Vascular organoids, methods for manufacturing and using organoids

Abstract

The present invention relates to a method for producing artificial vascular organoids, comprising providing stem cells capable of vascular differentiation, stimulating mesodermal differentiation in the stem cells, stimulating vascular differentiation in the stem cells, generating cell aggregates from the stem cells, embedding the cell aggregates in a collagen 3D matrix, and stimulating vascular differentiation of the aggregates in the collagen 3D matrix; organoids obtained from the method; use of the method and organoids in tested procedures and screening; and kits for carrying out the method.

Description

[Technical Field]

[0001] This invention relates to the field of artificial blood vessel organoids. [Background technology]

[0002] Blood vessels are susceptible to a variety of diseases known as vascular diseases. Damage to the vascular network can lead to a range of health problems, some of which can be serious or even fatal. These diseases can be caused by environmental etiologies or by developmental disorders.

[0003] Goodwin (Microvasc Res. 2007; 74(2-3): 172-183) describes an in vitro angiogenesis assay to evaluate the activity of drugs that affect angiogenesis in the pathogenesis of many diseases.

[0004] Duffy et al. (European Cells and Materials 21, 2011: 15-30) describe in vitro angiogenesis of collagen-glycosaminoglycan scaffolds in surface-adhered 2D culture.

[0005] Nakagami et al. (Hypertension 2006; 48:112-119) provide a method of cell-matrix interaction-mediated angiogenesis using Matrigel to force embryonic stem cells to develop into sprouting blood vessels containing endothelial cells and vascular smooth muscle cells.

[0006] Kusuma et al. (PNAS 110(31), 2013: 12601-12606), Gerecht-Nir et al. (Laboratory Investigation 83(12), 2003: 1811-1820), International Publication No. 2007 / 140340A2, International Publication No. 2014 / 145871A1, US2014 / 273220A1, and International Publication No. 2017 / 015415A1 describe the formation of vascular structures from isolated early vascular cells in an engineered matrix. Prior to introduction into the matrix, cells are obtained from human pluripotent stem cells that have been differentiated into early vascular cells and then individualized (by trypsin treatment and / or filtration through a 40 μm mesh). Individual cells proliferate within the matrix, where they aggregate to form a vascular network. The goal of these papers was to provide self-assembling cells that could be useful in regenerative medicine.

[0007] International Publication No. 2011 / 115974A1 relates to an apparatus for forming a 2D cultured vascular network on a surface.

[0008] Shen et al. (Cell Research 13 (5) (2003): 335-341) describe the formation of engineered blood vessels from smooth muscle cells of adult rabbits and from differentiated endothelial cells of mice. [Overview of the Initiative] [Problems that the invention aims to solve]

[0009] However, previous vascular models lacked sufficient similarity to the natural vascular network formed in vivo; therefore, an improved, more realistic vascular model is needed.

[0010] Therefore, an object of the present invention is to provide an improved vascular model, in addition to the model itself, which enables a wider range of applications such as disease models and testing in screening procedures. [Means for solving the problem]

[0011] The present invention provides stem cells capable of vascular differentiation, stimulates mesoderm differentiation in the stem cells, stimulates vascular differentiation in the stem cells, generates cell aggregates from the stem cells, embeds the cell aggregates in a collagen 3D matrix, and stimulates vascular differentiation of the aggregates in the collagen 3D matrix, and provides a method for generating an artificial blood vessel organoid.

[0012] In a closely related aspect, the present invention provides a method for generating an artificial blood vessel organoid, which includes embedding vascular stem cells in a collagen 3D matrix containing 10% - 50% laminin, 20% - 70% collagen I, and / or 2% - 30% collagen IV, and stimulating vascular differentiation of the stem cells in the collagen 3D matrix.

[0013] Using such a method, it is possible to provide a blood vessel organoid forming a further aspect of the present invention. In particular, the present invention provides an artificial blood vessel organoid culture containing an interconnected network of capillaries, where the capillaries include an endothelial layer and a basement membrane having perivascular pericytes, and (i) the organoid is produced by the method of the present invention, and / or (ii) the capillaries are embedded in an artificial 3D matrix containing a hydrogel having collagen, and / or (iii) the organoid culture contains 40 - 1000 blood vessels when counting the blood vessels between the intersections of individual blood vessels and capillaries. All three features (i), (ii), and (iii) are representative features of the present invention, and these may be required individually or in combination by the artificial blood vessel organoid culture of the present invention.

[0014] The present invention further provides a method for providing human capillaries in a non-human animal model, where the human capillaries include an endothelial layer and a basement membrane containing perivascular pericytes, and the method includes introducing a human blood vessel organoid of the present invention into a non-human animal, and a step of growing capillaries in the organoid.

[0015] The present invention also relates to non-human animal models including such artificial blood vessel organoid cultures, for example, inserts. Furthermore, a non-human animal model having human capillaries is provided, wherein the human capillaries include a basement membrane containing endothelium and pericytes around the vessels.

[0016] The present invention further relates to the use of cultured organisms or non-human animal models of the present invention, or methods for generating them as models of pathological conditions such as diabetes, wherein organoids or organoids in non-human animal models are susceptible to exposure to pathogens and developing the said pathological conditions, such as hyperglycemia in diabetes or destruction of pancreatic beta cells.

[0017] The present invention further provides a method for screening candidate chemical compounds that affect the etiology or pathogenesis of a disease, comprising administering the candidate compound to a culture or non-human animal model according to any embodiment of the present invention, or during the production of the culture or non-human animal model, and monitoring physiological differences in the culture or animal model compared to a culture or animal model in which the candidate compound has not been administered.

[0018] The present invention provides a novel therapeutic model for diabetes. Specifically, the present invention provides the use of Notch3 activation pathway inhibitors (e.g., gamma-secretase inhibitors, Notch3 inhibitors, DLL4 inhibitors, or combinations thereof) in the treatment or prevention of, for example, diabetic vascular disease, occlusive vascular disease, altered vascular permeability, tissue hypoxia, heart disease, stroke, kidney disease, blindness, impaired wound healing, or thick capillary basement membrane in chronic skin ulcers. The thick capillary basement membrane includes [details omitted]. The present invention also provides the use of Notch3 activation pathway inhibitors (e.g., gamma-secretase inhibitors, Notch3 inhibitors, DLL4 inhibitors) for use in such treatment or prevention, or for use in the manufacture of pharmaceuticals or pharmaceutical compositions for such treatment or prevention.

[0019] Finally, the present invention provides a kit suitable for the generation of artificial blood vessel organoids by any method of the present invention, comprising (i) a Wnt agonist or GSK inhibitor, (ii) a vascular differentiation factor selected from VEGF, FGF, and BMP, and (iii) a collagen 3D matrix.

[0020] All embodiments of the present invention are described together in the following detailed description, and all preferred embodiments relate to all embodiments, aspects, methods, organoids, animal models, applications, and kits. For example, kits or their components are used in or suitable for the methods of the present invention. Any components used in the described methods may be included in a kit. Organoids of the present invention are either results of the methods of the present invention or can be used in the methods and applications of the present invention. Preferred detailed descriptions of the methods of the present invention will be understood as similarly to the suitability of the obtained or used organoids or animal models of the present invention. Unless otherwise specified, all embodiments can be combined with one another. [Brief explanation of the drawing]

[0021] [Figure 1]Generation of human vascular networks from human stem cells. a. Schematic diagram of the protocol for differentiating human embryonic stem cells (ESCs) and human iPSCs into vascular networks and free-floating vascular organoids. The lower panel shows representative morphologies observed at the indicated differentiation stages. b, c. Immunofluorescence of CD31-expressing endothelial cells shows the establishment of a complex, interconnected vascular network in the collagen I / Matrigel matrix. d. 3D reconstruction of the CD31+ vascular network based on confocal image analysis. The scale of reconstruction is shown on three axes. e. TNFα-mediated activation of the 3D endothelial network revealed by induction of ICAM-1 expression. f-h. Endothelial (green) and pericyte (red) ranges of the vascular network determined by CD31+ endothelial and pericyte-specific markers CNN1, PDGFRβ, and SMA. Basement membrane formation is indicated by the expression of type IV collagen (ColIV). i. Self-organizing human capillary organoids shown by immunofluorescence of type IV collagen (ColIV) to visualize deposition in the basement membrane covering the endothelial canal. Notably, the data in b-i are from vascular organoids derived from human embryonic stem cells. DAPI staining has been shown to image the nuclei. Magnification is shown in each panel. [Figure 2] Generation of mature, continuous human capillaries. a. Free-floating organoids exhibit a dense endothelial network (CD31+) tightly covered by pericytes, as determined by PDGFRβ expression. A 3D reconstruction of the entire free-floating organoid is shown (upper left panel). b. Endothelial lumen formation in free-floating vascular organoids, shown by immunofluorescence and H&E staining of CD31+ endothelium. c. Representative electron micrograph of a free-floating vascular organoid. Note the generation of lumened, continuous capillary-like structures with the appearance of tight junctions (white arrowheads) and basement membranes (black arrows). L: Lumen; E: Endothelial cells. d. CD31+ end cells (arrowheads) indicate newly formed cells. Note the absence of ColIV+ basement membranes at the site of angiogenesis. Magnification is shown in each panel. [Figure 3]Establishment of a functional human vascular tree in mice. a. Transplantation of human vascular organoids into the renal capsule of NOD / SCID mice. The upper left panel shows the transplantation site (arrow). The vascular system derived from human organoids is visualized by a human-specific CD31 antibody that does not cross-react with mouse endothelium, as exemplified in the staining of mouse kidneys (inset). b-c. Functional human vascular system in mice revealed by FITC-dextran perfusion (green) (detected by human-specific anti-CD31 immunostaining, hCD31, red). d. Injection of human-specific anti-CD31 antibody to label perfused human vessels. Mouse vessels are visualized by mouse-specific anti-CD31 antibody (mCD31, green). e. Representative arterioles (A) and venules (V) appearing within a human vascular organoid graft, shown in H&E-stained tissue sections. f. Generation of human arterioles (A) and venules (V) in transplanted human vascular organoids. Arterioles are shown by staining of human CD31+ endothelial cells (red) tightly covered with vascular smooth muscle cells (vSMCs) detected by SMA, calponin, and MYH11 immunostaining. Venioles show a typical flattened endothelial phenotype and sparse vSMC range. Endothelial cells of mouse arterioles do not cross-react with human-specific CD31 antibody, as shown in the renal vessels (bottom right panel). Magnification is shown for each panel. g, representative axial T2-weighted images measured by MRI, blood flow (perfusion), relative blood volume (rBV), mean transit time (MTT), and leakage (K2). The axial plane was selected to show both the kidney (bordered in white) and implant (bordered in red). Muscle tissue is bordered in green. Quantitative values ​​(±SD) of perfusion, rBV, MTT, and K2 are shown in the table below. n=3 mice were analyzed. [Figure 4]Modeling of diabetic microangiopathy in human vascular organoids. a. Basement membrane thickening of cutaneous capillaries in skin biopsies of patients with late type 2 diabetes, shown by PAS staining (left) and staining of CD31+ endothelial cells and ColV for detection of the basement membrane. Skin vessels from non-diabetic patients are shown as a control. b. Representative electron micrographs of cutaneous capillaries from patients with late type 2 diabetes and non-diabetic patients show the formation of abnormally thick basement membranes in diabetic patients (double-sided arrows) compared to the basement membrane of non-diabetic controls (arrowheads). L, lumen; E, endothelial cells; P, pericytes. Bar graph shows quantitative analysis of basement membrane thickening (mean ± SD). n=6. ***p<0.001 (unpaired two-sided t-test). c-d. Human vascular organoids show increased type IV collagen deposition at hyperglycemia [75 mM glucose], which is even more pronounced by treatment with high glucose combined with the pro-inflammatory cytokines IL-6 [1 ng / mL] and TNFα [1 ng / mL] ("diabetes cocktail"). c. Representative image of basement membrane thickening. Inset shows confocal section of luminal vessel. d. Type IV collagen thickening quantified using confocal section. Individually measured vessels are indicated by dots. Over 130 vascular lumens were analyzed for each experimental condition from three independent biological replicas. ***p<0.001 (Student's t-test). e. High glucose / IL-6 / TNFα treatment results in significant dilation of ColIV-positive basement membrane lining the inside of human capillaries. The right panel shows a 3D reconstruction of basement membrane thickening directly covering CD31+ endothelial canals. Capronin immunostaining marks pericytes. f. Representative electron microscope images of vascular organoids cultured under diabetic and non-diabetic conditions confirm significant basement membrane thickening during diabetes treatment. Note the multiple layers of the basement membrane (arrows on both sides) under diabetic conditions. This cannot be observed in control organoids (arrowheads). L: Lumen; E: Endothelial cells; P: Pericytes. All magnifications are shown. [Figure 5]Inhibition of γ-secretase suppresses thickening of the vascular basement membrane in diabetic vascular organoids. a) Transcriptome analysis of CD31+ endothelial cells FACS selected from vascular organoids cultured under diabetic conditions (high glucose / IL6 / TNFα) and non-diabetic conditions. Differentially expressed genes and the top 5 upregulated genes (ranked by p-value) and GO: biological process heatmaps of upregulated genes are shown comparing diabetic and non-diabetic states. General GO: molecular function terms comparing upregulated genes from "diabetic" vascular organoids and cutaneous endothelial CD31+ cells from type II diabetic patients are plotted with their respective p-values. Patient upregulated genes were obtained from CD31+ endothelial cells selected from type II diabetic patients compared with CD31+ endothelial cells selected from non-diabetic individuals. b, c. Commonly prescribed diabetes medications do not affect basement membrane thickening during treatment of human vascular organoids with a diabetes cocktail (high glucose / IL6 / TNFα). b. Representative image of basement membrane thickening using collagen IV (ColIV) staining. The inset shows a confocal section of a luminal vessel covered with collagen IV (green). c. Optical sectioning was used to quantify basement membrane thickening. Each lumened vessel is shown as a dot. Over 130 lumens were analyzed for each experimental condition from three independent biological replicas. ***p<0.001 (Student's t-test comparing vehicle and drug-treated organoids with organoids cultured in parallel under non-diabetic conditions). In addition to the comparisons shown, all other drug treatments were p<0.001 compared to non-diabetic conditions and were not significant compared to the respective vehicle-diabetic condition controls. Drug dosages and culture conditions are described in the methods. d, e. Inhibition of γ-secretase by DAPT suppresses vascular basement membrane thickening in vascular organoids cultured under “diabetic” conditions, as visualized by ColIV. d. Representative image of basal thickening in diabetic vessels treated with small molecule inhibitors of various signaling pathways. Inset shows confocal section of luminal vessels encapsulated with collagen IV (ColIV, green). e. Basement membrane thickening was quantified using confocal section.Over 130 tubularized vessels (each vessel shown as an individual point) were analyzed from three independent biological replicas under each experimental condition. **p<0.01;***p<0.001 (Student's t-test). Notably, in addition to the comparisons shown, all other drug treatments were p<0.001 compared to non-diabetic conditions and not significant compared to vehicle-diabetic control conditions. Drug dosages and culture conditions are described in the methods. Prevention of basement membrane thickening by f, g, and γ-secretase inhibitor DAPT is dose-dependent. Quantitative analysis shows the ColIV thickness of over 130 tubularized structures (points) from at least one different organoid exposed to the conditions shown. ***p<0.001 (Student's t-test). [Figure 6] Differentiation of human ES cells into vascular organoids. a. Co-expression of endothelial marker CD31 and VE-cadherin in 3D endothelial tubes. Representative data of ESC-derived organoids grown in a collagen I matrix are shown. b, c. Human iPS cells differentiate efficiently in CD31+ positive tubes. b. Representative images of experiments repeated more than 20 times are shown. c. 3D reconstruction of CD31+ vascular networks derived from iPS cells based on confocal image analysis. The scale of reconstruction is shown on three axes. Data from b and c, and data of organoids grown in a collagen matrix. d. 3D reconstruction of entire free-floating organoids derived from iPS cells. Data were obtained using confocal image analysis of entire organoids imaged with anti-CD31 antibody. The scale of reconstruction is shown on three axes. All magnifications are shown in the panel. [Figure 7]Molecular characterization analysis of vascular organoids. a. Heatmap (RNAseq) of transcriptomes of FACS-sorted CD31+ endothelial cells from vascular organoids compared with genotype-tissue expression (GTEx) RNASeq data from indicated tissues. The gene expression profiles of endothelial tubes generated in vitro cluster most closely with those of human vascular tissue (GTEX_Artery_Coronary, GTEX_Artery_Aorta, GTEX_Artery_Tibial). b. Heatmaps of marker genes for pluripotency, perivascular cells, and endothelial cells. CD31+ endothelial cells sorted by FACS from vascular organoids were compared with primary and differentiated endothelial cells derived from iPS cells under previously published 2D culture conditions (Patsch et al. Nat. Cell Biol. 17, 994-1003 (2015)). c. Laminin expression (blue) imaging the basement membrane surrounding CD31+ endothelial tubes (green) in vascular organoids. Representative images of human ESC-derived vascular organoids proliferated in a collagen I matrix are shown. Magnification is indicated on the panel. [Figure 8] Common rodent models of diabetes do not show basement membrane thickening in the cutaneous microvessels. a. Quantification of basement membrane thickness of cutaneous capillaries in shown diabetic rat and mouse models compared to a non-diabetic control cohort. See Supplementary Table 2 for details. Data are shown as mean ± SD of the vessels analyzed. More than 5 animals per cohort. Age-matched C57BL / KsJ and C57BL / KsWT mice were used as controls. For ZDF rat models, heterozygous rats (fa / +) were used as controls. Basement membrane thickening was determined by morphometric analysis of collagen IV immunostaining. b. Representative images of skin sections from various mouse models to demonstrate ColIV (green) deposition over CD31+ (red) positive vessels. [Figure 9]Basement membrane thickening of human ESC-derived vascular organoids. a. ES cell-derived vessels were treated in diabetic medium (high glucose / IL6 / TNFα) or under normal conditions (non-diabetic). Basement membrane thickening was visualized using ColIV-specific antibody (green) around CD31-positive (red) endothelial ducts. Insets show confocal sections. CNN1 shows pericytes. b. Enhancement of ColIV expression in diabetic vascular organoids. Col4a1 and Col4a2 expression was determined by qPCR in vascular organoids treated in diabetic medium (high glucose / IL6 / TNFα) for 2 weeks and compared to untreated control organoids. Values ​​are shown as mean ± SD. *p<0.05 (Student's t-test). A pool of more than 15 vascular organoids was used in two independent experiments. [Figure 10] Efficient differentiation of pluripotent stem cells into endothelial and pericytes in vascular organoids. a. Established vascular networks at day 18 and late vascular organoids at day 30 were analyzed by FACS for endothelial and pericellular content. In both cases, over 80% of the differentiated cell population consisted of endothelial cells (CD31+) and pericytes (CD140b+). P: pericytes; EC: endothelial cells. b. Hematopoietic cells (CD45+) were hardly produced (approximately 1%), and about 10% of the cells observed after differentiation were mesenchymal stem cell-like cells (CD73+, CD90+). [Figure 11] Mature endothelial cells in vascular organoids. a. Endothelial cells in vascular organoids express von Willebrand factor (vWF) and show the formation of Weiberparard bodies (right panel). b. Binding of Ulex Europaeus agglutinin 1 (UEA-1) to capillary structures in vascular organoids indicates the presence of mature endothelial cells. c. Mature endothelial cells in free-floating vascular organoids efficiently take up acetylated LDL (ac-LDL). [Figure 12]Basement membrane thickening of transplanted human blood vessels in diabetic mice. Vascular organoids were transplanted into immunodeficient NOD / SCID / gamma (NSG) mice, and then (1 month later) the mice were treated with streptozotocin (STZ) to induce severe hyperglycemia. After 3 months, human transplants were harvested and analyzed for diabetic basement membrane thickening. Blood vessels derived from transplanted organoids were identified using a human-specific CD31 (hCD31) antibody. Type IV collagen staining (top panel) and electron microscopy (middle panel; arrows indicate deposited collagen fibrils) demonstrated severe basement membrane thickening in human vascular organoids derived from diabetic mice (STZ) compared to euglycemic mice (Ctrl). In contrast, intrinsic blood vessels in the mouse kidney did not show basement membrane changes at that stage (bottom panel; A, arterioles, C, capillaries). The absence of CD31 signaling in the kidney demonstrates the human specificity of the antibody. [Figure 13] Diabetic vascular regression is reproduced with human vascular organoid grafts. Human vascular organoids were transplanted into NSG mice treated with STZ for 1 month to induce diabetes. Three months after diabetes induction, grafts from diabetic mice (STZ) show an overall decrease in vascular density compared to euglycemic mice (Ctrl), as shown by endothelial (CD31) and pericyte (SMA) staining (upper panel). Human vessels from diabetic mice (STZ) show signs of vascular regression, such as endothelial apoptosis indicated by rounded cells (filled arrowheads) and absence of endothelial cells in SMA-positive vessel walls (empty arrowheads). [Figure 14]Blocking the Notch3 receptor or ligand Dll4 inhibits diabetic basement membrane thickening. In vitro treatment of vascular organoids with diabetic medium (hyperglycemia + IL-6 + TNF-α) for two weeks induced significant capillary basement membrane thickening compared to control medium (Ctrl), as indicated by type IV collagen staining (ColIV). To elucidate the direct targets of previously identified γ-secretase inhibitors (DAPT) capable of preventing diabetic vascular basement membrane thickening, functional blocking antibodies (α-Notch1, α-Notch3, α-Jagged1) and non-crosslinked recombinant proteins (Dll1, Dll4) were used under diabetic conditions to inhibit specific members of the Notch pathway. Blocking of Notch-1, Jagged-1, or Dll1 did not affect diabetes-mediated thickening of the vascular basement membrane, while blocking of Notch-3 or Dll4 completely blocked basement membrane thickening. In the vascular system, the Notch3 receptor is specifically expressed on pericytes, while the Notch ligand Dll4 is expressed on endothelium, suggesting that crosstalk between these two cell types mediated by Notch3 / Dll4 influences diabetic vascular basement membrane thickening. [Figure 15]Cellular and functional characterization of vascular organoids. a. FACS analysis to determine the various cell populations present in the initially generated vascular network and late-stage vascular organoids (NC8). Proportions of CD31+ endothelial cells, PDGFR-β+ pericytes, CD45+ hematopoietic cells, and CD90+CD73+ mesenchymal stem cell (MSC)-like cells. The bar graph in the right panel shows the relative populations of endothelial cells (EC) and pericytes (P) in the vascular network and vascular organoids. The graph shows the mean ± SEM from n=2 independent experiments with more than 50 vascular networks / organoids per experiment. b. Heatmaps of prototype marker genes for pluripotency, pericytes, and endothelial cells. CD31+ endothelial cells (EC) and PDGFR-β+ pericytes (P) sorted by FACS from the vascular network or vascular organoids were analyzed by RNA-seq and compared to the parental iPSC lineage (NC8). c. TNFα-mediated activation of vascular organoid (NC8) revealed by induction of ICAM-1 expression. ICAM-1 induction was measured 24 hours after addition of TNFα (dose). DAPI was used for nuclear counterstaining. d. Expression of von Willebrandt factor (vWF) in endothelial cells (CD31+) from vascular organoid (NC8). ColIV staining also shows the basement membrane contour. The right panel shows electron micrographs revealing the appearance of the Viber-Parade bodies. e. Endothelial network (CD31+) of vascular organoid (NC8) takes up acetylated low-density lipoprotein (ac-LDL). f. Vascular organoid (NC8) positive for staining with the lectin Ulex europaeus agglutinin 1 (UEA-1). Scale bars: d = 50 μm, 500 nm (EM upper panel), 100 nm (EM lower panel), e, f = 100 μm, or as shown in the image. [Figure 16] Analysis of diabetic vascular organoids. FACS analysis of vascular organoids (H9) cultured in non-diabetic medium and diabetic (high glucose / IL6 / TNFα) medium to determine the proportion of (a) CD31+ endothelial cell fraction and (b) PDGFR-β+ pericytes. [Figure 17]Inhibition of γ-secretase suppresses diabetic microangiopathy in human vascular organoids. a. Vascular permeability was evaluated by intravenously injecting FITC-dextran and co-staining with hCD31 to visualize human blood vessels. Note the diffusion FITC signal in diabetic STZ mice showing vascular leakage. DAPT treatment normalized diabetic vascular permeability. b. Quantification of vascular leakage measured by extravasation of FITC-dextran. n=(control=3, STZ=7, STZ+DAPT=5) mice. **p<0.01, *p<0.05 (one-way ANOVA). c, d. DAPT treatment restores human vascular density in diabetic STZ mice. Capillary density of human vascular grafts was measured by staining with human-specific anti-CD31 antibody (black). c. Quantification of human vascular density in transplanted vascular organoids. n=(control=3, STZ=5, STZ+DAPT=4) mice. ***p<0.001 (one-way ANOVA). d, representative images of human CD31+ vascular density in control, STZ, and STZ+DAPT treated mice. Scale bars, a, d=50μm, or as shown in the image. [Figure 18]Identification of Dll4-Notch3 as a candidate pathway for diabetic vascular basement membrane thickening. a. Representative images of basement membrane stained for ColIV in vascular organoids (from NC8 iPSCs) exposed to high glucose / IL6 / TNFα (diabetes) and treated with antibodies against Jagged-1, Notch1, Notch3, or recombinant Dll1 and Dll4. The inset shows confocal sections of individual vessels surrounded by type IV collagen (ColIV, green). The thickness of the lumen continuously surrounded by ColIV was measured in optical sections. For quantification (right panel), more than 130 lumens in total were analyzed for each experimental condition from three independent biological replicas of equal sample size. Individual measurements from lumened vessels are shown as points. Representative images and quantified values ​​of non-diabetic organoids are shown as a control. ***p<0.001 (one-way ANOVA). b. Representative images of basement membranes stained for ColIV from control, Dll4 KO, and Notch3 KO vascular ophthalmic organoids (NC8 iPSCs) exposed to high glucose / IL6 / TNFα (diabetes) or maintained under standard culture conditions (non-diabetic). The thickness of the lumen continuously surrounded by ColIV was measured in optical sections. Individual measurements from luminal vessels are shown as points in the right panel. A total of over 180 lumens were analyzed for each experimental condition from three independent biological replicas of equal sample size. ***p<0.001 (one-way ANOVA). c. STZ mice transplanted with human vascular organoids (H9 ESCs) were treated with Notch3 blocking antibody, and the transplants were stained with the basement membrane marker ColIV and human-specific CD31 to visualize human vessels. The basement membrane thickness (hCD31+) of individual human vessels was determined based on ColIV staining. n>140 vessels. ***p<0.001 (one-way ANOVA). n=(control=3, STZ=3, STZ+αNotch3=2) mice. Scale bars, a, b, c=50μm, c insert=10μm. [Figure 19]Generation of Dll4 and Notch3 knockout iPSCs and expression of Notch receptor / ligand in endothelial and pericytes. a, b. Dll4 and Notch3 knockout iPSCs (NC8) were generated using CRISPR / Cas9 genome editing. Single guide RNA (sgRNA) is shown with Notch3 / Dll4 sequences and generated indels (insertions / deletions). c. Western blot shows removal of Notch3 expression in the target iPSC. Clone #4 (red) was used for functional assay. FL, full-length Notch3; TTM, transmembrane Notch3 subunit. d. Immunostaining of vascular organoids shows Dll4 expression in endothelial cells (CD31+), but not in CRISPR / Cas9 genome-edited iPSCs. Scale bar: e = 50 μm. e. Heatmap of Notch receptor / ligand expressed in endothelial cells (EC) and pericytes isolated from vascular organoids by FACS sorting. The scale is shown in the log (standardized FKPM). [Figure 20] Characterization of the phenotype of vascular organoids. a. Co-culture of differentiated (NC8) endothelial cells and pericytes in a collagen-1 / Matrigel matrix. The formed endothelial network (CD31+) showed only weak interactions with pericytes (PDGFR-β+) and was not covered by a ColIV+ basement membrane. b. Successful generation of vascular networks from embryonic stem cells (H9) and two independent iPS cell lines. Note that PDGFR-β+ pericytes are in close proximity to the endothelial tubes (CD31+) and a ColIV+ basement membrane is formed. [Figure 21]Several α-secretase inhibitors prevent diabetes-induced vascular basement membrane thickening in human vascular organoids. Vascular organoids were cultured in diabetic medium (75 mM glucose, 1 ng / mL IL-6, 1 ng / mL TNF-α) in or without γ-secretase inhibitors (10 μM RO4929097, 1 μM dehydroxy-LY411575, 1 μM LY411575). The organoids were then fixed and stained for endothelial cells (CD31), pericytes (PDGFR), and vascular basement membrane protein ColIV. Representative images are shown. Diabetic conditions increase the amount of ColIV + basement membrane (vehicle). Treatment with three independent γ-secretase inhibitors prevents basement membrane (ColIV) thickening under diabetic conditions. Scale bar: 50 μm. [Modes for carrying out the invention]

[0022] This invention provides a method for generating artificial vascular organoids. Such artificial organoids are grown in vitro but closely resemble in vivo capillary structures. Organoids are miniaturized and simplified versions of organs, produced in three dimensions outside of a living organism, exhibiting realistic microanatomical structures. They originate from one or a few cells from tissue, embryonic stem cells, or induced pluripotent stem cells, and can self-organize in three-dimensional culture due to their self-regenerative and differentiation capabilities.

[0023] The organoids of this invention, derived from human stem cells, replicate the structure and function of human blood vessels. 3D vascular organoids are provided from embryonic stem cells and induced pluripotent stem cells. These vascular organoids include endothelium, pericytes, and basement membranes, and self-assemble to form an interconnected luminal capillary network. Human vascular organoids transplanted into mice form a perfused human vascular tree, including human arterioles and venules. Interestingly, in vitro exposure of vascular organoids to hyperglycemia and inflammatory cytokines induced thickening of the basement membrane and transcriptional changes in endothelial cells, mimicking microvascular changes in diabetic patients. Drug screening revealed that γ-secretase inhibitors mitigated this “diabetic” vascular damage in vascular organoids. Vascular organoids can be used to generate disease models for drug discovery, as we demonstrated by identifying γ-secretase as a candidate therapeutic target for diabetic vascular damage affecting hundreds of millions of patients.

[0024] A method for generating such organoids includes the steps of: providing stem cells capable of vascular differentiation; stimulating mesodermal differentiation in the stem cells; stimulating vascular differentiation in the stem cells; generating cell aggregates from the stem cells; embedding the cell aggregates in a collagen 3D matrix; and stimulating vascular differentiation of the aggregates in the collagen 3D matrix.

[0025] Stem cells capable of vascular differentiation include, for example, pluripotent stem cells. Pluripotent stem cells may be derived from embryonic stem cells or induced pluripotent stem cells (iPS cells). iPS cells are preferred.

[0026] Stem cells differentiate into mesodermal vascular pathways. Differentiation can be achieved by contacting cells with tissue (mesoderm / vascular) specific growth factors or differentiation factors. The cells can then be developed into the desired tissue. Such tissue-specific growth factors or differentiation factors are preferably mesodermal and / or vascular differentiation factors used in different stages of the method of the present invention. This determines the development of each type of cell into tissue in subsequent development. This causes the cells to transition from pluripotent to multipotent. In this case, other types of tissues can not become pluripotent, or can only become pluripotent again by reversion. Usually, not all cells differentiate into the selected tissue type. Usually, it is sufficient if about 50% or more of the cells, or at least 55%, or at least 60%, or at least 65%, or at least 70%, or at least 75%, initiate differentiation into the selected type of tissue (particularly mesoderm) and transform, reducing the differentiation potential of multipotent cells (as a percentage of cell mass) that have the fate of each initial tissue. Of course, this differentiation fate applies only to cells that do not revert to an undifferentiated or poorly differentiated state by the use of artificial proliferation and dedifferentiation stimuli. Obviously, even somatic cells can be reverted to pluripotent cells, but this is not applicable when defining the differentiation state herein. Preferably, once mesoderm or vascular differentiation has begun, no factors are introduced into the cells to revert them to pluripotent cells.

[0027] The organoids of this invention can be obtained by culturing pluripotent stem cells. In principle, if ethical reasons permit, the cells may also be totipotent.

[0028] "Totipotent" cells can differentiate into any cell type in the body (including germline cells) after exposure to stimuli that normally occur during development. Therefore, totipotent cells can be defined as cells that can grow into, or develop into, a whole organism.

[0029] The cells used in the method of the present invention are preferably pluripotent, not totipotent.

[0030] In certain preferred embodiments, the cells of the present invention (including all further embodiments related thereto) are pluripotent.

[0031] Pluripotent stem cells, while not capable of developing into the entire organism, can give rise to cell types derived from all three germ layers—mesoderm, endoderm, and ectoderm—and thus give rise to all types of cells in an organism. Pluripotency can be a characteristic of the cell itself in certain stem cells, for example, or it can be artificially induced. For example, in a preferred embodiment of the present invention, pluripotent stem cells are obtained from somatic cells, compound pluripotent cells, unipotent cells, or precursor cells from which pluripotency is induced. Such cells are referred to herein as induced pluripotent stem cells. The somatic cells, compound pluripotent, unipotent, or precursor cells used are, for example, patient-derived cells that are converted into pluripotent cells, which are the subject of the method of the present invention. Such cells or the resulting organoid cultures can be tested for abnormalities, for example, during the development of the organoid culture by the method of the present invention. The patient may suffer from, for example, vascular disorders. The characteristics of the said disorders can be reproduced and studied in the organoids of the present invention.

[0032] "Multipotent" cells are capable of giving rise to at least one cell type from each of two or more different organs or tissues of an organism, where the cell types may originate from the same or different germ layers, but cannot give rise to all cell types of the organism.

[0033] In contrast, "unipotent" cells can differentiate into cells of only one cell lineage.

[0034] "Progenitor cells" are cells that, like stem cells, have the ability to differentiate into a specific type of cell, but their differentiation options are limited, usually to only one target cell. Progenitor cells are usually unipotent, but they can also be pluripotent.

[0035] When differentiation ability decreases, stem cells differentiate in the following order: totipotent, pluripotent, compound pluripotent, and unipotent. During the development of the organoids of the present invention, stem cells differentiate from pluripotent (totipotent cells are also possible) to compound pluripotent mesoderm, vascular or endothelial stem cells, and further to unipotent stem cells of endothelial and pericyte cells.

[0036] Preferably, stem cells are derived from vertebrates such as mammals, reptiles, birds, amphibians, or fish. Terrestrial vertebrates are particularly preferred. Possible sources include non-human animals and humans. Mammals such as mice, cattle, horses, cats, dogs, and non-human primates are particularly preferred, with human cells being the most preferred. Non-human animal models, including organoids, may be selected from the same animal. Stem cells and animal models do not necessarily have to be from the same organism.

[0037] Stem cell differentiation has become a standard technique in this art. For example, differentiation and growth factors for forming vascular grafts are disclosed in International Publication No. 2016 / 094166A1. Such growth factors can also be used as differentiation factors in accordance with the present invention.

[0038] The method of the present invention includes a step of inducing mesoderm differentiation. Differentiation stimuli can be either specific to a single direction (e.g., mesoderm) or nonspecific to a differentiation pathway that includes mesoderm. Such nonspecific differentiation can be achieved with serum, such as fetal bovine serum (FBS) used by Gerecht-Nir et al. (see background). Nonspecific differentiation can lead to the presence of various germ layers, including ectoderm, neuroectoderm, and endoderm.

[0039] According to a preferred embodiment of the present invention, specific mesoderm differentiation is performed by a mesoderm-specific differentiation factor, or, less preferably, mesoderm can be selected from differentiated cells. Selection can be combined with a specific differentiation stimulus. Cell selection is undesirable because it requires cell isolation and individualization. According to the present invention, such individualization is undesirable because cells form or begin to form aggregates at this stage. Preferably, cells after mesoderm stimulation have at least 50%, preferably at least 60%, more preferably at least 70%, or at least 80% of their cells in mesoderm differentiation. Preferably, mesoderm differentiation involves treating stem cells with a Wnt agonist or GSK inhibitor, preferably CHIR99021. The Wnt agonist or GSK inhibitor achieves a high rate of mesoderm differentiation. The Wnt agonist may also be a Wnt stimulant such as CHIR99021.

[0040] Stem cells are also processed by vascular differentiation. In the method of the present invention, vascular differentiation is stimulated continuously or repeatedly, particularly within the 3D matrix, but if cells are forming aggregates, it is also stimulated before the cell aggregates are introduced into the 3D matrix.

[0041] Vascular differentiation may include endothelial differentiation, leading to the formation of small capillaries or capillary precursors. In the initial stages of this method, for example, before 3D matrix processing, such endothelial / vascular differentiation may not result in well-defined, lifelike capillaries with altered shapes within the 3D matrix.

[0042] Similar to mesoderm differentiation, preferably vascular differentiation is specific vascular differentiation, where preferably at least 50%, preferably at least 60%, more preferably at least 70%, or at least 80% of the cells are vascularized. Preferably, vascular differentiation in stem cells involves treating the stem cells with VEGF and / or FGF and / or BMP and / or hypoxic conditions of 12% (v / v) or less. VEGF, FGF, BMP, and hypoxia may be combined. The preferred VEGF is VEGF-A. The preferred FGF is FGF-2. The preferred BMP is BMP4. Hypoxic conditions refer to atmospheric oxygen of 12% (v / v) or less, i.e., oxygen in the gas phase supplied to the cells. The gas phase is preferably atmospheric pressure. Preferably, the oxygen content is even lower, preferably 10% or less, more preferably 8% or less, for example 6% or less (all v / v %). The oxygen content is preferably 2% or more, for example 2% to 12% (all v / v %). Preferably, cells are cultured in a medium containing VEGF at a concentration of 10 ng / ml to 50 ng / ml, preferably about 30 ng / ml. Preferably, cells are cultured in a medium containing FGF at a concentration of 10 ng / ml to 50 ng / ml, preferably about 30 ng / ml. Preferably, cells are cultured in a medium containing BMP at a concentration of 10 ng / ml to 50 ng / ml, preferably about 30 ng / ml.

[0043] Stem cells, before being introduced into a 3D matrix, form aggregates of cells. Preferably, these cells are in a suspension culture that allows such aggregation. This means that stem cells to be processed for mesoderm and / or vascular differentiation are already small aggregates. Such aggregates are usually small enough to be suspended in a suspension culture in liquid medium without a stable 3D matrix.

[0044] After differentiation, before embedding the differentiated stem cells in the aggregate into the 3D matrix, typically at least 30%, preferably at least 40%, e.g., about 50%, of the cells in the aggregate are endothelial cells. Preferably, at least 20%, e.g., 30%, of the cells in the aggregate are pericytes. Together, preferably at least 60%, preferably at least 70%, e.g., about 80%, of the cells are vascular cells.

[0045] Once the aggregates are embedded in the 3D matrix, the method of the present invention also includes vascular differentiation of the aggregates in the 3D matrix. Preferably, this vascular differentiation also includes specific vascular differentiation. Particularly preferred vascular differentiation of the aggregates includes treating the aggregate cells with VEGF and / or FGF. The preferred VEGF is VEGF-A. The preferred FGF is FGF-2. Preferably, the aggregates in the matrix are cultured in a medium containing VEGF at a concentration of 60 ng / ml to 150 ng / ml, preferably about 100 ng / ml. Preferably, the aggregates in the matrix are cultured in a medium containing FGF at a concentration of 60 ng / ml to 150 ng / ml, preferably about 100 ng / ml.

[0046] After culturing, particularly during mesoderm and / or vascular differentiation, cell aggregates formed from stem cells are embedded within a 3D matrix. These aggregates embedded within the 3D matrix preferably have a size of at least 30 cells, or at least 50 cells, preferably at least 100 cells, and particularly preferably at least 300 cells, for example, about 1000 cells. Preferably, the size is less than 100,000 cells, for example, less than 30,000 cells. While the cell aggregates need to have an established size, excessively large aggregates suffer from poor stability in liquid suspension culture. An aggregate is an accumulation of cells bound to each other by intercellular junctions and intercellular links.

[0047] Preferably, the aggregates are embedded in the collagen 3D matrix 7 to 15 days after the start of aggregate formation. At this point, the aggregates usually have an appropriate size and state of differentiation. A desirable timeline is shown in Figure 1a. Preferably, mesoderm differentiation stimulation (mesoderm induction) occurs 2 to 6 days, and preferably vascular differentiation stimulation (promotion of the vascular system) occurs 4 to 14 days.

[0048] Embedding cells within a 3D matrix can be carried out by any method known in the art. A preferred method is to fluidize the 3D matrix material and solidify or gel the 3D matrix around the cell aggregates.

[0049] The 3D matrix is ​​a collagen matrix, which preferably contains at least 50% by mass of collagen. The collagen includes collagen I, collagen II, collagen III, and collagen IV. Collagen I and collagen IV are most preferred. Preferably, the at least 50% consists of collagen I or collagen IV, and most preferably a mixture of collagen I and collagen IV.

[0050] The aggregates are cultured in a three-dimensional (3D) matrix. A 3D matrix is ​​different from a 2D culture, such as a 2D culture in a dish on a flat surface. "3D culture" means that the culture can expand in all three dimensions without being obstructed by a wall on one side (such as the bottom plate of a dish). Preferably, such a culture containing a 3D matrix is ​​preferably in a suspension state. The 3D matrix is ​​a gel, particularly a rigid and stable gel, which allows for further expansion and differentiation of the growing cell culture / tissue. The gel may also be a hydrogel. A suitable 3D matrix according to the present invention contains collagen. More preferably, the 3D matrix contains the extracellular matrix (ECM), or any component of the extracellular matrix selected from collagen, laminin, entactin, and heparin-sulfated proteoglycans, or any combination thereof. The extracellular matrix of the Engelbreth-Holm-Swarm tumor may be derived from any of its components, such as laminin, collagen, preferably type IV collagen, entactin, and optionally further heparan-sulfated proteoglycans, or any combination thereof. Such a matrix is ​​Matrigel. Matrigel is well known in the art (U.S. Patent No. 4,829,000) and has already been used to model 3D cardiac tissue (International Publication No. 01 / 55297A2) or nerve tissue (International Publication No. 2014 / 090993). Preferably, the matrix comprises laminin, collagen, and entactin, preferably 20% to 85% laminin, 3% to 50% collagen, and enough entactin, usually 0.5% to 10%, for the matrix to form a gel. If the amount of collagen is insufficient for gel formation, laminin may require the presence of entactin to form a gel. The Matrigel-rich matrix may contain at least 3.7 mg / ml by mass of approximately 50% to 85% laminin, 5% to 40% collagen IV, optionally 1% to 10% nidogen, optionally 1% to 10% heparan sulfate proteoglycan, and 1% to 10% entactin. According to the present invention, the collagen content is preferably increased, with collagen I being particularly preferred.In all embodiments, the particularly preferred matrix of the present invention comprises 10% to 50% laminin, 20% to 70% collagen I, and / or 2% to 30% collagen IV, preferably further comprising 0.5% to 10% nidogen, 0.5% to 10% heparan sulfate proteoglycan, and / or 0.5% to 10% entactin (all by mass%). These proportions relate only to the solid protein components, i.e., not to liquid components such as water (which is the main component of hydrogels). The solid components of Matrigel typically contain about 60% laminin, 30% collagen IV, and 8% entactin. The 3D matrix may also be a mixture of Matrigel and collagen, for example, a Matrigel:collagen I mixture of 2:1 to 1:3, preferably about 1:1. All percentage values ​​given for matrix components are by mass. These values ​​may vary, for example, by ±30%, depending on the source. Entactin is a cross-linking molecule that interacts with laminin and collagen. Such matrix components can be added in step r). These components are also preferred parts of the kit of the present invention. The 3D matrix may further contain growth factors such as EGF (epidermal growth factor), FGF (fibroblast growth factor), NGF, PDGF, IGF (insulin-like growth factor), and especially IGF-1, TGF-β, and tissue plasminogen activator. The 3D matrix may also not contain any of these growth factors.

[0051] Generally, a 3D matrix is ​​a three-dimensional structure of a biocompatible matrix. This preferably includes collagen, gelatin, chitosan, hyaluronan, methylcellulose, laminin, and / or alginates. The matrix may also be a gel, particularly a hydrogel. Organic chemical hydrogels may include polyvinyl alcohol, sodium polyacrylate, acrylic acid polymers, and copolymers having abundant hydrophilic groups. Hydrogels consist of a network of hydrophilic polymer chains and are sometimes seen as colloidal gels in which water is the dispersion medium. Hydrogels are natural or synthetic polymers with very high absorbency (containing more than 99% by mass of water). Also, due to their high water content, hydrogels have flexibility very similar to that of natural tissues. The 3D matrix, or its components, particularly ECM or collagen, may still remain in the resulting tissue culture. Preferably, the 3D matrix is ​​a collagen matrix, which preferably contains type I and / or type IV collagen.

[0052] Preferably, the 3D matrix is ​​a hydrogel. The matrix, in particular the hydrogel, has a viscoelastic storage modulus G' of 10 to 30. The storage modulus of a viscoelastic material measures the stored energy representing the elastic portion and the energy dissipated as heat representing the viscous portion. A method for measuring the storage modulus that can be used according to the present invention, for example by a rheometer, is described in Anguiano et al. PLoS ONE 2017, 12(2): e0171417.

[0053] Preferably, the collagen 3D matrix contains 10% to 50% laminin, 20% to 70% collagen I, and / or 2% to 30% collagen IV, and preferably further contains 0.5% to 10% nidogen, 0.5% to 10% heparan sulfate proteoglycan, and / or 0.5% to 10% entactin (all by mass%). Matrigel typically contains 50% to 85% laminin, 5% to 40% collagen IV, 1% to 10% nidogen, 1% to 10% heparan sulfate proteoglycan, and 1% to 10% entactin (solid protein components only).

[0054] The present invention also provides a method for generating artificial vascular organoids, comprising embedding vascular stem cells in a collagen 3D matrix containing 10% to 50% laminin, 20% to 70% collagen I, and / or 2% to 30%, and stimulating the vascular differentiation of the stem cells in the collagen 3D matrix. All embodiments and preferred embodiments described herein also apply to this method, which also constitutes an independent embodiment of the present invention. Hereinafter, it is shown that such a 3D matrix results in a very suitable vascular network reminiscent of an in vivo vascular network. In particular, such a network has large lumens and can be connected to the circulatory system of a model animal and incorporated into the model animal. Preferably, vascular stem cells are generated by differentiating mesodermal stem cells into vascular stem cells, which are preferably obtained by stimulating mesodermal differentiation, particularly in pluripotent stem cells, as described above. All these embodiments can be combined with the above description.

[0055] In all embodiments and aspects of the present invention, the aggregated cells are preferably cultured in the 3D matrix for at least 5 days, preferably at least 7 days. The culture in the 3D matrix may be 5 to 60 days or longer, preferably at least 10 days.

[0056] The 3D matrix itself can be suspended in a suspension culture.

[0057] Within the 3D matrix, the aggregates form a vascular network, including endothelium formed by endothelial cells surrounded by pericytes that form the basement membrane, which will be explained further later. Self-assembly of the vascular network usually occurs through sprouting angiogenesis, which involves the sprouting of blood vessels into the matrix.

[0058] The present invention further provides an artificial vascular organoid culture comprising an interconnected network of capillaries, wherein the capillaries comprise a basement membrane having endothelium and pericytes around the vessels, and (i) the organoid is produced by the method of the present invention, and / or (ii) the capillaries are embedded in an artificial 3D matrix comprising a hydrogel having collagen, and / or (iii) the organoid culture contains 40 to 1000 vessels when counting the individual vessels and vessels between capillary intersections. All three features (i), (ii), and (iii) are representative features of the present invention and may be required individually or in combination by the artificial vascular organoid culture of the present invention. The organoid may still include a 3D matrix or a portion thereof (ii). The same as described above regarding the 3D matrix in this method applies to the organoid.

[0059] Organoids are considered artificial tissues. “Artificial” means that they are grown in vitro and possess specific characteristics of artificial culture, such as similar size, viscosity, shape, and cellular structure. Shape may be irregular and differ from naturally occurring tissues, and cellular structure may differ due to size distortions. In particular, “artificial” excludes naturally occurring tissues and organs and their parts, such as natural tissue sections. 3D matrices may still be present in the culture, and / or organoids may have shapes determined by growth in such matrices. For example, organoids can be obtained by growing them in 3D matrices, particularly matrices like those described above. Artificial organoid cultures are not, in particular, cultures or tissue samples of vascular systems developed in vivo.

[0060] The number of blood vessels within organoids is surprisingly large, something not yet achieved in artificial cultures (iii). Preferably, organoid cultures contain at least 40, more preferably at least 60, at least 100, at least 200, or at least 300 or more blood vessels when counting the vessels between individual vessels and capillary intersections. The upper limit of 1000 capillaries is the result of a typical organoid that is still a manageable size for screening, for example, in a cell culture well plate, but of course, larger sizes and capillary numbers are possible by continuing organoid culture. The number of capillaries is counted as is commonly done in this field, i.e., by counting the vessels between individual vessels and capillary intersections. This number can be estimated by counting a small portion of the organoid and extrapolating that number to the entire organoid.

[0061] Preferably, the capillaries of the artificial blood vessel organoid culture have an average diameter of 1 μm to 30 μm, preferably 5 μm to 20 μm. Such large diameters and volumes of capillaries enable perfusion in circulating animal models. Preferably, the average diameter of the capillaries is at least 1 μm, more preferably at least 2 μm, even more preferably at least 3 μm, at least 4 μm, at least 5 μm, and at least 6 μm or more.

[0062] Artificial blood vessel organoids preferably have a maximum size of 100 μm to 10 mm. Sizes of 250 μm to 10 mm or 500 μm to 5 mm are preferred. This size is the organoid itself, i.e., the culture containing the entire vascular network, and preferably the organoid is still within a 3D matrix.

[0063] In particular, this size of approximately 1-2 mm makes it easier to manage organoids in cell culture well plates such as 96-well plates, and they can be used for large-scale experimental purposes. The organoids are stable and can withstand physical stress, allowing for movement by pipetting, for example, and are suitable for routine laboratory handling and automated processing in screening robots.

[0064] The artificial blood vessel organoid may be provided in the form of a spheroid. For example, particularly when the shortest dimension is 20% or more, particularly 30% or more, or 40% or more of the longest dimension. Preferably, the volume of the artificial blood vessel organoid is at least 1×10 6 μm 3 , particularly preferably at least 2×10 6 μm 3 , at least 4×10 6 μm 3 , at least 6×10 6 μm 3 , at least 8×10 6 μm 3 , at least 10×10 6 μm 3 , at least 15×10 6 μm 3 and / or is of a size of at least 250 μm, particularly at least 350 μm.

[0065] The organoid can also be provided as a disk, which can be suspended in a free-floating environment for ease of handling.

[0066] The presence of sufficient perivascular pericytes within the artificial organoids of the present invention is particularly surprising and indicates that the vascular network of the present invention in the organoids has achieved in vivo characteristics. The perivascular pericytes support endothelial cells. The ratio of endothelial cells to perivascular pericytes varies depending on the culture time of the organoids. Preferably, the ratio of endothelial cells to perivascular pericytes in the artificial blood vessel organoid culture is 100:1 to 1:10. Preferably, the ratio is 50:1 to 1:5, or 25:1 to 1:4, or 10:1 to 1:3, or 5:1 to 1:2. Usually, in young organoids, endothelial cells are in excess, and in old organoids, the ratio may be about 1:1, or there may even be an excess of pericytes relative to endothelial cells.

[0067] Preferably, the capillaries of the artificial blood vessel organoid culture contain mature endothelial cells. Mature endothelial cells may respond to TNF-alpha by responding to ICAM-1 expression. Preferably, the capillaries of the artificial blood vessel organoid culture contain mature pericytes. The maturity of the pericytes can be detected by measuring the expression markers of mature pericytes.

[0068] Endothelial cells may be surrounded by a basal membrane (also called a basement membrane). The basal membrane may contain collagen IV, fibronectin, and / or laminin. It may be rich in collagen IV. The thickness of the basal membrane can be a marker of capillary health and is measured as an indicator by screening or other testing methods. The basal membrane of capillaries in artificial blood vessel organoid cultures may have a thickness ranging from 0.1 μm to 3 μm, preferably 0.3 μm to 2.5 μm, depending on the size of the capillaries. Preferably, the average thickness of the basal membrane of capillaries in artificial blood vessel organoids is 0.3 μm to 2.5 μm, preferably 0.6 μm to 2.1 μm, particularly preferably 0.8 μm to 1.8 μm, and most preferably about 1.2 μm. "About" in this case means ±30%.

[0069] A further representative feature of the present invention is that the organoid generates venules and arterioles, as seen in in vivo vascular trees.

[0070] The present invention further provides a method for providing a non-human animal model having human capillaries, wherein the human capillaries include a basement membrane having endothelium and pericytes around the vessels, the method comprising the steps of introducing the human vascular organoid of the present invention, as described above, into a non-human animal, and growing capillaries in the organoid. Preferably, the human organoid is introduced onto or into the kidney of the non-human animal. The present invention also provides a non-human animal model comprising a culture of the inserted artificial vascular organoid of the present invention. As described above, the advantages of the organoid of the present invention are the versatility of the capillaries and the bio-like structure. By introducing these capillaries into non-human animals, their behavior can be studied in vivo.

[0071] Animal models for studying and investigating vascular diseases such as diabetes are well known in the art (e.g., International Publication No. 2015 / 044339A1). These models are typically based on animals with genetic modifications that induce disease states. However, such mutations also alter the premise of the study, potentially changing not only the onset of disease but also the response to tested treatment options. Therefore, it is necessary to investigate real-world conditions. A model of the human vascular system is particularly preferred. The present invention achieves this goal by providing organoids suitable for transplantation into test animals. However, as mentioned above, the organoids of the present invention, which are grown in vitro, closely resemble the vascular networks formed in vivo in an artificial and controllable environment (e.g., within a 3D matrix rather than connective tissue). Among the vascular system characteristics of the present invention that can be introduced into non-human animals are capillaries having a basement membrane with endothelium and pericytes around the vessels. Therefore, the present invention also provides a non-human animal model having human capillaries, where the human capillaries include a basement membrane with endothelium and pericytes around the vessels. All of these types of animal models are described collectively, and each preferred or further embodiment applies to all of the animal models of the present invention.

[0072] The present invention enables the study of human capillaries in non-human animals. Therefore, the organoids are preferably derived from human cells, i.e., they possess human capillaries in the non-human animals. The non-human animals are preferably vertebrates, such as mammals, reptiles, birds, amphibians, or fish. Terrestrial vertebrates are particularly preferred. Mice, cattle, horses, cats, dogs, and non-human primates are particularly preferred in all aspects and embodiments of the present invention. Of course, any vertebrate can be used as a source of organoids, and therefore as a source of capillaries. However, of course, a remarkable advantage lies in the fact that human organoids also make it possible to create non-human animals as model organisms without the need to use organoids. Preferably, the non-human animals are immunocompromised to avoid organoid rejection.

[0073] In contrast to previous non-human animals, including human endothelial cells, as summarized in the background technology section, the present invention not only introduces human cells into non-human animals, but also introduces a fully developed human capillary system into non-human animals. That is, human endothelium is studied around the human basement membrane and pericytes in a structure reminiscent of human capillaries, particularly a capillary system including venules and arterioles.

[0074] Preferably, the capillaries of the artificial blood vessel organoid culture or human capillaries in the animal model are perfused by the blood circulation system of a non-human animal. As mentioned above, the ability of the organoid capillaries to connect to the vascular system of a non-human animal model is one of the advantages of the present invention. Such connections are formed when implanted in an appropriate location in the animal. The renal membrane is a highly responsive site, but other locations known in the art for the study of tissue transplantation and transplantation techniques are equally suitable. Other organs, such as organs transplanted intraperitoneally or subcutaneously, can also be used. In some cases, at certain sites, it may be necessary to further stimulate capillary proliferation, for example, by supplying growth factors in an appropriate matrix such as a hydrogel or sponge.

[0075] The artificial vascular organoid cultures of the present invention can also be used as research tools to investigate external (e.g., drugs or other stimuli) or internal (muta) effects on the proliferation and activity of cells within the organoid. In an additional embodiment, the present invention provides a method for studying the effects of developing vascular tissue, e.g., defects, particularly developmental defects, the method comprising (i) reducing or increasing the expression of a target gene in cells at any stage of the method of the present invention or in developed (completed) organoids or animal models, or (ii) administering a target candidate compound to cells at any stage of the method of the present invention or in developed (completed) organoids or animal models. The target gene may be a gene suspected to be essential or harmful when active during the development of healthy vascular tissue. Preferred genes are disease-related genes, e.g., genes that are causative agents of hereditary diseases. Methods for reducing or increasing gene expression are known in the art and include knockout, knockdown, or mutagenesis (especially RNA interference, antisense inhibition, shRNA silencing, CRISPR-Cas mutagenesis, etc.), or transgene introduction (e.g., knock-in). Such reduction or increase may be conditional, for example, by introducing a gene construct with an inducible promoter and / or conditional knockout, knockdown, or knock-in. The introduction of conditional mutations in essential genes or lethal genes is possible, for example, by using a suitable conditional mutation vector containing a reversible gene trap. Conditional mutations preferably promote reversible mutations, which can be reversed to an activated or inactive state by stimulation, for example, the doubleflex system (International Publication No. 2006 / 056615A1; International Publication No. 2006 / 056617A1; International Publication No. 2002 / 88353A2; International Publication No. 2001 / 29208A1). Mutations are either random or site-directed mutations in a specific gene. Therefore, in a preferred embodiment of the present invention, reversible mutations are introduced into pluripotent stem cells by either random (forward) or site-directed (reverse) mutagenesis.A suitable vector includes an insertion cassette with reversible mutations. The mutations can be switched on or off at any stage of the method of the present invention. The vector or other nucleic acid can be introduced into cells by any method known in the art, for example, electroporation. Of course, it is also possible to provide cells having the given mutations. Such cells can be isolated from a patient, then a pluripotent stem cell state can be induced, and the cells can be generated in the tissue of the present invention in the manner described above. The patient may have a specific disease of interest, in particular a vascular defect or capillary deformity. Candidate compounds are described further below with respect to their potential as therapeutic candidates. However, any candidate compound can also be assayed for the desired effect on cells, capillaries, or entire organoids. Preferred candidate compounds are small organic molecules.

[0076] In any method, culture, or non-human animal model of the present invention, preferably, blood vessels or capillaries are exposed to the pathogen, and the organoid or human animal model is a model of the disease state.

[0077] The capillary formation process of the present invention may be susceptible to damage. Alternatively, pathological conditions may be induced in the organoid itself, for example, as an implant in a culture or animal model.

[0078] Induction of pathological conditions for research purposes is known in the art and may be exposure to harmful compounds or pathogens, unfavorable diet, mechanical stress, or injury, or a combination thereof (e.g., as disclosed in US2010 / 124533A1). Pathogens include microorganisms, particularly bacteria or fungi and viruses. Pathological conditions may also be the result of genetic disorders or dysfunctions.

[0079] The etiology may include hyperglycemia and / or inflammation, both of which can be found, for example, in diabetes. Particularly preferred is the condition being diabetes. Inflammation may include exposure to or induction of one or more inflammatory cytokines, preferably TNF-alpha and / or IL-6. Hyperglycemia means an increase in glucose levels reminiscent of type 2 diabetes. Such glucose levels are, for example, at least 50 mM, preferably at least 70 mM. An example of a condition that induces diabetes is 75 mM D-glucose + 1 ng / mL TNF-α + 1 ng / mL IL-6 for 1 to 2.5 weeks. Diabetic changes in organoid blood vessels include thickening of the basement membrane (increase in type IV collagen, fibronectin, laminin, and perlecan), decreased angiogenesis, and endothelial / pericyte death. In animal models, diabetes may also be induced by selecting animals with an organic cause of diabetes, such as pancreatic beta-cell deficiency, or by causing a pancreatic beta-cell deficiency. Beta cell deficiency can be caused by autoimmune disorders such as type 1 diabetes, or by chemotoxicity induced by, for example, streptozotocin.

[0080] The incidence of autoimmune type 1 diabetes, particularly type 2 diabetes mellitus (T2D), continues to increase, becoming a global epidemic with over 420 million patients. T2D has various risk factors in different populations, including genetic predisposition, obesity, aging, nutritional status, and physical inactivity. Hyperglycemia results in vascular damage, leading to arteriosclerosis and chronic diabetic microangiopathy. A structural feature of diabetic microangiopathy is the thickening of the capillary basement membrane, particularly due to increased expression and deposition of extracellular matrix proteins such as type IV collagen. These changes lead to occlusive vascular disease, altered vascular permeability, or tissue hypoxia, resulting in complications such as heart disease, stroke, kidney disease, blindness, impaired wound healing, chronic skin ulcers, or limb amputation. Such symptoms can be studied in the organoids of this invention, not necessarily in animal models.

[0081] While diabetic microvascular alterations can occur in dogs, hamsters, or monkeys, there is no single experimental animal model that exhibits all the clinical features of the vascular alterations seen in human patients. Furthermore, these vascular alterations have not been adequately reproduced in previous human in vitro cell culture models. Consequently, a comprehensive understanding of the vascular alterations affecting hundreds of millions of diabetic patients, which cause life-threatening pathological conditions and ever-increasing mortality, remains lacking. The 3D human vascular organoids of the present invention exhibit the morphological and molecular features of authentic human microvascular structures. These human 3D vessels can generate vascular trees in vivo in non-human animals such as mice. Importantly, these organoids can be used to model diabetic microangiopathy and to screen pathways aimed at protecting against "diabetes"-induced vascular damage.

[0082] The present invention further relates to a method for screening candidate compounds that affect the etiology or pathogenesis of a disease, the method comprising administering the candidate compound to a culture or non-human animal model according to any aspect and embodiment of the present invention, or during the production of the culture or non-human animal, and monitoring the physiological differences of the culture or animal model compared to the culture or animal model that has not been administered the candidate compound. The stem cells used in the method, the organoids or non-human animal models used for screening are either having or developing the pathogenesis as described above, or are exposed to the etiology. A method is provided for testing or screening candidate compounds for their effects on the characterization, modification, and development of capillaries and their networks, the method comprising contacting a candidate compound with a cell or organoid or animal in any of the methods of the present invention, or contacting an organoid of the present invention with a candidate compound, maintaining the contacted organoid in a culture or in vivo, and observing any changes in the organoid's capillaries, such as developmental changes [including changes in the developed or developing capillaries of the organoid (such as physiological changes or changes in gene expression)], compared to the organoid that has not been contacted with the candidate compound.

[0083] The contact step is a processing step of cells to be generated in the organoid of the present invention, or of organoids or their precursor cell aggregates. Candidate compounds may be small organic molecules, such as molecules having a mass of 100 Da to 5000 Da. Other candidate compounds may be biomolecules such as proteins, nucleic acids, or carbohydrates. Further candidate compounds may be solvents such as ethanol (of course, used at concentrations generally effective for cells) or bulk chemicals such as polymers. The processing must be at a concentration in which the specific effect of the compound is expected. Various concentrations can be tested in parallel. Typically, the concentration of candidate compounds is from 1 ng / ml to 100 mg / ml, for example, from 100 ng / ml to 1 mg / ml.

[0084] Furthermore, a method is provided for screening or testing candidate therapeutic agents suitable for treating the pathological condition of a target organoid, the method comprising, for example, providing the organoid of the present invention by carrying out the differentiation method of the present invention, and administering the candidate substance to the cells or to the organoid affected by the pathological condition at any, preferably all, of the steps in the method (above). As described above, changes in the organoid's vascular network are observed compared to the absence of such candidate drugs. Such changes may be, for example, the thickness of the basement membrane, as observed in the case of diabetes.

[0085] This method is used in the diabetes model described above. Specifically, the Notch3 activation pathway, particularly gamma-secretase and its pathway, has been identified as a suitable ameliorative agent for the treatment of diabetes. The present invention also provides the use of Notch3 activation pathway inhibitors (e.g., gamma-secretase inhibitors, Notch3 inhibitors, DLL4 inhibitors, or combinations thereof) in the treatment or prevention of, for example, thickened capillary basement membranes, occlusive vascular disease, altered vascular permeability, tissue hypoxia, heart disease, stroke, renal disease, blindness, impaired wound healing, or chronic skin ulcers in diabetic vascular disease.

[0086] Examples of Notch3 activation pathway inhibitors, particularly inhibitors of gamma-secretase, Notch3, or DLL4, are inhibitory antibodies and binding partners of gamma-secretase, Notch3, or DLL4. Antibodies include any functional equivalents and derivatives thereof, and include antibody fragments such as Fab, F(ab)2, Fv, single-chain antibodies (scAb), nanobodies or similar camelid antibodies, or antibody-antigen-binding domains. Antibodies that specifically bind to gamma-secretase, Notch3, or DLL4 are included in the present invention. Antibodies can be produced by immunization using full-length proteins, soluble forms of proteins, or fragments thereof. Antibodies of the present invention may be polyclonal or monoclonal, or recombinant antibodies, such as chimeric antibodies in which the mouse constant regions on the light and heavy chains are replaced with human sequences, or CDR-transplanted antibodies in which only the complementarity-determining regions are of mouse origin. Antibodies of the present invention may also be human antibodies prepared, for example, by immunization of transgenic animals capable of producing human antibodies (International Publication No. 93 / 12227). Antibodies are useful for detecting gamma-secretase, Notch3, or DLL4 in biological samples, thereby enabling the identification of cells or tissues that further produce the proteins, antibodies that bind to (and block interactions with other binding compounds to) gamma-secretase, Notch3, or DLL4, and have therapeutic applications as gamma-secretase, Notch3, or DLL4 inhibitors. Anti-gamma-secretase antibodies are particularly preferred. A preferred anti-Notch3 antibody is tarectumab. Abcam anti-DLL4 antibodies include, for example, ab7280, ab176876, and ab183532.

[0087] Further inhibitors of these components may be any (physiological) binding partners, e.g., receptors or ligands, that sequester gamma secretase, Notch3, or DLL4, thereby reducing their biological activity. The binding partner is preferably a binding protein. An example of a ligand for Notch3 is recombinant soluble DLL4 protein. Such a binding partner (preferably not crosslinked to a substrate or membrane, e.g., not crosslinked on a plate) binds to the corresponding Notch receptor without activation. Therefore, recombinant DLL4 protein can act as an inhibitor because it is not presented on cell surfaces such as endothelial cell surfaces (Scehnet et al. Blood 2007 109(11): 4753-4760; Noguera-Troise et al. Nature 2006 444(7122): 1032-1037). Preferably, such binding proteins are provided in a soluble form without being immobilized on a solid surface or cell membrane, and in particular without forming complexes with other proteins. Such solubilized forms bind to their respective targets (e.g., gamma secretase, Notch3, or DLL4) but fail to activate the signaling cascade; instead, they inhibit it by blocking the target. Binding proteins can also be provided as sequestering or masking agents, which block the action of the target by forming a complex that prevents the binding of the activating signaling molecule.

[0088] Further Notch3 activation pathway inhibitors, particularly gamma-secretase, Notch3, or DLL4 inhibitors, are small molecule inhibitors. Small molecules are typically small organic compounds with sizes of 5000 daltons or less, 2500 daltons or less, and even 1000 daltons or less. As can be readily tested by the methods disclosed herein, small molecule inhibitors inhibit the activity of gamma-secretase, Notch3, or DLL4 against diabetic organoids. Examples of gamma-secretase inhibitors include semagacestat, abagacestat, RO4929097, DAPT, LY3039478 (crenigacestat), LY411575, dehydroxyLY411575, LY450139, MK-0752, IMR-1, dibenzazepine, PF-03084014 (nirogacestat), L-685,458, FLI-06, NGP555, flurbiprofen, and sulindac.

[0089] Further inhibitors include inhibitory nucleic acids such as siRNA, shRNA, or sgRNA (in combination with CRISPR-Cas). RNA interference (RNAi) is a mechanism for repressing gene expression in a sequence-specific manner. RNAi is a highly effective method for repressing specific gene functions in eukaryotic cells. When RNAi is applied to cells or organisms, it involves the degradation of target mRNA upon transfection with a vector encoding a small interfering RNA (siRNA) oligo or small hairpin RNA (shRNA). Various methods of RNAi have been described and are commonly known to alter gene expression in plant cells, Drosophila, and human melanoma cells, as described, for example, in US2002 / 0162126 and US2002 / 0173478. The siRNAs used in the methods and compositions of the present invention are selected to target a desired molecule of the gamma secretase, Notch3, or DLL4 signaling pathway, or a combination of such molecules. In this way, they target various RNAs corresponding to target genes. Those skilled in the art will understand that the siRNAs described herein may also include modified siRNAs, double-stranded RNAs, microRNAs (miRNAs), which are hybrid DNA / RNA constructs or any equivalent thereof, as well as siRNA forms such as siRNA replicas in viral and nonviral vectors, small hairpin RNAs (shRNAs), and siRNAs or shRNAs in carriers.

[0090] For example, several methods exist in the art for inhibiting gene expression using RNAi, such as those described in International Publication Nos. 02 / 055692, 02 / 055693, EP1 144623B1, and 03 / 074654. By using siRNA therapy, any cellular factor can be targeted and inhibited for the gamma-secretase, Notch3, or DLL4 antagonistic and inhibitory therapies of the present invention. Accordingly, such compounds can be used as gamma-secretase, Notch3, or DLL4 inhibitors.

[0091] Inhibitors in nucleic acid-encoding forms are also provided. The inhibitory nucleic acid, antibody, or binding partner (e.g., receptor or ligand) is encoded on the nucleic acid expressing the inhibitor in a cell, thereby exhibiting an inhibitory effect.

[0092] The inhibitor is typically administered in a therapeutically effective dose, which reduces the activity of gamma-secretase, Notch3, or DLL4, thereby significantly reducing the form of diabetes. Preferably, gamma-secretase, Notch3, or DLL4 activity is reduced by at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% compared to the no-treatment dose (under otherwise similar conditions). In a preferred embodiment, this reduction is equal to the intracellular level of gamma-secretase, Notch3, or DLL4.

[0093] The inhibitor may be provided in a pharmaceutical composition. A pharmaceutical composition or formulation for therapeutic or prophylactic use may contain pharmaceutically acceptable diluents, carriers, solubilizers, emulsifiers, preservatives, and / or adjuvants. The present invention also provides a pharmaceutical composition comprising a therapeutically effective amount of a gamma-secretase, Notch3, or DLL4 inhibitor. The term "therapeutically effective amount" means an amount that provides a therapeutic effect for a particular condition and route of administration. The composition may be in liquid or lyophilized form and may contain diluents with varying pH values ​​and ionic strengths (Tris, acetic acid, phosphate buffer), solubilizers such as Tween or polysorbate, carriers such as human serum albumin or gelatin, preservatives such as thimerosal or benzyl alcohol, and antioxidants such as ascorbic acid or sodium metabisulfite. The selection of a particular composition depends on many factors, including the desired condition to be treated, the route of administration, and pharmacokinetic parameters. siRNA formulations are preferably administered in liposomal formulations.

[0094] The present invention further provides the use of artificial vascular organoids according to the present invention as implants in tissue replacement therapy, preferably obtained from cultures of the present invention using a hydrogel containing collagen. Treatment using the organoids of the present invention may include placing the artificial vascular organoid in a wound and incorporating the artificial vascular organoid culture into the wound. Use as an implant may include placing the organoid in a target to be treated, particularly at a location where connective tissue regrowth is required. Such regrowth may be halted by diseases that impair regrowth, such as diabetes, or by drug therapy or other therapies, such as chemotherapy or radiation in the case of a radiation accident. It is preferable that the wound be treated. Such wounds may be chronic wounds, particularly those that cannot be closed even after 30, 60, or 90 days. Chronic wounds may be caused by the above-mentioned circumstances, diseases, drug therapy, or treatments. In particular, wounds may be diabetic wounds, such as diabetic foot ulcers, or burns, such as third-degree burns. Wounds may include skin wounds. Skin wounds can include damage to both the epidermis and dermis. Wounds involving the skin may also include trauma to the underlying muscles, bones, and tendons. Treatment may include cleaning the wound, especially removing dead tissue to facilitate regeneration.

[0095] In this type of treatment, one or more organoids, whose number depends on the size of the wound, are placed in the volume of the treatment target, such as a wound, and the organoids can be integrated with the tissue surrounding the volume. The volume is preferably surrounded by patient tissue in at least 50%, preferably at least 75%, of the surface area of ​​one or more organoids facing the outside (in the case of multiple organoids facing other organoids, the internal surface area is not counted). This means that the volume is mostly internal and can be incorporated into the target. The wound can be an internal wound or an open wound. Even an open wound may have such a volume facing an open surface, such as a wound in the skin.

[0096] Incorporating organoids into wounds typically involves a regenerative process enhanced by the presence of blood vessels in the organoids of the present invention. These blood vessels can connect to the patient's circulatory system, improving oxygenation of the damaged tissue and consequently enhancing its regeneration.

[0097] To avoid immune responses to organoids and their cells, the organoid cells are preferably from the same organism as the patient (preferably both are human, or both are from the same non-human animal, preferably a mammal), and their MHC matches that of the patient. To rapidly provide such a well-matched organoid, an organoid library with various recorded MHC types can be created. This organoid can then be rapidly provided to the patient.

[0098] Furthermore, kits of compounds and substances are provided. The kits may include means for carrying out any method of the present invention. Of course, it is not necessary to include all substances, as some substances are standard chemicals or commonly available. Nevertheless, core substances are preferably provided. Other kits may provide rarer substances. The kits of the present invention or these substances can be combined. The components of the kit are usually provided in separate containers, such as vials or flasks. The containers can be packaged together. Preferably, the kit includes a manual or instructions for carrying out the method of the present invention or these steps.

[0099] A kit suitable for the generation of artificial vascular organoids by the method of the present invention is provided. The kit may comprise (i) a Wnt agonist or GSK inhibitor; (ii) a vascular differentiation factor selected from VEGF, preferably VEGF-A, FGF, preferably FGF-2, and BMP, preferably BMP4; and (iii) a collagen 3D matrix preferably comprising 10% to 50% laminin, 20% to 70% collagen I, and / or 2% to 30% collagen IV (all by mass%).

[0100] Preferably, the kit includes the 3D matrix described above, or its components for generating such a 3D matrix. The matrix components may be provided in a solid state, such as a freeze-dried state, which can be restored to a matrix, for example, by hydration. Any of the above matrices or their components can be included in the kit. Preferably, the matrix is ​​a hydrogel, in particular the collagen hydrogel described above. The kit may include such a reversible (preferably collagenous) component. A more preferred matrix component is a carbohydrate (polysaccharide) in particular polymer form. A preferred polysaccharide is agarose.

[0101] Any kit may further include cell growth nutrients, preferably DMEM / F12, knockout serum substitute (KOSR) medium, Glutamax, or essential amino acids and / or non-essential amino acids (NEAAs), or any combination thereof. Any compound mentioned in the examples may be included in the kit.

[0102] Any method or product described herein can be implemented in relation to any other method or product described herein, and it is intended that different embodiments can be combined.

[0103] The kit may further include instructions for carrying out the method of the present invention. Such instructions may be in printed form or in computer-readable format on a suitable data carrier.

[0104] The initially filed claims are intended to cover claims that are multiplely dependent on any filed claims or combinations thereof. Any embodiment described herein can be implemented with respect to the methods or products of the present invention, and vice versa. Any embodiment considered with respect to specific conditions can be applied or implemented with respect to different conditions. Furthermore, the compositions and kits of the present invention can be used to achieve the methods of the present invention.

[0105] "Comprising" is understood as an open term, meaning it allows for additional components or processes of the substance. "Consisting of" is understood as a closed term, meaning it does not include additional components or processes of the substance.

[0106] Throughout this application, the term “approximately” may be used to indicate that a value includes the standard deviation of the error of the apparatus or method used to determine that value, and in a given set, the value may refer to ±10%.

[0107] The present invention is further defined in the following preferred embodiments and definitions, all of which can be combined with the above detailed description.

[0108] 1. A method for generating an artificial blood vessel organoid, comprising providing stem cells capable of vascular differentiation, stimulating mesoderm differentiation in the stem cells, stimulating vascular differentiation in the stem cells, generating cell aggregates from the stem cells, embedding the cell aggregates in a collagen 3D matrix, and stimulating vascular differentiation of the aggregates in the collagen 3D matrix.

[0109] 2. The method according to 1, wherein the collagen 3D matrix comprises at least 50% by mass of collagen.

[0110] 3. The method according to 1 or 2, wherein the collagen 3D matrix comprises 10% to 50% laminin, 20% to 70% collagen I, and / or 2% to 30% collagen IV, and preferably further comprises 0.5% to 10% nidogen, 0.5% to 10% heparan sulfate proteoglycan, and / or 0.5% to 10% entactin (all by mass%).

[0111] 4. A method for generating an artificial vascular organoid, comprising embedding vascular stem cells in a collagen 3D matrix containing 10% to 50% laminin, 20% to 70% collagen I, and / or 2% to 30% collagen IV, and stimulating the vascular differentiation of the stem cells in the collagen 3D matrix.

[0112] 5. The method according to 4, wherein vascular stem cells are generated by differentiating mesodermal stem cells into vascular stem cells, and preferably, the mesodermal stem cells are obtained by stimulating mesodermal differentiation in pluripotent stem cells.

[0113] 6. The method according to any one of 1 to 5, wherein the stem cells capable of vascular differentiation are pluripotent stem cells, preferably induced pluripotent stem cells.

[0114] 7. The method according to any one of 1 to 6, wherein the cell aggregate embedded in the collagen matrix contains at least 50 cells.

[0115] 8. The method according to any one of 1 to 7, wherein mesoderm differentiation comprises treating the stem cells with a Wnt agonist or a GSK inhibitor, preferably CHIR99021.

[0116] 9. The method according to any one of 1 to 8, wherein the vascular differentiation in the stem cells comprises treating the stem cells with VEGF, preferably VEGF-A, and / or FGF, preferably FGF-2, and / or BMP, preferably BMP4, and / or under hypoxic conditions where atmospheric oxygen is 12% (v / v) or less.

[0117] 10. The method according to any one of 1 to 9, wherein the vascular differentiation of the aggregate comprises treating the cells of the aggregate with VEGF, preferably VEGF-A, and / or FGF, preferably FGF-2.

[0118] 11. The method according to any one of 1 to 10, wherein the aggregates are embedded in a collagen 3D matrix 7 to 15 days after the start of aggregate formation.

[0119] 12. The method according to any one of 1 to 11, wherein the cells of the aggregate are cultured in the 3D matrix for at least 5 days, preferably at least 7 days.

[0120] 13. The method according to any one of 1 to 12, wherein the 3D matrix is ​​preferably a hydrogel having a viscoelastic storage modulus G' of 10 to 30.

[0121] 14. An artificial blood vessel organoid culture comprising an interconnected network of capillaries, wherein the capillaries comprise a basement membrane having endothelium and pericytes around the vessels, wherein the organoid is produced by any one of methods 1 to 13, and / or the capillaries are embedded in an artificial 3D matrix comprising a hydrogel having collagen, and / or the organoid culture comprises 40 to 1000 vessels when counting the individual vessels and vessels between the intersections of capillaries.

[0122] 15. The artificial blood vessel organoid culture according to 14, wherein the capillaries have an average diameter of 1 μm to 30 μm.

[0123] 16. An artificial blood vessel organoid culture according to 14 or 15, wherein the ratio of endothelial cells to perivascular pericytes is 100:1 to 1:5.

[0124] 17. An artificial blood vessel organoid culture according to any one of 14 to 16, wherein the capillaries include mature endothelial cells and / or mature pericytes.

[0125] 18. A method for providing a non-human animal model having human capillaries, wherein the human capillaries include a basement membrane having endothelium and pericytes around the blood vessels, comprising the steps of introducing a human vascular organoid according to any one of 14 to 17 into a non-human animal, and causing the organoid to proliferate in its capillaries, wherein preferably the human organoid is introduced onto or into the kidney of the non-human animal.

[0126] A non-human animal model containing an inserted artificial blood vessel organoid culture, as described in any one of sections 19.14-18.

[0127] 20. A non-human animal model having human capillaries, wherein the human capillaries include a basement membrane containing endothelium and pericytes around the vessels.

[0128] 21. A non-human animal model according to 19 or 20, wherein the capillaries of the artificial blood vessel organoid culture or the human capillaries are perfused by the blood circulation system of a non-human animal.

[0129] 22. The method or culture or non-human animal model according to any one of 1 to 21, wherein the blood vessel or capillary is exposed to a pathogen, and the organoid or human animal model is a model of the disease state.

[0130] 23. The method according to 22, or a culture or non-human animal model, wherein the etiology comprises hyperglycemia and / or inflammation, and / or the above condition is diabetes, and preferably the inflammation comprises exposure to one or more inflammatory cytokines, preferably TNF-alpha and / or IL-6.

[0131] 24. A method for screening candidate compounds that affect the etiology or pathogenesis of a disease, comprising administering the candidate compound to the culture or non-human animal model described in any one of 1 to 23, or during the production of the culture or non-human animal model, and monitoring the physiological differences of the culture or animal model compared with the culture or animal model in which the candidate compound has not been administered.

[0132] 25. A method for studying the effects of developing vascular tissue, for example defects, particularly developmental defects, comprising (i) reducing or increasing the expression of a target gene in a cell in any step of the method of the present invention or in an organoid or animal according to any one of 1 to 21, or (ii) administering a candidate compound of interest to a cell during the development of the organoid at any stage of the organoid or animal according to any one of 1 to 21.

[0133] 26. Use of the artificial blood vessel organoid described in any one of 14 to 17 as an implant in tissue replacement therapy, particularly preferably in a treatment method in which the artificial blood vessel organoid is placed in a wound and the cultured artificial blood vessel organoid is incorporated into the wound.

[0134] 27. Use of Notch3 activation pathway inhibitors (e.g., gamma-secretase inhibitors, Notch3 inhibitors, DLL4 inhibitors, or combinations thereof) in the treatment or prevention of thickened capillary basement membranes in diabetic vascular disease, occlusive vascular disease, altered vascular permeability, tissue hypoxia, heart disease, stroke, renal disease, blindness, impaired wound healing, or chronic skin ulcers.

[0135] A kit suitable for the generation of artificial blood vessel organoids by any one of the methods described in 28.1 to 13, comprising: (i) a Wnt agonist or GSK inhibitor; (ii) a vascular differentiation factor selected from VEGF, preferably VEGF-A, FGF, preferably FGF-2, BMP, preferably BMP4; and (iii) a collagen 3D matrix preferably comprising 10% to 50% laminin, 20% to 70% collagen I, and / or 2% to 30% collagen IV (all by mass%).

[0136] The present invention is further illustrated by the following drawings and embodiments, but is not limited to these specific embodiments of the present invention. [Examples]

[0137] Example 1 Materials and methods Differentiation of human stem cells into vascular organoids. All experiments presented were performed using human iPS cell line NC8 (Pripuzova et al. Stem Cell Res. 14, 323-338 (2015)) or human embryonic stem cell (ESC) line H9 (Thomson et al. Science 282, 1145-1147 (1998)). All stem cells were cultured under conditions that did not include chemically defined feeder cells, as previously described (Chen et al. Nat. Methods 8, 424-9 (2011)). For differentiation, H9 ESCs or NC8 iPS cells were deaggregated with 0.5 mM EDTA for 2 minutes, followed by incubation with 0.1% stem proaccutase (Stempro Accutase) (Life Technologies) for 3 minutes. 2 × 10 5 The cells were resuspended in differentiation medium (DMEM: F12 medium, 20% KOSR, Glutamax, NEAA, all from Gibco) containing 50 μM Y-27632 (Calbiochem), and seeded in one well of a 6-well plate with an ultra-low adhesion surface for cell aggregation (Corning). Cell aggregates were treated with 12 μM CHIR99021 (Tocris) on day 3, and BMP4 (30 ng / mL, Stemcell Tech.), VEGF-A (30 ng / mL, Peprotech), and FGF-2 (30 ng / mL, Miltenyi) were added on days 5, 7, and 9. On day 11, the cells were switched to a medium containing VEGF-A (30 ng / mL), FGF-2 (30 ng / mL), and SB43152 (10 μM) to balance the endothelial cell / pericyte ratio. The obtained cell aggregates were embedded in a Matrigel:Collagen I (1:1) gel on day 13 and covered with differentiation medium containing 100 ng / mL VEGF-A and 100 ng / mL FGF-2. This differentiation medium was replaced every 2-3 days. After approximately 18 days, the vascular network was established and could be analyzed directly, or the network of individual cell aggregates could be excised from the gel and further cultured as free-floating vascular organoids in a 96-well low-adhesion plate (Sumilon, PrimeSurface 96U) for up to 3 months.

[0138] Human iPSC reprogramming and characterization. Human dermal fibroblasts (ATCCs) and blood samples were reprogrammed as previously described (Agu et al. Stem cell reports 5, 660-71 (2015)). Multiplex fluorescence in situ hybridization (M-FISH) was performed to confirm chromosomal integrity as described in Agu et al. For genotyping, sample preparation was carried out according to the Infinium HTS protocol guide recommended by Illumina Inc. Genotyping was performed using an Illumina Infinium PsychArray-24 BeadChip scanned with an Illumina iScan system according to the manufacturer's instructions. Genotypes were retrieved using Illumina GenomeStudio (Illumina, San Diego, CA, USA) with genotyping software (module 2.0.1), and samples with a call rate <0.995 were excluded. For analysis, Illumina default settings, InfiniumPsychArray-24v1-1_A1 manifest, and Infinium The PsychArray-24v1-1_A1_ClusterFile cluster file was applied. CNV analysis and plotting were performed using bcftools cnv.

[0139] Immunocytochemistry. Vascular networks in collagen I:Matrigel gel were fixed for 20 minutes, and free-floating vascular organoids were fixed in 4% PFA at room temperature (RT) for 1 hour. These were then blocked on a shaker at room temperature for 2 hours using 3% FBS, 1% BSA, 0.5% Triton, and 0.5% Tween. Notably, the vascular organoids were more stable than the vascular networks initially formed in the 3D gel and could therefore be used in standard immunohistochemical procedures. Primary antibodies were diluted 1:100–1:200 with blocking buffer and incubated overnight at 4°C. These studies used the following antibodies: anti-CD31 (DAKO, M082329), anti-VE-cadherin (Santa Cruz, sc-9989), anti-ICAM-1 (Sigma, HPA002126), anti-PDGFR-β (CST, 3169S), anti-SMA (Sigma, A2547), anti-carponin (Abcam, AB46794), anti-type IV collagen (Merck, AB769), anti-laminin (Merck, 19012), and anti-MYH11 (Sigma, HPA014539). After washing with PBS-T (0.05% Tween) for 10 minutes three times, the samples were incubated with Life Technologies' corresponding secondary antibodies [Alexa Fluor 555 donkey anti-mouse (A31570), Alexa Fluor 647 donkey anti-rabbit (A31573), Alexa Fluor 488 donkey anti-goat (A11055), Alexa Fluor 488 donkey anti-sheep (A11015)] in blocking buffer at 1:250 at room temperature for 2 hours. After washing with TBST for 20 minutes three times, the samples were counterstained with DAPI. The samples were mounted (DAKO S302380), dried overnight, and then imaged with a Zeiss 780 laser scanning microscope.

[0140] Vascular organoid transplantation. Vascular organoids were transplanted subcapsulate of 12-15 week old NSG mice. All surgical procedures were performed in accordance with Austrian law and ethical approval. Mice were imaged using MRI, and the transplantation was monitored over time. To test perfusion of human vascular grafts, mice were intravenously injected with either FITC-dextran (1.25 mg / mouse, Invitrogen D1822) or anti-human CD31-Alexa 647 (2 μg / mouse, BD 558094). The excised grafts were fixed with 4% PFA at room temperature for 2 hours and stained whole as described for vascular organoids above, or treated with immunohistochemistry or standard H&E histological staining. A specific anti-human CD31 antibody (DAKO, M082329) was used to distinguish between endogenous mouse vessels and transplanted human vessels, and a specific anti-mouse CD31 antibody (Abcam, AB56299) was used to visualize the mouse vessels. To rule out the possibility of cross-reactivity, these antibodies were tested on both human and mouse control sections to verify their specificity. Samples were imaged using a Zeiss 780 laser scanning microscope.

[0141] MRI imaging was performed using a 15.2 T Bruker system (Bruker BioSpec, Ettlingen, Germany) with a 35 mm orthogonal birdcage coil. A tailline for contrast agent delivery was inserted before imaging (30 gauge needle with silicone tubing). All animals (N=3) were anesthetized with isoflurane (4% induction, 1.5% maintenance). Respiration was monitored during imaging, and the isoflurane level was adjusted if respiration was less than 50 or greater than 80 per minute. Mice were kept warm in water heated to 37°C and circulated using a water pump. A multislice multiecho (MSME) spin echo sequence was used for anatomical positioning and visualization of the implant (repetition time (TR) / echo time (TE) = 3000 / 5.8~81.18 ms, 14 echoes, 117 μm² in-plane resolution, 0.5 mm section thickness, number of experiments [NEX] = 1). To compensate for contrast agent leakage, a 0.05 ml bolus injection of 0.01 mol / L gadolinium-based contrast agent (Magnevist, Berlex) was performed. Dynamically sensitive contrast agent (DSC) perfusion MRI was performed after injecting 0.05 ml of 0.25 mol / L Magnevist into the tail vein, with a time resolution of 500.6 ms (1 section; TR / TE = 500 / 1.7 ms; flip angle = 5 degrees; 468 x 468 μm). 2 Images were acquired using fast imaging with steady-state precession (FISP) at an in-plane resolution of 1 mm; section thickness; NEX=2; 360 iterations. Perfusion, relative blood volume (rBV), mean transit time (MTT), and leakage (K2) were calculated using the DSC data. Processing was performed offline using ImageJ (National Institutes of Health; rsbweb.nih.gov / ij / ) and the DSCoMAN plugin (Duke University, dblab.duhs.duke.edu / wysiwyg / downloads / DSCoMAN_1.0.pdf). For the analysis, the first five time points of the DSC-MRI time series were truncated to ensure steady-state magnetization and pre-bolus signal intensity.

number

number

[0142] Modeling of diabetic vascular damage in human vascular organoids. Endothelial networks established in vascular organoids were cultured for up to 3 weeks in non-diabetic control medium (17 mM glucose) or diabetic medium [75 mM glucose, in the presence of human TNFα (1 ng / mL, Invitrogen PHC3011) and / or IL-6 (1 ng / mL, Peprotech 200-06)], and the basement membrane was examined by type IV collagen immunostaining and electron microscopy. D-mannitol was used in non-diabetic medium as a control for hyperosmolarity. For quantification of the basement membrane, the acquired Z-stacks were analyzed, and the thickness of the ColIV coat around the luminal structure was measured using ImageJ software. For drug treatment, organoids were exposed to diabetes medium (75 mM glucose, 1 ng / mL human TNFα, and 1 ng / mL IL-6) in or without the following drugs: 2,4-thiazolidinedione (5 mM, Abcam ab144811), metformin (5 mM, Abcam ab120847), acarbose (80 μg / mL, Sigma A8980), nategringine (100 μM, Sigma N3538), diphenyleneiodonium (10 μM), glimepiride (30 nM, Sigma G2295), and pioglitazone (10 μM, Sigma E6910). The following small molecule inhibitors were used: N-acetyl-L-cysteine ​​(500 μM, Sigma, A7250), CHIR99021 (10 μM, Tocris 4423), Goe6976 (100 nM, Merck US1365250), MK2206 (10 μM, Eubio S1078), QNZ (10 μM, Eubio S4902), SB203580 (10 μM, Eubio S1076), SCH772984 (500 nM, Eubio S7101), SP600125 (10 μM, Eubio S1460), Y-27632 (10 μM, Calbiochem 688000), DAPT (25 μM, Sigma) D5942), SB431542 (10μM), Abcam ab120163).

[0143] FACS analysis of vascular organoids. Non-diabetic and diabetic vascular organoids were deaggregated in PBS using 25 μg / mL hyaluronidase (Worthington), 3 U / mL dispase (Gibco), 2 U / mL liberase (Roche), and 100 U DNAse (Stemcell Tech) at 37°C for 45–60 minutes. Single cells were then stained with the following antibodies: anti-CD31 (BD, 558094), anti-PDGFR-β (BD, 558821), anti-CD90 (Biolegend, 328117), anti-CD45 (ebioscience, 11-0459-41), and anti-CD73 (BD ​​742633). Dead cells were excluded using DAPI staining. BD FACS Aria III was used for cell sorting, and BD FACS LSR Fortessa II was used for cell analysis.

[0144] Genome editing using CRISPR / Cas9. 2A-Puro cassette. 13A mammalian expression vector expressing Cas9 from Streptococcus pyogenes (S. pyogenes) containing the (Addgene Plasmid:#62988;) gene was cleaved with BbSI (Thermo Fisher ER1011) slightly after the U6 promoter. The plasmid was then religated, and sgRNA was introduced for either Notch homologous protein 3 (Notch3) or delta-like protein 4 (Dll4). The following primers were used for sgRNA annealing: Notch3: forward primer, caccgGCCACTATGTGAGAACCCCG (SEQ ID NO: 7); reverse primer, aaacCGGGGTTCTCACATAGTGGCc (SEQ ID NO: 8); Dll4: forward primer, caccgCAGGAGTTCATCAACGAGCG (SEQ ID NO: 9); reverse primer, aaacCGCTCGTTGATGAACTCCTGc (SEQ ID NO: 10). The sgRNA plasmid was validated by Sanger sequencing and used for electroporation of iPSCs (NC8) using the 4D-Nucleofector System (Lonza). 2 μg of plasmid DNA was transfected using the P3 Primary Cell 4D-Nucleofector Kit. Transfected NC8 cells were seeded in Essential 8 medium (Gibco) containing 50 μM Y27632 (Calbiochem) on Matrigel-coated 6-well plates and cultured for 24 hours, followed by 48 hours of puromycin treatment (0.2 μg / ml). The remaining cells were cultured until colony formation was observed, and single colonies were further expanded for genotyping by Sanger sequencing. Knockout cell lines were validated by Western blotting or immunofluorescence staining.

[0145] Modeling of diabetic vascular complications in human vascular organoids in vivo. Immunodeficient NSG mice with human vascular organoid grafts were intraperitoneally injected with 40 mg / kg of streptozotocin (STZ) (Merck, 572201) daily for 5 consecutive days. STZ was dissolved in fresh citrate-buffered water (pH 4.6) daily and used immediately. Diabetes was confirmed (blood glucose > 300 mg / dL) by measuring non-fasting glucose using the OneTouch UltraEasy system (Lifetouch, AW06637502C). DAPT (Selleckchem S2215) was dissolved in ethanol and injected at 5 mg / kg using 90% corn oil for 5 consecutive days, with 2 days of no treatment per week. Anti-Notch3 blocking antibody (R&D AF1559) was injected at 1 mg / kg three times per week. FITC-Dextran was used to quantify vascular leakage. + The area was measured and FIJI software was used to determine the area of ​​perfused human blood vessels (hCD31). + The area was standardized to ). Next, this ratio was further standardized to control non-diabetic mice. To avoid measuring the acute effect of DAPT on vascular permeability, the permeability of long-term DAPT-treated vessels was measured after a 2-day discontinuation of treatment.

[0146] Next-generation sequencing and qRT-PCR analysis were performed. Vascular networks of non-diabetic and diabetic vascular organoids were deaggregated at 37°C for 45-60 minutes using 25 μg / mL hyaluronidase (Worthington), 3 U / mL dispase (Gibco), 2 U / mL liberase (Roche), and 100 U DNAse (Stemcell Tech) in PBS. Next, single cells were stained for CD31 expression (BD 558094), and DAPI-negative (= viable cells) were sorted using a FACS Aria III machine. CD31-positive, DAPI-negative endothelial cells were sorted directly into trizole LS buffer (Invitrogen), further processed, and RNA isolation was performed. For RNA sequencing, mRNA was enriched by poly(A) enrichment (NEB) and sequenced using Il-lumnia HiSeq2500. In qRT-PCR analysis, total RNA was extracted from all vascular organoids using Trizole (Invitrogen), and cDNA was synthesized using the iscript cDNA synthesis kit (Biorad) with SYBR Green master mix (Thermo) on a Biorad CFX real-time PCR instrument. All data were first standardized to GAPDH and then compared to non-diabetic control samples. The following primers were used. Col4a1-FWD:TGCTGTTGAAAGGTGAAAGAG(Sequence ID 1) Col4a1-REV:CTTGGTGGCGAAGTCTCC (Sequence ID 2) Col4a2-FWD:ACAGCAAGGCAACAGAGG (Sequence ID 3) Col4a2-REV:GAGTAGGCAGGTAGTCCAG(Sequence ID 4) GAPDH-FWD:TCTTCTTTTGCGTCGCCAG (Sequence ID 5) GAPDH-REV:AGCCCCAGCCTTCTCCA (Sequence ID 6) FN1-FWD:ACACAAGGAAATAAGCAAATG (Sequence ID 11) FN1-REV:TGGTCGGCATCATAGTTC (Sequence ID 12) TUBB-FWD:CCAGATCGGTGCCAAGTTCT(Sequence ID 13) TUBB-REV:GTTACCTGCCCCAGACTGAC(Sequence ID 14)

[0147] Bioinformatics analysis was performed. RNA-seq reads were aligned to the human genome (GRCh38 / hg38) using Tophat v2.0.10 and bowtie2 / 2.1.0. Gene and transcript abundance estimation and count prediction were performed using RSEM v1.2.25. Aligned reads were counted using HTSeq v0.6.1p1, and differential expression analysis was performed using DESeq2 v1.10.1 with an FDR threshold of 0.05. The GO term of upregulated genes was identified using Enrichr (Kuleshov et al. Nucleic Acids Res. 44, W90-7 (2016)). The expression profile similarity search server CellMontage v2 (cellmontage2.cira.kyoto-u.ac.jp; Fujibuchi et al. Bioinformatics 23, 3103-3104 (2007)) was used to classify the expression profiles of iPS.EC cells relative to cells of normal cell types. The mean relative abundance of iPS.EC cell transcripts in the total present particulate matter (TPM) was compared with 2919 pre-treated human gene expression datasets. Based on the results, iPS.EC cells are most similar to endothelial cells—all 75 of the most correlated datasets originated from endothelial cells—55 from venous endothelial cells, 13 from microvascular endothelial cells, 5 from arterial endothelial cells, and 2 from lymphatic endothelial cells, with correlation coefficients ranging from 0.69 to 0.64 and p-values ​​ranging from 5.38e-22¹² to 6.39e-18²⁸.To compare the iPS.EC expression profile with publicly available human tissue RNA-seq data (Lonsdale et al. Nat. Genet. 45, 580-5 (2013)), we used logarithmically transformed F / RPKM values ​​for 2338 tissue-specific genes (Cavalli et al. Genome Biol. 12, R101 (2011)) to combine our profile with previously described (Danielsson et al. Brief. Bioinform. 16, 941-949 (2015)) available expression profiles, removed sequencing batch effects using ComBat, and examined sample clustering in correlation heatmaps. We found that the iPS.EC expression profile clusters with the expression profile of GTEx arterial samples.

[0148] Skin samples from patients with type 2 diabetes and euglycemic control patients. Surgical human skin samples were collected from T2D and non-diabetic patients. Non-necrotic healthy skin was collected from lower limb amputations. Lower limb amputations in T2D patients were necessary due to diabetic foot syndrome. Foot amputations in non-diabetic patients were performed as a result of accidents, venous ulcers, or other vascular diseases unrelated to T2D. This study was approved by the local ethics committee, and all included patients submitted informed consent (numbers 449 / 2001; 81 / 2008). Notably, we included skin isolated at the maximum possible distance from ulcers or necrosis at the lower limb amputation site. Details of the patient population are shown in Table 1. [Table 1]

[0149] Immunohistochemistry of patient skin. Human skin specimens were cryopreserved with Geltol and stored at -80°C, or fixed with 4% paraformaldehyde and then embedded in paraffin. Sections of 2-5 μm were excised and used for subsequent immunofluorescence or immunohistochemical staining. The paraffin sections were dewaxed, hydrated, and heat-induced antigen recovery was performed. Antigenicity was recovered by microwave treatment (3 × 5 mins, 620 W) or by heating the sections in an autoclave in 10 mM citrate buffer (pH 6.0) for 60 minutes. Frozen sections were stored at -20°C, thawed and dried before use, and fixed in ice-cold acetone for 20 minutes. Subsequently, they were incubated with the indicated primary antibody and visualized using the biotin-streptavidin-horseradish peroxidase method or a fluorescently labeled secondary antibody.

[0150] Human patient-derived endothelial cell preparations. Four T2D patients and six non-diabetic patients were analyzed. For ex vivo preparations of BECs (spelled out), as already described. 11 Mechanical and enzymatic micro-preparation protocols, including the use of Dispause I (Roche Inc., #210455), were employed. The resulting single-cell suspensions were blocked with 1×PBS-1% FCS and incubated with anti-CD31, anti-CD45, and anti-podoplanin antibodies using a three-step procedure involving a washing step. See the section above for details on the antibodies. The cells were then sorted using FACStar Plus (Becton Dickinson). Total CD31 + Podoplanin - Endothelial cells were isolated, re-analyzed, pelletized twice (200g), dissolved in RLT buffer (Qiagen; #74104), and further processed for RNA sequencing.

[0151] Electron microscopy. Vascular organoids were fixed at room temperature for 1 hour using 2.5% glutaraldehyde in 0.1 M sodium phosphate buffer, pH 7.2. For electron microscopy of skin blood vessels from foot amputations of diabetic and non-diabetic patients, human skin was fixed with 4% PFA and 0.1% glutaraldehyde and embedded in Lowicryl-K4M. The samples were then washed with the same buffer, post-fixed with 1% osmium tetroxide in ddH2O, dehydrated in a series of stepwise acetone steps, and embedded in Agar100 resin. For electron microscopy of skin blood vessels from foot amputations of diabetic and non-diabetic patients, human skin was fixed with 4% PFA and 0.1% glutaraldehyde and embedded in Lowicryl-K4M. 70 nm sections were cut and post-stained with 2% uranyl acetate and lead Reynolds citrate. The sections were examined using an FEI Morgagni 268D (FEI, Eindhoven, The Netherlands) operated at 80kV. Images were acquired using an 11-megapixel Morada CCD camera (Olympus-SIS).

[0152] A rodent model of diabetes. The rodent models used in this study and references are shown in Table 2. The controls were either age-matched WT animals or untreated strains, as shown in the table. Sections of paraffin-embedded skin samples from all rodent models were stained with HE and PAS to visualize vascular morphology. [Table 2]

[0153] Statistics. Unless otherwise specified, all values ​​are shown as mean ± SEM. Statistical analysis was performed using GraphPad Prism. All statistical tests used are explained in the legend of the figures. P<0.05 was considered statistically significant.

[0154] Example 2 Establishment of human 3D vascular organoids Capillaries are composed of endothelial cells that form the inner wall and pericytes embedded in the surrounding basement membrane. Human endothelial cells have already been obtained from human embryonic stem cells (hESCs) and induced pluripotent stem cells (iPSCs) (James et al. Nat Biotechnol 28, 161-6 (2010); Patsch et al. Nat. Cell Biol. 17, 994-1003 (2015)). Furthermore, perivascular cells such as vascular smooth muscle cells can be generated from human ESCs and iPSCs (Cheung et al. Nat. Biotechnol. 30, 165-73 (2012)). However, to investigate the mechanisms of complex vascular diseases, a highly sophisticated model is needed that is similar to all the features of human microvascular structure, such as luminal endothelium, endothelial-pericyte interactions, and general basement membrane formation, and that can be applied to high-throughput drug screening. Therefore, we have embarked on establishing 3D human vascular organoids from hESCs and iPS cells.

[0155] To achieve this, we developed a multi-step protocol that modulates signaling pathways involved in mesoderm development and vascularization (Figure 1). First, we cultured human ES cell aggregates under hypoxic conditions and induced mesoderm differentiation by exposing these cell aggregates to the GSK inhibitor CHIR99021 to activate the Wnt pathway (Pasch et al., supra; Sumi et al. Development 135, 2969-2979 (2008)). Next, cell aggregates were treated with BMP4, VEGF-A, and FGF-2 (Bai et al. J. Cell. Biochem. 109, 363-374 (2010); Goldman et al. Stem Cells 27, 1750-1759 (2009)), and then with VEGF-A, FGF-2, and SB431542 (to block TGFβ signaling) (James et al., supra; Watabe et al. J. Cell Biol. 163, 1303-11 (2003)) to promote vascular differentiation. Then, these cell aggregates were embedded in a 3D matrix and further stimulated with VEGF-A and FGF-2 to promote vascular differentiation. After testing the defined experimental conditions in multiple pilot studies, a 3D Matrigel / Collagen I matrix was developed, thus enabling highly reproducible elongation of structures similar to vascular trees (Figure 1a). Immunostaining for the vascular marker CD31 confirmed that these elongations contained a high proportion of endothelial canals (Figure 1b, c). We also observed staining for VE-cadherin, an additional prototype marker for endothelial cells (Figure 6a). Confocal image analysis revealed that CD31 + The formation of a complex interconnected network of endothelial structures was demonstrated (Figure 1d). Furthermore, we used this approach to extract CD31 from human iPSCs. + We were able to develop vascular organoids (Figures 6b-6d).

[0156] Next, we have CD31 + We confirmed that vascular organoids reproduce the characteristics of human blood vessels in vivo. To profile gene expression, we deaggregated the organoids and performed CD31 analysis.+ For endothelial cells, selection was performed and RNA sequencing was carried out. CD31 from 3D cultures. + The gene expression profiles of endothelial cells clustered most closely with those of human blood vessels (GTEx) (Figure 7a). SHOGoin Cellmontage2 analysis further demonstrated that our organoid endothelial cells were exclusively identical to human endothelial cells (not shown). Furthermore, endothelial cells isolated from the organoids did not express the prototype hESC markers SOX2 and Nanog, nor the smooth muscle markers dystrophin, desmin, and myoguenin. Importantly, however, they did express biomarkers from primary human endothelial cells or previously reported 2D in vitro human endothelial cultures, such as CD34, CDH5, vWF, PECAM1, NOS3, or RAMP2 (Figure 7b). Endothelial cells isolated from the organoids also responded to TNFα stimulation by inducing the cell adhesion molecule ICAM1 (Figure 1e), demonstrating their functional capabilities. Most importantly, these 3D vascular organoids were self-organizing, and we observed the formation and proper localization of pericytes, defined by the molecular markers CNN1, SMA, and PDGFRβ (Figure 1f-h). The 3D structures were also surrounded by the basal layer, as determined by immunostaining for the prototype vascular basement membrane markers collagen IV (Figure 1h, i) and laminin (Figure 7c). Notably, co-culture of purified and differentiated endothelial and pericytes under the same conditions resulted in a weak endothelial cell network that showed little pericyte interaction and was not covered by collagen IV (Figure 20a). Importantly, we were able to reproducibly generate similar 3D vascular networks using the tested human embryonic stem cell line H9 and two additional iPSC lines (Figure 20b).

[0157] To further improve and standardize these in vitro microvascular structures for drug screening approaches, we developed free-floating 3D organoid cultures in a 96-microwell format (Figure 1a). These 1-2 mm free-floating organoids were used to study CD31 +A complex branching 3D capillary network was formed, consisting of pericytes closely bound to endothelial cells (Figure 2a). The generation of free-floating organoids from human ESCs and iPSCs was robust and reproducible. Importantly, the free-floating organoid cultures allowed for the isolation of individual organoids into wells for processing by immunohistochemistry and electron microscopy (EM). Immunohistochemistry and EM imaging demonstrated the formation of typical capillaries with endothelial cells, pericytes, and basement membrane, as well as the formation of typical tight junctions between endothelial cells (Figures 2b, c). We also found that CD31 was present at the edges of the proliferating vessels. + Observation of the end cells indicates the formation of new blood vessels (Figure 2d). As expected, these end cells are not surrounded by a basement membrane, which is only formed in mature capillaries (Figure 2d). The free-floating vascular organoids expanded after approximately 3–4 weeks of culture, after which growth ceased and they were maintained for at least 2 months thereafter.

[0158] Next, we used FACS to evaluate the cellular composition of vascular networks and free-floating organoids. Both were PDGFR-β + Pericytes and CD31 + It contained endothelium to varying degrees. The remaining cells were mainly CD90 + CD73 + Mesenchymal stem cell-like cells, and CD90 - CD45 + It was a small population of hematopoietic cells (Figure 15a). CD31 isolated from our vascular network and free-floating organoids. + Gene expression profiles of endothelial cells confirmed that these cells express mature endothelial markers such as von Willebrand factor (vWF) and efficiently downregulate parental iPSC pluripotency markers (Figure 15b). PDGFR-β from 3D cultures +Isolated cells showed mixed expression of endothelial / pericyte markers at the early vascular network stage, altered in vascular organoids toward typical pericyte characteristics such as the expression of NG2 (GSPG4), SMA (Acta2), or calponin-1 (CNN1) (Figure 15b). At this stage, we identified early PDGFR-β, which may still be present in vascular organoids. + We also found expression of Oct-4 and Nanog, which can arise from pericyte precursors. Importantly, endothelial cells in our free-floating organoids responded to TNF-α stimulation by inducing the cell adhesion molecule ICAM1 (Figure 15c), reflecting their functional capacity. Furthermore, we observed immunostaining for von Willebrandt factor (vWF), the formation of Weiber-Parard bodies, the uptake of acetylated LDL, and staining with lectin UEA-1 (Figures 15d-f), all of which indicate mature endothelial cells.

[0159] Therefore, we established self-organizing 3D human vascular organoids from hESCs and iPSCs that exhibit the morphological and molecular characteristics of the true human microvascular system.

[0160] Example 3 Vascular organoids establish functional human blood vessels in mice. To test whether vascular organoids can form functional blood vessels in vivo, we differentiated hiPSCs and hESCs into vascular organoids in vitro and transplanted them subcapsularly into the renal capsule of immunodeficient host mice. Human organoids, due to their compact structure, were reproducible and actually proliferated in the mouse environment, surviving for over 6 months in some cases. Staining of organoids and kidney tissue with human-specific anti-CD31 showed that human vascular structures were established alongside endogenous mouse blood vessels (Figure 3a). We also observed the sprouting of human blood vessels, as determined by the formation of end cells and the proliferation of human blood vessels into adjacent tissue. To evaluate blood circulation, we perfused receptor mice with ITC-dextran. We found that human blood vessels could access endogenous mouse blood vessels (Figures 3b, c). Similarly, when mice were perfused with human-specific anti-CD31 antibody, we observed perfusion and staining of blood vessels distinct from endogenous mouse blood vessels, as determined by mouse-specific anti-CD31 staining (Figure 3d).

[0161] Importantly, histological sectioning revealed that these human vessels could be identified as arterioles, capillaries, and venules (Figure 3e). This identification was made possible by human CD31 + This was further confirmed using immunohistochemistry for smooth muscle actin (SMA) or calponin as markers for endothelium and surrounding smooth muscle cells (Figure 3f). We also detected smooth muscle cells using antibodies specific to human myosin heavy chain 11 (MYH11) (Figure 3f). Furthermore, perfusion of the transplanted human vascular organoids was confirmed by MRI imaging, which detected flow into the transplanted human vascular organoids and, importantly, blood drainage from the vascular trees (Figure 3g). Quantitative MRI measurements of perfusion velocity and blood volume indicated well-vascularized and perfused grafts. In addition, mean transit time (MTT) and low vascular leakage (K2) confirmed the clearly normal tissue and function of human blood vessels compared to blood flow parameters in the kidneys and muscles of adjacent endogenous mice (Figure 3g). These data demonstrate that our human 3D capillary organoids can be identified as arterioles and venules in vivo and form perfused, functional human blood vessels in receptor mice.

[0162] Example 4 Diabetic vascular damage in human vascular organoids Diabetes mellitus is a leading cause of blindness, renal failure, heart attack, stroke, or lower limb amputation. Due to significant changes in blood vessels, it is largely defined by dilation of the basement membrane. Such structural changes due to diabetic microangiopathy have been observed in human kidney or muscle biopsies. To confirm the changes in diabetic microangiopathy in humans, we examined cutaneous microvessels in surgical specimens from euglycemic individuals and patients with type 2 diabetes (T2D). Clinical characteristics, including age, sex, body mass index (BMI), serum creatinine levels, and years of disease, are shown in Table 1. In cutaneous blood vessels of euglycemic controls, CD31 was determined by collagen IV and PAS staining (Figure 4a) and electron microscopy (Figure 4b). + The capillary endothelium was surrounded by a thin basement membrane. Microvessels in the skin of all type 2 diabetic patients included in our study revealed significant changes in extracellular matrix protein deposition and a greatly thickened basement membrane layer resembling onion skin, with typical fission (Figure 4a, b). Therefore, as expected, significant thickening of the basement membrane of skin capillaries in T2D patients is observed.

[0163] Diabetic microangiopathy is evident in the skin of diabetic patients but has not yet been observed in various rodent models of diabetes. Therefore, we conducted a comprehensive evaluation of the cutaneous microvascular systems in multiple genetically and environmentally induced mouse and rat models of diabetes. However, in none of these models—including leptin and leptin receptor mutant ob / ob and db / db mice, streptozotocin-treated mice, doxycycline-induced insulin knockout in mice, LDLR mutant mice on a high-fat diet, high-fat and glucose diets, or Zucker diabetic adipose rats with leptin receptor mutations, and streptozotocin-treated rats—we detected thickening of the basement membrane, which indicates cutaneous vascular pathology (Figure 9a, b, and Table 2). Thus, none of these very severe, long-term rodent models of type 1 and type 2 diabetes exhibited the characteristic feature of human diabetic vascular disease: thickening of the capillary basement membrane.

[0164] Since rodent models of diabetes do not replicate the cutaneous vascular damage present in diabetic patients, we wanted to test whether we could model this important phenotype in our human vascular organoids. To achieve this, we cultured 3D vascular organoids in high-glucose medium and monitored basement membrane dilation, detected by collagen IV, as in human skin samples. Interestingly, hyperglycemia resulted in a significant increase in collagen IV in human vascular organoids (Figure 4c, d). Because diabetes is associated with an inflammatory state including elevated serum levels of inflammatory cytokines such as TNF-α and IL-6, we also cultured vascular organoids in or without TNFα and IL-6 under euglycemic and hyperglycemic conditions. Under euglycemic conditions, collagen IV expression in vascular organoids did not change significantly with exposure to TNFα and IL-6 alone or in combination. However, collagen IV deposition was significantly increased in vascular organoids exposed to high glucose concentrations and both TNF-α and IL-6 (Figure 4c, d). Confocal sections of these organoids revealed significant dilation of collagen IV and thickening of the basement membrane in response to treatment with a "diabetes cocktail" of TNFα, IL6, and high glucose (Figure 4e). Furthermore, we observed significant thickening and fission of the basement membrane layer by EM, consistent with our findings in human T2D patients (Figure 4b) (Figure 4f). This thickening of the vascular basement membrane in response to the diabetes cocktail was observed in vascular organoids derived from human iPSCs (Figures 4c-f) and human ESCs.

[0165] Next, we characterized "diabetic organoids" exposed to high glucose / TNFα / IL6 based on gene expression. Significant reduction in endothelial cells and disappearance of pericytes were observed in vascular organoids exposed to TNF-α, IL6, and high glucose (Figure 16a, b). We selected CD31 from control and diabetic human vascular organoids. +RNA sequencing was performed on endothelial cells. Genes already suggested to be associated with human diabetes markers, including angiopoietin 2, apelin, ESM1, and TNFRSF11B, were among the top five most upregulated genes in diabetic organoids compared to control organoids (Figure 5a). In fact, differential gene expression profiles generated from skin blood vessels of diabetic organoids versus control organoids, and from T2D patients versus individuals with normal blood glucose levels, demonstrated significant overlap between diabetic organoids and T2D patients in relation to extracellular matrix, cell adhesion, and growth factor activity / binding (Figure 5a). We also found increased mRNA levels of collagen IV in diabetic organoids compared to controls (Figure 9b), and CD31 levels from control and diabetic organoids. + We found that the ontology (GO) pathway terms of the top five differentially expressed genes among endothelial cells were all related to collagen biosynthesis and extracellular matrix reorganization (Figure 5a). In contrast to vascular organoids, various endothelial cells exposed to high glucose, with or without TNFα / IL6, did not upregulate extracellular matrix and collagen biosynthesis components (including HUVEC), the immortalized human microvascular endothelial cell line HMEC1, and primary or TERT immortalized human vascular endothelial cells (BEC). Therefore, exposure of human vascular organoids to high glucose and an inflammatory environment results in significant thickening of the basal vascular membrane and alterations in gene expression profiles, modeling human diabetic microangiopathy.

[0166] Example 5 Inhibition of γ-secretase activity eliminates "diabetic" changes in vascular organoids. Having created an in vitro organoid model of human diabetic vascular complications, we then wanted to identify drugs that could block the thickening and dilation of the basement membrane in human vascular organoids treated with high glucose / TNFα / IL6. To this end, we first tested several approved drugs currently used in clinics for the treatment of diabetes. However, none of the drugs we tested—metformin, pioglitazone, glimepiride, acarbose, nateglidin, thiazolidinedione, and diphenyleodonium—had any effect on high glucose / TNFα / IL6-induced thickening of the basal vascular membrane in vascular organoids (Figure 5b, c).

[0167] Next, we screened diabetic vascular organoids using various small molecule inhibitors of common signaling and downstream pathways, namely GSK3, PKC, AKT, NFκB, ROS, p38-MAPK, JNK, ROCK, and ERK. None of these inhibitors had a significant effect on collagen IV dilation or capillary basement membrane thickening (Figure 5d, e). Notably, blocking NFκB did indeed significantly increase basement membrane thickening. Next, we evaluated inhibitors of γ-secretase, an enzyme that cleaves different receptors and activates distinct signaling pathways, including Notch. The γ-secretase inhibitor DAPT completely suppressed collagen IV dilation and basement membrane thickening in human vascular organoids exposed to a “diabetic cocktail” (Figure 5c, d). Furthermore, the action of the γ-secretase inhibitor was dose-dependent (Figure 5e), further confirming its specificity and efficacy. Importantly, we also observed that human blood vessels become more prone to leakage in diabetic mice, providing direct evidence that the morphological changes we observed are also related to impaired vascular function and that excessive vascular leakage was rescued by DAPT treatment (Figure 17a, b). Furthermore, in vivo DAPT treatment was found to improve CD31 in diabetic mice. +Human blood vessels were rescued from disappearance (Figure 17c, d). These data indicate that inhibition of γ-secretase activity inhibits structural and functional changes in diabetic blood vessels both in vitro and in vivo.

[0168] Example 6 Identification of Dll4-Notch3 as a candidate pathway for diabetic basement membrane thickening. γ-secretase is an enzyme capable of cleaving multiple distinct receptors and activating distinct signaling pathways, including Notch. To identify molecular DAPT targets involved in our experimental defense against diabetic vascular changes, we blocked the Notch ligands Jagged1, Dll1, Dll4, and Notch1 and Notch3 (all of which are prominently expressed in blood vessels). Inhibition of Jagged1, Dll1, and Notch1 had no apparent effect on the “diabetic” changes in our free-floating organoids. However, blocking Dll4 and Notch3 significantly rescued basement membrane thickening (Figure 18a). To confirm these findings, we generated Dll4 and Notch3 mutant human iPS cells using CRISPR / Cas9 (Figures 19a-d). From these mutant iPS cells, we were able to readily obtain vascular networks and free-floating vascular organoids (Figure 18b). Importantly, both Dll4 and Notch3 mutant vessels showed a significant reduction in basement membrane dilation compared to control organoids exposed to high glucose, IL6, and TNFα (Figure 18b). Finally, in vivo treatment of STZ-treated mice retaining human vascular trees with anti-Notch3 antibody showed that blocking Notch3 mitigates basement membrane changes in human vessels exposed to a diabetic environment (Figure 18c). Thus, without excluding other pathways, we identified Dll4-Notch3 as a key ligand-receptor pair capable of mediating basement membrane thickening in diabetic vascular disease.

[0169] conclusion Blood vessels are essential to the development of all organ systems and play a crucial role in a range of diseases, from stroke to heart attack or cancer. Due to their importance, several cell systems have been developed to study vascular biology during development and disease, including the use of classical endothelial cell lines such as HUVEC cells. Furthermore, endothelial and pericytes have been developed from human stem cells, respectively.

[0170] We have developed a robust and reproducible system for generating genuine human capillaries from hESCs and iPSCs. These blood organoids meet all the already defined criteria for human organoids. Interestingly, vascular organoids transplanted into immunodeficient mice resulted in connectivity between human blood vessels and the mouse circulatory system, as demonstrated by dextran perfusion, antibody injection, and MRI of blood flow, revealing perfusion and leakage rates comparable to endogenous mouse organs. Connecting the human vascular system to the mouse circulatory system reveals a clear vascular tree. Most importantly, the transplanted human organoids further develop into arterioles and venules in vivo, thus forming a true vascular tree, which has not been demonstrated before. Therefore, it may also be possible to use these organoids to develop more complex, multi-systemic organoids, for example, to form blood vessels containing cardiomyocytes or to attempt to generate blood vessels in brain or liver organoids. These could also be used to study rare vascular diseases using patient-derived iPSCs.

[0171] The global prevalence of diabetes has nearly doubled in the last 30 years, with current estimates indicating approximately 420 million people with diabetes, plus many more with prediabetes, often resulting in prolonged disease and increased mortality. Diabetes is a leading cause of blindness, renal failure, heart attack, stroke, and lower limb amputation, often as a result of vascular lesions such as insufficient tissue oxygenation, impaired cell transport, or significant thickening of the basement membrane leading to vascular rupture. While it is possible to model specific aspects of diabetic vascular changes in the retina and kidneys of rodents, to date, no single model has captured all the clinical features of diabetic vascular changes seen in humans. Furthermore, since none of the rodent models of diabetes we have tested show microvascular changes in the skin, it is essential to develop a novel system to identify the pathways and potential drug targets that function in these microvascular changes. To demonstrate the usefulness of our vascular organoids, we exposed them to a “diabetes cocktail” containing high glucose, IL-6, and TNFα. The results showed significant dilation of the collagen basement membrane and gene expression profiles, similar to the microvascular changes observed in the skin capillaries of T2D patients.

[0172] We tested many current antidiabetic drugs and small molecule inhibitors of several common signaling pathways, but only a few affected the dilation of the basement membrane of diabetic organoids. Interestingly, we found that the gamma-secretase inhibitor DAPT almost completely prevented basement membrane thickening in our organoid cultures. Gamma-secretase inhibitors are already undergoing clinical trials for Alzheimer's disease and are currently being tested as cancer treatments. These drugs could be reused to treat diabetic vascular disease in humans. Importantly, these data provide evidence in principle that a human vascular organoid model of diabetic microangiopathy is a useful screening tool for discovering new drugs that mitigate microvascular changes.

[0173] Gamma-secretase inhibitors are already undergoing clinical trials for Alzheimer's disease, and gamma-secretase inhibitors and Notch2 / 3 blockers are currently being tested as cancer treatments. Furthermore, inhibition of the Notch pathway by gamma-secretase inhibitors reduced diabetes-induced glomerulosclerosis and glomerular epithelial cell loss by apoptosis in diabetic rats. Therefore, these drugs can be reused for the treatment of diabetic vascular disease in humans. Importantly, these data provide proof in principle that human vascular organoids and our in vivo model of diabetic microangiopathy can be useful screening tools for developing new drugs to mitigate diabetic microvascular changes.

Claims

1. A method for generating an artificial blood vessel organoid that includes a network of interconnected capillaries, wherein the capillaries include a basement membrane having endothelium and pericytes, the method being as follows: This method stimulates mesodermal differentiation in mammalian stem cells capable of vascular differentiation, where mesodermal differentiation includes treating the stem cells with a Wnt agonist or a GSK inhibitor. The vascular differentiation in the aforementioned stem cells is stimulated, wherein the vascular differentiation in the aforementioned stem cells includes treating the stem cells with VEGF, FGF and / or BMP. Cell aggregates are generated from the aforementioned stem cells. The cell aggregates are embedded in a collagen 3D matrix containing collagen and laminin and / or entactin, and To stimulate the vascular differentiation of the aggregates in the collagen 3D matrix, wherein the vascular differentiation of the aggregates includes treating the cells of the aggregates with VEGF and FGF. The above method, including.

2. The method according to claim 1, wherein the cell aggregate embedded in the collagen 3D matrix comprises at least 30 cells.

3. The method according to claim 1 or 2, wherein the Wnt agonist or GSK inhibitor is CHIR99021.

4. The method according to any one of claims 1 to 3, wherein the vascular differentiation in the stem cells comprises treating the stem cells under hypoxic conditions of 12% (v / v) or less of atmospheric oxygen.

5. The method according to any one of claims 1 to 4, wherein the vascular differentiation of the aggregate comprises treating the cells of the aggregate with VEGF-A.

6. The method according to any one of claims 1 to 4, wherein the collagen 3D matrix comprises at least 50% by mass of collagen, and / or the collagen 3D matrix comprises 10% to 50% laminin, 20% to 70% collagen I, and / or 2% to 30% collagen IV.

7. The method according to claim 6, wherein the collagen 3D matrix further comprises 0.5% to 10% nidogen, 0.5% to 10% heparan sulfate proteoglycan, and / or 0.5% to 10% entactin (all by mass%).

8. The method according to any one of claims 1 to 7, wherein the 3D matrix is ​​a hydrogel.

9. The method according to claim 8, wherein the hydrogel has a viscoelastic storage modulus G' of 10 to 30.

10. An artificial blood vessel organoid culture comprising a capillary interconnection network, wherein the capillaries include a basement membrane having endothelium and pericytes, wherein the basement membrane comprises collagen IV, and the artificial blood vessel organoid culture is generated from mammalian stem cells capable of vascular differentiation, and the artificial blood vessel organoid culture further comprises hematopoietic cells.

11. The artificial blood vessel organoid culture according to claim 10, wherein the organoid is produced by the method described in any one of claims 1 to 9.

12. The artificial blood vessel organoid culture according to claim 10 or 11, wherein the capillaries are embedded within a collagen 3D matrix.

13. The artificial blood vessel organoid culture according to claim 10, 11, or 12, wherein the organoid culture contains 40 to 1,000 blood vessels when counting the blood vessels between the intersections of individual blood vessels and capillaries.

14. The artificial blood vessel organoid culture according to any one of claims 10 to 13, wherein the capillaries have an average diameter of 1 μm to 30 μm, and / or the ratio of endothelial cells to perivascular pericytes is 100:1 to 1:

10.

15. A method for providing human capillaries to a non-human animal model, comprising the steps of introducing a human artificial blood vessel organoid culture according to any one of claims 10 to 14, wherein the human capillaries comprise a basement membrane including endothelium and pericytes around the blood vessels, into a non-human animal, and causing the capillaries to proliferate in the organoid culture.

16. The method according to claim 15, wherein the organoid culture is introduced onto or into the kidney of the non-human animal.

17. A non-human animal model into which an artificial blood vessel organoid culture according to any one of claims 10 to 14 has been inserted.

18. The non-human animal model according to claim 17, wherein the capillaries of the artificial blood vessel organoid culture are perfused by the blood circulation system of the non-human animal.

19. A method for generating an artificial blood vessel organoid that is a model of a disease state by exposing an artificial blood vessel organoid produced by the method of any one of claims 1 to 9 to a pathogenic substance.

20. The method according to claim 19, wherein the etiology includes hyperglycemia and / or inflammation, and / or the condition is diabetes mellitus.

21. The method according to claim 20, wherein the inflammation comprises exposure to one or more inflammatory cytokines.

22. The method according to claim 21, wherein the one or more inflammatory cytokines are TNF-alpha and / or IL-6.

23. A pathological model of an artificial blood vessel organoid culture, generated by exposing the artificial blood vessel organoid culture according to any one of claims 10 to 14 to a pathogen.

24. The pathological model of an artificial blood vessel organoid culture according to claim 23, wherein the etiology includes hyperglycemia and / or inflammation, and / or the pathological condition is diabetes.

25. The pathological model of an artificial blood vessel organoid culture according to claim 24, wherein the inflammation comprises exposure to one or more inflammatory cytokines.

26. The disease model of an artificial blood vessel organoid culture according to claim 25, wherein the one or more inflammatory cytokines are TNF-alpha and / or IL-6.

27. ​​A disease model of a non-human animal model into which a model of the pathology of an artificial blood vessel organoid culture, generated by exposing the artificial blood vessel organoid culture according to any one of claims 10 to 14 to a pathogen, is inserted.

28. A pathological model of a non-human animal model according to claim 27, wherein the etiology includes hyperglycemia and / or inflammation, and / or the pathological condition is diabetes mellitus.

29. The disease model of a non-human animal model according to claim 28, wherein the inflammation comprises exposure to one or more inflammatory cytokines.

30. The disease model of a non-human animal model according to claim 29, wherein the one or more inflammatory cytokines are TNF-alpha and / or IL-6.

31. A method for screening candidate compounds that affect the etiology or pathogenesis of a disease, comprising administering the candidate compound to a disease model of an artificial blood vessel organoid culture or a disease model of a non-human animal model as described in any one of claims 23 to 30, and monitoring the physiological differences between the disease model of the artificial blood vessel organoid culture or the disease model of the non-human animal model in which the candidate compound has not been administered and the disease model of the artificial blood vessel organoid culture or the disease model of the non-human animal model in which the candidate compound has not been administered.

32. An artificial blood vessel organoid culture according to any one of claims 10 to 14, used as an implant in tissue replacement therapy.

33. The artificial blood vessel organoid culture according to claim 32, wherein the therapy includes placing the artificial blood vessel organoid culture in a wound and incorporating the artificial blood vessel organoid culture into the wound.

34. A kit for use in the method described in claims 1 to 9, comprising (i) a Wnt agonist or a GSK inhibitor, (ii) a vascular differentiation factor selected from VEGF, FGF, and BMP, and (iii) a collagen 3D matrix.

35. The kit according to claim 34, wherein the collagen 3D matrix comprises 10% to 50% laminin, 20% to 70% collagen I, and / or 2% to 30% collagen IV (all by mass%).

Images