Manipulated double-conjugated antibodies and their uses

JP7901158B2Active Publication Date: 2026-08-05BIOLOJIC DESIGN LTD
View PDF 3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
BIOLOJIC DESIGN LTD
Filing Date
2022-05-29
Publication Date
2026-08-05

Smart Images

  • Figure 0007901158000046
    Figure 0007901158000046
  • Figure 0007901158000047
    Figure 0007901158000047
  • Figure 0007901158000048
    Figure 0007901158000048
Patent Text Reader

Abstract

Described herein is an engineered bi-binding antibody that binds IL-13 and TSLP and its uses.Uses include the treatment of allergic conditions and respiratory conditions.Also described herein is a library that includes engineered bi-binding antibodies, as well as a method for producing engineered bi-binding antibodies, and the functional and biochemical characterization of the antibodies.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Statement regarding sequence listings This application includes an electronically submitted sequence listing in ASCII format, the entirety of which is incorporated herein by reference. The ASCII copy, created on 25 May 2022, is named P-605548-PC.txt and is 14.8 kilobytes in size.

[0002] This disclosure relates, in general, to double-conjugated antibodies that bind to IL-13 and TSLP. In one embodiment, the antibody may be used to treat an allergic or respiratory condition. [Background technology]

[0003] IL-13 is a 12.3 kDa class I cytokine monomeric protein. IL-13 has a four-alpha-helix bundle core topology typical of short, helical class I cytokines, and its structure is similar to its closely related cytokine, IL-4, exhibiting high structural identity but low sequence identity. Along with IL-4, IL-13 has been shown to regulate immunoglobulin class switching to IgE in B cells and is involved in mast cell recruitment. IL-13 is associated with CD4 + IL-13 is secreted by Th2 cells and type 2 innate lymphoid cells (ILC2). IL-13 can induce TGF-β production and has been shown to induce MUC5AC gene expression and mucin production in bronchial epithelial cells. IL-13 can also enhance contraction in smooth bronchial myocytes. IL-13 binds to the IL-4Ra / IL-13Ra1 heterodimer complex, which, upon binding, triggers a JAK signaling transducer and STAT6-dependent signaling cascade, subsequently inducing Th2 helper T cell differentiation, macrophage polarization to an M2 "substitute activated" phenotype, epithelial mucus production, smooth muscle contractility, and chemokine release.

[0004] IL-13 has been shown to be involved in defense against parasites, and in a knockout IL-13 mouse model, clearance of *Hookworm brevicarcinoma* was significantly delayed. Furthermore, shedding of *Whipworm nematodes* was completely inhibited despite the Th2 response remaining intact. Further studies have shown that IL-13 is a double-edged sword, playing a crucial role in defense against parasites, but its function in situations of immune system dysregulation is also known.

[0005] IL-13 is involved in the pathogenesis of human asthma because elevated levels of IL-13 mRNA and protein have been detected in the lungs of asthma patients, and this correlates with disease severity. Furthermore, human IL-13 gene polymorphisms leading to elevated IL-13 levels have been identified and are associated with asthma and atopic dermatitis, and elevated IL-13 levels have been detected in the lungs of asthma patients.

[0006] While IL-13 and IL-4 share similar receptors and signaling pathways, IL-13 has a distinct role in asthma, independent of IL-4. In mouse models, administration of IL-13 alone has been shown to be sufficient to induce eosinophil-derived inflammation and myxocyte hyperplasia. Furthermore, specific blockade of IL-13, rather than IL-4, is sufficient to reverse airway hyperresponse and mucus production in mouse models. Additionally, polymorphisms in the human IL-13 locus are known to be associated with increased susceptibility to asthma.

[0007] Therefore, specific inhibition of IL-13 signaling may have a positive therapeutic effect in patients with asthma or other known allergic or respiratory conditions.

[0008] Thymic interstitial lymphopoietin (TSLP) is a cytokine that signals via a heterodimeric receptor consisting of the IL-7Rα subunit and TSLP-R, which are unique components with homology to a common γ receptor-like chain. TSLP is expressed in epithelial cells of the thymus, lungs, skin, intestines, and tonsils, as well as airway smooth muscle cells, pulmonary fibroblasts, and interstitial cells. These cells produce TSLP in response to pro-inflammatory stimuli, and TSLP, through its activity on numerous innate immune cells, including dendritic cells, leads to allergic inflammatory responses. TSLP can also promote the proliferation of naive T cells, leading to differentiation into Th2 cells that express high levels of IL-4, IL-5, and IL-13. High levels of TSLP expression have been found in asthmatic lung epithelial cells and chronic atopic dermatitis lesions, suggesting a role of TSLP in allergic inflammation. Recent evidence also links TSLP to Th17 cell differentiation and Th17-derived inflammatory processes. Chronic allergic (atopic) asthma is often characterized by Th2-type inflammation, while non-allergic asthmatic inflammation is primarily neutrophilic, accompanied by a mixed Th1 and Th17 cytokine environment. Antagonists for TSLP are expected to be useful in treating inflammatory states.

[0009] Therefore, there remains an unmet need for compositions and methods for the treatment of diseases and conditions induced by IL-13 and TSLP activation, such as allergic and respiratory conditions, including but not limited to asthma. [Overview of the Initiative]

[0010] In one embodiment, the disclosure provides an isolated double-conjugated antibody comprising three complementarity-determining regions (CDRs) on the heavy chain (HCDR1, HCDR2, and HCDR3) and three CDRs on the light chain (LCDR1, LCDR2, and LCDR3), wherein the CDRs have the sequences of SEQ ID NOs. 149-154. In another embodiment, the double-conjugated antibody comprises a heavy-chain variable domain (VH) and a light-chain variable domain (VL) having the amino acid sequences of SEQ ID NOs. 155 and 156, or SEQ ID NOs. 157 and 158.

[0011] In one embodiment, isolated double-conjugated antibodies are disclosed herein, wherein HCDR1, HCDR2, and HCDR3 comprise the amino acid sequences of SEQ ID NOs. 349, 350, and 351, respectively, and LCDR1, LCDR2, and LCDR3 comprise the amino acid sequences of SEQ ID NOs. 359, 360, and 361, respectively.

[0012] In another embodiment, HCDR1, HCDR2, and HCDR3 each contain the amino acid sequences of SEQ ID NOs. 349, 356, and 351, respectively, and LCDR1, LCDR2, and LCDR3 each contain the amino acid sequences of SEQ ID NOs. 364, 360, and 371, respectively.

[0013] In another embodiment, HCDR1, HCDR2, and HCDR3 each contain the amino acid sequences of SEQ ID NOs. 349, 350, and 351, respectively, and LCDR1, LCDR2, and LCDR3 each contain the amino acid sequences of SEQ ID NOs. 362, 360, and 384, respectively.

[0014] In another embodiment, HCDR1, HCDR2, and HCDR3 each contain the amino acid sequences of SEQ ID NOs. 349, 350, and 351, respectively, and LCDR1, LCDR2, and LCDR3 each contain the amino acid sequences of SEQ ID NOs. 364, 360, and 384, respectively.

[0015] In another embodiment, HCDR1, HCDR2, and HCDR3 include the amino acid sequences shown in Table 8 or Table 4, and LCDR1, LCDR2, and LCDR3 include the amino acid sequences shown in Table 9 or Table 5.

[0016] In one aspect, an isolated bispecific antibody is disclosed herein, the bispecific antibody comprising a heavy chain variable region (VH) domain and a light chain variable region (VL) domain, the VH domain comprising a set of complementarity determining regions (CDRs), HCDR1, HCDR2, and HCDR3, the amino acid sequence of HCDR1 being set forth in SEQ ID NO: 136, the amino acid sequence of HCDR2 being set forth as I HX1 Y D G S N K (SEQ ID NO: 142) (where HX1 is any amino acid), the amino acid sequence of HCDR3 being set forth as A R HX2 HX3 HX4 HX5 HX6 HX7 HX8 HX9 HX10 HX11 F D HX12 (SEQ ID NO: 143) (where XH2, HX3, HX4, HX5, HX6, HX7, HX8, HX9, HX1o, HX11, and HX12 are any amino acids), or the VL domain comprising a set of CDRs, LCDR1, LCDR2, and LCDR3, the amino acid sequence of LCDR1 being set forth as LX1, LX2, G S K LX3 V (SEQ ID NO: 144) (where LX1, LX2, and LX3 are any amino acids), the amino acid sequence of LCDR2 being set forth as D D LX4 (SEQ ID NO: 145) (where LX4 is any amino acid), the amino acid sequence of LCDR3 being set forth as Q V W D LX5 LX6 S D LX7 V V (SEQ ID NO: 146) (where LX5, LX6, and LX7 are any amino acids), or comprising an antigen-binding domain site of an antibody comprising a combination of (a) and (b).

[0017] In related aspects, the amino acid sequence of HCDR2 is set forth in SEQ ID NO: 137, HX1 is selected from the group consisting of W and S, the amino acid sequence of HCDR3 is set forth in SEQ ID NO: 138, HX2 is selected from the group consisting of A and S, HX3 is P, HX4 is Q, HX5 is W, HX6 is selected from the group consisting of E, Q, M, L, and V, HX7 is selected from the group consisting of L, W, and Y, HX8 is selected from the group consisting of V and T, HX9 is selected from the group consisting of H, A, S, HX10 is E, HX11 is A, HX12 is selected from the group consisting of I, L, and M, the amino acid sequence of LCDR1 is set forth in SEQ ID NO: 139, LX1 is selected from the group consisting of N, L, and I, LX2 is selected from the group consisting of L and I, LX3 is selected from the group consisting of S and L, the amino acid sequence of LCDR2 is set forth in SEQ ID NO: 140, LX4 is selected from the group consisting of S and G, the amino acid sequence of LCDR3 is set forth in SEQ ID NO: 141, LX5 is selected from the group consisting of S and T, LX6 is selected from the group consisting of S and G, and LX7 is selected from the group consisting of H and G.

[0018] In a further related aspect of the isolated bispecific antibody, HX1 is W, HX2 is selected from the group consisting of A and S, HX6 is selected from the group consisting of E and M, HX7 is selected from the group consisting of L and W, HX8 is selected from the group consisting of V and T, HX9 is selected from the group consisting of H and A, HX12 is selected from the group consisting of I and L, LX1 is L, LX2 is I, LX3 is L, LX4 is selected from the group consisting of S and G, LX5 is S, LX6 is S, and LX7 is selected from the group consisting of H and G.

[0019] In yet another relevant embodiment of the isolated double-conjugated antibody, the isolated double-conjugated antibody comprises CDR, where HX1 is W, HX2 is A, HX6 is E, HX7 is L, HX8 is T, HX9 is A, HX12 is I, LX4 is S, and LX7 is G; or HX1 is W, HX2 is A, HX6 is M, HX7 is L, HX8 is V, HX9 is A, HX12 is L, LX4 is S, and LX7 is H; or HX1 is W, HX2 is S, HX6 is E, HX7 is W, HX8 is V, HX9 is H, HX12 is L, LX4 is G, and LX7 is G.

[0020] In another related embodiment of the isolated double-conjugated antibody, the VH domain, 26, 27, 31, 51, 56, 77, 92, 93, contains the amino acid sequence described in SEQ ID NO: 1, having at least one amino acid variant at any of the following positions (IMGT positions 57, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof), 26, 27, 31, 51, 56, 77, 92, 93, The total number of variant positions in the VH domain, VL domain, or combination thereof of the double-conjugated antibody is at least 2.

[0021] In a further relevant embodiment, the at least one variant amino acid in the VH domain contains the variant at position 106 (IMTG position 112) of SEQ ID NO: 1. In another further relevant embodiment, the amino acid sequence of the VH domain is selected from the sequences described in SEQ ID NOs: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, and 54. In yet another further relevant embodiment, the at least one amino acid variant in the VL domain contains the variant amino acid in the CDR region. In yet another further relevant embodiment, the variant amino acid in the VL domain contains the variant at position 26, 27, 31, or 96 of SEQ ID NO: 2, or a combination thereof (IMGT positions 27, 28, 38, or 115, or a combination thereof). In another further related embodiment, at least two variants are present in the VL domain, and the second variant includes a variant amino acid in the framework region. In yet another further related embodiment, the variant amino acid in the framework region includes the variant at position 56 or 77 of SEQ ID NO: 2, or a combination thereof (IMGT position 70 or 94, or a combination thereof).

[0022] In another related embodiment, the amino acid sequence of the VL domain is selected from the sequences described in SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, and 53. In another related embodiment, the amino acid sequence of the VH domain-VL domain pair is selected from the pair sequences described in SEQ ID NOs: 4 and 3, SEQ ID NOs: 6 and 5, SEQ ID NOs: 8 and 7, SEQ ID NOs: 10 and 9, SEQ ID NOs: 12 and 11, SEQ ID NOs: 14 and 13, SEQ ID NOs: 16 and 15, SEQ ID NOs: 18 and 17, SEQ ID NOs: 20 and 19, SEQ ID NOs: 22 and 21, SEQ ID NOs: 24 and 23, SEQ ID NOs: 26 and 25, SEQ ID NOs: 28 and 27, SEQ ID NOs: 30 and 29, SEQ ID NOs: 32 and 31, SEQ ID NOs: 34 and 33, SEQ ID NOs: 36 and 35, SEQ ID NOs: 38 and 37, SEQ ID NOs: 40 and 39, SEQ ID NOs: 42 and 41, SEQ ID NOs: 44 and 43, SEQ ID NOs: 46 and 45, SEQ ID NOs: 48 and 47, SEQ ID NOs: 50 and 49, SEQ ID NOs: 52 and 51, and SEQ ID NOs: 54 and 53.

[0023] In another embodiment, the isolated double-conjugated antibody disclosed herein comprises a heavy-chain variable domain (VH) and a light-chain variable domain (VL), where VH and VL comprise the amino acid sequences of SEQ ID NOs. 209 and 210.

[0024] In another embodiment, the isolated double-conjugated antibody disclosed herein comprises a heavy-chain variable domain (VH) and a light-chain variable domain (VL), where VH and VL comprise the amino acid sequences of SEQ ID NOs. 219 and 220.

[0025] In another embodiment, the isolated double-conjugated antibody disclosed herein comprises a heavy-chain variable domain (VH) and a light-chain variable domain (VL), where VH and VL comprise the amino acid sequences of SEQ ID NOs. 249 and 250.

[0026] In another embodiment, the isolated double-conjugated antibody disclosed herein comprises a heavy-chain variable domain (VH) and a light-chain variable domain (VL), where VH and VL comprise the amino acid sequences of SEQ ID NOs. 337 and 338.

[0027] In another embodiment, the isolated double-conjugated antibody disclosed herein comprises a heavy-chain variable domain (VH) and a light-chain variable domain (VL), the VH and VL comprising amino acid sequences shown in Table 1 or Table 10.

[0028] In another related embodiment, the double-conjugated antibody includes IgG, Fv, scFv, Fab, F(ab')2, minibody, diabody, or triabody. In yet another related embodiment, the IgG includes IgG1, IgG2, IgG3, or IgG4. In yet another related embodiment, the IgG includes mutant IgG that cannot bind to antibody-dependent cytotoxic components.

[0029] In one embodiment, a composition comprising an isolated double-conjugated antibody and a pharmaceutically acceptable carrier is disclosed herein.

[0030] In one embodiment, a nucleic acid construct comprising a nucleic acid sequence encoding a double-conjugated antibody is disclosed herein, the antibody comprising a heavy chain variable region (VH) domain and a light chain variable region (VL) domain, the VH domain comprising a set of CDR, HCDR1, HCDR2, and HCDR3, the amino acid sequence of HCDR1 being described in SEQ ID NO: 136, the amino acid sequence of HCDR2 being described as I HX1 YDGSNK (SEQ ID NO: 142) (where HX1 is any amino acid), and the amino acid sequence of HCDR3 being AR HX2 HX3 HX4 HX5 HX6 HX7 HX8 HX9 HX10 HX11 FD The VL domain is described as HX12 (SEQ ID NO: 143) (where XH2, HX3, HX4, HX5, HX6, HX7, HX8, HX9, HX10, HX11, and HX12 are any amino acids), or the VL domain includes a set of CDR, LCDR1, LCDR2, and LCDR3, where the amino acid sequence of LCDR1 is described as LX1, LX2, GSK LX3 V (SEQ ID NO: 144) (where LX1, LX2, and LX3 are any amino acids), the amino acid sequence of LCDR2 is described as DD LX4 (SEQ ID NO: 145) (where LX4 is any amino acid), and the amino acid sequence of LCDR3 is QVWD LX5 LX6 SD LX7 The antibody comprises an antigen-binding domain site described as VV (SEQ ID NO: 146) (where LX5, LX6, and LX7 are any amino acids), or a combination of (a) and (b).

[0031] In the relevant aspects of nucleic acids, the amino acid sequence encoding HCDR2 is described in SEQ ID NO: 137, where HX1 is selected from the group consisting of W and S; the amino acid sequence of HCDR2 is described in SEQ ID NO: 138, where HX2 is selected from the group consisting of A and S, HX3 is P, HX4 is Q, HX5 is W, HX6 is selected from the group consisting of E, Q, M, L, and V, HX7 is selected from the group consisting of L, W, and Y, HX8 is selected from the group consisting of V and T, HX9 is selected from the group consisting of H, A, and S, HX10 is E, and HX11 is A. HX12 is selected from the group consisting of I, L, and M, and the amino acid sequence of LCDR1 is described in SEQ ID NO: 139; LX1 is selected from the group consisting of N, L, and I; LX2 is selected from the group consisting of L and I; LX3 is selected from the group consisting of S and L, and the amino acid sequence of LCDR2 is described in SEQ ID NO: 140; LX4 is selected from the group consisting of S and G, and the amino acid sequence of LCDR3 is described in SEQ ID NO: 141; LX5 is selected from the group consisting of S and T; LX6 is selected from the group consisting of S and G; and LX7 is selected from the group consisting of H and G.

[0032] In the relevant aspects of nucleic acids, the amino acid encoding HX1 is W, HX2 is selected from the group consisting of A and S, HX6 is selected from the group consisting of E and M, HX7 is selected from the group consisting of L and W, HX8 is selected from the group consisting of V and T, HX9 is selected from the group consisting of H and A, HX12 is selected from the group consisting of I and L, LX1 is L, LX2 is I, LX3 is L, LX4 is selected from the group consisting of S and G, LX5 is S, LX6 is S, and LX7 is selected from the group consisting of H and G. The amino acid encoded for HX1 is W, HX2 is A, HX6 is E, HX7 is L, HX8 is T, HX9 is A, HX12 is I, LX4 is S, and LX7 is G; or HX1 is W, HX2 is A, HX6 is M, HX7 is L, HX8 is V, HX9 is A, HX12 is L, LX4 is S, and LX7 is H; or HX1 is W, HX2 is S, HX6 is E, HX7 is W, HX8 is V, HX9 is H, HX12 is L, LX4 is G, and LX7 is G; further related embodiments.

[0033] In the relevant aspects of the nucleic acid construct, the VH domain, 26, 27, 31, 51, 56, 77, 92, 93, contains the amino acid sequence described in Sequence ID No. 1, having at least one amino acid variant at any of the following positions: 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or any combination thereof), 26, 27, 31, 51, 56, 77, 92, 93, The VL domain comprising the amino acid sequence described in Sequence ID No. 2, having at least one amino acid variant at any of the 96 positions or any combination thereof (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or any combination thereof), or the combination of the VH domain described in (a) and the VL domain described in (b), the total number of variant positions in the encoded VH domain, the encoded VL domain, or the combination thereof is at least 2. In a further relevant embodiment, the sequence comprises two nucleic acid sequences, one encoding a variant double-conjugated antibody VH domain and the other encoding a variant double-conjugated antibody VL domain. In a further relevant embodiment, the nucleic acid sequence encoding the VH domain is selected from the sequences described in SEQ ID NOs: 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 105, and 107. In another further relevant embodiment, the nucleic acid sequence encoding the VL domain is selected from the sequences described in SEQ ID NOs: 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, and 108.In another further related embodiment, the nucleic acid sequences encoding the biantibody VH domain-VL domain pair are selected from the paired sequences described in SEQ ID NOs. 57 and 58, SEQ ID NOs. 59 and 60, SEQ ID NOs. 61 and 62, SEQ ID NOs. 63 and 64, SEQ ID NOs. 65 and 66, SEQ ID NOs. 67 and 68, SEQ ID NOs. 69 and 70, SEQ ID NOs. 71 and 72, SEQ ID NOs. 73 and 74, SEQ ID NOs. 75 and 76, SEQ ID NOs. 77 and 78, SEQ ID NOs. 79 and 80, SEQ ID NOs. 81 and 82, SEQ ID NOs. 83 and 84, SEQ ID NOs. 85 and 86, SEQ ID NOs. 87 and 88, SEQ ID NOs. 89 and 90, SEQ ID NOs. 91 and 92, SEQ ID NOs. 93 and 94, SEQ ID NOs. 95 and 96, SEQ ID NOs. 97 and 98, SEQ ID NOs. 99 and 100, SEQ ID NOs. 101 and 102, SEQ ID NOs. 103 and 104, SEQ ID NOs. 105 and 106, and SEQ ID NOs. 107 and 108.

[0034] In relevant embodiments of the nucleic acid construct, the antibody comprises IgG, Fv, scFv, Fab, F(ab')2, minibody, diabody, or triabody. In further relevant embodiments, the IgG comprises mutant IgG that cannot bind to antibody-dependent cytotoxic components.

[0035] In another related embodiment, the nucleic acid construct further includes a control sequence operably linked to the nucleic acid sequence.

[0036] In one embodiment, an expression vector comprising a nucleic acid construct encoding a double-conjugated antibody is disclosed herein, wherein the antibody comprises an antigen-binding domain site including a heavy chain variable region (VH) domain and a light chain variable region (VL) domain.

[0037] In one embodiment, a host cell comprising an expression vector comprising a nucleic acid construct encoding a double-conjugated antibody is disclosed herein, wherein the antibody comprises an antigen-binding domain site comprising a heavy chain variable region (VH) domain and a light chain variable region (VL) domain.

[0038] In one embodiment, a composition comprising a nucleic acid construct encoding a double-conjugated antibody and a pharmaceutically acceptable carrier is disclosed herein, wherein the antibody comprises an antigen-binding domain site including a heavy chain variable region (VH) domain and a light chain variable region (VL) domain.

[0039] In one embodiment, a method for producing a double-conjugated antibody comprising an antigen-binding domain site of an antibody including a heavy chain variable region (VH) domain and a light chain variable region (VL) domain is disclosed herein, the method comprising culturing host cells comprising an expression vector comprising a nucleic acid construct encoding a double-conjugated antibody, expressing the nucleic acid construct from the vector, the antibody comprising an antigen-binding domain site of an antibody including a heavy chain variable region (VH) domain and a light chain variable region (VL) domain, and isolating the double-conjugated antibody.

[0040] In one embodiment, a library of immunoglobulin or fragments thereof containing antigen-binding domain sites of an antibody comprising heavy chain variable region (VH) domains and light chain variable region (VL) domains is disclosed herein, wherein the VH domain comprises a set of CDR, HCDR1, HCDR2, and HCDR3, the amino acid sequence of HCDR1 being described in SEQ ID NO: 136, the amino acid sequence of HCDR2 being described as I HX1 YDGSNK (SEQ ID NO: 142) (where HX1 is any amino acid), and the amino acid sequence of HCDR3 being AR HX2 HX3 HX4 HX5 HX6 HX7 HX8 HX9 HX10 HX11 FD The VL domain is described as HX12 (SEQ ID NO: 143) (wherein XH2, HX3, HX4, HX5, HX6, HX7, HX8, HX9, HX10, HX11, and HX12 are any amino acids), or the VL domain includes a set of CDR, LCDR1, LCDR2, and LCDR3, the amino acid sequence of LCDR1 is described as LX1, LX2, GSK LX3 V (SEQ ID NO: 144) (wherein LX1, LX2, and LX3 are any amino acids), the amino acid sequence of LCDR2 is described as DD LX4 (SEQ ID NO: 145) (wherein LX4 is any amino acid), and the amino acid sequence of LCDR3 is described as QVWD LX5 LX6 SD LX7 VV (SEQ ID NO: 146) (wherein LX5, LX6, and LX7 are any amino acids).

[0041] In the relevant aspects of the library, the amino acid sequence of HCDR2 is described in SEQ ID NO: 137, where HX1 is selected from the group consisting of W and S; the amino acid sequence of HCDR2 is described in SEQ ID NO: 138, where HX2 is selected from the group consisting of A and S, HX3 is P, HX4 is Q, HX5 is W, HX6 is selected from the group consisting of E, Q, M, L, and V, HX7 is selected from the group consisting of L, W, and Y, HX8 is selected from the group consisting of V and T, HX9 is selected from the group consisting of H, A, and S, HX10 is E, and HX11 is A. HX12 is selected from the group consisting of I, L, and M, and the amino acid sequence of LCDR1 is described in SEQ ID NO: 139; LX1 is selected from the group consisting of N, L, and I; LX2 is selected from the group consisting of L and I; LX3 is selected from the group consisting of S and L, and the amino acid sequence of LCDR2 is described in SEQ ID NO: 140; LX4 is selected from the group consisting of S and G, and the amino acid sequence of LCDR3 is described in SEQ ID NO: 141; LX5 is selected from the group consisting of S and T; LX6 is selected from the group consisting of S and G; and LX7 is selected from the group consisting of H and G.

[0042] In a more relevant aspect of the library, HX1 is W, HX2 is selected from the group consisting of A and S, HX6 is selected from the group consisting of E and M, HX7 is selected from the group consisting of L and W, HX8 is selected from the group consisting of V and T, HX9 is selected from the group consisting of H and A, HX12 is selected from the group consisting of I and L, LX1 is L, LX2 is I, LX3 is L, LX4 is selected from the group consisting of S and G, LX5 is S, LX6 is S, and LX7 is selected from the group consisting of H and G.

[0043] In another further relevant aspect of the library, HX1 is W, HX2 is A, HX6 is E, HX7 is L, HX8 is T, HX9 is A, HX12 is I, LX4 is S, LX7 is G, HX1 is W, HX2 is A, HX6 is M, HX7 is L, HX8 is V, HX9 is A, HX12 is L, LX4 is S, LX7 is H, or HX1 is W, HX2 is S, HX6 is E, HX7 is W, HX8 is V, HX9 is H, HX12 is L, LX4 is G, LX7 is G. In yet another related aspect of the library, the VH domain, 26, 27, 31, 51, 56 The VL domain containing the amino acid sequence described in Sequence ID No. 2, which has at least one amino acid variant at any of the following positions (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or any combination thereof), or the combination of the VH domain described in (a) and the VL domain described in (b), the total number of variant positions in the VH domain, VL domain, or combination thereof is at least 2.

[0044] In another related aspect of the library, immunoglobulins include IgG, Fv, scFv, Fab, F(ab')2, minibodies, deabodies, or triabodies.

[0045] In another relevant aspect of the library, the IgG includes mutant IgG that cannot bind to antibody-dependent cytotoxic components.

[0046] In one embodiment, a method for treating a subject suffering from a disease or condition including an allergic or respiratory condition, an inflammatory condition of the skin or gastrointestinal organs and / or an autoimmune condition; scleroderma; or a tumor or cancer including Hodgkin lymphoma is disclosed herein, the method comprising administering to the subject an isolated double-conjugated antibody disclosed herein.

[0047] In one relevant aspect of a method of treating the subject, the allergic or respiratory condition is asthma, allergic asthma, non-allergic asthma, severe asthma, mild asthma, chronic obstructive pulmonary disease (COPD), eosinophilia, fibrosis and excessive mucus production, cystic fibrosis, allergic lung disease, airway hyperresponsiveness, goblet cell dysplasia, hypermucus secretion, airway remodeling, airway inflammatory conditions including pulmonary fibrosis, atopic dermatitis, urticaria, eczema, allergic enterogastritis, and allergic rhinitis, or a combination thereof, or the inflammatory and / or autoimmune condition is inflammatory bowel disease (IBD) and hepatic conditions including cirrhosis or fibrosis, or a combination thereof. [Brief explanation of the drawing]

[0048] A patent or application file must include at least one drawing drawn in color. Copies of this patent or patent application publication and the color drawing will be provided by the Secretariat upon request and payment of the required fees.

[0049] The subject matter of the manipulated double-conjugated antibodies is specifically pointed out and explicitly claimed in the conclusion section of this specification. However, these double-conjugated antibodies, along with their purpose, characteristics, and advantages, are best understood by referring to the following detailed description when read together with the accompanying drawings, both regarding their production and methods of use.

[0050] [Figure 1A]Figures 1A and 1B show the amino acid sequences of the template antibody heavy chain (SEQ ID NO: 1) (Figure 1A) and light chain (SEQ ID NO: 2) (Figure 1B), respectively, and indicate the framework (FR) and complementarity-determining regions (CDR) regions. For the heavy (H) chain, the different regions are labeled FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4, and in some embodiments, they are called HFR1, HCDR1, HFR2, HCDR2, HFR3, HCDR3, and HFR4. For the light (L) chain, the different regions are labeled FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4, and in some embodiments, they are called LFR1, LCDR1, LFR2, LCDR2, LFR3, LCDR3, and LFR4. Below the template amino acid sequence, variant amino acids of the genetically engineered double-bond clone are shown and aligned within the CDR and FR regions. [Figure 1B] Same as above.

[0051] [Figure 2A] Figures 2A and 2B show bar graphs illustrating the binding of re-epitope antibodies displayed on yeast to recombinant human IL-13 (rh-IL-13) (Figure 2A) or recombinant human TSLP (rhTSLP) (Figure 2B). Figure 2A shows the binding of isolated yeast surface-displayed anti-IL13 clones to 10 nM rh-IL-13. Figure 2B shows the binding of isolated yeast surface-displayed anti-TSLP clones to 10 nM rhTSLP. Data were normalized to the yeast surface expression level of each clone and to the mean fluorescence intensity (MFI) binding signals of anti-hIL-13 and anti-hTSLP from positive control yeast clones. [Figure 2B] Same as above.

[0052] [Figure 3A]Figures 3A–3F show size exclusion chromatography (SEC) scans of human standard IgG1 (Figure 3A), BDG33.003 (Figure 3B), BDG33.004 (Figure 3C), BDG33.005 (Figure 3D), BDG33.023 (Figure 3E), and BDG33.025 (Figure 3F). Purified IgG was analyzed in PBS buffer at 0.5 mL / min using a GE Superdex® 200 10 / 300 Increase column (column volume (CV) = 25 mL). In the antibody scans shown in Figures 3B–3D, the leading peak corresponds to that characteristic of large aggregates (0.36 CV), and the second peak with a retention of approximately 13.2 mL (0.528 CV) is characteristic of normal human IgG. The area under the curve (AUC) peak ratios are approximately 23% for the misfolded IgG fraction and 77% for the folded IgG fraction, respectively. For the antibody scans shown in Figures 3E-3F, the leading peak corresponds to one characteristic of large-diameter aggregates (0.36 CV), and the second peak with a retention of approximately 13.8 mL (0.55 CV) is characteristic of normal human IgG. The area under the curve (AUC) peak ratios for BDG33.023 (Figure 3E) are 97.3% for folded and 2.8% for misfolded, and for BDG33.025 (Figure 3F) are 98.5% for folded and 1.5% for misfolded. [Figure 3B] Same as above. [Figure 3C] Same as above. [Figure 3D] Same as above. [Figure 3E] Same as above. [Figure 3F] Same as above.

[0053] [Figure 4A]Figures 4A and 4B show differential scanning fluorescence (DSF) analysis of the melting points of the indicated IgG BDG33.023 (Figure 4A) and BDG33.025 (Figure 4B). In the upper graph, the light gray dashed line shows the T-onset, and the gray dashed lines show Tm1 and Tm2. The lower graph shows the first derivative of the measured values. Figure 4A: DSF of BDG33.023, T-onset at 64.2°C and first transition point at 67.7°C. Figure 4B: DSF of BDG33.025, T-onset at 56.4°C, first transition point at 60.9°C and second transition point at 67.4°C. [Figure 4B] Same as above.

[0054] [Figure 5A] Figures 5A-5F show surface plasmon resonance (SPR) analyses of antibodies binding to human IL-13, cynomolgus monkey IL-13, and human TSLP. Representative SPR sonograms of BDG33.003 and BDG33.004 binding to IL-13 are shown in Figures 5A-5D. Recombinant human IL-13 (rh-IL-13) was tested at 800 nM after a 2-fold dilution (Figures 5A-5B). Recombinant cynomolgus monkey IL-13 (rc-IL-13) was tested at 200 nM after a 2-fold dilution (Figures 5C-5D). Representative SPR sonograms of BDG33.003 and BDG33.004 binding to human TSLP (h-TSLP) are shown in Figures 5E and 5F. hTSLP served as an analyte at concentrations of 3.2 nM to 0.2 nM after a 2-fold dilution (Figures 5E-F). Representative SPR sensorgrams of BDG33.023 and BDG33.025, which bind to human IL-13 (h-IL-13), are shown in Figures 5G and 5H. hIL-13 served its purpose as an analyte at concentrations of 20 nM to 0.6 nM after being diluted twice (Figures 5G to 5H). [Figure 5B] Same as above. [Figure 5C] Same as above. [Figure 5D] Same as above. [Figure 5E] Same as above. [Figure 5F] Same as above. [Figure 5G] Same as above. [Figure 5H]Same as above.

[0055] [Figure 6A] Figures 6A-6E show the ELISA EC50 binding of BDG33.023 and BDG33.025 to human TSLP, giant cell monkey (cynomolgus monkey) TSLP, or giant cell monkey (cynomolgus monkey) IL-13. Binding of BDG33.023 (black circles) and BDG33.025 (black squares) to human TSLP (Figure 6A - human TSLP). Binding of BDG33.023 to cynomolgus monkey TSLP (Figure 6B - BDG33.023 cynomolgus monkey TSLP). Binding of BDG33.025 to cynomolgus monkey TSLP (Figure 6C - BDG33.025 cynomolgus monkey TSLP). Binding of BDG33.023 to cynomolgus monkey IL-13 (Figure 6D - BDG33.023 cynomolgus monkey IL-13). Binding of BDG33.025 to cynomolgus monkey IL-13 (Figure 6E-33.025 cynomolgus monkey IL-13). [Figure 6B] Same as above. [Figure 6C] Same as above. [Figure 6D] Same as above. [Figure 6E] Same as above.

[0056] [Figure 7A]Figures 7A–7D show competitive binding assays of antibodies against hTSLP or hIL-13. Figure 7A: The shown antibodies (anti-TSLP control, anti-IL-13 control, BDG33.023, BDG33.025) were pre-incubated with increasing levels of hIL-13 and added to plates pre-coated with hIL-13. Binding of BDG33.023 and BDG33.025 to plate-bound hIL-13 was inhibited as the soluble hIL-13 concentration increased. Figure 7B: The shown antibodies (anti-TSLP control, anti-IL-13 control, BDG33.023, BDG33.025) were pre-incubated with increasing levels of hTSLP and added to plates pre-coated with hTSLP. Binding of BDG33.023 and BDG33.025 to plate-bound hTSLP was inhibited as the soluble hTSLP concentration increased. Figure 7C: Antibodies (anti-TSLP control, anti-IL-13 control, BDG33.023, BDG33.025) were pre-incubated with increasing levels of hTSLP and added to plates pre-coated with hIL-13. Binding of BDG33.023 to IL-13 was inhibited as the concentration of soluble hTSLP increased. Figure 7D: The antibodies shown (anti-TSLP control, anti-IL-13 control, BDG33.023, BDG33.025) were pre-incubated with increasing levels of hIL-13 and added to plates pre-coated with hTSLP. Binding of BDG33.023 to plate-bound hTSLP was inhibited as the concentration of soluble hIL-13 increased. The anti-TSLP and anti-IL-13 control antibodies showed binding only to their respective ligands and competed only with their respective ligands. [Figure 7B] Same as above. [Figure 7C] Same as above. [Figure 7D] Same as above.

[0057] [Figure 8]Figure 8 shows the results of an ELISA specificity test comparing nonspecific and specific binding of BDG330.23 and BDG33.025. ELISA plates were coated with hIL-13, hTSLP, and unrelated cytokines IL-2, IL-17, and IL-4. The BSA binding signal corresponds to the assay background level.

[0058] [Figure 9] Figure 9 shows the results of an IC50 inhibition assay measuring IgG-specific blockade of hTSLP binding to an ELISA plate coated with the TSLP receptor (TSLP-R). The X-axis represents the concentration of the competitor. Competitors: TSLP-R (black circle) with a resulting IC50 of 3 nM, and BGD3 3.023 (black triangle) with a resulting IC50 of 0.41 nM.

[0059] [Figure 10] Figure 10 shows a schematic diagram of the downstream signaling pathway of the HEK-Blue IL-13 system.

[0060] [Figure 11A]Figures 11A–11D show data on the inhibition of hIL-13 pSTAT6 signaling. The results are based on the stimulation of the IL-13 activation pathway in HEK-Blue cells by recombinant rh-IL-13 and the inhibition of this stimulation by the indicated IgG. HEK-Blue IL-13 cells (50,000 cells / well) were incubated with rh-IL-13 at various concentrations (0 nM–8 nM). Downstream IL-13 signaling was quantified using QUANTI-Blue (Figure 11A) 24 hours after incubation. Downstream inhibition of hIL-13 on HEK-BLUE IL-13 cells by genetically modified double-conjugated antibodies was analyzed as follows: rh-IL-13 (0.4 nM) was incubated with the indicated antibodies in the antibody concentration range of 0 nM–750 nM. The antibodies assayed were BDG33.002 (positive control), BDG33.003 (clone C2), and BDG33.006 (negative control), respectively (Figure 11B). Clones BDG33.023 and BDG33.025 were assayed in the antibody concentration range of 0 nM to 100 nM (Figures 11C and 11D show IL-13 pSTAT6 inhibition of 33.023 and 33.025, respectively). After incubation, the hIL-13 / IgG mixture was added to the cells, and secreted placental alkaline phosphatase (SEAP) activity was quantified using QUANTI-Blue 24 hours after incubation. The data shown are the mean of the triple experiment, and the error bars represent the standard deviation. [Figure 11B] Same as above. [Figure 11C] Same as above. [Figure 11D] Same as above.

[0061] [Figure 12A]Figures 12A-12C show data on TSLP signaling pathway inhibition. Inhibition of the TSLP-dependent pSTAT5 signaling activation pathway and activation by BDG 33.023 in human leukemia MUTZ5 cells. Figure 12A shows flow cytometry analysis of MUTZ 5 CD127 (IL-7a) receptor and TSLP-R receptor expression, as follows: unstained cells (panel a), cells stained for CD127+ (approximately 36% of the total cell population labeled) (panel b), cells stained for TSLP-R+ (approximately 96% of the total cell population labeled) (panel c), and cells stained for both TSLP-R+ and CD127+ (approximately 41% of the total cell population labeled) (panel d) (Figure 12A). Figure 12B shows MUTZ5 pSTAT5 activation. EC50 of hTSLPphosphor-STAT5 (pSTAT5) activation in MUTZ5 cells. The percentage of positive cells (%) represents the proportion of pSTAT5-positive cells in the parent population. Figure 12C shows the inhibition of MUTZ5 pSTAT5 activation. IC50 of BDG33.023 inhibition of TSLP-dependent pSTAT5 activation in MUTZ5 cells. TSLP was pre-incubated with BDG33.023 at 0.48 pM to 500 pM for 30 minutes and then added to MUTZ5 cells. Positive cells represent the proportion of pSTAT5-positive cells in the parent population (Figure 12C). [Figure 12B] Same as above. [Figure 12C] Same as above.

[0062] [Figure 13] Figure 13 shows the retention times and calculated pI of some of the double-conjugated antibodies disclosed herein. The IgG marker retention time was 4.77 minutes.

[0063] [Figure 14A]Figures 14A–14C show several competitive ELISAs against TSLP with double-conjugated antibodies and 33.001 (tezeperumab). ELISA plates were coated overnight at 4°C with 50 ng / well of 33.001. Double-conjugated antibodies were diluted 2-fold and pre-incubated with a constant concentration of 7 nM TSLP-HIS at room temperature for 1 hour. After blocking and washing steps, the double-conjugated antibody-TSLP mixture was placed on the plate, incubated for 10 minutes, washed again, and then incubated with anti-HIS for 30 minutes. The results show that all tested double-conjugated antibodies presented similar IC50 values. [Figure 14B] Same as above. [Figure 14C] Same as above.

[0064] [Figure 15] Figure 15 shows the results of nanoscale differential scanning fluorescence (nanoDSF) analysis of some of the double-conjugated antibodies disclosed herein. The Tm threshold for the lambda chain was >65°C, and the T-onset was >60°C.

[0065] [Figure 16A] Figures 16A–16F show the results of surface plasmon resonance (SPR) analysis for some of the double-conjugated antibodies disclosed herein for human IL-13 and TSLP. [Figure 16B] Same as above. [Figure 16C] Same as above. [Figure 16D] Same as above. [Figure 16E] Same as above. [Figure 16F] Same as above.

[0066] [Figure 17A]Figures 17A and 17B show size exclusion chromatography (SEC) scans (Figure 17A) and nanoscale differential scanning fluorescence (DSF) analysis of the melting point (Figure 17B) for the antibody BDG38.074. Representative analyses of the IgG melting points shown were repeated twice. Light gray dashed lines indicate T-onset, and gray dashed lines indicate Tm1 and Tm2. Figure 17B shows the first differential values ​​of the measurements. DSF values ​​are summarized in Figure 15. [Figure 17B] Same as above.

[0067] [Figure 18A] Figures 18A-18D show the binding affinity of representative clones BDG38.74. Figure 18A shows the binding affinity of antibody BDG38.074 to IL-13. The results show that antibody BDG38.074 binds to human IL-13 with an affinity of two orders of magnitude picomoles. Figure 18B shows the binding affinity of antibody BDG38.074 to human TSLP. The results show that antibody BDG38.074 binds to human TSLP with an affinity of two orders of magnitude picomoles. Figure 18C shows the binding affinity of antibody BDG38.074 to cynomolgus monkey IL-13. Figure 18D shows the binding affinity of antibody BDG38.074 to cynomolgus monkey TSLP. [Figure 18B] Same as above. [Figure 18C] Same as above. [Figure 18D] Same as above.

[0068] [Figure 19A] Figures 19A and 19B show size exclusion chromatography (SEC) scans (Figure 19A) and nanoscale differential scanning fluorescence (DSF) analysis of the melting point (Figure 19B) for the antibody BDG38.079. Representative DSF analysis of the melting point of the indicated IgG (analyzed twice). The light gray dashed line indicates T-onset, and the gray dashed lines indicate Tm1 and Tm2. Figure 19B is a graph of the first differential values ​​of the measured values. The DSF values ​​are summarized in Figure 15. [Figure 19B] Same as above.

[0069] [Figure 20A] Figures 20A-20D show the binding of representative clone BDG38.079 to IL-13 and TSLP. Figure 20A shows the binding affinity of antibody BDG38.079 to human IL-13. The results show that antibody BDG38.079 binds to human IL-13 with an affinity of two orders of magnitude picomoles. Figure 20B shows the binding affinity of antibody BDG38.079 to human TSLP. The results show that antibody BDG38.079 binds to human TSLP with an affinity of one order of magnitude picomoles. Figure 20C shows the binding affinity of antibody BDG38.079 to cynomolgus monkey IL-13. Figure 20D shows the binding affinity of antibody BDG38.079 to cynomolgus monkey TSLP. [Figure 20B] Same as above. [Figure 20C] Same as above. [Figure 20D] Same as above.

[0070] [Figure 21A] Figures 21A and 21B show surface plasmon resonance (SPR) analyses of antibodies BDG38.074 and BDG38.079 against human or cynomolgus monkey IL-13 or TSLP. [Figure 21B] Same as above.

[0071] [Figure 22]Figure 22 shows that antibodies BDG38.074 and BDG38.079 inhibit IL-13 function in HEK reporter cell lines with double-digit picomolar affinity. Data on inhibition of hIL-13 pSTAT6 signaling are also shown. The results are based on stimulation of the IL-13 activation pathway in HEK-Blue cells by recombinant rh-IL-13 and inhibition of this stimulation by indicated IgG. rh-IL-13 (0.4 nM) was incubated with indicated antibodies in the antibody concentration range of 0 nM to 100 nM. After incubation, the hIL-13 / IgG mixture was added to the cells, and secreted embryonic alkaline phosphatase (SEAP) activity was quantified with QUANTI-Blue 24 hours after incubation. The data shown are the mean of a triple experiment, and the error bars represent the standard deviation. The antibodies assayed were tralokinumab, BDG38.074, and BDG38.079, respectively.

[0072] [Figure 23] Figure 23 shows that antibodies BDG38.074 and BDG38.079 exhibit similar functional inhibition to the anti-TSLP benchmark in the MUTZ-5 cell line. MUTZ5 cells were stimulated with human TSLP (hTSLP), and phosphorylated STAT5 (pSTAT5) staining was evaluated by phosphoflow cytometry.

[0073] [Figure 24A]Figures 24A and 24B show the inhibition results for representative clones. Figure 24A shows that antibodies BDG38.074 and BDG38.079 exhibit similar inhibition of CD23 expression to the anti-IL-13 benchmark (tralokinumab). The IC50 of antibody inhibition of IL-13 was determined by measuring CD23 expression levels in monocytes. At the end of 48-hour incubation of cells with different antibody concentrations, monocytes were cleaved from the bottom of the wells and stained with CD3 (Bio Legend, CAT: 300450), CD14 (Bio Legend, CAT: 301814), CD19 (Bio Legend, CAT: 302212), and CD23 (Bio Legend, CAT: 338506) antibodies. The CD23 percentage in the CD14+ population was measured using a CytoFLEX flow cytometer (Beckman Coulter). Figure 24B shows that antibodies BDG38.074 and BDG38.079 inhibit TARC expression similarity with the anti-TSLP benchmark (tezeperumab). The IC50 of antibody inhibition of hTSLP was determined by TARC inhibition. TARC levels were determined using the TARC DUOSET ELISA kit DY364 (R&D systems) according to the kit instructions. ELISA plates were read at 450 nm. Values ​​were analyzed using standard sample curves. [Figure 24B] Same as above.

[0074] [Figure 25A] Figures 25A and 25B show size exclusion chromatography (SEC) scans (Figure 25A) and nanoscale differential scanning fluorescence (DSF) analysis of the melting point (Figure 25B) for the antibody BDG38.094. The shown representative DSF analysis of the shown IgG melting point (analyzed twice) is also shown. In the upper graph, the light gray dashed line represents the T-onset, and the gray dashed lines represent Tm1 and Tm2. Figure 25B shows the first differential value of the measured values. The DSF values ​​are summarized in Table 11. [Figure 25B] Same as above.

[0075] [Figure 26A]Figures 26A-26D show the binding affinity of representative clones. Figure 26A shows the binding affinity of antibody BDG38.094 to human IL-13. Figure 26B shows the binding affinity of antibody BDG38.094 to human TSLP. Figure 26C shows the binding affinity of antibody BDG38.094 to cynomolgus monkey IL-13. Figure 26B shows the binding affinity of antibody BDG38.094 to cynomolgus monkey TSLP. [Figure 26B] Same as above. [Figure 26C] Same as above. [Figure 26D] Same as above.

[0076] [Figure 27A] Figures 27A and 27B show size exclusion chromatography (SEC) scans (Figure 27A) and nanoscale differential scanning fluorescence (DSF) analysis of the melting point (Figure 27B) for the antibody BDG38.138. Representative DSF analysis of the melting point of the indicated IgG (analyzed twice) is shown. In the upper graph, the light gray dashed line represents the T-onset, and the gray dashed lines represent Tm1 and Tm2. Figure 27B shows the first differential value of the measured values. DSF values ​​are summarized in Table 11. [Figure 27B] Same as above.

[0077] [Figure 28A] Figures 28A-28D show the binding affinity of representative clones. Figure 28A shows the binding affinity of antibody BDG38.138 to human IL-13. Figure 28B shows the binding affinity of antibody BDG38.138 to human TSLP. Figure 28C shows the binding affinity of antibody BDG38.138 to cynomolgus monkey IL-13. Figure 28D shows the binding affinity of antibody BDG38.138 to cynomolgus monkey TSLP. [Figure 28B] Same as above. [Figure 28C] Same as above. [Figure 28D] Same as above. [Modes for carrying out the invention]

[0078] The following detailed description includes numerous specific details to provide a complete understanding of the manipulated double-conjugated antibodies disclosed herein, including descriptions of their heavy and light chain variable regions. However, it will be understood by those skilled in the art that the preparation and use of double-conjugated antibodies may, in certain cases, be carried out without these specific details. In other cases, well-known methods, procedures, and components are not described in detail so as not to obscure the disclosures presented herein.

[0079] Conventionally, antigen-binding sequences are located within the heavy chain variable region and light chain variable region sequences of an antibody. These heavy chain and light chain variable regions may be manipulated to create new binding sites, for example, to produce antibodies or fragments of antibodies that bind to different antigens or epitopes of different antigens. In some embodiments, as described herein, manipulating the sequence of the heavy chain variable region, the sequence of the light chain variable region, or both, creates new binding sites for epitopes while maintaining the functionality of the antibody. In one embodiment, 21 specific sites within the heavy chain and light chain variable regions are identified, and in certain embodiments, the presence of variant amino acids at these sites generates a manipulated double-conjugated antibody or fragment. In some embodiments, the 21 possible variant sites provide a unique platform for manipulating the double-conjugated antibody or fragment.

[0080] Disclosed herein are engineered double-conjugate antibodies or fragments thereof in which either or both of the heavy-chain variable region or the light-chain variable region are mutated to contain a variant amino acid. In some embodiments, these engineered double-conjugate antibodies may be identified and selected from a library generated to contain a variant amino acid residue at a specific site within the variable heavy-chain region or the variable light-chain region or both. In some embodiments, these engineered double-conjugate antibodies may be generated by specifically mutating a target amino acid site within the variable heavy-chain region or the variable light-chain region or both. In some embodiments, these engineered double-conjugate antibodies may be used in therapeutic methods to treat subjects suffering from allergic or respiratory conditions.

[0081] Manipulated double-conjugated antibody As used herein, the term “double-conjugated antibody” refers to an antibody having two binding specificities. In certain embodiments, the double-conjugated antibodies disclosed herein bind to IL-13 and TSLP.

[0082] In some embodiments, the disclosure provides isolated double-conjugated antibodies comprising three complementarity-determining regions (CDRs) on the heavy chain (HCDR1, HCDR2, and HCDR3) and three CDRs on the light chain (LCDR1, LCDR2, and LCDR3) (see, for example, Tables 8 and 9). In some embodiments, the CDRs have the sequences of SEQ ID NOs. 149–154. In some embodiments, the double-conjugated antibody comprises a heavy-chain variable domain (VH) and a light-chain variable domain (VL) having the amino acid sequences of SEQ ID NOs. 155 and 156, or SEQ ID NOs. 157 and 158.

[0083] In one embodiment, HCDR1, HCDR2, and HCDR3 each contain the amino acid sequences of SEQ ID NOs. 349, 350, and 351, respectively, and LCDR1, LCDR2, and LCDR3 each contain the amino acid sequences of SEQ ID NOs. 359, 360, and 361, respectively.

[0084] In another embodiment, HCDR1, HCDR2, and HCDR3 each contain the amino acid sequences of SEQ ID NOs. 349, 356, and 351, respectively, and LCDR1, LCDR2, and LCDR3 each contain the amino acid sequences of SEQ ID NOs. 364, 360, and 371, respectively.

[0085] In another embodiment, HCDR1, HCDR2, and HCDR3 each contain the amino acid sequences of SEQ ID NOs. 349, 350, and 351, respectively, and LCDR1, LCDR2, and LCDR3 each contain the amino acid sequences of SEQ ID NOs. 362, 360, and 384, respectively.

[0086] In another embodiment, HCDR1, HCDR2, and HCDR3 each contain the amino acid sequences of SEQ ID NOs. 349, 350, and 351, respectively, and LCDR1, LCDR2, and LCDR3 each contain the amino acid sequences of SEQ ID NOs. 364, 360, and 384, respectively.

[0087] In another embodiment, HCDR1, HCDR2, and HCDR3 include the amino acid sequences shown in Table 8 or Table 4, and LCDR1, LCDR2, and LCDR3 include the amino acid sequences shown in Table 9 or Table 5.

[0088] In some embodiments, isolated double-conjugated antibodies are disclosed herein that include three complementarity-determining regions (CDRs) on the heavy chain (HCDR1, HCDR2, and HCDR3) and three CDRs on the light chain (LCDR1, LCDR2, and LCDR3). (i) HCDR1 contains the amino acid sequence of SEQ ID NO: 349 or 355, or the amino acid sequence of SEQ ID NO: 149 or 136, (ii) HCDR2 includes one of the amino acid sequences of SEQ ID NOs. 350, 352, 354, and 356, or the amino acid sequence of SEQ ID NO. 150, or the sequence described as I HX1 YDGSNK (SEQ ID NO. 142) (where HX1 is any amino acid), (iii) HCDR3 contains one amino acid sequence of SEQ ID NOs. 351, 353, 357, and 358, or the amino acid sequence of SEQ ID NOs. 151 or the sequence described as AR HX2 HX3 HX4 HX5 HX6 HX7 HX8 HX9 HX10 HX11 FD HX12 (SEQ ID NOs. 143) (where HX2, HX3, HX4, HX5, HX6, HX7, HX8, HX9, HX10, HX11, and HX12 are any amino acids), (iv) LCDR1 includes one amino acid sequence of SEQ ID NOs. 359, 362, 364, 366, 369, and 375, or the amino acid sequence of SEQ ID NO. 152, or the sequence described as LX1, LX2, GSK LX3 V (SEQ ID NO. 144) (where LX1, LX2, and LX3 are any amino acids), (v)LCDR2 includes the amino acid sequence of SEQ ID NO: 360 or 367, or the amino acid sequence of SEQ ID NO: 153, or the sequence described as DD LX4 (SEQ ID NO: 145) (where LX4 is any amino acid), (vi)LCDR3 contains one amino acid sequence of SEQ ID NOs: 361, 363, 365, 368, 370-374, 376-407, or the amino acid sequence of SEQ ID NO: 154, or the sequence described as QVWD LX5 LX6 SD LX7 VV (SEQ ID NO: 146) (where LX5, LX6, and LX7 are any amino acids).

[0089] In some embodiments, isolated double-conjugated antibodies are disclosed herein, HCDR1, HCDR2, and HCDR3 contain the amino acid sequences of SEQ ID NOs. 349, 350, and 351, respectively, and LCDR1, LCDR2, and LCDR3 contain the amino acid sequences of SEQ ID NOs. 359, 360, and 361, respectively, or HCDR1, HCDR2, and HCDR3 contain the amino acid sequences of SEQ ID NOs. 349, 356, and 351, respectively, and LCDR1, LCDR2, and LCDR3 contain the amino acid sequences of SEQ ID NOs. 364, 360, and 371, respectively, or HCDR1, HCDR2, and HCDR3 contain the amino acid sequences of SEQ ID NOs. 349, 350, and 351, respectively, and LCDR1, LCDR2, and LCDR3 contain the amino acid sequences of SEQ ID NOs. 362, 360, and 384, respectively, or HCDR1, HCDR2, and HCDR3 contain the amino acid sequences of SEQ ID NOs. 349, 350, and 351, respectively, while LCDR1, LCDR2, and LCDR3 contain the amino acid sequences of SEQ ID NOs. 364, 360, and 384, respectively.

[0090] In some embodiments, isolated double-conjugated antibodies are disclosed herein, where HCDR1, HCDR2, and HCDR3 comprise the amino acid sequences shown in Table 8 or Table 4, and LCDR1, LCDR2, and LCDR3 comprise the amino acid sequences shown in Table 9 or Table 5.

[0091] In some embodiments, isolated double-conjugated antibodies are disclosed herein, where HX1 is W or S, HX2 is A or S, HX3 is P, HX4 is Q, HX5 is W, HX6 is E, Q, M, L, or V, HX7 is L, W, or Y, HX8 is V or T, HX9 is H, A, or S, HX10 is E, HX11 is A, and HX12 is I, L, or M. LX1 is N, L, or I; LX2 is L or I; LX3 is S or L; LX4 is S or G; LX5 is S or T; LX6 is S or G; and LX7 is H or G.

[0092] In some embodiments, isolated double-conjugated antibodies are disclosed herein, where HX1 is W, HX2 is A or S, HX6 is E or M, HX7 is L or W, HX8 is V or T, HX9 is H or A, HX12 is I or L, LX1 is L, LX2 is I, LX3 is L, LX4 is S or G, LX5 is S, LX6 is S, and LX7 is H or G.

[0093] In some embodiments, isolated double-conjugated antibodies are disclosed herein, (a) HX1 is W, HX2 is A, HX6 is E, HX7 is L, HX8 is T, HX9 is A, HX12 is I, LX4 is S, LX7 is G, or (b) HX1 is W, HX2 is A, HX6 is M, HX7 is L, HX8 is V, HX9 is A, HX12 is L, LX4 is S, LX7 is H, or (c) HX1 is W, HX2 is S, HX6 is E, HX7 is W, HX8 is V, HX9 is H, HX12 is L, LX4 is G, and LX7 is G.

[0094] In some embodiments, isolated double-conjugated antibodies are disclosed herein, comprising a heavy chain variable region comprising the amino acid sequence described in SEQ ID NO: 1 having at least one amino acid variant at any position, or a light chain variable region comprising the amino acid sequence described in SEQ ID NO: 2 having at least one amino acid variant at any of the positions, or a combination thereof, wherein the total number of variant positions in the heavy chain variable region, the light chain variable region, or the combination thereof is at least 2. In some embodiments, isolated double-conjugated antibodies are disclosed herein, comprising a heavy chain variable region comprising the amino acid sequence described in SEQ ID NO: 1 and a light chain variable region comprising the amino acid sequence described in SEQ ID NO: 2, wherein at least two amino acid variants are present within the heavy chain variable region or the light chain variable region or a combination thereof. In some embodiments, isolated double-conjugated antibodies are disclosed herein, comprising a heavy chain variable region comprising the amino acid sequence described in SEQ ID NO: 1 having at least two amino acid variants at any position, and an arbitrary light chain variable region. In some embodiments, isolated double-conjugated antibodies are disclosed herein, comprising a light chain variable region comprising the amino acid sequence described in SEQ ID NO: 2 having at least two amino acid variants at any position, and an arbitrary heavy chain variable region.

[0095] As used herein, the term "heavy chain variable region" may be used interchangeably with the terms "VH domain" or "VH," all having the same meaning and quality. As used herein, the term "light chain variable region" may be used interchangeably with the terms "VL domain" or "VL," all having the same meaning and quality.

[0096] In certain embodiments, a library of complementary variable regions can be screened using specific variant VH and / or VL domains as described herein to identify VH / VL, respectively, that possess desirable properties such as increased affinity for an antigen. Such methods are described, for example, in Portolano et al., J.Immunol. (1993) 150:880-887, Clarkson et al., Nature (1991) 352:624-628, and Fischer et al., (2015) Exploiting light chains for the scalable generation and platform purification of native human bispecific IgG. Nature Communications volume 6, Article number: 6113.

[0097] Alternatively, VH and VL domains may be mixed and matched using other methods to identify Fab or F'(ab)2 with the desired double-binding activity. For example, Klimka et al., British Journal of Cancer (2000) 83:252-260 describes a screening process using a human VH library containing mouse VL and FR4 retained from CDR3 and mouse VH. After obtaining antibodies, VH was screened against a human VL library to obtain antigen-bound antibodies. Beiboer et al., J.Mol.Biol. (2000) 296:833-849 describes a screening process using entire mouse heavy chain and human light chain libraries. After obtaining antibodies, one VL was combined with a human VH library containing retained mouse CDR3. Antibodies capable of binding to the antigen were obtained. Rader et al., PNAS (1998) 95:8910-8915 describes a process similar to that of Beiboer et al. above.

[0098] The techniques described herein are known in themselves in the art. However, those skilled in the art will be able to use such techniques and common methodologies in the art to obtain antigen-binding fragments of antibodies according to some embodiments of the disclosure described herein.

[0099] Those skilled in the art will understand that, in its broadest sense, double-conjugated antibodies encompass antibodies that specifically bind to the antigenic determinants of IL-13 and TSLP. Those skilled in the art will further understand that the specificity of binding to IL-13 or TSLP reflects that the binding is selective for the antigen and can be distinguished from undesirable or nonspecific interactions. In certain embodiments, the double-conjugated antibody comprises one or more antibody fragments.

[0100] In some embodiments, the antigenic determinant comprises an IL-13 or TSLP epitope. The term "epitope" in certain embodiments includes polypeptide determinants capable of specific binding to an anti-IL-13 or anti-TSLP binding domain. An epitope is the region of an antigen that is bound by an antibody or an antigen-binding fragment thereof. In some embodiments, the antigen-binding fragment of an antibody comprises a heavy-chain variable region, a light-chain variable region, or a combination thereof as described herein.

[0101] In certain embodiments, the epitope determinant includes chemically active surface groups of molecules such as amino acids, sugar side chains, phosphoryls or sulfonyls, and in certain embodiments may have specific three-dimensional structural characteristics and / or specific charge characteristics. In certain embodiments, a bispecific antibody is said to specifically bind to an IL-13 or TSLP epitope if it preferentially recognizes IL-13 or TSLP in a complex mixture of proteins and / or macromolecules. A bispecific antibody specifically binds to an epitope when the equilibrium dissociation constant is ≤ 10 -5 、10 -6 、or 10 -7 M. In some embodiments, the equilibrium dissociation constant may be ≤ 10 -8 M or 10 -9 M. In some further embodiments, the equilibrium dissociation constant may be ≤ 10 -10 M, 10 -11 M, or 10 -12 M. In some embodiments, the equilibrium dissociation constant may be within the range of ≤ 10 -5 M to 10 -12 M.

[0102] The antibody-binding domain may be a fragment of an antibody, or a genetically engineered product of one or more fragments of an antibody, which is involved in specific binding to an antigen. “Specific binding” means that the binding is selective to the target antigen, for example, IL-13 or TSLP in the embodiments described herein, and can be distinguished from undesirable or nonspecific interactions. As used herein, the term “double-binding antibody” may, in certain embodiments, encompass a complete immunoglobulin structure, a fragment thereof, or a domain thereof.

[0103] Examples of antibody-binding domains include, but are not limited to, complementarity-determining regions (CDRs), variable regions (Fvs), VH domains, light chain variable regions (VLs), heavy chains, light chains, single-chain variable regions (scFvs), and Fab fragments. Those skilled in the art will understand that scFvs are not actually antibody fragments, but rather fusion polypeptides containing variable heavy chain (VH) and variable light chain (VL) regions of immunoglobulin, linked, for example, non-limitingly, by a short linker peptide of 10 to about 25 amino acids. Those skilled in the art will also understand that the antibody term "Fab" generally encompasses a portion of an antibody consisting of a single light chain (both variable and constant regions) linked by a disulfide bond to the variable region and primary constant region of a single heavy chain.

[0104] In some embodiments, the antibody encompasses the entire antibody molecule, including monoclonal antibodies, polyclonal antibodies, and multispecific (e.g., bispecific) antibodies. In some embodiments, the antibody encompasses antibody fragments that retain binding specificity, including, but are not limited to, variable heavy chain (VH) fragments, variable light chain (VL) fragments, Fab fragments, F(ab')2 fragments, scFv fragments, Fv fragments, minibodies, diabodies, triabodies, and tetrabodies (see, for example, Hudson and Souriau, Nature Med. 9:129-134 (2003), the whole of which is incorporated herein by reference). Humanized antibodies, primate-like antibodies, and chimeric antibodies are also included.

[0105] As used herein, in some embodiments, the term “antibody” may be used interchangeably with the term “immunoglobulin” and have all the same properties and meanings. Similarly, as used herein, in some embodiments, the term “antibody or fragment thereof” may be used interchangeably with the term “immunoglobulin or fragment thereof” and have all the same properties and meanings. Therefore, those skilled in the art will understand that in some embodiments, “antibody or fragment thereof” or “immunoglobulin or fragment thereof” may encompass IgG immunoglobulin, or fragments or structures including, but not limited to, IgG, scFv fragments, Fab fragments, F(ab')2 fragments, Fv fragments, minibodies, diabodies, triabodies, and tetrabodies.

[0106] Those skilled in the art will recognize that a “heavy chain variable region” or “VH” relating to an antibody encompasses a heavy chain fragment containing three CDRs interposed between adjacent segments known as framework (FR) regions, which are more conserved than CDRs and form a scaffold for supporting the CDRs. In certain embodiments, the terms “heavy chain variable region” or “VH” may be used interchangeably with “VH domain.”

[0107] Those skilled in the art will recognize that a “light chain variable region” or “VL” relating to an antibody encompasses a fragment of the light chain containing three CDRs interposed between framework (FR) regions. In certain embodiments, the terms “light chain variable region” or “VL” may be used interchangeably with “VL domain.”

[0108] Numerous amino acid sequences for the HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, LCDR3, and VH and VL regions of double-conjugated antibodies that bind to IL-13 and TSLP are disclosed herein. A discussion of some embodiments of the representative sequences disclosed herein is shown below. Figure 1A shows the template VH domain amino acid sequence described in SEQ ID NO: 1, and the positions of the three heavy chain (H) CDR regions (HCDR1, HCDR2, HCDR3) and four FR regions (HFR1, HFR2, HFR3, HFR4), while Figure 1B shows the template VL domain amino acid sequence described in SEQ ID NO: 2, and the positions of the three light chain (L) CDR regions (LCDR1, LCDR2, LCDR3) and four FR regions (LFR1, LFR2, LFR3, LFR4). The amino acid residues containing variant residues present in each of the CDR and FR regions of the re-epitope clone are clearly identified by comparing the linear schematic representation of the template VH or template VL sequence with the numbering and amino acids provided below (Figures 1A and 1B).

[0109] In some embodiments, the isolated double-conjugated antibody comprises an antigen-binding domain region of the antibody including a VH domain and a VL domain, wherein the VH domain includes a set of CDR, HCDR1, HCDR2, and HCDR3, the amino acid sequence of HCDR1 is described in SEQ ID NO: 136, the amino acid sequence of HCDR2 is described as I HX1 YDGSNK (SEQ ID NO: 142) (where HX1 is any amino acid), and the amino acid sequence of HCDR3 is described as AR HX2 HX3 HX4 HX5 HX6 HX7 HX8 HX9 HX10 HX11 FD HX12 (SEQ ID NO: 143) (where XH2, HX3, HX4, HX5, HX6, HX7, HX8, HX9, HX10, HX11, and HX12 are any amino acids). Those skilled in the art will recognize the 12 distinct sites within the VH domain shown in Figure 1A, and variant amino acids may be found, which are identified herein as HX, and in certain embodiments, may include the presence of variant amino acids within the heavy chain template sequence.

[0110] In some embodiments, the VH domain of the double-conjugated antibody includes HCDR1 (SEQ ID NO: 136), HCDR2 (SEQ ID NO: 142), and HCDR3 (SEQ ID NO: 143), and the VH domain contains a variant amino acid in at least one of HX1, HX2, HX3, HX4, HX5, HX6, HX7, HX8, HX9, HX10, HX11, and HX12.

[0111] In some embodiments, the VH domain of the double-conjugated antibody includes HCDR1 (SEQ ID NO: 136), HCDR2 (SEQ ID NO: 137) (where HX1 is selected from the group consisting of W and S), and HCDR3 (SEQ ID NO: 138) (where HX2 is selected from the group consisting of A and S, HX3 is P, HX4 is Q, HX5 is W, HX6 is selected from the group consisting of E, Q, M, L, and V, HX7 is selected from the group consisting of L, W, and Y, HX8 is selected from the group consisting of V and T, HX9 is selected from the group consisting of H, A, and S, HX10 is E, HX11 is A, and HX12 is selected from the group consisting of I, L, and M). In a particular embodiment, the isolated double-conjugated antibody contains variant amino acids including CDR1 (SEQ ID NO: 136), CDR2 (SEQ ID NO: 137) (where HX1 is W), CDR3 (SEQ ID NO: 138) (where HX2 is selected from the group consisting of A and S, HX3 is P, HX4 is Q, HX5 is W, HX6 is selected from the group consisting of E and M, HX7 is selected from the group consisting of L and W, HX8 is selected from the group consisting of V and T, HX9 is selected from the group consisting of H and A, HX10 is E, HX11 is A, and HX12 is selected from the group consisting of I and L).

[0112] In some embodiments, the double-conjugated antibodies are HCDR1 (SEQ ID NO: 136), HCDR2 (SEQ ID NO: 137) (where HX1 is W, and HCDR3 (SEQ ID NO: 138), where HX2 is A, HX3 is P, HX4 is Q, HX5 is W, HX6 is E, HX7 is L, HX8 is T, HX9 is A, HX10 is E, HX11 is A, and HX12 is I); or HCDR1 (SEQ ID NO: 136), HCDR2 (SEQ ID NO: 137) (where HX1 is W), HCDR3 (SEQ ID NO: 138) (where HX2 is A, HX3 is P, HX4 is It may have a VH domain containing HCDR1 (sequence number 136), HCDR2 (sequence number 137) (where HX1 is W), and HCDR3 (sequence number 138) (where HX2 is S, HX3 is P, HX4 is Q, HX5 is W, HX6 is E, HX7 is W, HX8 is V, HX9 is H, HX10 is E, HX11 is A, and HX12 is L); or it may have a VH domain containing HCDR1 (sequence number 136), HCDR2 (sequence number 137) (where HX1 is W), and HCDR3 (sequence number 138) (where HX2 is S, HX3 is P, HX4 is Q, HX5 is W, HX6 is E, HX7 is W, HX8 is V, HX9 is H, HX10 is E, HX11 is A, and HX12 is L).

[0113] The manipulated antibody clones containing variants in the VH domain described above are shown in Figure 1A.

[0114] In some embodiments, the isolated double-conjugated antibody comprises an antigen-binding domain region of the antibody including a VH domain and a VL domain, and in such embodiments, the VL domain comprises a set of CDR, LCDR1, LCDR2, and LCDR3, where the amino acid sequence of LCDR1 is described as LX1, LX2, GSK LX3 V (SEQ ID NO: 144) (where LX1, LX2, and LX3 are any amino acids), the amino acid sequence of LCDR2 is described as DD LX4 (SEQ ID NO: 145) (where LX4 is any amino acid), and the amino acid sequence of LCDR3 is described as QVWD LX5 LX6 SD LX7 VV (SEQ ID NO: 146) (where LX5, LX6, and LX7 are any amino acids). Those skilled in the art will recognize the seven distinct sites within the VL domain shown in Figure 1B, and the variant amino acid may be found within the CDR, which is identified herein as LX, and in certain embodiments may include the presence of the variant amino acid within the light chain template sequence.

[0115] In some embodiments, the variant amino acid within the light chain may be located in one of the framework regions. In some embodiments, the variant amino acid within the VL domain is located in the LFR3 region.

[0116] In some embodiments, the VL domain of the double-conjugated antibody includes LCDR, the amino acid sequence of LCDR1 is described in SEQ ID NO: 139, LX1 is selected from the group consisting of N, L, and I, LX2 is selected from the group consisting of L and I, LX3 is selected from the group consisting of S and L, the amino acid sequence of LCDR2 is described in SEQ ID NO: 140, LX4 is selected from the group consisting of S and G, the amino acid sequence of LCDR3 is described in SEQ ID NO: 141, LX5 is selected from the group consisting of S and T, LX6 is selected from the group consisting of S and G, and LX7 is selected from the group consisting of H and G. In certain embodiments, the isolated double-conjugated antibody comprises variant amino acids, such as LCDR1 (SEQ ID NO: 139) (where LX1 is L, LX2 is I, and LX3 is L), LCDR2 (SEQ ID NO: 140) (where LX4 is selected from the group consisting of S and G), and LCDR3 (SEQ ID NO: 141) (where LX5 is S, LX6 is S, and LX7 is selected from the group consisting of H and G).

[0117] In some embodiments, the double-conjugated antibodies are LCDR1 (SEQ ID NO: 139) (where LX1 is L, LX2 is I, and LX3 is L), LCDR2 (SEQ ID NO: 140) (where LX4 is S), and LCDR3 (SEQ ID NO: 141) (where LX5 is S, LX6 is S, and LX7 is G); or LCDR1 (SEQ ID NO: 139) (where LX1 is L, LX2 is I, and LX3 is L), LCDR2 (SEQ ID NO: 140) It may have a VL domain including (where LX4 is S), and LCDR3 (SEQ ID NO: 141) (where LX5 is S, LX6 is S, and LX7 is H), or LCDR1 (SEQ ID NO: 139) (where LX1 is L, LX2 is I, and LX3 is L), LCDR2 (SEQ ID NO: 140) (where LX4 is G), and LCDR3 (SEQ ID NO: 141) (where LX5 is S, LX6 is S, and LX7 is G).

[0118] The manipulated antibody clone containing the variant in the VL domain described above is shown in Figure 1B.

[0119] In some embodiments, isolated antibodies comprising heavy chain variable domains (VH) and light chain variable domains (VL) are disclosed herein, wherein the VH and VL are such that as in SEQ ID NOs. 209 and 210, 219 and 220, 249 and 250, 337 and 338, 155 and 156, 157 and 158, 4 and 3, 6 and 5, 8 and 7, 10 and 9, 12 and 11, 14 and 13, 16 and 15, and 18. and 17, SEQ ID NOs: 20 and 19, SEQ ID NOs: 22 and 21, SEQ ID NOs: 24 and 23, SEQ ID NOs: 26 and 25, SEQ ID NOs: 28 and 27, SEQ ID NOs: 30 and 29, SEQ ID NOs: 32 and 31, SEQ ID NOs: 34 and 33, SEQ ID NOs: 36 and 35, SEQ ID NOs: 38 and 37, SEQ ID NOs: 40 and 39, SEQ ID NOs: 42 and 41, SEQ ID NOs: 44 and 43, SEQ ID NOs: 46 and 45, SEQ ID NOs: 48 and 47, SEQ ID NOs: 50 and 49, SEQ ID NOs: 52 and 51, or SEQ ID NOs: 54 and 53.

[0120] In some embodiments, isolated antibodies comprising heavy chain variable domains (VH) and light chain variable domains (VL) are disclosed herein, and such antibodies include SEQ ID NOs. 209 and 210, SEQ ID NOs. 219 and 220, SEQ ID NOs. 249 and 250, SEQ ID NOs. 337 and 338, SEQ ID NOs. 155 and 156, SEQ ID NOs. 157 and 158, SEQ ID NOs. 4 and 3, SEQ ID NOs. 6 and 5, SEQ ID NOs. 8 and 7, SEQ ID NOs. 10 and 9, SEQ ID NOs. 12 and 11, SEQ ID NOs. 14 and 13, SEQ ID NOs. 16 and 15, SEQ ID NOs. 18 and 17, SEQ ID NOs. 20 and 19, SEQ ID NOs. 22 and 21, and The sequence includes sequences that are at least 80% identical (e.g., 80%, 85%, 90%, 95%, 98%, or 99% identical) to any of the sequences described in column numbers 24 and 23, sequence numbers 26 and 25, 28 and 27, 30 and 29, 32 and 31, 34 and 33, 36 and 35, 38 and 37, 40 and 39, 42 and 41, 44 and 43, 46 and 45, 48 and 47, 50 and 49, 52 and 51, or 54 and 53.

[0121] In some embodiments, isolated antibodies are disclosed herein, comprising a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH and VL comprise the amino acid sequences shown in Table 10 or Table 1. In some embodiments, isolated antibodies comprising a heavy chain variable domain (VH) and a light chain variable domain (VL) are disclosed herein, wherein the antibodies comprise sequences that are at least 80% identical (e.g., 80%, 85%, 90%, 95%, 98%, or 99% identical) to the sequences described in Table 10 or Table 1.

[0122] In some embodiments, isolated antibodies comprising heavy chain variable domains (VH) and light chain variable domains (VL) are disclosed herein. (a) The VH domain contains the amino acid sequence described in Sequence ID No. 1, which has amino acid variants at two or more positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or any combination thereof), (b) The VL domain contains the amino acid sequence described in Sequence ID No. 2, which has an amino acid variant at two or more positions 26, 27, 31, 51, 56, 77, 92, 93, or 96, or any combination thereof (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or any combination thereof).

[0123] In one embodiment, the isolated double-conjugated antibody disclosed herein comprises a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein VH and VL comprise the amino acid sequences of SEQ ID NOs. 209 and 210.

[0124] In another embodiment, the isolated double-conjugated antibody disclosed herein comprises a heavy-chain variable domain (VH) and a light-chain variable domain (VL), where VH and VL comprise the amino acid sequences of SEQ ID NOs. 219 and 220.

[0125] In another embodiment, the isolated double-conjugated antibody disclosed herein comprises a heavy-chain variable domain (VH) and a light-chain variable domain (VL), where VH and VL comprise the amino acid sequences of SEQ ID NOs. 249 and 250.

[0126] In another embodiment, the isolated double-conjugated antibody disclosed herein comprises a heavy-chain variable domain (VH) and a light-chain variable domain (VL), where VH and VL comprise the amino acid sequences of SEQ ID NOs. 337 and 338.

[0127] In another embodiment, the isolated double-conjugated antibody disclosed herein comprises a heavy-chain variable domain (VH) and a light-chain variable domain (VL), the VH and VL comprising amino acid sequences shown in Table 1 or Table 10.

[0128] In another embodiment, the isolated double-conjugated antibody disclosed herein comprises VH and VL sequences that are at least 80%, 85%, 90%, 95%, 98%, or 99% identical to the VH and VL sequences disclosed herein.

[0129] In some embodiments, the isolated double-conjugated antibody includes an antigen-binding domain site of the antibody comprising a VH domain and a VL domain, which include the combination of the VH domain HCDR and the VL domain LCDR described above. For example, in a non-limiting but specific embodiment, the VH domain includes a set of CDR, HCDR1, HCDR2, and HCDR3, the amino acid sequence of HCDR1 is described in SEQ ID NO: 136, the amino acid sequence of HCDR2 is described as I HX1 YDGSNK (SEQ ID NO: 142) (where HX1 is any amino acid), the amino acid sequence of HCDR3 is described as AR HX2 HX3 HX4 HX5 HX6 HX7 HX8 HX9 HX10 HX11 FD HX12 (SEQ ID NO: 143) (where XH2, HX3, HX4, HX5, HX6, HX7, HX8, HX9, HX10, HX11, and HX12 are any amino acids), and the VL domain includes a set of CDR, LCDR1, LCDR2, and LCDR3, the amino acid sequence of LCDR1 is LX1, LX2, GSK LX3 The amino acid sequence of LCDR2 is described as V (SEQ ID NO: 144) (where LX1, LX2, and LX3 are any amino acids), the amino acid sequence of LCD3 is described as DD LX4 (SEQ ID NO: 145) (where LX4 is any amino acid), and the amino acid sequence of LCD3 is described as QVWD LX5 LX6 SD LX7 VV (SEQ ID NO: 146) (where LX5, LX6, and LX7 are any amino acids).

[0130] In some embodiments, the VH domain includes a set of CDR, HCDR1, HCDR2, and HCDR3, where the amino acid sequence of HCDR1 is described in SEQ ID NO: 136, the amino acid sequence of HCDR2 is described in SEQ ID NO: 137, HX1 is selected from the group consisting of W and S, the amino acid sequence of HCDR3 is described in SEQ ID NO: 138, HX2 is selected from the group consisting of A and S, HX3 is P, HX4 is Q, HX5 is W, HX6 is selected from the group consisting of E, Q, M, L, and V, HX7 is selected from the group consisting of L, W, and Y, HX8 is selected from the group consisting of V and T, HX9 is selected from the group consisting of H, A, and S, and HX10 is E, H X11 is A, HX12 is selected from the group consisting of I, L, and M, the VL domain includes the set CDR, HCDR1, HCDR2, and HCDR3, the amino acid sequence of LCDR1 is described in SEQ ID NO: 139, LX1 is selected from the group consisting of N, L, and I, LX2 is selected from the group consisting of L and I, LX3 is selected from the group consisting of S and L, the amino acid sequence of LCDR2 is described in SEQ ID NO: 140, LX4 is selected from the group consisting of S and G, the amino acid sequence of LCDR3 is described in SEQ ID NO: 141, LX5 is selected from the group consisting of S and T, LX6 is selected from the group consisting of S and G, and LX7 is selected from the group consisting of H and G.

[0131] In a particular embodiment, the isolated double-conjugated antibody comprises a VH domain including a set of CDR, HCDR1, HCDR2, and HCDR3, where the amino acid sequence of HCDR1 is described in SEQ ID NO: 136, the amino acid sequence of HCDR2 is described in SEQ ID NO: 137, HX1 is W, the amino acid sequence of HCDR3 is described in SEQ ID NO: 138, HX2 is selected from the group consisting of A and S, HX3 is P, HX4 is Q, HX5 is W, HX6 is selected from the group consisting of E and M, HX7 is selected from the group consisting of L and W, HX8 is selected from the group consisting of V and T, and HX9 is Selected from the group consisting of H and A, HX10 is E, HX11 is A, HX12 is selected from the group consisting of I and L, and includes a VL domain containing the set of CDR, LCDR1, LCDR2, and LCDR3, the amino acid sequence of LCDR1 is described in SEQ ID NO: 139, LX1 is L, LX2 is I, LX3 is L, the amino acid sequence of LCDR2 is described in SEQ ID NO: 140, LX4 is selected from the group consisting of S and G, the amino acid sequence of LCDR3 is described in SEQ ID NO: 141, LX5 is S, LX6 is S, and LX7 is selected from the group consisting of H and G.

[0132] In some embodiments, the double-conjugated antibody comprises a VH domain containing a set of CDR, HCDR1, HCDR2, and HCDR3, and a VL domain containing a set of CDR, LCDR1, LCDR2, and LCDR3, the amino acid sequence of each CDR being as shown in Figures 1A and 1B for the clones shown in Figures 1A and 1B, for example, not limited to, Clone C2: HCDR1 (SEQ ID NO: 136), HCDR2 (SEQ ID NO: 137) (where HX1 is W), HCDR3 (SEQ ID NO: 138) (where HX2 is A, HX3 is P, HX4 is Q, HX5 is W, HX6 is E, HX7 is L, HX8 is T, HX9 is A, HX10 is E, HX11 is A, HX12 is I), LCDR1 (SEQ ID NO: 139) (where LX1 is L, LX2 is I, LX3 is L), LCDR2 (SEQ ID NO: 140) (where LX4 is S), and LCDR3 (SEQ ID NO: 141) (where LX5 is S, LX6 is S, LX7 is G), Clone C6: HCDR1 (SEQ ID NO: 136), HCDR2 (SEQ ID NO: 137) (where HX1 is W), HCDR3 (SEQ ID NO: 138) (where HX2 is A, HX3 is P, HX4 is Q, HX5 is W, HX6 is M, HX7 is L, HX8 is V, HX9 is A, HX10 is E, HX11 is A, HX12 is L), LCDR1 (SEQ ID NO: 139) (where LX1 is L, LX2 is I, LX3 is L), LCDR2 (SEQ ID NO: 140) (where LX4 is S), and LCDR3 (SEQ ID NO: 141) (where LX5 is S, LX6 is S, LX7 is H); or Clone C9 consists of HCDR1 (sequence number 136), HCDR2 (sequence number 137) (where HX1 is W), HCDR3 (sequence number 138) (where HX2 is S, HX3 is P, HX4 is Q, HX5 is W, HX6 is E, HX7 is W, HX8 is V, HX9 is H, HX10 is E, HX11 is A, and HX12 is L), LCDR1 (sequence number 139) (where LX1 is L, LX2 is I, and LX3 is L), LCDR2 (sequence number 140) (where LX4 is G), and LCDR3 (sequence number 141) (where LX5 is S, LX6 is S, and LX7 is G).

[0133] In some embodiments, the double-conjugated antibody comprises a set of HCDRs disclosed herein and an optional VL domain. In some embodiments, the double-conjugated antibody comprises a set of LCDRs disclosed herein and an optional VH domain. In some embodiments, the double-conjugated antibody comprises a paired set of HCDR-LCDRs disclosed herein.

[0134] In certain embodiments, a double-conjugated antibody comprising a VH domain containing an HCDR as described herein may be encoded by a nucleic acid construct. In certain embodiments, a double-conjugated antibody comprising a VL domain containing an LCDR as described herein may be encoded by a nucleic acid construct. In certain embodiments, a double-conjugated antibody comprising an HCDR containing an HCDR and a VH domain containing a VL domain as described herein may be encoded by a nucleic acid construct.

[0135] In certain embodiments, a double-conjugated antibody comprising a VH domain containing an HCDR as described herein may be encoded by a nucleic acid construct. In certain embodiments, a double-conjugated antibody comprising a VL domain containing an LCDR as described herein may be encoded by a nucleic acid construct. In certain embodiments, a double-conjugated antibody comprising an HCDR containing an HCDR and a VH domain containing a VL domain as described herein may be encoded by a nucleic acid construct.

[0136] In certain embodiments, a double-conjugated antibody containing a VH domain with an HCDR as described herein may be included in an immunoglobulin library. In certain embodiments, a double-conjugated antibody containing a VL domain with an LCDR as described herein may be included in an immunoglobulin library. In certain embodiments, a double-conjugated antibody containing an HCDR with an HCDR and a VH domain with a VL domain as described herein may be included in an immunoglobulin library.

[0137] In certain embodiments, a double-conjugated antibody comprising a VH domain containing HCDR as described herein may be produced by expressing a nucleic acid construct comprising a nucleic acid sequence encoding HCDR from a host cell and isolating the antibody. In certain embodiments, a double-conjugated antibody comprising a VL domain containing LCDR as described herein may be produced by expressing a nucleic acid construct comprising a nucleic acid sequence encoding LCDR from a host cell and isolating the antibody. In certain embodiments, a double-conjugated antibody comprising an HCDR containing HCDR and a VH domain containing a VL domain as described herein may be produced by expressing a nucleic acid construct comprising nucleic acid sequences encoding HCDR and LCDR from a host cell and isolating the antibody.

[0138] In certain embodiments, a double-conjugated antibody containing an HCDR-containing VH domain as described herein may be administered in a method to treat a subject in need, who is suffering from a disease or condition including an allergic or respiratory condition, an inflammatory condition of the skin or gastrointestinal tract and / or an autoimmune condition, scleroderma, or a tumor or cancer including Hodgkin lymphoma. In certain embodiments, a double-conjugated antibody containing an LCDR-containing VL domain as described herein may be administered in a method to treat a subject in need, who is suffering from a disease or condition including an allergic or respiratory condition, an inflammatory condition of the skin or gastrointestinal tract and / or an autoimmune condition, scleroderma, or a tumor or cancer including Hodgkin lymphoma. In certain embodiments, a double-conjugated antibody containing an LCDR-containing HCDR and a VH domain containing a VL domain as described herein may be administered in a method to treat a subject in need, who is suffering from a disease or condition including an allergic or respiratory condition, an inflammatory condition of the skin or gastrointestinal tract and / or an autoimmune condition, scleroderma, or a tumor or cancer including Hodgkin lymphoma.

[0139] In some embodiments, antibodies containing the heavy chain variable region amino acid sequence described in SEQ ID NO: 1 or the light chain variable region amino acid sequence described in SEQ ID NO: 2, or a combination thereof, do not bind to the IL-13 epitope. Therefore, the double-conjugated antibodies described herein are manipulated to include a binding region that is not originally present in the antibody. In other words, double-conjugated antibodies include “re-epitope” antibodies. Where used throughout, the terms “manipulated” and “re-epitope” may be used interchangeably in particular embodiments with the same quality and meaning. In some embodiments, the “re-epitope” antibody contains improved binding compared to the available antibody. In some embodiments, the “re-epitope” antibody has improved binding and dissociation constants (K) compared to the parent antibody. on and K off ) include. In some embodiments, the “re-epitope” antibody exhibits improved stability compared to the parent antibody. In certain embodiments, incorporating variant amino acid residues into at least two of the unique set of 21 variant sites within the CDR and FR of the VH and VL domains, as described herein, results in a “re-epitope” double-conjugate antibody exhibiting improved characteristics compared to the parent antibody. These re-epitope antibodies may exhibit advantageous characteristics.

[0140] Those skilled in the art will recognize that the "Fv" designation for an antibody encompasses the smallest fragment of the antibody that gives rise to a complete antigen-binding site. The Fv fragment consists of a variable region of a single light chain (VL) bound to a variable region of a single heavy chain (VH).

[0141] Those skilled in the art will recognize that “single-chain Fv antibody” or “scFv” with respect to an antibody encompasses an engineered antibody consisting of VL domains and VH domains linked to each other directly or via a peptide linker sequence. Those skilled in the art will understand that the linker may, in some embodiments, include a linear amino acid sequence. In some embodiments, the linear amino acid sequence ("linker") includes an enzymatic cleavage site and, in certain embodiments, may be referred to as a “cleavable linker” or “linker” or “cleavable peptide.” In some embodiments, the linker may be a cleavable linker. In some embodiments, the linker may be an incleavable linker. In some embodiments, the linker sequence is described in SEQ ID NO: 147 (GGGGSGGGGSGGGGS; SEQ ID NO: 147).

[0142] In some embodiments, the peptide linker sequence contains, for example, Gly, Asn, or Ser residues in various combinations. Other nearly neutral amino acids, such as Thr and Ala, may also be included in the linker sequence.

[0143] Other amino acid sequences that may be useful as linkers include those described in Maratea et al., Gene 40:39 46 (1985); Murphy et al., Proc.Natl.Acad.Sci.USA 83:8258 8262 (1986), U.S. Patent No. 4,935,233, U.S. Patent No. 4,751,180, Chaudhary et al., 1990, Proc.Natl.Acad.Sci.USA 87:1066-1070; Bird et al., 1988, Science 242:423-426, which are incorporated herein by reference in their entirety.

[0144] In some embodiments, the coding sequences of the VH and VL domains of a double-conjugated antibody or its fragment can be fused directly or by using a constructed flexible polylinker without any binding amino acids.

[0145] In certain embodiments, the peptide linker is designed to enable the correct interaction between two beta sheets that form the variable region of a single-chain antibody. Indirect linking can be achieved using any suitable linker, including but not limited to peptide linkers, polymer linkers, and chemical linkers. In certain embodiments, covalent bonding is an indirect linking through a peptide linker.

[0146] In some embodiments, the antibody includes a variant immunoglobulin. Examples of variant immunoglobulins include, but are not limited to, IgG that does not bind to antibody-dependent cell-mediated cytotoxicity (ADCC) components. 234 A / L 235 IgG containing the A(LALA) mutation cannot bind to the Fc receptor (see Xu D, Alegre ML, Varga SS, Rothermel AL, Collins AM, Pulito VL, et al.. In vitro characterization of five humanized OKT3 effector function variant antibodies. Cell Immunol. (2000) 200:16-26.10.1006 / cimm.2000.1617). In some embodiments, the biantibody is L 234 A / L 235 Contains IgG with A(LALA) mutation. The mutations numbered here are based on the EU numbering rules used for the constant region (see Xu D, Alegre ML, Varga SS, Rothermel AL, Collins AM, Pulito VL, et al.. In vitro characterization of five humanized OKT3 effector function variant antibodies. Cell Immunol. (2000) 200:16-26.10.1006 / cimm.2000.1617).

[0147] In some embodiments, the mutant IgG includes IgG1 and its Fc region is manipulated. In some embodiments, the mutant IgG includes IgG2 and its Fc region is manipulated. In some embodiments, the mutant IgG includes IgG3 and its Fc region is manipulated. In some embodiments, the mutant IgG includes IgG4 and its Fc region is manipulated. In certain embodiments, mutations within the Fc region of the antibody eliminate the antibody's immunoeffector function.

[0148] In some embodiments, the isolated double-conjugated antibody comprises IgG, Fv, scFv, Fab, F(ab')2, minibody, bispecific antibody, or tribody. In some embodiments, the isolated double-conjugated antibody comprises IgG, which is IgG1, IgG2, IgG3, or IgG4.

[0149] In some embodiments, the isolated double-conjugated antibody includes mutant IgG, which is unable to bind to antibody-dependent cytotoxic components.

[0150] In some embodiments, the double-conjugated antibody described herein comprises IgG immunoglobulin. In some embodiments, the double-conjugated antibody described herein comprises IgG1 immunoglobulin, IgG2 immunoglobulin, IgG3 immunoglobulin, or IgG4 immunoglobulin. In some embodiments, the double-conjugated antibody comprises IgG1 immunoglobulin. In some embodiments, the double-conjugated antibody comprises IgG2 immunoglobulin. In some embodiments, the double-conjugated antibody comprises IgG3 immunoglobulin. In some embodiments, the double-conjugated antibody comprises IgG4 immunoglobulin. In some embodiments, the double-conjugated antibody comprises IgG1 immunoglobulin or IgG4 immunoglobulin.

[0151] In some embodiments, the double-conjugated antibody described herein comprises a Fab immunoglobulin fragment. In some embodiments, the double-conjugated antibody described herein comprises an F(ab')2 immunoglobulin fragment. In some embodiments, the double-conjugated antibody described herein comprises an Fv immunoglobulin construct. In some embodiments, the double-conjugated antibody described herein comprises an scF immunoglobulin construct. In some embodiments, the double-conjugated antibody described herein comprises a minibody immunoglobulin construct comprising a pair of single-stranded Fv fragments linked via a CH3 domain.

[0152] In some embodiments, the double-conjugated antibodies described herein comprise a diabody immunoglobulin construct. In some embodiments, the diabody immunoglobulin construct comprises heavy-chain variable (VH) and light-chain variable (VL) regions linked by a small peptide linker. In some embodiments, the diabody immunoglobulin construct comprises a single-chain (Fv)2 in which two scFv fragments are covalently linked to each other. In some embodiments, the double-conjugated antibodies described herein comprise a diabody immunoglobulin construct comprising three scFv fragments covalently linked to each other. It has been shown in the art that diabodies have a dissociation constant up to 40 times lower than the corresponding scFv, which means they have a much higher affinity for their targets. As a result, the use of diabodies in the uses described below may result in a much lower dosage of diabodies or diabodies than of IgG containing the same VH and VL domains.

[0153] In some embodiments, the double-conjugated antibody includes a linker or multiple linkers between the binding components, for example, non-limitingly, between VH and VL in the scFv, minibody, diabody, triabody, or tetrabody. In some embodiments, the double-conjugated antibody does not include a linker or multiple linkers between the binding components, for example, non-limitingly, between VH and VL in the scFv, minibody, diabody, triabody, or tetrabody. In some embodiments, the linker may include a single amino acid. In some embodiments, the linker includes any linker known in the art. In some embodiments, the linker includes the amino acid sequence described in SEQ ID NO: 147.

[0154] Those skilled in the art will understand that the term “variant” encompasses polypeptides that differ from the specifically listed polypeptide sequences, e.g., the amino acid sequences described in SEQ ID NO: 1 and SEQ ID NO: 2, by one or more amino acid insertions, deletions, and / or substitutions, for example, produced using recombinant DNA technology. Variants of antigen-binding molecules disclosed herein include antigen-binding molecules in which one or more amino acid residues are modified by at least one substitution, addition, and / or deletion such that a new antigen-binding affinity is created within the antigen-binding molecule.

[0155] The double-binding region of the antibodies described herein comprises an immunoglobulin heavy chain variable region and an immunoglobulin light chain variable region (VH and VL, respectively), the amino acid sequence described in SEQ ID NO: 1 comprises a VH template, the amino acid sequence described in SEQ ID NO: 2 comprises a VL template, and the double-binding region comprises at least two variants within the VH template sequence, or within the VL template sequence, or a combination thereof.

[0156] Those skilled in the art will understand that, in certain embodiments, “isolated double-conjugated antibody” includes (1) an antibody that does not contain at least some other proteins that would typically be found in nature or in its synthesis, (2) an antibody that does not essentially contain other non-identical conjugated antibodies from the same source, (3) an antibody that can be recombinantly expressed by cells, (4) an antibody separated from at least about 50 percent of polynucleotides, lipids, carbohydrates, or other materials involved in its synthesis, or (5) an antibody that does not occur in nature, or any combination thereof. Such isolated antibodies may be encoded by genomic DNA, cDNA, mRNA or other RNA, may be of synthetic origin, or any combination thereof. In certain embodiments, the isolated antibody is substantially free of proteins or polypeptides or other contaminants that would interfere with its use (therapeutic, diagnostic, preventive, research, or otherwise). When used throughout, the terms “double antibody” and “double-conjugated antibody” may be used interchangeably with all the same meaning and quality.

[0157] In some embodiments, the heavy chain variable region includes the amino acid sequence described in Sequence ID No. 1, having at least one amino acid variant at any of the positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT numbering of heavy chain variable region variant positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or any combination thereof), and the light chain variable region includes the amino acid sequence described in Sequence ID No. 1, having at least one amino acid variant at any of the positions 26, 27, 31, 51, 56, 77, 92, 93, or 96, or any combination thereof (IMGT numbering of light chain variable region variant positions Disclosed herein are isolated double-conjugated antibodies comprising a light chain variable region containing the amino acid sequence described in SEQ ID NO: 2, or a combination of a variant heavy chain variable region and a variant light chain variable region, wherein the total number of variant positions in the heavy chain variable region, the light chain variable region, or the combination thereof is at least 2.

[0158] IMGT (registered trademark) is the international ImMunoGeneTics Information System (registered trademark) (see Nucleic Acids Res. 2015 Jan;43 (Database issue):D413-22.doi:10.1093 / nar / gku1056.Epub 2014 Nov 5 Free article.PMID:25378316 LIGM:441 and Dev Comp Immunol. 2003 Jan;27(1):55-77). IMGT is a unique numbering system for immunoglobulins and T cell receptor variable domains and Ig superfamily V-like domains (Lefranc MP1, Pommie C, Ruiz M, Giudicelli V, Foulquier E, Truong L, Thouvenin-Contet V, Lefranc G. Dev Comp Immunol 27:55-77.(2003)). IMGT® takes into account the Kabat definitions, structural data, and Chothia characterization of hypervariable loops of FR and CDR, and combines them to present a uniform numbering system for these IG and TcR variable domain sequences based on the alignment of five or more IG and TcR variable region sequences. IMGT is considered a universal numbering scheme for antibodies well known in the art.

[0159] In some embodiments, IMGT numbering is used when describing variant amino acid positions present in the VH and VL domains. In some embodiments, the variant amino acid position is presented as a specific position within a given sequence, for example, non-limitingly, within Sequence ID No. 1 and Sequence ID No. 2. In some embodiments, the variant amino acid position is identified by both a specific position within a given Sequence ID sequence and the IMGT numbering system. Those skilled in the art will recognize that the actual amino acid position number of an amino acid identified by a position number relative to a Sequence ID may differ from that of the IMGT numbering system, but the identified residue is identical. For example, non-limitingly, the amino acid residue at position 106 of Sequence ID No. 1 is the same residue identified at position 112 by the IMGT numbering system. Those skilled in the art will recognize that the same amino acid residue may be identified as having different positions depending on which system is used, but the position and identity of amino acid residues within a consecutive amino acid sequence are clear.

[0160] In some embodiments, isolated double-conjugated antibodies are disclosed herein, comprising a heavy chain variable region containing the amino acid sequence described in SEQ ID NO: 1, having at least one amino acid variant at any of the positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT numbering of heavy chain variable region variant positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or any combination thereof), and a light chain variable region containing the amino acid sequence described in SEQ ID NO: 2, optionally wherein the amino acid sequence of SEQ ID NO: 2 contains at least one variant amino acid, wherein the total number of variant positions in the heavy chain variable region, light chain variable region, or combination thereof is at least 2. In some embodiments, isolated double-conjugated antibodies are disclosed herein that include a heavy chain variable region containing the amino acid sequence described in Sequence ID No. 1, and an optional light chain variable region, having at least two amino acid variants at any of the positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT numbering of heavy chain variable region variant positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or any combination thereof).

[0161] Many light chain variable regions have amino acid sequences that are known in the art. Those skilled in the art can use such known sequences in conjunction with the heavy chain variable regions described herein to analyze double bonds using common methodologies and techniques well known in the art (see, for example, Example 1 below).

[0162] In some embodiments, isolated double-conjugated antibodies are disclosed herein, comprising a light chain variable region containing the amino acid sequence described in SEQ ID NO: 2, having at least one amino acid variant at position 26, 27, 31, 51, 56, 77, 92, 93, or 96, or any combination thereof (IMGT numbering of light chain variable region variant positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or any combination thereof), and a heavy chain variable region containing the amino acid sequence described in SEQ ID NO: 1, optionally wherein the amino acid sequence of SEQ ID NO: 1 contains at least one variant amino acid, wherein the total number of variant positions in the heavy chain variable region, the light chain variable region, or any combination thereof is at least 2. In some embodiments, isolated double-conjugated antibodies are disclosed herein that include a light chain variable region having at least two amino acid variants at any one or any combination thereof (IMGT numbering 27, 28, 38, 65, 70, 94, 109, 110, or 115 of the light chain variable region variant positions, as described in SEQ ID NO: 2, and an optional heavy chain variable region.

[0163] Many amino acid sequences of heavy chain variable regions are known in the art. Those skilled in the art can use such known sequences in conjunction with the light chain variable regions described herein to analyze double bonds using common methodologies and techniques well known in the art (see, for example, Example 1 below).

[0164] In some embodiments, the VH domain described herein includes the amino acid sequence described in SEQ ID NO: 1, having at least one amino acid variant at any position. In some embodiments, the VH containing the amino acid sequence described in SEQ ID NO: 1 includes at least two amino acid variants at any position. In some embodiments, the VH containing the amino acid sequence described in SEQ ID NO: 1 includes at least 1 to 10 amino acid variants at any position. In some embodiments, the VH containing the amino acid sequence described in SEQ ID NO: 1 includes 1 to 5 amino acid variants at any position. In some embodiments, the VH containing the amino acid sequence described in SEQ ID NO: 1 includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more amino acid variants at any position.

[0165] In some embodiments, the VL domain described herein includes the amino acid sequence described in SEQ ID NO: 2, having at least one amino acid variant at any position. In some embodiments, the VL containing the amino acid sequence described in SEQ ID NO: 2 includes at least two amino acid variants at any position. In some embodiments, the VL containing the amino acid sequence described in SEQ ID NO: 2 includes at least 1 to 10 amino acid variants at any position. In some embodiments, the VL containing the amino acid sequence described in SEQ ID NO: 2 includes 1 to 5 amino acid variants at any position. In some embodiments, the VL containing the amino acid sequence described in SEQ ID NO: 2 includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more amino acid variants at any position.

[0166] In some embodiments, the VH and VL domains described herein, including the amino acid sequences described in SEQ ID NO: 1 and SEQ ID NO: 2, respectfully have a combined number of at least two variant positions. In some embodiments, the VH and VL domains described herein, including the amino acid sequences described in SEQ ID NO: 1 and SEQ ID NO: 2, respectfully have a combined number of 2 to 20 variant positions. In some embodiments, the VH and VL domains described herein, including the amino acid sequences described in SEQ ID NO: 1 and SEQ ID NO: 2, respectfully have a combined number of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 variant positions. In some embodiments, the VH and VL domains described herein, including the amino acid sequences described in SEQ ID NO: 1 and SEQ ID NO: 2, respectfully have a combined number of more than 20 variant positions.

[0167] In certain embodiments, the biantibody-binding region described herein comprises heavy-chain and light-chain CDR sets, each interposed between heavy-chain and light-chain framework region (FR) sets that provide support to the CDRs and define the spatial relationships of the CDRs relative to each other. As used herein, the term “CDR set” refers to three hypervariable regions of the heavy-chain variable region or light-chain variable region. Proceeding from the N-terminus of the heavy-chain or light-chain polypeptide, these regions are denoted as “CDR1,” “CDR2,” and “CDR3,” respectively. Thus, the antigen-binding site comprises six CDRs, including the CDR sets derived from the heavy-chain and light-chain variable regions, respectively. Crystallographic analysis of several antigen-antibody complexes has shown that amino acid residues of the CDRs make extensive contact with the bound antigen, with the most extensive antigen contact occurring with heavy-chain CDR3. Therefore, the CDR regions are primarily responsible for the specificity of the antigen-binding site.

[0168] As used herein, the term “FR set” refers to the four adjacent amino acid sequences that form the CDR of a CDR set of a heavy chain variable region or light chain variable region. While some FR residues can come into contact with the binding antigen, FRs are primarily involved in the folding of the variable region into the antigen-binding site, particularly the FR residue immediately adjacent to the CDR. Within FRs, certain amino residues and specific structural features are highly conserved. In this regard, all variable region sequences contain an internal disulfide loop of approximately 90 amino acid residues. When the variable region folds into the binding site, the CDR is presented as a protruding loop motif that forms the antigen-binding surface. It is generally recognized that there are conserved structural regions of FRs, which influence the folded shape of the CDR loop to be a certain “standard” structure, regardless of the exact CDR amino acid sequence. Furthermore, certain FR residues are known to be involved in non-covalent interdomain contacts that stabilize the interaction between the antibody heavy and light chains.

[0169] In some embodiments, at least one variant in the VH contains a variant amino acid in the CDR region. In some embodiments, at least one variant in the VL contains a variant amino acid in the CDR region. In some embodiments, at least one variant in the VH contains a variant amino acid in the FR region. In some embodiments, at least one variant in the VL contains a variant amino acid in the FR region. In some embodiments, at least two variants in the VH contain a variant amino acid in the CDR region, the FR region, or both. In some embodiments, at least two variants in the VL contain a variant amino acid in the CDR region, the FR region, or both. In some embodiments, the variant location in the VH contains a variant in at least one CDR and at least one FR region. In some embodiments, the variant location in the VL contains a variant in at least one CDR and at least one FR region.

[0170] In some embodiments, a VH containing the amino acid sequence described in SEQ ID NO: 1 contains an amino acid variant at position 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT numbering of heavy chain variable region variant positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or any combination thereof). In some embodiments, a VH containing the amino acid sequence described in SEQ ID NO: 1 contains an amino acid variant at position 52 (IMGT position 57). In some embodiments, a VH containing the amino acid sequence described in SEQ ID NO: 1 contains an amino acid variant at position 99 (IMGT position 107). In some embodiments, a VH containing the amino acid sequence described in SEQ ID NO: 1 contains an amino acid variant at position 100 (IMGT position 108). In some embodiments, the VH containing the amino acid sequence described in SEQ ID NO: 1 contains an amino acid variant at position 101 (IMGT position 109). In some embodiments, the VH containing the amino acid sequence described in SEQ ID NO: 1 contains an amino acid variant at position 102 (IMGT position 110). In some embodiments, the VH containing the amino acid sequence described in SEQ ID NO: 1 contains an amino acid variant at position 103 (IMGT position 111). In some embodiments, the VH containing the amino acid sequence described in SEQ ID NO: 1 contains an amino acid variant at position 104 (IMGT position 111A). In some embodiments, the VH containing the amino acid sequence described in SEQ ID NO: 1 contains an amino acid variant at position 105 (IMGT position 112A). In some embodiments, the VH containing the amino acid sequence described in SEQ ID NO: 1 contains an amino acid variant at position 106 (IMGT position 112). In some embodiments, the VH containing the amino acid sequence described in SEQ ID NO: 1 contains an amino acid variant at position 107 (IMGT position 113). In some embodiments, VH containing the amino acid sequence described in SEQ ID NO: 1 contains an amino acid variant at position 108 (IMGT position 114). In some embodiments, VH containing the amino acid sequence described in SEQ ID NO: 1 contains an amino acid variant at position 111 (IMGT position 117).

[0171] In some embodiments, VH containing the amino acid sequence described in SEQ ID NO: 1 contains an amino acid variant at position 52 (IMGT position 57) and 1 to 3 further variant amino acids. In some embodiments, VH containing the amino acid sequence described in SEQ ID NO: 1 contains an amino acid variant at position 99 (IMGT position 107) and 1 to 3 further variant amino acids. In some embodiments, VH containing the amino acid sequence described in SEQ ID NO: 1 contains an amino acid variant at position 100 (IMGT position 108) and 1 to 3 further variant amino acids. In some embodiments, VH containing the amino acid sequence described in SEQ ID NO: 1 contains an amino acid variant at position 101 (IMGT position 109) and 1 to 3 further variant amino acids. In some embodiments, VH containing the amino acid sequence described in SEQ ID NO: 1 contains an amino acid variant at position 102 (IMGT position 110) and 1 to 3 further variant amino acids. In some embodiments, VH containing the amino acid sequence described in SEQ ID NO: 1 contains an amino acid variant at position 103 (IMGT position 111) and 1 to 3 further variant amino acids. In some embodiments, VH containing the amino acid sequence described in SEQ ID NO: 1 contains an amino acid variant at position 104 (IMGT position 111A) and 1 to 3 further variant amino acids. In some embodiments, VH containing the amino acid sequence described in SEQ ID NO: 1 contains an amino acid variant at position 105 (IMGT position 112A) and 1 to 3 further variant amino acids. In some embodiments, VH containing the amino acid sequence described in SEQ ID NO: 1 contains an amino acid variant at position 106 (IMGT position 112) and 1 to 3 further variant amino acids. In some embodiments, VH containing the amino acid sequence described in SEQ ID NO: 1 contains an amino acid variant at position 107 (IMGT position 113) and 1 to 3 further variant amino acids. In some embodiments, VH containing the amino acid sequence described in SEQ ID NO: 1 contains an amino acid variant at position 108 (IMGT position 114) and 1 to 3 further variant amino acids.In some embodiments, VH containing the amino acid sequence described in SEQ ID NO: 1 contains an amino acid variant at position 111 (IMGT position 117) and 1 to 3 further variant amino acids.

[0172] In some embodiments, the VH containing the amino acid sequence described in SEQ ID NO: 1 contains amino acid variants at positions 105 and 106 (IMGT positions 112A and 112). In some embodiments, the VH containing the amino acid sequence described in SEQ ID NO: 1 contains amino acid variants at positions 106 and 111 (IMGT positions 112 and 117). In some embodiments, the VH containing the amino acid sequence described in SEQ ID NO: 1 contains amino acid variants at positions 103 and 106 (IMGT positions 111 and 112). In some embodiments, the VH containing the amino acid sequence described in SEQ ID NO: 1 contains amino acid variants at positions 104 and 106 (IMGT positions 111A and 112). In some embodiments, the VH containing the amino acid sequence described in SEQ ID NO: 1 contains amino acid variants at positions 104, 106 and 111 (IMGT positions 111A, 112 and 117). In some embodiments, the VH containing the amino acid sequence described in SEQ ID NO: 1 contains amino acid variants at positions 105, 106, and 111 (IMGT positions 112A, 112, and 117). In some embodiments, the VH containing the amino acid sequence described in SEQ ID NO: 1 contains amino acid variants at positions 103, 106, and 111 (IMGT positions 111, 112, and 117). In some embodiments, the VH containing the amino acid sequence described in SEQ ID NO: 1 contains amino acid variants at positions 99, 104, and 111 (IMGT positions 107, 111A, and 117). In some embodiments, the VH containing the amino acid sequence described in SEQ ID NO: 1 contains amino acid variants at positions 52, 99, 104, and 111 (IMGT positions 57, 107, 111A, and 117).

[0173] In some embodiments, the VL containing the amino acid sequence described in SEQ ID NO: 2 contains an amino acid variant at any of the following positions: 26, 27, 31, 51, 56, 77, 92, 93, or 96, or any combination thereof (IMGT numbering of the light chain variable region variant position 27, 28, 38, 65, 70, 94, 109, 110, or 115, or any combination thereof). In some embodiments, the VL containing the amino acid sequence described in SEQ ID NO: 2 contains an amino acid variant at position 26 (IMGT position 27). In some embodiments, the VL containing the amino acid sequence described in SEQ ID NO: 2 contains an amino acid variant at position 27 (IMGT position 28). In some embodiments, the VL containing the amino acid sequence described in SEQ ID NO: 2 contains an amino acid variant at position 31 (IMGT position 38). In some embodiments, the VL containing the amino acid sequence described in SEQ ID NO: 2 contains an amino acid variant at position 51 (IMGT position 65). In some embodiments, the VL containing the amino acid sequence described in SEQ ID NO: 2 contains an amino acid variant at position 56 (IMGT position 70). In some embodiments, the VL containing the amino acid sequence described in SEQ ID NO: 2 contains an amino acid variant at position 77 (IMGT position 94). In some embodiments, the VL containing the amino acid sequence described in SEQ ID NO: 2 contains an amino acid variant at position 92 (IMGT position 109). In some embodiments, the VL containing the amino acid sequence described in SEQ ID NO: 2 contains an amino acid variant at position 93 (IMGT position 110). In some embodiments, the VL containing the amino acid sequence described in SEQ ID NO: 2 contains an amino acid variant at position 96 (IMGT position 115).

[0174] In some embodiments, the VL containing the amino acid sequence described in SEQ ID NO: 2 contains an amino acid variant at position 26 (IMGT position 27) and 1 to 7 further variant amino acids. In some embodiments, the VL containing the amino acid sequence described in SEQ ID NO: 2 contains an amino acid variant at position 27 (IMGT position 28) and 1 to 7 further variant amino acids. In some embodiments, the VL containing the amino acid sequence described in SEQ ID NO: 2 contains an amino acid variant at position 31 (IMGT position 38) and 1 to 7 further variant amino acids. In some embodiments, the VL containing the amino acid sequence described in SEQ ID NO: 2 contains an amino acid variant at position 51 (IMGT position 65) and 1 to 7 further variant amino acids. In some embodiments, the VL containing the amino acid sequence described in SEQ ID NO: 2 contains an amino acid variant at position 56 (IMGT position 70) and 1 to 7 further variant amino acids. In some embodiments, the VL containing the amino acid sequence described in SEQ ID NO: 2 contains an amino acid variant at position 77 (IMGT position 94) and 1 to 7 further variant amino acids. In some embodiments, the VL containing the amino acid sequence described in SEQ ID NO: 2 contains an amino acid variant at position 92 (IMGT position 109) and 1 to 7 further variant amino acids. In some embodiments, the VL containing the amino acid sequence described in SEQ ID NO: 2 contains an amino acid variant at position 93 (IMGT position 110) and 1 to 7 further variant amino acids. In some embodiments, the VL containing the amino acid sequence described in SEQ ID NO: 2 contains an amino acid variant at position 96 (IMGT position 115) and 1 to 7 further variant amino acids.

[0175] In some embodiments, the VL containing the amino acid sequence described in SEQ ID NO: 2 includes amino acid variants at positions 26, 27, 31, 56, 77, and 96 (IMGT positions 27, 28, 38, 70, 94, and 115). In some embodiments, the VL containing the amino acid sequence described in SEQ ID NO: 2 includes amino acid variants at positions 26, 27, 31, 56, 77, 92, and 96 (IMGT positions 27, 28, 38, 70, 94, 109, and 115). In some embodiments, the VL containing the amino acid sequence described in SEQ ID NO: 2 includes amino acid variants at positions 26, 31, 56, and 77 (IMGT positions 27, 38, 70, and 94). In some embodiments, the VL containing the amino acid sequence described in SEQ ID NO: 2 includes amino acid variants at positions 26, 27, 31, 56, and 77 (IMGT positions 27, 28, 38, 70, and 94). In some embodiments, the VL containing the amino acid sequence described in SEQ ID NO: 2 includes amino acid variants at positions 26, 27, 31, 56, 77, and 92 (IMGT positions 27, 28, 38, 70, 94, and 109). In some embodiments, the VL containing the amino acid sequence described in SEQ ID NO: 2 includes amino acid variants at positions 26, 27, 31, 51, 56, 77, and 92 (IMGT positions 27, 28, 38, 65, 70, 94, and 109). In some embodiments, the VL containing the amino acid sequence described in SEQ ID NO: 2 includes amino acid variants at positions 26, 31, 56, 77, 92, and 96 (IMGT positions 27, 38, 70, 94, 109, and 115). In some embodiments, the VL containing the amino acid sequence described in SEQ ID NO: 2 contains amino acid variants at positions 26, 31, 77, and 92 (IMGT positions 27, 38, 94, and 109). In some embodiments, the VL containing the amino acid sequence described in SEQ ID NO: 2 contains amino acid variants at positions 26, 27, 31, 56, 77, and 93 (IMGT positions 27, 28, 38, 70, 94, and 110). In some embodiments, the VL containing the amino acid sequence described in SEQ ID NO: 2 contains amino acid variants at positions 26, 27, 31, 56, 77, 93, and 96 (IMGT positions 27, 28, 38, 70, 94, 110, and 115).In some embodiments, the VL containing the amino acid sequence described in SEQ ID NO: 2 includes amino acid variants at positions 26, 27, 31, 51, 77, 93, and 96 (IMGT positions 27, 28, 38, 65, 94, 110, and 115). In some embodiments, the VL containing the amino acid sequence described in SEQ ID NO: 2 includes amino acid variants at positions 26, 27, 31, 56, 77, 93, and 96 (IMGT positions 27, 28, 38, 70, 94, 110, and 115). In some embodiments, the VL containing the amino acid sequence described in SEQ ID NO: 2 includes amino acid variants at positions 27, 31, 56, 77, and 96 (IMGT positions 28, 38, 70, 94, and 115). In some embodiments, a VL containing the amino acid sequence described in SEQ ID NO: 2 contains amino acid variants at positions 27, 31, 56, 77, 92, and 96 (IMGT positions 28, 38, 70, 94, 109, and 115). In some embodiments, a VL containing the amino acid sequence described in SEQ ID NO: 2 contains amino acid variants at positions 26, 27, 31, 51, 77, and 96 (IMGT positions 27, 28, 38, 65, 94, and 115). In some embodiments, a VL containing the amino acid sequence described in SEQ ID NO: 2 contains amino acid variants at positions 26, 27, 31, or 96 (IMGT positions 27, 28, 38, and 115), or any combination thereof.

[0176] In some embodiments, a VL containing the amino acid sequence described in SEQ ID NO: 2 contains an amino acid variant at either position 56 or 77 of SEQ ID NO: 2, or a combination thereof (IMGT position 70 or 94, or a combination thereof) within the framework region. In some embodiments, a VL containing the amino acid sequence described in SEQ ID NO: 2 contains at least one amino acid variant at either position 56 or 77 of SEQ ID NO: 2, or a combination thereof (IMGT position 70 or 94, or a combination thereof) within the framework region, wherein the variant amino acid at position 56 is leucine, alanine, arginine, lysine, aspartic acid, glycine, or glutamic acid, and / or the variant amino acid at position 77 is valine.

[0177] In some embodiments, isolated double-conjugated antibodies are disclosed herein, comprising a heavy chain variable region containing the amino acid sequence described in SEQ ID NO: 1, having at least one amino acid variant at any of the positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117 (IMGT), or a combination thereof, and a light chain variable region containing the amino acid sequence described in SEQ ID NO: 2, having at least one amino acid variant at any of the positions 27, 28, 38, 65, 70, 94, 109, 110, or 115 (IMGT), or a combination thereof, wherein the total number of variant positions in the double-conjugated antibody is at least 2.

[0178] In some embodiments, the isolated double-conjugated antibody includes variant VH or variant VL, or a combination thereof, having variant amino acids at positions other than (IMGT) 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117 in the heavy chain variable region and / or (IMGT) 27, 28, 38, 65, 70, 94, 109, 110, or 115 in the light chain variable region.

[0179] In some embodiments, at least one amino acid variant in VH contains a variant amino acid in the CDR region. In some embodiments, at least one amino acid variant in VH contains a variant amino acid in the CDR1 region. In some embodiments, at least one amino acid variant in VH contains a variant amino acid in the CDR2 region. In some embodiments, at least one amino acid variant in VH contains a variant amino acid in the CDR3 region. In some embodiments, at least two amino acid variants in VH contain variant amino acids in two different CDR regions. In some embodiments, at least two amino acid variants in VH contain a variant amino acid in the same CDR region. In some embodiments, at least two amino acid variants in VH contain a variant amino acid in the same CDR1 region. In some embodiments, at least two amino acid variants in VH contain a variant amino acid in the same CDR2 region. In some embodiments, at least two amino acid variants in VH contain a variant amino acid in the same CDR3 region. In some embodiments, at least two amino acid variants in VH contain variant amino acids in the CDR1 and CDR2 regions. In some embodiments, at least two amino acid variants in VH contain variant amino acids in the CDR1 and CDR3 regions. In some embodiments, at least two amino acid variants in VH contain variant amino acids in the CDR2 and CDR3 regions. In some embodiments, at least three amino acid variants in VH contain variant amino acids in a single CDR region. In some embodiments, at least three amino acid variants in VH contain variant amino acids in the CDR1 region. In some embodiments, at least three amino acid variants in VH contain variant amino acids in the CDR2 region. In some embodiments, at least three amino acid variants in VH contain variant amino acids in the CDR3 region. In some embodiments, at least three amino acid variants in VH contain variant amino acids in the CDR1 and CDR2 regions.In some embodiments, at least three amino acid variants in VH include variant amino acids in the CDR1 and CDR3 regions. In some embodiments, at least three amino acid variants in VH include variant amino acids in the CDR2 and CDR3 regions. In some embodiments, at least three amino acid variants in VH include variant amino acids in the CDR1, CDR2, and CDR3 regions. In some embodiments, at least four amino acid variants in VH include variant amino acids in a single CDR region. In some embodiments, at least four amino acid variants in VH include variant amino acids in the CDR1 region. In some embodiments, at least four amino acid variants in VH include variant amino acids in the CDR2 region. In some embodiments, at least four amino acid variants in VH include variant amino acids in the CDR3 region. In some embodiments, at least four amino acid variants in VH include variant amino acids in the CDR1 and CDR2 regions. In some embodiments, at least four amino acid variants in VH include variant amino acids in the CDR1 and CDR3 regions. In some embodiments, at least four amino acid variants in VH include variant amino acids in the CDR2 and CDR3 regions. In some embodiments, at least four amino acid variants in VH include variant amino acids in the CDR1, CDR2, and CDR3 regions. In some embodiments, when five or more amino acid variants are present in VH, the variant position includes a variant amino acid in a single CDR region. In some embodiments, when five or more amino acid variants are present in VH, the variant position includes an amino acid in the CDR1 region. In some embodiments, when five or more amino acid variants are present in VH, the variant position includes a variant amino acid in the CDR2 region. In some embodiments, when five or more amino acid variants are present in VH, the variant position includes a variant amino acid in the CDR3 region.In some embodiments, when five or more amino acid variants are present in VH, the variant position includes variant amino acids in the CDR1 and CDR2 regions. In some embodiments, when five or more amino acid variants are present in VH, the variant position includes variant amino acids in the CDR1 and CDR3 regions. In some embodiments, when five or more amino acid variants are present in VH, the variant position includes variant amino acids in the CDR2 and CDR3 regions. In some embodiments, when five or more amino acid variants are present in VH, the variant position includes variant amino acids in the CDR1, CDR2, and CDR3 regions.

[0180] In some embodiments, at least one amino acid variant in the VL contains a variant amino acid in the CDR region. In some embodiments, at least one amino acid variant in the VL contains a variant amino acid in the CDR1 region. In some embodiments, at least one amino acid variant in the VL contains a variant amino acid in the CDR2 region. In some embodiments, at least one amino acid variant in the VL contains a variant amino acid in the CDR3 region. In some embodiments, at least two amino acid variants in the VL contain variant amino acids in two different CDR regions. In some embodiments, at least two amino acid variants in the VL contain a variant amino acid in the same CDR region. In some embodiments, at least two amino acid variants in the VL contain a variant amino acid in the same CDR1 region. In some embodiments, at least two amino acid variants in the VL contain a variant amino acid in the same CDR2 region. In some embodiments, at least two amino acid variants in the VL contain a variant amino acid in the same CDR3 region. In some embodiments, at least two amino acid variants in the VL contain variant amino acids in the CDR1 and CDR2 regions. In some embodiments, at least two amino acid variants in the VL contain variant amino acids in the CDR1 and CDR3 regions. In some embodiments, at least two amino acid variants in the VL contain variant amino acids in the CDR2 and CDR3 regions. In some embodiments, at least three amino acid variants in the VL contain variant amino acids in a single CDR region. In some embodiments, at least three amino acid variants in the VL contain variant amino acids in the CDR1 region. In some embodiments, at least three amino acid variants in the VL contain variant amino acids in the CDR2 region. In some embodiments, at least three amino acid variants in the VL contain variant amino acids in the CDR3 region. In some embodiments, at least three amino acid variants in the VL contain variant amino acids in the CDR1 and CDR2 regions.In some embodiments, at least three amino acid variants in the VL include variant amino acids in the CDR1 and CDR3 regions. In some embodiments, at least three amino acid variants in the VL include variant amino acids in the CDR2 and CDR3 regions. In some embodiments, at least three amino acid variants in the VL include variant amino acids in the CDR1, CDR2, and CDR3 regions. In some embodiments, at least four amino acid variants in the VL include variant amino acids in a single CDR region. In some embodiments, at least four amino acid variants in the VL include variant amino acids in the CDR1 region. In some embodiments, at least four amino acid variants in the VL include variant amino acids in the CDR2 region. In some embodiments, at least four amino acid variants in the VL include variant amino acids in the CDR3 region. In some embodiments, at least four amino acid variants in the VL include variant amino acids in the CDR1 and CDR2 regions. In some embodiments, at least four amino acid variants in the VL include variant amino acids in the CDR1 and CDR3 regions. In some embodiments, at least four amino acid variants in the VL include variant amino acids in the CDR2 and CDR3 regions. In some embodiments, at least four amino acid variants in the VL include variant amino acids in the CDR1, CDR2, and CDR3 regions. In some embodiments, when five amino acid variants are present in the VL, the variant position includes a variant amino acid in a single CDR region. In some embodiments, when five amino acid variants are present in the VL, the variant position includes an amino acid in the CDR1 region. In some embodiments, when five amino acid variants are present in the VL, the variant position includes a variant amino acid in the CDR2 region. In some embodiments, when five amino acid variants are present in the VL, the variant position includes a variant amino acid in the CDR3 region. In some embodiments, when five amino acid variants are present in the VL, the variant position includes a variant amino acid in the CDR1 and CDR2 regions.In some embodiments, when five amino acid variants are present in the VL, the variant position includes the variant amino acid in the CDR1 and CDR3 regions. In some embodiments, when five amino acid variants are present in the VL, the variant position includes the variant amino acid in the CDR2 and CDR3 regions. In some embodiments, when five amino acid variants are present in the VL, the variant position includes the variant amino acid in the CDR1, CDR2, and CDR3 regions. In some embodiments, when six amino acid variants are present in the VL, the variant position includes the variant amino acid in a single CDR region. In some embodiments, when six amino acid variants are present in the VL, the variant position includes the amino acid in the CDR1 region. In some embodiments, when six amino acid variants are present in the VL, the variant position includes the variant amino acid in the CDR2 region. In some embodiments, when six amino acid variants are present in the VL, the variant position includes the variant amino acid in the CDR3 region. In some embodiments, when six amino acid variants are present in the VL, the variant position includes variant amino acids in the CDR1 and CDR2 regions. In some embodiments, when six amino acid variants are present in the VL, the variant position includes variant amino acids in the CDR1 and CDR3 regions. In some embodiments, when six amino acid variants are present in the VL, the variant position includes variant amino acids in the CDR2 and CDR3 regions. In some embodiments, when six amino acid variants are present in the VL, the variant position includes variant amino acids in the CDR1, CDR2, and CDR3 regions. In some embodiments, when seven or more amino acid variants are present in the VL, the variant position includes variant amino acids in a single CDR region. In some embodiments, when seven or more amino acid variants are present in the VL, the variant position includes amino acids in the CDR1 region. In some embodiments, when seven or more amino acid variants are present in the VL, the variant position includes variant amino acids in the CDR2 region.In some embodiments, when seven or more amino acid variants are present in the VL, the variant position includes the variant amino acid in the CDR3 region. In some embodiments, when seven or more amino acid variants are present in the VL, the variant position includes the variant amino acid in the CDR1 and CDR2 regions. In some embodiments, when seven or more amino acid variants are present in the VL, the variant position includes the variant amino acid in the CDR1 and CDR3 regions. In some embodiments, when seven or more amino acid variants are present in the VL, the variant position includes the variant amino acid in the CDR2 and CDR3 regions. In some embodiments, when seven or more amino acid variants are present in the VL, the variant position includes the variant amino acid in the CDR1, CDR2, and CDR3 regions.

[0181] In some embodiments, an amino acid variant includes the substitution of one amino acid residue with another. In some embodiments, an amino acid variant includes the substitution of a hydrophobic residue with a non-hydrophobic residue. In some embodiments, an amino acid variant includes the substitution of a charged residue with an uncharged residue. In some embodiments, an amino acid variant includes a neutral substitution in which the substituted amino acid has similar properties. In some embodiments, an amino acid variant includes the substitution of an aromatic residue with a non-aromatic residue. In some embodiments, a natural aromatic amino acid such as Trp, Tyr, and Phe is substituted with a synthetic non-natural acid such as phenylglycine, TIC, naphthyrellanine (Nol), a cyclic methylated derivative of Phe, a halogenated derivative of Phe, or o-methyl-Tyr. In some embodiments, variant substitution includes substituting a modified amino acid or a non-amino acid monomer (e.g., fatty acid, complex carbohydrate, etc.). Those skilled in the art will understand that the selection of amino acid residues at each variant position may affect the 3D structure of VH, VL, and / or combinations thereof in certain embodiments, but the selection of amino acid residues at each variant position is considered independently.

[0182] In some embodiments, “amino acid” or “amino acid residue” or “residue” is understood to include 20 naturally occurring, encoded amino acid residues, and those amino acids that are often post-translationally modified in vivo, such as hydroxyproline, phosphoserine, and phosphothreonine, as well as other non-ordinary amino acids, including but not limited to 2-aminoadipic acid, hydroxylysine, isodosmosine, norvaline, norleucine, and ornithine. In some embodiments, “amino acid” includes both D-amino acids and L-amino acids. In some embodiments, the amino acid variant substitution is a D-amino acid. In some embodiments, the amino acid variant substitution is an L-amino acid. In some embodiments, the variant residue includes a naturally occurring amino acid. In some embodiments, the variant residue includes a naturally occurring, encoded amino acid residue. In some embodiments, the variant residue includes a naturally occurring, unencoded amino acid residue. In some embodiments, the variant residue includes an amino acid that does not exist naturally.

[0183] In some embodiments, the variant residues include non-proteinogenic amino acids that do not exist in nature.

[0184] In some embodiments, the amino acid sequence of the VH domain of the double-conjugated antibody is selected, non-limitingly, from the sequences described in any of SEQ ID NOs: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, and 54. In some embodiments, the isolated double-conjugated antibody includes a heavy chain variable region containing the amino acid sequence described in any of SEQ ID NOs: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, and 54, as well as an optional variable light chain region. In some embodiments, the isolated double-conjugated antibody includes a heavy chain variable region containing the amino acid sequence described in SEQ ID NO: 4 and an optional variable light chain region. In some embodiments, the isolated double-conjugated antibody includes a heavy chain variable region containing the amino acid sequence described in SEQ ID NO: 6 and an optional variable light chain region. In some embodiments, the isolated double-conjugated antibody includes a heavy chain variable region containing the amino acid sequence described in SEQ ID NO: 8 and an optional variable light chain region. In some embodiments, the isolated double-conjugated antibody includes a heavy chain variable region containing the amino acid sequence described in SEQ ID NO: 10 and an optional variable light chain region. In some embodiments, the isolated double-conjugated antibody includes a heavy chain variable region containing the amino acid sequence described in SEQ ID NO: 12 and an optional variable light chain region. In some embodiments, the isolated double-conjugated antibody includes a heavy chain variable region containing the amino acid sequence described in SEQ ID NO: 14 and an optional variable light chain region. In some embodiments, the isolated double-conjugated antibody includes a heavy chain variable region containing the amino acid sequence described in SEQ ID NO: 16 and an optional variable light chain region. In some embodiments, the isolated double-conjugated antibody includes a heavy chain variable region containing the amino acid sequence described in SEQ ID NO: 18 and an optional variable light chain region. In some embodiments, the isolated double-conjugated antibody includes a heavy chain variable region containing the amino acid sequence described in SEQ ID NO: 20 and an optional variable light chain region. In some embodiments, the isolated double-conjugated antibody includes a heavy chain variable region containing the amino acid sequence described in SEQ ID NO: 22 and an optional variable light chain region. In some embodiments, the isolated double-conjugated antibody includes a heavy chain variable region containing the amino acid sequence described in SEQ ID NO: 24 and an optional variable light chain region.In some embodiments, the isolated double-conjugated antibody includes a heavy chain variable region containing the amino acid sequence described in SEQ ID NO: 26 and an optional variable light chain region. In some embodiments, the isolated double-conjugated antibody includes a heavy chain variable region containing the amino acid sequence described in SEQ ID NO: 28 and an optional variable light chain region. In some embodiments, the isolated double-conjugated antibody includes a heavy chain variable region containing the amino acid sequence described in SEQ ID NO: 30 and an optional variable light chain region. In some embodiments, the isolated double-conjugated antibody includes a heavy chain variable region containing the amino acid sequence described in SEQ ID NO: 32 and an optional variable light chain region. In some embodiments, the isolated double-conjugated antibody includes a heavy chain variable region containing the amino acid sequence described in SEQ ID NO: 34 and an optional variable light chain region. In some embodiments, the isolated double-conjugated antibody includes a heavy chain variable region containing the amino acid sequence described in SEQ ID NO: 36 and an optional variable light chain region. In some embodiments, the isolated double-conjugated antibody includes a heavy chain variable region containing the amino acid sequence described in SEQ ID NO: 38 and an optional variable light chain region. In some embodiments, the isolated double-conjugated antibody includes a heavy chain variable region containing the amino acid sequence described in SEQ ID NO: 40 and an optional variable light chain region. In some embodiments, the isolated double-conjugated antibody includes a heavy chain variable region containing the amino acid sequence described in SEQ ID NO: 42 and an optional variable light chain region. In some embodiments, the isolated double-conjugated antibody includes a heavy chain variable region containing the amino acid sequence described in SEQ ID NO: 44 and an optional variable light chain region. In some embodiments, the isolated double-conjugated antibody includes a heavy chain variable region containing the amino acid sequence described in SEQ ID NO: 46 and an optional variable light chain region. In some embodiments, the isolated double-conjugated antibody includes a heavy chain variable region containing the amino acid sequence described in SEQ ID NO: 48 and an optional variable light chain region. In some embodiments, the isolated double-conjugated antibody includes a heavy chain variable region containing the amino acid sequence described in SEQ ID NO: 50 and an optional variable light chain region. In some embodiments, the isolated double-conjugated antibody includes a heavy chain variable region containing the amino acid sequence described in SEQ ID NO: 52 and an optional variable light chain region. In some embodiments, the isolated double-conjugated antibody includes a heavy chain variable region containing the amino acid sequence described in SEQ ID NO: 54 and an optional variable light chain region.

[0185] In some embodiments, the amino acid sequence of the VH domain of the double-conjugated antibody is one of those listed in Table 1 or Table 10. In some embodiments, the isolated double-conjugated antibody includes a heavy chain variable region containing one of the amino acid sequences listed in Table 1 or Table 10, and an optional variable light chain region.

[0186] In some embodiments, the amino acid sequence of the VL domain of the double-conjugated antibody is selected, non-limitingly, from the sequences described in SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, and 53. In some embodiments, the isolated double-conjugated antibody includes a light chain variable region containing an amino acid sequence described in any of SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, and 53, as well as an optional variable heavy chain region. In some embodiments, the isolated double-conjugated antibody includes a light chain variable region containing an amino acid sequence described in SEQ ID NO: 3, and an optional variable heavy chain region. In some embodiments, the isolated double-conjugated antibody includes a light chain variable region containing the amino acid sequence described in SEQ ID NO: 5, and an optional variable heavy chain region. In some embodiments, the isolated double-conjugated antibody includes a light chain variable region containing the amino acid sequence described in SEQ ID NO: 7, and an optional variable heavy chain region. In some embodiments, the isolated double-conjugated antibody includes a light chain variable region containing the amino acid sequence described in SEQ ID NO: 9, and an optional variable heavy chain region. In some embodiments, the isolated double-conjugated antibody includes a light chain variable region containing the amino acid sequence described in SEQ ID NO: 11, and an optional variable heavy chain region. In some embodiments, the isolated double-conjugated antibody includes a light chain variable region containing the amino acid sequence described in SEQ ID NO: 13, and an optional variable heavy chain region. In some embodiments, the isolated double-conjugated antibody includes a light chain variable region containing the amino acid sequence described in SEQ ID NO: 15, and an optional variable heavy chain region. In some embodiments, the isolated double-conjugated antibody includes a light chain variable region containing the amino acid sequence described in SEQ ID NO: 17, and an optional variable heavy chain region. In some embodiments, the isolated double-conjugated antibody includes a light chain variable region containing the amino acid sequence described in SEQ ID NO: 19, and an optional variable heavy chain region. In some embodiments, the isolated double-conjugated antibody includes a light chain variable region containing the amino acid sequence described in SEQ ID NO: 21, and an optional variable heavy chain region. In some embodiments, the isolated double-conjugated antibody includes a light chain variable region containing the amino acid sequence described in SEQ ID NO: 23, and an optional variable heavy chain region.In some embodiments, the isolated double-conjugated antibody includes a light chain variable region containing the amino acid sequence described in SEQ ID NO: 25, and an optional variable heavy chain region. In some embodiments, the isolated double-conjugated antibody includes a light chain variable region containing the amino acid sequence described in SEQ ID NO: 27, and an optional variable heavy chain region. In some embodiments, the isolated double-conjugated antibody includes a light chain variable region containing the amino acid sequence described in SEQ ID NO: 29, and an optional variable heavy chain region. In some embodiments, the isolated double-conjugated antibody includes a light chain variable region containing the amino acid sequence described in SEQ ID NO: 31, and an optional variable heavy chain region. In some embodiments, the isolated double-conjugated antibody includes a light chain variable region containing the amino acid sequence described in SEQ ID NO: 33, and an optional variable heavy chain region. In some embodiments, the isolated double-conjugated antibody includes a light chain variable region containing the amino acid sequence described in SEQ ID NO: 35, and an optional variable heavy chain region. In some embodiments, the isolated double-conjugated antibody includes a light chain variable region containing the amino acid sequence described in SEQ ID NO: 37, and an optional variable heavy chain region. In some embodiments, the isolated double-conjugated antibody includes a light chain variable region containing the amino acid sequence described in SEQ ID NO: 39, and an optional variable heavy chain region. In some embodiments, the isolated double-conjugated antibody includes a light chain variable region containing the amino acid sequence described in SEQ ID NO: 42, and an optional variable heavy chain region. In some embodiments, the isolated double-conjugated antibody includes a light chain variable region containing the amino acid sequence described in SEQ ID NO: 43, and an optional variable heavy chain region. In some embodiments, the isolated double-conjugated antibody includes a light chain variable region containing the amino acid sequence described in SEQ ID NO: 45, and an optional variable heavy chain region. In some embodiments, the isolated double-conjugated antibody includes a light chain variable region containing the amino acid sequence described in SEQ ID NO: 47, and an optional variable heavy chain region. In some embodiments, the isolated double-conjugated antibody includes a light chain variable region containing the amino acid sequence described in SEQ ID NO: 49, and an optional variable heavy chain region. In some embodiments, the isolated double-conjugated antibody includes a light chain variable region containing the amino acid sequence described in SEQ ID NO: 51, and an optional variable heavy chain region. In some embodiments, the isolated double-conjugated antibody includes a light chain variable region containing the amino acid sequence described in SEQ ID NO: 53, and an optional variable heavy chain region.

[0187] In some embodiments, the amino acid sequence of the VL domain of the double-conjugated antibody is one of those listed in Table 1 or Table 10. In some embodiments, the isolated double-conjugated antibody includes a light chain variable region containing one of the amino acid sequences listed in Table 1 or Table 10, and an optional variable heavy chain region.

[0188] Those skilled in the art will recognize that when a VH domain or VL domain containing a known amino acid sequence is paired with a VL domain or VH domain, respectively, to include an antigen-binding region, such pairing can be analyzed for binding properties using methods well known in the art (see, for example, the disclosure herein and the following examples).

[0189] In some embodiments, the amino acid sequence of the heavy chain variable region-light chain variable region pair is selected, without limitation, from the pair sequences described in SEQ ID NOs: 4 and 3, SEQ ID NOs: 6 and 5, SEQ ID NOs: 8 and 7, SEQ ID NOs: 10 and 9, SEQ ID NOs: 12 and 11, SEQ ID NOs: 14 and 13, SEQ ID NOs: 16 and 15, SEQ ID NOs: 18 and 17, SEQ ID NOs: 20 and 19, SEQ ID NOs: 22 and 21, SEQ ID NOs: 24 and 23, SEQ ID NOs: 26 and 25, SEQ ID NOs: 28 and 27, SEQ ID NOs: 30 and 29, SEQ ID NOs: 32 and 31, SEQ ID NOs: 34 and 33, SEQ ID NOs: 36 and 35, SEQ ID NOs: 38 and 37, SEQ ID NOs: 40 and 39, SEQ ID NOs: 42 and 41, SEQ ID NOs: 44 and 43, SEQ ID NOs: 46 and 45, SEQ ID NOs: 48 and 47, SEQ ID NOs: 50 and 49, SEQ ID NOs: 52 and 51, and SEQ ID NOs: 54 and 53. In some embodiments, the isolated double-conjugated antibody includes a heavy chain variable region-light chain variable region pair selected from the pair sequences described in SEQ ID NOs: 4 and 3. In some embodiments, the isolated double-conjugated antibody includes a heavy chain variable region-light chain variable region pair selected from the pair sequences described in SEQ ID NOs. 6 and 5. In some embodiments, the isolated double-conjugated antibody includes a heavy chain variable region-light chain variable region pair selected from the pair sequences described in SEQ ID NOs. 8 and 7. In some embodiments, the isolated double-conjugated antibody includes a heavy chain variable region-light chain variable region pair selected from the pair sequences described in SEQ ID NOs. 10 and 9. In some embodiments, the isolated double-conjugated antibody includes a heavy chain variable region-light chain variable region pair selected from the pair sequences described in SEQ ID NOs. 12 and 11. In some embodiments, the isolated double-conjugated antibody includes a heavy chain variable region-light chain variable region pair selected from the pair sequences described in SEQ ID NOs. 14 and 13. In some embodiments, the isolated double-conjugated antibody includes a heavy chain variable region-light chain variable region pair selected from the pair sequences described in SEQ ID NOs. 16 and 15. In some embodiments, the isolated double-conjugated antibody includes a heavy chain variable region-light chain variable region pair selected from the pair sequences described in SEQ ID NOs. 18 and 17. In some embodiments, the isolated double-conjugated antibody comprises a heavy-chain variable region-light-chain variable region pair selected from the pair sequences described in SEQ ID NOs. 20 and 19.In some embodiments, the isolated double-conjugated antibody includes a heavy chain variable region-light chain variable region pair selected from the pair sequences described in SEQ ID NOs. 22 and 21. In some embodiments, the isolated double-conjugated antibody includes a heavy chain variable region-light chain variable region pair selected from the pair sequences described in SEQ ID NOs. 24 and 23. In some embodiments, the isolated double-conjugated antibody includes a heavy chain variable region-light chain variable region pair selected from the pair sequences described in SEQ ID NOs. 26 and 25. In some embodiments, the isolated double-conjugated antibody includes a heavy chain variable region-light chain variable region pair selected from the pair sequences described in SEQ ID NOs. 28 and 27. In some embodiments, the isolated double-conjugated antibody includes a heavy chain variable region-light chain variable region pair selected from the pair sequences described in SEQ ID NOs. 30 and 29. In some embodiments, the isolated double-conjugated antibody includes a heavy chain variable region-light chain variable region pair selected from the pair sequences described in SEQ ID NOs. 32 and 31. In some embodiments, the isolated double-conjugated antibody includes a heavy chain variable region-light chain variable region pair selected from the pair sequences described in SEQ ID NOs. 34 and 33. In some embodiments, the isolated double-conjugated antibody includes a heavy chain variable region-light chain variable region pair selected from the paired sequences described in SEQ ID NOs. 36 and 35. In some embodiments, the isolated double-conjugated antibody includes a heavy chain variable region-light chain variable region pair selected from the paired sequences described in SEQ ID NOs. 38 and 37. In some embodiments, the isolated double-conjugated antibody includes a heavy chain variable region-light chain variable region pair selected from the paired sequences described in SEQ ID NOs. 40 and 39. In some embodiments, the isolated double-conjugated antibody includes a heavy chain variable region-light chain variable region pair selected from the paired sequences described in SEQ ID NOs. 42 and 41. In some embodiments, the isolated double-conjugated antibody includes a heavy chain variable region-light chain variable region pair selected from the paired sequences described in SEQ ID NOs. 44 and 43. In some embodiments, the isolated double-conjugated antibody includes a heavy chain variable region-light chain variable region pair selected from the paired sequences described in SEQ ID NOs. 46 and 45. In some embodiments, the isolated double-conjugated antibody includes a heavy chain variable region-light chain variable region pair selected from the paired sequences described in SEQ ID NOs. 48 and 47. In some embodiments, the isolated double-conjugated antibody comprises a heavy-chain variable region-light-chain variable region pair selected from the pair sequences described in SEQ ID NOs. 50 and 49.In some embodiments, the isolated double-conjugated antibody comprises a heavy-chain variable region-light-chain variable region pair selected from the pair sequences described in SEQ ID NOs. 52 and 51. In some embodiments, the isolated double-conjugated antibody comprises a heavy-chain variable region-light-chain variable region pair selected from the pair sequences described in SEQ ID NOs. 54 and 53.

[0190] In some embodiments, the amino acid sequence of the heavy chain variable region-light chain variable region pair is selected from any of the following pair sequences: SEQ ID NOs: 209 and 210, 211 and 212, 213 and 214, 215 and 216, 217 and 218, 219 and 220, 221 and 222, 223 and 224, 225 and 226, 227 and 228, 229 and 230, 231 and 232, 233 and 234, 235 Sequence IDs 236, Sequence IDs 237 and 238, Sequence IDs 239 and 240, Sequence IDs 241 and 242, Sequence IDs 243 and 244, Sequence IDs 245 and 246, Sequence IDs 247 and 248, Sequence IDs 249 and 250, Sequence IDs 251 and 252, Sequence IDs 253 and 254, Sequence IDs 255 and 256, Sequence IDs 257 and 258, Sequence IDs 259 and 260, Sequence IDs 261 and 262, Sequence IDs 263 and 264, Sequence IDs 265 and 266, Sequence IDs 267 and 268, Sequence IDs 269 and 270, Sequence ID 2 71 and 272, SEQ ID NOs. 273 and 274, SEQ ID NOs. 275 and 276, SEQ ID NOs. 277 and 278, SEQ ID NOs. 279 and 280, SEQ ID NOs. 281 and 282, SEQ ID NOs. 283 and 284, SEQ ID NOs. 285 and 286, SEQ ID NOs. 287 and 288, SEQ ID NOs. 289 and 290, SEQ ID NOs. 291 and 292, SEQ ID NOs. 293 and 294, SEQ ID NOs. 295 and 296, SEQ ID NOs. 297 and 298, SEQ ID NOs. 299 and 300, SEQ ID NOs. 301 and 302, SEQ ID NOs. 303 and 304, SEQ ID NOs. 305 and 306, sequence Numbers 307 and 308, Sequence IDs 309 and 310, Sequence IDs 311 and 312, Sequence IDs 313 and 314, Sequence IDs 315 and 316, Sequence IDs 317 and 318, Sequence IDs 319 and 320, Sequence IDs 321 and 322, Sequence IDs 323 and 324, Sequence IDs 325 and 326, Sequence IDs 327 and 328, Sequence IDs 329 and 330, Sequence IDs 331 and 332, Sequence IDs 333 and 334, Sequence IDs 335 and 336, Sequence IDs 337 and 338, Sequence IDs 339 and 340, Sequence IDs 341 and 342,Sequence IDs 343 and 344, 345 and 346, 347 and 348.

[0191] In some embodiments, the amino acid sequence of the scFv fragment includes, but is not limited to, a pair of sequences described in any of the following sequences: SEQ ID NOs: 4 and 3, 6 and 5, 8 and 7, 10 and 9, 12 and 11, 14 and 13, 16 and 15, 18 and 17, 20 and 19, 22 and 21, 24 and 23, 26 and 25, 28 and 27, 30 and 29, 32 and 31, 34 and 33, 36 and 35, 38 and 37, 40 and 39, 42 and 41, 44 and 43, 46 and 45, 48 and 47, 50 and 49, 52 and 51, and 54 and 53.

[0192] Manipulated “re-epitope” VH domain, VL domain, or nucleotide sequences encoding both the VH and VL domains, as well as vectors and host cells containing these nucleotide sequences. This disclosure provides double-conjugated antibodies comprising a VH domain, a VL domain, or both a VH domain and a VL domain, each comprising a variant amino acid sequence compared to the template VH and VL sequences of SEQ ID NO: 1 and SEQ ID NO: 2, respectively. As described in detail above, in some embodiments, the double-conjugated antibody comprises a heavy chain variable region including the amino acid sequence described in SEQ ID NO: 1, having at least one amino acid variant at any of the positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or any combination thereof), 26, 27, 31, 51, 56, 77, The total number of variant positions in the encoded heavy chain variable region, encoded light chain variable region, or combination thereof is at least 2, and includes an amino acid sequence described in Sequence ID No. 2 having at least one amino acid variant at position 92, 93, or 96, or any combination thereof (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or any combination thereof), or a combination of the heavy chain variable region described in (a) and the light chain variable region described in (b).

[0193] In some embodiments, a nucleic acid construct comprising a nucleic acid sequence encodes an isolated double-conjugated antibody comprising an antigen-binding domain site of the antibody including a VH domain and a VL domain, wherein the VH domain includes the set of CDR, HCDR1, HCDR2, and HCDR3 disclosed herein. In some embodiments, the amino acid sequence of HCDR1 is described in SEQ ID NO: 136, the amino acid sequence of HCDR2 is described as I HX1 YDGSNK (SEQ ID NO: 142) (where HX1 is any amino acid), and the amino acid sequence of HCDR3 is described as AR HX2 HX3 HX4 HX5 HX6 HX7 HX8 HX9 HX10 HX11 FD HX12 (SEQ ID NO: 143) (where XH2, HX3, HX4, HX5, HX6, HX7, HX8, HX9, HX10, HX11, and HX12 are any amino acids).

[0194] In some embodiments, the nucleic acid construct comprising the nucleic acid sequence encodes the VH domain of a double-conjugated antibody comprising HCDR1 (SEQ ID NO: 136), HCDR2 (SEQ ID NO: 142), and HCDR3 (SEQ ID NO: 143), wherein the VH domain contains a variant amino acid in at least one of HX1, HX2, HX3, HX4, HX5, HX6, HX7, HX8, HX9, HX10, HX11, and HX12.

[0195] In some embodiments, the nucleic acid construct, which includes nucleic acid sequences, encodes the VH domain of a double-conjugated antibody comprising HCDR1 (SEQ ID NO: 136), HCDR2 (SEQ ID NO: 137) (where HX1 is selected from the group consisting of W and S), and HCDR3 (SEQ ID NO: 138) (where HX2 is selected from the group consisting of A and S, HX3 is P, HX4 is Q, HX5 is W, HX6 is selected from the group consisting of E, Q, M, L, and V, HX7 is selected from the group consisting of L, W, and Y, HX8 is selected from the group consisting of V and T, HX9 is selected from the group consisting of H, A, and S, HX10 is E, HX11 is A, and HX12 is selected from the group consisting of I, L, and M). In a particular embodiment, the nucleic acid construct comprising the nucleic acid sequence encodes a double-conjugated antibody comprising variant amino acids including HCDR1 (SEQ ID NO: 136) and HCDR2 (SEQ ID NO: 137) (where HX1 is W, HX2 is selected from the group consisting of A and S, HX3 is P, HX4 is Q, HX5 is W, HX6 is selected from the group consisting of E and M, HX7 is selected from the group consisting of L and W, HX8 is selected from the group consisting of V and T, HX9 is selected from the group consisting of H and A, HX10 is E, HX11 is A, and HX12 is selected from the group consisting of I and L).

[0196] In some embodiments, the nucleic acid constructs comprising nucleic acid sequences are HCDR1 (SEQ ID NO: 136), HCDR2 (SEQ ID NO: 137) (where HX1 is W), and HCDR3 (SEQ ID NO: 138) (where HX2 is A, HX3 is P, HX4 is Q, HX5 is W, HX6 is E, HX7 is L, HX8 is T, HX9 is A, HX10 is E, HX11 is A, and HX12 is I), or HCDR1 (SEQ ID NO: 136), HCDR2 (SEQ ID NO: 137) (where HX1 is W), and HCDR3 (SEQ ID NO: 138) (where HX2 is A, HX3 is P, and HX4 The encoding of a double-conjugated antibody containing a VH domain, where HX1 is Q, HX5 is W, HX6 is M, HX7 is L, HX8 is V, HX9 is A, HX10 is E, HX11 is A, and HX12 is L, or HCDR1 (SEQ ID NO: 136), HCDR2 (SEQ ID NO: 137) (where HX1 is W), and HCDR3 (SEQ ID NO: 138) (where HX2 is S, HX3 is P, HX4 is Q, HX5 is W, HX6 is E, HX7 is W, HX8 is V, HX9 is H, HX10 is E, HX11 is A, and HX12 is L).

[0197] In some embodiments, a nucleic acid construct comprising a nucleic acid sequence encodes an isolated double-conjugated antibody comprising an antigen-binding domain site of the antibody comprising a VH domain and a VL domain, wherein the VL domain comprises a set of CDR, LCDR1, LCDR2, and LCDR3, the amino acid sequence of LCDR1 is described as LX1, LX2, GSK LX3 V (SEQ ID NO: 144) (where LX1, LX2, and LX3 are any amino acids), the amino acid sequence of LCDR2 is described as DD LX4 (SEQ ID NO: 145) (where LX4 is any amino acid), and the amino acid sequence of LCDR3 is described as QVWD LX5 LX6 SD LX7 VV (SEQ ID NO: 146) (where LX5, LX6, and LX7 are any amino acids).

[0198] In some embodiments, a nucleic acid construct comprising a nucleic acid sequence encodes the VL domain of a double-conjugated antibody containing an LCDR. In some embodiments, a nucleic acid construct comprising a nucleic acid sequence encodes an isolated double-conjugated antibody containing an antigen-binding domain site of an antibody containing a VH domain and a VL domain, wherein the VL domain comprises a set of CDRs, LCDR1, LCDR2, and LCDR3 disclosed in Table 9 or Table 5. In some embodiments, the amino acid sequence of LCDR1 is described in SEQ ID NO: 139, LX1 is selected from the group consisting of N, L, and I, LX2 is selected from the group consisting of L and I, LX3 is selected from the group consisting of S and L, the amino acid sequence of LCDR2 is described in SEQ ID NO: 140, LX4 is selected from the group consisting of S and G, the amino acid sequence of LCDR3 is described in SEQ ID NO: 141, LX5 is selected from the group consisting of S and T, LX6 is selected from the group consisting of S and G, and LX7 is selected from the group consisting of H and G. In a particular embodiment, the nucleic acid construct comprising the nucleic acid sequence encodes an isolated double-conjugated antibody comprising a variant amino acid, such as LCDR1 (SEQ ID NO: 139) (where LX1 is L, LX2 is I, and LX3 is L), LCDR2 (SEQ ID NO: 140) (where LX4 is selected from the group consisting of S and G), and LCDR3 (SEQ ID NO: 141) (where LX5 is S, LX6 is S, and LX7 is selected from the group consisting of H and G).

[0199] In some embodiments, the nucleic acid construct comprising nucleic acid sequences is LCDR1 (SEQ ID NO: 139) (where LX1 is L, LX2 is I, and LX3 is L), LCDR2 (SEQ ID NO: 140) (where LX4 is S), and LCDR3 (SEQ ID NO: 141) (where LX5 is S, LX6 is S, and LX7 is G), or LCDR1 (SEQ ID NO: 139) (where LX1 is L, LX2 is I, and LX3 is L), LCDR2 (SEQ ID NO: 140) ( Here, LX4 is S), and LCDR3 (SEQ ID NO: 141) (where LX5 is S, LX6 is S, and LX7 is H), or LCDR1 (SEQ ID NO: 139) (where LX1 is L, LX2 is I, and LX3 is L), LCDR2 (SEQ ID NO: 140) (where LX4 is G), and LCDR3 (SEQ ID NO: 141) (where LX5 is S, LX6 is S, and LX7 is G) encodes a VL domain double-conjugated antibody.

[0200] In some embodiments, a nucleic acid construct comprising a nucleic acid sequence encodes an isolated double-conjugated antibody comprising an antigen-binding domain site of an antibody including a VH domain and a VL domain, comprising the combination of the VH domain HCDR and the VL domain LCDR described above. For example, non-limitingly, in certain embodiments, a nucleic acid construct comprising a nucleic acid sequence encodes a VH domain comprising the set CDR, HCDR1, HCDR2, and HCDR3, where the amino acid sequence of HCDR1 is described in SEQ ID NO: 136, the amino acid sequence of HCDR2 is described as I HX1 YDGSNK (SEQ ID NO: 142) (where HX1 is any amino acid), and the amino acid sequence of HCDR3 is AR HX2 HX3 HX4 HX5 HX6 HX7 HX8 HX9 HX10 HX11 FD The VL domain is described as HX12 (SEQ ID NO: 143) (where XH2, HX3, HX4, HX5, HX6, HX7, HX8, HX9, HX10, HX11, and HX12 are any amino acids), and the VL domain includes a set of CDR, LCDR1, LCDR2, and LCDR3, the amino acid sequence of LCDR1 is described as LX1, LX2, GSK LX3 V (SEQ ID NO: 144) (where LX1, LX2, and LX3 are any amino acids), the amino acid sequence of LCDR2 is described as DD LX4 (SEQ ID NO: 145) (where LX4 is any amino acid), and the amino acid sequence of LCD3 is described as QVWD LX5 LX6 SD LX7 VV (SEQ ID NO: 146) (where LX5, LX6, and LX7 are any amino acids).

[0201] In some embodiments, the nucleic acid construct comprising nucleic acid sequences encodes a VH domain comprising a set of CDR, HCDR1, HCDR2, and HCDR3, where the amino acid sequence of HCDR1 is described in SEQ ID NO: 136, the amino acid sequence of HCDR2 is described in SEQ ID NO: 137, HX1 is selected from the group consisting of W and S, the amino acid sequence of HCDR3 is described in SEQ ID NO: 138, HX2 is selected from the group consisting of A and S, HX3 is P, HX4 is Q, HX5 is W, HX6 is selected from the group consisting of E, Q, M, L, and V, HX7 is selected from the group consisting of L, W, and Y, HX8 is selected from the group consisting of V and T, and HX9 is selected from the group consisting of H, A, and S. 0 is E, HX11 is A, HX12 is selected from the group consisting of I, L, and M, the VL domain includes the set CDR, HCDR1, HCDR2, and HCDR3, the amino acid sequence of LCDR1 is described in SEQ ID NO: 139, LX1 is selected from the group consisting of N, L, and I, LX2 is selected from the group consisting of L and I, LX3 is selected from the group consisting of S and L, the amino acid sequence of LCDR2 is described in SEQ ID NO: 140, LX4 is selected from the group consisting of S and G, the amino acid sequence of LCDR3 is described in SEQ ID NO: 141, LX5 is selected from the group consisting of S and T, LX6 is selected from the group consisting of S and G, and LX7 is selected from the group consisting of H and G.

[0202] In a particular embodiment, a nucleic acid construct comprising a nucleic acid sequence encodes an isolated double-conjugated antibody comprising a VH domain including a set of CDR, HCDR1, HCDR2, and HCDR3, where the amino acid sequence of HCDR1 is described in SEQ ID NO: 136, the amino acid sequence of HCDR2 is described in SEQ ID NO: 137, HX1 is W, the amino acid sequence of HCDR3 is described in SEQ ID NO: 138, HX2 is selected from the group consisting of A and S, HX3 is P, HX4 is Q, HX5 is W, HX6 is selected from the group consisting of E and M, HX7 is selected from the group consisting of L and W, and HX8 is selected from the group consisting of V and T. Selected, HX9 is selected from the group consisting of H and A, HX10 is E, HX11 is A, HX12 is selected from the group consisting of I and L and includes a VL domain containing the set CDR, LCDR1, LCDR2, and LCDR3, the amino acid sequence of LCDR1 is described in SEQ ID NO: 139, LX1 is L, LX2 is I, LX3 is L, the amino acid sequence of LCDR2 is described in SEQ ID NO: 140, LX4 is selected from the group consisting of S and G, the amino acid sequence of LCDR3 is described in SEQ ID NO: 141, LX5 is S, LX6 is S, and LX7 is selected from the group consisting of H and G.

[0203] In some embodiments, the nucleic acid construct comprising the nucleic acid sequence encodes a re-epitope double-conjugated antibody comprising a VH domain containing a set of CDRs, HCDR1, HCDR2, and HCDR3, and a VL domain containing a set of CDRs, LCDR1, LCDR2, and LCDR3, wherein the amino acid sequence of each CDR is as shown in Figures 1A and 1B for the clones shown in Figures 1A and 1B, for example, not limited to,

[0204] Clone C2: HCDR1 (SEQ ID NO: 136), HCDR2 (SEQ ID NO: 137) (where HX1 is W), HCDR3 (SEQ ID NO: 138) (where HX2 is A, HX3 is P, HX4 is Q, HX5 is W, HX6 is E, HX7 is L, HX8 is T, HX9 is A, HX10 is E, HX11 is A, HX12 is I), LCDR1 (SEQ ID NO: 139) (where LX1 is L, LX2 is I, LX3 is L), LCDR2 (SEQ ID NO: 140) (where LX4 is S), and LCDR3 (SEQ ID NO: 141) (where LX5 is S, LX6 is S, LX7 is G),

[0205] Clone C6: HCDR1 (SEQ ID NO: 136), HCDR2 (SEQ ID NO: 137) (where HX1 is W), HCDR3 (SEQ ID NO: 138) (where HX2 is A, HX3 is P, HX4 is Q, HX5 is W, HX6 is M, HX7 is L, HX8 is V, HX9 is A, HX10 is E, HX11 is A, HX12 is L), LCDR1 (SEQ ID NO: 139) (where LX1 is L, LX2 is I, LX3 is L), LCDR2 (SEQ ID NO: 140) (where LX4 is S), and LCDR3 (SEQ ID NO: 141) (where LX5 is S, LX6 is S, LX7 is H); or

[0206] Clone C9 consists of HCDR1 (sequence number 136), HCDR2 (sequence number 137) (where HX1 is W), HCDR3 (sequence number 138) (where HX2 is S, HX3 is P, HX4 is Q, HX5 is W, HX6 is E, HX7 is W, HX8 is V, HX9 is H, HX10 is E, HX11 is A, and HX12 is L), LCDR1 (sequence number 139) (where LX1 is L, LX2 is I, and LX3 is L), LCDR2 (sequence number 140) (where LX4 is G), and LCDR3 (sequence number 141) (where LX5 is S, LX6 is S, and LX7 is G).

[0207] In certain embodiments, the nucleic acid construct comprises a single nucleic acid sequence. In certain embodiments, the nucleic acid construct comprises two nucleic acid sequences. In certain embodiments, the nucleic acid construct comprises a single nucleic acid sequence, and the VH domain and VL domain are encoded by the nucleic acid sequence. In certain embodiments, the nucleic acid construct comprises two nucleic acid sequences, and the VH domain is encoded by one nucleic acid sequence, and the VL domain is encoded by the other nucleic acid sequence.

[0208] The disclosures described herein provide polynucleotide sequences encoding variant VH, VL, or both the VH and VL domains as described herein. In certain embodiments, the template VH domain is encoded by the nucleotide sequence described in SEQ ID NO: 55, and the template VL domain is encoded by the nucleotide sequence described in SEQ ID NO: 56.

[0209] In some embodiments, nucleic acid constructs comprising nucleic acid sequences encoding double-conjugated antibodies are disclosed herein, wherein the antibody has at least one amino acid variant at any of the positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or any combination thereof), comprising the heavy chain variable region, 26, 27, 3 The total number of variant positions in the encoded heavy chain variable region, encoded light chain variable region, or combination thereof is at least 2, and includes an amino acid sequence described in Sequence ID No. 2 having at least one amino acid variant at any of the following positions: 1, 51, 56, 77, 92, 93, or 96, or any combination thereof (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or any combination thereof), or a combination of the heavy chain variable region described in (a) and the light chain variable region described in (b).

[0210] In some embodiments, the nucleotide construct sequence comprises two nucleic acid sequences, one encoding the variant heavy chain variable region and the other encoding the variant light chain variable region. In some embodiments, the nucleotide sequence or sequence encoding the double-conjugated antibody heavy chain variable region, light chain variable region, or both is optimized for mammalian transcription and translation.

[0211] This disclosure further provides, in certain embodiments, isolated nucleic acid constructs encoding nucleic acid sequences described herein. Exemplary polynucleotide sequences encoding variant VH and VL domains are provided in Table 2 below. Exemplary nucleic acid constructs containing nucleic acid sequences encoding variant VH domains linked to VL domains are provided in Table 3 below.

[0212] Nucleic acids include DNA and RNA. These and related embodiments may include polynucleotides encoding double-binding antibodies described herein. As used herein, the term “isolated polynucleotide” means a polynucleotide of genomic, cDNA, or synthetic origin, or some combination thereof, and by its origin, an isolated polynucleotide is either (1) unrelated to all or some polynucleotides found in nature, (2) linked to polynucleotides that are not linked in nature, or (3) not occurring in nature as part of a longer sequence.

[0213] Those skilled in the art will understand that the terms “polynucleotide” and “nucleic acid sequence” may, in some embodiments, be used interchangeably and have the same meaning and quality.

[0214] In some embodiments, the isolated nucleic acid sequences disclosed herein encode a VH domain containing the set of HCDRs disclosed throughout and in Figure 1A, a VL domain containing the set of LCDRs disclosed throughout and in Figure 1B, a VH domain containing the set of HCDRs, and a VL domain containing the set of LCDRs disclosed throughout and in Figures 1A and 1B, or a VH domain and a VL domain, or a VL domain and a VL domain of the double-conjugated antibody described in detail throughout herein.

[0215] As used herein, the term “polynucleotide” encompasses single-stranded or double-stranded nucleic acid macromolecules. In certain embodiments, nucleotides comprising a polynucleotide may be ribonucleotides or deoxyribonucleotides, or modified forms of either type of nucleotide. Such modifications include base modifications such as bromouridine, ribose modifications such as arabinosides and 2',3'-dideoxyribose, and internucleotide bond modifications such as phosphorothioates, phosphorodithioates, phosphoroselenoates, phosphorodyselerothioates, phosphoranilothioates, phosphoraniranates, and phosphoramidates. The term “polynucleotide” specifically includes single-stranded and double-stranded forms of DNA.

[0216] The term "naturally occurring nucleotides" includes deoxyribonucleotides and ribonucleotides. The term "modified nucleotides" includes nucleotides having modified or substituted sugar groups, etc. The term "oligonucleotide linkage" includes oligonucleotide linkages such as phosphorothioates, phosphorodithioates, phosphoroselenoates, phosphorodiselerothioates, phosphoranilothioates, phosphoraniranates, and phosphoramidates. For example, see LaPlanche et al., 1986, Nucl. Acids Res., 14:9081; Stec et al., 1984, J. Am. Chem. Soc., 106:6077; Stein et al., 1988, Nucl. Acids Res., 16:3209; Zon et al., 1991, Anti-Cancer Drug Design, 6:539; Zon et al., 1991, Oligonucleotides and Analogues: A Practice Approach, pp. 87-108 (F. Eckstein, Ed.), Oxford University Press, Oxford England; Stec et al., U.S. Patent No. 5,151,510; Uhlmann and Peyman, 1990, Chemical Reviews, 90:543, the disclosures thereof incorporated herein by reference for any purpose. Oligonucleotides may include detectable labels that enable the detection of oligonucleotides or their hybridizations.

[0217] In other related embodiments, the polynucleotide variant may have substantial identity with the polynucleotide template sequence, but the template sequence does not encode a double-conjugated antibody, or a fragment thereof, or a domain thereof.

[0218] In some embodiments, the polynucleotide variant contains one or more substitutions, additions, deletions, and / or insertions, thereby increasing the binding affinity of the binding domain encoded by the variant polynucleotide to a novel binding to the epitope compared to the unmodified template as specifically described herein.

[0219] In some embodiments, the nucleic acid sequence has at least one amino acid variant at any of the following positions: 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or any combination thereof), and encodes a heavy chain variable region containing the amino acid sequence described in Sequence ID No. 1. In some embodiments, the nucleic acid sequence has at least two amino acid variants at any of the following positions: 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or any combination thereof), and encodes a heavy chain variable region containing the amino acid sequence described in Sequence ID No. 1. In some embodiments, the nucleic acid sequence has at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid variants at any of the positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or any combination thereof), and encodes a heavy chain variable region containing the amino acid sequence described in Sequence ID No. 1.

[0220] In some embodiments, the nucleic acid construct includes a nucleic acid sequence encoding a heavy chain variable region, which includes a sequence selected from the sequences described in SEQ ID NOs: 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 105, and 107. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region includes the sequence described in SEQ ID NO: 57. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region includes the sequence described in SEQ ID NO: 59. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region includes the sequence described in SEQ ID NO: 61. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region includes the sequence described in SEQ ID NO: 63. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region includes the sequence described in SEQ ID NO: 65. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region includes the sequence described in SEQ ID NO: 67. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region includes the sequence described in SEQ ID NO: 69. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region includes the sequence described in SEQ ID NO: 71. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region includes the sequence described in SEQ ID NO: 73. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region includes the sequence described in SEQ ID NO: 75. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region includes the sequence described in SEQ ID NO: 77. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region includes the sequence described in SEQ ID NO: 79. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region includes the sequence described in SEQ ID NO: 81. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region includes the sequence described in SEQ ID NO: 83. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region includes the sequence described in SEQ ID NO: 85. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region includes the sequence described in SEQ ID NO: 87. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region includes the sequence described in SEQ ID NO: 89. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region includes the sequence described in SEQ ID NO: 91.In some embodiments, the nucleic acid sequence encoding the heavy chain variable region includes the sequence described in SEQ ID NO: 93. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region includes the sequence described in SEQ ID NO: 95. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region includes the sequence described in SEQ ID NO: 97. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region includes the sequence described in SEQ ID NO: 99. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region includes the sequence described in SEQ ID NO: 101. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region includes the sequence described in SEQ ID NO: 105. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region includes the sequence described in SEQ ID NO: 107.

[0221] In some embodiments, the nucleic acid construct includes a nucleic acid sequence encoding a double-conjugated antibody heavy chain variable region sequence described in any of SEQ ID NOs: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, and 54. In some embodiments, the nucleic acid sequence encodes the double-conjugated antibody heavy chain variable region sequence described in SEQ ID NO: 4. In some embodiments, the nucleic acid sequence encodes the double-conjugated antibody heavy chain variable region sequence described in SEQ ID NO: 6. In some embodiments, the nucleic acid sequence encodes the double-conjugated antibody heavy chain variable region sequence described in SEQ ID NO: 8. In some embodiments, the nucleic acid sequence encodes the double-conjugated antibody heavy chain variable region sequence described in SEQ ID NO: 10. In some embodiments, the nucleic acid sequence encodes the double-conjugated antibody heavy chain variable region sequence described in SEQ ID NO: 12. In some embodiments, the nucleic acid sequence encodes the double-conjugated antibody heavy chain variable region sequence described in SEQ ID NO: 14. In some embodiments, the nucleic acid sequence encodes the double-binding antibody heavy chain variable region sequence described in SEQ ID NO: 16. In some embodiments, the nucleic acid sequence encodes the double-binding antibody heavy chain variable region sequence described in SEQ ID NO: 18. In some embodiments, the nucleic acid sequence encodes the double-binding antibody heavy chain variable region sequence described in SEQ ID NO: 20. In some embodiments, the nucleic acid sequence encodes the double-binding antibody heavy chain variable region sequence described in SEQ ID NO: 22. In some embodiments, the nucleic acid sequence encodes the double-binding antibody heavy chain variable region sequence described in SEQ ID NO: 24. In some embodiments, the nucleic acid sequence encodes the double-binding antibody heavy chain variable region sequence described in SEQ ID NO: 26. In some embodiments, the nucleic acid sequence encodes the double-binding antibody heavy chain variable region sequence described in SEQ ID NO: 28. In some embodiments, the nucleic acid sequence encodes the double-binding antibody heavy chain variable region sequence described in SEQ ID NO: 30. In some embodiments, the nucleic acid sequence encodes the double-binding antibody heavy chain variable region sequence described in SEQ ID NO: 32. In some embodiments, the nucleic acid sequence encodes the double-binding antibody heavy chain variable region sequence described in SEQ ID NO: 34. In some embodiments, the nucleic acid sequence encodes the double-binding antibody heavy chain variable region sequence described in SEQ ID NO: 36.In some embodiments, the nucleic acid sequence encodes the double-conjugated antibody heavy chain variable region sequence described in SEQ ID NO: 38. In some embodiments, the nucleic acid sequence encodes the double-conjugated antibody heavy chain variable region sequence described in SEQ ID NO: 40. In some embodiments, the nucleic acid sequence encodes the double-conjugated antibody heavy chain variable region sequence described in SEQ ID NO: 42. In some embodiments, the nucleic acid sequence encodes the double-conjugated antibody heavy chain variable region sequence described in SEQ ID NO: 44. In some embodiments, the nucleic acid sequence encodes the double-conjugated antibody heavy chain variable region sequence described in SEQ ID NO: 46. In some embodiments, the nucleic acid sequence encodes the double-conjugated antibody heavy chain variable region sequence described in SEQ ID NO: 48. In some embodiments, the nucleic acid sequence encodes the double-conjugated antibody heavy chain variable region sequence described in SEQ ID NO: 50. In some embodiments, the nucleic acid sequence encodes the double-conjugated antibody heavy chain variable region sequence described in SEQ ID NO: 52. In some embodiments, the nucleic acid sequence encodes the double-conjugated antibody heavy chain variable region sequence described in SEQ ID NO: 54.

[0222] In some embodiments, the nucleic acid construct includes nucleic acid sequences encoding double-binding antibody heavy chain variable region sequences as listed in Table 10 or Table 1, for example, VH is sequence numbers 209, 211, 213, 215, 217, 219, 221, 223, 225, 227, 229, 231, 233, 235, 237, 239, 241, 243, 245, 247, 249, 251, 253, 255, 257, 259, 261, 263 , 265, 267, 269, 271, 273, 275, 277, 279, 281, 283, 285, 287, 289, 291, 293, 295, 297, 299, 301, 303, 305, 307, 309, 311, 313, 315, 317, 319, 321, 323, 325, 327, 329, 331, 333, 335, 337, 339, 341, 343, 345, and 347 may be included. In another embodiment, the nucleic acid construct includes a nucleic acid sequence encoding a VH that is at least 80%, 85%, 90%, 95%, 98%, or 99% identical to the VH sequences disclosed herein.

[0223] In some embodiments, the nucleic acid sequence encodes a light chain variable region containing the amino acid sequence described in Sequence ID No. 2, having at least one amino acid variant at any of the following positions: 26, 27, 31, 51, 56, 77, 92, 93, or 96, or any combination thereof (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or any combination thereof). In some embodiments, the nucleic acid sequence encodes a light chain variable region comprising the amino acid sequence described in Sequence ID No. 2, having at least one amino acid variant at any of the following positions: 26, 27, 31, 51, 56, 77, 92, 93, or 96, or any combination thereof (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or any combination thereof).

[0224] In some embodiments, the nucleic acid construct includes a nucleic acid sequence encoding a light chain variable region, which includes a sequence selected from the sequences described in SEQ ID NOs: 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, and 108. In some embodiments, the nucleic acid sequence encoding the light chain variable region includes the sequence described in SEQ ID NO: 58. In some embodiments, the nucleic acid sequence encoding the light chain variable region includes the sequence described in SEQ ID NO: 60. In some embodiments, the nucleic acid sequence encoding the light chain variable region includes the sequence described in SEQ ID NO: 62. In some embodiments, the nucleic acid sequence encoding the light chain variable region includes the sequence described in SEQ ID NO: 64. In some embodiments, the nucleic acid sequence encoding the light chain variable region includes the sequence described in SEQ ID NO: 66. In some embodiments, the nucleic acid sequence encoding the light chain variable region includes the sequence described in SEQ ID NO: 68. In some embodiments, the nucleic acid sequence encoding the light chain variable region includes the sequence described in SEQ ID NO: 70. In some embodiments, the nucleic acid sequence encoding the light chain variable region includes the sequence described in SEQ ID NO: 72. In some embodiments, the nucleic acid sequence encoding the light chain variable region includes the sequence described in SEQ ID NO: 74. In some embodiments, the nucleic acid sequence encoding the light chain variable region includes the sequence described in SEQ ID NO: 76. In some embodiments, the nucleic acid sequence encoding the light chain variable region includes the sequence described in SEQ ID NO: 78. In some embodiments, the nucleic acid sequence encoding the light chain variable region includes the sequence described in SEQ ID NO: 80. In some embodiments, the nucleic acid sequence encoding the light chain variable region includes the sequence described in SEQ ID NO: 82. In some embodiments, the nucleic acid sequence encoding the light chain variable region includes the sequence described in SEQ ID NO: 84. In some embodiments, the nucleic acid sequence encoding the light chain variable region includes the sequence described in SEQ ID NO: 86. In some embodiments, the nucleic acid sequence encoding the light chain variable region includes the sequence described in SEQ ID NO: 88. In some embodiments, the nucleic acid sequence encoding the light chain variable region includes the sequence described in SEQ ID NO: 90. In some embodiments, the nucleic acid sequence encoding the light chain variable region includes the sequence described in SEQ ID NO: 92.In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO: 94. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO: 96. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO: 98. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO: 100. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO: 102. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO: 104. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO: 106. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO: 108.

[0225] In some embodiments, the nucleic acid construct includes a nucleic acid sequence encoding a double-conjugated antibody light chain variable region sequence described in any of SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, and 53. In some embodiments, the nucleic acid sequence encodes the double-conjugated antibody light chain variable region sequence described in SEQ ID NO: 3. In some embodiments, the nucleic acid sequence encodes the double-conjugated antibody light chain variable region sequence described in SEQ ID NO: 5. In some embodiments, the nucleic acid sequence encodes the double-conjugated antibody light chain variable region sequence described in SEQ ID NO: 7. In some embodiments, the nucleic acid sequence encodes the double-conjugated antibody light chain variable region sequence described in SEQ ID NO: 9. In some embodiments, the nucleic acid sequence encodes the double-conjugated antibody light chain variable region sequence described in SEQ ID NO: 11. In some embodiments, the nucleic acid sequence encodes the double-conjugated antibody light chain variable region sequence described in SEQ ID NO: 13. In some embodiments, the nucleic acid sequence encodes the double-conjugated antibody light chain variable region sequence described in SEQ ID NO: 15. In some embodiments, the nucleic acid sequence encodes the double-conjugated antibody light chain variable region sequence described in SEQ ID NO: 17. In some embodiments, the nucleic acid sequence encodes the double-conjugated antibody light chain variable region sequence described in SEQ ID NO: 19. In some embodiments, the nucleic acid sequence encodes the double-conjugated antibody light chain variable region sequence described in SEQ ID NO: 21. In some embodiments, the nucleic acid sequence encodes the double-conjugated antibody light chain variable region sequence described in SEQ ID NO: 23. In some embodiments, the nucleic acid sequence encodes the double-conjugated antibody light chain variable region sequence described in SEQ ID NO: 25. In some embodiments, the nucleic acid sequence encodes the double-conjugated antibody light chain variable region sequence described in SEQ ID NO: 27. In some embodiments, the nucleic acid sequence encodes the double-conjugated antibody light chain variable region sequence described in SEQ ID NO: 29. In some embodiments, the nucleic acid sequence encodes the double-conjugated antibody light chain variable region sequence described in SEQ ID NO: 31. In some embodiments, the nucleic acid sequence encodes the double-conjugated antibody light chain variable region sequence described in SEQ ID NO: 33. In some embodiments, the nucleic acid sequence encodes the double-conjugated antibody light chain variable region sequence described in SEQ ID NO: 35.In some embodiments, the nucleic acid sequence encodes a dual - binding antibody light - chain variable region sequence set forth in SEQ ID NO: 37. In some embodiments, the nucleic acid sequence encodes a dual - binding antibody light - chain variable region sequence set forth in SEQ ID NO: 39. In some embodiments, the nucleic acid sequence encodes a dual - binding antibody light - chain variable region sequence set forth in SEQ ID NO: 41. In some embodiments, the nucleic acid sequence encodes a dual - binding antibody light - chain variable region sequence set forth in SEQ ID NO: 43. In some embodiments, the nucleic acid sequence encodes a dual - binding antibody light - chain variable region sequence set forth in SEQ ID NO: 45. In some embodiments, the nucleic acid sequence encodes a dual - binding antibody light - chain variable region sequence set forth in SEQ ID NO: 47. In some embodiments, the nucleic acid sequence encodes a dual - binding antibody light - chain variable region sequence set forth in SEQ ID NO: 49. In some embodiments, the nucleic acid sequence encodes a dual - binding antibody light - chain variable region sequence set forth in SEQ ID NO: 51. In some embodiments, the nucleic acid sequence encodes a dual - binding antibody light - chain variable region sequence set forth in SEQ ID NO: 53.

[0226] In some embodiments, the nucleic acid construct comprises a nucleic acid sequence encoding a dual - binding antibody light - chain variable region sequence set forth in Table 10 or Table 1. For example, VL may comprise any one of SEQ ID NOs: 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242, 244, 246, 248, 250, 252, 254, 256, 258, 260, 262, 264, 266, 268, 270, 272, 274, 276, 278, 280, 282, 284, 286, 288, 290, 292, 294, 296, 298, 300, 302, 304, 306, 308, 310, 312, 314, 316, 318, 320, 322, 324, 326, 328, 330, 332, 334, 336, 338, 340, 342, 344, 346, and 348. In another embodiment, the nucleic acid construct comprises a nucleic acid sequence encoding a VL that is at least 80%, 85%, 90%, 95%, 98%, or 99% identical to the VL sequences disclosed herein.

[0227] In some embodiments, the nucleic acid construct includes a nucleic acid sequence encoding a double-binding antibody heavy chain variable region-light chain variable region pair, which is selected from the paired sequences described in SEQ ID NOs. 57 and 58, SEQ ID NOs. 59 and 60, SEQ ID NOs. 61 and 62, SEQ ID NOs. 63 and 64, SEQ ID NOs. 65 and 66, SEQ ID NOs. 67 and 68, SEQ ID NOs. 69 and 70, SEQ ID NOs. 71 and 72, SEQ ID NOs. 73 and 74, SEQ ID NOs. 75 and 76, SEQ ID NOs. 77 and 78, SEQ ID NOs. 79 and 80, SEQ ID NOs. 81 and 82, SEQ ID NOs. 83 and 84, SEQ ID NOs. 85 and 86, SEQ ID NOs. 87 and 88, SEQ ID NOs. 89 and 90, SEQ ID NOs. 91 and 92, SEQ ID NOs. 93 and 94, SEQ ID NOs. 95 and 96, SEQ ID NOs. 97 and 98, SEQ ID NOs. 99 and 100, SEQ ID NOs. 101 and 102, SEQ ID NOs. 103 and 104, SEQ ID NOs. 105 and 106, and SEQ ID NOs. 107 and 108.

[0228] In some embodiments, the nucleic acid construct includes nucleic acid sequences encoding double-conjugated antibody heavy chain variable region-light chain variable region pairs shown in Table 10 or Table 1, for example, the VH and VL pairs may be one of the following: SEQ ID NOs: 209 and 210, 211 and 212, 213 and 214, 215 and 216, 217 and 218, 219 and 220, 221 and 222, 223 and 224, 225 and 226, 227 and 228, 229 and 230, 23 1 and 232, SEQ ID NOs: 233 and 234, SEQ ID NOs: 235 and 236, SEQ ID NOs: 237 and 238, SEQ ID NOs: 239 and 240, SEQ ID NOs: 241 and 242, SEQ ID NOs: 243 and 244, SEQ ID NOs: 245 and 246, SEQ ID NOs: 247 and 248, SEQ ID NOs: 249 and 250, SEQ ID NOs: 251 and 252, SEQ ID NOs: 253 and 254, SEQ ID NOs: 255 and 256, SEQ ID NOs: 257 and 258, SEQ ID NOs: 259 and 260, SEQ ID NOs: 261 and 262, SEQ ID NOs: 263 and 264, SEQ ID NOs: 265 and 266, SEQ ID NOs: 267 and 268, SEQ ID NOs. 269 and 270, SEQ ID NOs. 271 and 272, SEQ ID NOs. 273 and 274, SEQ ID NOs. 275 and 276, SEQ ID NOs. 277 and 278, SEQ ID NOs. 279 and 280, SEQ ID NOs. 281 and 282, SEQ ID NOs. 283 and 284, SEQ ID NOs. 285 and 286, SEQ ID NOs. 287 and 288, SEQ ID NOs. 289 and 290, SEQ ID NOs. 291 and 292, SEQ ID NOs. 293 and 294, SEQ ID NOs. 295 and 296, SEQ ID NOs. 297 and 298, SEQ ID NOs. 299 and 300, SEQ ID NOs. 301 and 302, sequence Numbers 303 and 304, Sequence numbers 305 and 306, Sequence numbers 307 and 308, Sequence numbers 309 and 310, Sequence numbers 311 and 312, Sequence numbers 313 and 314, Sequence numbers 315 and 316, Sequence numbers 317 and 318, Sequence numbers 319 and 320, Sequence numbers 321 and 322, Sequence numbers 323 and 324, Sequence numbers 325 and 326, Sequence numbers 327 and 328, Sequence numbers 329 and 330, Sequence numbers 331 and 332, Sequence numbers 333 and 334, Sequence numbers 335 and 336, Sequence numbers 337 and 338,Sequence IDs 339 and 340, 341 and 342, 343 and 344, 345 and 346, and 347 and 348. In another embodiment, the VH and VL pairs are at least 80%, 85%, 90%, 95%, 98%, or 99% identical to the VH and VL sequences disclosed herein.

[0229] Those skilled in the art will understand that in some embodiments, the sequences encoding the VH domain and the VL domain are linked by a sequence encoding a linker sequence. In some embodiments, the nucleic acid sequence encodes a polypeptide linker: ggcggtggtggtagcggaggcggaggatcaggtggaggcggcagt (SEQ ID NO: 148).

[0230] In some embodiments, the nucleic acid construct comprises a nucleic acid sequence encoding a double-binding antibody heavy chain variable region-light chain variable region scFv, which is selected from the sequences described in SEQ ID NOs. 109 to 135.

[0231] In some embodiments, a nucleic acid construct comprising a nucleic acid sequence encoding a biantibody as described herein encodes IgG immunoglobulin. In some embodiments, the nucleic acid sequence encoding a biantibody encodes IgG1 immunoglobulin, IgG2 immunoglobulin, IgG3 immunoglobulin, or IgG4 immunoglobulin. In some embodiments, the nucleic acid sequence encoding a biantibody encodes IgG1 immunoglobulin. In some embodiments, the nucleic acid sequence encoding a biantibody encodes IgG2 immunoglobulin. In some embodiments, the nucleic acid sequence encoding a biantibody encodes IgG3 immunoglobulin. In some embodiments, the nucleic acid sequence encoding a biantibody encodes IgG4 immunoglobulin. In some embodiments, the nucleic acid sequence encoding a biantibody encodes IgG1 immunoglobulin or IgG4 immunoglobulin.

[0232] In some embodiments, the nucleic acid sequence encoding the biantibody encodes a Fab immunoglobulin fragment. In some embodiments, the nucleic acid sequence encoding the biantibody encodes an F(ab')2 immunoglobulin fragment. In some embodiments, the nucleic acid sequence encoding the biantibody encodes an Fv immunoglobulin. In some embodiments, the nucleic acid sequence encoding the biantibody encodes an scFv immunoglobulin. In some embodiments, the nucleic acid sequence encoding the biantibody encodes a minibody immunoglobulin construct containing a pair of single-stranded Fv fragments linked via a CH3 domain.

[0233] In some embodiments, the nucleic acid sequence encoding the biantibody encodes a diabody immunoglobulin. In some embodiments, the diabody immunoglobulin construct includes heavy-chain variable (VH) and light-chain variable (VL) regions linked by a small peptide linker. In some embodiments, the diabody immunoglobulin construct includes a single-strand (Fv)2 in which two scFv fragments are covalently linked to each other. In some embodiments, the nucleic acid sequence encoding the biantibody encodes a diabody immunoglobulin construct comprising three covalently linked scFv fragments.

[0234] In some embodiments, the isolated polynucleotide construct encodes an isolated double-conjugated antibody disclosed herein.

[0235] In some embodiments, the nucleic acid sequence encoding the biantibody encodes a mutant immunoglobulin. In some embodiments, the nucleic acid sequence encoding the biantibody encodes a mutant IgG that cannot bind to antibody-dependent cytotoxic components. In some embodiments, the nucleic acid sequence encoding the biantibody encodes a mutant IgG1 that cannot bind to antibody-dependent cytotoxic components. In some embodiments, the nucleic acid sequence encoding the biantibody encodes L 234 A / L 235 It encodes an IgG containing the A(LALA) mutation. In some embodiments, the nucleic acid sequence encoding the biantibody is L 234 A / L 235It encodes IgG1 containing the A(LALA) mutation.

[0236] In some embodiments, as disclosed herein, mutagenesis approaches such as site-directed mutagenesis may be used to prepare variant VH, VL, or VH and VL nucleic acid sequences encoding variant VH, VL, or VH and VL amino acid sequences. The template VH and VL nucleic acid sequences of SEQ ID NOs. 55 and 56, respectively, encode the template amino acid sequences of SEQ ID NOs. 1 and 2, respectively. In some embodiments, the double-conjugated antibody comprises a variant VH domain, a variant VL domain, or both, encoded by the variant VH, VL, or VH and VL nucleotide sequences, the nucleotide sequences comprising the site-directed mutagenesis nucleotide template sequences of SEQ ID NOs. 55 and 56, respectively. This approach allows specific modifications in the polypeptide sequence to be performed via mutagenesis of the underlying polynucleotide encoding the polypeptide sequence. These techniques provide a simple approach to preparing and testing sequence variants, for example, introducing one or more nucleotide sequence changes into a polynucleotide, taking into account the desired amino acid variant sites, as described in detail above, for example, not limiting this approach.

[0237] Site-directed mutagenesis enables the production of mutants through the use of a specific oligonucleotide sequence encoding the DNA sequence of the desired mutation, as well as a sufficient number of adjacent nucleotides, providing a primer sequence of sufficient size and sequence complexity to form a stable double helix on both sides of the transverse deletion junction. The mutation may be utilized in a selected polynucleotide sequence to improve, alter, decrease, modify, or otherwise change the properties of the polynucleotide itself, and / or alter the properties, activity, composition, stability, or primary sequence of the encoded polypeptide.

[0238] In certain embodiments, the mutagenesis of a polynucleotide sequence encoding a component portion of a double-binding antibody (VH domain, VL domain, or a combination thereof), as disclosed herein, is intended to alter the binding properties of the encoded template VH or VL, or both, so that the resulting antibody contains double-binding affinity. Site-directed mutagenesis techniques are well known in the art and are widely used to produce variants of both polypeptides and polynucleotides. For example, site-directed mutagenesis is often used to alter specific portions of a DNA molecule. In such embodiments, primers typically containing about 14 to 25 nucleotides in length are used, and about 5 to 10 residues on either side of the junction of the sequence are modified.

[0239] As is understood by those skilled in the art, site-directed mutagenesis techniques have often utilized phage vectors, which exist in both single-stranded and double-stranded forms. Typical vectors useful for site-directed mutagenesis include vectors such as the M13 phage. These phages are commercially available and readily accessible, and their use is generally well known to those skilled in the art. Double-stranded plasmids are also routinely used in site-directed mutagenesis, eliminating the step of transferring the target gene from the plasmid to the phage.

[0240] Generally, site-directed mutagenesis according to this specification is carried out by first obtaining a single-stranded vector, or by lysing and separating the double strands of a double-stranded vector containing the DNA sequence encoding the desired peptide within its sequence. Oligonucleotide primers having the desired mutant sequence are generally prepared synthetically. These primers are then annealed with the single-stranded vector and subjected to a DNA polymerase, such as E. coli polymerase I Klenow fragment, to complete the synthesis of the mutant-carrying strand. Thus, a heteroduplex is formed, with one strand encoding the original non-mutant sequence and the second strand containing the desired mutation. This heteroduplex vector is then used to transform suitable cells, such as E. coli cells, and clones containing the recombinant vector with the mutant sequence configuration are selected.

[0241] The preparation of sequence variants of selected peptide-coding DNA segments using site-directed mutagenesis provides a means for producing potentially useful species, but is not intended to limit this, as there are other methods by which peptide sequence variants and the encoding DNA sequences can be obtained. In some embodiments, methods for preparing libraries include, but are not limited to, those known in the art, such as those described in U.S. Patent No. 9,889,423, which are incorporated herein in whole. In some embodiments, methods for designing sequence variants in a library include designing variant sequences on a computer and then synthesizing the sequences by methods involving both chemical and biochemical processes.

[0242] As used herein, the term “oligonucleotide-directed mutagenesis procedure” encompasses template-dependent processes and vector-mediated amplification, thereby resulting in an increase in the concentration of a detectable signal, such as an increase in the concentration of a particular nucleic acid molecule relative to its initial concentration, or amplification thereof. As used herein, the term “oligonucleotide-directed mutagenesis procedure” encompasses processes involving template-dependent extension of primer molecules. The term “template-dependent process” encompasses nucleic acid synthesis of RNA or DNA molecules, where the sequence of the newly synthesized strand of nucleic acid is determined by well-known rules of complementary base pairing (see, e.g., Watson, 1987). Typically, vector-mediated methods involve the introduction of a nucleic acid fragment into a DNA or RNA vector, clonal amplification of the vector, and recovery of the amplified nucleic acid fragment. Examples of such methodologies are provided in U.S. Patent No. 4,237,224, which is incorporated herein by reference in its entirety.

[0243] Another approach to the production of polypeptide VH and VL variants may employ repeated sequence recombination, as described in U.S. Patent No. 5,837,458. This approach involves repeated cycles of recombination and screening or selection to "evolve," for example, individual polynucleotide variants with increased binding affinity. Certain embodiments also provide constructs in the form of plasmids, vectors, transcriptions, or expression cassettes containing at least one polynucleotide described herein.

[0244] In certain embodiments, the above-mentioned polynucleotides encoding amino acids VH, VL, or VH and VL variants, such as VH, VL, or VH and VL variant polynucleotides, fragments, and hybrid-forming sequences, are included in the double-conjugated antibody.

[0245] The polynucleotides, or fragments thereof, described herein may be combined with other DNA sequences such as promoters, polyadenylation signals, additional restriction enzyme sites, multicloning sites, and other coding segments, so that their full length can vary considerably, regardless of the length of the coding sequence itself. Therefore, it is intended that nucleic acid fragments of almost any length may be used, and the full length is preferably limited by the ease of preparation and use in the intended recombinant DNA protocol. For example, exemplary polynucleotide segments with lengths of approximately 10,000, 5,000, 3,000, 2,000, 1,000, 500, 200, 100, and 50 base pairs (including all intermediate lengths) are intended to be useful.

[0246] In certain embodiments, isolated polynucleotides are inserted into a vector. In some embodiments, the vector includes an expression vector containing the polynucleotide constructs disclosed herein.

[0247] As used herein, the term "vector" encompasses a vehicle into which a polynucleotide encoding a protein can be covalently inserted so as to effect expression of the protein and / or cloning of the polynucleotide. The isolated polynucleotide may be inserted into a vector using any suitable method known in the art. For example, without limitation, the vector may be digested using appropriate restriction enzymes and then ligated to an isolated polynucleotide having matching restriction enzyme ends.

[0248] Examples of suitable vectors include, but are not limited to, plasmids, phagemids, cosmids, artificial chromosomes such as yeast artificial chromosomes (YACs), bacterial artificial chromosomes (BACs), or P1-derived artificial chromosomes (PACs), bacteriophages such as lambda phage or M13 phage, and animal viruses. Examples of categories of animal viruses useful as vectors include, but are not limited to, retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpesviruses (e.g., herpes simplex virus), poxviruses, baculoviruses, papillomaviruses, and papovaviruses (e.g., SV40).

[0249] For expression of a bispecific antibody or its components, the vector may be introduced into a host cell to enable expression of the polypeptide within the host cell. The expression vector may contain various elements for controlling expression, including, but not limited to, a promoter sequence, a transcription initiation sequence, an enhancer sequence, a selection marker, and a signal sequence. These elements may be appropriately selected by those skilled in the art. In some embodiments, these elements may be considered "regulatory elements."

[0250] Those skilled in the art will understand that the term “regulatory sequence” may encompass polynucleotide sequences that can influence the expression, processing, or intracellular localization of ligated or operably linked coding sequences. The nature of such regulatory sequences may depend on the host organism. In certain embodiments, a prokaryotic transcriptional regulatory sequence may include a promoter, a ribosome binding site, and a transcription termination sequence. In other specific embodiments, a eukaryotic transcriptional regulatory sequence may include a promoter containing one or more recognition sites for transcription factors, transcriptional enhancer sequences, transcription termination sequences, and polyadenylation sequences. In certain embodiments, a “regulatory sequence” may include a leader sequence and / or a fusion partner sequence.

[0251] In some embodiments, for example, the promoter sequence may be selected to promote the transcription of polynucleotides in the vector, for instance. Suitable promoter sequences include, but are not limited to, the T7 promoter, T3 promoter, SP6 promoter, beta-actin promoter, EF1a promoter, CMV promoter, and SV40 promoter. The enhancer sequence may be selected to enhance the transcription of polynucleotides. The selection marker may be selected to allow the selection of the inserted host cell from other host cells; for example, the selection marker may be a gene conferring antibiotic resistance. The signal sequence may be selected to allow the expressed polypeptide to be transported outside the host cell.

[0252] The vector may also include, but is not limited to, viral particles, liposomes, or protein coatings, as well as materials that assist in its entry into cells. In some embodiments, the host cell contains the expression vector disclosed herein.

[0253] In some embodiments, the expression vector includes an isolated nucleic acid sequence encoding a biantibody or its components, for example, a VH domain, a VL domain, or a combined VH-VL domain, which may be present in the above-mentioned Fab element, F(ab')2 element, scFv, Fv, minibody, diabody, or triabody. The bibinding domain and its components are described in detail above.

[0254] In some embodiments, the expression vector includes an isolated nucleic acid sequence encoding the VH domain. In some embodiments, the expression vector includes an isolated nucleic acid sequence encoding the VL domain. In some embodiments, the expression vector includes isolated nucleic acid sequences encoding both the VH and VL domains. In some embodiments, the expression vector includes isolated nucleic acid sequences encoding two VH and VL domains. In some embodiments, the expression vector includes isolated nucleic acid sequences encoding three VH and VL domains.

[0255] In some embodiments, the expression vector includes an isolated nucleic acid sequence encoding the VH domain component of the biantibody. In some embodiments, the expression vector includes an isolated nucleic acid sequence encoding the VL domain component of the biantibody. In some embodiments, the expression vector includes isolated nucleic acid sequences encoding the VH and VL domain components of the biantibody.

[0256] In some embodiments, the expression vector includes an isolated nucleic acid sequence encoding the VH domain component of a bivalent IgG antibody or a fragment thereof. In some embodiments, the expression vector includes an isolated nucleic acid sequence encoding the VL domain component of a bivalent IgG antibody or a fragment thereof. In some embodiments, the expression vector includes isolated nucleic acid sequences encoding the VH and VL domain components of a bivalent IgG antibody or a fragment thereof.

[0257] In some embodiments, the expression vector includes an isolated nucleic acid sequence encoding the VH domain component of scFv. In some embodiments, the expression vector includes an isolated nucleic acid sequence encoding the VL domain component of scFv. In some embodiments, the expression vector includes isolated nucleic acid sequences encoding both the VH and VL domain components of scFv.

[0258] Double-conjugated antibodies are described in detail above. Those skilled in the art will certainly understand, using the knowledge in the art and the specific details newly described herein, the range of components that can be encoded by the isolated nucleic acids described herein.

[0259] For the cloning of polynucleotides, a vector may be introduced into a host cell (isolated host cell) to enable replication of the vector itself, thereby amplifying copies of the polynucleotides contained therein. Cloning vectors generally include, but are not limited to, a replication origin, a promoter sequence, a transcription start sequence, an enhancer sequence, and a selection marker. These elements can be appropriately selected by those skilled in the art. For example, the replication origin may be selected to promote autonomous replication of the vector in the host cell.

[0260] In certain embodiments, this disclosure provides isolated host cells containing the vectors provided herein. These vector-containing host cells may be useful for the expression or cloning of polynucleotides contained in the vectors.

[0261] In some embodiments, recombinant host cells comprise one or more of the above-described constructs. The nucleic acid encodes any CDR or set of CDRs, or a VH domain or VL domain, or an antibody-antigen binding site or antibody molecule, for example, non-limitingly, IgG, Fv, scFv, Fab, F(ab')2, minibody, diabody, or triabody. In some embodiments, a method for producing the encoded product is disclosed herein, the method comprising expression from the encoding nucleic acid construct. Expression can be achieved in some embodiments by culturing recombinant host cells containing the nucleic acid construct under appropriate conditions. After production by expression, the VH or VL domain, or VH-VL pair, or antibody can be isolated and / or purified using any appropriate technique and then used as needed in therapeutic methods described herein, for example.

[0262] In some embodiments, the double-bound antibodies, VH domains, and / or VL domains encoding the nucleic acid molecules and vectors according to the present invention may be prepared, isolated, and / or purified in substantially pure or homogeneous form.

[0263] In some embodiments, systems for the cloning and expression of polypeptides in various different host cells are well known. Suitable host cells include, but are not limited to, prokaryotic cells, fungal cells, yeast cells, or higher eukaryotic cells such as insect cells or mammalian cells.

[0264] Suitable prokaryotic cells for this purpose include, but are not limited to, eubacteria such as Gram-negative or Gram-positive organisms, such as Escherichia, e.g., Escherichia coli, Enterobacter, Erwinia, Klebsiella, Proteus, Salmonella, e.g., Salmonella typhimurium, Serratia, e.g., Serratia marcescans, and Sigella, as well as Bacillus such as Bacillus subtilis and Bacillus licheniformis, Pseudomonas such as Pseudomonas erginosa, and Streptomyces.

[0265] The expression of antibodies and antigen-binding fragments in prokaryotic cells such as Escherichia coli is well established in the art. For a review, see, for example, Pluckthun, A. Bio / Technology 9:545-551 (1991). Expression in eukaryotic cells in culture is also available to those skilled in the art as an option for the production of antibodies or their antigen-binding fragments. See, for example, Ref, ME (1993) Curr. Opinion Biotech. 4:573-576 and Trill J Jet al. (1995) Curr. Opinion Biotech 6:553-560.

[0266] Suitable fungal cells for this purpose include, but are not limited to, filamentous fungi and yeasts. Exemplary examples of fungal cells include Saccharomyces cerevisiae, common baker's yeast, Schizosaccharomyces pombe, for example, K. lactis, K. fragilis (ATCC12,424), K. bulgaricus (ATCC16,045), K. wickeramii (ATCC24,178), and K. waltii (ATCC24,178) Kluyveromyces hosts such as CC56,500, Kluyveromyces drosophilarum (ATCC36,906), Kluyveromyces thermotolerans, and Kluyveromyces marxianus, as well as the genus Yarrowia (EP402,226) and Pichia pastris. Examples include *Pastoris* (EP183,070), Candida, *Trichoderma reesia* (EP244,234), *Neurospora crassa*, *Schwanniomyces occidentalis* and other *Schwanniomyces* species, as well as filamentous fungi such as *Neurospora*, *Penicillium*, and *Tripocladium*, and *Aspergillus* hosts such as *A. nidulans* and *A. niger*.

[0267] Higher eukaryotic cells, particularly those derived from multicellular organisms, may be used for the expression of glycosylated VH and VL domains provided herein. Suitable higher eukaryotic cells include, but are not limited to, invertebrate cells and insect cells, as well as vertebrate cells. Examples of invertebrate cells include plant cells and insect cells. Numerous baculovirus strains and mutants, as well as corresponding insect host cells tolerated by hosts such as Spodoptera frugiperda (caterpillar), Aedes aegypti (mosquito), Aedes albopictus (mosquito), Drosophila melanogaster (fly), and Bombyx mori, have been identified. Various virus strains for transfection, such as the K-1 variant of Autographa californica NPV and the Bm-5 strain of Bombyx mori NPV, are publicly available and can be used as the viruses described herein, in particular for the transfection of Spodoptera fulgiperda cells. Plant cell cultures of cotton, corn, potato, soybean, petunia, tomato, and tobacco can also be used as hosts. Mammalian cell lines available in the art for the expression of heterologous polypeptides include Chinese hamster ovary (CHO) cells, HeLa cells, pup hamster kidney cells, NS0 mouse melanoma cells, YB2 / 0 rat myeloma cells, human embryonic kidney cells, human embryonic retinal cells, and many others.Non-limiting examples of vertebrate cells include the CV1 monkey kidney cell line transformed with SV40 (COS-7, ATCC CRL 1651), human embryonic kidney cell line (293 or 293 cells subcloned for growth in suspension culture, Graham et al., J. Gen Virol. 36:59 (1977)), baby hamster kidney cells (BHK, ATCC CCL 10), Chinese hamster ovary cells / -DHFR (CHO, Urlaub et al., Proc. Natl. Acad. Sci. USA 77:4216 (1980)), ExpiCHO-S® cells (ThermoFisher Scientific catalog number A29133), mouse Sertoli cells (TM4, Mather, Biol. Reprod. 23:243-251 (1980)), and monkey kidney cells (CV1 ATCC CCL 10). Examples of mammalian host cell lines include African green monkey kidney cells (VERO-76, ATCC CRK-1587), human neck carcinoma cells (HELA, ATCC CCL 2), canine kidney cells (MDCK, ATCC CCL 34), buffalo rat hepatocytes (BRL 3A, ATCC CRL 1442), human lung cells (W138, ATCC CCL 75), human hepatocytes (Hep G2, HB 8065), mouse mammary tumor cells (MMT 060562, ATCC CCL 51), TRI cells (Mather et al., Annals NYAcad.Sci.383:44-68 (1982)), MRC 5 cells, FS4 cells, and human hepatoma cell lines (Hep G2).

[0268] In some embodiments, the expression vector comprises a nucleic acid construct as described herein. A suitable vector may be selected or constructed to contain appropriate control sequences, including a promoter sequence, a terminator sequence, a polyadenylation sequence, an enhancer sequence, a marker gene, and other sequences as needed. The control sequences may be operably ligated to the nucleic acid sequences contained within the nucleic acid construct. The vector may be a plasmid, for example, a phage or phagemide as needed. For further details, see, for example, Molecular Cloning: A Laboratory Manual: 3rd edition, Sambrook and Russell, 2001, Cold Spring Harbor Laboratory Press. For example, many known techniques and protocols for manipulating nucleic acids in the preparation of nucleic acid constructs, mutagenesis, sequencing, introduction of DNA into cells and gene expression, and protein analysis are described in detail in Current Protocols in Molecular Biology, Second Edition, Ausubel et al. eds., John Wiley & Sons, 1988, and Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Ausubel et al. eds., John Wiley & Sons, 4th edition 1999. The disclosures of Sambrook et al. and Ausubel et al. (both) are incorporated herein by reference.

[0269] Vectors can be introduced into host cells using any suitable method known in the art, including, but not limited to, DEAE-dextran-mediated delivery, calcium phosphate precipitation, cationic lipid-mediated delivery, liposome-mediated transfection, electroporation, microprojector impact, receptor-mediated gene delivery, and delivery mediated by polylysine, histones, chitosan, and peptides. Standard methods for transfection and transformation of cells for expression of the vector of interest are well known in the art.

[0270] In some embodiments, host cells containing nucleic acids disclosed herein are provided herein. Such host cells may be in vitro or cultured. Such host cells may be in vivo. The presence of host cells in vivo may enable intracellular expression of the double-conjugated antibodies described herein as "intrabodies" or intracellular antibodies. Intrabodies may be used in gene therapy.

[0271] In certain embodiments, the host cell comprises a first polypeptide, for example, a first vector encoding a VH domain, and a second polypeptide, for example, a second vector encoding a VL domain.

[0272] In certain embodiments, the host cell contains a first vector encoding the variant VH domain and a second vector encoding the variant VL domain. In certain embodiments, the host cell contains a single vector encoding both the variant VH and variant VL domains.

[0273] In some embodiments, the isolated cell comprises an isolated nucleic acid sequence as disclosed herein. In some embodiments, the isolated cell comprises two isolated nucleic acid sequences as disclosed herein, one nucleic acid encoding a variant VH domain and the other nucleic acid encoding a variant VL domain. In some embodiments, the isolated cell comprises a single isolated nucleic acid sequence as disclosed herein, encoding both a variant VH domain and a variant VL domain.

[0274] In certain embodiments, the first vector and the second vector may or may not be introduced simultaneously. In certain embodiments, the first vector and the second vector may be introduced together into the host cell. In certain embodiments, the first vector may be introduced into the host cell first, and then the second vector may be introduced. In certain embodiments, the first vector may be introduced into the host cell and then established into a stable cell line expressing the first polypeptide, and then the second vector may be introduced into the stable cell line.

[0275] In a particular embodiment, the host cell contains a vector encoding at least one variant VH domain and at least one variant VL contained within a double-conjugated antibody.

[0276] Following introduction, expression from the nucleic acid may be induced or enabled, for example, by culturing host cells under conditions for gene expression. In certain embodiments, the Disclosure provides a method for expressing a polypeptide provided herein, comprising culturing host cells containing the vector under conditions in which the polynucleotide inserted into the vector is expressed.

[0277] In some embodiments, the nucleic acid is integrated into the genome (e.g., chromosomes) of the host cell. Integration can be facilitated by including sequences that promote recombination with the genome, according to standard techniques. In some embodiments, the nucleic acid construct is not integrated into the genome, and the vector is an episome.

[0278] In some embodiments, methods are disclosed herein that include using the above-described constructs in an expression system to express the double-conjugated antibodies or fragments thereof.

[0279] Suitable conditions for polynucleotide expression include, but are not limited to, a suitable culture medium, an appropriate density of host cells in the culture medium, the presence of necessary nutrients, the presence of cofactors, appropriate temperature and humidity, and the absence of microbial contamination. Those skilled in the art can select conditions appropriate for the purpose of expression.

[0280] Method for synthesizing manipulated re-epitope biantibodies In some embodiments, a method for producing a double-conjugated antibody comprising a VH domain containing the HCDR described herein is described herein. In some embodiments, a method for producing a double-conjugated antibody comprising a VL domain containing the LCDR described herein is described herein. In some embodiments, a method for producing a double-conjugated antibody comprising a VH domain containing the HCDR described herein and a VL domain containing the LCDR described herein is described herein.

[0281] In some embodiments, (a) an amino acid sequence described in Sequence ID No. 1 having at least one amino acid variant at any of the positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or any combination thereof), (b) at least one at any of the positions 26, 27, 31, 51, 56, 77, 92, 93, or 96, or any combination thereof (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or any combination thereof) A method for producing a double-conjugate antibody heavy chain variable region comprising a light chain variable region having an amino acid variant, the amino acid sequence described in SEQ ID NO: 2, or a combination of the heavy chain variable region described in (c)(a) and the light chain variable region described in (b), wherein the total number of variant positions in the heavy chain variable region, the light chain variable region, or the combination thereof of the double-conjugate antibody is at least 2, comprises the step of culturing a cell or a plurality of cells containing nucleic acid sequences encoding at least VH and VL of the double-conjugate antibody, wherein the polypeptide comprising the variant VH and variant VL domains is expressed and isolated, and the isolated variant VH and variant VL domains form a heterodimer. As disclosed in detail herein, the isolated nucleic acid sequences encoding the variant VH and variant VL domains may be contained within a vector, and the same vector or different vectors may be used. In some embodiments, the respective variant VH and variant VL domains may be expressed from different host cells, and dimerization occurs after isolation or purification of the constituent variant VH and variant VL domains. In some embodiments, the variant VH domain and the variant VL domain may be expressed from the same host cell, and dimerization occurs during culture or after isolation or purification of the constituent variant VH and VL domains.

[0282] Those skilled in the art will understand that producing double-conjugated antibodies involves synthesizing amino acid polypeptide components containing a VH domain, a VL domain, or both. In some embodiments, such synthesis begins with nucleic acid constructs described in detail herein. The terms “producing” and “synthesizing” may be used interchangeably in some embodiments, all having the same quality and meaning.

[0283] In some embodiments, synthesizing a double-conjugated antibody includes synthesizing an IgG heavy chain containing a variant VH domain, an IgG light chain containing a variant VL domain, or both. In some embodiments, synthesizing a double-conjugated antibody includes synthesizing an IgG heavy chain containing a variant VH domain. In some embodiments, synthesizing a double-conjugated antibody includes synthesizing an IgG light chain containing a variant VL domain. In some embodiments, synthesizing a double-conjugated antibody includes synthesizing both an IgG heavy chain containing a variant VH domain and an IgG light chain containing a variant VL domain. In some embodiments, synthesizing a double-conjugated antibody includes synthesizing Fab, which includes a fragment of an IgG heavy chain containing a variant VH domain and a fragment of an IgG light chain containing a variant VL domain. In some embodiments, synthesizing a double-conjugated antibody includes synthesizing F(ab')2, which includes a fragment of an IgG heavy chain containing a variant VH domain and a fragment of an IgG light chain containing a variant VL domain. In some embodiments, synthesizing a double-conjugated antibody includes synthesizing Fv, which includes a variant VH domain and a variant VL domain. In some embodiments, synthesizing a double-conjugated antibody includes synthesizing an scFv containing a variant VH domain and a variant VL domain. In some embodiments, synthesizing a double-conjugated antibody includes synthesizing a minibody containing a variant VH domain and a variant VL domain. In some embodiments, synthesizing a double-conjugated antibody includes synthesizing a diabody containing a variant VH domain and a variant VL domain. In some embodiments, synthesizing a double-conjugated antibody includes synthesizing a triabody containing a variant VH domain and a variant VL domain. In some embodiments, synthesizing a double-conjugated antibody includes synthesizing a variant VH domain. In some embodiments, synthesizing a double-conjugated antibody includes synthesizing a variant VL domain.

[0284] In certain embodiments, polypeptides expressed in host cells can form dimers, thereby producing double-conjugated antibodies or their binding components.

[0285] In some embodiments, a method for synthesizing a double-conjugated antibody includes a step of mutating a nucleic acid sequence encoding a template heavy chain variable region that does not contain a double-conjugated VH domain in order to generate a variant VH domain that may contain a double-conjugated VH domain. In some embodiments, a method for synthesizing a double-conjugated antibody includes a step of mutating a nucleic acid sequence encoding a template light chain variable region that does not contain a double-conjugated VL domain in order to generate a variant VL domain that may contain a double-conjugated VH domain. In some embodiments, a method for synthesizing a double-conjugated antibody includes a step of mutating a nucleic acid sequence encoding a template heavy chain variable region that does not contain a double-conjugated VH domain in order to generate a variant VH domain that may contain a double-conjugated VH domain, and a step of mutating a nucleic acid sequence encoding a template light chain variable region that does not contain a double-conjugated VL domain in order to generate a variant VL domain that may contain a double-conjugated VH domain, wherein the variant VH and VL domains constitute the double variable region of the antibody. Methods for mutating nucleic acid sequences are described in detail above and are illustrated below in the examples.

[0286] In some embodiments, the template nucleic acid sequence encoding the template heavy chain variable region is described in SEQ ID NO: 55. In some embodiments, the template nucleic acid sequence encoding the template light chain variable region is described in SEQ ID NO: 56. As described throughout, the template VH and VL sequences do not contain double-binding regions.

[0287] In some embodiments, the method for synthesizing a double-conjugated antibody includes introducing at least two variant sites within the VH and VL domains. In some embodiments, the method for synthesizing a double-conjugated antibody includes introducing at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 variant sites within the VH and VL domains. The variant sites may be distributed between the VH and VL domains. In some embodiments, the variant sites are located within the CDR region of the VH domain. In some embodiments, the variant sites are located within the CDR region of the VL domain. In some embodiments, the variant sites are located within the FR region of the VH domain. In some embodiments, the variant sites are located within the FR region of the VL domain. In some embodiments, the variant sites are located within the CDR region and / or FR region of the VH domain. In some embodiments, the variant sites are located within the CDR region and / or FR region of the VL domain. In some embodiments, the variant region is located within the CDR region and / or FR region of the VH domain, and within the CDR region and / or FR region of the VL domain.

[0288] In certain embodiments, the complex of the variant VH domain and the variant VL domain may be formed within the host cell. For example, the heterodimer of the variant VH domain and the variant VL domain may be formed within the host cell using relevant enzymes and / or cofactors. In certain embodiments, the complex of the variant VH domain polypeptide and the variant VL domain polypeptide may be secreted outside the cell. In certain embodiments, the variant VH domain and the variant VL domain may be secreted from the host cell and form a heterodimer outside the host cell.

[0289] In certain embodiments, the variant VH domain and the variant VL domain may be expressed separately and dimerize under appropriate conditions. For example, the variant VH domain and the variant VL domain may be combined in an appropriate buffer, allowing them to dimerize through appropriate interactions such as hydrophobic interactions. As another example, the variant VH domain and the variant VL domain may be combined in an appropriate buffer containing enzymes and / or cofactors that can promote dimerization of the variant VH domain and the variant VL domain. As yet another example, the variant VH domain and the variant VL domain may be combined in an appropriate vehicle, allowing them to react with each other in the presence of appropriate reagents and / or catalysts.

[0290] In certain embodiments, the variant VH domain and variant VL domain may be contained within a longer polypeptide sequence that includes, but is not limited to, a constant region, hinge region, linker region, Fc region, or disulfide bond region, or any combination thereof. The constant region is the folding unit of the immunoglobulin in the constant portion of the immunoglobulin molecule, also called the domain of the constant region (e.g., CH1, CH2, CH3, CH4, Ck, Cl). In some embodiments, the longer polypeptide may contain multiple copies of the variant VH domain, variant VL domain, or both, and is not limited to, for example, when a double-conjugated antibody contains a diabody or triabody.

[0291] In certain embodiments, the variant VH domain and variant VL domain are generated by DNA synthesis and PCR, and translation of the resulting nucleotide sequence. In certain embodiments, the generated sequence can be subcloned into an expression vector. In certain embodiments, the generated sequence can be subcloned into two expression vectors. In certain embodiments, the expression vector is a plasmid. In certain embodiments, the variant VH domain and variant VL domain are constructed on an IgG template, which does not have double-binding capability.

[0292] In certain embodiments, transient expression is achieved by co-transfecting an expression vector encoding both the variant VH domain and the variant VL domain into suitable cells, or by transfecting an expression vector encoding both into suitable cells. Those skilled in the art will understand that there are numerous transfection methods and protocols that can be used for this purpose. In certain embodiments, transfection or co-transfection is performed using the PEI method.

[0293] Expression polypeptides containing variant VH domains and variant VL domains and / or polypeptide complexes can be collected using any suitable method. Variant VH domains and variant VL domains and / or polypeptide complexes may be expressed intracellularly in the perimembrane space or secreted extracellularly into the culture medium. If polypeptides containing variant VH domains and variant VL domains and / or polypeptide complexes are expressed intracellularly, host cells containing polypeptides containing variant VH domains and variant VL domains and / or polypeptide complexes may be lysed, and polypeptides and / or polypeptide complexes may be isolated from the lysate by removing undesirable fragments by centrifugation or ultrafiltration. If polypeptides containing variant VH and variant VL domains, and / or polypeptide complexes, are secreted into the perimembrane lumen of E. coli, the cell paste may be thawed for approximately 30 minutes in the presence of agents such as sodium acetate (pH 3.5), EDTA, and phenylmethylsulfonyl fluoride (PMSF), and cell fragments may be removed by centrifugation (Carter et al., BioTechnology 10:163-167 (1992)). If polypeptides containing variant VH and variant VL domains, and / or polypeptide complexes, are secreted into the culture medium, the supernatant of the cell culture may be collected and concentrated using a commercially available protein concentration filter, such as an Amincon or Millipore Pellicon ultrafiltration unit. Protease inhibitors and / or antibiotics may be included in the collection and concentration steps to inhibit proteolysis and / or the growth of contaminating microorganisms.

[0294] Expression polypeptides and / or polypeptide complexes containing variant VH and variant VL domains can be further purified by appropriate methods such as affinity chromatography, hydroxyl apatite chromatography, size exclusion chromatography, gel electrophoresis, dialysis, ion exchange fractionation on ion exchange columns, ethanol precipitation, reverse-phase HPLC, chromatography on silica, chromatography on heparin Sepharose, chromatography on anion or cation exchange resins (such as polyaspartate columns), isoelectric focusing, SDS-PAGE, and ammonium sulfate precipitation (see Bonner, PL, Protein purification, published by Taylor & Francis, 2007; Janson, JC, et al, Protein purification: principles, high resolution methods and applications, published by Wiley-VCH, 1998 for reviews).

[0295] In certain embodiments, polypeptides containing variant VH domains and variant VL domains and / or polypeptide dimer complexes can be purified by affinity chromatography. In certain embodiments, protein A chromatography or protein A / G (protein A and protein G fusion protein) chromatography may be useful for purifying polypeptides and / or polypeptide complexes containing components derived from antibody CH2 domains and / or CH3 domains (Lindmark et al., J.Immunol.Meth.62:1-13 (1983)), Zettlit, KA, Antibody Engineering, Part V, 531-535, 2010). In certain embodiments, the double-binding antibodies disclosed herein do not bind to protein A. In certain embodiments, protein G chromatography may be useful for purifying polypeptides and / or polypeptide complexes containing IgGγ triple chains (Guss et al., EMBO J.5:1567 1575 (1986)). In certain embodiments, protein L chromatography can be useful for purifying polypeptides and / or polypeptide complexes containing K light chains (Sudhir, P., Antigen engineering protocols, Chapter 26, Humana Press, 1995; Nilson, BHKet et al, J. Biol. Chem., 267, 2234-2239 (1992)). The matrix to which affinity ligands bind is most often agarose, but other matrices are available. Mechanically stable matrices such as controlled pore glass or poly(styrenedivinyl)benzene allow for faster flow rates and shorter processing times than can be achieved with agarose. If the antibody contains a CH3 domain, Bakerbond ABX resin (JTBaker, Phillipsburg, NJ) is useful for purification.

[0296] Following any preliminary purification steps, the mixture containing the double-conjugated antibody and impurities may be subjected to low-pH hydrophobic interaction chromatography using elution buffer at a pH of approximately 2.5–4.5, preferably at a low salt concentration (e.g., approximately 0–0.25 M salt).

[0297] In certain embodiments, polypeptides containing variant VH domains and variant VL domains and / or polypeptide dimer complexes can be purified by affinity chromatography and size exclusion chromatography (SEC). Those skilled in the art will understand that there are numerous methods and protocols suitable for this purpose. In certain embodiments, protein purification by affinity chromatography and SEC is performed using AKTA genuine instruments (GE Lifesciences). In certain embodiments, affinity capture of double-bound antibodies is achieved by passing the recovered supernatant through a column of CaptureSelect® CH1-XL affinity matrix (Thermo Scientific). After washing the column with PBS, the proteins are eluted with 0.1 M glycine, pH 2.5 and immediately neutralized with 1 / 6 volume of 1 M Tris-HCl, pH 8.0. The affinity-purified proteins are then concentrated to 5–10 mg / ml using an Amicon 30 kD concentrator (Merck Millipore) and subjected to SEC purification on a Superdex® 200 column (GE Lifesciences) equilibrated with PBS. Next, the protein fraction is collected and analyzed using SDS-PAGE and HPLC-SEC.

[0298] The binding of synthesized double-bound immunoglobulins to epitopes can be analyzed using methods well known in the art as described herein, including ELISA analysis, SPR analysis, DSF analysis, and cell-based binding assays.

[0299] In some embodiments, the heavy chain variable region includes the template amino acid sequence described in SEQ ID NO: 1, the template containing at least one amino acid variant at any of the following positions (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or any combination thereof); and the template described in SEQ ID NO: 2 A method for synthesizing a double-conjugated antibody comprising a light chain variable region containing an amino acid sequence, wherein the template contains at least one amino acid variant at any of the following positions (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or any combination thereof), wherein the total number of variant positions in the heavy chain variable region, the light chain variable region, or any combination thereof is at least 2, is as follows: (a) Modifying the template heavy chain variable region, the template light chain variable region, or both. (i) The modification of the template heavy chain variable region includes modifying the template heavy chain variable region described in Sequence ID No. 1, wherein the selected template variable chain does not contain a double bond region. (ii) The modification of the template light chain variable region includes modifying the template light chain variable region described in Sequence ID No. 2, wherein the selected template variable chain does not contain a double bond region. (iii) Mutation of both the template heavy chain variable region and the template light chain variable region includes mutating the template heavy chain variable region described in Sequence ID No. 1 and mutating the template light chain variable region described in Sequence ID No. 2, wherein both selected template variable chains do not contain a double bond region, and such mutation includes mutating at least two residues in the template heavy chain variable region, the template light chain variable region, or a combination thereof. (b) Synthesizing a mutated template variant heavy chain variable chain and a mutated template variant light chain variable chain. (c) Forming the mutated template variant heavy chain variable and the mutated template variant light chain variable into human antibodies; and (d) Screen the human antibodies of (c) for binding to the biantigen. This includes producing double-conjugated antibodies.

[0300] As described herein and illustrated below, in some embodiments, the synthesized antibody comprises IgG immunoglobulin. In some embodiments, the synthesized antibody comprises IgG1 immunoglobulin, IgG2 immunoglobulin, IgG3 immunoglobulin, or IgG4 immunoglobulin. In some embodiments, the synthesized antibody comprises IgG1 immunoglobulin. In some embodiments, the synthesized antibody comprises IgG2 immunoglobulin. In some embodiments, the synthesized antibody comprises IgG3 immunoglobulin. In some embodiments, the synthesized antibody comprises IgG4 immunoglobulin. In some embodiments, the synthesized antibody comprises IgG1 immunoglobulin or IgG4 immunoglobulin.

[0301] In some embodiments, the synthesized antibody comprises a Fab immunoglobulin fragment. In some embodiments, the synthesized antibody comprises an F(ab')2 immunoglobulin fragment. In some embodiments, the synthesized antibody comprises an Fv immunoglobulin construct. In some embodiments, the synthesized antibody comprises an scFv immunoglobulin construct. In some embodiments, the synthesized antibody comprises a minibody immunoglobulin construct comprising a pair of single-stranded Fv fragments linked via a CH3 domain.

[0302] In some embodiments, the synthesized antibody comprises a diabody immunoglobulin construct. In some embodiments, the synthesized antibody comprises a diabody immunoglobulin construct comprising three scFv fragments covalently linked to each other. In some embodiments, the synthesized antibody comprises a triabody.

[0303] In some embodiments, the synthesized antibody contains mutant IgG that cannot bind to antibody-dependent cytotoxic components. In some embodiments, the synthesized antibody contains mutant IgG1 that cannot bind to antibody-dependent cytotoxic components. In some embodiments, the synthesized antibody contains mutant IgG4 that cannot bind to antibody-dependent cytotoxic components.

[0304] Immunoglobulin Library In certain embodiments, a library of immunoglobulins or fragments thereof containing variant VH domains, variant VL domains, or variant VH domains and variant VL domains, as described in detail herein, is disclosed herein (see the following examples). In some embodiments, a library of immunoglobulins or fragments thereof containing variant VH domains, variant VL domains, or variant VH domains and variant VL domains may be screened for double-conjugated antibodies, fragments thereof, or components thereof.

[0305] In some embodiments, the immunoglobulin or fragment library includes a library of variable heavy chain domains. In some embodiments, the immunoglobulin or fragment library includes a library of variable light chain domains. In some embodiments, the immunoglobulin or fragment library includes libraries of variable heavy chain domains and variable light chain domains.

[0306] In some embodiments, a method for generating a library of dual antigen-binding immunoglobulin variable heavy chain regions for screening for binding to an epitope includes: (a) selecting a VH template antigen-binding molecule described in SEQ ID NO: 1, the selected template not specifically binding to an epitope; (b) selecting at least one residue position for a mutation from positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111 in template SEQ ID NO: 1, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or any combination thereof); and (c) selecting at least one variant residue to be replaced at at least one residue position selected in (b) so that a library containing multiple variants of the template VH is generated. In some embodiments, a method for generating a library of biantigen-binding immunoglobulin variable light chain regions for screening for binding to an epitope includes: (a) selecting a VL template antigen-binding molecule described in SEQ ID NO: 2, the selected template not specifically binding to an epitope; (b) selecting at least one residue position for a mutation from positions 26, 27, 31, 51, 56, 77, 92, 93, or 96 in the template SEQ ID NO: 2, or any combination thereof (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or any combination thereof); and (c) selecting at least one variant residue to be replaced at the at least one residue position selected in (b) so that a library containing multiple variants of the template VL is generated.

[0307] In some embodiments, a method for generating a library of biantigen-binding immunoglobulins containing a variable heavy chain region and a variable light chain region for screening for epitope binding includes: (a) selecting a VH template antigen-binding molecule described in SEQ ID NO: 1, wherein the selected template does not specifically bind to an epitope; (b) selecting a VL template antigen-binding molecule described in SEQ ID NO: 2, wherein the selected template does not specifically bind to an epitope; and (c) for a mutation, at least one residue from positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111 in template SEQ ID NO: 1, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or any combination thereof). (d) for the mutation, select at least one residue from positions 26, 27, 31, 51, 56, 77, 92, 93, or 96 in template SEQ ID NO: 2, or any combination thereof (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or any combination thereof), and (e) select at least one variant residue to substitute at the selected at least one residue position in (c), or select at least one variant residue to substitute at the selected at least one residue position in (d), such that the total number of variant residues in each possible double-bound immunoglobulin is at least 2, and a library is generated containing multiple variants of template VH and variants of template VL.

[0308] In some embodiments, the method for constructing the library can be seen in the examples. In some embodiments, the generated library described herein can be used to identify immunoglobulins bound to a dual target. In some embodiments, the generated library described herein can be used to identify immunoglobulins bound to a specific epitope.

[0309] In some embodiments, the use of a protein library containing immunoglobulins variant VH, variant VL, or variant VH and variant VL as described in detail herein provides a method for identifying immunoglobulins bound to a dual target. In some embodiments, the use of a protein library containing immunoglobulins variant VH, variant VL, or variant VH and variant VL as described in detail herein provides a method for identifying immunoglobulins bound to a specific epitope.

[0310] In some embodiments, the protein library containing immunoglobulins including variant VH and variant VL includes a library of antibody molecules. In some embodiments, the protein library containing immunoglobulins including variant VH and variant VL includes a library of IgG molecules. In some embodiments, the protein library containing immunoglobulins including variant VH and variant VL includes a library of IgG1, IgG2, IgG3, or IgG4 molecules. In some embodiments, the IgG molecules are mutant IgG molecules that cannot bind to antibody-dependent cytotoxic components.

[0311] In some embodiments, the protein library containing immunoglobulins including variant VH and variant VL includes a library of Fab or F(ab')2 molecules. In some embodiments, the protein library containing immunoglobulins including variant VH and variant VL includes a library of Fv molecules, scFv molecules, minibody molecules, diabody molecules, or triabody molecules.

[0312] In some embodiments, existing immunoglobulin VH and VL templates can be modified to introduce variant amino acids at specific positions for the purpose of generating double antigen-binding sites in the variant VH and variant VL domains, and the variant VH and variant VL domain protein library contains at least 10, 100, 1,000, 10,000, 100,000, or 1,000,000 variant VH, variant VL, or variant VH and variant VL, each having at least two variant positions. In some embodiments, the variant VH and variant VL domain protein library contains 1,000 to 1,000,000 variant VH domains, variant VL domains, or variant VH and variant VL domains, each having at least two variant positions. In some embodiments, the variant VH domain and variant VL domain protein library includes 10,000 to 1,000,000 variant VH domains, variant VL domains, or variant VH domains and variant VL domains, each having at least two variant positions.

[0313] In some embodiments, the variant VH domain and variant VL domain protein library includes 1,000 to 1,000,000 variant VH domains, variant VL domains, or variant VH domains and variant VL domains having variant positions 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, and 15.

[0314] In some embodiments, the protein libraries of variant VH domains and variant VL domains have at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 variant positions. 6 ~10 14 The variant VH domain, variant VL domain, or variant VH domain and variant VL domain comprises 10 variant VH domains, variant VL domains, and variant VL domains. In some embodiments, the protein library of variant VH domains and variant VL domains has at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 variant positions. 6 ~10 14 A variant VH domain, a variant VL domain, or a variant VH domain and a variant VL domain.

[0315] The library is then screened for binding to one or more antigens. After molecular characterization for desired properties, selected antibody domains or regions, for example, not limited to VH domains or VL domains, or both, are cloned into immunoglobulin molecules by genetic engineering techniques, resulting in the substitution of the corresponding region. Alternatively, only the DNA encoding the VH or VL region, or both, or the DNA encoding the variant amino acid, may be replaced to obtain an immunoglobulin with additional binding sites to the molecule. In some embodiments, the selection of immunoglobulin molecules from which the variant region is cloned may be IgG, Fv, scFv, Fab, F(ab')2, minibody, diabody, or triabody. In some embodiments, IgG is IgG1, IgG2, IgG3, or IgG4. In some embodiments, IgG includes variant IgG that cannot bind to antibody-dependent cytotoxic components.

[0316] In some embodiments, the expressed CDRs are as described above for HCDR1, HCDR2, HCD3, LCDR1, LCDR2, and LCDR3, with certain positions containing variant amino acids as described in detail above, as shown in Figures 1A and 1B.

[0317] The sites of the mutation are as described above and, in certain embodiments, include positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111 in template SEQ ID NO: 1, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or any combination thereof), and positions 26, 27, 31, 51, 56, 77, 92, 93, or 96 in template SEQ ID NO: 2, or any combination thereof (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or any combination thereof). In some embodiments, additional sites within the VH template or the VL template may be mutated.

[0318] In a particular embodiment, the method for generating the library further includes generating the library by synthesizing a template variant (VH, VL, or both VH and VL) from the nucleic acid construct as described in detail above.

[0319] The result of generating the above library is (a) a heavy chain variable region containing the amino acid sequence described in SEQ ID NO: 1, having at least one amino acid variant at any of the following positions (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or any combination thereof), (b) 26, 27, 31, 51, 56, 77, 92, 93, if (c) A library of immunoglobulins comprising a light chain variable region containing the amino acid sequence described in SEQ ID NO: 2, having at least one amino acid variant at position 96, or any combination thereof (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or any combination thereof), or a combination of the heavy chain variable region described in (a) and the light chain variable region described in (b), wherein the total number of variant positions in the heavy chain variable region, light chain variable region, or combination thereof is at least 2.

[0320] Mammalian cell expression systems are described above. These expression systems offer numerous potential advantages for therapeutic antibody generation, including the ability to simultaneously select key manufacturing-related properties such as high levels of expression and stability while presenting functionally glycosylated IgG on the cell surface, thereby creating libraries of potentially double-conjugated immunoglobulins.

[0321] In some embodiments, the immunoglobulin library includes IgG molecules, Fab molecules, F(ab')2 molecules, FV molecules, VH molecules, VL molecules, scFv molecules, diabodies, minibodies, or triabodies. In some embodiments, the IgG molecules include IgG1, IgG2, IgG3, or IgG4. In some embodiments, IgG includes mutant IgG that cannot bind to antibody-dependent cytotoxic components. In some embodiments, IgG1 includes mutant IgG1 that cannot bind to antibody-dependent cytotoxic components.

[0322] In some embodiments, a method is disclosed herein in which a library containing an antigen molecule or a portion thereof is screened to select a double-bonded molecule having desirable properties (e.g., binding affinity, stability, etc.). In some embodiments, the portion of the antigen includes at least one IL-13 antigenic epitope. In some embodiments, double-bonded molecules isolated from the library after such screening are disclosed herein.

[0323] In some embodiments, a method for screening a library of described immunoglobulins for double-binding molecules is disclosed herein, comprising: (a) screening a library containing an antigen molecule or fragment thereof to identify a double-binding molecule that binds to the epitope of interest; (b) screening the binding substance identified in step (a) to determine which residues are variants and which variant residues are enriched in the binding immunoglobulin; (c) synthesizing an optimized library of double-binding substance variants using the information from step (b); and (d) repeating steps (a) to (c) using the optimized library. In some embodiments, a method for screening a library of described immunoglobulins for double-bonded molecules is disclosed herein, comprising: (a) screening a library containing the epitope of interest to identify double-bonded molecules that bind to the epitope of interest; (b) screening the binding substances identified in step (a) to determine which residues are variants and which variant residues are enriched in the binding immunoglobulin; (c) synthesizing an optimized library of double-bonded substance variants using the information from step (b); and (d) repeating steps (a) to (c) using the optimized library.

[0324] According to some embodiments, the specific binding of a variant immunoglobulin to an antigen molecule is determined by a binding assay selected from a group of immunoassays, including but not limited to enzyme-linked immunosorbent assays (ELISA), surface plasmon resonance assays, saturated migration difference nuclear magnetic resonance spectroscopy, migration NOE (trNOE) nuclear magnetic resonance spectroscopy, competitive assays, tissue binding assays, live cell binding assays, and cell extraction assays.

[0325] Binding assays can be performed using a variety of methods known in the art, including, but not limited to, FRET (fluorescence resonance energy transfer) and BRET (bioluminescence resonance energy transfer) based assays such as AlphaScreen® (amplified luminescence proximity homogeneity assay), scintillation proximity assays, ELISA (enzyme-linked immunosorbent assay), SPR (surface plasmon resonance, also known as BIACORE®), isothermal titration calorimetry, differential scanning calorimetry, gel electrophoresis, and chromatography including gel filtration. These and other methods may utilize several fusion partners or labels.

[0326] In some embodiments, variant immunoglobulins are conjugated to labels selected from the group consisting of organic molecules, enzyme labels, radioactive labels, color labels, fluorescent labels, chromogenic labels, luminescent labels, haptens, digoxigenin, biotin, metal complexes, metals, colloidal gold, and mixtures thereof. Conjugation to labels may, in certain embodiments, enable simple detection of the conjugate in binding assays (e.g., ELISA) and binding studies.

[0327] Composition used In some embodiments, pharmaceutical compositions comprising a double-conjugated antibody described herein that provide a therapeutic agent are described herein. In some embodiments, pharmaceutical compositions comprising a double-conjugated antibody that provides a therapeutic agent comprising a mutant IgG that cannot bind to antibody-dependent cytotoxic components are described herein. In some embodiments, pharmaceutical compositions comprising a double-conjugated antibody that have therapeutic properties against allergic conditions or respiratory conditions are described herein.

[0328] In some embodiments, the pharmaceutical composition comprises a double-conjugated antibody containing variant VH, variant VL, or both variant VH and variant VL, as well as a pharmaceutically acceptable carrier. The amino acid sequences of the variant VH and variant VL domains, and their pairs, are described in detail above (see, for example, Table 1, but not limited thereto).

[0329] In certain embodiments, the composition comprises one of the isolated double-conjugated antibodies disclosed herein and a pharmaceutically acceptable carrier.

[0330] In one embodiment, the pharmaceutical composition comprises double-conjugated antibodies having HCDR1, HCDR2, and HCDR3, each containing the amino acid sequences of SEQ ID NOs. 349, 350, and 351, and LCDR1, LCDR2, and LCDR3, each containing the amino acid sequences of SEQ ID NOs. 359, 360, and 361.

[0331] In another embodiment, the pharmaceutical composition comprises double-conjugated antibodies having HCDR1, HCDR2, and HCDR3, each containing the amino acid sequences of SEQ ID NOs. 349, 356, and 351, and LCDR1, LCDR2, and LCDR3, each containing the amino acid sequences of SEQ ID NOs. 364, 360, and 371.

[0332] In another embodiment, the pharmaceutical composition comprises double-conjugated antibodies having HCDR1, HCDR2, and HCDR3, each containing the amino acid sequences of SEQ ID NOs. 349, 350, and 351, and LCDR1, LCDR2, and LCDR3, each containing the amino acid sequences of SEQ ID NOs. 362, 360, and 384.

[0333] In another embodiment, the pharmaceutical composition comprises double-conjugated antibodies having HCDR1, HCDR2, and HCDR3, each containing the amino acid sequences of SEQ ID NOs. 349, 350, and 351, and LCDR1, LCDR2, and LCDR3, each containing the amino acid sequences of SEQ ID NOs. 364, 360, and 384.

[0334] In another embodiment, the pharmaceutical composition comprises double-conjugated antibodies having HCDR1, HCDR2, and HCDR3 having amino acid sequences shown in Table 8 or Table 4, and LCDR1, LCDR2, and LCDR3 having amino acid sequences shown in Table 9 or Table 5.

[0335] In another embodiment, the pharmaceutical composition comprises a double-conjugated antibody containing a heavy-chain variable domain (VH) and a light-chain variable domain (VL), wherein VH and VL contain the amino acid sequences of SEQ ID NOs. 209 and 210.

[0336] In another embodiment, the pharmaceutical composition comprises a double-conjugated antibody containing a heavy-chain variable domain (VH) and a light-chain variable domain (VL), wherein VH and VL contain the amino acid sequences of SEQ ID NOs. 219 and 220.

[0337] In another embodiment, the pharmaceutical composition comprises a double-conjugated antibody containing a heavy-chain variable domain (VH) and a light-chain variable domain (VL), wherein VH and VL contain the amino acid sequences of SEQ ID NOs. 249 and 250.

[0338] In another embodiment, the pharmaceutical composition comprises a double-conjugated antibody containing a heavy-chain variable domain (VH) and a light-chain variable domain (VL), wherein VH and VL contain the amino acid sequences of SEQ ID NOs. 337 and 338.

[0339] In another embodiment, the pharmaceutical composition comprises a double-conjugated antibody containing a heavy-chain variable domain (VH) and a light-chain variable domain (VL), wherein VH and VL contain amino acid sequences shown in Table 10 or Table 1.

[0340] In another embodiment, the pharmaceutical composition comprises a double-conjugated antibody comprising a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein VH and VL are at least 80%, 85%, 90%, 95%, 98%, or 99% identical to the VH and VL sequences disclosed herein.

[0341] In some embodiments, the pharmaceutical composition comprising a double-conjugated antibody comprises any double antibody described herein, comprising variant VH, variant VL, or variant VH and variant VL. In some embodiments, the pharmaceutical composition comprising a double-conjugated antibody comprises a heavy chain variable region containing the amino acid sequence described in SEQ ID NO: 1, having at least one amino acid variant at any of the positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or any combination thereof), 26, 27, 31, 51, 56 The light chain variable region includes the amino acid sequence described in Sequence ID No. 2, having at least one amino acid variant at any of the following positions: 77, 92, 93, or 96, or any combination thereof (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or any combination thereof), or a combination of the heavy chain variable region described in (a) and the light chain variable region described in (b), wherein the total number of variant positions in the heavy chain variable region, light chain variable region, or combination thereof is at least 2.

[0342] Those skilled in the art will recognize that, in some embodiments, the term “double-conjugated antibody” can be used interchangeably with the term “drug” or “pharmaceutical,” all having the same meaning and quality. In some embodiments, a drug comprising a double-conjugated antibody comprises a pharmaceutical composition.

[0343] In some embodiments, compositions comprising the double-conjugated antibodies described herein, as well as the administration of such compositions in various therapeutic settings, are described herein.

[0344] The administration of the double-conjugated antibodies described herein, either in their pure form or in appropriate pharmaceutical compositions, can be carried out via any acceptable mode of administration of the agent for performing similar utility. Pharmaceutical compositions can be prepared by combining the double-conjugated antibody or a double-conjugated antibody-containing composition with an appropriate physiologically acceptable carrier, diluent, or excipient, and can be formulated into preparations in solid, semi-solid, liquid, or gaseous forms such as tablets, capsules, powders, granules, ointments, solvents, suppositories, injections, inhalants, gels, microspheres, and aerosols. Furthermore, other pharmaceutically active ingredients and / or appropriate excipients, such as salts, buffers, and stabilizers, may but are not required to be present in the composition. Administration can be achieved by a variety of different routes, including oral, parenteral, nasal, intravenous, intradermal, subcutaneous, or topical. In some embodiments, the mode of administration depends on the nature of the condition to be treated or prevented. An amount that reduces, inhibits, prevents, or delays the progression and / or metastasis of cancer after administration is considered effective. Those skilled in the art will understand that the term “physiologically acceptable carrier, diluent or excipient” may, in some embodiments, be used interchangeably with the term “pharmaceutically acceptable carrier” with all the same meaning and quality.

[0345] In some embodiments, the pharmaceutical composition described herein includes a nucleotide sequence encoding a double-conjugated antibody. In some embodiments, the nucleotide sequence encoding a double-conjugated antibody disclosed herein includes a single linear nucleotide sequence. In some embodiments, the nucleotide sequence encoding a double-conjugated antibody disclosed herein includes two linear nucleotide sequences. In some embodiments, the nucleotide sequence encoding a double-conjugated antibody disclosed herein includes two nucleotide sequences present in the same vector. In some embodiments, the nucleotide sequence encoding a double-conjugated antibody disclosed herein includes two nucleotide sequences present in different vectors.

[0346] In some embodiments, the nucleotide sequence includes a variant VH domain or a variant VL domain or a combination thereof. In some embodiments, the same nucleotide sequence includes a variant VH domain or a variant VL domain or a combination thereof. In some embodiments, different nucleotide sequences encode a variant VH domain or a variant VL domain or a combination thereof. In some embodiments, one nucleotide sequence encodes a variant VH domain and another nucleotide sequence encodes a variant VL domain. In some embodiments, one nucleotide sequence encodes a variant VH domain and another nucleotide sequence encodes a variant VL domain with a linker sequence between them, thereby enabling heterodimerization of the variant VH domain and the variant VL domain, as described in Duperret EK et al., Cancer Res, Oct. 4 (doi: 10.1158 / 0008-5472. CAN-18-1429).

[0347] In some embodiments, a method for treating an allergic condition or respiratory condition, or a combination thereof, in a subject is a variant VH domain comprising the amino acid sequence described in SEQ ID NO: 1, having at least one amino acid variant at any of the positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or a combination thereof), and (b The method comprises administering to a subject in need a pharmaceutical composition comprising a double-conjugated antibody comprising a variant VL domain containing the amino acid sequence described in SEQ ID NO: 2, which has at least one amino acid variant at any of the following positions (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or any combination thereof), and the method treats an allergic condition, respiratory condition, or a combination thereof, compared to a subject that has not been administered the pharmaceutical composition.

[0348] In some embodiments, a method for treating an allergic condition or respiratory condition, or a combination thereof, in a subject comprises administering to a subject in need a pharmaceutical composition comprising a double-conjugated antibody comprising a variant VH domain containing the amino acid sequence described in SEQ ID NO: 1, which has at least one amino acid variant at any of the following positions (52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117), the method treating the allergic condition or respiratory condition, or a combination thereof, compared to a subject that has not been administered the pharmaceutical composition.

[0349] In some embodiments, a method for treating an allergic condition or respiratory condition, or a combination thereof, in a subject comprises administering to a subject in need a pharmaceutical composition comprising a double-conjugated antibody comprising a variant VL domain containing the amino acid sequence described in SEQ ID NO: 2, which has at least one amino acid variant at any of the following positions (IMGT positions 26, 27, 31, 51, 56, 77, 92, 93, or 96, or any combination thereof), the method treating the allergic condition or respiratory condition, or a combination thereof, compared to a subject that has not been administered the pharmaceutical composition.

[0350] How to use In some embodiments, a method for treating a subject suffering from a disease or condition is disclosed herein, the method comprising administering to the subject a composition comprising an isolated double-conjugated antibody disclosed herein. In some embodiments, the disease or condition is an allergic or respiratory condition, an inflammatory or autoimmune condition, or a tumor or cancer. In some embodiments, the disease or condition is asthma, allergic asthma, non-allergic asthma, severe asthma, mild asthma, chronic obstructive pulmonary disease (COPD), a condition with airway inflammation, cystic fibrosis, allergic lung disease, airway hyperresponsiveness, goblet cell dysplasia, hypermucosalgia, airway remodeling, pulmonary fibrosis, atopic dermatitis, urticaria, eczema, allergic enterogastritis, allergic rhinitis, inflammatory bowel disease, cirrhosis or fibrosis, or a combination thereof.

[0351] In some embodiments, a method for treating an allergic or respiratory condition, an inflammatory condition of the skin or gastrointestinal tract and / or an autoimmune condition, scleroderma, or a tumor or cancer including Hodgkin lymphoma, or any combination thereof, in a subject comprises the step of administering a pharmaceutical composition containing a double-conjugated antibody or a pharmaceutical composition thereof, wherein the double-conjugated antibody comprises a heavy chain variable region including an HCDR (HCDR1, HCDR2, HCDR3 as described in detail herein, see, for example, Table 8 or Table 4). In some embodiments, a method for treating an allergic or respiratory condition, an inflammatory condition of the skin or gastrointestinal tract and / or an autoimmune condition, scleroderma, or a tumor or cancer including Hodgkin lymphoma, or any combination thereof, in a subject comprises the step of administering a pharmaceutical composition containing a double-conjugated antibody or a pharmaceutical composition thereof, wherein the double-conjugated antibody comprises a light chain variable region including an LCDR (LCDR1, LCDR2, LCDR3 as described in detail herein, see, for example, Table 9 or Table 5). In some embodiments, a method for treating an allergic or respiratory condition, an inflammatory condition of the skin or gastrointestinal organs and / or an autoimmune condition, scleroderma, or a tumor or cancer including Hodgkin lymphoma, or any combination thereof, in a subject comprises the step of administering a pharmaceutical composition comprising a double-conjugated antibody or a pharmaceutical composition comprising a heavy-chain variable region comprising HCDRs (HCDR1, HCDR2, HCDR3) and LCDRs (LCDR1, LCDR2, LCDR3 as described herein in detail).

[0352] In a particular embodiment, a method for treating a subject suffering from a disease or condition includes administering a double-conjugated antibody comprising three complementarity-determining regions (CDRs) on a heavy chain (HCDR1, HCDR2, and HCDR3) and three CDRs on a light chain (LCDR1, LCDR2, and LCDR3), HCDR1, HCDR2, and HCDR3 each contain the amino acid sequences of SEQ ID NOs. 349, 350, and 351, respectively, and LCDR1, LCDR2, and LCDR3 each contain the amino acid sequences of SEQ ID NOs. 359, 360, and 361, respectively, or HCDR1, HCDR2, and HCDR3 each contain the amino acid sequences of SEQ ID NOs. 349, 356, and 351, respectively, and LCDR1, LCDR2, and LCDR3 each contain the amino acid sequences of SEQ ID NOs. 364, 360, and 371, respectively, or HCDR1, HCDR2 Each of the following is a possible combination: HCDR3 contains the amino acid sequences of SEQ ID NOs. 349, 350, and 351, respectively; LCDR1, LCDR2, and LCDR3 contain the amino acid sequences of SEQ ID NOs. 362, 360, and 384, respectively; or HCDR1, HCDR2, and HCDR3 contain the amino acid sequences of SEQ ID NOs. 349, 350, and 351, respectively; LCDR1, LCDR2, and LCDR3 contain the amino acid sequences of SEQ ID NOs. 364, 360, and 384, respectively; or CDR has the sequences of SEQ ID NOs. 149-154.

[0353] In some embodiments, a method for treating a subject suffering from a disease or condition involves administering a double-conjugated antibody containing three complementarity-determining regions (CDRs) on a heavy chain (HCDR1, HCDR2, and HCDR3) and three CDRs on a light chain (LCDR1, LCDR2, and LCDR3), wherein HCDR1, HCDR2, and HCDR3 contain amino acid sequences shown in Table 8 or Table 4, and LCDR1, LCDR2, and LCDR3 contain amino acid sequences shown in Table 9 or Table 5.

[0354] In some embodiments, a method for treating a subject suffering from a disease or condition includes administering a double-conjugated antibody containing VH and VL having sequences of SEQ ID NOs. 209 and 210, SEQ ID NOs. 219 and 220, SEQ ID NOs. 249 and 250, SEQ ID NOs. 337 and 338, SEQ ID NOs. 155 and 156, and SEQ ID NOs. 157 and 158. In some embodiments, a method for treating a subject suffering from a disease or condition includes administering a double-conjugated antibody containing VH and VL domains having sequences shown in Table 10 or Table 1.

[0355] In some embodiments, a method for treating an allergic or respiratory condition, an inflammatory condition of the skin or gastrointestinal organs and / or an autoimmune condition, scleroderma, or a tumor or cancer including Hodgkin lymphoma, or any combination thereof, in a subject, is a pharmaceutical composition comprising a double-conjugated antibody or the pharmaceutical composition thereof, the double-conjugated antibody having (a) a heavy chain variable region comprising the amino acid sequence described in SEQ ID NO: 1, having at least one amino acid variant at any of the positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or any combination thereof), (b) 26, 27, 31, 51, 56, 77, 92, 93, or The method comprises administering to a subject requiring treatment, the double-conjugated antibody, or the pharmaceutical composition thereof, to a subject, compared to a subject not administered with the double-conjugated antibody, or the pharmaceutical composition thereof, a light chain variable region containing the amino acid sequence described in SEQ ID NO: 2, or a combination of the heavy chain variable region described in (a) and the light chain variable region described in (b), wherein the total number of variant positions in the heavy chain variable region, the light chain variable region, or the combination thereof is at least 2.

[0356] In some embodiments, a method for treating an allergic or respiratory condition, an inflammatory condition of the skin or gastrointestinal organs and / or an autoimmune condition, scleroderma, or a tumor or cancer including Hodgkin lymphoma, or any combination thereof, in a subject is a pharmaceutical composition comprising a double-conjugated antibody or the pharmaceutical composition thereof, wherein the double-conjugated antibody is located at any of the following positions (IMGT positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof) The method comprises administering to a subject requiring treatment a heavy chain variable region comprising the amino acid sequence described in Sequence ID No. 1, having at least one amino acid variant in 113, 114, or 117, or a combination thereof, wherein the total number of variant positions in the heavy chain variable region is at least 2, and the method treats an allergic or respiratory condition, an inflammatory condition of the skin or gastrointestinal organs and / or an autoimmune condition, scleroderma, or a tumor or cancer, including Hodgkin lymphoma, in a subject compared to a subject that has not been administered the double-conjugated antibody or the pharmaceutical composition.

[0357] In some embodiments, a method for treating an allergic or respiratory condition, an inflammatory condition of the skin or gastrointestinal tract and / or autoimmune condition, scleroderma, or a tumor or cancer including Hodgkin lymphoma, or any combination thereof, in a subject comprises administering to a subject in need a pharmaceutical composition comprising a double-conjugated antibody or the pharmaceutical composition thereof, the double-conjugated antibody comprising a light chain variable region comprising the amino acid sequence described in SEQ ID NO: 2, having at least one amino acid variant at any of the 26, 27, 31, 51, 56, 77, 92, 93, or 96 positions, or any combination thereof (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or any combination thereof), the total number of variant positions in the light chain variable region being at least 2, the method treating an allergic or respiratory condition, an inflammatory condition of the skin or gastrointestinal tract and / or autoimmune condition, scleroderma, or a tumor or cancer including Hodgkin lymphoma in the subject compared to a subject not administered with the double-conjugated antibody or the pharmaceutical composition thereof.

[0358] In some embodiments, a method for treating an allergic or respiratory condition, an inflammatory condition of the skin or gastrointestinal organs and / or an autoimmune condition, scleroderma, or a tumor or cancer including Hodgkin lymphoma, or any combination thereof, in a subject is a pharmaceutical composition comprising a double-conjugated antibody or the pharmaceutical composition thereof, the double-conjugated antibody comprising (a) a heavy chain variable region comprising the amino acid sequence described in SEQ ID NO: 1, having at least one amino acid variant at any of the positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or any combination thereof), and (b) 26, 2 The method comprises administering to a subject requiring treatment, a light chain variable region containing the amino acid sequence described in Sequence ID No. 2, having at least one amino acid variant at any of the following positions (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or any combination thereof), wherein the total number of variant positions in the heavy chain variable region, the light chain variable region, or any combination thereof is at least 2, the double-conjugated antibody, or the pharmaceutical composition thereof, to a subject that has not been administered to the subject, the treatment of an allergic or respiratory condition, an inflammatory condition of the skin or gastrointestinal organs and / or an autoimmune condition, scleroderma, or a tumor or cancer including Hodgkin lymphoma.

[0359] In some embodiments of methods for treating allergic or respiratory conditions, inflammatory conditions of the skin or gastrointestinal tract and / or autoimmune conditions, scleroderma, or tumors or cancers including Hodgkin lymphoma, the amino acid sequence of the variant VH domain is selected, non-limitingly, from any of the sequences described in SEQ ID NOs: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, and 54. In some embodiments of methods for treating allergic or respiratory conditions, inflammatory conditions of the skin or gastrointestinal organs and / or autoimmune conditions, scleroderma, or tumors or cancers including Hodgkin lymphoma, the double-conjugated antibody includes, but is not limited to, a heavy chain variable region comprising the amino acid sequences described in SEQ ID NOs: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, and 54, as well as any variable light chain region. In some embodiments of the methods disclosed herein, the amino acid sequence of the variant VH domain includes a sequence that is at least 80% identical (e.g., 80%, 85%, 90%, 95%, 98%, or 99% identical) to any of the sequences described in SEQ ID NOs: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, and 54.

[0360] In some embodiments of the methods disclosed herein, the VH domain of the double-conjugated antibody is SEQ ID NOs: 209, 211, 213, 215, 217, 219, 221, 223, 225, 227, 229, 231, 233, 235, 237, 239, 241, 243, 245, 247, 249, 251, 253, 255, 257, 259, 261, 263, 265, 267, 269, 271, 27 The sequence is selected from any of the sequences described in 3, 275, 277, 279, 281, 283, 285, 287, 289, 291, 293, 295, 297, 299, 301, 303, 305, 307, 309, 311, 313, 315, 317, 319, 321, 323, 325, 327, 329, 331, 333, 335, 337, 339, 341, 343, 345, and 347. In another embodiment, the VH domain is at least 80%, 85%, 90%, 95%, 98%, or 99% identical to the VH sequences disclosed herein.

[0361] Those skilled in the art will understand that the sequence identity percentage can be determined using any of the numerous publicly available software applications, for example, the BlastP software from the National Center for Biotechnology Information (NCBI), which uses default parameters, without limitation.

[0362] In some embodiments of methods for treating allergic or respiratory conditions, inflammatory conditions of the skin or gastrointestinal tract and / or autoimmune conditions, scleroderma, or tumors or cancers including Hodgkin lymphoma, the amino acid sequence of the variant light chain variable region (VL) is selected, non-limitingly, from any of the sequences described in SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, and 53. In some embodiments of methods for treating allergic or respiratory conditions, inflammatory conditions of the skin or gastrointestinal organs and / or autoimmune conditions, scleroderma, or tumors or cancers including Hodgkin lymphoma, the double-conjugated antibody includes, but is not limited to, a light chain variable region comprising the amino acid sequences described in SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, and 53, as well as any variable heavy chain region. In some embodiments of the methods disclosed herein, the amino acid sequence of the variant VH domain includes a sequence that is at least 80% identical (e.g., 80%, 85%, 90%, 95%, 98%, or 99% identical) to any of the sequences described in SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, and 53, and an optional variable heavy chain region.

[0363] In some embodiments of the methods disclosed herein, the VL domain of the double-conjugated antibody is SEQ ID NOs: 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242, 244, 246, 248, 250, 252, 254, 256, 258, 260, 262, 264, 266, 268, 270, 272, 27 The sequence is selected from any of the sequences described in 4, 276, 278, 280, 282, 284, 286, 288, 290, 292, 294, 296, 298, 300, 302, 304, 306, 308, 310, 312, 314, 316, 318, 320, 322, 324, 326, 328, 330, 332, 334, 336, 338, 340, 342, 344, 346, and 348. In another embodiment, the VL domain is at least 80%, 85%, 90%, 95%, 98%, or 99% identical to the VL sequences disclosed herein.

[0364] In some embodiments of methods for treating allergic or respiratory conditions, inflammatory conditions of the skin or gastrointestinal tract and / or autoimmune conditions, scleroderma, or tumors or cancers including Hodgkin lymphoma, the amino acid sequence of the variant VH domain is, non-limitingly, selected from the sequences described in SEQ ID NOs: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, and 54, and the amino acid sequence of the variant light chain variable region (VH) is, non-limitingly, selected from any of the sequences described in SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, and 53. In some embodiments of methods for treating allergic or respiratory conditions, inflammatory conditions of the skin or gastrointestinal organs and / or autoimmune conditions, scleroderma, or tumors or cancers including Hodgkin lymphoma, the amino acid sequence of the heavy chain variable region-light chain variable region pair is selected, without limitation, from the pair sequences described in SEQ ID NOs: 4 and 3, SEQ ID NOs: 6 and 5, SEQ ID NOs: 8 and 7, SEQ ID NOs: 10 and 9, SEQ ID NOs: 12 and 11, SEQ ID NOs: 14 and 13, SEQ ID NOs: 16 and 15, SEQ ID NOs: 18 and 17, SEQ ID NOs: 20 and 19, SEQ ID NOs: 22 and 21, SEQ ID NOs: 24 and 23, SEQ ID NOs: 26 and 25, SEQ ID NOs: 28 and 27, SEQ ID NOs: 30 and 29, SEQ ID NOs: 32 and 31, SEQ ID NOs: 34 and 33, SEQ ID NOs: 36 and 35, SEQ ID NOs: 38 and 37, SEQ ID NOs: 40 and 39, SEQ ID NOs: 42 and 41, SEQ ID NOs: 44 and 43, SEQ ID NOs: 46 and 45, SEQ ID NOs: 48 and 47, SEQ ID NOs: 50 and 49, SEQ ID NOs: 52 and 51, and SEQ ID NOs: 54 and 53. In some embodiments, the amino acid sequence of the VH-VL pair is selected from any of the pair sequences listed below: SEQ ID NOs: 209 and 210, 211 and 212, 213 and 214, 215 and 216, 217 and 218, 219 and 220, 221 and 222, 223 and 224, 225 and 226, 227 and 228, 229 and 230,Sequence IDs 231 and 232, 233 and 234, 235 and 236, 237 and 238, 239 and 240, 241 and 242, 243 and 244, 245 and 246, 247 and 248, 249 and 250, 251 and 252, 253 and 254, 255 and 256, 257 and 258, 259 and 260, SEQ ID NOs. 261 and 262, SEQ ID NOs. 263 and 264, SEQ ID NOs. 265 and 266, SEQ ID NOs. 267 and 268, SEQ ID NOs. 269 and 270, SEQ ID NOs. 271 and 272, SEQ ID NOs. 273 and 274, SEQ ID NOs. 275 and 276, SEQ ID NOs. 277 and 278, SEQ ID NOs. 279 and 280, SEQ ID NOs. 281 and 282, SEQ ID NOs. 283 and 284, SEQ ID NOs. 285 and 286, SEQ ID NOs. 287 and 288, SEQ ID NOs. 289 and 290, sequence numbers 291 and 292, sequence numbers 293 and 294, sequence numbers 295 and 296, sequence numbers 297 and 298, sequence numbers 299 and 300, sequence numbers 301 and 302, sequence numbers 303 and 304, sequence numbers 305 and 306, sequence numbers 307 and 308, sequence numbers 309 and 310, sequence numbers 311 and 312, sequence number...

Claims

1. An isolated double-conjugated antibody that binds to IL-13 and TSLP, comprising three complementarity-determining regions (CDRs) (HCDR1, HCDR2, and HCDR3) on the heavy chain and three CDRs (LCDR1, LCDR2, and LCDR3) on the light chain, (a) HCDR1 includes the amino acid sequence described in SEQ ID NO: 349, HCDR2 includes the amino acid sequence described in SEQ ID NO: 350, HCDR3 includes the amino acid sequence described in SEQ ID NO: 351, LCDR1 includes the amino acid sequence described in SEQ ID NO: 364, LCDR2 includes the amino acid sequence described in SEQ ID NO: 360, and LCDR3 includes the amino acid sequence described in SEQ ID NO:

384. (b) HCDR1 includes the amino acid sequence described in SEQ ID NO: 349, HCDR2 includes the amino acid sequence described in SEQ ID NO: 354, HCDR3 includes the amino acid sequence described in SEQ ID NO: 351, LCDR1 includes the amino acid sequence described in SEQ ID NO: 364, LCDR2 includes the amino acid sequence described in SEQ ID NO: 360, and LCDR3 includes the amino acid sequence described in SEQ ID NO:

365. (c) HCDR1 includes the amino acid sequence described in SEQ ID NO: 349, HCDR2 includes the amino acid sequence described in SEQ ID NO: 350, HCDR3 includes the amino acid sequence described in SEQ ID NO: 351, LCDR1 includes the amino acid sequence described in SEQ ID NO: 359, LCDR2 includes the amino acid sequence described in SEQ ID NO: 360, and LCDR3 includes the amino acid sequence described in SEQ ID NO:

361. (d) HCDR1 includes the amino acid sequence described in SEQ ID NO: 349, HCDR2 includes the amino acid sequence described in SEQ ID NO: 356, HCDR3 includes the amino acid sequence described in SEQ ID NO: 351, LCDR1 includes the amino acid sequence described in SEQ ID NO: 364, LCDR2 includes the amino acid sequence described in SEQ ID NO: 360, and LCDR3 includes the amino acid sequence described in SEQ ID NO:

371. (e) HCDR1 includes the amino acid sequence described in SEQ ID NO: 349, HCDR2 includes the amino acid sequence described in SEQ ID NO: 350, HCDR3 includes the amino acid sequence described in SEQ ID NO: 351, LCDR1 includes the amino acid sequence described in SEQ ID NO: 362, LCDR2 includes the amino acid sequence described in SEQ ID NO: 360, and LCDR3 includes the amino acid sequence described in SEQ ID NO:

384. (f) HCDR1 includes the amino acid sequence described in SEQ ID NO: 349, HCDR2 includes the amino acid sequence described in SEQ ID NO: 352, HCDR3 includes the amino acid sequence described in SEQ ID NO: 353, LCDR1 includes the amino acid sequence described in SEQ ID NO: 362, LCDR2 includes the amino acid sequence described in SEQ ID NO: 360, and LCDR3 includes the amino acid sequence described in SEQ ID NO:

363. (g) HCDR1 contains the amino acid sequence described in SEQ ID NO: 349, HCDR2 contains the amino acid sequence described in SEQ ID NO: 352, HCDR3 contains the amino acid sequence described in SEQ ID NO: 351, LCDR1 contains the amino acid sequence described in SEQ ID NO: 366, LCDR2 contains the amino acid sequence described in SEQ ID NO: 367, and LCDR3 contains the amino acid sequence described in SEQ ID NO:

368. (h) HCDR1 contains the amino acid sequence described in SEQ ID NO: 355, HCDR2 contains the amino acid sequence described in SEQ ID NO: 356, HCDR3 contains the amino acid sequence described in SEQ ID NO: 351, LCDR1 contains the amino acid sequence described in SEQ ID NO: 369, LCDR2 contains the amino acid sequence described in SEQ ID NO: 367, and LCDR3 contains the amino acid sequence described in SEQ ID NO:

370. (i) HCDR1 includes the amino acid sequence described in SEQ ID NO: 349, HCDR2 includes the amino acid sequence described in SEQ ID NO: 352, HCDR3 includes the amino acid sequence described in SEQ ID NO: 353, LCDR1 includes the amino acid sequence described in SEQ ID NO: 362, LCDR2 includes the amino acid sequence described in SEQ ID NO: 367, and LCDR3 includes the amino acid sequence described in SEQ ID NO:

372. (j) HCDR1 includes the amino acid sequence described in SEQ ID NO: 349, HCDR2 includes the amino acid sequence described in SEQ ID NO: 350, HCDR3 includes the amino acid sequence described in SEQ ID NO: 351, LCDR1 includes the amino acid sequence described in SEQ ID NO: 359, LCDR2 includes the amino acid sequence described in SEQ ID NO: 360, and LCDR3 includes the amino acid sequence described in SEQ ID NO:

373. (k) HCDR1 contains the amino acid sequence described in SEQ ID NO: 349, HCDR2 contains the amino acid sequence described in SEQ ID NO: 350, HCDR3 contains the amino acid sequence described in SEQ ID NO: 351, LCDR1 contains the amino acid sequence described in SEQ ID NO: 364, LCDR2 contains the amino acid sequence described in SEQ ID NO: 360, and LCDR3 contains the amino acid sequence described in SEQ ID NO:

374. (l) HCDR1 contains the amino acid sequence described in SEQ ID NO: 355, HCDR2 contains the amino acid sequence described in SEQ ID NO: 350, HCDR3 contains the amino acid sequence described in SEQ ID NO: 357, LCDR1 contains the amino acid sequence described in SEQ ID NO: 375, LCDR2 contains the amino acid sequence described in SEQ ID NO: 367, and LCDR3 contains the amino acid sequence described in SEQ ID NO:

376. (m) HCDR1 contains the amino acid sequence described in SEQ ID NO: 349, HCDR2 contains the amino acid sequence described in SEQ ID NO: 350, HCDR3 contains the amino acid sequence described in SEQ ID NO: 351, LCDR1 contains the amino acid sequence described in SEQ ID NO: 362, LCDR2 contains the amino acid sequence described in SEQ ID NO: 360, and LCDR3 contains the amino acid sequence described in SEQ ID NO:

377. (n) HCDR1 includes the amino acid sequence described in SEQ ID NO: 355, HCDR2 includes the amino acid sequence described in SEQ ID NO: 356, HCDR3 includes the amino acid sequence described in SEQ ID NO: 351, LCDR1 includes the amino acid sequence described in SEQ ID NO: 369, LCDR2 includes the amino acid sequence described in SEQ ID NO: 367, and LCDR3 includes the amino acid sequence described in SEQ ID NO:

378. (o) HCDR1 contains the amino acid sequence described in SEQ ID NO: 355, HCDR2 contains the amino acid sequence described in SEQ ID NO: 356, HCDR3 contains the amino acid sequence described in SEQ ID NO: 351, LCDR1 contains the amino acid sequence described in SEQ ID NO: 369, LCDR2 contains the amino acid sequence described in SEQ ID NO: 367, and LCDR3 contains the amino acid sequence described in SEQ ID NO:

379. (p) HCDR1 includes the amino acid sequence described in SEQ ID NO: 349, HCDR2 includes the amino acid sequence described in SEQ ID NO: 350, HCDR3 includes the amino acid sequence described in SEQ ID NO: 351, LCDR1 includes the amino acid sequence described in SEQ ID NO: 359, LCDR2 includes the amino acid sequence described in SEQ ID NO: 360, and LCDR3 includes the amino acid sequence described in SEQ ID NO:

380. (q) HCDR1 contains the amino acid sequence described in SEQ ID NO: 355, HCDR2 contains the amino acid sequence described in SEQ ID NO: 356, HCDR3 contains the amino acid sequence described in SEQ ID NO: 351, LCDR1 contains the amino acid sequence described in SEQ ID NO: 369, LCDR2 contains the amino acid sequence described in SEQ ID NO: 367, and LCDR3 contains the amino acid sequence described in SEQ ID NO:

379. (r) HCDR1 includes the amino acid sequence described in SEQ ID NO: 355, HCDR2 includes the amino acid sequence described in SEQ ID NO: 352, HCDR3 includes the amino acid sequence described in SEQ ID NO: 351, LCDR1 includes the amino acid sequence described in SEQ ID NO: 369, LCDR2 includes the amino acid sequence described in SEQ ID NO: 367, and LCDR3 includes the amino acid sequence described in SEQ ID NO:

381. (s) HCDR1 contains the amino acid sequence described in SEQ ID NO: 355, HCDR2 contains the amino acid sequence described in SEQ ID NO: 350, HCDR3 contains the amino acid sequence described in SEQ ID NO: 357, LCDR1 contains the amino acid sequence described in SEQ ID NO: 369, LCDR2 contains the amino acid sequence described in SEQ ID NO: 367, and LCDR3 contains the amino acid sequence described in SEQ ID NO:

370. (t) HCDR1 includes the amino acid sequence described in SEQ ID NO: 355, HCDR2 includes the amino acid sequence described in SEQ ID NO: 356, HCDR3 includes the amino acid sequence described in SEQ ID NO: 351, LCDR1 includes the amino acid sequence described in SEQ ID NO: 366, LCDR2 includes the amino acid sequence described in SEQ ID NO: 367, and LCDR3 includes the amino acid sequence described in SEQ ID NO:

382. (u) HCDR1 includes the amino acid sequence described in SEQ ID NO: 355, HCDR2 includes the amino acid sequence described in SEQ ID NO: 350, HCDR3 includes the amino acid sequence described in SEQ ID NO: 351, LCDR1 includes the amino acid sequence described in SEQ ID NO: 369, LCDR2 includes the amino acid sequence described in SEQ ID NO: 367, and LCDR3 includes the amino acid sequence described in SEQ ID NO:

370. (v) HCDR1 contains the amino acid sequence described in SEQ ID NO: 355, HCDR2 contains the amino acid sequence described in SEQ ID NO: 356, HCDR3 contains the amino acid sequence described in SEQ ID NO: 351, LCDR1 contains the amino acid sequence described in SEQ ID NO: 369, LCDR2 contains the amino acid sequence described in SEQ ID NO: 367, and LCDR3 contains the amino acid sequence described in SEQ ID NO:

383. (w) HCDR1 contains the amino acid sequence described in SEQ ID NO: 355, HCDR2 contains the amino acid sequence described in SEQ ID NO: 352, HCDR3 contains the amino acid sequence described in SEQ ID NO: 351, LCDR1 contains the amino acid sequence described in SEQ ID NO: 366, LCDR2 contains the amino acid sequence described in SEQ ID NO: 367, and LCDR3 contains the amino acid sequence described in SEQ ID NO:

385. (x) HCDR1 contains the amino acid sequence described in SEQ ID NO: 355, HCDR2 contains the amino acid sequence described in SEQ ID NO: 350, HCDR3 contains the amino acid sequence described in SEQ ID NO: 351, LCDR1 contains the amino acid sequence described in SEQ ID NO: 369, LCDR2 contains the amino acid sequence described in SEQ ID NO: 367, and LCDR3 contains the amino acid sequence described in SEQ ID NO:

386. (y) HCDR1 contains the amino acid sequence described in SEQ ID NO: 355, HCDR2 contains the amino acid sequence described in SEQ ID NO: 352, HCDR3 contains the amino acid sequence described in SEQ ID NO: 351, LCDR1 contains the amino acid sequence described in SEQ ID NO: 369, LCDR2 contains the amino acid sequence described in SEQ ID NO: 367, and LCDR3 contains the amino acid sequence described in SEQ ID NO:

387. (z) HCDR1 includes the amino acid sequence described in SEQ ID NO: 355, HCDR2 includes the amino acid sequence described in SEQ ID NO: 356, HCDR3 includes the amino acid sequence described in SEQ ID NO: 351, LCDR1 includes the amino acid sequence described in SEQ ID NO: 369, LCDR2 includes the amino acid sequence described in SEQ ID NO: 367, and LCDR3 includes the amino acid sequence described in SEQ ID NO:

388. (aa) HCDR1 contains the amino acid sequence described in SEQ ID NO: 355, HCDR2 contains the amino acid sequence described in SEQ ID NO: 356, HCDR3 contains the amino acid sequence described in SEQ ID NO: 351, LCDR1 contains the amino acid sequence described in SEQ ID NO: 369, LCDR2 contains the amino acid sequence described in SEQ ID NO: 367, and LCDR3 contains the amino acid sequence described in SEQ ID NO:

389. (bb) HCDR1 contains the amino acid sequence described in SEQ ID NO: 355, HCDR2 contains the amino acid sequence described in SEQ ID NO: 352, HCDR3 contains the amino acid sequence described in SEQ ID NO: 351, LCDR1 contains the amino acid sequence described in SEQ ID NO: 369, LCDR2 contains the amino acid sequence described in SEQ ID NO: 367, and LCDR3 contains the amino acid sequence described in SEQ ID NO:

379. (cc) HCDR1 contains the amino acid sequence described in SEQ ID NO: 355, HCDR2 contains the amino acid sequence described in SEQ ID NO: 352, HCDR3 contains the amino acid sequence described in SEQ ID NO: 351, LCDR1 contains the amino acid sequence described in SEQ ID NO: 369, LCDR2 contains the amino acid sequence described in SEQ ID NO: 367, and LCDR3 contains the amino acid sequence described in SEQ ID NO:

390. (dd) HCDR1 contains the amino acid sequence described in SEQ ID NO: 355, HCDR2 contains the amino acid sequence described in SEQ ID NO: 350, HCDR3 contains the amino acid sequence described in SEQ ID NO: 351, LCDR1 contains the amino acid sequence described in SEQ ID NO: 366, LCDR2 contains the amino acid sequence described in SEQ ID NO: 367, and LCDR3 contains the amino acid sequence described in SEQ ID NO:

391. (ee) HCDR1 contains the amino acid sequence described in SEQ ID NO: 355, HCDR2 contains the amino acid sequence described in SEQ ID NO: 350, HCDR3 contains the amino acid sequence described in SEQ ID NO: 351, LCDR1 contains the amino acid sequence described in SEQ ID NO: 375, LCDR2 contains the amino acid sequence described in SEQ ID NO: 367, and LCDR3 contains the amino acid sequence described in SEQ ID NO:

392. (ff) HCDR1 contains the amino acid sequence described in SEQ ID NO: 355, HCDR2 contains the amino acid sequence described in SEQ ID NO: 354, HCDR3 contains the amino acid sequence described in SEQ ID NO: 351, LCDR1 contains the amino acid sequence described in SEQ ID NO: 369, LCDR2 contains the amino acid sequence described in SEQ ID NO: 367, and LCDR3 contains the amino acid sequence described in SEQ ID NO:

393. (gg) HCDR1 contains the amino acid sequence described in SEQ ID NO: 355, HCDR2 contains the amino acid sequence described in SEQ ID NO: 356, HCDR3 contains the amino acid sequence described in SEQ ID NO: 351, LCDR1 contains the amino acid sequence described in SEQ ID NO: 369, LCDR2 contains the amino acid sequence described in SEQ ID NO: 367, and LCDR3 contains the amino acid sequence described in SEQ ID NO:

394. (hh)HCDR1 contains the amino acid sequence described in SEQ ID NO: 355, HCDR2 contains the amino acid sequence described in SEQ ID NO: 356, HCDR3 contains the amino acid sequence described in SEQ ID NO: 351, LCDR1 contains the amino acid sequence described in SEQ ID NO: 369, LCDR2 contains the amino acid sequence described in SEQ ID NO: 367, and LCDR3 contains the amino acid sequence described in SEQ ID NO:

395. (ii) HCDR1 contains the amino acid sequence described in SEQ ID NO: 355, HCDR2 contains the amino acid sequence described in SEQ ID NO: 350, HCDR3 contains the amino acid sequence described in SEQ ID NO: 351, LCDR1 contains the amino acid sequence described in SEQ ID NO: 369, LCDR2 contains the amino acid sequence described in SEQ ID NO: 367, and LCDR3 contains the amino acid sequence described in SEQ ID NO:

396. (jj) HCDR1 contains the amino acid sequence described in SEQ ID NO: 355, HCDR2 contains the amino acid sequence described in SEQ ID NO: 352, HCDR3 contains the amino acid sequence described in SEQ ID NO: 351, LCDR1 contains the amino acid sequence described in SEQ ID NO: 369, LCDR2 contains the amino acid sequence described in SEQ ID NO: 367, and LCDR3 contains the amino acid sequence described in SEQ ID NO:

397. (kk) HCDR1 contains the amino acid sequence described in SEQ ID NO: 355, HCDR2 contains the amino acid sequence described in SEQ ID NO: 350, HCDR3 contains the amino acid sequence described in SEQ ID NO: 351, LCDR1 contains the amino acid sequence described in SEQ ID NO: 369, LCDR2 contains the amino acid sequence described in SEQ ID NO: 367, and LCDR3 contains the amino acid sequence described in SEQ ID NO:

398. (ll) HCDR1 contains the amino acid sequence described in SEQ ID NO: 355, HCDR2 contains the amino acid sequence described in SEQ ID NO: 350, HCDR3 contains the amino acid sequence described in SEQ ID NO: 351, LCDR1 contains the amino acid sequence described in SEQ ID NO: 369, LCDR2 contains the amino acid sequence described in SEQ ID NO: 367, and LCDR3 contains the amino acid sequence described in SEQ ID NO:

388. (mm) HCDR1 contains the amino acid sequence described in SEQ ID NO: 355, HCDR2 contains the amino acid sequence described in SEQ ID NO: 350, HCDR3 contains the amino acid sequence described in SEQ ID NO: 351, LCDR1 contains the amino acid sequence described in SEQ ID NO: 369, LCDR2 contains the amino acid sequence described in SEQ ID NO: 367, and LCDR3 contains the amino acid sequence described in SEQ ID NO:

394. (nn) HCDR1 contains the amino acid sequence described in SEQ ID NO: 355, HCDR2 contains the amino acid sequence described in SEQ ID NO: 350, HCDR3 contains the amino acid sequence described in SEQ ID NO: 351, LCDR1 contains the amino acid sequence described in SEQ ID NO: 375, LCDR2 contains the amino acid sequence described in SEQ ID NO: 367, and LCDR3 contains the amino acid sequence described in SEQ ID NO:

398. (oo) HCDR1 contains the amino acid sequence described in SEQ ID NO: 355, HCDR2 contains the amino acid sequence described in SEQ ID NO: 352, HCDR3 contains the amino acid sequence described in SEQ ID NO: 357, LCDR1 contains the amino acid sequence described in SEQ ID NO: 375, LCDR2 contains the amino acid sequence described in SEQ ID NO: 367, and LCDR3 contains the amino acid sequence described in SEQ ID NO:

399. (pp) HCDR1 contains the amino acid sequence described in SEQ ID NO: 355, HCDR2 contains the amino acid sequence described in SEQ ID NO: 350, HCDR3 contains the amino acid sequence described in SEQ ID NO: 351, LCDR1 contains the amino acid sequence described in SEQ ID NO: 375, LCDR2 contains the amino acid sequence described in SEQ ID NO: 367, and LCDR3 contains the amino acid sequence described in SEQ ID NO:

400. (qq) HCDR1 contains the amino acid sequence described in SEQ ID NO: 355, HCDR2 contains the amino acid sequence described in SEQ ID NO: 350, HCDR3 contains the amino acid sequence described in SEQ ID NO: 357, LCDR1 contains the amino acid sequence described in SEQ ID NO: 375, LCDR2 contains the amino acid sequence described in SEQ ID NO: 367, and LCDR3 contains the amino acid sequence described in SEQ ID NO:

398. (rr) HCDR1 contains the amino acid sequence described in SEQ ID NO: 349, HCDR2 contains the amino acid sequence described in SEQ ID NO: 350, HCDR3 contains the amino acid sequence described in SEQ ID NO: 351, LCDR1 contains the amino acid sequence described in SEQ ID NO: 369, LCDR2 contains the amino acid sequence described in SEQ ID NO: 367, and LCDR3 contains the amino acid sequence described in SEQ ID NO:

378. (ss) HCDR1 contains the amino acid sequence described in SEQ ID NO: 355, HCDR2 contains the amino acid sequence described in SEQ ID NO: 350, HCDR3 contains the amino acid sequence described in SEQ ID NO: 351, LCDR1 contains the amino acid sequence described in SEQ ID NO: 375, LCDR2 contains the amino acid sequence described in SEQ ID NO: 367, and LCDR3 contains the amino acid sequence described in SEQ ID NO:

401. (tt) HCDR1 contains the amino acid sequence described in SEQ ID NO: 355, HCDR2 contains the amino acid sequence described in SEQ ID NO: 356, HCDR3 contains the amino acid sequence described in SEQ ID NO: 358, LCDR1 contains the amino acid sequence described in SEQ ID NO: 369, LCDR2 contains the amino acid sequence described in SEQ ID NO: 367, and LCDR3 contains the amino acid sequence described in SEQ ID NO:

402. (uu)HCDR1 contains the amino acid sequence described in SEQ ID NO: 349, HCDR2 contains the amino acid sequence described in SEQ ID NO: 356, HCDR3 contains the amino acid sequence described in SEQ ID NO: 358, LCDR1 contains the amino acid sequence described in SEQ ID NO: 369, LCDR2 contains the amino acid sequence described in SEQ ID NO: 367, and LCDR3 contains the amino acid sequence described in SEQ ID NO:

403. (vv) HCDR1 contains the amino acid sequence described in SEQ ID NO: 355, HCDR2 contains the amino acid sequence described in SEQ ID NO: 356, HCDR3 contains the amino acid sequence described in SEQ ID NO: 358, LCDR1 contains the amino acid sequence described in SEQ ID NO: 375, LCDR2 contains the amino acid sequence described in SEQ ID NO: 367, and LCDR3 contains the amino acid sequence described in SEQ ID NO:

376. (ww) HCDR1 contains the amino acid sequence described in SEQ ID NO: 355, HCDR2 contains the amino acid sequence described in SEQ ID NO: 350, HCDR3 contains the amino acid sequence described in SEQ ID NO: 351, LCDR1 contains the amino acid sequence described in SEQ ID NO: 369, LCDR2 contains the amino acid sequence described in SEQ ID NO: 367, and LCDR3 contains the amino acid sequence described in SEQ ID NO:

402. (xx) HCDR1 contains the amino acid sequence described in SEQ ID NO: 349, HCDR2 contains the amino acid sequence described in SEQ ID NO: 350, HCDR3 contains the amino acid sequence described in SEQ ID NO: 353, LCDR1 contains the amino acid sequence described in SEQ ID NO: 359, LCDR2 contains the amino acid sequence described in SEQ ID NO: 360, and LCDR3 contains the amino acid sequence described in SEQ ID NO:

404. (yy) HCDR1 contains the amino acid sequence described in SEQ ID NO: 355, HCDR2 contains the amino acid sequence described in SEQ ID NO: 350, HCDR3 contains the amino acid sequence described in SEQ ID NO: 357, LCDR1 contains the amino acid sequence described in SEQ ID NO: 375, LCDR2 contains the amino acid sequence described in SEQ ID NO: 367, and LCDR3 contains the amino acid sequence described in SEQ ID NO:

405. (zz) HCDR1 contains the amino acid sequence described in SEQ ID NO: 355, HCDR2 contains the amino acid sequence described in SEQ ID NO: 350, HCDR3 contains the amino acid sequence described in SEQ ID NO: 351, LCDR1 contains the amino acid sequence described in SEQ ID NO: 366, LCDR2 contains the amino acid sequence described in SEQ ID NO: 367, and LCDR3 contains the amino acid sequence described in SEQ ID NO:

406. (aaa) HCDR1 contains the amino acid sequence described in SEQ ID NO: 355, HCDR2 contains the amino acid sequence described in SEQ ID NO: 350, HCDR3 contains the amino acid sequence described in SEQ ID NO: 351, LCDR1 contains the amino acid sequence described in SEQ ID NO: 375, LCDR2 contains the amino acid sequence described in SEQ ID NO: 367, LCDR3 contains the amino acid sequence described in SEQ ID NO: 407, or (bbb) HCDR1 contains the amino acid sequence described in SEQ ID NO: 355, HCDR2 contains the amino acid sequence described in SEQ ID NO: 354, HCDR3 contains the amino acid sequence described in SEQ ID NO: 351, LCDR1 contains the amino acid sequence described in SEQ ID NO: 369, LCDR2 contains the amino acid sequence described in SEQ ID NO: 367, and LCDR3 contains the amino acid sequence described in SEQ ID NO:

379. Isolated double-conjugated antibody.

2. The antibody comprises a heavy chain variable domain VH and a light chain variable domain VL, wherein VH and VL are respectively sequence numbers 337 and 338, 213 and 214, 209 and 210, 219 and 220, 249 and 250, 211 and 212, 215 and 216, 217 and 218, 221 and 222, 223 and 224, 225 and 226, and Each of the following sequence numbers: 227 and 228, 229 and 230 respectively, 231 and 232 respectively, 233 and 234 respectively, 235 and 236 respectively, 237 and 238 respectively, 239 and 240 respectively, 241 and 242 respectively, 243 and 244 respectively, 245 and 246 respectively, 247 and 248 respectively, 251 and 252 respectively, 253 and 254 respectively, 255 and 256, respectively, sequence numbers 257 and 258, respectively, sequence numbers 259 and 260, respectively, sequence numbers 261 and 262, respectively, sequence numbers 263 and 264, respectively, sequence numbers 265 and 266, respectively, sequence numbers 267 and 268, respectively, sequence numbers 269 and 270, respectively, sequence numbers 271 and 272, respectively, sequence numbers 273 and 274, respectively, sequence numbers 275 and 276, respectively, sequence numbers 277 and 278, respectively, sequence numbers 279 and 280, respectively, sequence numbers 281 and 282, respectively, sequence numbers Numbers 283 and 284, sequence numbers 285 and 286 respectively, sequence numbers 287 and 288 respectively, sequence numbers 289 and 290 respectively, sequence numbers 291 and 292 respectively, sequence numbers 293 and 294 respectively, sequence numbers 295 and 296 respectively, sequence numbers 297 and 298 respectively, sequence numbers 299 and 300 respectively, sequence numbers 301 and 302 respectively, sequence numbers 303 and 304 respectively, sequence numbers 305 and 306 respectively, sequence numbers 307 and 308 respectively, sequence numbers 309 and 310 respectively,The isolated double-conjugated antibody according to claim 1, comprising the amino acid sequence described in SEQ ID NOs. 311 and 312, SEQ ID NOs. 313 and 314, SEQ ID NOs. 315 and 316, SEQ ID NOs. 317 and 318, SEQ ID NOs. 319 and 320, SEQ ID NOs. 321 and 322, SEQ ID NOs. 323 and 324, SEQ ID NOs. 325 and 326, SEQ ID NOs. 327 and 328, SEQ ID NOs. 329 and 330, SEQ ID NOs. 331 and 332, SEQ ID NOs. 333 and 334, SEQ ID NOs. 335 and 336, SEQ ID NOs. 339 and 340, SEQ ID NOs. 341 and 342, SEQ ID NOs. 343 and 344, SEQ ID NOs. 345 and 346, or SEQ ID NOs. 347 and 348, respectively.

3. The aforementioned antibodies are IgG, Fv, scFv, Fab, F(ab') 2 The isolated double-conjugated antibody according to claim 1, comprising a minibody, a diabody, or a triabody.

4. The isolated double-conjugated antibody according to claim 3, wherein the IgG is IgG1, IgG2, IgG3, or IgG4.

5. The isolated double-conjugated antibody according to claim 3, wherein the IgG comprises a heavy chain (HC) containing a mutation that reduces binding to the Fc receptor, and the double-conjugated antibody containing the mutation cannot bind to antibody-dependent cytotoxic components.

6. The isolated double-conjugated antibody according to claim 5, wherein the mutation is an L234A L235A P329G (LALAPG) mutation or an L234A L235A (LALA) mutation.

7. The isolated double-conjugated antibody according to claim 2, wherein the VH and VL each comprise the amino acid sequences described in SEQ ID NOs: 337 and 338, and the antibody comprises a heavy chain (HC) containing the L234A L235A P329G (LALAPG) mutation.

8. The isolated double-conjugated antibody according to claim 2, wherein the VH and VL each comprise the amino acid sequences described in SEQ ID NOs. 337 and 338, and the antibody comprises a heavy chain (HC) containing the L234A L235A (LALA) mutation.

9. A composition comprising an isolated double-conjugated antibody that binds to IL-13 and TSLP as described in claim 1 or claim 2, and a pharmaceutically acceptable carrier.

10. An isolated polynucleotide construct encoding an isolated double-conjugated antibody that binds to IL-13 and TSLP as described in claim 1 or claim 2.

11. An expression vector comprising the polynucleotide construct according to claim 10.

12. A host cell comprising the expression vector described in claim 11.

13. A composition comprising an isolated double-conjugated antibody that binds to IL-13 and TSLP according to claim 1 or 2, for the preparation of a pharmaceutical for treating a disease or condition.

14. The composition according to claim 13, wherein the disease or condition is an allergic or respiratory condition, an inflammatory or autoimmune condition, or a tumor or cancer.

15. The composition according to claim 13, wherein the disease or condition is asthma, allergic asthma, non-allergic asthma, severe asthma, mild asthma, chronic obstructive pulmonary disease (COPD), a condition with airway inflammation, cystic fibrosis, allergic lung disease, airway hyperresponsiveness, goblet cell dysplasia, excessive mucus secretion, airway remodeling, pulmonary fibrosis, atopic dermatitis, urticaria, eczema, allergic enterogastritis, allergic rhinitis, inflammatory bowel disease, cirrhosis or fibrosis, or a combination thereof.