene - Encoding two or more miRNAs, comprising the miRNA of SEQ ID NO: 92 and a fragment thereof having the sequence of SEQ ID NO: 15 or SEQ ID NO: 99, or comprising the miRNA of SEQ ID NO: 92 and a fragment thereof having the sequence of SEQ ID NO: 17 or SEQ ID NO: 100, and further - Encodes RNA that inhibits the function of one or more miRNAs selected from the group consisting of miRNAs SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 34, 35, and 36.

[0039] Therefore, a single transgene encodes both a miRNA that enhances its function and an RNA that inhibits the function of one or more miRNAs.

[0040] In another embodiment of the present invention, the viral vector is selected from the group consisting of miRNAs with sequence numbers 15, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 92, 99, and 100, or, in the case of miRNAs with partially conserved sequences, the closest human homolog of each sequence. Of this group, conserved miRNAs, i.e., 15, 17, 18, 19, 20, 21, 22, 24, 25, 26, 92, 99, 100, or their closest human homologs, are most preferred. The closest human homologs of each sequence are shown in Figure 5B.

[0041] In a further embodiment of the present invention, a viral vector is provided, having a nucleic acid comprising an even number of transgene expression cassettes and a transgene expression cassette optionally comprising (or comprising) a promoter, a transgene, and a polyadenylation signal, wherein the promoter or polyadenylation signal is located opposite to each other.

[0042] In one embodiment, the viral vector is a recombinant AAV vector, and in other embodiments of the present invention, it has any of the AAV-2 serotype, AAV-5 serotype, or AAV-6.2 serotype.

[0043] In a different embodiment of the present invention, a viral vector is provided, wherein the capsid comprises a first protein (see WO2015 / 018860) having the sequence of SEQ ID NO: 29 or 30. i) In a further embodiment of the present invention, a viral vector is provided, the viral vector comprising a first protein whose capsid is 80% identical, more preferably 90%, and most preferably 95% identical to a second protein having the sequence of SEQ ID NO: 82, wherein one or more gaps are permitted in the alignment between the first protein and the second. ii) In a different embodiment of the present invention, a viral vector is provided, the viral vector comprising a first protein whose capsid is 80% identical, more preferably 90%, and most preferably 95% identical to the second protein of SEQ ID NO: 82, wherein the alignment gap between the first protein and the second protein is counted as a mismatch. iii) In a different embodiment of the present invention, a viral vector is provided which comprises a first protein whose capsid is 80% identical, more preferably 90%, and most preferably 95% identical to the second protein of SEQ ID NO: 82, and which is permitted to have no alignment gap between the first and second proteins.

[0044] In all embodiments (i) to (iii), for determining identity between the first protein and the comparison protein, any amino acid that does not have a corresponding portion in the alignment between the two proteins is considered a mismatch (including overhangs that do not have a corresponding portion). For determining identity, the alignment that gives the highest identity score is used.

[0045] The packaged nucleic acid can be single-stranded or double-stranded. A particular alternative to AAV vectors is to use a self-complementary design where the vector genome is packaged as a double-stranded nucleic acid. Expression initiation is faster, but the vector's packaging capacity is reduced to approximately 2.3 kb. (See Naso et al., 2017, reference.)

[0046] Another aspect of the present invention is a described viral vector for use in the treatment of lung diseases, preferably ILDs. Diseases that can be treated by the present invention are preferably selected from the group consisting of PF-ILD, IPF, connective tissue disease (CTD)-associated ILD, rheumatoid arthritis ILD, chronic fibrosing hypersensitivity pneumonitis (HP), idiopathic nonspecific interstitial pneumonia (iNSIP), unclassifiable idiopathic interstitial pneumonia (IIP), environmental / occupational lung diseases, pulmonary hypertension (PH), fibrotic silicosis, systemic scleroderma ILD, and sarcoidosis and fibrosarcoma.

[0047] The delivery strategy for recombinant AAV therapeutics is also referenced, for example, in Naso et al., 2017.

[0048] A double-stranded plasmid vector containing an AAV vector genome is a further embodiment of the invention.

[0049] Further embodiments of the present invention relate to this miRNA inhibitor for use as a pharmaceutical.

[0050] The present invention also intends to use miRNA mimetics for the prevention and / or treatment of lung diseases, preferably ILD. Lung diseases that can be treated with the miRNA mimetics of the present invention are those presented above and include fibroproliferative diseases such as ILD, PF-ILD, and IPF. The miRNA mimetics of the present invention typically and preferably consist of a sequence of nucleotides of 21, 22, or 23 consecutive nucleotides. The length of the miRNA mimetics (i.e., the length of the "nucleotide oligomer" in the case of single-stranded mimetics, or the length of the "nucleotide oligomer" (i.e., sense strand) in the case of double-stranded mimetics containing the oligomer and other oligonucleotides bound to the oligomer) generally and preferably matches the length of each miRNA they mimic. For miRNA mimes of 23nt miRNAs such as miR-181a-5p or miRNA-212-5p, the length of the miRNA mime (i.e., the oligomer in the case of a single-stranded mime, or the sense strand in the case of a double-stranded mime) is either 23nt (preferably) or 22nt under the condition that one nucleotide is deleted at the 3' end. The deletion at the 3' end is acceptable for the corresponding miRNA mime because, compared to true mRNA (see, e.g., SEQ ID NOs. 99 and 100), it is separated from the seed region and the 13-16 nucleotide region of the miRNA (Grimson et al., 2007).

[0051] Accordingly, further embodiments of the present invention are combinations of miRNA mimes used for the prevention and / or treatment of fibroproliferative diseases such as ILD, PF-ILD, and IPF, wherein the combination comprises (i) a miRNA mime having the sequence of SEQ ID NO: 92, and (ii) a miRNA mime having the sequence of SEQ ID NO: 15 and / or a miRNA mime having the sequence of SEQ ID NO: 17. The combination of miRNA mimes may further comprise one or more mimes of miRNAs having sequences selected from the group consisting of SEQ ID NOs: 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 37, 38, and 39, preferably sequences selected from the group consisting of SEQ ID NOs: 18 and 19. In one embodiment, the miRNA mime is provided for use in a method for the prevention and / or treatment of fibroproliferative diseases such as ILD, PF-ILD, and IPF, wherein the miRNA has the sequence of SEQ ID NO: 92, and the method further comprises the administration of a miRNA mime having the sequence of SEQ ID NO: 15. In another embodiment, the miRNA mime is provided for use in a method for the prevention and / or treatment of fibroproliferative diseases such as ILD, PF-ILD, and IPF, where the miRNA has the sequence of SEQ ID NO: 92, and the method further comprises the administration of a miRNA mime having the sequence of SEQ ID NO: 17. Prevention and / or treatment further comprises the administration of a miRNA mime preferably having the sequence of SEQ ID NO: 18 or a miRNA mime having the sequence of SEQ ID NO: 19.

[0052] Similarly, further embodiments provide a miRNA mime for use in the prevention and / or treatment of fibroproliferative disorders such as ILD, PF-ILD, or IPF, where the miRNA has Sequence ID No. 92. The prevention and / or treatment further comprises administering a miRNA mime having the sequence of Sequence ID No. 15 or a miRNA mime having the sequence of Sequence ID No. 17. More preferably, - The prevention and / or treatment includes the administration of miRNA mimetics having the sequence of SEQ ID NO: 92, miRNA mimetics having the sequence of SEQ ID NO: 15, and miRNA mimetics having the sequence of SEQ ID NO: 18, or - The prevention and / or treatment includes the administration of miRNA mimetics having the sequence of SEQ ID NO: 92, miRNA mimetics having the sequence of SEQ ID NO: 17, and miRNA mimetics having the sequence of SEQ ID NO: 18, or - The prevention and / or treatment includes the administration of miRNA mimics having the sequence of SEQ ID NO: 92, miRNA mimics having the sequence of SEQ ID NO: 15, and miRNA mimics having the sequence of SEQ ID NO: 17.

[0053] Further embodiments of the present invention include a pharmaceutical composition for the treatment of fibroproliferative disorders such as ILD, PF-ILD, or IPF, comprising (i) a miRNA mime of a miRNA having the sequence of SEQ ID NO: 92, and (ii) a miRNA mime of a miRNA having the sequence of SEQ ID NO: 15 or a miRNA mime of a miRNA having the sequence of SEQ ID NO: 17, as well as these miRNA mimes and a pharmaceutically acceptable carrier or diluent.

[0054] A further embodiment of the present invention is a pharmaceutical composition comprising a miRNA mime of a miRNA having the sequence of SEQ ID NO: 92, a miRNA mime of a miRNA having the sequence of SEQ ID NO: 15, and a pharmaceutically acceptable carrier or diluent. Another embodiment of the present invention is a pharmaceutical composition comprising a miRNA mime of a miRNA having the sequence of SEQ ID NO: 92, a miRNA mime of a miRNA having the sequence of SEQ ID NO: 17, and a pharmaceutically acceptable carrier or diluent. Preferably, the miRNA mimes in the composition are encapsulated in lipid nanoparticles (LNPs). The LNPs preferably have an average particle size between 30 and 200 nm. The pharmaceutical composition may further contain 25 to 65 mol% of ionized lipids.

[0055] In any of the above embodiments, the miRNA mime having the sequence of SEQ ID NO: 92 is preferably an oligomer having the sequence of SEQ ID NO: 92 (in the case of a single-stranded-single-stranded mime), or contains said oligomer (in the case of a double-stranded mime). Similarly, the miRNA mime having the sequence of SEQ ID NO: 15 is preferably an oligomer having the sequence of SEQ ID NO: 15 or an oligomer having the sequence of SEQ ID NO: 99, or contains said oligomer. The miRNA mime having the sequence of SEQ ID NO: 17 is preferably an oligomer having the sequence of SEQ ID NO: 17 or an oligomer having the sequence of SEQ ID NO: 100, or contains said oligomer.

[0056] The present invention also provides a miRNA mime of miRNA m29a-3p used for the treatment of fibroproliferative disorders such as ILD, PF-ILD, or IPF, wherein the miRNA mime is (somewhat preferred) an oligomer of nucleotides consisting of selected sequences from the group of SEQ ID NOs. 92, or comprises (preferred) said oligomer, and has the following conditions: -Oligomers optionally contain nucleotides with chemical modifications that result in non-native nucleotides that exhibit base-pairing behavior at corresponding positions (AU and GC) determined by the sequence of each miRNA; - The oligomers optionally contain nucleotide analogs that exhibit base-pairing behavior at corresponding positions (AU and GC) determined by the sequence of each miRNA; -Oligomers are optionally conjugated to lipids to facilitate drug delivery. Herein, the prevention and / or treatment further includes the administration of a miRNA mime having the sequence of SEQ ID NO: 15 and / or a miRNA mime having the sequence of SEQ ID NO: 17.

[0057] In one embodiment, prevention and / or treatment further includes administration of a miRNA mimeograph having the sequence of SEQ ID NO: 15. Preferably, the miRNA mimeograph having the sequence of SEQ ID NO: 15 is a nucleotide oligomer (somewhat preferred) consisting of the sequence of SEQ ID NO: 15 (preferred) or SEQ ID NO: 99, or comprises such oligomer, having the following conditions: - The oligomer optionally contains nucleotides with chemical modifications that result in non-natural nucleotides that exhibit base-pairing behavior at corresponding positions (AU and GC) determined by the sequence of each miRNA. - The oligomers are optionally conjugated with lipids to facilitate drug delivery.

[0058] In other embodiments, prevention and / or treatment further include administration of a miRNA mimeograph having the sequence of SEQ ID NO: 17. Preferably, the miRNA mimeograph having the sequence of SEQ ID NO: 17 is (somewhat preferred) a nucleotide oligomer (somewhat preferred) consisting of the sequence of SEQ ID NO: 17 (preferred) or SEQ ID NO: 100 (preferred), or comprises (preferred) such oligomer, and has the following conditions: - The oligomers optionally contain nucleotide analogs that exhibit base-pairing behavior at corresponding positions (AU and GC) determined by the sequence of each miRNA; - The oligomers are optionally conjugated with lipids to facilitate drug delivery.

[0059] If the miRNA mime is not encapsulated and delivered in lipid-based nanoparticles (LNPs), it is desirable that the oligomer described above be conjugated with lipids to facilitate drug delivery.

[0060] In yet another embodiment, prevention and / or treatment further comprises the administration of a miRNA mimeograph having the sequence of SEQ ID NO: 19. Preferably, the miRNA mimeograph having the sequence of SEQ ID NO: 19 is (somewhat preferred) an oligomer of nucleotides consisting of the sequence of SEQ ID NO: 19, or comprises such oligomer (preferred), and has the following conditions: - The oligomer optionally contains nucleotides with chemical modifications that result in non-natural nucleotides that exhibit base-pairing behavior at corresponding positions (AU and GC) determined by the sequence of each miRNA. - The oligomers optionally contain nucleotide analogs that exhibit base-pairing behavior at corresponding positions (AU and GC) determined by the sequence of each miRNA.

[0061] Furthermore, embodiments of the present invention include combinations of a miRNA mimite of miRNA 29a-3p (SEQ ID NO: 92) and a mimite of miRNA 212-5p (SEQ ID NO: 15) or miRNA 181a-5p (SEQ ID NO: 17) used for the treatment of fibroproliferative disorders such as ILD, PF-ILD, or IPF, where the miRNA mimite is a nucleotide oligomer consisting of the sequences of SEQ ID NO: 92, SEQ ID NO: 15 or 99, and SEQ ID NO: 17 or 100, respectively, and each having the following conditions: - The oligomers optionally contain nucleotides with chemical modifications that result in non-native nucleotides that exhibit base-pairing behavior at corresponding positions (AU and GC) determined by the sequence of each miRNA.

[0062] A further embodiment of the present invention is a miRNA mimetics used for the treatment of fibroproliferative disorders such as ILD, PF-ILD, or IPF, comprising a combination of miRNA 29a-3p (SEQ ID NO: 92) and miRNA 212-5p (SEQ ID NO: 15 or 99) or miRNA 181a-5p (SEQ ID NO: 17 or 100), wherein the miRNA mimetics are or comprise a nucleotide oligomer consisting of the sequences of SEQ ID NO: 92, SEQ ID NO: 15 or 99, and SEQ ID NO: 17 or 100.

[0063] These embodiments preferably involve the delivery of miRNA mimetics encapsulated in lipid-based nanoparticles (LNPs). When LNP particles are used for delivery, the dosage may be 0.01 to 5 mg / kg of miRNA mimetics per kg of target, preferably 0.03 to 3 mg / kg, more preferably 0.1 to 0.4 mg / kg, and most preferably 0.3 mg / kg. Administration of LNP particles is preferably systemic, more preferably intravenously.

[0064] In the case of a double-stranded miRNA mime, the miRNA mime includes a nucleotide oligomer (sense strand) bound to one or more oligonucleotides that are fully or partially complementary to the sense strand of the miRNA mime, and the sense strand of the miRNA mime may or may not form an overhang (or multiple overhangs) having a single-stranded region together with these one or more oligonucleotides.

[0065] Double-stranded miRNA mimetics are preferred.

[0066] Further embodiments of the present invention relate to the pharmaceutical composition defined above, wherein the composition is an inhalation composition.

[0067] Further embodiments of the present invention relate to the pharmaceutical composition defined above, wherein the composition is for systemic administration, preferably intravenous administration.

[0068] A further embodiment of the present invention is a method for treating or preventing a fibroproliferative disorder such as ILD, PF-ILD, or IPF, comprising administering the pharmaceutical composition defined above to a subject in need thereof.

[0069] For example, the use of miRNA inhibitors or miRNA mimes may be effective in inhibiting fibrosis in the pathological respiratory epithelium of subjects suffering from pulmonary fibrosis via the aerosol pathway, and thus restoring the integrity of the pathological tissue to restore full functionality.

[0070] The aforementioned viral vector is preferably 1.0 x 10 10 ~1.0x10 14 The amount administered is equivalent to a viral dose within the range of vg / kg (viral genome per kg of body weight), which is 1.0 x 10⁻¹⁰. 11 ~1.0x10 12 A range of vg / kg is more preferable, 5.0x10 11 ~5.0x10 12 A range of vg / kg is even more preferable, and 1.0x10 12 ~5.0x10 11The range is even more preferable. About 2.5x10 12 A viral dose of vg / kg is most preferable. The amount of the viral vector to be administered, such as the AAV vector according to the present invention, can be adjusted, for example, by the strength of the expression of one or more transgenes.

[0071] A further aspect of the present invention is the use of the viral vector, miRNA inhibitor and miRNA mimic according to the present invention for combination therapy with nintedanib or pirfenidone.

[0072] Terms and definitions used

[0073] Expression cassette includes a transgene, usually a promoter, and a polyadenylation signal. The promoter is operably linked to the transgene. Suitable promoters can be selectively or constitutively activated in lung cells such as alveolar epithelial cells. Non-limiting specific examples of suitable promoters include constitutively active promoters such as the cytomegalovirus immediate early gene promoter, the Rous sarcoma virus long terminal repeat promoter, the human elongation factor la promoter, and the human ubiquitin c promoter. Non-limiting specific examples of lung-specific promoters include the surfactant protein C gene promoter, the surfactant protein B promoter, and the Clara cell 10kD ("CC10") promoter.

[0074] TransgeneDepending on the embodiment of the present invention, the transgene may encode (i) one or more miRNAs, for example, a miRNA having the sequence of SEQ ID NO: 92, or one or more miRNAs that are downregulated in a bleomycin-induced pulmonary fibrosis model or an AAV-TGFβ1-induced pulmonary fibrosis model, or (ii) RNAs that inhibit the function of one or more miRNAs that are upregulated in a bleomycin-induced pulmonary fibrosis model or an AAV-TGFβ1-induced pulmonary fibrosis model, or the options of (i) and (ii). The transgene may include an open reading frame encoding a protein for transduction reporting (e.g., eGFP, see Figure 11) or for therapeutic purposes.

[0075] RNA that inhibits the function of one or more miRNAs This reduces or eliminates the function of its target miRNA through complementary binding. Two different vector design strategies can be applied, as shown in Figures 8B and 8C. 1) Expression of antisense-like molecules designed to specifically bind to profibrosis-promoting miRNAs and thereby inhibit their function (Figure 8B). Each molecule, called an anti-miR, can be incorporated into an expression vector as short hairpin RNA (shRNA) or artificial miRNA. Similar to the miRNA supplementation approach, several miRNA target sequences can be incorporated into a single vector to enable inhibition of various target miRNAs. 2) Expression of mRNA containing several copies of the miRNA-binding site, the so-called sponge, aimed at selectively sequestering profibrosis-promoting miRNAs and thereby inhibiting their function (Figure 8C). With this option, RNA inhibition does not undergo RNAi processing or RNAi maturation.

[0076] According to the present invention miRNA inhibitors The term refers to an oligomer consisting of a continuous sequence of 7 to at least 22 nucleotides in length.

[0077] Used here nucleotideThe term refers to a glycoside, which comprises a sugar moiety (usually ribose or deoxyribose), a base moiety, and a covalent group (binding group) such as the internucleotide bond of a phosphate or phosphorothioate. It includes both natural nucleotides and non-natural nucleotides, which are modified sugar and / or base moieties and are referred to here as nucleotide analogs. Non-natural nucleotides include bicyclic nucleotides, or nucleotides with a sugar moiety such as 2'-modified nucleotides, or 2'-substituted nucleotides.

[0078] Non-natural nucleotides connect chemical modification A genome having the following modifications (i) Nucleotides containing non-natural sugar portions , Examples include bicyclic nucleotides, or 2'-modified nucleotides, or 2'-substituted nucleotides, which are all 2'-modified nucleotides.

[0079] (ii) Nucleotides with phosphorothioate (PS) and phosphodithioate (PS2) modifications To improve miRNA nuclease resistance, serum stability, and blood concentration, one or more nucleotides in a miRNA inhibitor or mimetic can be modified to replace the oxygen of the nucleotide phosphate group with a sulfur, defined as a phosphorothioate (PS). For some sequences, this can be combined or complemented by the introduction of a second sulfur group to the existing PS, defined as phosphorothioate PS2. PS2 modifications at different positions on the sense strand, such as nucleotides 19+20 or 3+12 (counting from the 5' end), can further increase serum stability and thus improve the pharmacokinetic properties of miRNA inhibitors / miRNA mimetic (ACS Chem. Biol. 2012, 7, 1214-1220).

[0080] (iii) Nucleotides with boranophosphate modification In some miRNA oligonucleotides, the exchange of one oxygen of a ribose phosphate group to a BH3 group may be beneficial. If the seed region of a miRNA oligonucleotide is not modified by other chemical modifications, boranophosphate modification at one or more nucleotides may improve serum stability. Boranophosphate modification may also increase the serum stability of miRNA oligonucleotides (Nucleic Acids Research, Vol.32 No.20, 5991-6000).

[0081] (iv) Nucleotides with 2'O-methyl modification In addition to or phosphate modification, methylation of the oxygen bonded to carbon C2 of the ribose ring can be a further option for oligonucleotide modification. 2'O-methylribose modification of the sense chain can improve thermal stability and enzyme digestion resistance.

[0082] (v) Nucleotides with fluorine modification at the 2'OH group To enhance the serum stability of oligonucleotides and improve the binding affinity of miRNA oligonucleotides to their targets, 2'OH fluorine modification of miRNA oligonucleotides may also be beneficial. 2'OH fluorine modification involves replacing the hydroxyl group on carbon C2 of the ribose ring with a fluorine atom. Fluorine modification can be applied to both sense and antisense strands.

[0083] " Nucleotide analogs A nucleoside analog is a variant of a native oligonucleotide due to modification of the sugar and / or base moiety. Preferably, but not limited to this description, the analog has a functional effect on the way in which the oligomer works to bind to its target; for example, by enhancing binding affinity to the target, and / or resistance to nucleases, and / or ease of transport to cells. Specific examples of nucleoside analogs are described by Freier and Altman (Nucl. Acid Res, 25:4429-4443, 1997) and Uhlmann (Curr. Opinion in Drug Development, 3:293-213, 2000).

[0084] The incorporation of affinity-enhancing analogs in oligomers, including LOK nucleic acid (LNA®), allows for a reduction in the size of specifically binding oligomers and can also reduce the upper limit of oligomer size before nonspecific or abnormal binding occurs. The term "LNA®" refers to the bicyclic nucleoside analog known as "LOK nucleic acid" (Rajwanshi et al., Angew Chem. Int. Ed. Engl., 39(9) 1656-1659, 2000). This may refer to LNA® monomers, or, when used in the context of "LNA® oligonucleotides," oligonucleotides containing one or more such bicyclic analogs.

[0085] Preferably, the miRNA inhibitors of the present invention refer to antisense oligonucleotides having a sequence complementary to a specific upregulated miRNA (a miRNA selected from the group consisting of miRNAs SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 34, 35, and 36). These oligomers may contain or be composed of a sequence of at least 7 to 22 consecutive nucleotides in total, up to 70% analog (LNA®). The shortest oligomer (7 nucleotides) would correspond to an antisense oligonucleotide having complete sequence complementarity to the first 7 nucleotides located at the 5' end of the mature form of a specific upregulated miRNA (including the 7-nucleotide sequence at positions 2-8 from the 5' end (called the "seed" sequence) that is involved in miRNA target specificity) (Lewis et al., Cell. 2005 / 1 / 14; 120(1):15-20).

[0086] A specific upregulated miRNA target site blocker refers to an antisense oligonucleotide having a sequence complementary to a specific upregulated miRNA binding site located on a particular mRNA. These oligomers may be designed according to the teachings of US20090137504. These oligomers may contain or be composed of a contiguous nucleotide sequence with a total contiguous nucleotide length of 8 to 23. These sequences may span 20 nucleotides in the 5' or 3' direction from a sequence corresponding to the reverse complement of a particular upregulated miRNA "seed" sequence.

[0087] The term "miRNA mimite" in the invention refers to an oligomer of single- or double-stranded nucleotides that can specifically increase the activity of a particular miRNA, wherein the term "particular miRNA" means a miRNA having a sequence selected from the group consisting of SEQ ID NOs: 15, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 37, 38, 39, and 92, preferably 92, 15, 17, 19, 18, and 20, most preferably 15, 17, and 19, and more preferably SEQ ID NO: 15. The term "miRNA mimite" includes pharmaceutically acceptable salts. A miRNA mimite of a miRNA increases the concentration of a functional equivalent of the miRNA in a cell, thereby increasing the overall activity of the miRNA.

[0088] These miRNA mimetics of the present invention typically and preferably consist of a sequence of nucleotides with a continuous nucleotide length of 21, 22, or 23. The length of the miRNA mimetics (i.e., oligonucleotides in the case of single-stranded mimetics, or sense strands in the case of double-stranded mimetics) typically matches (preferably) the length of each miRNA they mimic.

[0089] For miRNA mimes of 23nt miRNAs such as miR-181a-5p or miRNA-212-5p, the length of the miRNA mime (i.e., the oligomer in the case of a single-stranded mime or the sense strand in the case of a double-stranded mime) is either 23nt (preferably) or 22nt under the condition that one nucleotide is deleted at the 3' end. The deletion at the 3' end is acceptable because, compared to true mRNA (see, e.g., SEQ ID NOs. 100, 99), it is far from the seed region and the 13-16 nucleotide region of the miRNA (Grimson et al., 2007).

[0090] The miRNA mimes of miRNA 29a-3p, 212-5p, miRNA 181a-5p, miRNA 181b-5p, and miRNA 10a-5p are intended for use in the treatment of fibroproliferative disorders such as ILD, PF-ILD, or IPF, where the miRNA mimes are nucleotide oligomers consisting of the sequences of SEQ ID NO: 92, SEQ ID NO: 15 or 99, SEQ ID NO: 17 or 100, SEQ ID NO: 18, and SEQ ID NO: 19, or comprising such nucleotide oligomers, each having conditions (a), (b) and (c), (a) and (c), (a) and (d), or (c) and (d). (a) The oligomer optionally contains nucleotides having chemical modifications that result in non-native nucleotides that exhibit base-pairing behavior at corresponding positions (AU and GC) determined by the sequence of each miRNA, preferably those chemically modified as shown in (i) to (v) above; (b) The oligomers optionally include nucleotide analogs that exhibit base-pairing behavior at corresponding positions (AU and GC) determined by the sequence of each miRNA, preferably nucleotide analogs described by Freier and Altman (Nucl. Acid Res., 25:4429-4443, 1997) and Uhlmann (Curr. Opinion in Drug Development, 3:293-213, 2000) or the bicyclic analogs described above; (c) The oligomers are optionally conjugated with lipids to facilitate drug delivery.

[0091] Lipid conjugate oligomers are well known in this field; see Osborne et al., NUCLEIC ACID THERAPEUTICS Volume 28, Number 3, 2018.

[0092] An oligomer consisting of the sequence of sequence number x means that the oligomer contains the sequence of sequence number x and has the same number of covalently bonded nucleotide units (which may be chemically modified) or nucleotide analogs as shown in sequence number x.

[0093] miRNA mimes may be single-stranded or double-stranded. A single-stranded mime is an oligonucleotide that does not have other oligonucleotide molecules to bind to it and has complete or partial base pairing. A double-stranded miRNA mime is defined as one bound to one or more oligonucleotides that are completely or partially complementary to the miRNA mime, and may or may not form an oligonucleotide overhang with a single-stranded region. The three RNA strand designs mentioned in item 1.11 are examples of double-stranded miRNA mimes. Further examples are disclosed in Vinnikov et al., (2014), p. 10661, last paragraph, first line.

[0094] The miRNA mime preferably has at least 80%, more preferably at least 90%, and even more preferably 95% or more of the biological effect of the same amount of natural miRNA determined in one or more experiments as described in item 1.11.

[0095] miRNA mimes or miRNA inhibitors can also be encapsulated in lipid nanoparticles (LNPs) and delivered as natural or non-natural nucleotides. For RNA as a cargo molecule, the most effective LNPs contain ionized lipids with pKa values ​​generally below pH 7 and consist of up to four components: ionized lipids, structural lipids, cholesterol, and polyethylene glycol (PEG) lipids.

[0096] Ionized lipids include 1,2-dilinoleoyl-3-dimethylamine (DLin-DMA), 2,2-dilinoleoyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), heptatriaconta-6,9,28,31-tetraen-19-yl-4-(dimethylamino)butanoic acid (DLinMC3-DMA) (Naseri N, Valizadeh H, Zakeri-Milani P. Solid lipid nanoparticles and nanostructured lipid carriers: structure, preparation, and application. Adv Pharm Bull. 2015;5(3):305-313), and ATX-lipids (Ramaswamy S, Tonnu N, Tachikawa K, et al. Systemic delivery of factor IX messenger RNA for protein replacement therapy. Proc Natl Acad Sci This includes, but is not limited to, YSK12-C4 lipids (Sato Y, Hashiba K, Sasaki K, et al., Understanding structure-activity relationships of pH-sensitive cationic lipids facilitates the rational identification of promising lipid nanoparticles for delivering siRNAs in vivo. J Control Release. 2019;295:140-152.).

[0097] Structural lipids include, but are not limited to, dioleoyl-sn-glycero-3-phosphatidylcholine (DOPC), dimyristoyl-sn-glycero-3-phosphatidylcholine (DMPC), distearoyl-sn-glycero-3-phosphatidylcholine (DSPC), dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), dipalmitoyl-sn-glycero-3-phosphatidylethanolamine (DPPE), dioleoyl-sn-glycero-3-phosphatidylethanolamine (DOPE), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphatidylcholine (POPC), and hydrogenated soybean phosphatidylcholine (HSPC). Cholesterol includes, but is not limited to, cholesterol, 3-(N-(N0,N0-dimethylaminoethane)-carbamoyl)cholesterol, sterols, and steroids.

[0098] PEG-lipids include 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[amino(polyethylene glycol)-2000(DSPE-mPEG] 2000 ), 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[amino(polyethylene glycol)-2000(DMPE-mPEG 2000 ), 1,2-Dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-[amino(polyethylene glycol)-2000(DPPE-mPEG 2000 ), and 1,2-Dioleoyl-sn-glycero-3-phosphoethanolamine-N-[amino(polyethylene glycol)-2000(DOPE-mPEG 2000 ), as well as when their PEG lengths have changed, for example, PEG 500 PEG 1000 PEG 5000 This includes, but is not limited to, PEG-lipids such as those listed above.

[0099] LNP formulations can include different proportions of a single LNP component, different particle sizes, and different ratios of positively charged polymer amine (N=nitrogen) groups to negatively charged nucleic acid phosphate (P) groups (N / P ratio). Preferred formulations consist of or contain 25-65 mol% ionized lipids, preferably 40 mol%, 5-30 mol% structural lipids, preferably 15 mol%, 15-50 mol% cholesterol, preferably 40 mol%, and 1-5 mol% PEG-lipids, preferably 2 mol%. The average LNP particle size can be varied between 30-200 nm and the N / P ratio between 2 and 4, but the most preferred nanoparticle size is 100 nm and the N / P ratio is 3.

[0100] The most preferred LNP formulation has the following composition: 40 mol% ionized lipid consisting of DLinMC3-DMA or ATX lipid, or YSK12-C4-lipid, 15 mol% DSPC, 40 mol% cholesterol, and DSPE-mPEG with a particle size of 100 nm and an N / P ratio of 3. 2000 2 mol%.

[0101] The most preferred miRNA configuration for LNP delivery of miRNA mimes is the inclusion of a passenger sense strand complementary to the antisense strand. The passenger strand protects the antisense strand from endonucleases. As described by Vinnikov et al., both strands have an LNA-modified overhang on the 3' side consisting of two nucleotides with LNA modification (Vinnikov et al, 2014). LNA stands for Lock Nucleic Acid and is defined by the LNA-modified overhang of two nucleotides on the 3' side, which contains a methylene bridge between the 2-oxygen and 4-carbon of the ribofuranose ring. The first nucleotide on the 5' side of the sense strand is also LNA-modified, facilitating strand identification in the RISC complex. The LNA moiety restricts the flexibility of the monomer, locking it into a rigid bicyclic N-type conformation while providing exceptional resistance to nucleases and very low cytotoxicity. Furthermore, these minimal modifications offer a compromise between stability and functionality in both in vitro and in vivo applications (Elme'n et al., 2005; Mook et al., 2007, as cited by Vinikov et al.). LNA modifications increase the melting temperature (Tm value) in hybridization with complementary sequences. Each LNA-modified nucleotide can raise the Tm of the formed nucleotide pair by up to 8°C (DOI:10.1007 / 3-540-27262-3_21). The lengths of the sense and antisense strands typically consist of 20-22, 20-23, 20-24, or 20-25 nucleotides.

[0102] Another option is to design microRNA mimes using the three RNA strand designs described in item 1.11 (Functional characterization of miRNAs in cell analysis).

[0103] When LNP particles are used for delivery, the dosage may be 0.01 to 5 mg / kg, preferably 0.03 to 3 mg / kg, more preferably 0.1 to 0.4 mg / kg, and most preferably 0.3 mg / kg, of the amount of miRNA mimeograph per kg of the target of treatment. Administration of LNP particles is preferably systemic, more preferably intravenously. [Examples]

[0104] 1. Methods and Materials 1.1 AAV production, purification, and quantification HEK-293h cells were cultured in DMEM+GlutaMAX medium supplemented with 10% fetal bovine serum. Three days before transfection, cells were seeded into 15 cm tissue culture plates and allowed to reach 70-80% confluence on the day of transfection. For transfection, a culture area of ​​1 cm² was used. 2 A total of 0.5 μg of total DNA was mixed in equimolar ratio with 300 mM CaCl2 in 1 / 10 the volume of the culture medium and the total plasmid required for AAV production. The plasmid constructs were as follows: one plasmid encoding the AAV6.2 cap gene (Strobel B et al., 2015); a plasmid containing an AAV2 ITR flanking expression cassette with an optimized codon usage frequency mouse Tgfb1 gene and a CMV promoter expressing the hGh polyA signal, with the Tgfb1 sequence containing C223S and C225S mutations that increase the fragments of the active protein (Brunner AM et al., 1989); and the pHelper plasmid (AAV Helper-free system, Agilent). For the preparation of GFP and stuffer control vectors, the Tgfb1 plasmid was replaced with an eGFP plasmid containing an AAV2 ITR-adjacent CMV-eGFP-SV40pA cassette, and with an AAV-stuffer control plasmid containing an SV40 polyA signal after the AAV2 ITR-adjacent uncoding region derived from the 3'-UTR of E6-AP ubiquitin protein ligase UBE3A, respectively.

[0105] Next, the plasmid CaCl2 mix was added dropwise to equal volumes of 2x HBS buffer (50 mM HEPES, 280 mM NaCl, 1.5 mM Na2HPO4), incubated at room temperature for 2 minutes, and then added to the cells. After 5–6 hours of incubation, the culture medium was replaced with fresh medium. Transfected cells were grown at 37°C for a total of 72 hours. The cells were detached with EDTA at a final concentration of 6.25 mM and pelleted by centrifugation at 1000xg for 10 minutes at room temperature. The cells were then resuspended in "lysis buffer" (50 mM Tris, 150 mM NaCl, 2 mM MgCl2, pH 8.5). The AAV vector was purified essentially as previously described (Strobel B et al. 2015): in the iodixanol gradient-based purification, cells taken from up to 40 plates were dissolved in 8 mL of lysis buffer. The cells were then lysed by three freeze / lysis cycles using liquid nitrogen and a 37°C water bath. For each plate initially transfected, 100 units of benzonase nuclease (Merck) were added to the mixture and incubated at 37°C for 1 hour. After precipitating the cell debris at 2500xg for 15 minutes, the supernatant was transferred to a 39 mL Beckman Coulter Quick Seal tube. An iodixanol (OptiPrep, Sigma Aldrich) stepwise gradient was prepared by layering 8 mL of 5% iodixanol solution, 6 mL of 25% iodixanol solution, 8 mL of 40% iodixanol solution, and 5 mL of 58% iodixanol solution, diluted in PBS-MK (1xPBS, 1 mM MgCl2, 2.5 mM KCl), beneath the cell lysate. NaCl was pre-added to the 15% phase at a final concentration of 1 M. To facilitate the distinction of phase boundaries within the gradient, 1.5 μL of 0.5% phenol red was added per 1 mL to 15% and 25% iodixanol solutions, and 0.5 μL was added to the 58% phase. After centrifugation at 18°C, 63000 rpm, and 2 hours using a 70Ti rotor, the bottom of the tubes was punctured. The first 5 mL (corresponding to the 58% phase) was discarded, and the next 3.5 mL containing AAV vector particles was collected. PBS was added to the AAV fraction to a total volume of 15 mL, and ultrafiltration / concentration was performed using a Merck Millipore Amicon Ultra-15 centrifugal filter unit with a MWCO of 100 kDa. After concentrating to approximately 1 mL, the retaining solution was filled to 15 mL and concentrated again. This process was repeated a total of three times. Glycerol was added to the preparation at a final concentration of 10%. After sterilization by filtration using Merck Millipore Ultrafree-CL filter tubes, the AAV product was aliquoted and stored at -80°C.

[0106] 1.2 Mouse Model and Functionality Retrieval For reporter gene studies, 2.9 x 10⁶ female C57Bl / 6 or Balb / c mice, purchased from Charles River Laboratories and aged 9-12 weeks, were injected. 10 AAV5-CMV-fLuc or 3x10 vector genome (vg) 11 Either vg AAV6.2-CMV-GFP was administered intratracheally under light anesthesia (3-4% isoflurane). Alternatively, 3 x 10⁶ C57Bl / 6 mice were given. 11 Vg AAV2-L1-CMV-GFP was administered intravenously (iv). Reporter readout was performed 2-3 weeks after AAV administration (see figure caption). For luciferase imaging, luciferin 30 mg / kg was administered intraperitoneally to mice as a substrate before image acquisition. For GFP reporters, histological fresh frozen sections were prepared and GFP fluorescence was directly analyzed by fluorescence microscopy, or formalin-fixed paraffin-embedded sections were prepared for GFP IHC analysis (see further details below).

[0107] For the fibrosis model, 9-12 week old male C57Bl / 6 mice purchased from Charles River Laboratories were given 2.5 x 10 11 (vg) AAV-TGFβ1 or AAV-Stuffer, bleomycin 1 mg / kg, or 50 μL of physiological saline were administered intratracheally under light anesthesia. Fibrosis was evaluated on days 3, 7, 14, 21, and 28 after AAV / bleomycin administration. Briefly, to evaluate lung function, mice were anesthetized with intraperitoneal (ip) administration of pentobarbital / xylazine hydrochloride, cannulated into the trachea, and treated with intravenous (iv) administration of pancuronium bromide. Subsequently, lung function measurements (i.e., lung compliance, forced vital capacity (FVC)) were performed using the Scireq flexiVent FX system. The mice were then euthanized with an overdose of pentobarbital, the lungs were dissected, weighed, and washed twice with 700 μL PBS to obtain BAL fluid for stratified analysis of BAL immunocells and proteins (data not published). The left lung of each mouse was treated for histological evaluation by a histopathologist, while the right lung was used for total RNA extraction, as described below.

[0108] For the pharmacokinetic study of miR-212-5p AAV, we used 10-12 week old male C57BL / 6JRj mice from Janvier Labs. Under light anesthesia with short exposure to isoflurane, we administered a Staffer-negative control AAV (1x10) to mice. 11 vg) or three increasing doses of miR-212-5p-AAV (9x10) 9 VG, 10x10 10 VG and 1x10 11 (vg) was administered intratracheally (it). Mice were euthanized 7, 14, and 28 days after AAV administration. The lungs were flash-frozen with liquid nitrogen and processed into frozen lung powder for total RNA isolation (using Qiagen's miRNAeasy kit).

[0109] 1.3 Histology For the preparation of histological lung samples, the left lung lobe was fixed in a separatory funnel filled with 4% paraformaldehyde (PFA) and inflated at a water pressure of 20 cm depth for 20 minutes. The filled lung was then occluded by tracheal ligation and immersed in 4% PFA for at least 24 hours. Subsequently, the PFA-fixed lung was embedded in paraffin. Using a microtome, 3 μm lung sections were prepared, dried, deparaffinized with xylene, and rehydrated with an ethanol reduction series (100-70%). Masson's trichrome staining was performed using a Gemini ES Automated Slide Stainer according to an established protocol. For GFP-IHC, enzymatic antigen recovery was performed, and the antibody was diluted in Bond primary antibody diluent (Leica Biosystems) at the indicated ratio. Slides were stained with Abcam rabbit anti-GFP polyclonal antibody ab290 at a 1:1000 dilution and appropriate isotype control antibodies, respectively. Slides from which only antigen retrieval was performed were used as additional negative controls. Finally, sections were mounted in Merck Millipore Aquatex medium.

[0110] 1.4 RNA preparation For the preparation of whole lung RNA, the right lung was flash-frozen in liquid nitrogen immediately after dissection. The frozen lung was homogenized in 2 mL of pre-cooled Qiagen RLT buffer + 1% β-mercaptoethanol using a Peqlab Precellys 24 dual homogenizer and 7 mL ceramic bead tubing. 150 μL of the homogenate was then mixed with 550 μL of QIAzol Lysis Reagent (Qiagen). After adding 140 μL of chloroform, the mixture was vigorously shaken for 15 seconds and centrifuged at 4°C and 12,000xg for 5 minutes. 350 μL of the upper layer of RNA-containing aqueous phase was then further purified using the Qiagen miRNeasy 96 Kit according to the manufacturer's instructions. After purification, RNA concentration was measured using a Synergy HT multimode microplate reader and Take3 module (BioTek Instruments). RNA quality was evaluated using an Agilent 2100 Bioanalyzer.

[0111] 1.5 RNA sequencing The cDNA library was prepared using the Illumina TruSeq RNA Sample Preparation Kit. Briefly, 200 ng of total RNA was subjected to poly(A) enrichment using oligo-dT-conjugated magnetic beads. The poly(A)-containing mRNA was fragmented into approximately 150-160 bp fragments. After reverse transcription with random primers, a second cDNA strand was synthesized with DNA polymerase I. Following end repair and adenine single-base addition, a phosphothymidine-binding index adapter was attached to each cDNA to facilitate sample attachment to the sequencing flow cell and to enable sample identification after multiplex sequencing. After purification and PCR enrichment of cDNA, the library was diluted to 2 nM and clustered in flow cells at 9.6 pM using the Illumina TruSeq SR Cluster Kit v3-cBot-HS and cBot instrument. Sequencing of 52 bp single reads and 7-base index reads was performed on an Illumina HiSeq 2000 using the Illumina TruSeq SBS Kit v3-HS. Approximately 20 million loads were sequenced per sample.

[0112] For miRNAs, the Illumina TruSeq Small RNA Library Preparation Kit was used to prepare the cDNA library. As a result of the miRNA process by Dicer, the miRNAs contained free 5'-phosphate and 3'-hydroxyl groups, which were used to ligate specific adapters before the synthesis of the first and second strands of cDNA. The cDNAs were then amplified and indexed by PCR. Small RNAs were enriched using Agencecourt AMPure XP magnetic beads (Beckman Coulter). The samples were finally clustered at 9.6 pM and sequenced while being spiked into mRNA sequencing samples.

[0113] 1.6 Computational Process and Data Analysis (mRNA-Seq and miRNA-Seq Data Processing) mRNA-Seq reads were mapped to the mouse reference genome GRCm38.p6 and Ensembl mouse gene annotation version 86 (http: / / oct2016.archive.ensembl.org) using STAR aligner v.2.5.2a (Dobin et al., 2013). The quality of raw sequence reads was evaluated using FastQC v0.11.2, and alignment quality metrics were confirmed using RNASeQC v1.18 (De Luca D. Set al., 2012). Subsequently, duplicate reads in the RNA-Seq samples were marked using bamUtil v1.0.11, and the duplication rate was subsequently evaluated using the dupRadar Bioconductor package v1.4 (Sayols-Puig, S. et al., 2016). Read count vectors were generated using the feature counts package (Liao Y. et al., 2014). After aggregation into a count matrix, the data were normalized using Trimmed mean of M values ​​(TMM) and then transformed to log(counts per million) (CPM) using VOOMS (Ritchie ME, 2015). Descriptive analyses such as PCA and hierarchical clustering were performed to identify potential outliers. Expression differences between treatments and controls at each time point were examined using limma with significant thresholds of p adj ≤ 0.05 and abs(log2FC) ≥ 0.5. Two out of a total of 124 samples were excluded for failing to meet the QC criteria.

[0114] miRNA-Seq reads were trimmed using Kraken package v.12-274 (Davis MPA et al., 2013) and subsequently mapped to the mouse reference genome GRCm38.p6 and miRbase v.21 mouse miRNA (http: / / mirbase.org) using STAR aligner v.2.5.2a. The quality of raw sequence reads was assessed using FastQC v0.11.2 (http: / / www.bioinformatics.babraham.ac.uk / projects / fastqc / ), and trimming size and biotype distribution were assessed using in-house scripts. After aggregation into a count matrix, the data were normalized using Trimmed mean of M values ​​(TMM) and subjected to VOOMS transformation to log(counts per million) (CPM). Descriptive analyses such as PCA and hierarchical clustering were performed to identify potential outliers. Expression differences between treatments and controls at each time point were measured using limma with significant thresholds of p adj ≤ 0.05 and abs(log2FC) ≥ 0.5.

[0115] 1.7 Integrated Data Analysis (Correlation between Functional Parameters and Expression) Spearman's rho between lung function and lung weight measurements and the voom conversion log (CPM) of each miRNA and mRNA across all samples in both models and at all time points.

[0116] 1.8 Determination of Presumed miRNA-mRNA Target Pairs A stepwise approach was employed to determine the mRNA targets of miRNAs. First, low-expression miRNAs and mRNAs were removed from the expression matrix. Subsequently, Spearman's rho was calculated between the voom-converted log(CPM) of each miRNA versus each mRNA for both models and all samples at all time points, using the corAndPvalue function (Langfelder & Horvath, 2008) from WGCNA v.1.60. The correlation set based on the predicted miRNA-mRNA pairs is defined as all combinations with a correlation ≤ -0.6. To add sequence-based predictions of the predicted miRNA-mRNA pairs, all combinations predicted by at least two of the five most cited miRNA prediction algorithms (DIANA, Miranda, PicTar, TargetScan, miRDB) available in the bioconductor package miRNAtap v.1.10.0 / miRNAtap.db v.0.99.10 (Pajak & Simpson, 2016) were used as sequence-based pairs. The final set of miRNA-mRNA pairs was the crossover between anticorrelation-based and sequence-based interaction pairs, significantly reducing the number of predictions and resulting in a more reliable subset.

[0117] 1.9 Conservation of mouse-human miRNA sequences Seed regions (positions 2 to 7) were extracted from all mouse and human miRNAs in miRBase 21. For all combinations of mouse and human miRNAs, global alignment between the seed region and maturation was calculated using the pairwise alignment function of the Bioconductor Biostrings package (v2.46.0). The Needleman-Wunsch algorithm was applied using RNA substitution matrices with a match score of 1 and a mismatch score of 0. Two categories were assigned to miRNA candidates: miRNAs with an alignment score of 6 in the seed region of a mouse-human pair with the same name were classified as "conserved," and miRNAs with an alignment score of less than 6 in the seed region of a mouse-human pair with the same name were classified as "non-conserved." Additionally, miRNAs with an alignment score greater than 20 in the alignment of each mature sequence were assigned to the "mature high similarity" category.

[0118] 1.10 Characterization of miRNAs based on gene set enrichment of target gene sets Functional analysis of miRNAs was performed using enrichment functions on mRNA targets predicted from MetabaseR package v.4.2.3 and gene set classifications "pathway maps," "pathway map folders," "process networks," "metabolic networks," "toxicity networks," "disease genes," "toxic pathologies," "GO processes," "GO molecular functions," and "GO localizations." The enrichment functions perform hypergeometric tests on the overlapping portions of the query gene set and the reference set from the metabase. Data retrieval for characterizing the miRNA target sets was performed on the metabase on March 12, 2018.

[0119] 1.11 Functional analysis of miRNAs in cell analysis miRNAs were characterized by their effects on the production of the pro-inflammatory cytokine IL-6, fibroblast proliferation in pro-fibrotic processes, fibroblast-to-myofibroblast transition (FMT), collagen expression, and epithelial-to-mesenchymal transition (EMT). Unless otherwise stated in the figures or figure captions, A549, NHBEC (human normal bronchial epithelial cells), or NHLF (human normal lung fibroblasts) cells were transiently transfected with miRNA mimes at concentrations of 2 nM for miRNA alone or 2+2 nM for miRNA combinations.

[0120] All miRNA mimics used in the experiments shown in the figure were purchased from Qiagen in the triple-stranded miRCURY LNA miRNA Mimic format. The miRCURY LNA miRNA Mimic design includes three RNA strands instead of the two RNA strands that characterize conventional miRNA mimics. The miRNA (guide) strand is an unmodified RNA strand with a sequence that precisely corresponds to the miRBase annotation. However, the passenger strand is divided into two LNA-enhanced RNA strands (https: / / www.qiagen.com / de / products / discovery-and-translational-research / functional-and-cell-analysis / mirna-functional-analysis / mircury-lna-mirna-mimics / mircury-lna-mirna-mimics / #orderinginformation). When properly designed, these three-stranded RNA mimics are as potent as conventional double-stranded RNA mimics. A major advantage is that, due to the segmented nature of the passenger strand, only the miRNA strand is loaded into the RNA-induced silencing complex (RISC), preventing the generation of miRNA activity from the two complementary passenger strands. The phenotypic changes observed with the miRCURY LNA miRNA mimic can therefore be attributed to the miRNA simulated by the mimic (see diagram for miRNA target identification with biotinylated mimic).

[0121] The unique three-strand RNA design is made possible by incorporating high-affinity LNA nucleotides into the two passenger strands. The sequence, length, and LNA spike pattern of the two passenger strands are optimized using a sophisticated empirically derived design algorithm. Bramsen, J.B. Raet al. (2007) Improved silencing properties using small internally segmented interfering RNAs. Nucleic Acids Research 35:5886-5897. PMID:17726057. Griffiths-Jones, S. (2004) The miRNA Registry. Nucleic Acids Research Database Issue 32:D109-111.3.miRBase:www.mirbase.org.Kahn, AA, et al. (2009) Transfection of small RNAs globally perturbs gene regulation by endogenous miRNAs.Nature Biotechnology 27(6):549-555.doi:10.1038 / nbt.1543.

[0122] Figures 22, 23, and 24 show the use of miRNA mimes of miR-29a-3p, miR-181a-5p, and miR-212-5p, as well as their corresponding controls: - hsa-miR-29a-3p:MIMAT0000086: 5'UAGCACCAUCUGAAAUCGGUUA - hsa-miR-181a-5p:MIMAT0000256: 5'AACAUUCAACGCUGUCGGUGAGU - hsa-miR-212-5p:MIMAT0022695: 5'ACCUUGGCUCUAGACUGCUUACU - Negative control 4: GAUGGCAUUCGAUCAGUUCUA

[0123] All other miRNA mimes used in the other figures were designed similarly. Therefore, the sequence from sequence number 19 was used for miR-181b-5p, and the sequence from sequence number 18 was used for miR-10a-5p.

[0124] Under the latter conditions, a 4nM miRNA control was used. After 24 hours, TGFβ1 was added to the cells at a concentration of 5 ng / mL, and the cells were incubated for 24 hours (IL-6, proliferation analysis, and collagen mRNA expression) or 72 hours (collagen protein expression, FMT, and EMT analysis). Gene expression was measured by extracting total RNA from cells using the Qiagen RNeasy Plus 96 kit and reverse transcribing it to cDNA using the High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific). IL-6 gene expression was detected by the Taqman qPCR assay (Hs00174131_m1). IL-6 protein was quantified in the cell supernatant using the MSD V-PLEX Proinflammatory Panel 1 Human kit. To assess cell proliferation, cells were grown for 24 hours in the presence of TGFβ1 and analyzed using the WST-1 proliferation assay kit (Sigma / Roche). FMT was evaluated by growing NHLF cells as described above, followed by fixation and immunofluorescence staining of collagen 1a1. Images were acquired using the IN Cell Analyzer 2000 high-content cellular imaging system, collagen was quantified, and normalized by cell number (identified by DAPI-stained cell nuclei). EMT evaluation was performed using NHBEC cells and E-cadherin immunostaining in the same manner.

[0125] Immunoblotting was performed using Novex gels, ThermoFisher buffers, and a BioRad electrophoresis apparatus, following standard procedures. All primary antibodies were purchased from Cell Signaling Technology.

[0126] Cell analysis was performed using either lung epithelial cells or primary lung fibroblasts derived from human patient material. Therefore, due to the heterogeneity of each patient donor (e.g., genetic characteristics, environment, disease / surgery cause, cell isolation), the derived cells also inherently possess a certain degree of heterogeneity. Consequently, slight variability between analyses is possible, which explains a certain standard deviation and different analytical windows within the same analytical format. Nevertheless, primary cells were used because they are directly derived from patient material and are therefore more relevant to human disease.

[0127] 2.Results Administration of AAV-TGFβ1 and bleomycin induces pulmonary fibrosis pathology in mice. After administration of AAV-TGFβ1, bleomycin, or a suitable control (NaCl, AAV-Stuffer), longitudinal fibrosis progression was measured over 4 weeks, as shown in Figure 1. Histological analysis of Masson's trichrome-stained lung tissue sections at day 21 revealed a pulmonary fibrosis phenotype characterized by alveolar septal thickening, increased extracellular matrix deposition, and the presence of immune cells, which was evident in AAV-TGFβ1 and bleomycin-treated animals but absent in NaCl and AAV-Stuffer-controlled mice (Figure 2). Significant increases in lung weight in diseased animals clearly confirmed abnormal ECM deposition and tissue remodeling. Furthermore, as a functional consequence, lung function was significantly impaired after TGFβ1 overexpression and bleomycin treatment, thereby reflecting clinical observations of fibrotic ILD patients. In particular, bleomycin-induced changes in functional readout occurred one week before the changes in the AAV-TGFβ1 model, but very similar phenotypes were evident from day 21 onwards.

[0128] Transcriptional characterization of chronic disease onset. To analyze the overall changes in molecular pathways and gene expression underlying disease progression and progression in two models of pulmonary fibrosis, RNA was prepared from lung homogenates of each animal and subjected to next-generation sequencing (NGS) analysis. The number of differentially expressed mRNAs and miRNAs is shown in Figure 3. Pathway analysis (Figure 3C) predicted early enrichment of injury and acute inflammation-related processes in the bromycin model, while inflammation was absent in the early stages of the AAV model and occurred only during the fibrosis progression phase (after day 14). In contrast, enrichment of remodeling / ECM-related processes occurred in a similar manner after approximately day 14 in both disease models.

[0129] Identification of miRNAs associated with clinically relevant disease phenotypes. A stepwise selection strategy using multiple filtering criteria was established to identify miRNA candidates likely to be directly associated with disease onset (Figure 4). The central fibrosis-related criterion was incorporated by selecting only miRNAs whose longitudinal expression profiles were strongly or inversely correlated with either decreased lung function or increased lung weight, respectively. Furthermore, miRNA candidates needed to be differentially expressed at least at one time point in one model. Next, miRNAs were classified according to species conservation (conserved in humans vs. present only in mice) based on seed sequence and complete sequence similarity. The resulting list of miRNA candidates was finally manually curated to exclude candidates with different expression in the two disease models and / or with variable expression profiles, as well as non-conserved miRNAs that are upregulated but not targeted in humans. Further exclusion of miRNAs previously patented in the context of pulmonary fibrosis was achieved through literature text mining. The final hit list is shown in Figure 5.

[0130] miRNA target prediction (Figure 6). As a first approach to characterizing the functional roles of miRNAs, we computer-predicted putative mRNA targets by searching the DIANA, MiRanda, PicTar, TargetScan, and miRDB databases via the Bioconductor package miRNAtap (see Materials and Methods for details). We further examined the targets predicted in at least two of the five databases. Subsequently, each set of miRNA target genes was analyzed in terms of enrichment of specific disease-related processes, and Figure 7 illustrates the putative functions of genes targeted by specific miRNAs.

[0131] Functionality of miRNAs in the mir-E backbone (Figure 12). To demonstrate the functionality of miRNA sequences in the mir-E backbone, a GFP expression construct with the miRNA target sequence in the 3'UTR was used. HEK-293 cells were transiently transfected with a plasmid encoding one miRNA and a GFP expression construct. GFP fluorescence was measured 72 hours after transfection. The fluorescence signal of the negative control, i.e., a miRNA without the target sequence in the GFP 3'UTR, was set to 100%, and the multiplicative change in the fluorescence signal of all other constructs was correlated with the negative control. The positive control was the optimal mir-E construct, which, as expected, resulted in the most pronounced GFP knockdown. All other constructs also resulted in clear GFP knockdown, indicating that they are not only properly expressed but also accurately processed. The optimal length of the guide strand in the mir-E backbone is 22 nucleotides (nt), which may explain why 23nt miR212-5p is not as effective as 22nt miR212-5p. Therefore, 22nt miR212-5p is one preferred embodiment of the present invention.

[0132] miRNA expression in primary human lung fibroblasts (Figure 13). To analyze the expression of candidate miRNAs in a human context, small RNA sequencing was performed in primary human lung fibroblasts. As shown in Figure 13, strong expression was observed for all miRNAs on the candidate list, albeit at varying levels, which supports the concept of species-translating findings from a mouse pulmonary fibrosis model to humans.

[0133] Functional analysis of miRNAs in cellular analysis (Figures 14-21). To demonstrate the anti-fibrotic function of candidate miRNAs, synthetic miRNA mimes containing fully matured miRNA sequences were constructed, and transient transfection experiments were performed in cellular analysis reflecting key mechanisms of fibrotic remodeling. In the first experimental set, the effects of five selected miRNAs (mir-10a-5p, mir-181a-5p, mir-181b-5p, mir-212-3p, mir-212-5p) were analyzed in A549 cells and primary bronchial airway epithelial cells with and without pro-fibrotic TGFβ stimulation. As shown in Figure 14(A), transient transfection of four of the five miRNA mimes significantly reduced TGFβ-induced mRNA expression of IL6, a well-known inflammatory gene marker. The only exception was mir-212-3p, which did not show a significant anti-inflammatory effect in this setting. Interestingly, the same results were obtained in unstimulated A549 cells. To further clarify these findings at the protein level, IL6 expression in cell culture supernatants was measured by ELISA. These experiments examined mir-10a-5p, mir-181a-5p, mir-181b-5p, and combinations of these three miRNAs. As shown in Figure 14(B), each miRNA and all three combinations showed a significant decrease in IL6 expression in unstimulated and TGFβ-stimulated A549 cells, thereby confirming the anti-inflammatory effects of these miRNAs. In addition to its pro-inflammatory function, TGFβ plays a central role as an inducer of epithelial-to-mesenchymal transition (EMT), a characteristic of fibrotic remodeling in pulmonary fibrosis. During TGFβ-induced EMT, the expression of E-cadherin, an airway epithelial marker gene, decreases due to the transition from epithelial to fibroblast-like (mesenchymal) cell phenotype. To evaluate the potential protective role of selected miRNA candidates against TGFβ-induced EMT, we applied a cellular analysis combining cell analysis using human primary tracheal epithelial cells and high-content cell imaging analysis for the quantification of E-cadherin expression.As demonstrated by the significantly higher E-cadherin expression levels in the miRNA-treated group compared to the control group, as shown in Figure 15, all miRNAs tested in this setting showed a remarkable inhibitory effect on TGFβ-mediated EMT induction.

[0134] In addition to miR-10a+miR-181a-5p+miR-181b-5p, we also wanted to evaluate other miRNA combinations, so we repeated the previous EMT analysis, which is shown in Figure 15B. Individual miR-181a-5p, miR-181b-5p, and miR-212-5p were able to restore E-cadherin protein expression in lung epithelial cells after TGFβ treatment. The combinations of miR-181a-5p+miR-212-5p+miR10a-5p and miR-181a-5p+miR-212-5p also showed significant improvement in E-cadherin expression in the EMT analysis. Consistently, the best effects were observed with the three combinations of miR-181a-5p + miR-181b-5p + miR10a-5p, allowing for a reduction in miRNA dosage to achieve effects similar to those of miR-181a-5p, miR-181b-5p, or miR-10a-5p alone (Figure 15B). The variability in the analysis window between Figures 15A and 15B can be explained by a combination of slight variability between analyses and the differing behaviors of human primary lung epithelial cells from different donors. Nevertheless, the direction and significance of the miRNA effect remain unchanged.

[0135] In addition to airway epithelial cells, fibroblasts are considered a cell type highly relevant to the fibrotic process. By acting as a major source of overproduction of collagen and other extracellular matrix components, fibroblasts directly contribute to pulmonary sclerosis, which is involved in lung dysfunction and the eventual loss of structural integrity of the lung. To further investigate the function of candidate miRNAs during fibroblast activation, transient transfection experiments were performed on human primary lung fibroblasts under unstimulated and TGFβ-stimulated (pro-fibrotic) conditions. Functional indicators such as IL-6 expression, collagen expression, and fibroblast proliferation were evaluated in the presence or absence of miRNAs. As shown in Figure 16, all analyzed miRNAs showed a significant decrease in IL-6 expression in both the presence and absence of TGFβ, as measured by qRT-PCR. Furthermore, as shown in Figure 17, mir-212-3p, mir-181a-5p, and mir-181b-5p showed inhibitory effects on fibroblast proliferation under both basal and TGFβ-induced conditions. As shown in Figure 18, only the three combinations of mir-10a-5p, mir-181a-5p, and mir-181b-5p showed a significant dose-dependent effect on TGFβ-induced FMT compared to the control group. On the other hand, none of the miRNAs tested showed a significant effect when transfected individually. Nevertheless, miR-212-5p showed a trend toward collagen reduction in this analysis using this fibroblast donor (Figure 18). To determine whether the observed trend toward collagen deposition by miR212-5p was significant, or whether it was due to analytical variability caused by handling primary cells, FMT analysis was repeated with seven different fibroblast donors and a wider range of miRNA doses (Figure 19).

[0136] Figure 19 shows the effects of miRNA181a-5p and miR-212-5p alone on collagen 1 deposition upon TGFβ stimulation in FMT analysis. miR-181a-5p tended to reduce collagen 1 deposition at higher concentrations. miR-212-5p significantly reduced collagen 1 deposition in normal and IPF-pulmonary fibroblasts from 0.25 nM compared to each miRNA control mimite (Figure 19). In addition to collagen 1 deposition, miR-181a-5p and miR-212-5p altered the expression of new collagens other than collagen 1 in human lung fibroblasts (Figures 20 and 21). Upon TGFβ stimulation, miR-181a-5p and miR-212-5p reduced intracellular collagen 1a1 and collagen 5a1 (Figure 20A / B). Compared to miRNA-negative controls, the combination of miR-181a-5p and miR-212-5p showed a further significant reduction in collagen 1a1 protein expression (Figure 20A). Following the reduction in Col1a1 and Col5a1, Col3a1 mRNA expression was also significantly reduced by miR-212-5p and the combination of miR-181a-5p and miR-212-5p (Figure 20C). To finally demonstrate that the observed anti-fibrotic effects of miR-181a-5p and miR-212-5p in human lung fibroblasts are not solely through the regulation of TGFβ signaling, the miRNA mimes were also tested in co-cultures of epithelial-fibroblasts mimicking the cellular fibrotic niche (Figure 21). In a co-culture system in which a fibrosis-promoting mediator from epithelial cells activates co-cultured human lung fibroblasts, miR-212-5p significantly reduced Col1a1 expression in human lung fibroblasts, regardless of prior stimulation of epithelial cells with TGFβ (Figure 21).

[0137] Figure 22 shows the effects of miRNA-29a-3p, miRNA-181a-5p, and miR-212-5p, as well as their combinations, on TGFβ-stimulated collagen 1 deposition in FMT analysis. miR-29a-3p significantly reduced collagen deposition by up to 50%, and miR-212-5p significantly reduced collagen deposition by up to 78%. miR-181a-5p showed a trend of collagen reduction that could be improved in combination with miR-29a, leading to a 50% reduction at higher concentrations. The combination of miR-29a-3p and miR-212-5p significantly reduced collagen by up to 80%. It is noteworthy that this could be achieved with half the miRNA dose of each specific miRNA in the combination compared to the dose of miRNA-29a-3p or miR-212-5p alone. Even using just 1.33 nM of each miRNA in the three combinations—miR-29a-3p, miR-212-5p, and miR-181a-5p—significantly achieved a collagen reduction of approximately 70% compared to the miRNA control (Figure 22).

[0138] Following collagen 1 deposition in primary lung fibroblasts, miR-181a-5p and miR-212-5p significantly inhibit intracellular collagen 1 synthesis, especially when administered in combination (Figures 23A, 24). This approximately 50% reduction in Col1a1 protein synthesis was significantly improved by adding miR-29a-3p to the two combinations of miR-181a-5p / miR-212-3p, resulting in complete inhibition of Col1a1 synthesis. For Col5a1 (Figures 23B, 24) protein synthesis and Col3a1 RNA de novo synthesis (Figures 23C, 24), the same trend was observed with the three combinations of miR-29a-3p, miR-181a-5p, and miR-212-5p, showing stronger inhibition of these collagen subtypes after TGFβ stimulation.

[0139] To characterize the performance of the viral construct, naive mice were transductioned with increasing doses of the AAV 6.2 construct containing the miR-212-5p expression cassette (see plasmid-derived SEQ ID NO: 61, SEQ ID NO: 91, see Figure 26), and these mice were sacrificed 7, 14, and 28 days after intratracheal lung infusion of AAV. As shown in Figure 25, increasing doses of miR-212-5p AAV resulted in a dose-dependent increase in miR-212-5p lung expression (Figure 25). On day 7, 1 x 10⁶ 11 The vg miR-212-5p AAV resulted in a 300x upgrade to miR-212-5p, which later increased to 350x at 14 and 28 days.

[0140] In summary, functional analyses in human airway epithelial cells and human lung fibroblasts demonstrate anti-inflammatory, anti-proliferative, and anti-fibrotic effects for selected miRNA candidates. The most significant effects were observed across all analytical formats for miR-181a-5p, mir-181b-5p, and mir-212-5p, while mir-10a-5p and mir-212-3p showed similar profiles, albeit with lower efficacy compared to the aforementioned miRNAs. In FMT analysis, positive effects were observed for miR-10a-5p, miR-181a-5p, miR-181b-5p, and miR-212-5p, while the combination of mir-10a-5p, mir-181a-5p, and mir-181b-5p showed improved inhibitory effects in FMT analysis, indicating an additive or synergistic effect of this combination. Overall, very strong antifibrotic effects of miR-181a-5p on lung epithelial cells and very strong antifibrotic effects of miR-212-5p on fibroblasts were observed, suggesting that this combination of two miRNAs is a very potent antifibrotic combination affecting the two most important cell types in pulmonary fibrosis. Therefore, combinations of candidate miRNAs, and in particular mimics of miR-181a-5p and miR-212-5p, or mimics of each of them, offer a favorable option for developing therapeutic approaches with superior efficiency profiles compared to individual miRNAs. Furthermore, the published collagen inhibitory effect of miR-29a-3p alone could be verified under fibrotic conditions. We were able to demonstrate that specific combinations of miR-29a-3p and miR-212-5p, or three combinations of miR-29a-3p, miR-212-5p, and miR-181a-5p, yielded more pronounced anti-fibrotic effects compared to single miRNAs or the two-combination of miR-212-5p and miR-181a-5p. Compared to the use of miRNAs alone, using the miRNAs in combination at lower doses may maintain anti-fibrotic activity and lead to a reduction in undesirable / non-specific effects in transductioned cells.Furthermore, specific combinations of mirR-29a-3p with miR-212-5p or both miR-212-5p and miR-181a-5p offer the potential to address pulmonary hypertension (PH) in patients with ILD, PF-ILD, or IPF who already have PH or would otherwise develop it. Chen, T. et al. demonstrated that increasing miR-212-5p reduces RVSP and pulmonary vascular wall remodeling in a mouse model of pulmonary hypertension. In addition to (super)additive or synergistic benefits, the three combinations also possess anti-fibrotic effects in two key cell types in the pathogenesis of pulmonary fibrosis: epithelial cells and fibroblasts. By combining miR-181a-5p, which exhibits a remarkable anti-fibrotic effect through transformation of lung epithelial cells, with miR-212-5p and miR29a-3p, which have significant anti-fibrotic effects through inhibition of fibroblast activation and ECM deposition, this triple combination of three miRNAs enhances the biological therapeutic spectrum compared to individual miRNAs.

[0141] Therapeutic applications of miRNATo translate the discovery of novel pulmonary fibrosis-associated miRNAs into therapeutic applications, vector-mediated expression-based approaches offer attractive opportunities for chronic diseases such as pulmonary fibrosis by enabling the long-term expression of miRNAs or miRNA target sequences. As shown in Figure 8, various vector design strategies are available to modulate miRNA function. To replenish miRNAs that are downregulated under fibrotic conditions, vectors using polymerase II promoters (e.g., CMV, CBA) or polymerase III promoters (e.g., U6, H1) can be applied to the expression of a single miRNA sequence or a combination of several miRNAs (Figure 8A). While both promoter classes are generally applicable to miRNA expression, constructs based on polymerase II promoters offer further advantages by enabling the use of cell type-specific promoters, thereby allowing for the design of more specific and potentially safer vector constructs. Endogenous miRNAs are expressed as precursor molecules called so-called pri-miRNAs and are processed first into pri-miRNAs through cellular RNAi mechanisms, and then in a second step into mature, biologically active forms. To efficiently mature vector-derived miRNAs, the target sequence can be expressed either as an endogenous precursor miRNA or as an artificial miRNA by incorporating the mature miRNA sequence into an exogenous miRNA backbone, such as the miR30 scaffold or an optimized form of the miR-E backbone (Fellmann C et al., 2013). Examples of constructs based on the miR-E backbone are provided in the examples and sequence lists below. Constructs noted as “guide position” are preferred (Table 1). Sequence IDs 40-81 provide examples of miRNA expression cassette designs using the miR-E backbone. Sequence IDs 40-69 describe examples of expression cassettes containing mature miRNA or native pre-miRNA for each individual miRNA, while Sequence IDs 70-81 describe combinations of three different miRNAs in a monocistronic expression cassette.All given expression cassettes are embedded in an AAV vector backbone and consist of a reverse-terminal repeat derived from AAV2, a CMV promoter, an SV40 polyadenylation signal, and, in some cases, a high-sensitivity green fluorescent protein (eGFP) upstream of a miRNA sequence (one or more). As shown in Figures 8B and 8C, two different vector design strategies are applicable to modulate the functionality of miRNAs upregulated under fibrillation: 1) Expression of antisense-like molecules designed to specifically bind to profibrosis-promoting miRNAs and thereby inhibit their function (Figure 8B). Each molecule is a so-called anti-miR and can be incorporated into the expression vector as short hairpin RNA (shRNA) or artificial miRNA. Similar to miRNA supplementation, several miRNA target sequences can be incorporated into a single vector, thereby enabling inhibition of various target miRNAs. 2) Expression of mRNA containing several copies of the miRNA binding site, a so-called sponge, aims to selectively block profibrosis-promoting miRNAs and thereby inhibit their function (Figure 8C). In summary, various vector design strategies can be used for the functional regulation (replacement or inhibition) of pulmonary fibrosis-related miRNAs.

[0142] For the lung delivery of the aforementioned expression constructs, non-viral and viral gene therapy vectors are applicable. However, compared to currently available non-viral delivery systems, such as liposomes, viral vectors have demonstrated superior properties in terms of efficacy and tissue / cell type selectivity, as demonstrated in various papers over the past few years. Furthermore, viral vectors offer great potential for engineering methods to further improve their potency, selectivity, and safety properties. Adeno-associated virus (AAV)-based viral vectors have emerged as one of the best vector systems for in vivo gene therapy, based on their excellent preclinical and clinical safety profiles and highly efficient and stable gene delivery to various target organs and cell types, including fully differentiated and non-dividing cells. Since the discovery of serotype AAV2, the prototype of AAV, in 1965 (Atchison et al.), various further serotypes have been identified from humans, non-human primates, and phylogenetically different species such as pigs, birds, and others. To date, more than 100 natural AAV isolates have been reported, and interestingly, these isolates differ in terms of tissue tropism. The application of capsid engineering approaches has recently expanded the repertoire of AAV vectors available for gene therapy approaches. A groundbreaking paper by Limberis et al. (2009) described a systematic comparison of 27 AAV capsid variants and native serotypes for pulmonary transduction, and based on this groundbreaking paper, AAV5, AAV6, and AAV6.2 were identified as capsids highly suitable for pulmonary delivery after local administration routes (e.g., intranasal or intratracheal administration). Furthermore, an AAV capsid variant designed based on AAV2 (AAV2-L1) was recently described as a novel vector enabling specific gene delivery to the lungs after systemic administration of the vector (Korbelin et al., 2016). As shown in Figure 9, expression vectors containing miRNA or miRNA target sequences can be flanked by AAV reverse terminal repeats (ITRs) at their 5' and 3' ends, thereby enabling packaging into AAV capsids suitable for lung delivery of each construct, as exemplified by AAV2-L1, AAV5, AAV6, and AAV6.2.The efficacy of AAV-mediated lung delivery using the aforementioned capsid variants was confirmed in mouse studies by evaluating transgene expression using constructs expressing the reporter gene (GFP, fLuc) by immunohistochemistry (Figure 10A, D) or in vivo imaging (Figure 10B, C). At the histological level, bronchial airway epithelial cells, alveolar epithelial cells, and parenchymal cells stained positively for reporter gene expression, indicating successful gene delivery to these cell types. Furthermore, in the case of systemically delivered AAV2-L1, quantitative transgene expression was also detected in lung endothelial cells. It is noteworthy that transgene expression remained stable without a decrease in expression levels up to 6 months after the initial vector administration (data not shown). In summary, the AAV vector represents a highly attractive delivery system for the stable expression of therapeutic miRNAs or miRNA target sequences in disease-associated cell dies in the lung, thereby providing a novel and highly innovative multi-target therapeutic method for IPF and other fibrotic interstitial pneumonias with unmet medical needs.

[0143] List of References ● Adegunsoye A, Oldham JM, Fernandez Perez ER et al.Outcomes of immunosuppressive therapy in chronic hypersensitivity pneumonitis.ERJ Open Res.2017;3:00016-2017 ● Atchison RW,Casto BC,Hammon WM;Adenovirus-associated defective virus particles;Science.1965 Aug 13;149(3685):754-6 ● Bagnato G.Harari S.Cellular interactions in the pathogenesis of interstitial lung diseases.Eur Respir Rev 2015;24:102-114 ● Beckett.T Inhalation of Nebulized Perfluorochemical Enhances Recombinant Adenovirus and Adeno-Associated Virus-Mediated Gene Expression in Lung Epithelium,Human Gene Therapy Methods 23:98-110(2012),DOI:10.1089 / hgtb.2012.014 ● Brunner AM,Marquardt H,Malacko AR,Lioubin MN,Purchio AF(1989)Site-directed mutagenesis of cysteine residues in the pro region of the transforming growth factor beta 1 precursor.Expression and characterization of mutant proteins;J Biol Chem 264(23):13660-13664 ● Chen,T.,MiR-212-5p Is a Potential Therapeutic Tool in Treatment of Pulmonary Hypertension Am J Respir Crit Care Med 2018;197:A4616,www.atsjournals.org ● Chen,T.,Engineering of Endothelium-Derived Extracellular Vesicles with Altered miRNA Cargo to Treat Severe Pulmonary Hypertension,Am J Respir Crit Care Med 2019;199:A2401 ● Cottin V,Wollin L,Fischer A,Quaresma M,Stowasser S,Harari S.Fibrosing interstitial lung diseases:knowns and unknowns.Eur Resp Rev 2019;28:180100 ● Davis MP,van Dongen S,Abreu-Goodger C,Bartonicek N,Enright AJ;Kraken:a set of tools for quality control and analysis of high-throughput sequence data;Methods,63(1),(2013),pp.41-49 ● DeLuca DS,Levin JZ,Sivachenko A,Fennell T,Nazaire MD,Williams C,Reich M,Winckler W,Getz G;RNA-SeQC:RNA-seq metrics for quality control and process optimization.Bioinformatics.2012 Jun 1;28(11):1530-2 ● Dobin A,Davis CA,Schlesinger F,Drenkow J,Zaleski C,Jha S,Batut P,Chaisson M,Gingeras TR;STAR:ultrafast universal RNA-seq aligner.Bioinformatics.2013 Jan 1;29(1):15-21 ● Doyle TJ,Dellaripa PF.Lung manifestations in the rheumatic diseases.Chest 2017;152:1283-95 ● Elme’n J,Thonberg H,Ljungberg K,Frieden M,Westergaard M,Xu Y,Wahren,B,Liang Z,Orum H,Koch T,Wahlestedt C(2005)Locked nucleic acid(LNA)mediated improvements in siRNA stability and functionality.Nucleic Acids Res 33:439-447 ● Fellmann C,Hoffmann T,Sridhar V,Hopfgartner B,Muhar M,Roth M,Lai DY,Barbosa IA,Kwon JS,Guan Y,Sinha N,Zuber J;An Optimized microRNA Backbone for Effective Single-Copy RNAi;Cell Rep.2013 Dec 26;5(6):1704-13 ● Gimenez A,Storrer K,Kuranishi L,et al.Change in FVC and survival in chronic fibrotic hypersensitivity pneumonitis.Thorax 2017;73:391-392 ● Goh NS,Hoyles RK,Denton CP,et al.Short-term pulmonary function trends are predictive of mortality in interstitial lung disease associated with systemic sclerosis.Arthritis Rheumatol 2017;69:1670-1678 ● Grimson MicroRNA Targeting Specificity in Mammals:Determinants beyond Seed Pairing,Volume 27,Issue 1,6 July 2007,Pages 91-105,https: / / doi.org / 10.1016 / j.molcel.2007.06.017 ● Guler SA,Winstone TA,Murphy D,et al.Does systemic-sclerosis-associated interstitial lung disease burn out? Specific phenotypes of disease progression.Ann Am Thorac Soc 2018;15(12):1427-1433 ● Fischer A,Brown KK,du Bois RM et al.Mycophenolate mofetil improves lung function in connective tissue disease-associated interstitial lung disease.J Rheumatol.2013;40:640-6 ● Flaherty KR,Brown KK,Wels AU,et al.Design of the PF-ILD trial:a double-blind,randomised,placebo-controlled phase III trial of nintedanib in patients with progressive fibrosing interstitial lung disease.BMJ Open Respir Res 2017;4:e000212 ● Freier,S.,The ups and downs of nucleic acid duplex stability:structure-stability studies on chemically-modified DNA:RNA duplexes,Nucleic Acids Research(volume 25 issue 22 pages 4429-4443) ● Galie N,Humbert M,Vachiery JL,et al.2015 ESC / ERS Guidelines for the diagnosis and treatment of pulmonary hypertension.ERJ 2015 46:903-975;DOI:10.1183 / 13993003.01032-2015 ● Guler SA,Ellison K,Algamdi M,Collard HR,Ryerson CJ.Heterogeneity in unclassifiable interstitial lung disease:a systematic review and meta-analysis.Ann Am Thorac Soc 2018;15(7):854-863 ● Hall,A.,RNA interference using boranophosphate siRNAs:structure-activity relationships,Nucleic Acids Research,2004,Vol.32,No.20 5991-6000 ● Hopkins RB,Burke N,Fell C,Dion G,Kolb M;Epidemiology and survival of idiopathic pulmonary fibrosis from national data in Canada;Eur.Respir.J.,48(1)(2016),pp.187-195 ● Jegal Y,Kim DS,Shim TS et al.Physiology is a stronger predictor of survival than pathology in fibrotic interstitial pneumonia.Am J Respir Crit Care Med 2005;171:639-644 ● Jiang,R.,The emerging roles of a novel CCCH-type zinc finger protein,ZC3H4,in silica-induced epithelial to mesenchymal transition,Toxicology Letters 307(2019)26-40 ● Khalil N,Churg A,Muller N,O’Connor R.Environmental,inhaled and ingested causes of pulmonary fibrosis.Toxicol Pathol 2007;35:86-96 ● Kim MY,Song JW,Do KH,et al.Idiopathic nonspecific interstitial pneumonia:changes in high-resolution computed tomography on long-term follow-up.J Comput Assist Tomogr 2012;36:170-174 ● Kolb M,Vasakova M.The natural history of progressive fibrosing interstitial lung diseases.Resp Res(Lond)2019;20(1):57 ● Kоrbelin J,Sieber T,Michelfelder S,Lunding L,Spies E,Hunger A,Alawi M,Rapti K,Indenbirken D,Mueller OJ,Pasqualini R,Arap W,Kleinschmidt JA,Trepel M;Pulmonary Targeting of Adeno-associated Viral Vectors by Next-generation Sequencing-guided Screening of Random Capsid Displayed Peptide Libraries;Mol Ther.2016 Jun;24(6):1050-1061 ● Langfelder P,Horvath S;WGCNA:an R package for weighted correlation network analysis;BMC Bioinformatics.2008 Dec 29;9:559 ● Ley B,Collard HR(2013);Epidemiology of idiopathic pulmonary fibrosis;Clin.Epidemiol.,5:483-492 ● Liao Y,Smyth GK,Shi W;feature Counts:an efficient general purpose program for assigning sequence reads to genomic features;Bioinformatics 30,923-930(2014) ● Limberis MP,Vandenberghe LH,Zhang L,Pickles RJ,Wilson JM;Transduction efficiencies of novel AAV vectors in mouse airway epithelium in vivo and human ciliated airway epithelium in vitro;Mol Ther.2009 Feb;17(2):294-301 ● Luckhardt TR,Thannickal VJ.Systemic sclerosis-associated fibrosis:an accelerated aging phenotype? Curr Opin Rheumatol 2015;27:571-576 ● Mathai SC,Danoff SK;Management of interstitial lung disease associated with connective tissue disease;BMJ.2016 Feb 24;352 ● Mook OR,Baas F,de Wissel MB,Fluiter K(2007)Evaluation of locked nucleic acid-modified small interfering RNA in vitro and in vivo.Mol Cancer Ther 6:833-843. ● Morisset J,Johannson KA,Vittinghoff E et al.Use of mycophenolate mofetil or azathioprine for the management of chronic hypersensitivity pneumonitis.Chest.2017;151:619-625 ● Naso,WF,Tomkowicz,B,Perry WL,Strohl,W Adeno-Associated Virus(AAV)as a Vector for Gene Therapy;BioDrugs(2017)31:317-334 ● Osborn,M.,Improving siRNA Delivery In Vivo Through Lipid Conjugation,Nucleic Acid Therapeutics,Volume 28,Number 3,2018 ● Pajak M and Simpson TI(2016);miRNAtap:miRNAtap:microRNA Targets-Aggregated Predictions.R package version 1.10.0. ● Rajwanshi.V,The eight stereoisomers of LNA(locked nucleic acid):a remarkable family of strong RNA binding molecules,Angewandte Chemie,International Edition Volume 39,Issue 9 Pages 1656-1659 Journal 2000 ● Raghu G,Collard HR,Egan JJ,et al.;ATS / ERS / JRS / ALAT Committee on Idiopathic Pulmonary Fibrosis An official ATS / ERS / JRS / ALAT statement:idiopathic pulmonary fibrosis:evidence-based guidelines for diagnosis and management;Am J Respir Crit Care Med.2011;183(6):788-824 ● Ritchie ME,Phipson B,Wu D,Hu Y,Law CW,Shi W,Smyth GK;limma powers differential expression analyses for RNA-sequencing and microarray studies;Nucleic Acids Res.2015 Apr 20;43(7) ● Sadeleer LJ de,Hermans F,Dycker E de,et al.Effects of corticosteroid treatment and antigen avoidance in a large hypersensitivity pneumonitis cohort:a single-centre cohort study.J Clin Med 2019;8:14 ● Sayols S,Scherzinger D,Klein H;dupRadar:a Bioconductor package for the assessment of PCR artifacts in RNA-Seq data;BMC Bioinformatics 17,428(2016) ● Scott M.Hammond;An overview of microRNAs;Adv Drug Deliv Rev.2015 Jun 29;87:3-14 ● Schwartz MI,King TE.Interstitial lung disease 5th Ed.Shelton:People’s Medical Publishing House 2011 ● Solomon JJ,Chung JH,Cosgrove GP,et al.Predictors of mortality in rheumatoid arthritis-associated interstitial lung disease.Eur Respir J 2016;47:588-596 ● Spagnalo P,Rossi G,Trisolini R,Sverzellati N,Baughman RP,Wells AU.Pulmonary sarcoidosis.Lancet Respir Med.2018 May;6(5):389-402. ● Strobel B,Duechs MJ,Schmid R,Stierstorfer BE,Bucher H,Quast K,Stiller D,Hildebrandt T,Mennerich D,Gantner F,Erb KJ,Kreuz S;Modeling Pulmonary Disease Pathways Using Recombinant Adeno-Associated Virus 6.2;Am J Respir Cell Mol Biol.2015 Sep;53(3):291-302. ● Strobel B,Miller FD,Rist W,Lamla T.Comparative Analysis of Cesium Chloride-and Iodixanol-Based Purification of Recombinant Adeno-Associated Viral Vectors for Preclinical Applications;Hum Gene Ther Methods.2015 Aug;26(4):147-57 ● Strobel,B.Modeling pulmonary fibrosis by AAV-mediated TGFβ1 Expression:a proof of concept study for AAV-based disease modeling and riboswitch-controlled vector production;Konstanz,Univ.,Diss.,2016,2018,http: / / kops.uni-konstanz.de / handle / 123456789 / 33826 ● Sun,S Enhancing the Therapeutic Delivery of Oligonucleotides by Chemical Modification and Nanoparticle Encapsulation,Molecules 2017,22,1724;doi:10.3390 / molecules22101724 ● Thannickal VJ,Zhou Y,Gaggar A,Duncan SR.Fibrosis:ultimate and proximate causes.J Clin Invest 2014;124(11):4673-4677 ● Tashkin DP,Elashoff R,Clements PJ et al.Scleroderma Lung Study Research Group.Cyclophosphamide versus placebo in scleroderma lung disease.N Engl J Med.2006;354:2655-66 ● Uhlmann,Recent advances in the medicinal chemistry of antisense oligonucleotides,Curr Opinion in Drug Development,vol.3,no.2,2000,pages 203-213 ● Vinnikov,I.A.,Hypothalamic miR-103 Protects from Hyperphagic Obesity in Mice,The Journal of Neuroscience,August 6,2014·34(32):10659-10674·10659 ● Volkmann ER,Tashkin DP,Sim M,Kim GH,Goldin J,Clements PJ.Determining progression of scleroderma-related interstitial lung disease.J Scleroderma Rel Disord 2019;4(1):62-70 ● Walsh SL,Wells AU,Sverzellati N,et al.An integrated clinicoradiological staging system for pulmonary sarcoidosis:a case-cohort study.Lancet Respir Med 2014;2:123-30 ● Wells AU.Approach to diagnosis of diffuse lung disease.Clinical respiratory medicine 2nd Ed.Albert RK,Spiro SG&Jett JR(Eds.).Mosby [Elsevier Science] 2004 ● Wells AU,Brown KK,Flaherty KR,Kolb M,Thannickal VJ on behalf of the IPF Consensus Working Group.What’s in a name? That which we call IPF,by any other name would act the same.Eur Respir J 2018;51:1800692 ● Wollin L, Distler JHW, Redente EF, et al. Potential of nintedanib in treatment of progressive fibrosing interstitial lung diseases. Eur Respir J 2019;54(3). pii:1900161 ● Wu Z, Asokan A, Grieger JC, Govindasamy L, Agbandje-McKenna M, Samulski RJ Single amino acid changes can influence titer, heparin binding, and tissue tropism in different adeno-associated virus serotypes; J Virol 2006;80:11393-11397 ● Xianbin, Y., Gene silencing activity of siRNA molecules containing phosphorodithioate substitutions ACS Chem. Biol. 2012,7,1214-1220 ● Yang, X., Silica-induced initiation of circular ZC3H4 RNA / ZC3H4 pathway promotes the pulmonary macrophage activation. FASEB J. 32,3264-3277(2018). www.fasebj.org

[0144]

Table 1

Claims

1. A viral vector comprising a capsid and a packaged nucleic acid, wherein the packaged nucleic acid encodes two or more miRNAs, and the two or more miRNAs include the miRNA of SEQ ID NO: 92 and the miRNA of SEQ ID NO: 15 or a fragment thereof having the sequence of SEQ ID NO:

99.

2. A viral vector comprising a capsid and a packaged nucleic acid, wherein the packaged nucleic acid encodes two or more miRNAs, and the two or more miRNAs include the miRNA of SEQ ID NO: 92 and the miRNA of SEQ ID NO: 17 or a fragment thereof having the sequence of SEQ ID NO:

100.

3. The viral vector according to claim 1 or 2, wherein the packaged nucleic acid encodes three or more miRNAs, and the miRNAs include (i) the miRNA of SEQ ID NO: 92, (ii) the miRNA of SEQ ID NO: 15 or a fragment thereof having the sequence of SEQ ID NO: 99, and (iii) the miRNA of SEQ ID NO: 17 or a fragment thereof having the sequence of SEQ ID NO:

100.

4. The viral vector according to claim 3, wherein the packaged nucleic acid encodes a miRNA having the sequence of SEQ ID NO: 92, a miRNA having the sequence of SEQ ID NO: 15, and a miRNA having the sequence of SEQ ID NO:

17.

5. A viral vector according to any one of claims 1 to 4, comprising a capsid and a packaged nucleic acid comprising one or more transgene expression cassettes containing a transgene encoding the following: - At least one miRNA selected from the group consisting of the miRNA of SEQ ID NO: 92, a fragment of SEQ ID NO: 15 or a fragment thereof having the sequence of SEQ ID NO: 99, and a fragment of SEQ ID NO: 17 or a fragment thereof having the sequence of SEQ ID NO: 100, and - RNA that inhibits the function of one or more miRNAs selected from the group consisting of miRNAs SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 34, 35, and 36.

6. A viral vector comprising a capsid and a packaged nucleic acid containing two or more transgene expression cassettes containing transgenes, - The first expression cassette comprises a first transgene encoding the miRNA of SEQ ID NO: 92, a fragment of SEQ ID NO: 15 or a fragment thereof having the sequence of SEQ ID NO: 99, and a fragment of SEQ ID NO: 17 or a fragment thereof having the sequence of SEQ ID NO: 100, and - The second expression cassette contains a second transgene that encodes RNAs that inhibit the function of one or more miRNAs selected from the group consisting of miRNAs with SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 34, 35, and 36. A viral vector according to any one of claims 1 to 5.

7. The viral vector according to any one of claims 5 to 6, wherein the RNA inhibition does not undergo RNAi processing or RNAi maturation.

8. The viral vector according to any one of claims 5 to 7, wherein the nucleic acid has an even number of transgene expression cassettes.

9. The viral vector according to any one of claims 5 to 8, wherein the transgene expression cassette comprises a promoter, a transgene, and a polyadenylation signal, and the promoter or the polyadenylation signal is positioned opposite to each other.

10. The viral vector according to any one of claims 1 to 9, wherein the vector is a recombinant AAV vector.

11. The viral vector according to any one of claims 1 to 10, wherein the vector is a recombinant AAV vector having the AAV-2 serotype.

12. The viral vector according to any one of claims 1 to 11, wherein the capsid comprises a first protein having the sequence of SEQ ID NO: 29 or 30.

13. The viral vector according to any one of claims 1 to 12, wherein the capsid comprises a first protein which is 80% identical to a second protein having the sequence of SEQ ID NO: 82, but one or more gaps are permitted in the alignment between the first protein and the second protein.

14. The viral vector according to any one of claims 1 to 13, wherein the capsid comprises a first protein which is 95% identical to the second protein of SEQ ID NO: 82, but the alignment gap between the first protein and the second protein is considered a mismatch.

15. The viral vector according to any one of claims 1 to 14, wherein the vector is a recombinant AAV vector having the AAV5 or AAV6.2 serotype.

16. The viral vector according to claim 15, wherein the capsid of the recombinant AAV6.2 vector comprises a capsid protein having the sequence of SEQ ID NO:

82.

17. The viral vector according to any one of claims 1 to 15, wherein the packaged nucleic acid is double-stranded.

18. The viral vector according to any one of claims 1 to 15, wherein the packaged nucleic acid is single-stranded.

19. A viral vector according to any one of claims 1 to 18, used for the prevention or treatment of a disease selected from the group consisting of ILD, PF-ILD, IPF, connective tissue disease (CTD)-associated ILD, rheumatoid arthritis ILD, hypersensitivity pneumonitis with chronic fibrosis (HP), idiopathic nonspecific interstitial pneumonia (iNSIP), unclassifiable idiopathic interstitial pneumonia (IIP), environmental / occupational lung disease, pulmonary hypertension (PH), fibrotic silicosis, systemic scleroderma ILD, sarcoidosis, and fibrosarcoma.

20. A viral vector according to any one of claims 1 to 18, for use as a pharmaceutical product.

21. An AAV vector comprising a vector genome encoding two or more miRNAs, wherein the two or more miRNAs include the miRNA of SEQ ID NO: 92 and the miRNA of SEQ ID NO: 15 or a fragment thereof having the sequence of SEQ ID NO:

99.

22. An AAV vector comprising a vector genome encoding two or more miRNAs, wherein the two or more miRNAs include a miRNA fragment having the sequence of SEQ ID NO: 92 and a miRNA or fragment thereof having the sequence of SEQ ID NO:

17.

23. The AAV vector according to claim 21 or 22, wherein the vector genome encodes (i) a miRNA containing the sequence of SEQ ID NO: 92, (ii) a miRNA or a fragment thereof containing the sequence of SEQ ID NO: 15 and having the sequence of SEQ ID NO: 99, and (iii) a miRNA or a fragment thereof containing the sequence of SEQ ID NO: 17 and having the sequence of SEQ ID NO:

100.

24. The AAV vector according to claim 23, wherein the vector genome encodes (i) a miRNA having the sequence of SEQ ID NO: 92, (ii) a miRNA having the sequence of SEQ ID NO: 15, and (iii) a miRNA having the sequence of SEQ ID NO:

17.

25. The AAV vector according to any one of claims 21 to 24, wherein the vector genome further encodes RNAs that inhibit the function of one or more miRNAs selected from the group consisting of miRNAs SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 34, 35, and 36.

26. A double-stranded plasmid vector comprising an AAV vector according to any one of claims 21 to 25.

27. A combination of miRNA mimes used in a method for preventing and / or treating fibroproliferative disorders, wherein the combination comprises (i) a miRNA mime having the sequence of SEQ ID NO: 92, and (ii) a miRNA mime having the sequence of SEQ ID NO: 15 and / or a miRNA mime having the sequence of SEQ ID NO:

17.

28. A miRNA mimite of miRNA-29a-3p used in methods for the prevention and / or treatment of fibroproliferative disorders, wherein the miRNA mimite is a nucleotide oligomer consisting of the sequence of SEQ ID NO: 92, or comprises a nucleotide oligomer consisting of the sequence of SEQ ID NO: 92, provided the following conditions are met: - The oligomer optionally contains nucleotides having chemical modifications that result in non-natural nucleotides that exhibit base-pairing behavior at corresponding positions (AU and GC) determined by the sequence of Sequence ID No. 92; - The oligomer optionally contains a nucleotide analog that exhibits base-pairing behavior at the corresponding positions (AU and GC) determined by the sequence of Sequence ID No. 92; - The oligomer is optionally conjugated with a lipid to facilitate drug delivery. It has, The prevention and / or treatment further comprises administering a miRNA mime having the sequence of SEQ ID NO: 15 and / or a miRNA mime having the sequence of SEQ ID NO:

17.

29. A miRNA mime used in the method of claim 28, wherein the prevention and / or treatment further comprises administering a mimetic of a mimetic of a mimetic having the sequence of SEQ ID NO:

15.

30. A miRNA mime used in the method of claim 29, wherein the mime of a miRNA having the sequence of SEQ ID NO: 15 is a nucleotide oligomer consisting of the sequence of SEQ ID NO: 15 or SEQ ID NO: 99, or comprises a nucleotide oligomer consisting of the sequence of SEQ ID NO: 15 or SEQ ID NO: 99, provided the following conditions are met: - The oligomer optionally contains nucleotides having chemical modifications that result in non-natural nucleotides that exhibit base-pairing behavior at corresponding positions (AU and GC) determined by the sequence of SEQ ID NO: 15 or SEQ ID NO: 99; - The oligomer optionally contains a nucleotide analog that exhibits base-pairing behavior at the corresponding positions (AU and GC) determined by the sequence of SEQ ID NO: 15 or SEQ ID NO: 99; - The oligomer is optionally conjugated with a lipid to facilitate drug delivery. A miRNA mimetic that possesses [a certain characteristic].

31. A miRNA mime used in the method of claim 28, wherein the prevention and / or treatment further comprises administering a miRNA mime having the sequence of SEQ ID NO:

17.

32. A mimic of the miRNA having the sequence of SEQ ID NO: 17 is a nucleotide oligomer consisting of the sequence of SEQ ID NO: 17 or SEQ ID NO: 100, or contains a nucleotide oligomer consisting of the sequence of SEQ ID NO: 17 or SEQ ID NO: 100, provided the following conditions are met: - The oligomer optionally contains nucleotides having chemical modifications that result in non-natural nucleotides that exhibit base-pairing behavior at corresponding positions (AU and GC) determined by the sequence of SEQ ID NO: 17 or SEQ ID NO: 100; - The oligomer optionally contains a nucleotide analog that exhibits base-pairing behavior at the corresponding positions (AU and GC) determined by the sequence of SEQ ID NO: 17 or SEQ ID NO: 100; - The oligomer is optionally conjugated with a lipid to facilitate drug delivery. A miRNA mime used in the method of claim 31, having the following characteristics.

33. A miRNA mime used in the method of any one of claims 28 to 32, wherein the prevention and / or treatment further comprises administering a mimetic of a mimetic of a mimetic of a sequence of sequence number 19.

34. A mimic of the miRNA having the sequence of SEQ ID NO: 19 is either a nucleotide oligomer consisting of the sequence of SEQ ID NO: 19, or contains a nucleotide oligomer consisting of the sequence of SEQ ID NO: 19, provided the following conditions are met: - The oligomer optionally contains nucleotides having chemical modifications that result in non-natural nucleotides that exhibit base-pairing behavior at corresponding positions (AU and GC) determined by the sequence of Sequence ID No. 19; - The oligomer optionally contains a nucleotide analog that exhibits base-pairing behavior at the corresponding positions (AU and GC) determined by the sequence of Sequence ID No. 19; - The oligomer is optionally conjugated with a lipid to facilitate drug delivery. A miRNA mime used in the method of claim 33, having the following characteristics.

35. A miRNA mime used in the method according to any one of claims 28 to 34, wherein the fibroproliferative disorder is IPF or PF-ILD.

36. Use of (i) a miRNA mime of a miRNA having the sequence of SEQ ID NO: 92 and (ii) a miRNA mime of a miRNA having the sequence of SEQ ID NO: 15 and / or a miRNA mime of a miRNA having the sequence of SEQ ID NO: 17 for the manufacture of therapeutic drugs for fibroproliferative disorders such as IPF or PF-ILD or ILD.

37. A pharmaceutical composition comprising a miRNA mimite of miRNA (miRNA 29a-3p) having the sequence of SEQ ID NO: 92, a miRNA mimite of miRNA (miRNA 212-5p) having the sequence of SEQ ID NO: 15, and a pharmaceutically acceptable carrier or diluent.

38. A pharmaceutical composition comprising a miRNA mimite of miRNA (miRNA 29a-3p) having the sequence of Sequence ID No. 92, a miRNA mimite of miRNA (miRNA 181a-5p) having the sequence of Sequence ID No. 17, and a pharmaceutically acceptable carrier or diluent.

39. A pharmaceutical composition comprising a miRNA mimite of miRNA (miRNA 29a-3p) having the sequence of SEQ ID NO: 92, a miRNA mimite of miRNA (miRNA 181a-5p) having the sequence of SEQ ID NO: 17, a miRNA mimite of miRNA (miRNA 212-5p) having the sequence of SEQ ID NO: 15, and a pharmaceutically acceptable carrier or diluent.

40. The pharmaceutical composition according to claim 37, 38, or 39, wherein the miRNA mimetic in the composition is encapsulated in lipid nanoparticles (LNPs).

41. The pharmaceutical composition according to claim 40, wherein the composition contains 25 to 65 mol% of ionized lipids.

42. The pharmaceutical composition according to claim 40 or 41, wherein the average particle size of the LNP is 30 to 200 nm.

43. (a) A miRNA mime of miRNA29a-3p, wherein the miRNA mime is a nucleotide oligomer consisting of the sequence of SEQ ID NO: 92, or contains a nucleotide oligomer consisting of the sequence of SEQ ID NO: 92, provided the following conditions are met: - The oligomer optionally contains nucleotides having chemical modifications that result in non-natural nucleotides that exhibit base-pairing behavior at corresponding positions (AU and GC) determined by the sequence of Sequence ID No. 92; - The oligomer optionally contains a nucleotide analog that exhibits base-pairing behavior at the corresponding positions (AU and GC) determined by the sequence of Sequence ID No. 92; - The oligomer is optionally conjugated with a lipid to facilitate drug delivery. A miRNA mimetic having; (b) A miRNA mime of miRNA212-5p, wherein the miRNA mime is a nucleotide oligomer consisting of the sequence of SEQ ID NO: 15 or SEQ ID NO: 99, or comprises a nucleotide oligomer consisting of the sequence of SEQ ID NO: 15 or SEQ ID NO: 99, provided the following conditions are met: - The oligomer optionally contains nucleotides having chemical modifications that result in non-natural nucleotides that exhibit base-pairing behavior at corresponding positions (AU and GC) determined by the sequence of SEQ ID NO: 15 or SEQ ID NO: 99; - The oligomer optionally contains a nucleotide analog that exhibits base-pairing behavior at the corresponding positions (AU and GC) determined by the sequence of SEQ ID NO: 15 or SEQ ID NO: 99; - The oligomer is optionally conjugated with a lipid to facilitate drug delivery. miRNA mimetics having; and (c) pharmaceutically acceptable carrier or diluent A pharmaceutical composition containing the above.

44. (a) A miRNA mime of miRNA29a-3p, wherein the miRNA mime is a nucleotide oligomer consisting of the sequence of SEQ ID NO: 92, or contains a nucleotide oligomer consisting of the sequence of SEQ ID NO: 92, provided the following conditions are met: - The oligomer optionally contains nucleotides having chemical modifications that result in non-natural nucleotides that exhibit base-pairing behavior at corresponding positions (AU and GC) determined by the sequence of Sequence ID No. 92; - The oligomer optionally contains a nucleotide analog that exhibits base-pairing behavior at the corresponding positions (AU and GC) determined by the sequence of Sequence ID No. 92; - The oligomer is optionally conjugated with a lipid to facilitate drug delivery. A miRNA mimetic having; (b) A miRNA mime of miRNA181a-5p, wherein the miRNA mime is a nucleotide oligomer consisting of the sequence of SEQ ID NO: 17 or SEQ ID NO: 100, or contains a nucleotide oligomer consisting of the sequence of SEQ ID NO: 17 or SEQ ID NO: 100, provided the following conditions are met: - The oligomer optionally contains nucleotides having chemical modifications that result in non-natural nucleotides that exhibit base-pairing behavior at corresponding positions (AU and GC) determined by the sequence of SEQ ID NO: 17 or SEQ ID NO: 100; - The oligomer optionally contains a nucleotide analog that exhibits base-pairing behavior at the corresponding positions (AU and GC) determined by the sequence of SEQ ID NO: 17 or SEQ ID NO: 100; - The oligomer is optionally conjugated with a lipid to facilitate drug delivery. miRNA mimetics having; and (c) pharmaceutically acceptable carrier or diluent A pharmaceutical composition containing the above.

45. (a) A miRNA mime of miRNA29a-3p, wherein the miRNA mime is a nucleotide oligomer consisting of the sequence of SEQ ID NO: 92, or contains a nucleotide oligomer consisting of the sequence of SEQ ID NO: 92, provided the following conditions are met: - The oligomer optionally contains nucleotides having chemical modifications that result in non-natural nucleotides that exhibit base-pairing behavior at corresponding positions (AU and GC) determined by the sequence of Sequence ID No. 92; - The oligomer optionally contains a nucleotide analog that exhibits base-pairing behavior at the corresponding positions (AU and GC) determined by the sequence of Sequence ID No. 92; - The oligomer is optionally conjugated with a lipid to facilitate drug delivery. A miRNA mimetic having; (b) A miRNA mime of miRNA181a-5p, wherein the miRNA mime is a nucleotide oligomer consisting of the sequence of SEQ ID NO: 17 or SEQ ID NO: 100, or comprises a nucleotide oligomer consisting of the sequence of SEQ ID NO: 17 or SEQ ID NO: 100, provided the following conditions are met: - The oligomer optionally contains nucleotides having chemical modifications that result in non-natural nucleotides that exhibit base-pairing behavior at corresponding positions (AU and GC) determined by the sequence of SEQ ID NO: 17 or SEQ ID NO: 100; - The oligomer optionally contains a nucleotide analog that exhibits base-pairing behavior at the corresponding positions (AU and GC) determined by the sequence of SEQ ID NO: 17 or SEQ ID NO: 100; - The oligomer is optionally conjugated with a lipid to facilitate drug delivery. A miRNA mimetic having; (c) A miRNA mime of miRNA212-5p, wherein the miRNA mime is a nucleotide oligomer consisting of the sequence of SEQ ID NO: 15 or SEQ ID NO: 99, or comprises a nucleotide oligomer consisting of the sequence of SEQ ID NO: 15 or SEQ ID NO: 99, provided the following conditions are met: - The oligomer optionally contains nucleotides having chemical modifications that result in non-natural nucleotides that exhibit base-pairing behavior at corresponding positions (AU and GC) determined by the sequence of SEQ ID NO: 15 or SEQ ID NO: 99; - The oligomer optionally contains a nucleotide analog that exhibits base-pairing behavior at the corresponding positions (AU and GC) determined by the sequence of SEQ ID NO: 15 or SEQ ID NO: 99; - The oligomer is optionally conjugated with a lipid to facilitate drug delivery. miRNA mimetics having; and (d) pharmaceutically acceptable carrier or diluent A pharmaceutical composition containing the above.

46. The pharmaceutical composition according to any one of claims 37 to 44, wherein the miRNA mimite of miRNA29a-3p is a double-stranded miRNA mimite.

47. The pharmaceutical composition according to claim 37, 39, 40, 41, 43, or 45, wherein the miRNA mimite of miRNA-212-5p is a double-stranded miRNA mimite.

48. The pharmaceutical composition according to claim 38, 39, 40, 42, 44, or 45, wherein the miRNA mimite of miRNA181a-5p is a double-stranded miRNA mimite.

49. A pharmaceutical composition according to any one of claims 37 to 48, used for the prevention and / or treatment of a disease selected from the group consisting of ILD, PF-ILD, IPF, connective tissue disease (CTD)-related ILD, rheumatoid arthritis ILD, hypersensitivity pneumonitis with chronic fibrosis (HP), idiopathic nonspecific interstitial pneumonia (iNSIP), unclassifiable idiopathic interstitial pneumonia (IIP), environmental / occupational lung disease, pulmonary hypertension (PH), fibrotic silicosis, systemic scleroderma ILD, sarcoidosis, and fibrosarcoma.

Images