Novel engineered capsid serotypes of recombinant adeno-associated virus vectors exhibiting improved transduction efficiency and broad distribution in the brain.

Abstract

Engineered brain-tropic adeno-associated viral vectors and methods for their use are disclosed.

Description

Technical Field

[0001] I. Cross - reference to Related Applications This application claims the benefit of U.S. Provisional Patent Application No. 63 / 074,548, filed on September 4, 2020, the disclosure of which is hereby expressly incorporated by reference in its entirety.

Background Art

[0002] II. Background Art Adeno - associated virus (AAV) vectors are often used in gene therapy for neurological diseases due to their safety profile and promising results in clinical trials. One challenge for AAV - based gene therapy is the effective transduction of a large number of appropriate cell types. The brain and nerve tissues are particularly difficult sites for effective transduction. What is needed is a new vector that can effectively and efficiently transduce nerve tissues, especially the brain.

Summary of the Invention

[0003] III. Summary of the Invention Engineered adeno - associated virus (AAV) vectors and their use are disclosed.

[0004] In one aspect, disclosed herein is an engineered adeno - associated virus (AAV) vector comprising a recombinant 2 (Rec2) capsid having one or more substitutions, insertions, and / or deletions at a heparin - binding locus (e.g., substitutions, deletions, and / or insertions at residues corresponding to residues between residues 561 and 591 of SEQ ID NO: 1), wherein the substitution confers neuron - tropism to the vector. In one aspect, the one or more substitutions occur at residues corresponding to residues 585, 587, 588, 589, and / or 594 of SEQ ID NO: 1 (e.g., substitutions such as Q588P, Q589L, Q589I, Q589V, Q589G, Q594L, Q594I, and / or Q594V).

[0005] Also disclosed herein are regulatory elements (e.g., Woodchuck post-transcriptional regulatory element (WPRE) sequences) and transgenes operably linked to promoters (e.g., β-galactosidase 1 (GLB1), Niemann-Pick C1 (NPC1), apolipoprotein E (APOE), GD3 synthase, huntingtin (Htt), interleukin (IL)-10 (IL-10), myelin oligodendrocyte glycoprotein (MOG), mitogen-activated protein kinase). 8 Interaction Protein 3 (MAPKA8IP3), Survival Motor Neuron (SMN) 1 (SMN1), SMN2, Cas9, β-glucocerebrosidase (GBA), sphingomyelin phosphodiesterase 1 (SMPD1), beta-hexosaminidase A (HEXA), nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), neurotrophin (NT) 3 (NT-3), NT-4 / 5, NT-6, glial cell-derived neurotrophic factor (GDNF), ciliary neurotrophic factor (CNTF), white Blood-blocking factor (LIF), insulin-like growth factor (IGF) 1 (IGF-1), β-fibroblast growth factor (FGF), Neurturin, Percefin, Artemin, transforming growth factor (TGF) alpha (TGFα), TGFβ, IGF-2, platelet-derived growth factor (PDGF), epidermal growth factor (EGF), cardiotropin, vascular endothelial growth factor (VEGF), Sonic Hedgehog (SHH), bone morphogenetic protein (BMP), FGF20, vasoactive enteric peptide (VIP), p An engineered AAV vector according to any prior embodiment, further comprising: a first expression cassette containing leiotrophin (PTN), aromatic L-amino acid decarboxylase (AADC), TH, 5-hydroxytryptamine (5HT), hepatocyte growth factor (HGF), miRNA-222, miRNA-7, and / or miRNA-132, etc.; and a second expression cassette containing a tissue-specific promoter operably linked to an RNA silencing element that targets a regulatory element within the first expression cassette.

[0006] In one embodiment, disclosed herein is the incorporation of genes (e.g., β-galactosidase 1 (GLB1), Niemann-Pick C1 (NPC1), apolipoprotein E (APOE), GD3 synthase, huntingtin (Htt), interleukin (IL)-10 (IL-10), myelin oligodendrocyte glycoprotein (MOG), mitogen-activated protein kinase 8) into neural tissue within the target brain (e.g., the frontal cortex and / or prefrontal cortex). Interacting protein 3 (MAPKA8IP3), survival motor neuron (SMN) 1 (SMN1), SMN2, Cas9, β-glucocerebrosidase (GBA), sphingomyelin phosphodiesterase 1 (SMPD1), beta-hexosaminidase A (HEXA), nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), neurotrophin (NT) 3 (NT-3), NT-4 / 5, NT-6, glial cell-derived neurotrophic factor (G DNF), ciliary neurotrophic factor (CNTF), leukemia inhibitory factor (LIF), insulin-like growth factor (IGF) 1 (IGF-1), β-fibroblast growth factor (FGF), Neurturin, Percefin, Artemin, transforming growth factor (TGF) alpha (TGFα), TGFβ, IGF-2, platelet-derived growth factor (PDGF), epidermal growth factor (EGF), cardiotropin, vascular endothelial growth factor (VEGF), sonic hedgehog A method for delivering (such as serotonin (SHH), bone morphogenetic protein (BMP), FGF20, vasoactive intestinal peptide (VIP), pleiotrophin (PTN), aromatic L-amino acid decarboxylase (AADC), TH, 5-hydroxytryptamine (5HT), hepatocyte growth factor (HGF), miRNA-222, miRNA-7, and / or miRNA-132) is provided, comprising administering to a subject an engineered AAV vector as described in any prior embodiment. In some embodiments, the AAV vector has a transduction efficiency of at least 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, or 75%.Methods for delivering genes to nerve tissue are also disclosed, in which the AAV vector is administered systemically (for example, intravenously, including but not limited to IV injection or IV infusion, and / or into the posterior orbit) or via cerebrospinal fluid injection.

[0007] Also disclosed herein are methods for treating, inhibiting, reducing, mitigating, improving, and / or preventing neurological disorders in subjects (e.g., Alzheimer's disease, Parkinson's disease, multiple system atrophy (MSA), lysosomal storage disease (LSD), and / or muscular dystrophy), wherein the subject is subjected to an engineered AAV vector as described in any prior embodiment encoding a therapeutic agent (e.g., but not limited to β-galactosidase 1 (GLB1), Niemann-Pick C1 (NPC1), apolipoprotein E( APOE), GD3 synthase, huntingtin (Htt), interleukin (IL)-10 (IL-10), myelin oligodendrocyte glycoprotein (MOG), mitogen-activated protein kinase 8-interacting protein 3 (MAPKA8IP3), survival motor neuron (SMN) 1 (SMN1), SMN2, Cas9, β-glucocerebrosidase (GBA), sphingomyelin phosphodiesterase 1 (SMPD1), beta-hexosaminidase A (HEXA), neurogenesis Growth Factor (NGF), Brain-Derived Neurotrophic Factor (BDNF), Neurotrophin (NT) 3 (NT-3), NT-4 / 5, NT-6, Glial Cell-Derived Neurotrophic Factor (GDNF), Ciliary Body Neurotrophic Factor (CNTF), Leukemia Inhibitor (LIF), Insulin-like Growth Factor (IGF) 1 (IGF-1), β-Fibroblast Growth Factor (FGF), Neurturin, Percefin, Artemin, Transforming Growth Factor (TGF) Alpha (TGFα), TGFβ, IGF-2, Platelet-Derived Growth Factor ( This includes administering a transgene containing PDGF, epidermal growth factor (EGF), cardiotropin, vascular endothelial growth factor (VEGF), sonic hedgehog (SHH), bone morphogenetic protein (BMP), FGF20, vasoactive intestinal peptide (VIP), pleiotrophin (PTN), aromatic L-amino acid decarboxylase (AADC), TH, 5-hydroxytryptamine (5HT), hepatocyte growth factor (HGF), miRNA-222, miRNA-7, and / or miRNA-132.Also disclosed are methods for treating, inhibiting, reducing, mitigating, improving, and / or preventing neurological disorders described in any prior embodiment, wherein the AAV vector is administered systemically (e.g., intravenously, including, but not limited to, IV injection or IV infusion, posterior orbital, or via cerebrospinal fluid injection). [Brief explanation of the drawing]

[0008] IV. Brief Description of the Drawings The accompanying drawings incorporated herein and forming part thereof illustrate some embodiments and, together with the description, illustrate the compositions and methods disclosed. [Figure 1] [Figure 1] Representative GFP fluorescence 3 weeks after unilateral injection of LC.V1 vector into the striatum of mice. [Figure 2] [Figure 2] This figure shows rat 1 transduced with AAV:LC.V1 (lot number LC-195); titer: 1.2 × 10¹³ vg / ml. Delivery was by CED to the right striatum (15 μl; 1 μl / min). Euthanasia was performed 3 weeks after transduction. Staining was IHC for GFP (transgene). [Figure 3] [Figure 3] Two rats transduced with AAV:LC.V1 (lot number LC-195); titer: 1.2 × 10¹³ vg / ml are shown. Delivery was by CED to the right striatum (15 μl; 1 μl / min). Euthanasia was performed 3 weeks after transduction. Staining was IHC for GFP (transgene). [Figure 4-1] [Figures 4A-4C] Show intracerebral delivery of LC.V1 to the thalamus in non-human primates (NHP). 4A - NHP brain section stained with the neuronal marker NeuN (red fluorescence). 4B - NHP brain section stained for the transgene / reporter gene GFP (green fluorescence). 4C - Combined staining with NeuN+GFP showing near-complete coverage of the monkey thalamus. [Figures 4D-4K] Show fluorescent staining of NHP brain sections showing transduction of pyramidal neurons in laminar V within the prefrontal cortex and frontal cortex. This transduction was a result of retrograde transport of LC.V1 from the injection site (thalamus). Red fluorescence - staining for the neuronal marker, NeuN; green fluorescence - reporter gene, GFP. [Figure 4-2] Same as above. [Figure 5-1] [Figures 5A-5C] Higher magnification images of representative NHP-stained (double fluorescence) brain sections from the prefrontal cortex showing neuronal transduction in layer V. 5A - Brain section stained for the neuronal marker, NeuN (red fluorescence). 5B - Brain section stained for the reporter gene, GFP (green fluorescence). 5C - Combined staining for NeuN + GFP. [Figures 5D-5H] Results of retrograde transport from the thalamus to the hippocampus / precipitous area by LC.V1 vector injected into the thalamus (primary injection site). NHP sections were stained for the neuronal marker, NeuN (red fluorescence), and the reporter gene, GFP (green fluorescence). Higher magnification images of brain sections from that region are shown in panels 5F-5H. [Figure 5I] Efficiency of neuronal transduction using LC.V1 vector injected into the NHP thalamus. Values ​​were calculated from brain sections stained with double fluorescence for NeuN and GFP. [Figure 5-2] Same as above. [Figure 5-3] Same as above. [Figure 5-4] Same as above. [Figure 6] [Figures 6A-6D] These figures show neuronal transduction of the primary target—midbrain (VTA and substantia nigra)—using the LC.V1 vector (6A), and its anterograde transport to distant brain structures, the caudate nucleus (6B and 6C), and the caudate nucleus putamen (6B and 6D). NHP sections were stained with the neuronal marker NeuN (red fluorescence) and the reporter gene GFP (green fluorescence). [Figure 7-1][Figures 7A-7F] Demonstrates that the distribution of LC.V1 vectors within the brain parenchyma can be monitored by real-time MRI. 7A - NHP thalamic brain section stained with double fluorescence for the neuronal marker NeuN (red fluorescence) and the reporter gene GFP (green fluorescence). 7B - MRI scan from real-time MRI during injection of LC.V1 mixed with the MRI contrast agent ProHance. 7C - Superimposed Figures 7A and 7B showing a near-perfect correlation between GFP expression from the LC.V1 vector and the area of ​​ProHance signaling. 7D - MRI scan from real-time MRI during injection of LC.V1 mixed with the MRI contrast agent ProHance into the right midbrain (VTA and substantia nigra). 7E - NHP brain section stained with double fluorescence for the neuronal marker NeuN (red fluorescence) and the reporter gene GFP (green fluorescence). 7F - Superimposed Figures 7D and 7E showing a near-perfect correlation between GFP expression from the LC.V1 vector and the area of ​​ProHance signaling. [Figure 7-2] Same as above. [Figure 8-1] [Figure 8] Representative images of transgene transduction (GFP) from representative animals at different brain levels along the anterior-posterior axis. Animals received either systemic injection via the right posterior orbital sinus (RO) or tail vein (TV), or CSF injection via left ventricular delivery (LV). Each animal received 50 μL systemically or 25 μL in CSF with AAV:LC.V1 at a titer of 8.36E+13 vg / mL (lot number CS1851). Immunohistochemistry of GFP (transgene) 1:1000 using cresyl violet counterstaining. Abbreviations: prefrontal cortex (PFCtx), striatum (Str), thalamus (Thal), substantia nigra (SN), cerebellum (Cb), green fluorescent protein (GFP). [Figure 8-2] Same as above. [Figure 8-3] Same as above. [Figure 9][Figure 9] Representative images of transgene transduction (GFP) in different peripheral organs from representative animals are shown. Animals received either systemic injection via the right retroorbital sinus (RO) or tail vein (TV), or CSF injection via left ventricular delivery (LV). Each animal received 50 μL systemically or 25 μL in CSF with AAV:LC.V1 at a titer of 8.36E+13 vg / mL (lot number CS1851). Immunohistochemistry for GFP (transgene) 1:1000 using cresyl violet counterstaining. Naive mice (not injected) were included as negative controls to show the absence of the GFP signal. The green signal indicates the innate GFP signal from vector transduction. Abbreviations: Wild type (WT), Green fluorescent protein (GFP). [Figure 10] [Figure 10] Representative images of transgene transduction (GFP) in the hippocampus and dentate gyrus from representative animals. Animals received either systemic injection via the right retroorbital sinus (RO) or tail vein (TV), or CSF injection via left ventricular delivery (LV). Each animal received 50 μL systemically or 25 μL in CSF with AAV:LC.V1 at a titer of 8.36E+13 vg / mL (lot number CS1851). Immunohistochemistry of GFP (transgene) 1:1000 using cresyl violet counterstaining. Abbreviations: hippocampal cornuammonis (CA), dentate gyrus (DG), green fluorescent protein (GFP). [Figure 11] [Figure 11] Representative images of neuronal directional evaluation (NeuN) are shown. Double immunofluorescence staining for GFP (transgene, green) and the specific neuronal marker NeuN (red). White arrowheads indicate NeuN / GFP colocalization, confirming the neuronal directional properties of the LC.V1 vector. Blue arrowheads indicate transduced non-NeuN cells. Abbreviations: Green fluorescent protein (GFP), Neuronal nuclear protein (NeuN) [Figure 12] [Figure 12] No explanation provided. [Modes for carrying out the invention]

[0009] V. Modes for carrying out the invention Before disclosing and describing the compounds, compositions, articles, devices, and / or methods of the present invention, it should be understood that they are not limited to specific synthesis methods or specific recombinant biotechnology methods unless otherwise specified, and are not limited to specific reagents (which, of course, can change) unless otherwise specified. It should also be understood that the terms used herein are intended solely to describe specific embodiments and are not intended to limit them.

[0010] A.Definition As used herein and in the appended claims, the singular forms "a," "an," and "the" include multiple references unless the context clearly indicates otherwise. For example, a reference to "pharmaceutical carriers" includes mixtures of two or more such carriers.

[0011] In this specification, a range may be expressed as being “about” a particular value and / or “about” another particular value. When such a range is expressed, another embodiment includes from that particular value and / or to the other particular value. Similarly, when a value is expressed as an approximation, it will be understood that the use of the antecedent “about” forms another embodiment of the particular value. It will be further understood that each endpoint of a range is significant both in relation to and independent of the other endpoint. It is also understood that several values disclosed herein exist, and in addition to the value itself, each value is disclosed herein as “about” that particular value. For example, if the value “10” is disclosed, “about 10” is also disclosed. As will be properly understood by those skilled in the art, when it is disclosed that a value is “less than that value,” it is also understood that the possible ranges “greater than that value” and between that value are also disclosed. For example, if the value “10” is disclosed, “less than 10” as well as “greater than 10” are also disclosed. Also, throughout this application, data is provided in several different formats, and it is understood that this data represents ranges of endpoints and starting points, as well as any combination of data points. For example, if a particular data point “10” and a particular data point 15 are disclosed, in addition to between 10 and 15, values greater than 10, greater than or equal to 10, less than 10, less than or equal to 10, and equal to 10, greater than 15, greater than or equal to 15, less than 15, less than or equal to 15, and equal to 15 are understood to be disclosed. It is also understood that each unit between two particular units is also disclosed. For example, if 10 and 15 are disclosed, 11, 12, 13, and 14 are also disclosed.

[0012] In this specification and the appended claims, reference is made to several terms that are defined to have the following meanings.

[0013] “Optional” or “optionally” means that the event or circumstance described later may or may not occur, and this description includes instances where the event or circumstance occurs and instances where it does not occur.

[0014] "Increase" can refer to any change that results in a greater quantity of symptoms, disease, composition, condition, or activity. An increase may be a statistically significant increase in any individual value, median, or mean of a condition, symptom, activity, or composition. Thus, an increase may be an increase of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100%, insofar as the increase is statistically significant.

[0015] "Reduction" can refer to any change that results in a smaller amount of symptom, disease, composition, condition, or activity. A substance is also understood to decrease the genetic output of a gene if the genetic output of the gene product containing that substance is less than the genetic output of the gene product without that substance. For example, a reduction could also be a change in the symptoms of a disorder, such that the symptoms are less severe than previously observed. A reduction can be a statistically significant decrease in any individual, median, or mean value of a condition, symptom, activity, or composition. Thus, a reduction can be a decrease of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100%, insofar as the reduction is statistically significant.

[0016] "Inhibit," "to inhibit," and "inhibition" mean reducing activity, response, condition, disease, or other biological parameter. This may include, but is not limited to, the complete elimination of activity, response, condition, or disease. This may also include, for example, a 10% reduction of activity, response, condition, or disease compared to natural or control levels. Thus, a reduction may be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any amount in between, compared to natural or control levels.

[0017] "Reduce," or other forms of this term, such as "reducing" or "reduction," means a decrease in an event or characteristic (e.g., tumor growth). This is typically related to some standard or expected value; in other words, it is relative, but it is understood that it is not always necessary to refer to a standard or relative value. For example, "to reduce tumor growth" means to reduce the rate of tumor growth compared to a standard or control.

[0018] "Prevent" or other forms of the word, such as "preventing" or "prevention," means to stop a particular event or characteristic, to stabilize or slow the development or progression of a particular event or characteristic, or to minimize the likelihood of a particular event or characteristic occurring. Prevention is typically more absolute than reduction, for example, and therefore does not require comparison with a contrast. Where used herein, something may be reduced but not preventable, while something that is reduced may be prevented. Similarly, something may be prevented but not reduced, while something that is prevented may be reduced. Where reduction or prevention is used, it should be understood that the use of other words is also expressly disclosed unless specifically designated otherwise.

[0019] The term "subject" refers to any individual that is the target of administration or treatment. A subject may be a vertebrate, e.g., a mammal. In one embodiment, a subject may be a human, a non-human primate, a cattle, a horse, a pig, a dog, or a cat. A subject may also be a guinea pig, a rat, a hamster, a rabbit, a mouse, or a mole. Thus, a subject may be a human or a veterinary patient. The term "patient" refers to a subject under the treatment of a clinician, e.g., a physician.

[0020] The term "therapeutically effective" means that the amount of the composition used is sufficient to alleviate one or more causes or symptoms of a disease or disorder. Such alleviation may only require reduction or modification, and does not necessarily have to be elimination.

[0021] The term “treatment” refers to the medical management of a patient with the intention of curing, alleviating, stabilizing, or preventing a disease, pathological condition, or disorder. This term includes active treatment, i.e., treatment specifically directed toward improvement of a disease, pathological condition, or disorder, and causal treatment, i.e., treatment directed toward the elimination of the cause of the associated disease, pathological condition, or disorder. In addition, this term includes palliative treatment, i.e., treatment designed to alleviate symptoms rather than cure the disease, pathological condition, or disorder; preventive treatment, i.e., treatment directed toward minimizing, or partially or completely inhibiting, the onset of the associated disease, pathological condition, or disorder; and adjunct treatment, i.e., treatment used to supplement another specific therapy directed toward improvement of the associated disease, pathological condition, or disorder.

[0022] "Biocompatibility" generally refers to materials and any metabolites or their breakdown products that are generally non-toxic to the recipient and do not cause serious side effects in the subject.

[0023] "Containing" is intended to mean that a composition, method, etc., includes the enumerated elements but does not exclude other elements. When used to define compositions and methods, "essentially consisting of" shall mean including the enumerated elements but excluding other elements that have any essential importance to the combination. Thus, a composition essentially consisting of the elements defined herein does not exclude trace contaminants and pharmaceutically acceptable carriers, e.g., phosphate-buffered saline, preservatives, etc., from isolation and purification methods. "Consisting of" shall mean excluding anything beyond trace elements of other components for administering the composition provided and / or claimed in this disclosure, and substantial method steps. Embodiments defined by each of these transitional terms are within the scope of this disclosure.

[0024] A "control" is an alternative subject or sample used in an experiment for comparative purposes. A control may be "positive" or "negative."

[0025] The “effective dose” of a drug refers to a sufficient amount of the drug to provide the desired effect. The amount of drug that is “effective” will vary from subject to subject, depending on many factors such as the subject’s age and general condition, and the specific drug. Therefore, it is not always possible to specify a quantifiable “effective dose.” However, the appropriate “effective dose” for any subject may be determined by those skilled in the art using routine experiments. Also, as used herein, unless otherwise specified, the “effective dose” of a drug may also refer to an amount that covers both the therapeutic effective dose and the prophylactic effective dose. The “effective dose” of a drug required to achieve a therapeutic effect may vary depending on factors such as the subject’s age, sex, and weight. The administration regimen may be adjusted to provide the optimal therapeutic response. For example, the dose may be divided into several doses and administered daily, or the dose may be reduced proportionally as indicated by the urgency of the treatment situation.

[0026] A “pharmaceutically acceptable” ingredient may mean an ingredient that is not biologically or otherwise undesirable, i.e., an ingredient that can be incorporated into a pharmaceutical formulation provided herein and administered to a subject as described herein, without causing a significantly undesirable biological effect or interacting in an adverse manner with any other ingredient in the formulation containing it. When used in reference to administration to humans, this term generally means that the ingredient meets the necessary standards for toxicity and manufacturing testing, or that it is included in the Inactive Ingredients Guide prepared by the U.S. Food and Drug Administration.

[0027] A “pharmaceutically acceptable carrier” (sometimes referred to as “carrier”) generally means a carrier or excipient useful in the preparation of safe and non-toxic pharmaceutical or therapeutic compositions, and includes carriers that are permitted for veterinary and / or human pharmaceutical or therapeutic use. The terms “carrier” or “pharmaceutically acceptable carrier” may include, but are not limited to, phosphate-buffered salines, water, emulsions (such as oil / water or water / oil emulsions), and / or various types of wetting agents. As used herein, the term “carrier” includes, but is not limited to, any excipient, diluent, filler, salt, buffer, stabilizer, solubilizer, lipid, stabilizer, or material well known in the art for use in pharmaceutical formulations, and materials further described herein.

[0028] "Pharmacologically active" (or simply "active") can refer to a pharmacologically active derivative or analog that has the same type of pharmacological activity as the parent compound, and to approximately the same degree (e.g., salts, esters, amides, complexes, metabolites, isomers, fragments, etc.).

[0029] "Therapeutic agent" refers to any composition having beneficial biological effects. Beneficial biological effects include both therapeutic effects, e.g., treatment of disorders or other undesirable physiological conditions, and preventive effects, e.g., prevention of disorders or other undesirable physiological conditions (e.g., non-immunogenic cancer). These terms also encompass, but are not limited to, pharmaceutically acceptable, pharmacologically active derivatives of beneficial agents specifically referred to herein, including salts, esters, amides, precursors, active metabolites, isomers, fragments, analogs, etc. When the term "therapeutic agent" is used, and subsequently when a particular agent is specifically identified, it should be understood that this term includes the agent itself, as well as pharmaceutically acceptable, pharmacologically active salts, esters, amides, precursors, complexes, active metabolites, isomers, fragments, analogs, etc.

[0030] The “therapeutic effective amount” or “therapeutic effective dose” of a composition (e.g., a composition containing a drug) refers to the amount effective in achieving a desired therapeutic outcome. In some embodiments, the desired therapeutic outcome is the control of a neurological disorder or disability. A given therapeutic effective amount of a therapeutic agent will typically vary with respect to the type and severity of the disorder or disease being treated, as well as factors such as the age, sex, and weight of the subject. The term can also refer to the amount of a therapeutic agent, or the rate of delivery of the therapeutic agent (e.g., amount over time), that is effective in promoting a desired therapeutic effect, such as pain relief. The exact desired therapeutic effect will vary according to the condition being treated, the subject's tolerance, the drug and / or drug formulation being administered (e.g., the potency of the therapeutic agent, the concentration of the drug in the formulation, etc.), and various other factors understood by those skilled in the art. In some cases, the desired biological or medical response may be achieved after multiple administrations of the composition over several days, weeks, or years.

[0031] Throughout this application, various publications are referenced. The disclosures of these publications, in their entirety, are incorporated herein by reference to provide a more complete description of the state of the art relating to this application. The disclosed references are also discussed in the texts relating thereto, and the materials contained therein are incorporated herein by reference individually and specifically.

[0032] B. Composition The components used to prepare the disclosed compositions, as well as the compositions themselves used in the methods disclosed herein, are disclosed. When these and other materials are disclosed herein, and combinations, subsets, interactions, groups, etc., of these materials are disclosed, specific references to each of the various individual and collective combinations and substitutions of these compounds may not be explicitly disclosed, but it is understood that each is specifically intended and described herein. For example, when a particular engineered adeno-associated virus vector is disclosed and considered, and several modifications that can be made to several molecules including the engineered adeno-associated virus vector are considered, specifically, each and all combinations and substitutions of the engineered adeno-associated virus vectors, as well as modifications that are possible unless specifically indicated otherwise, are intended. Thus, when AD is disclosed as an example of a combination molecule, as well as classes A, B, and C of molecules, as well as classes D, E, and F, it is understood that each is individually and collectively intended, even if each is not individually enumerated, i.e., AE, AF, BD, BE, BF, CD, CE, and CF are disclosed. Similarly, any subset or combination of these is also disclosed. Therefore, for example, the subgroups AE, BF, and CE would be considered disclosed. This concept applies to all aspects of this application, including, but not limited to, steps in a method for preparing and using the disclosed compositions. Thus, where various additional steps that may be implemented exist, it is understood that each of these additional steps may be implemented in any particular embodiment or combination of embodiments of the disclosed method.

[0033] Improving the efficiency of viral gene delivery is becoming increasingly important for enhancing the success of various clinical trials. We created a novel hybrid recombinant AAV serotype, rAAV2 / rec2, by combining structural domains of different rAAV serotypes isolated from primate brains. However, the Rec2 serotype was found to be no different from the naturally occurring AAV2 capsid in terms of retinal transduction. The Rec2 capsid serotype transduces adipose tissue with far greater efficiency than naturally occurring AAV serotypes. One concern with the Rec2 capsid is its high efficiency for hepatic transduction, which hinders the need for selective gene transfer into adipose tissue. To generate a novel serotype with improved adipose-specificity and eliminate hepatic transduction, we created several point mutations in the Rec2 capsid by analyzing the amino acid sequences of the capsids between AAV8, Rec2, Rec3, and AAV2.

[0034] In one embodiment, disclosed herein is an engineered adeno-associated virus (AAV) vector comprising a recombinant 2 (Rec2) capsid containing one or more substitutions, insertions, and / or deletions at the heparin-binding locus (e.g., substitutions, deletions, and / or insertions at residues corresponding to the residues between residues 561 and 591 of the Rec2 capsid protein shown in SEQ ID NO: 1), wherein the substitutions confer directivity to nerve tissue to the vector. In one embodiment, the one or more substitutions occur at residues corresponding to residues 585, 587, 588, 589, and / or 594 of SEQ ID NO: 1 (e.g., substitutions such as Q588P, Q589L, Q589I, Q589V, Q589G, Q594L, Q594I, and / or Q594V). In one embodiment, disclosed herein is an engineered adeno-associated virus (AAV) vector comprising a recombinant 2 (Rec2) capsid containing the Q588P, Q589L, and Q594L substitutions, as shown in SEQ ID NO: 1 and SEQ ID NO: 6.

[0035] Also disclosed herein are engineered AAV vectors further comprising a first expression cassette containing a regulatory element (e.g., a woodchuck post-transcriptional regulatory element (WPRE) sequence) and a transgene operably ligated to a promoter. In one embodiment, the AAV vector may also comprise a second cassette, the second cassette comprising a tissue-specific promoter operably ligated to an RNA silencing element that targets a regulatory element in the first expression cassette.

[0036] 1.Homology / Identity It should be understood that one way of defining any known variants and derivatives or possible variants of the genes and proteins disclosed herein is by defining the variants and derivatives in terms of homology to a particular known sequence. Specifically, variants of these and other genes and proteins disclosed herein that have at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, and 99 percent homology to the stated sequence are disclosed. Those skilled in the art will readily understand how to determine the homology of two proteins or nucleic acids, for example, genes. For example, homology can be calculated after aligning the two sequences so that the level of homology is highest.

[0037] Another method for calculating homology can be performed by publicly available algorithms. Optimal alignment of sequences for comparison can be performed by the local homology algorithm of Smith and Waterman Adv.Appl.Math.2:482(1981), the homology alignment algorithm of Needleman and Wunsch, J.MoL Biol.48:443(1970), the similarity search method of Pearson and Lipman, Proc.Natl.Acad.Sci.USA85:2444(1988), computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA, Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI), or by inspection.

[0038] For example, the same kind of homology can be obtained for nucleic acids by algorithms disclosed in Zuker, M. Science 244:48-52, 1989, Jaeger et al. Proc. Natl. Acad. Sci. USA 86:7706-7710, 1989, and Jaeger et al. Methods Enzymol. 183:281-306, 1989, which are incorporated herein by reference at least for materials related to nucleic acid alignment.

[0039] 2. Delivery of the composition to cells Several compositions and methods exist that can be used to deliver nucleic acids to cells, either in vitro or in vivo. These methods and compositions can be broadly classified into two classes: virus-based delivery systems and non-virus-based delivery systems. For example, nucleic acids can be delivered through several direct delivery systems such as electroporation, lipofection, calcium phosphate precipitation, plasmids, viral vectors, viral nucleic acids, phage nucleic acids, phages, and cosmids, or through the transfer of genetic material in cells or carriers, such as cationic liposomes. Suitable means for transfection, including viral vectors, chemical transfectants, or physico-mechanical methods such as electroporation and direct diffusion of DNA, are described, for example, in Wolff, JA, et al., Science, 247, 1465-1468, (1990) and Wolff, JANature, 352, 815-818, (1991). Such methods are well known in the art and are readily adaptable for use with the compositions and methods described herein. In certain cases, this method may be modified to function specifically with large DNA molecules. Furthermore, by using these methods and leveraging the carrier's targeting properties, specific diseases and cell populations can be targeted.

[0040] a) Nucleic acid-based delivery systems A transfer vector can be any nucleotide construct used to deliver a gene to a cell (e.g., a plasmid) or used as part of a general strategy for gene delivery, for example, as part of a recombinant retrovirus or adenovirus (Ram et al. Cancer Res. 53:83-88, (1993)).

[0041] As used herein, a viral vector is a drug that delivers a transgene to a cell (e.g., a brain cell) without degradation and includes a promoter that brings the gene to expression within the cell to which it is delivered. In some embodiments, the engineered viral vectors disclosed herein are derived from adeno-associated vectors (AAVs).

[0042] (1) Adeno-associated virus vector Another type of viral vector is based on adeno-associated virus (AAV). This defective parvovirus is a preferred vector because it can infect many cell types and is non-pathogenic to humans. AAV-type vectors can transport approximately 4–5 kb of DNA, and wild-type AAV is known to stably insert into chromosome 19 (e.g., AAV integration site 1 (AAVS1)). In one embodiment, the disclosed AAV vector may include a selection marker, such as a gene encoding green fluorescent protein, GFP.

[0043] In one embodiment, the AAV contains a pair of inverted terminal repeats (ITRs) adjacent to at least one cassette containing a promoter that directs cell-specific expression ligated to a heterologous gene. In this context, heterologous refers to any nucleotide sequence or gene that is not native to the AAV or B19 parvovirus.

[0044] Typically, the AAV and B19 coding regions are deleted, resulting in a safe, non-cytotoxic vector. AAV ITRs (typically derived from AAV2), or modifications thereof, confer infectivity and site-specific integration rather than cytotoxicity, and the promoter directs cell-specific expression. U.S. Patent No. 6,261,834 is incorporated herein by reference with respect to materials related to AAV vectors.

[0045] Therefore, the disclosed vectors are designed to persist in the nucleus as extrachromosomal cells and not integrate into the human genome. This ability to persist without integration enhances the safety of these vectors.

[0046] Inserted genes in viruses and retroviruses typically contain promoters and / or enhancers that help control the expression of the desired gene product. A promoter is generally a DNA sequence that functions when it is fixed relative to the transcription start site. Promoters contain core elements necessary for the fundamental interaction between RNA polymerase and transcription factors, and may also contain upstream and response elements.

[0047] b) In vivo / Ex vivo As described above, the composition can be administered within a pharmaceutically acceptable carrier and delivered in vivo and / or ex vivo to target cells by various mechanisms known in the art (e.g., naked DNA uptake, liposome fusion, intramuscular injection of DNA via gene gun, endocytosis, etc.).

[0048] When using the ex vivo method, cells or tissues can be removed and maintained outside the body according to standard protocols well known in the art. The composition can be introduced into cells via any gene transfer mechanism, such as calcium phosphate-mediated gene delivery, electroporation, microinjection, or proteoliposomes. Transduced cells can then be injected into the subject (e.g., in a pharmaceutically acceptable carrier) or orthotopically transplanted and returned, according to standard methods for the cell or tissue type. Standard methods are known for the transplantation or injection of various cells into the subject.

[0049] 3. Expression System Nucleic acids delivered to cells typically contain gene expression regulatory systems. For example, inserted genes in viruses and retroviral systems usually contain promoters and / or enhancers that help regulate the expression of the desired gene product. A promoter is generally a DNA sequence that functions when it is fixed in a position relative to the transcription start site. Promoters contain core elements necessary for the basic interaction between RNA polymerase and transcription factors, and may contain upstream and response elements.

[0050] a) Virus promoters and enhancers Preferred promoters for controlling transcription from vectors within mammalian host cells can be obtained from a variety of sources, e.g., from the genomes of viruses such as polyomas, monkey virus 40 (SV40), adenoviruses, retroviruses, hepatitis B virus, and most preferably cytomegalovirus, or from heterologous mammalian promoters, such as the beta-actin promoter. Early and late promoters of SV40 virus are conveniently obtained as SV40 restriction fragments that also contain the SV40 virus origin of replication (Fiers et al., Nature, 273:113 (1978)). The immediate early promoter of human cytomegalovirus is conveniently obtained as the HindIII E restriction fragment (Greenway, PJ et al., Gene 18:355-360 (1982)). Of course, promoters derived from host cells or related species are also useful herein.

[0051] An enhancer generally refers to a DNA sequence that functions without a fixed distance from the transcription start site and can be either 5' (Laimins, L. et al., Proc. Natl. Acad. Sci. 78:993 (1981)) or 3' (Lusky, ML, et al., Mol. Cell Bio. 3:1108 (1983)). Furthermore, enhancers can be located within introns (Banerji, J. Let al., Cell 33:729 (1983)) and within the coding sequence itself (Osborne, TF, et al., Mol. Cell Bio. 4:1293 (1984)). They are typically 10–300 bp in length and function in cis. Enhancers function to increase transcription from nearby promoters. Enhancers also often contain response elements that mediate transcriptional regulation. Promoters may also contain response elements that mediate transcriptional regulation. Enhancers often determine the regulation of gene expression. Many enhancer sequences are now known from mammalian genes (globin, elastase, albumin, fetoprotein, and insulin), but typically, eukaryotic virus-derived enhancers will be used for general expression. Preferred examples include the SV40 enhancer (bp100-270) at the late origin of replication, the cytomegalovirus early promoter enhancer, the polyoma enhancer at the late origin of replication, and the adenovirus enhancer.

[0052] Promoters and / or enhancers can be specifically activated by either light or specific chemical events that trigger their function. The system can be modified with reagents such as tetracycline and dexamethasone. There are also methods to enhance gene expression in viral vectors by exposure to irradiation, such as gamma irradiation, or by alkylating chemotherapeutic agents.

[0053] In certain embodiments, the promoter and / or enhancer region can act as a constitutive promoter and / or enhancer to maximize the expression of the region of the transcription unit being transcribed. In certain constructs, the promoter and / or enhancer region is active in all eukaryotic cell types, even if it is expressed only in specific types of cells at specific times. A preferred promoter of this type is the CMV promoter (650 nucleotides). Other preferred promoters are the SV40 promoter, cytomegalovirus (full-length promoter), and the LTR of retroviral vectors.

[0054] It has been shown that all specific regulatory elements can be cloned and used to construct expression vectors that are selectively expressed in specific cell types, such as melanoma cells. The glial fibrillary acetate protein (GFAP) promoter has been used to selectively express genes in glial-derived cells.

[0055] Furthermore, expression vectors used in eukaryotic host cells (yeast, fungi, insects, plants, animals, humans, or nucleated cells) may contain sequences necessary for transcription termination that can affect mRNA expression. These regions are transcribed as polyadenylated segments in the untranslated portion of mRNA encoding tissue factor proteins. The 3' untranslated region also includes the transcription termination site. It is preferable that the transcription unit also contains the polyadenylated region. One advantage of this region is that it increases the likelihood that the transcription unit will be processed and transported like mRNA. The identification and use of polyadenylated signals in expression constructs are well established. It is preferable that homologous polyadenylated signals are used in the transgene construct. In a particular transcription unit, the polyadenylated region is derived from the SV40 initial polyadenylated signal and consists of approximately 400 bases. It is also preferable that the transcription unit contains other standard sequences, either alone or in combination with the above sequences, that improve expression or stability from the construct.

[0056] b) Marker Viral vectors can contain nucleic acid sequences that encode marker products. These marker products are used to determine whether a gene is delivered to a cell and, upon delivery, expressed. Preferred marker genes are the E.Coli lacZ gene encoding β-galactosidase and green fluorescent protein.

[0057] In some embodiments, the marker may be a selectable marker. Examples of selectable markers suitable for mammalian cells include dihydrofolate reductase (DHFR), thymidine kinase, neomycin, neomycin analog G418, hydromycin, and puromycin. Once such selectable markers are successfully transferred to mammalian host cells, the transformed mammalian host cells can survive under selective pressure. There are two distinct categories of selective regimes that are widely used. The first category is based on the use of mutant cell lines that lack cellular metabolism and the ability to grow independently of supplemental medium. Two examples are CHO DHFR-cells and mouse LTK-cells. These cells lack the ability to grow without the addition of nutrients such as thymidine or hypoxanthine. Because these cells lack specific genes necessary for the complete nucleotide synthesis pathway, they cannot survive unless the missing nucleotides are provided in supplemental medium. An alternative method for supplementing the culture medium is to alter the growth requirements of cells lacking the respective genes by introducing intact DHFR or TK genes. Individual cells that are not transformed with the DHFR or TK genes will not be able to survive in unsupplemented culture medium.

[0058] The second category refers to selection schemes used in any cell type and are dominant selections that do not require the use of mutant cell lines. These schemes typically use drugs to halt the growth of host cells. Those cells with novel genes will express proteins that transmit drug resistance and will survive selection. Examples of such dominant selection use the drugs neomycin (Southern P. and Berg, P., J. Molec. Appl. Genet. 1:327 (1982)), mycophenolate (Mulligan, R. and Berg, P. Science 209:1422 (1980)), or hygromycin (Sugden, B. et al. Mol. Cell. Biol. 5:410-413 (1985)). Three examples use bacterial genes under the control of eukaryotic cells to transmit resistance to the appropriate drugs G418 or neomycin (Geneticin), xgpt (mycophenolate), or hygromycin, respectively. Other compounds include neomycin analog G418 and puramycin.

[0059] 4. Peptides a) Protein variants As discussed herein, numerous variants of the AAV capsid proteins (VP1, VP2, and VP3) are known and intended herein. In addition to the known functional strain variants, derivatives of the AAV capsid proteins also exist that function in the disclosed methods and compositions. Protein variants and derivatives are well understood by those skilled in the art and, in some examples, may involve amino acid sequence modifications. For example, amino acid sequence modifications are typically classified into one or more of three classes: substitution variants, insertion variants, or deletion variants. Insertions include fusions of the amino terminus and / or carboxyl terminus, as well as intrasequential insertions of one or more amino acid residues. Insertions are usually smaller than insertions of amino terminus or carboxyl terminus, for example, of about 1 to 4 residues. Derivatives of immunogenic fusion proteins, such as those described in the examples, are prepared by fusion of a polypeptide of sufficient size to confer immunogenicity to a target sequence, either by crosslinking in vitro or by recombinant cell cultures transformed with DNA encoding the fusion. A deletion is characterized by the removal of one or more amino acid residues from a protein sequence. Typically, approximately 2 to 6 residues are deleted at any single site within the protein molecule. These variants are usually prepared by site-directed mutagenesis of nucleotides in the protein-coding DNA, thereby producing variant-coding DNA, which is then expressed in recombinant cell cultures. Techniques for producing substitutional mutations at specific sites in DNA with known sequences, such as M13 primer mutagenesis and PCR mutagenesis, are well known. Amino acid substitutions are typically single-residue but can occur at several different sites at once, insertions are usually around 1 to 10 amino acid residues, and deletions range from approximately 1 to 30 residues. Deletions or insertions are preferably made in adjacent pairs, i.e., deletions or insertions of two residues. Substitutions, deletions, insertions, or any combination thereof can be combined to arrive at the final construct. The mutation should not cause the sequence to deviate from the reading frame, and preferably, it should not generate a complementary region capable of producing a secondary mRNA structure.A substitutional variant is one in which at least one residue is removed and a different residue is inserted in its place. Such substitutions are generally carried out according to Tables 1 and 2 below and are called conservative substitutions. [Table 1] [Table 2]

[0060] Substantial changes in functional or immunological identity are achieved by selecting substitutions that are less conserved than those in Table 2, i.e., by selecting residues that have significantly different effects on maintaining (a) the structure of the polypeptide backbone in the substitution area as a sheet or helix, (b) the molecular charge or hydrophobicity at the target site, or (c) the bulk of the side chains. Substitutions that are generally expected to bring about the greatest changes in protein properties are (a) hydrophilic residues, e.g., ceryl or threonyl, being replaced by (or thereby) hydrophobic residues, e.g., leucyl, isoleucyl, phenylalanyl, valyl, or alanyl; (b) cysteine ​​or proline being replaced by (or thereby) any other residue; (c) residues with an electropositive side chain, e.g., lysyl, arginyl, or histidyl, being replaced by (or thereby) an electronegative residue, e.g., glutamyl or aspar; or (d) residues with a bulky side chain, e.g., phenylanine, being replaced by a residue without a side chain, e.g., glycine in this case; or (e) increasing the number of sites for sulfylation and / or glycosylation.

[0061] For example, replacing one amino acid residue with another amino acid residue that is biologically and / or chemically similar is known to those skilled in the art as a conservative substitution. For example, a conservative substitution is replacing one hydrophobic residue with another hydrophobic residue, or replacing one polar residue with another polar residue. Substitutions include, for example, combinations of Gly, Ala, Val, Ile, Leu, Asp, Glu, Asn, Gln, Ser, Thr, Lys, Arg, and Phe, Tyr. Such conservatively substituted variations of each explicitly disclosed sequence are included in the mosaic polypeptides provided herein.

[0062] Substitution or deletion mutagenesis can be used to insert sites for N-glycosylation (Asn-X-Thr / Ser) or O-glycosylation (Ser or Thr). Deletion of cysteine ​​or other unstable residues may also be desirable. Potential proteolytic sites, such as Arg deletion or substitution, can be achieved, for example, by deleting one of the basic residues or substituting one with a glutaminyl or histidyl residue.

[0063] Certain post-translational derivatizations are the result of the recombinant host cell's action on the expressed polypeptide. Glutaminyl and asparaginyl residues are often deamidated post-translation to their corresponding glutamyl and asparyl residues. Alternatively, these residues are deamidated under weakly acidic conditions. Other post-translational modifications include hydroxylation of proline and lysine, phosphorylation of hydroxyl groups of ceryl or threonyl residues, methylation of the o-amino groups of lysine, arginine, and histidine side chains (TECreighton, Proteins: Structure and Molecular Properties, WH Freeman & Co., San Francisco pp79-86

[1983] ), acetylation of N-terminal amines, and, in some cases, amidation of C-terminal carboxyls.

[0064] It should be understood that one way of defining protein variants and derivatives disclosed herein is by defining them in terms of homology / identity to a particular known sequence. Specifically disclosed herein are variants of these and other proteins having at least 70%, 75%, 80%, 85%, 90%, or 95% homology to the stated sequence. Those skilled in the art will readily understand how to determine the homology of two proteins. For example, homology can be calculated after aligning the two sequences to the highest level of homology.

[0065] Another method for calculating homology can be performed by publicly available algorithms. Optimal alignment of sequences for comparison can be performed by the local homology algorithm of Smith and Waterman Adv.Appl.Math.2:482(1981), the homology alignment algorithm of Needleman and Wunsch, J.MoL Biol.48:443(1970), the similarity search method of Pearson and Lipman, Proc.Natl.Acad.Sci.USA85:2444(1988), computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA, Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI), or by inspection.

[0066] For example, the same type of homology can be obtained for nucleic acids using the algorithms disclosed in Zuker, M. Science 244:48-52, 1989, Jaeger et al. Proc. Natl. Acad. Sci. USA 86:7706-7710, 1989, and Jaeger et al. Methods Enzymol. 183:281-306, 1989.

[0067] It is understood that the descriptions of conserved variants and homology can be combined in any combination, for example, in embodiments where the variant has at least 70% homology to a particular sequence that is a conserved variant.

[0068] This specification considers various proteins and protein sequences, and it is understood that nucleic acids capable of encoding those protein sequences are also disclosed. This will include all degenerate sequences associated with a particular protein sequence, i.e., all nucleic acids having sequences that encode one particular protein sequence, as well as all nucleic acids including degenerate nucleic acids encoding disclosed variants and derivatives of protein sequences. Therefore, while each particular nucleic acid sequence may not be described herein, it is understood that each sequence and all sequences are actually disclosed and described herein through the disclosed protein sequences. While an amino acid sequence does not indicate which particular DNA sequence encodes that protein in an organism, it is understood that if a particular variant of a disclosed protein is disclosed herein, the known nucleic acid sequences that encode that protein, in which that protein appears, are also known and are disclosed and described herein.

[0069] It is understood that there are numerous amino acids and peptide analogs that can be incorporated into the disclosed compositions. For example, there are numerous D amino acids or amino acids with functional substituents different from those shown in Tables 1 and 2. Opposite stereoisomers of naturally occurring peptides, as well as stereoisomers of peptide analogs, are disclosed. These amino acids can be readily incorporated into polypeptide chains by loading tRNA molecules with selected amino acids and manipulating gene constructs to insert the analog amino acids into the peptide chain in a site-specific manner, for example, by utilizing amber codons.

[0070] It can produce molecules that are similar to peptides but are not linked via natural peptide bonds. For example, bonds for amino acids or amino acid analogs can include CH2NH--, --CH2S--, --CH2--CH2--, --CH=CH-- (cis and trans), --COCH2--, --CH(OH)CH2--, and --CHH2SO-- (these and others are also mentioned in *Chemistry and Biochemistry of Amino Acids, Peptides, and Proteins*, B. Weinstein, eds., Marcel Dekker, New York, p.267 (1983), Spatola, AF, *Vega Data* (March 1983), Vol.1, Issue 3, *Peptide Backbone Modifications* (general review), Morley, Trends Pharm Sci (1980) pp.463-468, and Hudson, D. et al., Int J Pept Prot Res 14:177-185(1979)(--CH2NH--, CH2CH2--), Spatola et al.Life Sci 38:1243-1249(1986)(--CH H2--S), Hann J.Chem.Soc Perkin Trans.I 307-314(1982)(--CH--CH--, cis and trans), Almquist et al. al.European Appln,EP 45665 This can be seen in CA (1982), 97:39405 (1982) (--CH(OH)CH2--), Holladay et al. Tetrahedron. Lett 24:4401-4404 (1983) (--C(OH)CH2--), and Hruby Life Sci 31:189-199 (1982) (--CH2--S--), each of which is incorporated herein by reference. A particularly preferred non-peptide bond is --CH2NH--.It is understood that peptide analogs, such as β-alanine and γ-aminobutyric acid, may have two or more atoms between their bonded atoms.

[0071] Amino acid analogs and their derivatives, as well as peptide analogs, often offer advantages such as more economical production, greater chemical stability, enhanced pharmacological properties (half-life, absorption, potency, efficacy, etc.), altered specificity (e.g., broader biological activity), and reduced antigenicity.

[0072] Because D-amino acids are not recognized by peptidases, they can be used to produce more stable peptides. More stable peptides can be produced by systematically substituting one or more amino acids in a consensus sequence with the same type of D-amino acid (e.g., D-lysine instead of L-lysine). Cysteine ​​residues can be used to cyclize or bond two or more peptides together. This can be beneficial for constraining peptides to a specific three-dimensional structure.

[0073] 5. Pharmaceutical carriers / delivery of pharmaceuticals As described above, the composition may also be administered in vivo within a pharmaceutically acceptable carrier. “pharmaceutically acceptable” means a material that is not biologically or otherwise undesirable, i.e., a material that can be administered to a subject together with nucleic acids or vectors, without causing any undesirable biological effects or interacting in a harmful manner with any other components of the pharmaceutical composition in which it comes into contact. The carrier may, as is well known to those skilled in the art, be selected to minimize any degradation of the active ingredient and to minimize any adverse side effects in the subject.

[0074] The compositions (i.e., the manipulated AAV vectors disclosed herein) may be administered orally, parenterally (e.g., intravenously), intramuscularly, intraperitoneally, percutaneously, by cerebrospinal fluid injection, extracorporeally, topically, including topical intranasal administration or administration by inhalation. As used herein, “topical intranasal administration” means delivery of the composition to the nose and nasal passages through one or both nostrils, and may include delivery by a spray or droplet mechanism, or by aerosolization of the nucleic acid or vector. Administration of the composition by inhalation can be done through the nose or mouth via delivery by spray or droplet mechanism. Delivery may also be delivered directly to any area of ​​the respiratory system (e.g., the lungs) via intubation. The exact amount of composition required will vary depending on the subject, depending on the species, age, weight, and general condition of the subject, the severity of the allergic disorder being treated, the specific nucleic acid or vector used, and the mode of administration. Therefore, it is impossible to specify an exact amount for all compositions. However, an appropriate amount can be determined by those skilled in the art using only routine experiments that give rise to the teachings herein.

[0075] Parenteral administration of compositions, when used, generally involves injection. Injectable preparations can be prepared in conventional forms, such as liquid solutions or suspensions, solid forms suitable for solutions of suspensions in liquids prior to injection, or emulsions. Recently revised parenteral administration approaches involve the use of sustained or prolonged release to maintain a constant dosage. See, for example, U.S. Patent No. 3,610,795, incorporated herein by reference.

[0076] The materials may be in solution or suspension (e.g., microparticles, liposomes, or incorporated into cells). These may target specific cell types via antibodies, receptors, or receptor ligands. The following references illustrate the use of this technology to target specific proteins in tumor tissue (Senter, et al., Bioconjugate Chem., 2:447-451, (1991), Bagshawe, KD, Br.J. Cancer, 60:275-281, (1989), Bagshawe, et al., Br.J. Cancer, 58:700-703, (1988), Senter, et al., Bioconjugate Chem., 4:3-9, (1993), Battelli, et al., Cancer Immunol.Immunother., 35:421-425, (1992), Pietersz and McKenzie, Immunolog.Reviews, 129:57-80, (1992), and Roffler, et al. al., Biochem.Pharmacol, 42:2062-2065, (1991). Vehicles such as "Stealth" and other antibody-coupled liposomes (including lipid-mediated drugs targeting colon cancer), receptor-mediated targeting of DNA via cell-specific ligands, lymphocyte-directed tumor targeting, and highly specific therapeutic retroviral targeting of mouse glioma cells in vivo. The following references illustrate the use of this technology to target specific proteins to tumor tissue (Hughes et al., Cancer Research, 49:6214-6220, (1989), and Litzinger and Huang, Biochimica et Biophysica Acta, 1104:179-187, (1992)). Generally, receptors are involved in either constitutive or ligand-induced endocytosis pathways. These receptors cluster within clathrin-coated pits, enter the cell via clathrin-coated vesicles, pass through acidified endosomes where the receptors are sorted, and are then either recycled to the cell surface, stored within the cell, or degraded in lysosomes.Internal transport pathways perform a variety of functions, including nutrient uptake, removal of activated proteins, clearance of macromolecules, opportunistic entry of viruses and toxins, ligand dissociation and degradation, and regulation at the receptor level. Many receptors follow two or more intracellular pathways depending on cell type, receptor concentration, ligand type, ligand titer, and ligand concentration. The molecular and cellular mechanisms of receptor-mediated endocytosis have been reviewed (Brown and Greene, DNA and Cell Biology 10:6, 399-409 (1991)).

[0077] a) A pharmaceutically acceptable carrier This antibody-containing composition can be used therapeutically in combination with a pharmaceutically acceptable carrier.

[0078] Suitable carriers and their formulations are described in Remington: The Science and Practice of Pharmacy (19th ed.), Argennaro, Mack Publishing Company, Easton, PA 1995. Typically, an appropriate amount of pharmaceutically acceptable salt is used in the formulation to make it isotonic. Examples of pharmaceutically acceptable carriers include, but are not limited to, physiological saline, Ringer's solution, and dextrose solution. The pH of the solution is preferably about 5 to about 8, more preferably about 7 to about 7.5. Further carriers include sustained-release preparations such as a semipermeable matrix of a solid hydrophobic polymer containing an antibody, the matrix in the form of a molded article, e.g., a film, liposomes, or microparticles. It will be apparent to those skilled in the art that certain carriers may be more preferred, for example, depending on the route of administration and the concentration of the composition being administered.

[0079] Pharmaceutical carriers are known to those skilled in the art. These are, most typically, standard carriers for drug administration to humans, including solutions such as sterile water, saline, and buffer solutions at physiological pH. These compositions can be administered intramuscularly or subcutaneously. Other compounds will be administered according to standard procedures used by those skilled in the art.

[0080] The pharmaceutical composition may contain, in addition to the selected molecule, a carrier, a thickener, a diluent, a buffer, a preservative, a surfactant, and the like. The pharmaceutical composition may also contain one or more active ingredients such as an antimicrobial agent, an anti-inflammatory agent, or an anesthetic.

[0081] The pharmaceutical composition may be administered in several ways, depending on whether topical or systemic treatment is desired and the area to be treated. Administration may be topical (including ophthalmic, vaginal, rectal, and nasal), oral, by inhalation, or parenterally by, for example, intravenous infusion, cerebrospinal fluid injection, subcutaneous injection, intraperitoneal injection, or intramuscular injection. The disclosed engineered viral vector may be administered intravenously, intraperitoneally, intramuscularly, subcutaneously, intracavitarially, or percutaneously.

[0082] Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic / aqueous solutions, emulsions, or suspensions, including physiological saline and buffer media. Parenteral vehicles include sodium chloride solution, ringer's dextrose, dextrose and sodium chloride, lactated Ringer's solution, or fixative oils. Intravenous vehicles include fluids and nutritional supplements, electrolyte supplements (such as those based on ringer's dextrose), etc. Preservatives and other additives, such as antimicrobial agents, antioxidants, chelating agents, and inert gases, may also be present.

[0083] Preparations for topical administration may include ointments, lotions, creams, gels, intravenous infusions, suppositories, sprays, liquids, and powders. Conventional pharmaceutical carriers, aqueous, powder, or oily bases, thickeners, etc., may be required or desirable.

[0084] Compositions for oral administration include powders or granules, suspensions or solutions in water or a non-aqueous medium, capsules, sachets, or tablets. Thickeners, flavorings, diluents, emulsifiers, dispersants, or binders may be desirable.

[0085] Some of these compositions may be administered as pharmaceutically acceptable acids or base addition salts formed by reaction with inorganic acids such as hydrochloric acid, hydrobromic acid, perchloric acid, nitric acid, thiocyanic acid, sulfuric acid, and phosphoric acid, and organic acids such as formic acid, acetic acid, propionic acid, glycolic acid, lactic acid, pyruvic acid, oxalic acid, malonic acid, succinic acid, maleic acid, and fumaric acid, or by reaction with inorganic bases such as sodium hydroxide, ammonium hydroxide, and potassium hydroxide, and organic bases such as mono, di, trialkyl, and arylamines, and substituted ethanolamines.

[0086] b) Therapeutic use The effective dosage and schedule for administering this composition can be determined empirically, and making such determinations is within the scope of the art. The dosage range for administering the composition should be large enough to produce the desired effect in which the symptoms of the disorder are affected. The dosage should not be so large as to cause adverse side effects, such as undesirable cross-reactions or anaphylactic reactions. In general, the dosage will vary depending on the patient's age, condition, sex, and the severity of the disease, the route of administration, or whether other drugs are included in the regimen, and can be determined by those skilled in the art. The dosage may be adjusted by the individual physician in the event of any contraindications. The dosage may vary and may be administered in doses once or twice daily over a day or several days. Guidelines for appropriate dosages for a given class of medicinal products can be found in the literature. For example, guidance on selecting an appropriate antibody dose can be found in the literature on the therapeutic use of antibodies, such as Handbook of Monoclonal Antibodies, Ferrone et al., eds., Noges Publications, Park Ridge, NJ, (1985) ch.22 and pp.303-357, and Smith et al., Antibodies in Human Diagnosis and Therapy, Haber et al., eds., Raven Press, New York (1977) pp.365-389. A typical daily dose of an antibody used alone may range from approximately 1 μg / kg body weight to over 100 mg / kg body weight per day, depending on the factors mentioned above.

[0087] C. Methods for treating neurological disorders In one embodiment, disclosed herein are methods for treating, inhibiting, reducing, mitigating, improving, and / or preventing neurological disorders in a subject (e.g., Alzheimer's disease, Parkinson's disease, multiple system atrophy (MSA), lysosomal storage disease (LSD), and / or muscular dystrophy), comprising administering to the subject a therapeutic agent encoded by a manipulated AAV vector disclosed herein. The therapeutic agents include GLB1 (encoding β-galactosidase for the treatment of GM1 ganriosidosis), Niemann-Pick C1 (NPC1) (for the treatment of Niemann-Pick disease), apolipoprotein E (APOE) (for the treatment of Alzheimer's disease), GD3 synthase, huntingtintin (Htt) (for the treatment of Huntington's disease), interleukin (IL)-10 (IL-10) (for multiple sclerosis, traumatic brain injury, spinal lateral sclerosis, Alzheimer's disease, and Pa - For the treatment of disorders including but not limited to Kinson's disease, myelin oligodendrocyte glycoprotein (MOG) (for the treatment of narcolepsy), mitogenic factor-activated protein kinase 8 interacting protein 3 (MAPKA8IP3) (for the treatment of spastic biliary palsy, intellectual disability, cerebral atrophy, and / or corpus callosum hypoplasia), survival motor neuron (SMN) 1 (SMN1) and / or SMN2 (for the treatment of spinal muscular atrophy (SMA)), Cas9, β-glucocerebrosin GBA (for the treatment of Gauscher disease and / or lysosomal storage disease (LSD)), sphingomyelin phosphodiesterase 1 (SMPD1) (for the treatment of Niemann-Pick disease, Parkinson's disease, and / or lysosomal storage disease), beta-hexosaminidase A (HEXA) (for the treatment of Tay-Sachs disease and / or lysosomal storage disease), nerve growth factor (NGF) (for the treatment of pain and age-related neurodegenerative diseases), brain-derived neurotrophic factor (BDNF) (for age-related and pathological diseases) (For the treatment of neurological disorders), neuronutrient (NT)3 (NT-3) (for the treatment of autism spectrum disorder, Alzheimer's disease, Huntington's disease, and / or Parkinson's disease), NT-4 / 5 (for the treatment of Alzheimer's disease, Huntington's disease, and / or Parkinson's disease), NT-6 (for the treatment of Alzheimer's disease, Huntington's disease, and / or Parkinson's disease), glial cell-derived neurotrophic factor (GDNF) (for the treatment of Alzheimer's disease and / or multiple system atrophy (MSA)),Any therapeutic agent whose expression can rescue the loss of function of ciliary neurotrophic factor (CNTF), leukemia inhibitory factor (LIF), insulin-like growth factor (IGF) 1 (IGF-1), β-fibroblast growth factor (FGF), Neuturin (for the treatment of Parkinson's disease), Percefin (for the treatment of Parkinson's disease), Artemin (for the treatment of Parkinson's disease), transforming growth factor (TGF) alpha (TGFα), TGFβ, IGF-2, platelet-derived growth factor (PDGF), epidermal growth factor (EGF), cardiotropin, vascular endothelial growth factor (VEGF), Sonic Hedgehog (SHH) (for the treatment of holoprosencephaly), bone morphogenetic protein (BMP), FGF20, vasoactive intestinal peptide (VIP), pleiotrophin (PTN), aromatic L-amino acid decarboxylase (AADC), TH, 5-hydroxytryptamine (5HT), and hepatocyte growth factor (HGF). As mentioned above, the therapeutic agent may also include microRNAs, including but not limited to miRNA-222, miRNA-7, and miRNA-132.

[0088] Also disclosed are methods for treating, inhibiting, reducing, mitigating, improving, and / or preventing neurological disorders described in any prior embodiment, wherein the AAV vector is administered systemically (e.g., intravenously, including but not limited to IV injection or IV infusion, and / or into the posterior orbit) or via cerebrospinal fluid injection.

[0089] The disclosed AAV vectors may encode any peptide, protein, antibody, or nucleic acid suitable for the treatment of neurological disorders or conditions. Examples of such nucleic acids, peptides, proteins, and antibodies known to those skilled in the art are provided. [Examples]

[0090] D. Examples The following examples are provided to those skilled in the art to provide a complete disclosure and description of methods for preparing and evaluating the compounds, compositions, articles, devices, and / or methods claimed herein, and are intended to be purely illustrative and not to limit the disclosure. While efforts have been made to ensure accuracy with respect to numerical values ​​(e.g., quantity, temperature, etc.), some error and deviation should be taken into consideration. Unless otherwise indicated, parts are parts by weight, temperature is °C or ambient temperature, and pressure is atmospheric pressure or near thereto.

[0091] 1. Example 1: Production of LC.V1 capsid Recombinant AAV vectors are attractive gene delivery vehicles because they can transduce both meristematic and postmittal tissues with low immunogenicity and long-term transgene expression. AAV2-mediated gene transfer into tissues such as the liver, muscle, retina, and central nervous system has been reported. Subsequently, novel non-human serotypes such as AAV8 were isolated and identified by PCR-based screening of primate tissues, and were shown to transduce neurons better than those of AAV2. Furthermore, comparisons among these novel primate serotypes revealed that the broad neuronal transduction after injection of cy5, rh20, and rh39 was at a higher level than that of AAV8. Based on this research, we generated a series of hybrid recombinant capsids, including the Rec2 capsid, by structural domain exchange or shuffling between fragments from cy5, rh20, and rh39, hoping that their directivity would allow novel hybrid serotypes to efficiently target the retina. In in vivo and in vitro evaluations, the transduction efficacy of the Rec2 capsid was comparable to that of AAV2 or AAV5. However, surprisingly, the Rec2 serotype exhibits superior transduction in both brown and white adipose tissue compared to the tested naturally occurring serotypes, including AAV1, AAV8, and AAV9 serotypes. Since the initial publication of Rec2-mediated gene transfer into adipose tissue, Rec2 serotype vectors have been applied to basic and translational studies. In addition, Rec2 can also effectively transduce the liver via intravenous injection. To improve transduction efficacy into adipose tissue and reduce transduction into the liver, several variants of the Rec2 capsid were created by point mutations or insertion mutations.

[0092] The capsid (CAP) gene in the AAV2 genome, via alternative splicing and initiation, encodes structural viral proteins (VPs) including VP1, VP2, and VP3, so all three VP proteins share the same carboxyl-terminal amino acid. VP1, VP2, and VP3, in a molar ratio of 1:1:10, constitute the AAV capsid, forming an icosidohedral structure. AAV targeting determines cell entry. AAV2 enters cells by using membrane-associated heparan sulfate proteoglycan (HSPG) as its primary receptor. Other candidates have also been reported to contribute to AAV adhesion. The atomic structure of the AAV2 capsid has been determined at a resolution of 3.0 microns. Based on computer modeling, several gene capsid modifications may be permissible for AAV2 serotypes. For example, working results suggest a potential heparin-binding locus containing a cluster between positions 561 and 591, which has been reconfirmed by a recent comprehensive AAV capsid fitness topographic study. Further research identifies residues R585 and R588 as two primary amino acid residues involved in HSPG binding. Several studies have reported gene modifications focusing on the N587 and I588 surrounding residues for vector retargeting. Therefore, to screen for improved fat-targeting of novel serotype capsids, it was decided to induce mutations in the Rec2 capsid region corresponding to the region surrounding R585 and R588 of the AAV2 capsid. Recently, gene modifications have been extended beyond the R585-R588 region (Table 3). Initial in vivo screening showed that all variants exhibited lower transduction efficiency into adipose tissue or liver compared to the native Rec2 capsid. For example, variant 1, i.e., the LC.V1 capsid, reduced transduction efficiency into adipose tissue by 76% via intrafat injection and 83% via intraperitoneal injection compared to the native Rec2 capsid. Furthermore, LC.V1 showed 50% lower transduction efficiency to the liver compared to the natural Rec2 capsid. These variants were considered a failure of the original intention to generate adipose-specific AAV serotypes and were subsequently screened for transduction to other tissues.Surprisingly, variant 1, i.e., the LC.V1 capsid, showed high transduction to neurons and widespread transgene expression in mouse brain (Figure 1) and rat brain (Figures 2 and 3). Specifically, 1 × 10¹⁶ of the LC.V1 vector expressing green fluorescent protein (GFP) per 1 μL. 9 The virus was injected unilaterally into the striatum of C57BL / 6 mice at a dose of 1.8 × 10¹⁶ viral particles. The transduction area was approximately 3 mm, representing about 15% of the mouse brain (Figure 1). The LC.V1 vector showed similar extensive transduction in Sprague-Dawley rat brains via convection-enhanced delivery (CED) to the unilateral striatum (1.8 × 10¹⁶ per 15 μL). 11 (Individual viral particles). Surprisingly, robust transduction in rat brains was observed in many brain structures, including the striatum (target structure), cortex, septum, hippocampus, thalamus, subthalamic nucleus, and substantia nigra (Figures 2 and 3). The vector spread from the target structure exceeded 3.5 mm anteriorly and 5 mm posteriorly. The LC.V1 vector appeared to transduce mainly neurons with very high efficiency and be transported in the retrograde direction. Table 3. Genetic modifications of the Rec2 capsid [Table 3]

[0093] 2. Example 2: Construction of LC.V1 capsid and GFP reporter vector packaging. The Rec2 capsid was mutated with Q588P, Q589L, and Q594L via the GeneArt site-directed mutagenesis plus kit (A14604, Invitrogen). The Rec2 capsid sequences are based on publicly available data. Primers for mutagenesis were synthesized by Integrated DNA Technologies (IDT) and listed as follows: VP3_1763-FW / CAGATAACTTGCAGCCGCTAAACACGGCT CCTCTAATTGGAACTGTCAA (SEQ ID NO: 4) and VP3_1763RV / TTGACAGTTCCAATTAG AGGAGCCGTGTTTAGCGGCTGCAAGTTATCTG (SEQ ID NO: 5).

[0094] Mutagenesis was set up and performed according to the kit instructions, and nucleotide substitutions at each site were confirmed by sequencing at the core facility of the Ohio State University Comprehensive Cancer Center. The rAAV vector backbone contains a CBA (hybrid cytomegalovirus-chicken β-actin) promoter, a woodchuck hepatitis virus posttranscriptional regulator (WPRE), and a bovine growth hormone polyadenylation signal adjacent to the AAV2 inverted terminal repeat. GFP was cloned into the polylinker region of the rAAV expression plasmid. All plasmids used for viral packaging were prepared using the EndoFree plasmid Maxi and Mega Kit (Qiagen). 293 human embryonic kidney cells were co-transfected with three plasmids containing GFP as a reporter gene: the rAAV cis plasmid, the AAV helper plasmid encoding the rep and cap (Rec2) genes, and the adenovirus helper pF Δ6 using standard CaPO4 transfection. rAAV was purified from cell lysates by ultracentrifugation over an iodoxanol density gradient (OptiPrep density gradient medium, D1556, Sigma). rAAV was titrated by quantitative PCR using Power SYBR Green PCR Master Mix (Applied Biosystems #A25742) with a Step OnePlus Real-Time PCR System (Applied Biosystems).

[0095] One of the most important characteristics of gene therapy vectors is their efficiency in transducing target cells. In central nervous system (CNS) gene therapy, scientists are always looking for the "best performer" that will efficiently spread throughout the brain and transduce the maximum number of neurons. This would ensure the best treatment outcomes for many neurodegenerative diseases that affect large parts of the brain (Alzheimer's disease, Parkinson's disease, lysosomal storage diseases). We evaluated the transduction efficiency of the LC.V1 vector delivered to the brains of non-human primates via convection-enhanced delivery (CED). Briefly, we injected 124 μl of LC.V1 into the left monkey thalamus (injection rate 3 μl / min) and 59 μl of LC.V1 into the right midbrain (ventral tegmental area - VTA + substantia nigra) using MRI-guided CED. The animals were sedated and then placed in a stereotactic system with MR-compatible cranially mounted transient cannula guides positioned in each hemisphere. Following a T1-weighted planning scan (Siemens 3.0T Trio MR unit) to establish the trajectory, a custom-designed fused silica perfusion-resistant ceramic cannula with a 3mm step tip was used for injection. Prohance (2 mmol / l chelated gadolinium) was added to the virus to visualize the injector distribution during MRI. Serial MRIs were acquired to monitor the injector distribution within each target site, providing real-time feedback to the surgical team. After 3 weeks, the animals were euthanized, and the brains were processed for immunohistochemical staining to assess distribution and transduction efficiency. Double fluorescence staining for the transgene, GFP, and the neuronal marker, NeuN, was used to determine the percentage of transduced neurons (transduction efficiency).

[0096] Transduction of non-human primate brains using LC.V1 demonstrated that this vector is highly efficient in terms of the distribution and efficiency of transduction across a wide range of brain regions. Specifically, the thalamus showed almost complete coverage based on transgene expression (GFP) at the injection site of only 124 μL of the LC.V1 vector (Figure 4A-C). The mean neuronal transduction efficiency from the four thalamic nuclei (ventroantorectalis, ventromedial, lateral dorsal, and medial dorsal) was 67% (Figure 5I) as measured by GFP expression. LC.V1 is transported retrogradely from the injection site (thalamus) to cortical regions, where it transduces pyramidal neurons in the prefrontal cortex and prefrontal cortex layer V (Figures 4D-K and 5A-C). This is significant as it supports the use of LC.v1 for the treatment of diseases affecting the prefrontal cortex. The neuronal transduction efficiency within the prefrontal cortex was 50% (Figure 5I), based on the average of eight cortical regions (four lateral and medial) from three separate sections of brain tissue within area 9 of the prefrontal cortex. LC.V1 is transported retrogradely from the injection site (thalamus) to the hippocampus, transducing neurons in the hippocampal plateau (Figures 5D-H). The average neuronal transduction efficiency within this structure is 53% (Figure 5I). LC.V1 is transported retrogradely from the injection site (midbrain: VTA and substantia nigra) to the striatum (both caudate nucleus and caudate putamen), where numerous GFP-positive fibers can be observed (Figures 6A-D). The distribution of LC.V1 within the brain parenchyma delivered via CED can be monitored by real-time MRI imaging. By including the MRI contrast agent ProHance (gadoteridol) and continuously monitoring the distribution of ProHance, the convective motion of LC.V1 viral particles can be tracked. MRI scans correlated perfectly with histological (immunofluorescence-IF) brain sections showing expression of the transgene GFP (Figures 7A-F). The data presented herein also support the observation that LC.V1 is bidirectional, exhibiting both retrograde and anterograde transport. Furthermore, the vector distribution could be monitored in real time, which is important as it allows the administering physician to monitor the vector delivery and stop or adjust the infusion when the primary target is filled or delivered to the correct location.

[0097] Next, we wanted to evaluate systemic and non-substantial delivery pathways such as CSF by assessing the level of transgenic transduction (via GFP expression) at different brain levels from the anterior-posterior axis (Figure 8), peripheral organs (Figure 9), and the hippocampus and dentate gyrus (Figure 10) from representative animals. We observed that LC.V1 was distributed throughout and uniformly regardless of non-substantial delivery pathways. Positive GFP signals were also observed along all cortical lobes (prefrontal cortex, frontal cortex, temporal, parietal, and occipital) when administered via lateral tail vein injection, CSF, or lateral ventricle injection. Next, we assayed both neuronal and astrocyte directional transduction. Here, LC.V1 appeared to transduce neurons and interneurons in all cortical and subcortical regions (pyramidal cells, moderately spinous neurons, dopaminergic neurons, Purkinje cells, etc.) (Figure 11). We noted that while some rAAVs (particularly AAV9) have been shown to cross the blood-brain barrier in the central nervous system of neonatal mice, the same claim has not been made in adult subjects. Compared to AAV9.HR, we injected similar doses (4.0E+12vg vs. 4.18E+12vg) and LC.V1 performed better distribution and higher expression levels. Compared to AAV-PHP.B, we injected higher doses (1.0E+12vg vs. 4.18E+12vg) and LC.V1 performed similar / better distribution and expression levels.

[0098] To perform these experiments, animals (C57BL / 6 mice) received either systemic injection via the right posterior orbital sinus (RO) or tail vein (TV), or CSF injection via left ventricular delivery (LV). Each animal received 50 μL systemically or 25 μL into CSF ​​of AAV:LC.V1 at a titer of 8.36E+13 vg / mL (lot number CS1851). Injection into the left ventricle (also known as intraventricular delivery) was achieved using a custom-made fused silica 1 mm step cannula. Vector delivery was stereotactically guided using the following coordinates from a mouse brain map: anterior-posterior: -0.3 mm; medial-lateral: +0.9 mm; dorsal-ventral: -1.8 mm.

[0099] E. Array Amino acid sequence of the Rec2 capsid protein (SEQ ID NO: 1) [ka] Amino acid sequence of the LC.V1 capsid (SEQ ID NO: 6) [ka]

[0100] F. References Becerra SP, Koczot F, Fabisch P, Rose JA.1988.Synthesis of adeno-associated virus structural proteins requires both alternative mRNA splicing and alternative initiations from a single transcript.J Virol 62:2745-54 Buning H,Huber A,Zhang L,Meumann N,Hacker U.2015.Engineering the AAV capsid to optimize vector-host-interactions.Curr Opin Pharmacol 24:94-104 Charbel Issa P,De Silva SR,Lipinski DM,Singh MS,Mouravlev A,You Q,Barnard AR,Hankins MW,During MJ,Maclaren RE.2013.Assessment of tropism and effectiveness of new primate-derived hybrid recombinant AAV serotypes in the mouse and primate retina.PLoS One 8:e60361 Deverman BE,Pravdo PL,Simpson BP,Kumar SR,Chan KY,Banerjee A,Wu WL,Yang B,Huber N,Pasca SP,Gradinaru V(2016)Cre-dependent selection yields AAV variants for widespread gene transfer to the adult brain.Nat Biotechnol 34:204-209 Duan D,Li Q,Kao AW,Yue Y,Pessin JE,Engelhardt JF.1999.Dynamin is required for recombinant adeno-associated virus type 2 infection.J Virol 73:10371-6 During MJ,Liu X,Huang W,Magee D,Slater A,McMurphy T,Wang C,Cao L.2015.Adipose VEGF Links the White-to-Brown Fat Switch With Environmental,Genetic,and Pharmacological Stimuli in Male Mice.Endocrinology 156:2059-73 Gao G,Vandenberghe LH,Wilson JM.2005.New recombinant serotypes of AAV vectors.Curr Gene Ther 5:285-97 Gao GP,Alvira MR,Wang L,Calcedo R,Johnston J,Wilson JM.2002.Novel adeno-associated viruses from rhesus monkeys as vectors for human gene therapy.Proc Natl Acad Sci U S A 99:11854-9 Girod A,Ried M,Wobus C,Lahm H,Leike K,Kleinschmidt J,Deleage G,Hallek M.1999.Genetic capsid modifications allow efficient re-targeting of adeno-associated virus type 2.Nat Med 5:1052-6 Huang W,Liu X,Queen NJ,Cao L.2017.Targeting Visceral Fat by Intraperitoneal Delivery of Novel AAV Serotype Vector Restricting Off-Target Transduction in Liver.Mol Ther Methods Clin Dev 6:68-78 Huang W,McMurphy T,Liu X,Wang C,Cao L.2016.Genetic Manipulation of Brown Fat Via Oral Administration of an Engineered Recombinant Adeno-associated Viral Serotype Vector.Mol Ther 24:1062-9 Huang W,Queen NJ,Cao L.2019.rAAV-Mediated Gene Delivery to Adipose Tissue.Methods Mol Biol 1950:389-405 Huang W,Queen NJ,McMurphy TB,Ali S,Cao L.2019.Adipose PTEN regulates adult adipose tissue homeostasis and redistribution via a PTEN-leptin-sympathetic loop.Mol Metab 30:48-60 KD Foust,E Nurre,CL Montgomery,A Hernandez,CM Chan,BK Kaspar(2009).Intravascular AAV9 preferentially targets neonatal neurons and adult astrocytes.Nat Biotechnol,27(2009),pp.59-65 Kern A,Schmidt K,Leder C,Muller OJ,Wobus CE,Bettinger K,Von der Lieth CW,King JA,Kleinschmidt JA.2003.Identification of a heparin-binding motif on adeno-associated virus type 2 capsids.J Virol 77:11072-81 Klein RL,Dayton RD,Leidenheimer NJ,Jansen K,Golde TE,Zweig RM.2006.Efficient neuronal gene transfer with AAV8 leads to neurotoxic levels of tau or green fluorescent proteins.Mol Ther 13:517-27 Lawlor PA,Bland RJ,Mouravlev A,Young D,During MJ.2009.Efficient gene delivery and selective transduction of glial cells in the mammalian brain by AAV serotypes isolated from nonhuman primates.Mol Ther 17:1692-702 Liu X,Magee D,Wang C,McMurphy T,Slater A,During M,Cao L.2014.Adipose tissue insulin receptor knockdown via a new primate-derived hybrid recombinant AAV serotype.Mol Ther Methods Clin Dev 1 Lluis Samaranch,Ernesto A Salegio,Waldy San Sebastian,Adrian P Kells,John R Bringas,John Forsayeth,Krystof S Bankiewicz(2013)Strong cortical and spinal cord transduction after AAV7 and AAV9 delivery into the cerebrospinal fluid of nonhuman primates.Hum Gene Ther.2013 May;24(5):526-32 McMurphy TB,Huang W,Xiao R,Liu X,Dhurandhar NV,Cao L.2017.Hepatic Expression of Adenovirus 36 E4ORF1 Improves Glycemic Control and Promotes Glucose Metabolism Through AKT Activation.Diabetes 66:358-71 Mingozzi F,High KA.2011.Therapeutic in vivo gene transfer for genetic disease using AAV:progress and challenges.Nat Rev Genet 12:341-55 Ng R,Hussain NA,Zhang Q,Chang C,Li H,Fu Y,Cao L,Han W,Stunkel W,Xu F.2017.miRNA-32 Drives Brown Fat Thermogenesis and Trans-activates Subcutaneous White Fat Browning in Mice.Cell Rep 19:1229-46 Nicklin SA,Buening H,Dishart KL,de Alwis M,Girod A,Hacker U,Thrasher AJ,Ali RR,Hallek M,Baker AH.2001.Efficient and selective AAV2-mediated gene transfer directed to human vascular endothelial cells.Mol Ther 4:174-81 Ogden PJ,Kelsic ED,Sinai S,Church GM.2019.Comprehensive AAV capsid fitness landscape reveals a viral gene and enables machine-guided design.Science 366:1139-43 Opie SR,Warrington KH,Jr.,Agbandje-McKenna M,Zolotukhin S,Muzyczka N.2003.Identification of amino acid residues in the capsid proteins of adeno-associated virus type 2 that contribute to heparan sulfate proteoglycan binding.J Virol 77:6995-7006 Perabo L,Goldnau D,White K,Endell J,Boucas J,Humme S,Work LM,Janicki H,Hallek M,Baker AH,Buning H.2006.Heparan sulfate proteoglycan binding properties of adeno-associated virus retargeting mutants and consequences for their in vivo tropism.J Virol 80:7265-9 Pillay S,Meyer NL,Puschnik AS,Davulcu O,Diep J,Ishikawa Y,Jae LT,Wosen JE,Nagamine CM,Chapman MS,Carette JE.2016.An essential receptor for adeno-associated virus infection.Nature 530:108-12 Qing K,Mah C,Hansen J,Zhou S,Dwarki V,Srivastava A.1999.Human fibroblast growth factor receptor 1 is a co-receptor for infection by adeno-associated virus 2.Nat Med 5:71-7 Rabinowitz JE,Samulski J.1998.Adeno-associated virus expression systems for gene transfer.Curr Opin Biotechnol 9:470-5 Rabinowitz JE,Xiao W,Samulski RJ.1999.Insertional mutagenesis of AAV2 capsid and the production of recombinant virus.Virology 265:274-85 Ried MU,Girod A,Leike K,Buning H,Hallek M.2002.Adeno-associated virus capsids displaying immunoglobulin-binding domains permit antibody-mediated vector retargeting to specific cell surface receptors.J Virol 76:4559-66 Samaranch L,Salegio EA,San SW,Kells AP,Foust KD,Bringas JR,Lamarre C,Forsayeth J,Kaspar BK,Bankiewicz KS(2012)Adeno-associated virus serotype 9 transduction in the central nervous system of nonhuman primates.Hum Gene Ther 23:382-389. Summerford C,Bartlett JS,Samulski RJ.1999.AlphaVbeta5 integrin:a co-receptor for adeno-associated virus type 2 infection.Nat Med 5:78-82 Summerford C,Samulski RJ.1998.Membrane-associated heparan sulfate proteoglycan is a receptor for adeno-associated virus type 2 virions.J Virol 72:1438-45 Taymans JM,Vandenberghe LH,Haute CV,Thiry I,Deroose CM,Mortelmans L,Wilson JM,Debyser Z,Baekelandt V.2007.Comparative analysis of adeno-associated viral vector serotypes 1,2,5,7,and 8 in mouse brain.Hum Gene Ther 18:195-206 Uhrig S,Coutelle O,Wiehe T,Perabo L,Hallek M,Buning H.2012.Successful target cell transduction of capsid-engineered rAAV vectors requires clathrin-dependent endocytosis.Gene Ther 19:210-8 Wang D,Li SY,Gessler DJ,Xie J,Zhong L,Tran K,Vliet KV,Ren LZ,Su Q,He R,Goetzmann JE,Flotte TR,Agbandje-McKenna M,Gao GP(2018)A rationally engineered capsid variant of AAV9 for systemic CNS-directed and peripheral tissue-detargeted gene delivery in neonates.Mol Ther--Methods Clin Dev 9:234-246. Wu P,Xiao W,Conlon T,Hughes J,Agbandje-McKenna M,Ferkol T,Flotte T,Muzyczka N.2000.Mutational analysis of the adeno-associated virus type 2(AAV2)capsid gene and construction of AAV2 vectors with altered tropism.J Virol 74:8635-47 Xiao R,Mansour AG,Huang W,Chrislip LA,Wilkins RK,Queen NJ,Youssef Y,Mao HC,Caligiuri MA,Cao L.2019.Adipocytes:A Novel Target for IL-15 / IL-15Ralpha Cancer Gene Therapy.Mol Ther 27:922-32 Xie L,Zhang Y,Gunasekar SK,Mishra A,Cao L,Sah R.2017.Induction of adipose and hepatic SWELL1 expression is required for maintaining systemic insulin-sensitivity in obesity.Channels(Austin)11:673-7 Xie Q,Bu W,Bhatia S,Hare J,Somasundaram T,Azzi A,Chapman MS.2002.The atomic structure of adeno-associated virus(AAV-2),a vector for human gene therapy.Proc Natl Acad Sci U S A 99:10405-10 Yang Q,Mamounas M,Yu G,Kennedy S,Leaker B,Merson J,Wong-Staal F,Yu M,Barber JR.1998.Development of novel cell surface CD34-targeted recombinant adenoassociated virus vectors for gene therapy.Hum Gene Ther 9:1929-37 Zhang H,Yang B,Mu X,Ahmed SS,Su Q,He R,Wang HY,Mueller C,Sena-Esteves M,Brown R,Xu ZS,Gao GP(2011)Several rAAV vectors efficiently cross the blood-brain barrier and transduce neurons and astrocytes in the neonatal mouse central nervous system.Mol Ther 19:1440-1448 Zhang R,Xu G,Cao L,Sun Z,He Y,Cui M,Sun Y,Li S,Li H,Qin L,Hu M,Yuan Z,Rao Z,Ding W,Rao Z,Lou Z.2019.Divergent engagements between adeno-associated viruses with their cellular receptor AAVR.Nat Commun 10:3760 Zhang Y,Xie L,Gunasekar SK,Tong D,Mishra A,Gibson WJ,Wang C,Fidler T,Marthaler B,Klingelhutz A,Abel ED,Samuel I,Smith JK,Cao L,Sah R.2017.SWELL1 is a regulator of adipocyte size,insulin signalling and glucose homeostasis.Nat Cell Biol 19:504-17 Zhu Y,Gao Y,Tao C,Shao M,Zhao S,Huang W,Yao T,Johnson JA,Liu T,Cypess AM,Gupta O,Holland WL,Gupta RK,Spray DC,Tanowitz HB,Cao L,Lynes MD,Tseng YH,Elmquist JK,Williams KW,Lin HV,Scherer PE.2016.Connexin 43 Mediates White Adipose Tissue Beginning by Facilitating the Propagation of Sympathetic Neuronal Signals.Cell Metab 24:420-33. This disclosure provides, for example, the following: [Section 1] An engineered adeno-associated virus (AAV) vector comprising a recombinant 2 (Rec2) capsid containing one or more substitutions within a heparin-binding locus, wherein the substitutions confer directivity to nerve tissue to the vector. [Section 2] The modified AAV vector according to item 1, wherein one or more of the substitutions occur at residues corresponding to residues 588, 589, and / or 594 of SEQ ID NO: 1. [Section 3] The manipulated AAV vector according to item 2, wherein one or more of the substitutions include Q588P, Q589L, Q589I, Q589V, Q589G, Q594L, Q594I, and / or Q594V. [Section 4] A modified AAV vector according to any one of claims 1 to 3, further comprising: a first expression cassette containing a regulatory element and a transgene operably linked to a promoter; and a second expression cassette containing a tissue-specific promoter operably linked to an RNA silencing element that targets the regulatory element in the first expression cassette. [Section 5] The method according to item 4, wherein the adjustment element of the first cassette is a woodchuck transfer adjustment element (WPRE) sequence. [Section 6] A method for delivering a gene to neural tissue in the brain of a subject, comprising administering to the subject an engineered AAV vector as described in any one of items 1 to 5. [Section 7] A method for treating a neurological disorder in a subject, comprising administering to the subject an engineered AAV vector described in any one of items 1 to 5, wherein the engineered vector encodes a therapeutic agent. [Section 8] The aforementioned transgene or therapeutic agent may include β-galactosidase 1 (GLB1), Niemann-Pick C1 (NPC1), apolipoprotein E (APOE), GD3 synthase, huntingtin (Htt), interleukin (IL)-10 (IL-10), myelin oligodendrocyte glycoprotein (MOG), mitogen-activated protein kinase 8 interacting protein 3 (MAPKA8IP3), survival motor neuron (SMN) 1 (SMN1), SMN2, Cas9, β-glucocerebrosidase (GBA), sphingomyelin phosphodiesterase 1 (SMPD1), beta-hexosaminidase A (HEXA), nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), neurotrophin (NT) 3 (NT-3), NT-4 / 5, NT-6, glial cell-derived neurotrophic factor (GDNF), and ciliary neurotrophic factor. A method for delivering the genes described in item 6 or 7, or for treating a neurological disorder, comprising (CNTF), leukemia inhibitory factor (LIF), insulin-like growth factor (IGF) 1 (IGF-1), β-fibroblast growth factor (FGF), neutrinoblastine, percefin, artemin, transforming growth factor (TGF) alpha (TGFα), TGFβ, IGF-2, platelet-derived growth factor (PDGF), epidermal growth factor (EGF), cardiotropin, vascular endothelial growth factor (VEGF), sonic hedgehog (SHH), bone morphogenetic protein (BMP), FGF20, vasoactive enteric peptide (VIP), pleiotrophin (PTN), aromatic L-amino acid decarboxylase (AADC), TH, 5-hydroxytryptamine (5HT), hepatocyte growth factor (HGF), miRNA-222, miRNA-7, and / or miRNA-132. [Section 9] The method according to claim 6 or 7, wherein the neurological disorder includes Alzheimer's disease, Parkinson's disease, and / or muscular dystrophy. [Section 10] A method for delivering a gene described in any one of claims 6 to 8, or for treating a neurological disorder, wherein the manipulated AAV vector is administered via post-orbital, intravenous, or cerebrospinal fluid injection.

Claims

1. An engineered adeno-associated virus (AAV) vector comprising a recombinant 2 (Rec2) capsid containing at least one substitution in a heparin-binding locus, wherein the one or more substitutions in the heparin-binding locus include at least one of Q588P, Q589L, and Q594L of SEQ ID NO: 1, the Rec2 capsid has at least 90% sequence identity with SEQ ID NO: 1, and the substitutions confer directivity to nerve tissue to the vector.

2. The manipulated AAV vector according to claim 1, further comprising: a first expression cassette comprising a regulatory element and a transgene operably linked to a promoter; and a second expression cassette comprising a tissue-specific promoter operably linked to an RNA silencing element that targets the regulatory element in the first expression cassette.

3. The manipulated AAV vector according to claim 2, wherein the adjustment element of the first cassette is a woodchuck post-transfer adjustment element (WPRE) sequence.

4. A composition comprising an engineered AAV vector according to any one of claims 1 to 3 for use in a method of delivering a gene to neural tissue in the brain of a target, wherein the method comprises administering the composition to the target.

5. A composition comprising an engineered AAV vector according to any one of claims 1 to 3 for use in a method for treating a neurological disorder in a subject, wherein the method comprises administering the composition to the subject, and the engineered AAV vector of the composition encodes a therapeutic agent.

6. The aforementioned transgene or therapeutic agent is β-galactosidase 1 (GLB1), Niemann-Pick C1 (NPC1), apolipoprotein E (APOE), GD3 synthase, huntingtin (Htt), interleukin (IL)-10 (IL-10), myelin oligodendrocyte glycoprotein (MOG), mitogen-activated protein kinase 8 interacting protein 3 (MAPKA8IP3), survival motor neuron (SM N)1 (SMN1), SMN2, Cas9, β-glucocerebrosidase (GBA), sphingomyelin phosphodiesterase 1 (SMPD1), beta-hexosaminidase A (HEXA), nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), neurotrophin (NT)3 (NT-3), NT-4 / 5, NT-6, glial cell-derived neurotrophic factor (GDNF), ciliary neurotrophic factor (CNTF), leukemia inhibitor A composition according to claim 4 for delivering genes to nerve tissue, comprising inhibitory factor (LIF), insulin-like growth factor (IGF) 1 (IGF-1), β-fibroblast growth factor (FGF), neutrinoblastine, percefin, artemin, transforming growth factor (TGF) alpha (TGFα), TGFβ, IGF-2, platelet-derived growth factor (PDGF), epidermal growth factor (EGF), cardiotropin, vascular endothelial growth factor (VEGF), sonic hedgehog (SHH), bone morphogenetic protein (BMP), FGF20, vasoactive intestinal peptide (VIP), pleiotrophin (PTN), aromatic L-amino acid decarboxylase (AADC), TH, 5-hydroxytryptamine (5HT), hepatocyte growth factor (HGF), miRNA-222, miRNA-7, and / or miRNA-132, or a composition according to claim 5 for treating a neurological disease.

7. The composition according to claim 5, wherein the neurological disease includes Alzheimer's disease, Parkinson's disease, and / or muscular dystrophy.

8. The composition according to any one of claims 4 to 6, wherein the manipulated AAV vector is administered via postorbital, intravenous, or cerebrospinal fluid injection for delivering genes or treating neurological disorders.

Images