Antisense oligomers for monoamine oxidase B and their applications

JP7904925B2Active Publication Date: 2026-08-13INST FOR BASIC SCI +1
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Filing Date
2023-05-30
Publication Date
2026-08-13

Smart Images

  • Figure 0007904925000004
    Figure 0007904925000004
  • Figure 0007904925000005
    Figure 0007904925000005
  • Figure 0007904925000006
    Figure 0007904925000006
Patent Text Reader

Abstract

The present invention relates to an antisense oligomer against monoamine oxidase B and its use, and to an antisense oligomer that regulates the amount of a gene encoding monoamine oxidase B, specifically mRNA or protein, and its use for the prevention, alleviation or treatment of liver diseases, obesity or neurological diseases.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to an antisense oligomer against monoamine oxidase B and its use, and relates to a gene encoding monoamine oxidase B, specifically, an antisense oligomer that regulates the amount of mRNA or protein, and its use for the prevention, alleviation or treatment of liver diseases, obesity or neurological diseases.

[0002]

Background Art

[0003] MAO (Monoamine oxidase) is particularly located in the outer mitochondrial membrane of the liver and brain and is known to promote the oxidative deamination reaction of monoamine neurotransmitters such as dopamine. It is known that hydrogen peroxide (H2O2), which induces oxidative stress and neuronal cell death, is produced through the reaction promoted by MAO.

[0004] There are MAO-A and MAO-B in MAO, and MAO-B is abundant in neurons and astrocytes that release serotonin and is known to be selectively inhibited by potent inhibitors such as selegiline and rasagiline.

[0005] In particular, in the human brain, it is known that the expression level of monoamine oxidase B (Monoamine oxidase B, MAO-B) increases with age and its activity increases in neurological diseases (Park et al., Sci Adv. 2019 Mar 20;5(3):eaav0316).

[0006] Under the above technical background, the inventors of the present application confirmed an antisense oligomer against monoamine oxidase B, and confirmed that the antisense oligomer can be used for the prevention, alleviation or treatment of neurological diseases by regulating the expression of mRNA encoding monoamine oxidase B, and thus completed the present invention.

[0007]

[0008] [Overview of the Initiative] [Problems that the invention aims to solve]

[0009] The object of the present invention is to provide an antisense oligomer that regulates the expression of a gene encoding monoamine oxidase B.

[0010] Another object of the present invention is to provide a pharmaceutical composition for the prevention, alleviation, or treatment of liver disease or neurological disease comprising the antisense oligomer. Another object of the present invention is to provide a method for the prevention, alleviation, or treatment of liver disease or neurological disease by administering the antisense oligomer. Another object of the present invention is to provide a manufacturing application for a composition for the prevention, alleviation, or treatment of liver disease or neurological disease comprising the antisense oligomer. [Means for solving the problem]

[0011] To achieve the above objective, the present invention provides an oligomer having a length of 10 nt to 50 nt that can hybridize with at least eight consecutive nucleic acid bases from the pre-mRNA sequence of the entire MAOB (major nucleotide-based) nucleic acid sequence.

[0012] Furthermore, the present invention provides an oligomer having a length of 10 nt to 50 nt that can hybridize with at least eight consecutive nucleic acid bases from a sequence selected from the group consisting of Sequence IDs 2, 3, and 9.

[0013] Furthermore, the present invention provides an oligomer having a length of 10 nt to 50 nt that can hybridize with at least eight consecutive nucleic acid bases from the sequence of Sequence ID No. 9.

[0014] Furthermore, the present invention provides an oligomer comprising a sequence selected from the group consisting of Sequence IDs 22, 23, and 29.

[0015] Furthermore, the present invention provides an oligomer containing the sequence of Sequence ID No. 29.

[0016] Furthermore, the present invention provides an oligomer having the following sequence and chemical structure:

[0017] T*GAAC*6*6*5*5*5*7*7*6*5*6*ACGA*G;

[0018] G*ATCA*6*5*7*7*6*6*8*6*8*6*6*CAGC*T; and

[0019] C*ACTA*5*8*6*5*6*5*8*5*8*8*TAGC*C,

[0020] Here, PS stands for phosphorothioate; 2'MOE stands for 2'-O-methoxyethyl. A = 2'MOE-A, C = 2'MOE-5'-methyl-C, G = 2'MOE-G, T = 2'MOE-T, 5 = DNA-A, 6 = DNA-5'-methyl-C, 7 = DNA-G, 8 = DNA-T, and * = PS.

[0021] Furthermore, the present invention provides a composition comprising an oligomer and at least one pharmaceutically acceptable carrier or diluent.

[0022] Furthermore, the present invention provides a composition for the prevention, alleviation, or treatment of liver disease or neurological disease comprising an oligomer and at least one pharmaceutically acceptable carrier or diluent. The present invention also provides a method for the prevention, alleviation, or treatment of liver disease or neurological disease comprising administering a composition comprising the oligomer and at least one pharmaceutically acceptable carrier or diluent. Another object of the present invention is to provide a manufacturing application for a composition for the prevention, alleviation, or treatment of liver disease or neurological disease comprising an oligomer and at least one pharmaceutically acceptable carrier or diluent.

[0023] In addition, the present invention provides a composition for preventing, reducing or treating fatty liver, comprising an oligomer and at least one pharmaceutically acceptable carrier or diluent. Further, the present invention aims to provide a method for preventing, reducing or treating fatty liver, which comprises administering a composition comprising the oligomer and at least one pharmaceutically acceptable carrier or diluent. Another object of the present invention is to provide a use for manufacturing a composition for preventing, reducing or treating fatty liver, which composition comprises an oligomer and at least one pharmaceutically acceptable carrier or diluent.

[0024] In addition, the present invention provides a composition for preventing, reducing or treating obesity, comprising an oligomer and at least one pharmaceutically acceptable carrier or diluent. Further, the present invention aims to provide a method for preventing, reducing or treating obesity, which comprises administering a composition comprising the oligomer and at least one pharmaceutically acceptable carrier or diluent. Another object of the present invention is to provide a use for manufacturing a composition for preventing, reducing or treating obesity, which composition comprises an oligomer and at least one pharmaceutically acceptable carrier or diluent.

[0025]

Brief Description of Drawings

[0026] [Figure 1a-1b] It is the test result of confirming the possibility of suppressing MAOB mRNA expression level through the KD test in the Huh7 cell line.

[0027] [Figure 2] It is the result of confirming the suppression of MAOB expression level in the A34, A35, and A41 candidate groups through the KD test in the Huh7 cell line.

[0028] [Figure 3a] It is the test result of confirming the safety through measuring the survival rate and the test result of confirming the suppression of expression level when injecting MAOB ASO.

[0029] [Figure 3b]This result confirms that MAOB mRNA expression was suppressed in the cerebrum, thalamus, and cerebellum of the group injected with A41.

[0030] [Figure 4a] These are the results of a study that confirmed safety and suppressed expression levels in adult animals after MAOB ASO injection, based on survival rate measurements.

[0031] [Figure 4b] This is the result of an experiment on memory recovery through MAOB ASO injection in an Alzheimer's model.

[0032] [Figure 5a] This is an experimental result measuring the amount of tonic GABA through MAOB ASO injection in an Alzheimer's model.

[0033] [Figure 5b] These are the results relative to tonic GABA levels measured in existing, identical Alzheimer's animal models.

[0034] [Figure 6a] This study presents experimental results identifying the weight-reducing effect of MAOB ASO injection in animal models of fatty liver disease and obesity.

[0035] [Figure 6b] These results are in comparison to histologically observed triglyceride changes in the livers of existing identical fatty liver and obese animal models.

[0036]

[0037] [Modes for carrying out the invention]

[0038] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by experts skilled in the art to which the present invention pertains. In general, the nomenclature used herein is well known and commonly used in the art.

[0039] The antisense oligomer (oligonucleotide) according to the present invention can suppress the expression of a gene encoding monoamine oxidase B, specifically mRNA. The antisense oligomer (oligonucleotide) according to the present invention contains a sequence complementary to the mRNA encoding monoamine oxidase B.

[0040] "Antisense activity" means any detectable or measurable activity that contributes to the hybridization of an antisense compound to its target nucleic acid. In a particular embodiment, antisense activity is a reduction in the amount or expression of the target nucleic acid or the protein encoded by such target nucleic acid. The antisense activity according to the present invention acts on a target nucleic acid encoding monoamine oxidase B, reducing the amount or expression of the encoded monoamine oxidase B protein.

[0041] "Targeting," "targeting," or "being targeted" means specifically hybridizing with a target nucleic acid to induce a desirable effect.

[0042] "Target nucleic acid," "target RNA," and "target RNA transcript" all refer to nucleic acids that can be targeted by antisense oligomers.

[0043] The present invention includes an oligomer capable of hybridizing to a target nucleic acid through hydrogen bonding.

[0044] "Inhibition" refers to a decrease in the target nucleic acid level or target protein level in the presence of an antisense compound complementary to the target nucleic acid, compared to the target nucleic acid level or target protein level in the absence of the antisense oligomer.

[0045] "Antisense oligomers" include single-stranded oligonucleotides having a nucleic acid base sequence that enables hybridization to a corresponding site or segment of a target nucleic acid.

[0046] The present invention relates to an oligomer having a length of 10 nt to 50 nt that can hybridize with at least eight consecutive nucleic acid bases from the nucleic acid sequence of the entire MAOB premRNA sequence.

[0047] The sequence is chrX:43,766,610-43,882,450(hg38, (-)strand, length 115, 841 bp) and may include the sequence of Sequence ID No. 41. The oligomer according to the present invention can hybridize with at least eight consecutive nucleic acid bases from the following nucleic acid sequences.

[0048] The oligomer according to the present invention is capable of hybridization with at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 consecutive nucleic acid bases from the nucleic acid sequence.

[0049] In hybridization, the conditions used to achieve a strict, specific level of hybridization vary depending on the properties of the nucleic acid being hybridized. For example, the length of the nucleic acid region being hybridized, the degree of homology, the nucleotide sequence composition (e.g., GC / AT composition ratio), and the nucleic acid type (e.g., RNA, DNA) are considered when selecting hybridization conditions. An additional consideration is whether the nucleic acid is immobilized, for example, on a filter.

[0050] Examples of very strict conditions include: 2XSSC / 0.1% SDS at room temperature (hybridization conditions); 0.2XSSC / 0.1% SDS at room temperature (less strict conditions); 0.2XSSC / 0.1% SDS at 42°C (normally strict conditions); and 0.1XSSC at 68°C (highly strict conditions). The washing process can be carried out using any one of these conditions, for example, the highly strict conditions, or each of the aforementioned conditions, and all or part of the conditions can be repeated for 10 to 15 minutes each in the order described above. However, as described above, the optimal conditions vary depending on the specific hybridization reaction involved and can be determined through experimentation. Generally, highly strict conditions are used for the hybridization of important probes.

[0051] At least one of the hybridized base pairs may include a wobble pair G:U, I:A, I:C, or I:U.

[0052] The present invention includes an oligomer having a length of 10 nt to 50 nt that can hybridize with at least eight consecutive nucleic acid bases from a sequence selected from the group consisting of SEQ ID NOs: 1 to 20.

[0053] [Table 1]

[0054] One example includes an antisense oligomer containing 18 to 21 linked nucleosides, which is capable of hybridizing with at least 8 consecutive nucleic acid bases from sequences selected from the group consisting of SEQ ID NOs. 1 to 20, and has a length of 10 to 50 nt. It may also include an oligomer capable of hybridizing with at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 consecutive nucleic acid bases from sequences selected from the group consisting of SEQ ID NOs. 1 to 20, and has a length of 10 to 50 nt.

[0055] One example may be an antisense oligomer containing 15 to 25 linked nucleosides, which can hybridize with at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 consecutive nucleic acid bases selected from the group consisting of SEQ ID NOs. 1 to 20, and may include oligomers having a length of 10 to 50 nt.

[0056] One example may be an antisense oligomer containing 18 to 21 linked nucleosides, which can hybridize with at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 consecutive nucleic acid bases selected from the group consisting of SEQ ID NOs. 1 to 20, and may include oligomers having a length of 10 to 50 nt.

[0057] Specifically, the sequences can hybridize with 18 or more, 19 or more, or 20 consecutive nucleic acid bases selected from the group consisting of sequence numbers 1 to 20, and may contain oligomers having a length of 10 nt to 50 nt.

[0058] Furthermore, the present invention relates to an oligomer having a length of 10 nt to 50 nt that can hybridize with at least eight consecutive nucleic acid bases from a sequence selected from the group consisting of Sequence ID No. 2, 3, or 9.

[0059] It may contain oligomers having a length of 10 nt to 50 nt that are capable of hybridizing with at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 consecutive nucleic acid bases selected from the group consisting of sequence numbers 2, 3, and 9.

[0060] At least one of the hybridized base pairs may include a fluctuating base pair G:U, I:A, I:C, or I:U.

[0061] Furthermore, the present invention is an oligomer having a length of 10 nt to 50 nt that can hybridize with at least eight consecutive nucleic acid bases from the sequence of Sequence ID No. 9.

[0062] The sequence of Sequence ID No. 9 can hybridize with at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 consecutive nucleic acid bases and may contain oligomers having a length of 10 nt to 50 nt.

[0063] At least one of the hybridized base pairs may include a fluctuating base pair G:U, I:A, I:C, or I:U.

[0064] "Consecutive nucleic acid bases" refers to nucleic acid bases that are immediately adjacent to each other. "Nucleoside linkage" refers to the chemical bond between each nucleoside. "Linked nucleosides" refers to adjacent nucleosides that are linked together.

[0065] "Nucleic acids" refer to molecules composed of monomeric nucleotides. Nucleic acids include ribonucleic acid (RNA), deoxyribonucleic acid (DNA), single-stranded nucleic acids, double-stranded nucleic acids, small interfering ribonucleic acid (siRNA), and microRNAs (miRNAs). Nucleic acids can also contain combinations of these elements within a single molecule.

[0066] "Nucleic acid base" refers to a heterocyclic region that can pair with a base of another nucleic acid.

[0067] "Nucleic acid base sequence" refers to the sequence of nucleic acid bases that is unrelated to any sugars, ligatures, or nucleic acid base deformations.

[0068] "Nucleoside" refers to a nucleic acid base linked to a sugar.

[0069] A "nucleotide" refers to a nucleoside that has a phosphate group covalently linked to the sugar portion of the nucleoside.

[0070] An "oligomer" refers to a polymer of linked monomeric units that can hybridize into the region of a nucleic acid molecule.

[0071] An "oligonucleotide" refers to a polymer of linked nucleosides, each of which can be independently deformed or imformed.

[0072] A "single-stranded oligonucleotide" refers to an oligonucleotide that is not hybridized to a complementary strand.

[0073] At least one of the base pairs forming the hybridization can include a fluctuating base pair G:U, I:A, I:C, or I:U. The antisense oligomer according to the present invention can include, for example, a sequence having 90% or more sequence homology with a sequence selected from the group consisting of SEQ ID NOs. 21 to 40.

[0074] Specifically, the sequence may include sequences selected from the group consisting of sequence numbers 21-40 that exhibit sequence homology of 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100%.

[0075] The antisense oligomer according to the present invention may include, for example, a sequence having 90% or more sequence homology with one or more sequences selected from the group consisting of SEQ ID NOs: 22, 23, and 29.

[0076] Specifically, the antisense oligomer according to the present invention may include one or more sequences selected from the group consisting of sequence numbers 22, 23, and 29, and sequences exhibiting sequence homology of 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100%.

[0077] The antisense oligomer according to the present invention may include, for example, a sequence having 90% or more sequence homology to the sequence of SEQ ID NO: 29.

[0078] Specifically, the antisense oligomer according to the present invention may include a sequence that exhibits 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% sequence homology with the sequence of SEQ ID NO: 29.

[0079] As used herein, “homology” refers to the percentage of identity between polynucleotide portions. “Identity” refers to the degree to which sequences are functionally or structurally identical based on the polynucleotide sequence through a comparison window. Sequence homology can be confirmed by comparing sequences using standard software, such as programs called BLASTN or BLASTX, which were developed based on BLAST (Proc. Natl. Acad. Sci. USA, 90, 5873-5877, 1993).

[0080] In one embodiment, the antisense oligomer according to the present invention may contain 20 linked nucleosides. Specifically, the antisense oligomer according to the present invention may contain one or more sequences selected from the group consisting of SEQ ID NOs: 22, 23, and 29.

[0081] TGAACCCAAAGGCACACGAG(Sequence ID 22);

[0082] GATCACAGGCCTCTCCAGCT(Sequence ID 23); and

[0083] CACTAATCACATATTTAGCC (Sequence ID 29).

[0084] In particular, the antisense oligomer according to the present invention may contain the sequence of SEQ ID NO: 29.

[0085] In this specification, complementary sequences include some base deletions and incomplete complementarity that are sufficient to suppress the expression of mRNA encoding monoamine oxidase B.

[0086] "Nucleoside" refers to a nucleic acid base linked to a sugar, while "nucleotide" refers to a nucleoside that has a phosphate group covalently linked to the sugar portion of the nucleoside. "Nucleic acid base" refers to a heterocyclic portion that can pair with a base of another nucleic acid.

[0087] An "oligomer" refers to a polymer of linked monomeric units that can hybridize to at least the region of a nucleic acid molecule.

[0088] The nucleoside may include deformed nucleoside links, or it may include a deformed sugar.

[0089] Specifically, the nucleoside linkage may be a phosphorothioate, boranophosphate, or methyl phosphonate linkage.

[0090] The nucleoside linkage according to the present invention may be a sooosssssssssssooos linkage, where s is a phosphorothioate nucleoside linkage and o is a phosphodiester nucleoside linkage.

[0091] The nucleoside may contain the following modified sugars:

[0092] Modifications of substitution at the 2'-carbon position of the sugar structure with 2'-O-methyl (2'-O-Me), 2'-O-methoxyethyl (2'MOE), 2'-O-methoxyethyl-5'methyl, 2'-O-aminoethyl, 5'-methyl, 2'-O-propyl (propyl), 2'-methylthioethyl (methylthioethyl), or 2'-fluoro (2'-Fluoro).

[0093] The nucleoside may include, for example, phosphorothioate, boranophosphate, or methylphosphonate linkages as internucleoside links; and variations in substitution of 2'-O-methyl (2'-O-Me), 2'-O-methoxyethyl (2'MOE), 2'-O-methoxyethyl-5'methyl, 2'-O-aminoethyl, 5'-methyl, 2'-O-propyl, 2'-methylthioethyl, or 2'-fluoro at the 2' carbon position of the sugar structure.

[0094] The nucleoside may be characterized by including a modification selected from the group configured as follows: The modification may include a modification of the sugar moiety, for example, a modification at the 2' carbon position of the sugar structure within the nucleotide, specifically a modification to 2'-O-methyl (2'-O-Me), 2'-O-methoxyethyl (2'MOE), 2'-O-methoxyethyl-5'methyl, 2'-O-aminoethyl, 5'-methyl, 2'-O-propyl, 2'-methylthioethyl, or 2'-fluoro; a modification of the nucleotide bond to a phosphorothioate, boranophosphate, or methylphosphonate; a modification to a PNA (peptide nucleic acid), LNA (locked nucleic acid), or UNA (unlocked nucleic acid) form; and a phosphate group.

[0095] "2'-O-methoxyethyl" (also known as 2'-MOE and 2'-O(CH2)2-OCH3) represents the O-methoxyethyl modification at the 2' position of the furosyl ring.

[0096] "2'-O-methoxyethyl nucleotide" refers to a nucleotide that contains a modified sugar moiety of 2'-O-methoxyethyl.

[0097] "Modified sugars" refer to substitutions or alterations from natural sugars.

[0098] "5-methylcytosine" refers to cytosine that has been modified to have a methyl group attached at the 5' position. 5-methylcytosine is a modified nucleic acid base.

[0099] "Deformed nucleoside linkage" refers to substitution or arbitrary modification of naturally occurring nucleoside linkages.

[0100] "Modified nucleic acid bases" refers to any nucleic acid base other than adenine, cytosine, guanine, thymidine, or uracil. "Modified nucleic acid bases" refers to the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).

[0101] A "modified nucleotide" refers to a nucleotide having an independently modified sugar moiety, a modified nucleoside linkage, or a modified nucleic acid base. A "modified nucleoside" refers to a nucleoside having an independently modified sugar moiety or a modified nucleic acid base.

[0102] A "deformed oligonucleotide" refers to an oligomer that contains at least one deformed nucleotide.

[0103] The antisense oligomer according to the present invention may contain, but is not limited to, trivalent GalNAc (N-acetylgalactosamine) or pentavalent GalNAc (N-acetylgalactosamine).

[0104] The antisense oligomer according to the present invention may include modifications to 2'-O-methoxyethyl (2'MOE), 2'-O-methoxyethyl-5'methyl, 5'-methyl, or phosphorothioate bonds.

[0105] Another perspective concerns antisense oligomers containing 12 to 30 linked nucleosides, each containing at least eight consecutive nucleic acid bases selected from the group comprised of sequence numbers 2, 3, and 9.

[0106] One example is an antisense oligomer containing 18 to 21 linked nucleosides, comprising at least 8 consecutive nucleic acid bases from sequences selected from the group comprised of SEQ ID NOs: 2, 3, and 9. It may also contain at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, or at least 15 consecutive nucleic acid bases from sequences selected from the group comprised of SEQ ID NOs: 2, 3, and 9.

[0107] One example may be an antisense oligomer containing 15 to 25 linked nucleosides, which may contain at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, or at least 15 consecutive nucleic acid bases selected from the group consisting of SEQ ID NOs: 2, 3, and 9.

[0108] One example may be an antisense oligomer containing 18 to 21 linked nucleosides, which may contain at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, or at least 15 consecutive nucleic acid bases selected from the group consisting of SEQ ID NOs: 2, 3, and 9.

[0109] Specifically, the sequence may contain 18 or more, 19 or more, or 20 consecutive nucleic acid bases selected from the group consisting of sequence numbers 2, 3, and 9.

[0110] Another perspective concerns antisense oligomers containing 12 to 30 linked nucleosides, each containing at least eight consecutive nucleic acid bases from the sequence of Sequence ID No. 9.

[0111] One example is an antisense oligomer containing 18 to 21 linked nucleosides, and containing at least 8 consecutive nucleic acid bases from the sequence of Sequence ID No. 9. It may also contain at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, or at least 15 consecutive nucleic acid bases from sequences selected from the group consisting of Sequence ID Nos. 2, 3, and 9.

[0112] One example may be an antisense oligomer containing 15 to 25 linked nucleosides, which may contain at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, or at least 15 consecutive nucleic acid bases from the sequence of Sequence ID No. 9.

[0113] One example may be an antisense oligomer containing 18 to 21 linked nucleosides, which may contain at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, or at least 15 consecutive nucleic acid bases from the sequence of Sequence ID No. 9.

[0114] Specifically, the sequence of sequence number 9 may contain 18 or more, 19 or more, or 20 consecutive nucleic acid bases.

[0115] The present invention relates to an antisense oligomer that targets a gene encoding monoamine oxidase B, comprising a sequence selected from the group consisting of SEQ ID NOs: 2, 3, and 9. In particular, the antisense oligomer according to the present invention may contain the sequence of SEQ ID NO: 9.

[0116] The oligomer according to the present invention may have a length of 13 nt to 35 nt, or a length of 16 nt to 25 nt. The oligomer may be 16 nt, 17 nt, 18 nt, 19 nt, 20 nt, 21 nt, 22 nt, 23 nt, 24 nt, or 25 nt.

[0117] Each of the nucleosides selected from the group comprised of Sequence IDs 2, 3, and 9 may include a modified form. For example, the nucleoside linkage may include a modified nucleoside linkage or a modified sugar.

[0118] Specifically, the nucleoside linkage may be a phosphorothioate, boranophosphate, or methylphosphonate linkage. At least one of the modified nucleoside linkages may be a phosphorothioate linkage.

[0119] The nucleoside linkage according to the present invention may be a sooosssssssssssooos linkage, where s is a phosphorothioate nucleoside linkage and o is a phosphodiester nucleoside linkage.

[0120] At least one nucleoside of the oligomer may contain a modified sugar different from that of DNA or RNA. The nucleoside may contain a modified sugar as follows:

[0121] Modifications of substitution at the 2'-carbon position of the sugar structure to 2'-O-methyl (2'-O-Me), 2'-O-methoxyethyl (2'MOE), 2'-O-methoxyethyl-5'methyl, 2'-O-aminoethyl, 5'-methyl, 2'-O-propyl, 2'-methylthioethyl, or 2'-fluoro.

[0122] The nucleoside may be characterized by including a modification selected from the group configured as follows: The modification may include a modification of the sugar moiety, for example, a modification at the 2' carbon position of the sugar structure within the nucleotide, specifically a modification to 2'-O-methyl (2'-O-Me), 2'-O-methoxyethyl (2'MOE), 2'-O-methoxyethyl-5'methyl, 2'-O-aminoethyl, 5'-methyl, 2'-O-propyl, 2'-methylthioethyl, or 2'-fluoro; a modification of the nucleotide bond to a phosphorothioate, boranophosphate, or methylphosphonate; a modification to a PNA (peptide nucleic acid), LNA (locked nucleic acid), or UNA (unlocked nucleic acid) form; and a phosphate group.

[0123] The antisense oligomer according to the present invention may include modifications to 2'-O-methoxyethyl (2'MOE), 2'-O-methoxyethyl-5'methyl, 5'-methyl, or a phosphorothioate bond. At least one nucleoside of the oligonucleotide may have 2'-O-methoxyethyl (2'MOE).

[0124] Each of the nucleosides in the sequence of Sequence ID No. 9 can be modified. For example, the nucleoside linkage can include a modified nucleoside linkage or a modified sugar.

[0125] Specifically, the nucleoside linkage may be a phosphorothioate, boranophosphate, or methylphosphonate linkage.

[0126] The nucleoside linkage according to the present invention may be a sooosssssssssssooos linkage, where s is a phosphorothioate nucleoside linkage and o is a phosphodiester nucleoside linkage.

[0127] The nucleoside may contain sugars that have been modified as follows:

[0128] Modifications of substitution at the 2'-carbon position of the sugar structure to 2'-O-methyl (2'-O-Me), 2'-O-methoxyethyl (2'MOE), 2'-O-methoxyethyl-5'methyl, 2'-O-aminoethyl, 5'-methyl, 2'-O-propyl, 2'-methylthioethyl, or 2'-fluoro.

[0129] The nucleoside may be characterized by including a modification selected from the group configured as follows: The modification may include a modification of the sugar moiety, for example, a modification at the 2' carbon position of the sugar structure within the nucleotide, specifically a modification to 2'-O-methyl (2'-O-Me), 2'-O-methoxyethyl (2'MOE), 2'-O-methoxyethyl-5'methyl, 2'-O-aminoethyl, 5'-methyl, 2'-O-propyl, 2'-methylthioethyl, or 2'-fluoro; a modification of the nucleotide bond to a phosphorothioate, boranophosphate, or methylphosphonate; a modification to a PNA (peptide nucleic acid), LNA (locked nucleic acid), or UNA (unlocked nucleic acid) form; and a phosphate group.

[0130] The oligomers according to the present invention may include modifications to 2'-O-methoxyethyl (2'MOE), 2'-O-methoxyethyl-5'methyl, 5'-methyl, or phosphorothioate bonds.

[0131] At least one nucleoside of the oligomer may be a nucleotide analog in which an additional ring is formed on the sugar portion.

[0132] The modified sugar of at least one nucleoside of the oligomer may be bicyclic (cEt) or LNA (locked nucleic acid).

[0133] "Bicyclic sugar" refers to a furosyl ring that has been modified by the linking of ring atoms on two non-identical carbon atoms. Bicyclic sugars are modified sugars.

[0134] Bicyclic sugars contain 4'-CH(CH3)-O-2' crosslinks. In one example, at least one modified sugar contains 2'-O-methoxyethyl.

[0135] The oligomer is a gap segment consisting of 8 to 12 linked deoxynucleosides;

[0136] A 5' wing segment consisting of 3 to 7 linked nucleosides; and

[0137] It includes a 3' wing segment consisting of 3 to 7 linked nucleosides;

[0138] b. The gap segment is located between the 5' wing segment and the 3' wing segment.

[0139] c. Each nucleoside in each wing segment may be an oligomer containing a modified sugar.

[0140] The oligomer has a gap segment consisting of 20 segments of length and 10 linked deoxynucleosides;

[0141] A 5' wing segment consisting of five linked nucleosides; and

[0142] It includes a 3' wing segment consisting of 5 linked nucleosides;

[0143] The gap segment is located between the 5' wing segment and the 3' wing segment.

[0144] Each nucleoside in each wing segment may be an oligomer containing 2'-O-methoxyethyl sugar (2'-MOE ribose).

[0145] The aforementioned nucleoside linkage is an antisense oligomer consisting of sooossssssssssssooos linkages: s may be a phosphorothioate nucleoside linkage, and o may be a phosphodiester nucleoside linkage.

[0146] The oligomer has a length of 18:

[0147] A gap segment consisting of 8 linked deoxynucleosides,

[0148] A 5' wing segment consisting of five linked nucleosides, and

[0149] It contains a 3' wing segment consisting of 5 linked nucleosides,

[0150] The gap segment is located between the 5' wing segment and the 3' wing segment.

[0151] Each nucleoside in each wing segment may be an oligomer containing 2'-O-methoxyethyl sugar (2'-MOE ribose).

[0152] The aforementioned oligomer has a length of 20:

[0153] A gap segment consisting of 8 linked deoxynucleosides,

[0154] A 5' wing segment consisting of 6 linked nucleosides, and

[0155] It contains a 3' wing segment consisting of 6 linked nucleosides,

[0156] The gap segment is located between the 5' wing segment and the 3' wing segment.

[0157] Each nucleoside in each wing segment may be an oligomer containing 2'-O-methoxyethyl sugar (2'-MOE ribose).

[0158] A "gapmer" refers to a chimeric antisense compound in which an internal region having multiple nucleosides supporting RNase H cleavage is located between each external region having one or more nucleosides, and the nucleosides including the internal region are chemically separated from the nucleosides or nucleosides including each external region. The internal region may be referred to as a "gap segment," and the external regions may be referred to as a "wing segment."

[0159] "Gap-extended" refers to a chimeric antisense compound having gap segments of 12 or more consecutive 2'-deoxyribonucleosides located between the 5' and 3' wing segments, each containing 1 to 6 nucleosides, and immediately adjacent to them.

[0160] In one embodiment, at least one nucleoside may contain a modified nucleic acid base. The modified nucleic acid base may be 5-methylcytosine (5mC).

[0161] Specifically, the antisense oligomer according to the present invention can be selected from the group configured as follows.

[0162] JPEG0007904925000002.jpg20170PS, phosphorothioate;2'MOE, 2'-O-methoxyethyl. A=2'MOE-A, C=2'MOE-5'-methyl-C, G=2'MOE-G, T=2'MOE-T, 5=DNA-A, 6=DNA-5'-methyl-C, 7=DNA-G, 8=DNA-T, *=PS

[0163] Furthermore, the present invention relates to a pharmaceutical composition for the prevention, alleviation, or treatment of neurological diseases, comprising the aforementioned oligomer. Furthermore, the present invention relates to a method for the prevention, alleviation, or treatment of neurological diseases, comprising the step of administering an antisense oligomer to an individual. Furthermore, the present invention relates to a manufacturing application for a composition for the prevention, alleviation, or treatment of neurological diseases, comprising the aforementioned antisense oligomer.

[0164] The oligomer according to the present invention may be an MAO-B inhibitor. The present invention relates to a method for reducing the amount of MAOB mRNA or protein in animals, comprising administering the oligomer according to the present invention to animals to reduce the amount of MAOB mRNA or protein. Through this, oxygen radical formation can be reduced and the amount of useful monoamines in the brain can be increased. In addition, in brain diseases such as Alzheimer's disease and brain injury, MAO-B promotes the putrescine metabolic process in reactive astrocytes, causing the production of excessive GABA. Therefore, the antisense oligomer MAO-B inhibitor according to the present invention can act as an inhibitor of GABA production by astrocytes, and can restore nerve signal transmission and brain function. The aforementioned neurological disorders may include, but are not limited to, Parkinson's disease (PD), Alzheimer's disease (AD), Huntington's disease (HD), amyotrophic lateral sclerosis (ALS), frontotemporal dementia, corticobasal degeneration, or progressive supranuclear palsy (PSP).

[0165] The oligomer according to the present invention may be used for the prevention, alleviation, or treatment of liver disease. Specifically, the liver disease may be fatty liver. The present invention also relates to a pharmaceutical composition for the prevention, alleviation, or treatment of liver disease comprising the oligomer. The present invention also relates to a method for the prevention, alleviation, or treatment of liver disease comprising the step of administering an antisense oligomer to an individual. The present invention also relates to a manufacturing application for a composition for the prevention, alleviation, or treatment of liver disease comprising the antisense oligomer.

[0166] Furthermore, the present invention relates to a pharmaceutical composition for the prevention, reduction, or treatment of obesity, comprising the aforementioned oligomer. Furthermore, the present invention relates to a method for the prevention, reduction, or treatment of obesity, comprising the step of administering an antisense oligomer to an individual. Furthermore, the present invention relates to a manufacturing application for a composition for the prevention, reduction, or treatment of obesity, comprising the aforementioned antisense oligomer.

[0167] In this specification, “treatment” may be used to include all of the following: reduction or improvement of symptoms, reduction of the scope of the disease, delay or mitigation of disease progression, improvement, reduction or stabilization of the disease state, partial or complete recovery, extension of survival, and other favorable treatment outcomes.

[0168] The present invention relates to a composition comprising an oligomer and at least one pharmaceutically acceptable carrier or diluent.

[0169] The aforementioned pharmaceutical composition may be manufactured by further comprising one or more pharmaceutically acceptable carriers in addition to the active ingredient. The pharmaceutically acceptable carrier must be compatible with the active ingredient of the present invention and can be used as a mixture of saline solution, sterile water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, and one or more of these components. Other common additives such as antioxidants, buffers, and bacteriostatic agents may be added as needed. Diluents, dispersants, surfactants, binders, and lubricants may also be added to further formulate the composition into injectable dosage forms such as aqueous solutions, suspensions, and emulsions.

[0170] This includes any pharmaceutically acceptable salt, ester, or salt of such ester, or any other oligomer that, when administered to an animal, including a human, can (directly or indirectly) provide a biologically active metabolite or residue thereof. Thus, for example, this relates to pharmaceutically acceptable salts of antisense oligomers, precursors, pharmaceutically acceptable salts of such precursors, and other bioequivalents. Suitable pharmaceutically acceptable salts include, without limitation, the following: sodium and potassium salts.

[0171] The aforementioned composition and the second formulation can be administered in combination. When the "combined administration" includes the second formulation, it may be a single pharmaceutical composition or a separate pharmaceutical composition. The second formulation may be administered via the same or a different route of administration as the composition. Combined administration includes simultaneous or sequential administration.

[0172] The present invention relates to a method for reducing the amount of MAOB mRNA or protein in an animal, comprising administering a composition according to the present invention to the animal in order to reduce the amount of MAOB mRNA or protein.

[0173] The aforementioned animal may, but is not limited to, humans, primates such as monkeys, dogs, pigs, cattle, sheep, goats, mice, and rats. For example, the aforementioned animal may be a human.

[0174] The method of administering the pharmaceutical composition can be determined by a typical expert in the art based on the symptoms of a typical patient and the severity of the disease.

[0175] The pharmaceutical compositions of the present invention can be administered parenterally. The administration routes of the compositions according to the present invention are not limited to these, but include, for example, oral, intravenous, intramuscular, intraarterial, intramuscular, intradural, intracardiac, transdermal, subcutaneous, intraperitoneal, intestinal, sublingual, or local administration. The pharmaceutical compositions of the present invention can be administered to the central nervous system (CNS). The pharmaceutical compositions of the present invention can be administered by intrathecal injection.

[0176] Depending on the circumstances, the pharmaceutical compositions of the present invention may be administered by intravenous injection or subcutaneous injection.

[0177] The dosage of the composition according to the present invention varies widely depending on the patient's weight, age, sex, health condition, diet, administration time, method, excretion rate, or disease severity, and can be easily determined by a typical expert in the art. Furthermore, for clinical administration, the composition of the present invention can be formulated into an appropriate dosage form using known techniques.

[0178] "Dose" means the specified amount of a pharmaceutical preparation delivered in a single dose or over a specified period. A dose may be administered in one, two, or more boluses, tablets, or injections. For example, in certain embodiments where subcutaneous administration is desired, the desired dose requires a volume that cannot be readily accommodated by a single injection, and the desired dose can be achieved using two or more injections. Drugs may be administered by infusion over a long period or continuously. A dose may be referred to as the amount of a pharmaceutical preparation per hour, day, week, or month.

[0179]

[0180] [Examples]

[0181] The present invention will be described in more detail below through examples. It will be obvious to those ordinary in the art that these examples are for illustrative purposes only and that the scope of the present invention should not be construed as being limited by these examples.

[0182]

[0183] Example 1. MaoB knockdown ASO screening

[0184]

[0185] In Huh7 cell lines, we tested the possibility of suppressing MAOB mRNA expression. Candidates a33-a52 were transformed with 200 nM ASO for 48 hours. As shown in Figures 1a and 1b, candidates A34, A35, and A41 from the a33-a52 candidate group showed significant suppression of MAOB expression (Error bar: 95% confidence interval).

[0186] JPEG0007904925000003.jpg190156

[0187] Example 2. MaoB knockdown lead ASO test

[0188]

[0189] KD testing was performed on the Huh7 cell line. Each ASO was plasma-infected with 200 nM for 48 hours. When the experiment was repeated in Huh7 with candidate groups A34, A35, and A41, which were derived from the screening of candidate groups a33-a52, repeated and effective suppression of MAOB expression was observed, as shown in Figure 2.

[0190]

[0191] Example 3. MaoB ASO KD Test

[0192] 3-1. MaoB ASO KD test in p1 mice

[0193] 25 μg of PBS, control ASO(a114), and MAOB-targeting ASO(a41) were administered intracerebroventricularly to mice in C57BL / J on postnatal day 1 (ICV injection, 2.0 mm ventrally from the skin surface). A 33G needle was used for ICV injection. Eight days after ICV injection, all brains were dissected into the cerebrum, thalamus, and cerebellum. Rneasy mini prep kit (Qiagen) was used for mRNA isolation and purification from ASO-injected mice. SuperScript III First-Strand Synthesis System (Invitrogen) was used for cDNA synthesis. TM) was used. qRT-PCR was PowerUp TM SYBR TM Green Master Mix(AppliedBiosystems TM ), 500 nM primers, and 10 ng of cDNA in ASO-injected brains were used. The following primer sequences were used for qRT-PCR: mMAOB forward: 5-'AGTTGAGCGGCTGATACACT-3', reverse: 5'-TGGCCCATCTCATCCATTGT-3'; GAPDH forward: 5'-TGATGACATCAAGAAGGTGGTGAAG-3', reverse: 5'-TCCTTGGAGGCCATGTAGGCCAT-3'. Relative mRNA expression levels were calculated using the comparative Ct method and normalized to GAPDH mRNA levels.

[0194] As shown in Figure 3a, safety confirmation tests were conducted through survival rate measurements and expression suppression confirmation tests (1 day after birth) after MAOB ASO injection. In an experiment in which candidate ASOs A34, A35, and A41 were injected into C57BL / 6j animals on 1 day after birth to check for any problems with survival, candidate A41 was confirmed to have no problems with survival.

[0195] As shown in Figure 3b, candidate ASOs A34, A35, and A41 were injected into C57BL / 6j animals on postnatal day 1, and MAOB mRNA expression levels were measured. The results confirmed that MAOB mRNA expression was suppressed in the cerebrum, thalamus, and cerebellum of the group injected with A41.

[0196]

[0197] 3-2. MaoB ASO KD Test on APP / PS1 Mouse

[0198]

[0199] 500 μg of control ASO (a114) and ASO-targeting MAOB (a41) were injected intracerebroventricularly into adult C57BL / 6J mice (toxicity and knockdown efficiency tests) and APP / PS1 mice. Mice were anesthetized with vaporized isofran and placed in stereotactic frames (Kopf). The scalp was incised and holes were drilled into the skull of the ventricles (anterior / posterior +0.3 mm, internal / external from the bregma -0.8 mm, dorsal / abdominal from the brain surface, -2.5 mm). ASO (100 μg / μL concentration) was loaded onto a glass needle and injected into the ventricles at a rate of 1 μl / min for 5 minutes (total 5 μl) using a syringe pump (KD Scientific). Adult C57BL / 6J mice were used for knockdown efficiency and toxicity tests. The brains were dissected 2 weeks after injection into the thalamus, cerebrum, and cerebellum. RNA was isolated using Rneasy miniporep kil (Qiagen). cDNA was synthesized from mRNA using oligodT primers and the SuperScript III First-Strand Synthesis System (Invitrogen) kit. Gene expression levels were measured by qRT-PCR of 10 ng of cDNA using PowerUp SYBR Green Master Mix (Applied Biosystems). APP / PS1 mice were used for behavioral studies and electrophysiology for more than two weeks after injection.

[0200] Figure 4a shows the results of safety confirmation experiments and expression suppression confirmation experiments conducted on adult animals after MAOB ASO injection, through survival rate measurements. When candidate A41 ASO was injected into C57BL / 6j animals for 12 months and MAOB mRNA expression levels were measured, it was confirmed that MAOB mRNA expression was suppressed in the cerebrum, thalamus, and cerebellum.

[0201]

[0202] Prior to the passive avoidance test, the mice were handled by the experimenter daily for seven days. In the passive avoidance test, the mice were placed in a two-compartment shuttle chamber (light and dark) equipped with a constant current shock generator (Scitech). On acquisition day, the mouse was placed in the corner of the light chamber for 60 seconds (habituation), and the shutter between the two chambers was opened. As the mouse passed through the shutter, it closed immediately, transmitting an aversive electric shock (0.5 mA, 2 seconds) to the grid floor. After the shock, the mouse was returned to its cage, and the holding test was performed 24 hours after the acquisition test. For the maintenance test, the mouse was placed in the corner of the light chamber, and the shutter was opened after one minute. The waiting time before entering the dark chamber was automatically recorded up to a maximum of 540 seconds.

[0203] Figure 4b shows the results of an experiment on memory recovery through MAOB ASO injection in an Alzheimer's model. Injection of MAOB ASO A41 into the Alzheimer's animal model APP / PS1 confirmed that reduced memory function recovered to a level similar to that of the normal group.

[0204]

[0205] 3-3. MaoB ASO KD test (tonic GABA recording) on ​​APP / PS1 mouse

[0206]

[0207] Brain slices were prepared from APP / PS1 transgenic mice and wild littermates approximately 13–16 months old. Mice were deeply anesthetized with isofran. After anesthesia, the brains were rapidly removed from the skull and precipitated in an ice-cold NMDG-based cutting solution containing 93 mM NMDG, 2.5 mM KCl, 1.2 mM NaH2PO4, 30 mM NaHCO3, 20 mM HEPES, 25 mM glucose, 5 mM sodium ascorbate, 2 mM thiourea, 3 mM sodium pyruvate, 10 mM MgSO4, and 0.5 mM CaCl2. (Sodium ascorbate, 2 mM thiourea, 3 mM sodium pyruvate, 10 mM MgSO4, 0.5 mM CaCl2 (pH adjusted with 300 mOsm–310 mOsm, 10 N HCl)).

[0208] The cutting fluid was gas-treated with 95% O2 and 5% CO2. Hippocampal slices were obtained by vibrating a microtome (DSK, Linearslicer 7N) with coronal hippocampal sections 300 μm thick and maintained at room temperature in an aqueous chamber containing extracellular artificial cerebrospinal fluid.

[0209] Liquid (aCSF) solutions (126 mM NaCl, 24 mM NaHCO3, 1 mM NaH2PO4, 2.5 mM KCl, 2.5 mM CaCl2, 2 mM MgCl2, and 10 mM D-(+)-glucose (pH 7.4)) were gas-treated with 95% O2 and 5% CO2. Slices were incubated in aCSF at room temperature for at least 1 hour before recording. Whole cell patch-clamp recordings were generated from the cell bodies of granule cells in DG. The maintenance potential was -70 mV. The pipette resistance was typically 5-7 megaohms, and the internal solution was adjusted to 135 mM CsCl, 4 mM NaCl, 0.5 mM CaCl2, 10 mM Hepes, 5 mM EGTA, 2 mM Mg-adenosine triphosphate, 0.5 mM Na2-guanosine triphosphate, and 10 mM QX-314, CsOH (278 mOsm-285 mOsm) 7.2. Before measuring the tonic current, the baseline current was stabilized with d-AP5 (50 μM) and 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX, 20 μM). The amplitude of the tonic GABA current was measured using the Clampfit program by shifting the baseline after administration of bicuculline (100 mM). The tonic current was measured from the baseline to the bicuculline-treated current.

[0210]

[0211] Figure 5a shows the results of an experiment measuring tonic GABA levels via MAOB ASO injection in an Alzheimer's model. When MAOB ASO A41 was injected into the Alzheimer's animal model APP / PS1, a tonic GABA level of approximately 3.2 pA was measured. This is a relatively low amount compared to the tonic GABA levels measured in existing, identical Alzheimer's animal models, as shown in Figure 5b.

[0212]

[0213] 3-4. Mao BASO KD test (measurement of body weight change) in mice fed a high-fat diet.

[0214]

[0215] All experiments conducted using the high-fat diet mouse model utilized C57BL / 6J background mice derived from Jackson Laboratory (stock number 000664) in the United States. Six-week-old male C57BL / 6J mice (DBL, Chungcheongbuk-do, South Korea) were fed either a high-fat diet (60% kcal fat, D12492, Research Diets Inc.) or a general diet (Teklad, 2018S, Envigo) for 6 to 23 weeks. PBS and 3.5 mg / kg of ASO (a143) were used as the control group, while MAOB-targeting ASO (a41 with GalNAc conjugation) was used. High-fat diet mice were anesthetized with vaporized isofran, and 200 μl of ASO (3.5 mg / kg concentration) was injected subcutaneously using a syringe loaded with ASO while holding the mice by the neck. During the total observation period of 5 weeks, injections were administered twice, at week 0 and week 2. Body weight was measured once a week from week 0 to week 5.

[0216] Figure 6a shows the experimental results of weight loss effects through MAOB ASO injection in fatty liver and obesity models. In high-fat diet mice, which serve as animal models for fatty liver and obesity, injection of MAOB-targeting ASO resulted in a significant reduction in body weight compared to the control group.

[0217]

[0218] 3-5. MaoB ASO KD test (fatty liver phenotype) in high-fat diet (HFD) mice

[0219]

[0220] Each mouse used in steps 3-4 was deeply anesthetized with isofran at 5 weeks, and its organs were immediately isolated. Liver tissue was fixed overnight with 4% PFA for further processing. Histological changes in lipid droplets were confirmed through hematoxylin and eosin (H&E) staining. Mayer's hematoxylin was used as a control stain for all slides.

[0221] A significant increase in triglycerides was observed in the livers of mice fed a high-fat diet, a trait similar to that of fatty liver disease. Figure 6b shows the experimental results of the fatty liver recovery effect of MAOB ASO injection in high-fat diet mice. Injection of MAOB-targeting ASO into high-fat diet mice resulted in a significant decrease in triglycerides compared to the control group.

[0222] [Industrial applicability]

[0223] According to the present invention, by reducing the amount of mRNA or protein encoding monoamine oxidase B, it can be effectively used to prevent, alleviate, or treat neurological or liver diseases.

[0224]

[0225] Although specific aspects of the present invention have been described in detail above, it will be clear to those with ordinary skill in the art that such specific descriptions are merely preferred embodiments and do not limit the scope of the invention. Therefore, the substantial scope of the present invention is defined by the appended claims and their equivalents.

[0226] [Sequence Listing Free Text]

[0227] I attached an electronic file.

Claims

1. This oligomer suppresses MAOB gene expression through hybridization with the MAOB pre-mRNA sequence described in Sequence ID No.

41. The oligomer is capable of hybridization via Watson-Crick pairing with at least 20 consecutive nucleic acid bases from a sequence selected from the group consisting of Sequence IDs 1 to 19, and the oligomer has a length of 20 nt to 35 nt.

2. The oligomer according to claim 1, wherein the oligomer is capable of hybridization with at least 20 consecutive nucleic acid bases from a sequence selected from the group consisting of Sequence IDs 2, 3, and 9 via Watson-Crick type base pairing, and has a length of 20 nt to 35 nt.

3. The oligomer according to claim 1, wherein the oligomer is capable of hybridization with at least 20 consecutive nucleic acid bases from the sequence of sequence number 9 via Watson-Crick type base pairing, and has a length of 20 nt to 35 nt.

4. The oligomer described above has the following sequence and chemical structure, as described in claim 1: T*GAAC*6*6*5*5*5*7*7*6*5*6*ACGA*G; G*ATCA*6*5*7*7*6*6*8*6*8*6*CAGC*T; or C*ACTA*5*8*6*5*6*5*8*5*8*8*TAGC*C, Here, PS stands for phosphorothioate; 2'MOE, 2'-O-methyl. A = 2'MOE-A, C = 2'MOE-5'-methyl-C, G = 2'MOE-G, T = 2'MOE-T, 5 = DNA-A, 6 = DNA-5'-methyl-C, 7 = DNA-G, 8 = DNA-T, and * = PS.

5. The oligomer described above has the following sequence and chemical structure, as described in claim 1: C*ACTA*5*8*6*5*6*5*8*5*8*8*TAGC*C, Here, PS stands for phosphorothioate; 2'MOE, 2'-O-methyl. A = 2'MOE-A, C = 2'MOE-5'-methyl-C, G = 2'MOE-G, T = 2'MOE-T, 5 = DNA-A, 6 = DNA-5'-methyl-C, 7 = DNA-G, 8 = DNA-T, and * = PS.

6. The oligomer according to claim 1, comprising GalNAc (N-acetylgalactosamine).

7. The oligomer according to claim 6, wherein trivalent GalNAc (N-acetylgalactosamine) is linked to the 5' or 3' terminal phosphate of the oligomer.

8. A composition comprising a salt of an oligomeric compound according to any one of claims 1 to 7 and at least one pharmaceutically acceptable carrier or diluent.

9. The composition according to claim 8, wherein the salt is a sodium salt or a potassium salt.

10. The composition according to claim 8, for the prevention, alleviation, or treatment of neurological disorders.

11. The composition according to claim 10, wherein the neurological disease is Alzheimer's disease.

12. The composition according to claim 8, for the prevention, alleviation, or treatment of liver disease.

13. The composition according to claim 12, wherein the liver disease is fatty liver.

14. The composition according to claim 8, for the prevention, alleviation, or treatment of metabolic diseases.

15. The composition according to claim 14, wherein the metabolic disorder is obesity.

Citation Information

Patent Citations

  • Alpha-aminoamide derivative compound and pharmaceutical composition comprising same

    US20170298011A1

  • Haloallylamine dual amine oxidase inhibitors

    WO2021258159A1