Synthetic oncolytic LNP replicon RNA and its use in cancer immunotherapy
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2024-09-20
- Publication Date
- 2026-08-13
Smart Images

Figure 0007904878000008 
Figure 0007904878000009 
Figure 0007904878000010
Abstract
Description
[Technical Field]
[0001] Related applications This application claims priority under 35 U.S.C. § 119(e) of U.S. Provisional Patent Application No. 62 / 815,611, filed on 8 March 2019, the entire contents of which are incorporated herein by reference. [Background technology]
[0002] background This disclosure relates to a synthetic oncolytic virus comprising lipid nanoparticles containing one or more types of lipids and self-amplifying replicon RNA containing sequences encoding immunomodulatory molecules. [Overview of the project]
[0003] overview This disclosure is based, at least in part, on the unexpected discovery that synthetic oncolytic viruses, when injected at tumor sites, successfully induce a local anti-cancer immune response in the tumor and enable systemic immunity against peripheral tumors. Consequently, one aspect of this disclosure provides a synthetic oncolytic virus comprising lipid nanoparticles containing one or more types of lipids and self-amplified replicon RNA containing a sequence encoding the interleukin (IL)-12 molecule. The lipid nanoparticles can induce immunogenic cell death. The IL-12 molecule is expressed by the self-amplified replicon RNA.
[0004] The synthetic oncolytic virus contains lipid nanoparticles. The lipid nanoparticles contain one or more types of lipids. In some embodiments, one or more types of lipids contain cationic lipids. In some embodiments, the cationic lipid is N1,N3,N5-tris(3-(didodecylamino)propyl)benzene-1,3,5-tricarboxamide (TT3). In some embodiments, the lipid nanoparticles contain TT3, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), cholesterol, and C14-PEG2000. Furthermore, the synthetic oncolytic virus contains self-amplifying replicon RNA. In some embodiments, the self-amplicon RNA is derived from an alphavirus or other Group IV virus (such as a positive single-stranded RNA virus like hepatitis C virus (HCV)). In some embodiments, the alphavirus can be Venezuelan equine encephalitis virus, Semliki Forest virus, or Sindbis virus.
[0005] In some embodiments, the self-amplifying replicon RNA contains a sequence encoding an IL-12 molecule. In some embodiments, the sequence encoding the IL-12 molecule is located in the subgenomic region of the self-amplifying replicon RNA. In some embodiments, the self-amplifying replicon RNA contains a nucleotide sequence that is at least 90% identical to the wild-type (WT) replicon RNA having the sequence of SEQ ID NO: 1. In some embodiments, the self-amplifying replicon RNA is not identical to SEQ ID NO: 1 and can express the IL-12 molecule at a higher level compared to the self-amplifying replicon RNA containing SEQ ID NO: 1. In some embodiments, the replicon RNA that can express the IL-12 molecule at a higher level contains the point mutations G3936C and / or A475G of SEQ ID NO: [[ID=X]]
[0006] In some embodiments, the self-amplifying replicon RNA further contains a serum albumin coding sequence. In some embodiments, the self-amplifying replicon RNA further contains a lumican coding sequence. In some aspects, the self-amplifying replicon RNA contains a sequence encoding an IL-12 molecule. In some embodiments, the IL-12 molecule is selected from the group consisting of IL-12, an IL-12 subunit, or a mutant IL-12 molecule that retains an immunomodulatory function. In some further embodiments, the IL-12 molecule contains the IL12α and / or IL12β subunit.
[0007] In some embodiments, the lipid nanoparticles have a diameter of about 100 - 120 nm. In some embodiments, the lipid nanoparticles have a zeta potential of about 3 - 6 mV. In some embodiments, the lipid and the self - amplifying replicon RNA have a mass ratio of about 1:2 - 2:1.
[0008] The present disclosure relates, at least in part, to a pharmaceutical composition comprising a synthetic oncolytic virus and a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutical composition is formulated for intratumoral injection.
[0009] The present disclosure relates, at least in part, to a method for treating cancer in a subject in need thereof, comprising administering to the subject a pharmaceutical composition comprising an effective amount of any synthetic oncolytic virus or a pharmaceutical composition containing a synthetic oncolytic virus. In some embodiments, the subject is a human patient having or suspected of having cancer. Exemplary target cancers include, but are not limited to, melanoma, breast cancer, and colon cancer. In some embodiments, the pharmaceutical composition is administered to the subject in a single dose. In some embodiments, the pharmaceutical composition is administered to the subject by intratumoral injection.
[0010] A pharmaceutical composition containing any of the synthetic oncolytic viruses described herein for use in the treatment of any of the target diseases disclosed herein (e.g., cancer), and a pharmaceutical composition containing a synthetic oncolytic oligonucleotide for use in the manufacture of a medicament for the treatment of cancer are also within the scope of the present disclosure. Details of one or more embodiments of the invention are set forth in the following description. Other features or advantages of the invention will also be apparent from the following drawings and the detailed description of some embodiments, and from the appended claims. BRIEF DESCRIPTION OF THE DRAWINGS
[0011] Brief Description of the Drawings [Figure 1]Figures 1A-1H are charts showing the effects of transfecting B16F10 cells with DOTAP, lipofectamine (Lipo), TT3 nanoparticles (TT3), mutant replicon RNA (RNA), DOTAP, Lipo, and TT3 nanoparticles encapsulating mutant replicon RNA (DOTAP-mtRep, Lipo-mtRep, and TT3-mtRep), electroporation (Electro), and electroporation using mutant replicon RNA (Electro-mtRep). Figure 1A is a graph showing the survival rate of B16F10 cells 3 days after transfection. Figure 1B is a graph showing GFP expression in B16F10 cells transfected with lipid nanoparticles encapsulated with mutant or inactive (dead) replicon RNA (deRep). Figure 1C is a graph showing the percentage of B16F10 dead cells transfected with PI+ annexin V+ transfected lipid nanoparticles or lipid nanoparticles encapsulated with replicon RNA. Immunogenic cell death induced by lipid nanoparticles or lipid nanoparticles encapsulated with replicon RNA is indicated by the percentage of calreticulin+ (CRT+) cells (Figure 1D), extracellular ATP (Figure 1E), and HMGB1 release (Figure 1F). Figure 1G shows the diameters of lipid nanoparticles and lipid nanoparticles loaded with mutant replicon RNA. Figure 1H shows the zeta potentials of lipid nanoparticles and lipid nanoparticles loaded with mutant replicon RNA.
[0012] [Figure 2] Figures 2A–2J are charts showing that mtRep and deRep induce TLR3 signaling and the ISGF3 complex to necrotic cell death. LNP-replicon RNAs induce TLR3 signaling (Figures 2B and 2E) and activate the expression of interferon-stimulated genes Stat1, Stat2, IRF9, IRF3, and cGAS (Figures 2F–2J), but do not activate TLR2 (Figure 2A), TLR7 (Figure 2C), or TLR9 (Figure 2D).
[0013] [Figure 3] Figures 3A–3K are charts showing that TT3-mtRep recruits immune cells and eliminates tumor growth. Figure 3A shows that mtRep recruits more Ly6cloLy6G+ granulocytes on day 3 post-injection. Figure 3B shows the percentage of mCherry+ cells among CD45+ and CD45- cells in tumors injected with TT3-mtRep on day 3 post-injection. Figure 3C shows the expression of the ISGF3 complex (Stat1 / Stat2 / IRF9) as well as IRF3 and cGAS on day 1 post-injection with TT3-mtRep. Figures 3D–3F show immune cell infiltration into tumors (granulocytes, M-MDSCs, monocytes, macrophages, CD4 T, CD8 T, NK, NKT, conventional DC1 (cDC1), and conventional DC2 (cDC2)) one day after injection of TT3-mtRep (Figure 3D), and one day after injection of three sequential injections (Figure 3F). Figures 3G–3H show that TT3-mtRep induces more cell death (Figure 3G), more immune cell infiltration (Figure 3H), reduced tumor weight (Figure 3I), tumor area (Figure 3J), and increased CCL5 expression (Figure 3K) one day after three sequential injections of TT3-mtRep.
[0014] [Figure 4]Figures 4A–4G are charts showing that TT3-mtRep, which encodes IL12-MSA or IL12-MSA-lumican, effectively modulates the tumor microenvironment and immune cell infiltration. Figures 4A and 4B show ELISA quantification of IFNα2 in tumors (Figure 4A) and serum (Figure 4B) at 1 and 3 days after injection of TT3-mtRep. Figure 4C shows that B16F10 cells transfected with mtRep-IL12-MSA and mtRep-IL12-MSA-lumican can produce IL-12. Figure 4D shows IL-12 levels in tumors at 1 and 3 days after a single injection of TT3-mtRep, TT3-mtRep-IL12-MSA, or TT3-mtRep-IL12-MSA-lumican. Figures 4E-4F show immune cell infiltration in tumors on day 1 (Figure 4E) and day 3 (Figure 4F) after a single injection of TT3-mtRep, TT3-mtRep-IL12-MSA, or TT3-mtRep-IL12-MSA-Lumican. Figure 4G shows the number of conventional DC1 (cDC1) cells in tumor drainage lymph nodes on day 1 and day 3 after a single injection of TT3-mtRep, TT3-mtRep-IL12-MSA, or TT3-mtRep-IL12-MSA-Lumican.
[0015] [Figure 5] Figures 5A–5E are charts illustrating the synergistic anticancer effects in vivo of immunomodulatory IL12 and TT3-mtRep-induced immunogenic cell death. The synergistic anticancer effects were evaluated by changes in body weight (Figure 5A), serum IFNr (Figure 5B), tumor area (Figure 5C), and survival curves (Figure 5D). Figure 5E shows that TT3-mtRep-IL12 treatment may prevent tumor recurrence in treated mice.
[0016] Detailed description This disclosure is based, at least in part, on the unexpected discovery that, upon injection at a tumor site, a synthetic oncolytic virus containing lipid nanoparticles with one or more types of lipids and auto-amplified replicon RNA containing a sequence encoding the IL-12 molecule successfully elicits an anti-cancer immune response in local tumors and enables systemic immunity against peripheral tumors.
[0017] I. Synthetic oncolytic viruses This disclosure relates, at least in part, to synthetic oncolytic viruses. As used herein, the term “synthetic” means a non-natural or modified oncolytic virus as disclosed herein, which includes lipid nanoparticles and self-amplified replicon RNA containing sequences encoding IL-12 molecules. In some respects, this disclosure relates to utilizing lipid nanoparticles (LNPs) capable of inducing immunogenic cell death by themselves to facilitate the delivery of biologically active agents (e.g., auto-amplified replicon RNA encoding the IL-12 molecule) into tumor cells.
[0018] (i) Lipid nanoparticles This disclosure relates, at least in part, to the delivery of biologically active molecules to cells using lipid nanoparticles. Specifically, the present invention relates to a synthetic oncolytic virus comprising an auto-amplified replicon RNA expressing IL-12 encapsulated by lipid nanoparticles, a composition thereof, and a method of using the synthetic oncolytic virus and its composition for treating subjects having or suspected of having cancer. As used herein, lipid nanoparticles (LNPs) refer to vesicles such as spherical vesicles having a continuous lipid bilayer. Lipid nanoparticles may be used in a manner by which pharmaceutical therapies are delivered to a targeted site. Non-limited examples of LNPs include liposomes, double-headed amphiphilic compounds, solid lipid nanoparticles (SLNs), nanostructured lipid carriers (NLCs), and monolayer membrane structures (e.g., archaeosomes and micelles).
[0019] As used herein, lipid nanoparticles comprise one or more types of lipids. As used herein, lipids refer to a group of organic compounds, including, but not limited to, esters of fatty acids, and are characterized in some embodiments by being insoluble in water but soluble in many organic solvents. They are generally divided into at least three classes: (1) “simple lipids,” which comprise fats and oils as well as waxes; (2) “compound lipids,” which comprise phospholipids and glycolipids; and (3) “derived lipids,” such as steroids. Non-limited examples of lipids include triglycerides (e.g., tristearin), diglycerides (e.g., glycerol behenate), monoglycerides (e.g., glycerol monostearate), fatty acids (e.g., stearic acid), steroids (e.g., cholesterol), and waxes (e.g., cetyl palmitate). In some embodiments, one or more types of lipids in LNPs comprise cationic lipids.
[0020] As used herein, cationic lipids refer to any of the many species of lipids that carry a net positive charge at a selected pH, such as physiological pH. Such lipids include, but are not limited to, N1,N3,N5-tris(3-(didodecylamino)propyl)benzene-1,3,5-tricarboxamide (TT3), N-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTAP); lipofectamine; 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 1,2-dilinolenylooxy-N,N-dimethylaminopropane (DLenDMA), dioctadecyldimethylammonium (DODMA), and distearyldimethyl This includes ammonium (DSDMA), N,N-dioleyl-N,N-dimethylammonium chloride (DODAC); N-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA); N,N-distearyl-N,N-dimethylammonium bromide (DDAB); 3-(N-(N′,N′-dimethylaminoethane)-carbamoyl)cholesterol (DC-Chol); and N-(1,2-dimyristiloxypropa-3-yl)-N,N-dimethyl-N-hydroxyethylammonium bromide (DMRIE).
[0021] In some embodiments, the cationic lipid is TT3. When used herein, TT3 can form lipid nanoparticles for the intracellular delivery of various biological agents. In addition, this disclosure also demonstrates that unloaded TT3-LNPs can induce immunogenic cell death (ICD) in cancer cells in vivo and in vitro. As described herein, immunogenic cell death refers to a form of cell death that can induce an effective immune response through the activation of dendritic cells (DCs) and the resulting activation of specific T cell responses. In some embodiments, the cells undergoing immunogenic cell death (ICD) are tumor cells. Immunogenic tumor cell death can trigger an effective anti-tumor immune response. In some embodiments, the synthetic oncolytic virus comprises TT3-LNPs that encapsulate a self-amplified replicon (TT3-LNP-replicon RNA) encoding only a reporter gene. The self-amplified replicon RNA may work synergistically with TT3-LNPs to induce higher levels of ICD in tumor cells compared to TT3-LNPs alone. In another embodiment, the synthetic oncolytic virus contains TT3-LNPs that encapsulate auto-amplified replicon RNA encoding the IL-12 molecule. IL-12, an immunomodulatory cytokine, elicits a potent immune response against local tumors. Furthermore, the combination of TT3-LNPs, auto-amplified replicon RNA, and IL-12 expression is not only effective in synergistic inhibition of tumor cells at site, but also elicits a systemic anti-tumor immune response, killing peripheral tumor cells and preventing tumor recurrence.
[0022] In some embodiments, the cationic lipid is DOTAP. When used herein, DOTAP can also form lipid nanoparticles. DOTAP can be used for highly efficient transfection into eukaryotic cells of DNA containing yeast artificial chromosomes (YACs) for transient or stable gene expression, and is also suitable for the efficient transfer of other negatively charged molecules such as RNA, oligonucleotides, nucleotides, ribonucleo-protein (RNP) complexes, and proteins into mammalian cell investigation samples.
[0023] In another embodiment, the cationic lipid is lipofectamine. When used herein, lipofectamine is produced and marketed by Invitrogen and is a common transfection reagent used in molecular biology and cell biology. It is used by lipofection to increase the efficiency of transfection of RNA (including mRNA and siRNA) or plasmid DNA into cell cultures in vitro. Lipofectamine contains lipid subunits that can form liposomes or lipid nanoparticles that capture transfection payloads, e.g., self-amplifying replicon RNA, in an aqueous environment. RNA-containing liposomes (their surfaces are positively charged) can fuse with the negatively charged plasma membrane of living cells due to fusion mediated by the neutral copolymer of the liposome and the cell membrane, allowing nucleic acid cargo molecules to cross into the cytoplasm for replication or expression.
[0024] In some embodiments, LNPs consist primarily of cationic lipids along with other lipid components. These typically include, but are not limited to, other lipid molecules belonging to the phosphatidylcholine (PC) class (e.g., 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC) and 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE)), sterols (e.g., cholesterol) and polyethylene glycol (PEG)-lipid conjugates (e.g., 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[folate(polyethylene glycol)-2000 (DSPE-PEG2000) and 1,2-dimiristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000 (C14-PEG2000)). Table 1 shows formulations of two LNPs, TT3-LNP and DOTAP-LNP. [Table 1]
[0025] The particle size of lipid nanoparticles can affect drug release rate, in vivo distribution, mucosal adhesion, water uptake into cells, exchange of buffers into the nanoparticles, and protein diffusion. In some embodiments, the diameter of LNPs is in the range of 30–150 nm. In some embodiments, the diameter of LNPs is in the range of 100–120 nm. In some embodiments, the diameter of LNPs may be 30 nm, 40 nm, 50 nm, 60 nm, 70 nm, 80 nm, 90 nm, 100 nm, 101 nm, 102 nm, 103 nm, 104 nm, 105 nm, 106 nm, 107 nm, 108 nm, 109 nm, 110 nm, 111 nm, 112 nm, 113 nm, 114 nm, 115 nm, 116 nm, 117 nm, 118 nm, 119 nm, or 120 nm.
[0026] Zeta potential is a measure of the effective charge on the surface of lipid nanoparticles. The magnitude of the zeta potential provides information about the stability of the particle. In some embodiments, the zeta potential of LNPs ranges from -10 millivolts (mV) to 25 mV. In some embodiments, the zeta potential of LNPs ranges from 3 to 6 mV. In some aspects, the zeta potential of LNP can be 3mv, 3.1mv, 3.2mv, 3.3mv, 3.4mv, 3.5mv, 3.6mv, 3.7mv, 3.8mv, 3.9mv, 4mv, 4.1mv, 4.2mv, 4.3mv, 4.4mv, 4.5mv, 4.6mv, 4.7mv, 4.8mv, 4.9mv, 5mv, 5.1mv, 5.2mv, 5.3mv, 5.4mv, 5.5mv, 5.6mv, 5.7mv, 5.8mv, 5.9mv, and 6mv.
[0027] This disclosure relates, at least in part, to encapsulating replicon RNA with lipid nanoparticles. In some embodiments, the mass ratio between LNPs and replicon RNA is in the range of 1:2 to 2:1. In some embodiments, the mass ratio between LNPs and replicon RNA may be 1:2, 1:1.5, 1:1.2, 1:1, 1.1:1, 1.2:1, 1.3:1, 1.4:1, 1.5:1, 1.6:1, 1.7:1, 1.8:1, 1.9:1, and 2:1. In some embodiments, the mass ratio between LNPs and replicon RNA may be 1:1.
[0028] (ii) Self-amplifying replicon RNA In this disclosure, auto-amplified replicon RNA encoding the IL-12 molecule under a subgenome promoter, as a substitute for the structural proteins required for viral replication, is a substantial objective in cancer immunotherapy. As used herein, the term “auto-amplified replicon RNA” refers to an auto-amplified genetic element containing RNA that replicates from a single origin of replication. The terms “replicon RNA” and “auto-amplified replicon RNA” are used interchangeably herein. In some embodiments, auto-amplified replicon RNA is a viral replicon.
[0029] Viruses are tiny pathogens that can only replicate inside living host cells (e.g., prokaryotes and eukaryotes). Outside living cells, viruses exist as independent particles (e.g., viral particles or virions) containing genetic material in the form of DNA or RNA (the latter which can be single-stranded or double-stranded). Viruses with DNA are called DNA viruses, and viruses with RNA are called RNA viruses. In some cases, viruses contain nucleic acid-related proteins, and the combination of a virus and nucleic acid-related proteins is called a nucleoprotein. In addition to genetic material, viruses have a single or double protein coat, also known as a capsid, which facilitates the attachment of the virus to receptors on living host cells during infection and protects the viral genetic material from enzymatic degradation. The combination of a nucleoprotein and a capsid is called a nucleocapsid. In some cases, viruses have a lipid bilayer envelope interspersed with glycosylated (trans-)membrane-related proteins encoded by the virus. Once a virus infects a living host cell, it relies on the host cell to supply the mechanisms for its replication and subsequent proliferation. The viral genome encodes several structural and non-structural regulatory proteins.
[0030] As used herein, the terms “subgenome” or “of a subgenome” refer to a smaller section of the entire replicon genome. Consequently, as used herein, subgenome transcription refers to the transcription of one or more genes in the replicon genome, rather than all the genes that make up the replicon genome. In one embodiment, subgenome transcription refers to the transcription of a gene for experimental or therapeutic purposes, as described elsewhere herein. As used herein in the context of viruses, the term “structural protein” refers to proteins that constitute the structural components of a mature, constructed viral particle or virion. Non-limiting examples of such structural proteins include nucleocapsid core proteins (e.g., the gag protein), enzymes packaged within the viral particle (e.g., the pol protein), and membrane components (e.g., the env protein). In contrast, as used herein in the context of viruses, the term “non-structural protein” refers to proteins that do not constitute the structural components of a viral particle or virion but are expressed in host cells. Some of the roles of non-structural proteins, but are not limited to, include replicon formation, immunomodulation, and transactivation of structural protein genes.
[0031] In some aspects, self-amplifying replicon RNA originates from alphaviruses. Different in nature from host mRNA, alphavirus replicon RNA encodes a set of four non-structural proteins (nsPs1-4) responsible for both genome replication and, when modified to include genes encoding non-viral products such as the IL-12 molecule, providing transcription of such non-viral products under a subgenome promoter. Alphaviruses are part of the group IV Togaviridae family of viruses, possessing a positively oriented, single-stranded RNA genome and characterized by an icosahedral nucleocapsid. Other non-restrictive examples of group IV viruses may include the Astroviridae, Caliciviridae, Coronaviridae, Flaviviridae, Picornaviridae, Arteriviridae, and Togaviridae families. The genus Alphavirus encompasses 26 enveloped viruses that infect eukaryotes. Alphaviruses have a broad host range and are delivered by mosquitoes and blood-sucking arthropods.
[0032] Non-specific examples of alphaviruses include Venezuelan horse encephalitis virus (VEE), Semlik Forest virus (SF), Sindobis virus (SIN), Eastern equine encephalitis virus (EEE), Western equine encephalitis virus (WEE), Everglades virus (EVE), Mukambo virus (MUC), Pixna virus (PIX), Semlik Forest virus (SF), Middelburg virus (MID), Chikungunya virus (CHIK), Onyonnyon virus (ONN), Ross River virus (RR), Berma Forest virus (BF), Geta virus (GET), Sagiyama virus (SAG), Beval virus (BEB), Mayarovirus (MAY), Una virus (UNA), Aura virus (AURA), and Babanki virus (Babanki This includes the BAB virus, the Highlands J virus (HJ), and the Fort Morgan virus (FM).
[0033] In this disclosure, at least in part, alphavirus replicons are VEE alphavirus replicons. VEE virus is a viral pathogen typically carried by mosquitoes that cause VEE or encephalomyelitis, primarily in equid species. However, humans can also contract VEE, and individuals with weakened immune systems are at risk of developing particularly severe complications if infected with VEE. VEE virions are spherical and possess a lipid membrane with a surface protein consisting of glycoproteins that extend around the outer surface. Typically, VEE has a genome of approximately 11.45 kb, excluding a 5' terminal cap and a 3' terminal poly(A) tract, and contains four non-structural proteins (nsPs) and five structural proteins. The non-structural proteins include nsP1, nsP2, nsP3, and nsP4, while the structural region encodes proteins C, E3, E2, 6K, and E1. In some cases, the self-amplified replicon RNA is WT replicon RNA derived from VEE. The sequence of VEE virus WT replicon RNA is represented by SEQ ID NO: 1: GCCAGCAACGCGAGCTCTAATACGACTCACTATAG (Sequence ID 1)
[0034] The self-amplified replicon RNAs described herein contain nucleotide sequences that are identical to SEQ ID NO: 1 by at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99% or more. In some embodiments, the self-amplified replicon RNA is identical to SEQ ID NO: 1 by at least 90%. Auto-amplifying RNAs (replicons) are a promising new platform for gene therapy, but their application is still limited by the short persistence of expression in some cell types and low levels of transgene expression in vivo. In vitro evolution of synthetic replicon RNAs offers a potentially powerful strategy for modifying and enhancing replicon expression both in vitro and in vivo. Using in vitro evolution methods, mutations were identified in nsP2 and nsP3 of the Venezuelan encephalitis (VEE) replicons, which promoted subgenome expression in human cells.
[0035] In some embodiments, the self-amplifying replicon RNA includes mutations that allow the replicon RNA to express the IL-12 molecule at a higher level compared to the replicon RNA containing SEQ ID NO: 1. In some embodiments, the self-amplifying replicon RNA includes at least one point mutation at nucleic acid positions 3936 and / or 4758 of the WT replicon of SEQ ID NO: 1. In some embodiments, the self-amplifying replicon RNA includes at least one of the following point mutations: guanine to cytosine at position 3936 of the WT replicon sequence of SEQ ID NO: 1 (G3936C) and adenine to guanine at position 4758 of the WT replicon sequence of SEQ ID NO: 1 (A4758G). The G3936C mutation would result in a change from glycine to arginine at amino acid residue 1309 (G1309R). The A4758G mutation would result in a change from serine to glycine at amino acid residue 1583 (S1583G). In some embodiments, the sequence of mutant self-amplifying replicon RNA (mt replicon RNA) is represented by Sequence ID No. 2 (mutation highlighted (bold, underlined text)): [ka] [ka] [ka] [ka]
[0036] In another embodiment, the self-amplifying replicon RNA is derived from the hepatitis C virus (HCV). HCV is part of the group IV Flaviviridae family of viruses and possesses a 9.6–12.3 kilobase-long, cathode monosegmental, linear, single-stranded RNA genome. The 5' end of flaviviruses has a methylated nucleotide cap, while other members of this family are uncapped and encode an intrasequence liposome entry site.
[0037] In another aspect, alphaviruses are SF viruses. SF viruses are viral pathogens typically carried by mosquitoes that cause encephalitis. Semliki Forest Virus is a positive-strand RNA virus with a genome of approximately 13,000 base pairs encoding nine proteins. The 5'-two-thirds of the genome encode four non-structural proteins involved in RNA synthesis, while structural proteins are encoded in the 3'-two-thirds. Of the structural proteins, the C protein constitutes an icosahedral capsid enclosed in a lipid bilayer derived from the host cell. The outermost surface of the virus is almost entirely covered by heterodimers of glycoproteins E1 and E2, arranged in interconnected trimers that form the outer shell. The trimers are anchored to the membrane by the E2 cytoplasmic domain associated with the nucleocapsid.
[0038] In another aspect, the alphavirus is the SIN virus. The virus is transmitted by mosquitoes. The SIN virus causes Sindbis fever in humans, and symptoms include joint pain, rash, and discomfort. The Sindbis virus is an enclosed particle with an icosahedral capsid. Its genome is a single-stranded RNA approximately 11.7 kb long. It has a 5' cap and a 3' polyadenylated tail and thus serves directly as messenger RNA (mRNA) within host cells. The genome encodes four non-structural proteins at the 5' end and the capsid and two envelope proteins at the 3' end. This is characteristic of all togaviruses. Replication is intracytoplasmic and rapid. The genomic RNA is partially translated at the 5' end, then produces non-structural proteins involved in genome replication as well as the production of new genomic RNA and shorter subgenomic RNA strands. These subgenomic strands are translated into structural proteins. Viruses assemble on the surface of host cells and acquire their envelopes through budding. Non-coding RNA elements have been found to be essential for Sindbisvirus genome replication.
[0039] Viral replicon RNA can stimulate an immune response via Toll-like receptors (TLRs). Subsets of TLRs, TLR3, TLR7 / 8, and TLR9, are involved in the antiviral response by triggering the production of antiviral cytokines such as type I interferon (IFN). TLR3 responds to double-stranded RNA, an intermediate state of replication for many viruses. TLR7 / 8 recognize viral single-stranded RNA, while TLR9 recognizes unmethylated CpG motifs within viral DNA. TLRs involved in viral recognition are expressed on the endosomal membrane and can be separated according to their requirements for the adapter protein MyD88: TLR3 activity is MyD88-independent, while TLR7 / 8 / 9 is MyD88-dependent. Activation of TLR3 leads to the production of type I interferon (IFN). Signaling of type I interferon through the ISGF3 (STAT1 / STAT2 / IFN) complex is required for sustained Rip3 activation and necroptosis.
[0040] In some embodiments, LNP-replicon RNA can stimulate TLR3 signaling, which leads to necrotic cell death in tumor cells. In some embodiments, LNP-replicon RNA can enhance LNP-induced immunogenic cell death (ICD). In some embodiments, TT3-LNP-replicon RNA can exert tumor inhibition through synergistically induced ICD in tumor cells and induce an anti-tumor immune response (e.g., recruitment of immune cells such as granulocytes, monocytes, macrophages, myeloid suppressor cells, dendritic cells, T cells, and NK cells). In some embodiments, synthetic oncolytic viruses contain TT3-LNP-mt replicon RNA.
[0041] In some embodiments, replicon RNA contains a coding sequence for a molecule detectable in a subgenomic region. In some embodiments, the detectable molecule is a nucleic acid or polypeptide. In some embodiments, the polypeptide is a fluorescent protein. Fluorescent proteins are known in the art and are a subclass of fluorophores, which are fluorescent chemical compounds that have the ability to re-emit light upon excitation. A fluorophore will absorb excitation light energy at a first specific wavelength and then re-emit light energy at a second, longer specific wavelength. Each type of fluorophore reacts to and emits light of different wavelengths depending on the nature of its chemical structure and the environment.
[0042] In some aspects, fluorescent proteins are not limited to these, but include wt-GFP, green fluorescent proteins (e.g., EGFP, Emerald, Superfolder GFP, Azami Green, mWasabi, TagGFP, TurboGFP, AcGFP, ZsGreen, T-Sapphire, etc.), blue fluorescent proteins (e.g., EBFP, EBFP2, Azurite, mTagBFP, etc.), blue-green fluorescent proteins (e.g., ECFP, mECFP, Cerulean, mTurquoise, CyPet, AmCyan1, Midori-Ishi Cyan, TagCFP, mTFP1(Teal), etc.), yellow fluorescent proteins (e.g., EYFP, Topaz, Venus, mCitrine, YPet, TagYFP, PhiYFP, ZsYellow1, mBanana, etc.), and orange fluorescent proteins (e.g., Kusabira Orange, Kusabira This includes Orange2, mOrange, mOrange2, dTomato, dTomato-Tandem, TagRFP, TagRFP-T, DsRed, DsRed2, DsRed-Express(T1), DsRed-Monomer, mTangerine, etc., or red fluorescent proteins (e.g., mRuby, mApple, mStrawberry, AsRed2, mRFP1, JRed, mCherry, HcRed1, mRaspberry, dKeima-Tandem, HcRed-Tandem, mPlum, AQ143, etc.).
[0043] In some respects, as described herein, the self-amplifying replicon RNA contains a coding sequence for IL-12 expression within a subgenomic region. An exemplary coding sequence for IL-12 is represented by Sequence ID No. 3:
[0044] Structurally, IL-12 belongs to the type I cytokine and possesses a four-alpha-helical bundle structure. IL-12 acts in the form of a heterodimeric protein (IL-12-p70; IL-12-p30 / p40), consisting of two covalently linked p30 and p40 subunits. Conversely, the IL-12-p40 / p40 homodimer primarily acts as an antagonistic inhibitor of IL-12-p70 action. IL-12 is a multifaceted cytokine; its action creates interconnections between innate and adaptive immunity. IL-12 was initially described as a factor secreted from PMA-induced EBV-transformed B cell lines. Based on its action, IL-12 was initially called a "cytotoxic lymphocyte maturation factor" and a "natural killer cell stimulant." Due to its ability to bridge innate and adaptive immunity and its potent stimulation of IFN-γ production—a cytokine that aligns the natural mechanisms of robust anti-cancer defense—IL-12 was considered a worthy candidate for tumor immunotherapy in humans. However, severe side effects associated with systemic administration of IL-12 in clinical studies and the very narrow therapeutic index of this cytokine significantly dampened enthusiastic interest in its use in cancer patients.
[0045] Following the discovery of IL-12, three other members (IL-23, IL-27, and IL-35) were added to the IL-12 family and shown to play crucial roles in Th1 cell function. IL-12 is a ligand for a receptor composed of two amino acid chains: IL-12R-β1 and IL-12R-β2. The IL-12 receptor is expressed constitutively (e.g., IL-12R-β1 in B cells) or inductively (IL-12R-β2) in a variety of immune cells, including NK cells, T, and B lymphocytes. Ligand-bound IL-12R-β2 is phosphorylated at tyrosine, which provides sites for two kinases, JAK2 and TYK2. Among the transcription factors of the STAT family, STAT4 is considered the most specific mediator of the cellular response elicited by IL-12.
[0046] The main components of IL-12's action are as follows: increasing the production of IFN-γ from NK and T cells, which is the most potent mediator of IL-12's action; stimulating the growth and cytotoxicity of activated NK cells, CD8+ and CD4+ T cells, and shifting the differentiation of CD4+ Th0 cells toward the Th1 phenotype; enhancing antibody-dependent cell-mediated cytotoxicity (ADCC) against tumor cells; and suppressing the induction of IgG and IgE production from B cells. The main sources of IL-12 in humans are activated antigen-presenting cells such as dendritic cells, especially those with the CD1c+ phenotype, as well as hematopoietic phagocytic cells (monocytes, macrophages, and neutrophils as well), although IL-12 can also be produced by other cell types. While IL-12 acts on a variety of immune cells, its overall physiological role appears to be the integration of the Th1 immune response against a given pathogen.
[0047] In some aspects, this disclosure describes local delivery of IL-12 by LNPs encapsulating replicon RNA of a virus encoding IL-12 in its subgenomic region. In addition to synergistic tumor cell immunogenic cell death (ICD) induced by LNP-replicon RNA, in some aspects, IL-12 expression in the tumor microenvironment may lead to further immunostimulation and enhancement of the anti-tumor immune response. In some aspects, the LNP-replicon RNA-IL-12 combination in the tumor microenvironment can induce a systemic anti-tumor immune response. In other aspects, the LNP-replicon RNA-IL-12 combination in the tumor microenvironment can eradicate tumor cells and prevent tumor recurrence. In some aspects, synthetic oncolytic viruses include TT3-LNP-mt-replicon RNA-IL12.
[0048] In some embodiments, replicon RNA-IL12 further contains a coding sequence for serum albumin. The half-life of peptides and proteins (e.g., cytokines) in their biological environment (e.g., serum, tumor microenvironment) are influenced by a variety of factors, including size, charge, sensitivity to proteolysis, their biological properties, the turnover rate of the proteins they bind to, and other factors. In some cases, the half-life of proteins in their biological environment can roughly correlate with their size. Peptides and proteins (e.g., cytokines) smaller than approximately 70 kDa can be removed via renal filtration, and therefore they generally have very short half-lives. However, larger proteins will survive for several days. Three types of proteins, IgG, serum albumin, and transferrin, survive for much longer than would naturally be predicted by their size. In some embodiments, serum albumin is human serum albumin. In some embodiments, serum albumin is mouse serum albumin (MSA).
[0049] The exemplary coding sequence for the replicon RNA-IL12-MSA is represented by sequence number 4:
[0050] In some embodiments, the replicon RNA-IL-12 is fused with a serum albumin-coding sequence. In some embodiments, the IL-12-albumin fusion molecule has a longer half-life in the tumor microenvironment. In some embodiments, the IL-12-albumin fusion protein can persist in the tumor microenvironment for at least 1, 2, 3, 4, 5, 6, 7, 8 days, or longer. In some embodiments, the synthetic oncolytic virus contains LNP-replicon RNA-IL-12-serum albumin. In other embodiments, the synthetic oncolytic virus contains TT3-LNP-replicon RNA-IL-12-serum albumin. In yet another embodiment, the synthetic oncolytic virus contains TT3-LNP-mt-replicon RNA-IL-12-serum albumin. The persistent presence of IL-12 in the tumor microenvironment will prolong the antitumor immune response exerted by the synthetic oncolytic virus.
[0051] In some embodiments, replicon RNA-IL12-serum albumin further contains a coding sequence for lumican. Lumican is one of the major extracellular proteins in the interstitial extracellular matrix (ECM) of skin, corneal stroma, sclera, aorta, muscle, lung, kidney, bone, cartilage, and intervertebral discs. It is a member of the small leucine-rich proteoglycan (SLRP) family, possessing a 30-50 kDa core protein containing a signal peptide, a negatively charged N-terminal domain, a highly conserved leucine-rich internal domain, and a carboxyl-terminal domain. The core and glycan chains of the lumican protein can interact with various cellular effectors, including cytokines, growth factors, and cell surface receptors, and can regulate cell adhesion, proliferation, and migration. As an endogenous collagen-binding protein, the presence of lumican in the tumor microenvironment will promote local retention of IL-12, as described herein, and enhance the efficacy and safety of tumor immunotherapy. In some embodiments, the replicon RNA-IL-12-MSA contains a coding sequence for lumican. In other embodiments, the mtreplicon RNA-IL-12-MSA (mtRep-IL12-MSA) contains a coding sequence for lumican.
[0052] The example coding sequence for the mtreplicon RNA-IL-12-MSA-lumican (mtRep-IL12-MSA-lumican) is represented by sequence number 5:
[0053] In some embodiments, the synthetic oncolytic virus comprises LNP-replicon RNA-IL-12-serum albumin-lumican. In other embodiments, the synthetic oncolytic virus comprises TT3-LNP-replicon RNA-IL-12-serum albumin-lumican. In yet another embodiment, the synthetic oncolytic virus comprises TT3-LNP-mt-replicon RNA-IL-12-serum albumin-lumican. Retention of IL-12 in the tumor microenvironment will improve the efficacy and safety of the synthetic oncolytic virus.
[0054] In some cases, the replicon RNA may contain one or more genes of experimental or therapeutic interest. In some embodiments, the genes of experimental or therapeutic interest may encode cytokines, chemokines, or growth factors other than IL-12. Cytokines are known in the art, and the term itself refers to a generalized group of small proteins secreted by some cells in the immune system and having effects on other cells. Cytokines are known to enhance the immune response of cells, and when used herein, may include, but are not limited to, TNFα, IFN-γ, IFN-α, TGF-β, IL-1, IL-2, IL-4, IL-10, IL-13, IL-17, IL-18, and chemokines.
[0055] Chemokines are useful in studies investigating responses to infection, immune responses, inflammation, trauma, sepsis, cancer, and reproduction, among other applications. Chemokines are known in the art and are a type of cytokine that typically induces chemotaxis of leukocytes in responding cells very close to the site of infection. Non-limited examples of chemokines include CCL14, CCL19, CCL20, CCL21, CCL25, CCL27, CXCL12, CXCL13, CXCL-8, CCL2, CCL3, CCL4, CCL5, CCL11, and CXCL10. Growth factors are known in the art and the term itself is sometimes interchangeable with the term cytokine. As used herein, the term “growth factor” refers to naturally occurring substances that can stimulate intercellular signaling and cell proliferation. Cytokines may be growth factors, while certain types of cytokines may also have inhibitory effects on cell growth, thus distinguishing the two terms.
[0056] Non-limiting examples of growth factors include adremedullin (AM), angiopoietin (Ang), autocrine cell motility stimulant, bone morphogenetic protein (BMP), ciliary neurotrophic factor (CNTF), leukemia inhibitory factor (LIF), interleukin-6 (IL-6), macrophage colony-stimulating factor (m-CSF), granulocyte colony-stimulating factor (G-CSF), granulocyte-macrophage colony-stimulating factor (GM-CSF), epidermal growth factor (EGF), ephrin A1, ephrin A2, ephrin A3, ephrin A4, ephrin A5, ephrin B1, ephrin B2, ephrin B3, erythropoietin (EPO), fibroblast growth factor 1 (FGF1), fibroblast growth factor 2 (FGF2), fibroblast growth factor 3 (FGF3), fibroblast growth factor 4 (FGF4), fibroblast growth factor 5 (FGF5), Fibroblast growth factor 6 (FGF6), Fibroblast growth factor 7 (FGF7), Fibroblast growth factor 8 (FGF8), Fibroblast growth factor 9 (FGF9), Fibroblast growth factor 10 (FGF10), Fibroblast growth factor 11 (FGF11), Fibroblast growth factor 12 (FGF12), Fibroblast growth factor 13 (FGF13), Fibroblast growth factor 14 (FGF14), Fibroblast growth factor 15 ( FGF15), fibroblast growth factor 16 (FGF16), fibroblast growth factor 17 (FGF17), fibroblast growth factor 18 (FGF18), fibroblast growth factor 19 (FGF19), fibroblast growth factor 20 (FGF20), fibroblast growth factor 21 (FGF21), fibroblast growth factor 22 (FGF22), fibroblast growth factor 23 (FGF23), fetal bovine growth hormone (Fetal Bovine Somatotrophin (FBS), Glial Cell-Derived Neurotrophic Factor (GDNF), Neurturin, Percefin, Artemin, Growth and Differentiation Factor-9 (GDF9), Hepatocyte Growth Factor (HGF), Liver Cancer Growth Factor (HDGF), Insulin, Insulin-like Growth Factor-1 (IGF-1), Insulin-like Growth Factor-2 (IGF-2), Interleukin-1 (IL-1), IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, Keratinocyte Growth Factor (KGF), Migration-stimulating FactorIt includes (MSF) factor, macrophage-stimulating protein (MSP), myostatin (GDF-8), neuregulin 1 (NRG1), neuregulin 2 (NRG2), neuregulin 3 (NRG3), neuregulin 4 (NRG4), brain-derived neurotrophic factor (BDNF), nerve growth factor (NGF), neurotrophin-3 (NT-3), neurotrophin-4 (NT-4), placental growth factor (PGF), platelet-derived growth factor (PDGF), renalase (RNLS), T cell growth factor (TCGF), thrombopoietin (TPO), transforming growth factor alpha (TGF-α), transforming growth factor beta (TGF-β), tumor necrosis factor alpha (TNF-α), and vascular endothelial growth factor (VEGF).
[0057] II. Pharmaceutical Compositions In some respects, this disclosure relates, at least in part, to pharmaceutical compositions comprising synthetic oncolytic viruses as described herein. The pharmaceutical compositions described herein may further comprise pharmaceutically acceptable carriers (excipients) to form a pharmaceutical composition for use in treating a target disease. "Acceptable" means that the carrier is compatible with (and preferably able to stabilize) the active ingredient of the composition and is not harmful to the subject to be treated. Pharmaceutically acceptable excipients (carriers) comprising buffers are well known in the art. See, for example, Remington: The Science and Practice of Pharmacy 20th Ed. (2000) Lippincott Williams and Wilkins, Ed. KE Hoover.
[0058] Pharmaceutical compositions used for in vivo administration must be sterile. This can be easily achieved, for example, by filtration through a sterile filtration membrane. Compositions containing synthetic oncolytic viruses may be placed in containers with sterile access ports, such as intravenous solution bags or vials with pierceable stoppers that can be penetrated by a subcutaneous needle. In some embodiments, the pharmaceutical compositions used herein may be formulated for intratumoral injection. When used herein, intratumoral injection refers to the direct injection of an antitumor composition (e.g., an immunostimulant synthetic oncolytic virus) into a tumor. High concentrations of the composition can be achieved in situ while using small amounts of the drug. Local delivery of immunotherapy enables multiple combination therapies while significantly preventing systemic exposure and off-target toxicity.
[0059] In other aspects, pharmaceutical compositions may be formulated for intramuscular, intravenous, or subcutaneous injection. The pharmaceutical composition used in this method may be in the form of a lyophilized formulation or aqueous solution and may contain pharmaceutically acceptable carriers, buffers, excipients, salts, or stabilizers. For example, see Remington: The Science and Practice of Pharmacy 20th Ed. (2000) Lippincott Williams and Wilkins, Ed. KE Hoover. Acceptable carriers, excipients, or stabilizers are nontoxic to the recipient at the dosage and concentration used and include buffers such as phosphates, citrates, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (octadecyldimethylbenzylammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl, or benzyl alcohol; alkylparabens such as methyl or propylparaben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol, etc.); low molecular weight (less than about 10 residues) polypeptides; serum albumin The materials may also include proteins such as methyl ester, gelatin, or immunoglobulin; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other hydrocarbons including glucose, mannose, or dextran; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose, or sorbitol; salt-forming counterions such as sodium; metal complexes (e.g., Zn-protein complexes); and / or nonionic surfactants such as TWEEN®, PLURONICS®, or polyethylene glycol (PEG).
[0060] In some examples, the pharmaceutical compositions described herein include lipid nanoparticles that can be prepared by methods known in the art, such as those described in Epstein, et al., Proc. Natl. Acad. Sci. USA 82:3688 (1985); Hwang, et al., Proc. Natl. Acad. Sci. USA 77:4030 (1980); and U.S. Patents 4,485,045 and 4,544,545. Liposomes with enhanced circulation time are disclosed in U.S. Patent 5,013,556. Particularly useful liposomes can be produced by reverse-phase evaporation with lipid compositions containing phosphatidylcholine, cholesterol, and PEG-derivativeized phosphatidylethanolamine (PEG-PE). The liposomes are extruded through a filter of a specified pore size to produce liposomes having a desired diameter.
[0061] In other examples, the pharmaceutical compositions described herein may be formulated in sustained-release form. A preferred example of a sustained-release preparation is a semipermeable matrix of a solid hydrophobic polymer containing a synthetic oncolytic virus, the matrix being in the form of a molded article, e.g., a film or microcapsules. Examples of sustained-release matrices include polyesters, hydrogels (e.g., poly(2-hydroxyethyl methacrylate) or poly(vinyl alcohol)), polylactide (U.S. Patent No. 3,773,919), L-glutamic acid and 7-ethyl-L-glutamate copolymers, non-degradable ethylene vinyl acetate, degradable lactate-glycolic acid copolymers such as LUPRON DEPOT (trademark) (an injectable microsphere composed of lactate-glycolic acid copolymer and leuprolide acetate), sucrose acetate isobutyrate, and poly-D-(-)-3-hydroxybutyric acid.
[0062] Suitable surfactants particularly include nonionic agents such as polyoxyethylene sorbitan (e.g., TWEEN® 20, 40, 60, 80, or 85) and other sorbitans (e.g., SPAN® 20, 40, 60, 80, or 85). Compositions containing surfactants conveniently contain between 0.05 and 5% surfactant, and may be between 0.1 and 2.5%. It will be understood that other components, such as mannitol or other pharmaceutically acceptable vehicles, may be added if necessary. The pharmaceutical compositions described herein may be in unit dosage forms such as tablets, pills, capsules, powders, granules, solutions or suspensions, or suppositories, and may be administered orally, parenterally, or rectally, or by inhalation or inhalation.
[0063] To prepare solid compositions such as tablets, the first active ingredient can be mixed with a pharmaceutical carrier, such as conventional tableting components like corn starch, lactose, sucrose, sorbitol, talc, stearic acid, magnesium stearate, dicalcium phosphate, or gum, and other pharmaceutical diluents, such as water, to form a solid preliminary formulation composition containing a homogeneous mixture of the compound of the present invention, or a non-toxic, pharmaceutically acceptable salt thereof. When these preliminary formulation compositions are referred to as homogeneous, it means that the active ingredient is evenly dispersed throughout the composition so that the composition can be easily divided into unit dosage forms such as tablets, pills, and capsules, all of which are equally effective. This solid preliminary formulation composition is then divided into unit dosage forms of the type described above, containing 0.1 to about 500 mg of the active ingredient of the present invention. Tablets or pills of the novel compositions may be coated or otherwise synthesized to provide dosage forms that offer the benefit of sustained action. For example, a tablet or pill may contain an inner dose component and an outer dose component, the latter enclosing the former in the form of an envelope. The two components may be separated by an enteric-coated layer, which serves to resist disintegration in the stomach and allows the inner component to pass through the duodenum intact or delay its release. A variety of materials can be used for such an enteric-coated layer or coating, and such materials include numerous polymer acids and mixtures of polymer acids with materials such as shellac, cetyl alcohol, and cellulose acetate.
[0064] Suitable emulsions may be prepared using commercially available lipid emulsions such as INTRALIPID®, LIPOSYN®, INFONUTROL®, LIPOFUNDIN®, and LIPIPHYSAN®. The active ingredient may be dissolved in a pre-mixed emulsion composition, or alternatively dissolved in oil (e.g., soybean oil, safflower oil, cottonseed oil, sesame oil, corn oil, or tonsil oil) and mixed with phospholipids (e.g., egg phospholipids, soybean phospholipids, or soybean lecithin) and water to form an emulsion. It will be understood that other components, such as glycerol or glucose, may be added to adjust the tonicity of the emulsion. Suitable emulsions will typically contain up to 20% oil, for example, between 5 and 20%. The lipid emulsion may contain lipid droplets of a suitable size and may have a pH in the range of 5.5 to 8.0.
[0065] Pharmaceutical compositions for inhalation or inhalation include solutions, pharmaceutically acceptable suspensions in aqueous or organic solvents, or mixtures thereof, and powders. Liquid or solid compositions may contain suitable pharmaceutically acceptable excipients, such as those presented above. In some embodiments, compositions are administered orally or via nasal respiratory routes for topical or systemic effects. The composition, preferably in a sterile, pharmaceutically acceptable solvent, may be sprayed using a gas. The sprayed solution may be inhaled directly from the spraying device, or the spraying device may be attached to a face mask, tent-like device, or intermittent positive pressure breathing machine. The solution, suspension, or powder composition may be administered, preferably orally or nasally, from a device that delivers the formulation in an appropriate manner.
[0066] III. Therapeutic Applications Pharmaceutical compositions disclosed herein, including synthetic oncolytic viruses, may be used in the treatment of cancer, for example, in cancer immunotherapy. To put the methods disclosed herein into practice, an effective amount of any of the pharmaceutical compositions described herein may be administered to a subject in need of treatment (e.g., a human) via a preferred route, such as intramuscular, intraperitoneal, intracerebral, subcutaneous, intra-articular, intra-sacral, intrathecal, oral, inhalation, or topical, intratumoral administration, intratumoral administration, intratumoral administration, intratumoral administration, intramuscular, intraperitoneal, intra-intramuscular, intra-articular, intra-sacral, intra-articular, intra-articular, intra-articular, intra-articular, intra-articular, intra-articular, oral, inhalation, or topical routes, intratumoral administration, or intratumoral administration. Commercial nebulizers for liquid formulations, including jet nebulizers and ultrasonic nebulizers, are useful for administration. Liquid formulations may be sprayed directly, and lyophilized powders may be sprayed after reconstitution. Alternatively, pharmaceutical compositions containing synthetic oncolytic viruses may be aerosolized using fluorocarbon formulations and metered-dose inhalers, or inhaled as lyophilized and ground powders. In some examples, the pharmaceutical compositions described herein are formulated for intratumoral injection. In certain examples, the pharmaceutical compositions may be administered to a subject (e.g., a human patient) via a topical route, such as injection into a topical site, such as a tumor site or an infection site.
[0067] As used herein, “effective dose” refers to the amount of each activator required to produce a therapeutic effect on a subject, either alone or in combination with one or more other activators. In some embodiments, the therapeutic effect is a reduced tumor load, a reduction in cancer cells, or increased immune activation. Determining whether the amount of synthetic oncolytic virus achieved a therapeutic effect will be obvious to those skilled in the art. The effective dose will vary depending on the individual patient's parameters, including the specific disease being treated, the severity of the disease, age, physical condition, size, sex, and weight, the duration of treatment, the nature of the concomitant therapy (if any), the specific route of administration, and similar factors within the knowledge and expertise of the healthcare practitioner, as will be recognized to those skilled in the art. These factors can be addressed by experimental methods that are well known to those skilled in the art and are merely routine. It is generally preferred that it be the maximum dose of the individual's components or combination thereof used, i.e., the highest safe dose according to reasonable medical judgment.
[0068] Empirical considerations, such as half-life, will generally contribute to the determination of dosage. The frequency of administration may be determined and adjusted throughout treatment, and is generally, but not necessarily, based on the treatment and / or suppression and / or remission and / or delay of the target disease / impairment. Alternatively, sustained-release formulations of synthetic oncolytic viruses may be appropriate. Various formulations and devices for achieving sustained release are known in the art. In some embodiments, the treatment is a single injection of a pharmaceutical composition containing a synthetic oncolytic virus. In some embodiments, the single injection is administered intratumorally to a subject requiring it.
[0069] In some cases, the dosage of synthetic oncolytic viruses as described herein may be determined empirically in an individual receiving one or more doses of the synthetic oncolytic. The individual is given progressively increasing doses of the composition containing the synthetic oncolytic. To assess the efficacy of the synthetic oncolytic virus, disease / disorder guidelines may be pursued. For repeated administrations over several days or longer, the treatment is continued, depending on the disease, until the desired symptom suppression occurs or a sufficient therapeutic level is achieved, alleviating the targeted disease or disorder or its symptoms.
[0070] In some embodiments, the frequency of administration is once a week, once every two weeks, once every four weeks, once every five weeks, once every six weeks, once every seven weeks, once every eight weeks, once every nine weeks, or once every ten weeks; or once a month, once every two months, or once every three months, or longer. The progress of this treatment is readily monitored by conventional techniques and assays. The drug regimen of the synthetic oncolytic virus used may be changed over time. In some embodiments, the methods described herein involve administering a pharmaceutical composition containing a synthetic oncolytic virus in one or more doses to a subject requiring treatment (e.g., a human patient).
[0071] For the purposes of this disclosure, the appropriate dosage of synthetic oncolytic viruses as described herein will depend on the specific synthetic oncolytic virus, the type and severity of the disease / disorder, whether the synthetic oncolytic virus is administered for prophylactic or therapeutic purposes, prior treatment, the patient's clinical history and response to the synthetic oncolytic virus, and the discretion of the attending physician. The clinician may administer synthetic oncolytic viruses until the dosage reaches the desired outcome. In some embodiments, the desired outcome is a reduction in tumor load, a reduction in cancer cells, or increased immune activation. A method for determining whether the dosage has produced the desired outcome will be apparent to those skilled in the art. Administration of one or more synthetic oncolytic viruses may be continuous or intermittent, depending, for example, the recipient's physiological condition, whether the purpose of administration is therapeutic or prophylactic, and other factors known to a skilled practitioner. The administration of synthetic oncolytic viruses may be continuous over a pre-selected period, or, for example, in a series of intervald doses before, during, or after the onset of the target disease or disorder.
[0072] As used herein, the term “to treat” means the application or administration of a composition comprising one or more activators intended to treat, cure, alleviate, reduce, modify, symbiose, remission, improve, or affect a target disease or disorder, symptoms of a disease / disorder, or predisposition to a disease / disorder.
[0073] Alleviating a target disease / disorder includes delaying the onset or progression of the disease, or reducing the severity of the disease. Alleviating a disease does not necessarily require a therapeutic outcome. As used in this context, “delaying” the onset of a target disease or disorder means postponing, preventing, slowing, delaying, keeping constant, and / or postponing the progression of the disease. This delay can be of varying lengths depending on the disease history and / or the individual being treated. Methods that “delay” or alleviate the onset of a disease, or delay the onset of a disease, are methods that reduce the probability of developing one or more symptoms of the disease within a given time frame, and / or reduce the spread of symptoms within a given time frame, compared to not using the method. Such comparisons are typically based on clinical studies using a sufficient number of subjects to yield statistically significant results.
[0074] The “onset” or “progression” of a disease means the first signs of the disease and / or the subsequent progression. The onset of a disease can be detected and assessed using standard clinical techniques that are well known in the art. However, onset also refers to progression that would be undetectable. For the purposes of this disclosure, onset or progression refers to the biological course of symptoms. “Onset” includes occurrence, recurrence, and disease onset. When used herein, “onset” or “progression” of a target disease or disorder includes the initial onset and / or recurrence.
[0075] In some embodiments, a pharmaceutical composition containing a synthetic oncolytic virus as described herein is administered to a subject requiring treatment in an amount sufficient to reduce tumor load or cancer cell growth in vivo by at least 5% (e.g., 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more). In other embodiments, a pharmaceutical composition containing a synthetic oncolytic virus as described herein may be administered in an amount effective to increase immune activity by at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more.
[0076] The subjects to be treated by the methods described herein may be humans, livestock, sport animals, pets, primates, mammals such as horses, dogs, cats, mice, and rats. In one embodiment, the subject is a human. Compositions containing synthetic oncolytic viruses as described herein may be used in subjects requiring treatment to enhance immune activity, such as T-cell activity. In some aspects, the subjects may be human patients who have cancer, are suspected of having cancer, or are at risk of cancer. Non-limited examples of cancer include melanoma, squamous cell carcinoma, small cell lung cancer, non-small cell lung cancer, adenocarcinoma of the lung, squamous cell carcinoma of the lung, peritoneal cancer, hepatocellular carcinoma, gastrointestinal cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, liver cancer, breast cancer, colon cancer, colorectal cancer, endometrial or uterine cancer, salivary gland cancer, kidney cancer, prostate cancer, vulvar cancer, thyroid cancer, liver cancer, stomach cancer, and various types of head and neck cancer, including squamous cell head and neck cancer. In some aspects, cancer may be melanoma, lung cancer, colorectal cancer, renal cell carcinoma, urothelial carcinoma, or Hodgkin lymphoma.
[0077] Subjects with a target disease or disorder (e.g., cancer) can be identified through routine examinations, such as clinical tests, organ function tests, CT scans, or ultrasound. Subjects suspected of having any of these target diseases / disorders will likely exhibit one or more symptoms of the disease / disorder. Subjects at risk of disease / disorder may have one or more risk factors associated with that disease / disorder. Such subjects can also be identified through routine medical procedures.
[0078] In some embodiments, a pharmaceutical composition containing a synthetic oncolytic virus may be used in conjunction with another suitable therapeutic agent (e.g., an anticancer agent, an antiviral agent, or an antibacterial agent) and / or other agents that help enhance and / or complement the immunostimulatory effect of the synthetic oncolytic virus. In such combination therapy, the composition containing the synthetic oncolytic virus and the additional therapeutic agent (e.g., an anticancer agent or other as described herein) may be administered to the subject in a sequential manner (i.e., each therapeutic agent is administered at different times). Alternatively, these therapeutic agents, or at least two of them, may be administered to the subject substantially simultaneously.
[0079] Combination therapy may also include the administration of the agents described in the specification (e.g., pharmaceutical compositions containing synthetic oncolytic viruses and anticancer agents) in combination with other bioactive components (e.g., various anticancer agents) and non-pharmacological therapies (e.g., surgery).
[0080] It should be understood that any combination of a composition containing a synthetic oncolytic virus and another anticancer agent (e.g., a chemotherapeutic agent) may be used in any sequence for treating cancer. The combinations described herein, but are not limited to these, may be selected based on a number of factors including effectiveness in reducing tumorigenesis or tumor growth, reducing cancer cells, increasing immune activation, and / or alleviating at least one symptom associated with cancer, or in mitigating the side effects of another agent in the combination. For example, the combination therapies described herein may reduce any of the side effects associated with each individual member of the combination, such as the side effects associated with the anticancer agent.
[0081] In some aspects, other anticancer therapies include chemotherapy, radiotherapy, surgery, and / or immunotherapy. Examples of chemotherapeutic agents include, but are not limited to, carboplatin or cisplatin, docetaxel, gemcitabine, nab-paclitaxel, paclitaxel, pemetrexed, and vinorelbine. Examples of radiotherapy include, but are not limited to, ionizing radiation, gamma radiation, neutron radiation therapy, electron radiation therapy, proton radiation therapy, brachytherapy, systemic radioactive isotopes, and radiosensitizers. Examples of surgery include, but are not limited to, curative surgery (e.g., tumor removal surgery), prophylactic surgery, laparoscopic surgery, and laser surgery. Examples of immunotherapy include, but are not limited to, adoptive cell transplantation and therapeutic cancer vaccines.
[0082] Examples of additional chemotherapy include, but are not limited to, the following: platinum-based drugs such as carboplatin, oxaliplatin, cisplatin, nedaplatin, satraplatin, lovaplatin, triplatin, tetranitrate, picoplatin, prolindac, alloplatin and other derivatives; topoisomerase I inhibitors such as camptothecin, topotecan, irinotecan / SN38, rubitecan, berotecan and other derivatives; and Topoisomerase II inhibitors such as toposide (VP-16), daunorubicin, doxorubicin preparations (e.g., doxorubicin, doxorubicin HCl, doxorubicin analogs, or doxorubicin and its salts or analogs in liposomes), mitoxantrone, acralubicin, epirubicin, idarubicin, amrubicin, amsacrin, pirarubicin, barurubicin, zolbucine, teniposide and other derivatives; folic acid family (Folic Antimetabolites such as (methotrexate, pemetrexed, larcitrexed, aminopterin, and analogs); purine antagonists (thioguanine, fludarabine, cladribine, 6-mercaptopurine, pentostatin, clofarabine, and analogs) and pyrimidine antagonists (cytarabine, phloxuridine, azacitidine, tegafur, carmofur, capecitabine, gemcitabine, hydroxyurea, 5-fluorouracil (5FU), and analogs); nitrogen mustards (e.g., cyclophosphamide, melphalan, chlorambucil, mechloretamine, ifosfamide, tropho) Alkylating agents such as sphamide, prednimustine, bendamustine, uramustine, estramustine, and analogs; nitrosourea (e.g., carmustine, lomustine, semustine, hotemustine, nimustine, ranimustine, streptozocin, and analogs); triazenes (e.g., dacarbazine, altoretamine, temozolomide, and analogs); alkyl sulfonates (e.g., busulfan, mannosulfan, treosulfan, and analogs); procarbazine; mitobronitol, and aziridines (e.g., carbocon, triadicone, thioTEPA, triethylenemelamine, and analogs);Antibiotics such as hydroxyureas and anthracyclines (e.g., doxorubicin preparations, daunorubicin, epirubicin, and other derivatives); anthracendions (e.g., mitoxantrone and its analogs); streptomyces family (e.g., bleomycin, mitomycin C, actinomycin, plicamycin); and ultraviolet light.
[0083] III. Kits for therapeutic use This disclosure also provides kits for use in immunotherapy against cancer (e.g., melanoma, lung cancer, colorectal cancer, or renal cell carcinoma) and / or for treating cancer or reducing the risk of cancer. Such kits may comprise one or more containers containing a pharmaceutical composition containing a synthetic oncolytic virus, for example, any of those described herein. In some embodiments, the kit may include instructions for use in accordance with any of the methods described herein. For example, the included instructions may include instructions for administering a composition containing a synthetic oncolytic virus for the treatment of, delaying or mitigating the onset of, a target disease such as those described herein. The kit may further include instructions for selecting an individual suitable for treatment based on identifying whether the individual has the target disease. In yet another embodiment, the instructions include instructions for administering a composition containing a synthetic oncolytic virus to an individual at risk of having the target disease.
[0084] Instructions for the use of compositions containing synthetic oncolytic viruses generally include information regarding dosage, administration schedule, and route of administration for the intended treatment. Containers may be unit doses, bulk packaging (e.g., multi-dose packaging), or subunit doses. Instructions supplied with the kit of the present invention are typically written on a label or accompanying document (e.g., a paper sheet included in the kit), but computer-readable instructions (e.g., carried instructions on a magnetic or optical storage disk) are also acceptable. Labels or accompanying documents indicate that the composition is used to treat, delay the onset of, and / or alleviate cancer-related diseases or disorders, such as those described herein. Instructions may be provided to perform any of the methods described herein.
[0085] The kits described herein are in preferred packaging. Preferred packaging includes, but is not limited to, vials, bottles, wide-mouth bottles, flexible packaging (e.g., sealed Mylar or plastic bags), etc. What is intended is packaging for use in combination with certain devices such as inhalers, nasal administration devices (e.g., atomizers) or infusion devices such as minipumps. The kits may have a sterile access port (e.g., the container may be an intravenous solution bag or vial with a stopper that can be pierced by a subcutaneous needle). The container may also have a sterile access port (e.g., the container may be an intravenous solution bag or vial with a stopper that can be pierced by a subcutaneous needle). At least one activator in the composition is a composition containing synthetic oncolytic viruses such as those described herein. The kit may optionally provide additional components such as buffers and decision-making information. Typically, the kit includes a container and labels or accompanying documents (one or more) on or associated with the container. In some embodiments, the present invention provides articles of manufacture comprising the contents of the kit described above.
[0086] IV. General Techniques The implementation of this invention will, unless otherwise indicated, utilize conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry, and immunology, which will be within the scope of the skills of the art. Molecular Cloning: A Laboratory Manual, second edition (Sambrook, et al., 1989) Cold Spring Harbor Press;Oligonucleotide Synthesis (MJ Gait, ed., 1984);Methods in Molecular Biology, Humana Press; Cell Biology: A Laboratory Notebook (JE Cellis, ed., 1998) Academic Press; Animal Cell Culture (RI Freshney, ed., 1987); Introduction to Cell and Tissue Culture (JP Mather and PE Roberts, 1998) Plenum Press; Cell and Tissue Culture: Laboratory Procedures (A. Doyle, JB Griffiths, and DG Newell, eds., 1993-8) J. Wiley and Sons; Methods in Enzymology (Academic Press, Inc.); Handbook of Experimental Immunology (DM Weir and CC Blackwell, eds.); Gene Transfer Vectors for Mammalian Cells (JM Miller and MP Calos, eds., 1987); Current Protocols in Molecular Biology (FM Ausubel, et al., eds., 1987); PCR: The Polymerase Chain Reaction, (Mullis, et al., eds.Current Protocols in Immunology (JE Coligan et al., eds., 1991); Short Protocols in Molecular Biology (Wiley and Sons, 1999); Immunobiology (CA Janeway and P. Travers, 1997); Antibodies (P. Finch, 1997); Antibodies: a practical approach (D. Catty., ed., IRL Press, 1988-1989); Monoclonal antibodies: a practical approach (P. Shepherd and C. Dean, eds., Oxford University Press, 2000); Using antibodies: a laboratory manual (E. Harlow and D. Lane (Cold Spring Harbor Laboratory Press, 1999); The Antibodies (M. Zanetti and JD Capra, eds., Harwood Academic Publishers, (1995). Without further detail, it is conceivable that those skilled in the art can make the most use of the present invention based on the above description. Therefore, the following specific embodiments should be construed as mere examples and should not limit anything in the remainder of this disclosure. All publications referenced herein are incorporated by reference for the purposes or subject matter referred to herein.
[0087] It is conceivable that those skilled in the art can make full use of the present invention based on the above description without further detail. Therefore, the following specific embodiments should be construed as mere examples and should not limit the remainder of this disclosure in any way. All publications referenced herein are incorporated by reference for the purposes or subject matter referred to herein.
[0088] example material and method Cell lines and animals Cell lines B16F10 (ATCC® CRL-6475®), HEK-blue-TLR2 (Invivogen), HEK-blue-TLR3 (Invivogen), HEK-blue-TLR7 (Invivogen), HEK-blue-TLR9 (Invivogen), and Raw-Lucia ISG (Invivogen) were cultured according to the supplier's instructions (37°C, 5% CO2). Female C57BL / 6J (JAX catalog number 000664) mice aged 6-8 weeks were purchased and maintained at the Massachusetts Institute of Technology (MIT) Animal Facility. All animal studies and procedures were carried out in accordance with federal, state, and local guidelines under the IACUC-approved animal protocol by the MIT Committee of Animal Care.
[0089] Antibodies, staining, and FACS analysis Antibodies against mouse Ly6c (HK1.4), CD11b (M1 / 70), CD11c (N418), F4 / 80 (BM8), MHC-II (M5 / 114.15.2), CD45 (30-F11), CD3 (17A2), CD4 (GK1.5), CD8 (53-6.7), NK1.1 (PK136), CD45.2 (104), CD24 (30-F1), XCR1 (ZET), and CD64 (X54-5 / 7.1) were from Biolegend. Antibodies against mouse Ly6G (1A8), CD16 / 32 (2.4G2), and CD103 (M290) were from BD Biosciences. The antibody against mouse calreticulin (ab2907) was from Abcam. The live / dead dye (L34966) was from ThermoFisher.
[0090] B16F10 melanoma-bearing mice were euthanized and necropped according to federal, state, and local guidelines under the IACUC-approved animal protocol by the MIT Committee on Animal Protection. Tumor-discharging lymph nodes were then finely crushed, and tumors were thinly sliced and digested with collagenase IV (1 mg / ml) for 1 hour for single-cell suspension. The single-cell suspension was filtered through a 70 μm nylon constrainer and stained as described. 10 . Stained samples were analyzed using a FACS analyzer from BD Biosciences (LSR-II or LSR-II-Fortessa). Analysis was performed on a BD-LSRII Fortessa analyzer. All flow cytometry data were analyzed using FlowJo (Flowjo LLC), and plots were prepared using GraphPad Prism.
[0091] Construct, In Vitro Transcription, Capping / Methylation of Replicon RNA, and Neon Transfection The main chain of the mutant replicon construct was derived from the in vitro progress made in the previous study (currently being revised). IL12-MSA and IL12-MSA-lumican were amplified from plasmids from Prof. Dane Wittrup Lab and modified in the subgenomic region of the mutant replicon. Replicon RNA was transcribed in vitro (IVT) from the linearized VEE construct template using the MEGAscript® T7 Transcription Kit (ThermoFisher) according to the manufacturer's instructions. The resulting replicon RNA was capped and methylated using the ScriptCap® m7G Capping System and ScriptCap® 2'-O-Methyltransferase Kit (Cellscript) according to the manufacturer's instructions. RNA purity was assessed by gel electrophoresis. In vitro transfection was performed using 5 μg of RNA per 500,000 cells in 100 μl of R buffer from a NEON electroporation kit (ThermoFisher) under conditions of 1200 volts, 20 milliseconds, and 1 pulse.
[0092] Formulation of lipid nanoparticles and encapsulation of replicon RNA To encapsulate 10 μg of replicon RNA within DOTAP nanoparticles, a lipid mixture consisting of 16.9375 μl of DOTAP (Avanti, Cat#890890, 10 mg / ml), 15.965 μl of DSPC (Avanti, Cat#850365, 3 mg / ml), 18.7675 μl of cholesterol (Sigma-Aldrich, Cat#C8667, 6 mg / ml), and 13.6 μl of DSPE-PEG2000 (Avanti Cat#880128, 2.5 mg / ml) in a molar ratio of 40:10:48:2 was prepared in ethanol and evaporated under N2 until one-third of the initial total volume remained. Next, 10 μg of replicon RNA (1 mg / ml) in 11.8 μl of 0.1 M citrate buffer (pH 6.0) was added by pipetting, followed by a second addition of an additional 22 μl of 0.1 M citrate buffer (pH 6.0) by pipetting. The mixture was shaken for 1 hour, and then dialyzed against PBS at 25°C for another 1 hour in a 3,500 MWCO dialysis cassette.
[0093] The encapsulation of replicon RNA within lipofectamine nanoparticles was performed according to the instructions for the Lipofectamine® MessengerMAX® transfection reagent (thermofisher.com / order / catalog / product / LMRNA008). To encapsulate 10 μg of replicon RNA within TT3 nanoparticles, 10 μl of TT3 (10 mg / ml) in a molar ratio of 20:30:40:0.75 is used. 11A lipid mixture consisting of 8.04 μl of DOPE (Avanti, Cat#850725, 10 mg / ml), 5.572 μl of cholesterol (Sigma-Aldrich, Cat#C8667, 10 mg / ml), and 3.452 μl of C14-PEG2000 (Avanti Cat# 880150, 2 mg / ml) was prepared in 10.437 μl of ethanol. 4.167 μl of citrate buffer (pH 3.0, 10 mM) was added to the mixture. Then, 10 μg of replicon RNA (1 mg / ml) from 31.667 μl of citrate buffer (pH 3.0, 10 mM) was added by pipetting. The mixture was dialyzed against PBS at 25°C for 80 minutes in a 3,500 MWCO dialysis cassette. The resulting lipid nanoparticles loaded with the replicons were fractionated at an appropriate dosage for intratumor injection (10 μg / mouse) and for in vitro transfection (5 μg / 500,000 cells in 500 μl of culture medium).
[0094] Annexin V / PI staining, ATP assay, and Elisa Annexin V / PI staining was performed according to the instructions for the Biolegend kit (Cat#640932). Extracellular ATP was assayed using the ENLITEN® ATP Assay System (Promega). HMGB1, CCL5, IFNα2, IL12, and IFNγ were measured using ELISA kits from Chondrex (Cat#6010, HMGB1), R & D System (Cat#DY478, CCL5), Abcam (Cat#ab215409, IFNα2), and Biolegend (Cat#88-7121-88, IL12, Cat#88-7314-88, IFNγ), following their respective instructions for use.
[0095] RNA extraction and quantitative PCR analysis To quantify the levels of RNA transcripts, total RNA was extracted from cells or tumors transfected with LNP-replicon RNA as indicated, reverse transcribed using the TaqMan® Reverse Transcription Reagents Kit (ABI Catalog No. N8080234), and subsequently amplified using Sybr Green Master Mix (Roche) and specific primers for Stat1 (Cat#MP215434), Stat2 (Cat#MP215434), IRF9 (Cat#MP206708), IRF3 (Cat#MP206702), and cGAS (Cat#MP214711), and detected by Roche LightCycler 480. Ct values were normalized using the housekeeping gene mouse actin B for comparison.
[0096] Example 1: Synthetic all-in-one LNP replicon RNA for cancer immunotherapy Synthetic multifunctional lipid nanoparticles (LNPs) encapsulating replicon RNA, each with lipid and RNA components that perform multiple roles, can simplify the therapeutic process and amplify therapeutic effects: lipid formulations that promote both cellular uptake and cytosolic delivery of RNA while also directly inducing immunogenic cell death. In parallel, these LNPs deliver self-amplifying replicon RNA that encodes immunomodulatory therapeutic proteins and directly provides amplification of immunostimulation and subsequent immune responses. Functionally, these synthetic LNP replicon RNAs induce local immunogenic cell death in tumors and also naturally express immunomodulation in transfected cells. Immunogenic cell death can enhance tumor infiltration by immune cells and provide a reservoir of tumor-specific antigens that can be cross-presented to prepare for new T cell responses. LNP formulations containing the cationic lipid TT3 were identified as particularly suitable for these targets: three cationic lipid nanoparticles containing the key cationic lipids DOTAP, lipofectamine (Lipo), or TT3 were compared. As RNA cargo, an alphavirus replicon derived from Venezuelan encephalitis virus was used, in which the structural protein was replaced by the target cargo gene inserted under the promoter of a subgenome. When formulated with this self-amplified replicon RNA (LNP-mtRep), the DOTAP, lipo, and TT3 lipid formulations formed particles with average nanoparticle diameters of 97, 46, and 105 nm, respectively, and zeta potentials of +22.9, -6.7, and +4.3 mv (Figure 1G-1H).
[0097] The toxicity of (mtRep)LNPs loaded with "empty" pair RNA was assessed by incubating each formulation with B16F10 melanoma tumor cells in vitro. This assay revealed a significant decrease in viability for cells treated with TT3 LNPs, and that mtRep synergistically enhanced TT3, further killing tumor cells 3 days after transfection (Figure 1A). TT3 LNPs were more effective than DOTAP or Lipo in promoting tumor cell death. Notably, direct electroporation of replicons into tumor cells was relatively non-toxic, and it was indicated that LNP delivery facilitated cell killing. To determine whether replicons delivered with TT3 LNPs could drive cargo gene expression prior to cell death, we evaluated reporter gene GFP expression following LNP (mtRep) treatment. TT3-mtRep treatment led to approximately 35.4% of B16F10 cells expressing GFP 12 hours after transfection, which was lower than electroporation (approximately 90%) but significantly better than DOTAP-mtRep (approximately 0.05%) or Lipo-mtRep (approximately 7.6%) treatment (Figure 1B). Consistent with Figure 1A, cells transfected with TT3 nanoparticles showed a large population of annexin V+ / PI+ dead cells, and mtRep again had a synergistic effect on this cell death (Figure 1C).
[0098] To determine whether TT3(mtRep)-induced cell death is a type of immunogenic cell death (ICD), we measured calreticulin (CRT), which generally resides on the endoplasmic reticulum (ER) and is transported to the cell surface as an eat-me signal during ICD1. TT3 and mtRep synergistically promoted the transport of CRT to the cell surface (Figure 1D). Extracellular ATP activates the NLRP3 inflammasome 2, and extracellular HMGB1 mediates inflammation during ICD3. TT3, TT3-mtRep, and TT3-deRep effectively induced the release of ATP and HMGB1 (Figures 1E and 1F). In summary, TT3-mtRepRNA is a promising oncolytic agent that can induce immunogenic cell death while also leading to transient expression of cargo genes encoded by the replicon.
[0099] Example 2: Replicon RNA triggers TLR3 signaling and induces the ISGF3 complex, which is involved in necrotic cell death. To determine the mechanism underlying the synergistic effect of replicons and TT3LNPs on cell death, DOTAP, Lipo, or TT3 nanoparticles were transfected into reporter cells HEK-TLR2, HEK-TLR3, HEK-TLR7, or HEK-TLR9 (invivogen.com) with or without encapsulated mtRep encoding the reporter gene (or with encapsulated "inactive" mutant replicons (deRep) lacking functional gene expression). Both Lipo and TT3 LNPs possessing mtRep or deRep activated TLR3 signaling but did not stimulate any of the other TLRs tested (Figure 2A-D). When tested on Raw-Lucia-ISG reporter cells (invivogen.com), these same LNP formulations significantly induced interferon-stimulated genes (Figure 2E). These data suggest that TLR3 recognizes replicon RNA and induces an interferon response in response to LNP-mediated delivery.
[0100] Replicon RNA activates the ISGF3(Stat1 / Stat2 / IRF9) complex for necrotic cell death. 5 It activates TLR3 signaling through TRIF, which leads to type I interferon production. 4 Therefore, we assayed mRNA transcript levels of Stat1, Stat2, and IRF9, components of the ISGF3 complex, as well as IRF3 and cGAS, STING pathway genes, by qPCR. TT3 nanoparticles encapsulating mtRep or deRep increased the levels of Stat1, Stat2, and IRF9 by approximately 6-fold, 16-fold, and 3-fold, respectively, compared to an untreated control (Figure 2F-H). In contrast, they had no effect on the transcription of IRF3 or cGAS (Figure 2I-J). DOTAP and Lipo formulations failed to induce the ISGF3 complex, likely due to the low transfection efficiency of replicon RNA by these nanoparticles (Figure 1B). These data suggest that mtRep and deRep likely activate TLR3 signaling and induce the ISGF3 complex, promoting necrotic cell death, a type of immunogenic cell death.
[0101] Example 3: TT3-mtRep recruits immune cells and eliminates established tumors. The objective was to determine whether TT3-mtRep has an effect on immunogenic cell death and the in vivo expression of cargo genes, particularly in relation to the response to necrotic cell death. 6 Ly6c lo Ly6G +The absolute number of the granulocyte population was measured in tumors 3 days after intratumoral injection of TT3 nanoparticles encapsulating wild-type replicon RNA (wtRep), another mutant replicon RNA (mt2Rep), and the mutant replicon (mtRep) used above. Unexpectedly, mtRep showed a significantly greater recruitment (about 2-fold higher) of this granulocyte population to the tumor (Figure 3A), and better expression encoded by the subgenomic promoter (Figure 3B). Thus, TT3-mtRep induces immunogenic cell death along with the expression of appropriate cargo genes. In vivo studies using TT3-mtRep were subsequently carried out.
[0102] The in vivo expression levels of Stat1 / Stat2 / IRF9 and the STING signaling genes IRF3 and cGAS were measured following intratumoral LNP delivery of the replicon. Consistent with Figures 2F-J in vitro, tumors injected with TT3-mtRep significantly highly expressed Stat1 / Stat2 / IRF9 (ISGF3 complex), while IRF3 and cGAS were at equivalent levels of expression (Figure 3C), suggesting that administration of TT3-mtRep also initiated necrotic cell death in vitro.
[0103] To better understand the effect of TT3-mtRep on the immune composition in tumors, granulocytes (CD45 + CD11b + Ly6c lo Ly6G + ), M-MDSC (CD45 + CD11b + Ly6c hi Ly6G + ), monocytes (D45 + CD11b + Ly6c lo Ly6G - ), macrophages (CD45 + CD11b + Ly6c - Ly6G - F4 / 80 + ), CD4 T (CD45 + CD3ε+ CD4 + ), CD8 T(CD45 + CD3ε + CD8 + ), NK(CD45 + CD3ε - NK1.1 + ), NKT(CD45 + CD3ε + NK1.1 + ), conventional DC1 (cDC1, CD45 + CD11c + MHC-II + CD24 + CD64 - CD103 + CD11b - XCR1 hi ), and conventional DC2 (cDC2, CD45 + CD11c + MHC-II + CD24 + CD64 - CD103 + CD11b + XCR1 lo Immune cells such as ) were mapped and quantified in tumors on day 1 (Figure 3D) and day 3 (Figure 3E) after a single injection of LNP-replicon RNA, as well as on day 1 after three sequential injections (Figure 3F). In this dynamic analysis of the immune composition in tumors, granulocytes and cDC1s were rapidly recruited and decreased, respectively, on day 1 after injection of replicon RNA (Figure 3C), suggesting that granulocytes are an early event and cDC1s likely begin transport to tumor-discharging lymph nodes in response to LNP-replicon RNA. CD4 T, CD8 T, NK, and NKT cells were also recruited on day 3 after injection of replicon RNA (Figure 3D).
[0104] When LNP-replicon RNA was administered in three sequential injections, monocytes increased and macrophages decreased, but no significant changes were observed in lymphocyte-like cells such as CD4 T, NK, and NKT cells (Figure 3E). The effects of these approximately three sequential injections included approximately 10% more cell death (Figure 3F), approximately 4-fold higher tumor-infiltrating immune cells (Figure 3G), and a 2-fold reduction in tumor weight (Figure 3H) in the TT3-mtRep group samples, resulting in a significant regression of tumor growth (Figure 3I). Consistent with the increase in NK and NKT cells in conjunction with TT3-mtRep treatment, CCL5 expression was significantly induced (Figure 3I), which is primarily secreted by NK cells. 7 , and activated CD8 T cells (rstats.immgen.org / Skyline / skyline.html). These data indicate that TT3-mtRep induced immunogenic cell death in tumors, along with cargo gene expression, as observed in vitro in Figures 1 and 2. Most importantly, TT3-mtRep significantly modulated the tumor microenvironment and led to tumor mobilization of CD8 T cells and NK cells.
[0105] Example 4: TT3-mtRep, encoded with IL12-MSA or IL12-MSA-Lumican, effectively modulates the tumor microenvironment and immunocomposition. Intratumoral injection of TT3 (mtRep), which encodes a reporter gene, led to delayed tumor growth, while encoding immunomodulatory proteins within the replicon could lead to further immunostimulation and enhancement of antitumor immunity. An attractive candidate is IL-12, which may differentiate CD4 T helpers into Th1 cells and enhance the cytotoxic effects of NK and CD8 T cells. 8 One of the subunits of IL12, also named IL12b or IL12p40, is primarily used by antigen-presenting cells (CD8). + It is secreted from DCs (rstats.immgen.org / Skyline / skyline.html) and can be functionally activated by type I interferons. 9However, interferon α2 (IFNα2), the primary form of type I interferon, was low in either serum (Figure 4A) or tumor (Figure 4B) on days 1 and 3 after TT3-mtRep injection, suggesting that IL-12 secreted by DCs would remain low in the tumor microenvironment (TME). Therefore, we designed IL12-MSA or IL12-MSA-Lumican, which are fusions of IL12α (P30), IL12β (P40) with mouse serum albumin (MSA), or MSA with lumican. Lumican is an endogenous collagen-binding protein, and we hypothesized that it would promote the retention of IL-12 expressed on it in the TME, thereby enhancing the efficacy and safety of replicon therapy. We transfected B16F10 cells with the Replicon construct in vitro by NEON transfection, and confirmed the secretion of IL-12 in these transfected cells by ELISA (Figure 4C).
[0106] Consistently, tumors injected with TT3-mtRep encoding IL12-MSA (TT3-mtRep-IL12-MSA) or IL12-MSA-lumican (TT3-mtRep-IL12-MSA-lumican) expressed high levels of IL12 in vivo, reaching 40 ng / mg in the tumors (Figure 4D). Comparing the immunocomposition of tumors one day after injection, granulocytes were increased 1.5 to 3 times in tumors treated with TT3-mtRep expressing IL12-MSA and IL12-MSA-lumican, in contrast to the group treated with TT3-mtRep encoding the reporter gene mCherry (Figure 4E). On day 3, the IL12-MSA and IL12-MSA-Lumican groups recruited approximately 2–3 times more granulocytes, CD8 T cells, and cDC2 cells to the tumors compared to the replicons encoding the unrelated reporter gene (Figure 4F). Interestingly, all tumors treated with TT3-mtRep encoding the reporter gene, IL12-MSA, or IL12-MSA-Lumican showed a decrease in cDC1 cells compared to the untreated group (Figures 4E–4F). To determine whether cDC1 is transported to the TDLN, we counted cDC1 cells there and showed a significant increase in cDC1 cells in the lymph nodes after TT3-mtRep treatment, regardless of which cargo gene was encoding (Figure 4G). The increase in cDC1 cells continued in the IL12-MSA group (Figure 4G).
[0107] Example 5: Immunomodulatory IL12 and ICD induced by TT3-mtRep effectively eradicate B16F10 tumors. Because administering IL12 protein has been associated with severe side effects in clinical studies, we measured body weight changes in tumor-bearing mice treated with IL-12 encoded in a replicon. The mtRep-IL12-MSA group experienced approximately 5% body weight loss over one week. In contrast, the mtRep and mtRep-IL12-MSA-Lumican groups experienced only approximately 2% body weight loss and recovered within a few days (Figure 5A). Consistently, we failed to measure serum IL-6 or TNFα on day 1 or day 3 after injection of mtRep-IL12-MSA or mtRep-IL12-MSA-Lumican (data not shown). However, we observed a significant increase in serum IFN-γ in the mtRep-IL12-MSA group (Figure 5B), consistent with body weight loss in Figure 5A. Interestingly, the replicons expressing IL12-MSA or IL12-MSA-lumican were 50 mm in size at the time of treatment. 2 Even large, established tumors showed dramatic tumor regression (Figure 5C). Mice with tumors treated with TT3-mtRep encoding IL12-MSA and IL12-MSA-lumican showed 60% and 80% tumor elimination, respectively, 75 days after B16F10 injection. To determine whether these treated mice elicited a systemic immune response that prevents B16F10 tumor recurrence, these mice were immunized with 100,000 B16F10 cells in the contralateral flank. As expected, all treated mice rejected B16F10 tumors compared to naive mice that rapidly developed B16F10 tumors. These data suggest that the synergistic effect of immunomodulatory IL12 and ICD (immunogenic cell death) can effectively eradicate B16F10 tumors and induce a systemic immune response that prevents B16F10 tumor recurrence.
[0108] References: [Table 2-1] [Table 2-2]
[0109] Other embodiments All features disclosed herein may be combined in any combination. Each feature disclosed herein may be replaced by an alternative feature that serves the same, equivalent, or similar purpose. Thus, unless otherwise specified, each disclosed feature is merely an example of a general series of equivalent or similar features. From the above description, those skilled in the art will readily identify the essential features of the present invention and can make various modifications and alterations to suit various uses and conditions without departing from its spirit and scope. Therefore, other embodiments are also within the scope of the claims.
[0110] Equal parts While several embodiments of the invention have been described and illustrated herein, those skilled in the art will readily recall various other means and / or structures for carrying out the functions described herein and / or for obtaining the results and / or one or more advantages described herein, and each of such changes and / or modifications will be considered to fall within the scope of the embodiments of the invention described herein. More generally, all parameters, dimensions, materials and configurations described herein are illustrative, and those skilled in the art will readily understand that the actual parameters, dimensions, materials and / or configurations will depend on the specific application (one or more) in which the teachings of the invention are used. Those skilled in the art will be able to recognize or confirm many equivalents to the particular embodiments of the invention described herein by using only routine experimental methods. Thus, it should be understood that the embodiments described above are presented as examples only, and within the scope of the appended claims and their equivalents, embodiments of the invention may be practiced in ways different from those specifically described and claimed. The embodiments of the invention of this disclosure are directed to each of the individual features, systems, articles, materials, kits and / or methods described herein. In addition, any combination of two or more such features, systems, articles, materials, kits, and / or methods, provided that such features, systems, articles, materials, kits, and / or methods are not inconsistent with each other, is included within the scope of the inventions of this disclosure.
[0111] It should be understood that all definitions defined and used herein are superseded by dictionary definitions, definitions in documents incorporated by reference, and / or the ordinary meanings of the terms being defined. All references, patents, and patent applications disclosed herein are incorporated by reference with respect to the subject matter from which they are cited, and in some cases, the entire document may be included.
[0112] When used herein and in the claims, the indefinite articles "a" and "an" should be understood to mean "at least one" unless explicitly indicated otherwise. When used herein and in the claims, the phrase “and / or” should be understood to mean “either or both” of the elements thus combined; that is, the elements exist associatively in some cases and as dissociatively in other cases. Multiple elements enumerated by “and / or” should be interpreted in the same manner, that is, “one or more” of the elements thus combined. Other elements may optionally exist, other than those specifically identified by the “and / or” clause, whether related to or unrelated to those specifically identified elements. Thus, as a non-restrictive example, when used in conjunction with open-ended words such as “comprising,” the reference to “A and / or B” may, in one embodiment, refer to A only (optionally encompassing elements other than B); in another embodiment, to B only (optionally encompassing elements other than A); in yet another embodiment, to refer to both A and B (optionally encompassing other elements); and so on.
[0113] When used herein and in the claims, “or” should be understood to have the same meaning as “and / or” as defined above. For example, when items in a list are separated, “or” or “and / or” should be interpreted as inclusive, that is, including more than one of the elements of the number or list, and optionally including additional unlisted items, rather than just one. Only terms that explicitly indicate the opposite, such as “only one of” or “exactly one of” or, when used in the claims, “consisting of,” would refer to including exactly one of the elements of the number or list. In general, the term "or" as used herein should be interpreted as referring to an exclusive alternative (i.e., "one or the other, but not both") only when preceded by an exclusive term such as "either," "one of," "only one of," or "exactly one of." When used in claims, "consisting essentially of" should have its usual meaning as used in the field of patent law.
[0114] When used herein and in the claims, the phrase “at least one” in relation to a list of one or more elements means at least one element selected from any one or more elements in the list, but not necessarily including at least one of each and all elements specifically enumerated in the list of elements, and not excluding any combination of elements in the list of elements. This definition may also optionally include elements other than those specifically identified in the list of elements to which the phrase “at least one” refers, whether related to or unrelated to those specifically identified elements. Therefore, as an unrestricted example, “at least one of A and B” (or equivalently, “at least one of A or B” or equivalently, “at least one of A and / or B”) could mean, in one embodiment, at least one of which B is absent and includes any number of A's (and optionally includes elements other than B); in another embodiment, at least one of which A is absent and includes at least one, and any number of B's (and optionally includes elements other than A); in yet another embodiment, at least one of which includes any number of A's and any number of B's (and optionally includes other elements); and so on.
[0115] Unless otherwise explicitly stated, in any method claimed herein that involves more than one step or action, it should be understood that the order of the steps or actions of the method is not necessarily limited to the order in which they are enumerated.
Claims
1. (i) Lipid nanoparticles containing N1,N3,N5-tris(3-(didodecylamino)propyl)benzene-1,3,5-tricarboxamide (TT3); and (ii) (a) Sequences encoding alphavirus nonstructural proteins nsP1, nsP2, nsP3, and nsP4, and (b) Sequence encoding the interleukin (IL)-12 molecule Alphavirus replicon RNA, including A composition comprising, The composition wherein alphavirus replicon RNA is encapsulated by lipid nanoparticles.
2. The composition according to claim 1, wherein the alphavirus replicon RNA is derived from Venezuelan encephalitis virus (VEE), chikungunya virus (CHIK), semliki forest virus (SF), or Sindbis virus (SIN).
3. The composition according to claim 1 or 2, wherein the sequence encoding the IL-12 molecule is located within a subgenomic region of alphavirus replicon RNA.
4. The composition according to any one of claims 1 to 3, wherein the alphavirus replicon RNA comprises a nucleotide sequence that is at least 90% identical to SEQ ID NO:
1.
5. Lipid nanoparticles further, (i) Phosphatidylcholine, (ii) Cholesterol, (iii) Polyethylene glycol (PEG)-lipid conjugate, or (iv) A combination of two or more types of (i) to (iii) A composition according to any one of claims 1 to 4, comprising:
6. Lipid nanoparticles further, (i) 1,2-Dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), (ii) Cholesterol, (iii) 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)]-2000 (C14-PEG2000), or (iv) A combination of two or more types of (i) to (iii) A composition according to any one of claims 1 to 5, comprising:
7. The composition according to any one of claims 1 to 6, wherein the lipid nanoparticles further comprise 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) and cholesterol.
8. A pharmaceutical composition comprising the composition according to any one of claims 1 to 7 and a pharmaceutically acceptable carrier.
9. The pharmaceutical composition according to claim 8, further comprising 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)]-2000 (C14-PEG2000).
10. The pharmaceutical composition according to claim 8 or 9, formulated for intratumor injection, intramuscular injection, subcutaneous injection, or intravenous injection.
11. A pharmaceutical composition according to any one of claims 8 to 10, formulated for intratumor injection.
12. A kit comprising the composition according to any one of claims 1 to 7 and instructions for administering the composition to a subject requiring it.
13. A method for producing the composition according to any one of claims 1 to 7, comprising loading alphavirus replicon RNA onto lipid nanoparticles.
14. A pharmaceutical composition according to any one of claims 8 to 11, for use in the treatment of cancer in a subject where it is required.
15. The pharmaceutical composition according to claim 14, wherein the cancer is melanoma, breast cancer, colon cancer, squamous cell carcinoma, small cell lung cancer, non-small cell lung cancer, adenocarcinoma of the lung, squamous cell carcinoma of the lung, peritoneal cancer, hepatocellular carcinoma, gastrointestinal cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, liver cancer, colorectal cancer, endometrial cancer or uterine cancer, salivary gland cancer, kidney cancer, prostate cancer, vulvar cancer, thyroid cancer, liver cancer, stomach cancer, squamous cell head and neck cancer, renal cell carcinoma, urothelial carcinoma, or Hodgkin lymphoma.
Citation Information
Patent Citations
Synthetic oncolytic LNP replicon RNA and its use for cancer immunotherapy
JP2022524391A
JPP7561134B
Benzene-1,3,5-tricarboxamide derivatives and uses thereof
US20180147166A1