Method for producing vertebral plate cells and utilization of said vertebral plate cells

JP7905109B2Active Publication Date: 2026-08-14OSAKA UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Filing Date
2022-03-14
Publication Date
2026-08-14

AI Technical Summary

Benefits of technology

【0008】 本発明により、多能性幹細胞からゼノフリーかつフィーダーフリー培養系で椎板細胞を簡便に製造することができる。本発明により製造された椎板細胞は、軟骨誘導因子を含まない軟骨形成基本培地を用いて三次元培養することにより軟骨組織を製造することができ、さらに骨誘導因子を含まない骨形成基本培地を用いて三次元培養することにより軟骨内骨化組織を製造することができる。また、本発明により、軟骨形成制御物質および骨形成制御物質をスクリーニングすることができる。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007905109000001
    Figure 0007905109000001
  • Figure 0007905109000002
    Figure 0007905109000002
  • Figure 0007905109000003
    Figure 0007905109000003
Patent Text Reader

Abstract

The present invention provides a method for producing sclerotome cells from pluripotent stem cells in a xeno-free and feeder-free culture system. This method comprises: (1) a step for culturing pluripotent stem cells in a first differentiation culture medium that contains only a Wnt signal activation agent as an induction factor; (2) a step for switching the cells cultured in step (1) into a second differentiation culture medium that contains only a Wnt signal activation agent, TGFβ signal inhibitor, and BMP signal inhibitor as induction factors, and culturing; (3) a step for switching the cells cultured in step (2) into a third differentiation culture medium containing only a Wnt signal inhibitor, TGFβ signal inhibitor, and BMP signal inhibitor as induction factors, and culturing; and (4) a step for switching the cells cultured in step (3) into a fourth differentiation culture medium containing, as induction factors, only a hedgehog signal activation agent and at least one selection from the group consisting of BMP signal inhibitors and Wnt signal inhibitors, and culturing.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a method for producing vertebral plate cells from pluripotent stem cells and the use of the produced vertebral plate cells.

Background Art

[0002] [[ID=1eleven]] In the early stage of development, after being divided into groups of ectoderm, mesoderm, and endoderm, the organs and tissues that each group is responsible for are formed. The mesoderm from which bone and cartilage tissues are derived is the axial mesoderm and the lateral plate mesoderm. These originate from the primitive streak that develops following gastrulation. The axial mesoderm differentiates into somites and vertebral plates, and further differentiates into the bones, cartilage, ligaments, and tendons of the trunk. Therefore, it is considered that if a differentiation induction system that follows the above process is developed from pluripotent stem cells, the physiological skeletal development process can be reproduced in vitro.

[0003] On the other hand, when producing target cells or tissues from pluripotent stem cells, there are concerns regarding safety and cost due to the use of a medium to which components of unknown exact composition (for example, fetal bovine serum) are added, and the use of gene introduction or recombinant proteins as differentiation inducing factors. As a method for producing various cells and tissues using pluripotent stem cells, it is ideal to use a method that uses only known components and uses economical and safe low molecular weight compounds.

[0004] ​​​​​​​​​​​​​​Kanke K et al., Stem Cell Reports. 2014 May 22;2(6):751-60. doi: 10.1016 / j.stemcr.2014.04.016. [Non-Patent Document 2] Zujur D et al., Sci Adv. 2017 May 12;3(5):e1602875. doi: 10.1126 / sciadv.1602875. [Overview of the project] [Problems that the invention aims to solve]

[0006] The present invention aims to provide a simple method for producing vertebral plate cells from pluripotent stem cells in a xeno-free and feeder-free culture system. Furthermore, the present invention aims to provide a method for screening chondrogenesis-regulating substances and bone formation-regulating substances. [Means for solving the problem]

[0007] [1] A method for producing vertebral plate cells from pluripotent stem cells in a xeno-free and feeder-free culture system, comprising the following steps (1) to (4): (1) A step of culturing pluripotent stem cells in a first differentiation medium containing only a Wnt signaling activator as an inductive factor; (2) A step of replacing the cells cultured in step (1) with a second differentiation medium containing only a Wnt signaling activator, a TGFβ signaling inhibitor, and a BMP signaling inhibitor as inductive factors and culturing them; (3) A step of replacing the cells cultured in step (2) with a third differentiation medium containing only a Wnt signaling inhibitor, a TGFβ signaling inhibitor, and a BMP signaling inhibitor as inductive factors and culturing them; and (4) A step of replacing the cells cultured in step (3) with a fourth differentiation medium containing only a Hedgehog signaling activator and at least one selected from the group consisting of a BMP signaling inhibitor and a Wnt signaling inhibitor as an inductive factor and culturing them. [2] The method according to [1], wherein the inducing factor is not a recombinant protein. [3] The method according to [1] or [2], wherein DMEM / F12 medium supplemented with 0-2% ITS supplement, 0-2% NEAA, 0-100 μM 2-mercaptoethanol and 0-2% B27 serum-free supplement is used as the basal medium. [4] The method according to any one of [1] to [3], wherein the culture period of step (1) is until it is confirmed that the cells express at least one marker selected from the group consisting of TBXT and MIXL1, the culture period of step (2) is until it is confirmed that the cells express at least one marker selected from the group consisting of TBX6 and MSGN1, the culture period of step (3) is until it is confirmed that the cells express at least one marker selected from the group consisting of PARAXIS, PAX3 and FOXC2, and the culture period of step (4) is until it is confirmed that the cells express at least one marker selected from the group consisting of PAX1, PAX9, SOX9 and NKX3.2. [5] The method according to any one of [1] to [4], wherein the culture time for each of steps (1) to (3) is 12 to 36 hours, and the culture time for step (4) is 36 to 84 hours. [6] The method according to any one of [1] to [5] above, wherein the vertebral plate cells are for living transplantation. [7] A method for producing endochondral ossification tissue, comprising the steps of producing vertebral plate cells by any of the methods described in [1] to [6] above, transplanting the obtained vertebral plate cells into a mammal other than a human, and excising tissue derived from the transplanted vertebral plate cells from the mammal. [8] A method for producing cartilage tissue, comprising the steps of producing vertebral plate cells by any of the methods described in [1] to [6] above, and culturing the obtained vertebral plate cells in a cartilage-forming basic medium that does not contain cartilage-inducing factors in a three-dimensional manner. [9] A method for producing endochondral ossification tissue, comprising the steps of: producing vertebral plate cells by any method described in [1] to [6] above; three-dimensionally culturing the obtained vertebral plate cells in a basal culture medium for cartilage formation with or without cartilage-inducing factors to produce cartilage tissue; and three-dimensionally culturing the cartilage tissue in a basal culture medium for bone formation with or without bone-inducing factors.

[10] A method for screening chondrogenesis control substances, comprising the steps of: producing vertebral plate cells by any of the methods described in [1] to [6] above; culturing the obtained vertebral plate cells in three dimensions in the presence or absence of a test substance using a basic chondrogenesis medium that does not contain cartilage-inducing factors to form cartilage tissue; and selecting a test substance that increases or decreases the amount of cartilage in the cartilage tissue compared with cartilage tissue formed in the absence of the test substance.

[11] A method for screening chondrogenesis-regulating substances, comprising the steps of: producing vertebral disc cells by any of the methods described in [1] to [6] above; transplanting the obtained vertebral disc cells into a mammal other than a human; administering a test substance to the mammal; excising tissue derived from the transplanted vertebral disc cells from the mammal; and selecting a test substance that increases or decreases the amount of cartilage in the transplanted tissue by comparing it with transplanted tissue excised from a mammal that has not been administered the test substance.

[12] A method for screening chondrogenesis-regulating substances, comprising the steps of: producing vertebral disc cells by any of the methods described in [1] to [6] above; transplanting the obtained vertebral disc cells into a mammal other than a human; excising tissue derived from the transplanted vertebral disc cells from the mammal and transferring it to a culture system; contacting the transplanted tissue with a test substance; and selecting a test substance that increases or decreases the amount of cartilage in the transplanted tissue compared with transplanted tissue that has not been in contact with the test substance.

[13] A method for screening for bone formation control substances, comprising the steps of: producing vertebral plate cells by any of the methods described in [1] to [6] above; three-dimensional culturing of cartilage tissue differentiated from the obtained vertebral plate cells using a basic osteogenic medium in the presence or absence of the test substance to form bone tissue; and selecting a test substance that increases or decreases bone mass in the bone tissue by comparing it with bone tissue formed in the absence of the test substance.

[14] A method for screening bone formation-regulating substances, comprising the steps of: producing vertebral plate cells by any of the methods described in [1] to [6] above; transplanting the obtained vertebral plate cells into a mammal other than a human; administering a test substance to the mammal; excising tissue derived from the transplanted vertebral plate cells from the mammal; and selecting a test substance that increases or decreases the bone mass of the transplanted tissue by comparing it with transplanted tissue excised from a mammal that has not been administered the test substance.

[15] A method for screening bone formation-regulating substances, comprising the steps of: producing vertebral plate cells by any of the methods described in [1] to [6] above; transplanting the obtained vertebral plate cells into a mammal other than a human; excising tissue derived from the transplanted vertebral plate cells from the mammal and transferring it to a culture system; contacting the transplanted tissue with a test substance; and selecting a test substance that increases or decreases the bone mass of the transplanted tissue compared with transplanted tissue that has not been in contact with the test substance.

[16] A method for screening for bone formation regulatory substances, comprising the steps of: producing vertebral plate cells by any of the methods described in [1] to [6] above; three-dimensional culturing of cartilage tissue differentiated from the obtained vertebral plate cells using a basic osteogenic medium in the presence or absence of the test substance to form bone tissue; and selecting a test substance that increases or decreases the ZEB2 expression level in bone tissue by comparing it with bone tissue formed in the absence of the test substance.

[17] A method for screening bone formation control substances according to

[16] , comprising the step of selecting a test substance that simultaneously increases or decreases the expression levels of ZEB2 and RUNX2, or ZEB2 and SP7, or ZEB2, RUNX2 and SP7, in bone tissue formed in the presence of the test substance, compared to bone tissue formed in the absence of the test substance.

[18] A method for screening bone formation regulatory substances, comprising the steps of: producing vertebral disc cells by the method according to any one of claims 1 to 6; transplanting the obtained vertebral disc cells into a mammal other than a human; administering a test substance to the mammal; excising tissue derived from the transplanted vertebral disc cells from the mammal; and selecting a test substance that increases or decreases the ZEB2 expression level of the transplanted tissue by comparing it with transplanted tissue excised from a mammal that has not been administered the test substance.

[19] A method for screening bone formation-regulating substances according to

[18] , comprising the step of selecting a test substance that simultaneously increases or decreases the expression levels of ZEB2 and RUNX2, or ZEB2 and SP7, or ZEB2, RUNX2 and SP7, in transplant tissue excised from a mammal administered with the test substance, compared to transplant tissue excised from a mammal not administered with the test substance.

[20] A method for screening bone formation regulatory substances, comprising the steps of: producing vertebral disc cells by any of the methods described in [1] to [6] above; transplanting the obtained vertebral disc cells into a mammal other than a human; excising tissue derived from the transplanted vertebral disc cells from the mammal and transferring it to a culture system; contacting the transplanted tissue with a test substance; and selecting a test substance that increases or decreases the ZEB2 expression level of the transplanted tissue compared with transplanted tissue that has not been in contact with the test substance.

[21] A method for screening bone formation-regulating substances according to

[20] , comprising the step of selecting a test substance that simultaneously increases or decreases the expression levels of ZEB2 and RUNX2, or ZEB2 and SP7, or ZEB2, RUNX2, and SP7 in transplant tissue that has come into contact with the test substance, compared to transplant tissue that has not come into contact with the test substance. [Effects of the Invention]

[0008] The present invention enables the simple production of vertebral disc cells from pluripotent stem cells in a xeno-free and feeder-free culture system. The vertebral disc cells produced by this invention can be used to produce cartilage tissue by three-dimensional culture using a cartilage-forming basal medium that does not contain cartilage-inducing factors, and further, endochondral ossification tissue can be produced by three-dimensional culture using a bone-forming basal medium that does not contain bone-inducing factors. Furthermore, the present invention allows for the screening of cartilage-forming regulatory substances and bone-forming regulatory substances. [Brief explanation of the drawing]

[0009] [Figure 1]This figure shows the results of measuring the mRNA expression levels of marker genes (PAX1, PAX9, and Nkx3.2) in vertebral plate cells obtained from human iPS cell strains Col2.3-Cherry(COL), 201B7, and NiPS strains, as well as human ES cell strain SEES3, using the production method of the present invention or a conventional method (as described by Loh et al. (Cell. 2016 Jul 14;166(2):451-467. doi: 10.1016 / j.cell.2016.06.011.)). [Figure 2] This figure shows images of calcified tissue at the transplantation site, obtained by X-ray micro-CT at time from 4 to 26 weeks after transplantation, after transplantation of vertebral plate cells obtained from human iPS cells using the manufacturing method of the present invention into the renal capsule of NOD SCID mice. [Figure 3] This figure shows the results of observing hematoxylin-eosin stained (HE stained) specimens of calcified tissue at the transplantation site 8 or 18 weeks after transplantation, following transplantation of vertebral plate cells obtained from human iPS cells or human ES cells using the manufacturing method of the present invention into the renal capsule of NOD SCID mice. [Figure 4] This figure shows the results of observing HE-stained and safranin O-stained specimens of calcified tissue at the transplantation site 18 weeks after transplantation, following transplantation of vertebral plate cells obtained from human iPS cells using the manufacturing method of the present invention under the renal capsule of NOD SCID mice. [Figure 5] This figure shows the results of observing immunostained specimens of calcified tissue at the transplantation site 18 weeks after transplantation, following transplantation of vertebral plate cells obtained from human iPS cells using the manufacturing method of the present invention under the renal capsule of NOD SCID mice. [Figure 6] This figure shows the results of observing oil red O stained specimens of calcified tissue at the transplantation site 18 weeks after transplantation, following transplantation of vertebral plate cells obtained from human iPS cells using the manufacturing method of the present invention under the renal capsule of NOD SCID mice. [Figure 7] This figure shows the results of observing HE-stained specimens of cell aggregates (Day 42) cultured in a basic chondrogenic medium containing chondrogenic factors or a basic chondrogenic medium without chondrogenic factors, using the manufacturing method of the present invention to obtain vertebral plate cells (Day 5) from human ES cells. [Figure 8] This figure shows the results of observing safranin O-stained specimens and von Kossa-stained specimens of cell masses obtained by culturing lamina cells (Day 5) obtained from human ES cells by the production method of the present invention in a chondrogenic basal medium containing a bone induction factor, replacing the medium with a bone formation basal medium without the bone induction factor on Day 42, and culturing until Day 70. [Figure 9] This figure shows the results of observing safranin O-stained specimens and von Kossa-stained specimens of cell masses obtained by culturing lamina cells (Day 5) obtained from human ES cells by the production method of the present invention in a chondrogenic basal medium with or without a bone induction factor, replacing the medium with a bone formation basal medium containing the bone induction factor on Day 42, and culturing until Day 70. [Figure 10] This figure shows X-ray images of cell masses on Day 100 obtained by culturing lamina cells (Day 5) obtained from human ES cells by the production method of the present invention in a chondrogenic basal medium with or without a cartilage induction factor and culturing in a bone formation basal medium with or without a bone induction factor on Day 42. [Figure 11] This figure shows the results of comparing the number of lamina cells obtained from human ES cells by the production method of the present invention using the synthetic medium of Example 1 with the number of lamina cells obtained by inducing differentiation from human ES cells using a medium containing fetal bovine serum. [Figure 12] Lamina cells obtained from human iPS cells or human ES cells by the production method of the present invention were transplanted under the renal capsule of NOD SCID mice. Single-cell RNA sequencing analysis was performed on human iPS cell-derived endochondral ossification tissue collected 7 weeks and 19 weeks after transplantation, and multi-omics analysis was performed on human ES cell-derived endochondral ossification tissue collected 20 weeks after transplantation to show the results of searching for novel bone formation transcription factors. [Figure 13] This figure shows the results of infecting human mesenchymal stem cells with a lentivirus expressing shRNA against ZEB2 and culturing them, and comparing the expression levels of ZEB2, RUNX2, and SP7 genes at the start of osteoblast differentiation induction and 14 days after differentiation induction with the expression levels of cells in the control shRNA-expressing lentivirus-infected group. [Figure 14]This figure shows the results of comparing the expression levels of the ZEB2, RUNX2, and SP7 genes at the start of osteoblast differentiation induction and 14 days after differentiation induction in human mesenchymal stem cells infected with a retrovirus expressing the ZEB2 gene, with those of cells infected with a GFP-expressing retrovirus. [Modes for carrying out the invention]

[0010] [Method for producing vertebral plate cells] The present invention provides a method for producing vertebral disc cells from pluripotent stem cells in a xeno-free and feeder-free culture system (hereinafter referred to as "the production method of the present invention"). The vertebral disc (sclerotome) is also called the sclerotome. The production method of the present invention may include the following steps (1) to (4). (1) A step of culturing pluripotent stem cells in a first differentiation medium containing only a Wnt signaling activator as an inducing factor. (2) A step in which the cells cultured in step (1) are cultured in a second differentiation medium containing only a Wnt signaling activator, a TGFβ signaling inhibitor, and a BMP signaling inhibitor as inducing factors. (3) A step of replacing the cells cultured in step (2) with a third differentiation medium containing only Wnt signaling inhibitors, TGFβ signaling inhibitors, and BMP signaling inhibitors as inducing factors and culturing them, and (4) A step of replacing the cells cultured in step (3) with a fourth differentiation medium containing only one selected from the group consisting of a Hedgehog signaling activator and a BMP signaling inhibitor and a Wnt signaling inhibitor as an inductive factor, and culturing them.

[0011] The pluripotent stem cells usable in the manufacturing method of the present invention are stem cells that possess pluripotency, enabling differentiation into all cells present in the body, and also possess proliferative capacity. Examples include induced pluripotent stem (iPS) cells, embryonic stem (ES) cells, embryonic stem (ntES) cells derived from cloned embryos obtained by nuclear transfer, sperm stem (GS) cells, embryonic germ (EG) cells, cultured fibroblasts, and pluripotent cells (Muse cells) derived from bone marrow stem cells. Preferred pluripotent stem cells are iPS cells or ES cells.

[0012] iPS cells are artificial stem cells derived from somatic cells that can be created by introducing specific reprogramming factors into somatic cells in the form of DNA or protein, and possess characteristics nearly equivalent to those of ES cells, such as pluripotency and the ability to proliferate through self-renewal (K. Takahashi and S. Yamanaka (2006) Cell, 126:663-676; K. Takahashi et al. (2007), Cell, 131:861-872; J. Yu et al. (2007), Science, 318:1917-1920; Nakagawa, M. et al., Nat. Biotechnol. 26:101-106 (2008); International Publication WO 2007 / 069666).

[0013] iPS cells can be derived from various iPS cell lines established by institutions such as the National Institutes of Health (NIH), RIKEN, and Kyoto University. For example, human iPS cell lines include RIKEN's HiPS-RIKEN-1A, HiPS-RIKEN-2A, HiPS-RIKEN-12A, and Nips-B2, and Kyoto University's AK5, TkDN-Sev2, 692D2, 253G1, 201B7, 409B2, 454E2, 606A1, 610B1, 648A1, 1231A3, 1390D4, and 1390C1. Alternatively, clinical-grade cell lines provided by Kyoto University or Cellular Dynamics International, as well as research and clinical cell lines created using those cell lines, may be used.

[0014] ES cells are stem cells that are established from the inner cell mass of early embryos (e.g., blastocysts) of mammals such as humans and mice, and possess pluripotency and the ability to proliferate through self-renewal. ES cells are embryo-derived stem cells that originate from the inner cell mass of the blastocyst, which is the 8-cell stage of a fertilized egg, after the morula stage. They possess the ability to differentiate into any cell that makes up an adult, known as pluripotency, and the ability to proliferate through self-renewal. ES cells were discovered in mice in 1981 (MJ Evans and MH Kaufman (1981), Nature 292:154-156), and subsequently, ES cell lines were established in primates such as humans and monkeys (JA Thomson et al. (1998), Science 282:1145-1147; JA Thomson et al. (1995), Proc. Natl. Acad. Sci. USA, 92:7844-7848; JA Thomson et al. (1996), Biol. Reprod., 55:254-259; JA Thomson and VS Marshall (1998), Curr. Top. Dev. Biol., 38:133-165).

[0015] For mouse ES cells, various mouse ES cell lines established by inGenious, RIKEN, and others are available. For human ES cells, various human ES cell lines established by the National Institutes of Health (NIH), RIKEN, Kyoto University, and Cellartis are available. For example, ES cell lines such as NIH's CHB-1 to CHB-12, RUES1, RUES2, and HUES1 to HUES28, WisCell Research Institute's WA01(H1) and WA09(H9), and RIKEN's KhES-1, KhES-2, KhES-3, KhES-4, KhES-5, SSES1, SSES2, and SSES3 can be used. In addition, KhES-1, KhES-2, KhES-3, and KhES11 are available from the Institute for Virus Research and Regenerative Medicine, Kyoto University.

[0016] In step (1), pluripotent stem cells are cultured in a first differentiation medium containing only a Wnt signaling activator as an inductive factor. The basal medium for differentiation can be, for example, DMEM / F12 or DMEM, but is not limited to these. The basal medium may also contain insulin-transferrin-sodium selenite (ITS) supplement, non-essential amino acids (NEAA), 2-mercaptoethanol, or B27 serum-free supplement. The concentration of the ITS supplement is usually 0% to 2%, preferably about 1%. The concentration of NEAA is usually 0% to 2%, preferably about 1%. The concentration of 2-mercaptoethanol is usually 0 μM to 100 μM, preferably about 55 μM. The concentration of B27 serum-free supplement is usually 0% to 2%, preferably about 1%. The same basal medium can be used from step (1) to step (4).

[0017] Examples of Wnt signaling activators include CHIR99021 (CHIR, CAS No. 252917-06-9), CHIR98014 (CAS No. 252935-94-7), WAY-316606 (CAS No. 915759-45-4), IQ-1 (CAS No. 331001-62-8), QS11 (CAS No. 944328-88-5), SB216763 (CAS No. 280744-09-4), BIO (CAS No. 667463-62-9), LY2090314 (CAS No. 603288-22-8), TWS119 (CAS No. 601514-19-6), and Tideglusib (CAS No. Examples include 865854-05-3) and SB415286 (CAS No. 264218-23-7). The Wnt signaling activator is preferably not a recombinant protein. When CHIR is used as the Wnt signaling activator, its concentration is usually 0.01 μM to 30 μM, preferably about 5 μM.

[0018] Pluripotent stem cells maintained in culture according to a standard method are dispersed into single cells or microclamps, and a cell dispersion prepared using maintenance medium is seeded onto a plate and cultured overnight. Then, the medium is changed to the first differentiation medium to start step (1). Alternatively, pluripotent stem cells maintained in culture according to a standard method may be dispersed into single cells or microclamps, and a cell dispersion prepared using the first differentiation medium may be seeded onto a plate to start step (1).

[0019] Step (1) is a step in which pluripotent stem cells are differentiated into the anterior primitive streak. Differentiation into the anterior primitive streak can be confirmed by the expression of at least one of the anterior primitive streak markers, TBXT (T-box transcription factor T) and MIXL1 (Mix paired-like homeobox). Therefore, it is preferable to continue step (1) until the expression of at least one of TBXT and MIXL1 is confirmed. Marker expression can be confirmed by known methods such as RT-PCR and Western blotting. For example, the nucleotide and amino acid sequences of human TBXT, human TBX6, and human MIXL1 can be obtained using the following NCBI accession numbers. Human TBXT: nucleotide sequence NM_003181.4, amino acid sequence NP_003172.1 Human MIXL1: Base sequence NM_001282402.2, amino acid sequence NP_001269331.1

[0020] The incubation time in step (1) may be 12 hours, 14 hours, 16 hours, 18 hours, 20 hours, 22 hours or more. Alternatively, the incubation time in step (1) may be 36 hours, 34 hours, 32 hours, 30 hours, 28 hours, 26 hours or less. Preferably, it is about 24 hours.

[0021] In step (2), the cells cultured in step (1) are cultured in a second differentiation medium containing only a Wnt signaling activator, a TGFβ signaling inhibitor, and a BMP signaling inhibitor as inducing factors. The same Wnt signaling activator used in the first differentiation medium may be used. Examples of TGFβ signaling inhibitors include A83-01 (CAS No. 909910-43-6), LY364947 (CAS No. 396129-53-6), SB431542 (CAS No. 301836-41-9), LY2157299 (CAS No. 700874-72-2), LY2109761 (CAS No. 700874-71-1), SB525334 (CAS No. 356559-20-1), SB505124 (CAS No. 694433-59-5), GW788388 (CAS No. 452342-67-5), and 616453 (CAS No. 356559-13-2). Examples of BMP signaling inhibitors include LDN-193189 (CAS No. 1062368-24-4), Dorsomorphin (CAS No. 866405-64-3), DMH1 (CAS No. 1206711-16-1), and K02288 (CAS No. 1431985-92-0). It is preferable that the Wnt signaling activator, TGFβ signaling inhibitor, and BMP signaling inhibitor are not recombinant proteins. When CHIR is used as the Wnt signaling activator, its concentration is usually 0.01 μM to 30 μM, preferably about 5 μM. When A83-01 is used as the TGFβ signaling inhibitor, its concentration is usually 0.01 μM to 10 μM, preferably about 1 μM. When LDN-193189 is used as the BMP signaling inhibitor, its concentration is usually 0.005 μM to 2 μM, preferably about 0.25 μM.

[0022] Step (2) is initiated by replacing the first differentiation medium with the second differentiation medium. The cells may be washed with PBS or similar during the medium change. Step (2) is the process of differentiating the anterior primitive streak into the paraxial mesoderm. Differentiation into the paraxial mesoderm can be confirmed by the expression of at least one of the paraxial mesoderm markers, TBX6 (T-box transcription factor 6) and MSGN1 (mesogenin-1). Therefore, it is preferable to continue step (2) until the expression of at least one of TBX6 and MSGN1 is confirmed. Marker expression can be confirmed by known methods such as RT-PCR and Western blotting. For example, the nucleotide and amino acid sequences of human TBX6 and human MSGN1 can be obtained using the following NCBI accession numbers. Human TBX6: Base sequence NM_004608.4, amino acid sequence NP_004599.2 Human MSGN1: Nucleotide sequence NM_001105569.3, amino acid sequence NP_001099039.1

[0023] The incubation time in step (2) may be 12 hours, 14 hours, 16 hours, 18 hours, 20 hours, 22 hours or more. Alternatively, the incubation time in step (2) may be 36 hours, 34 hours, 32 hours, 30 hours, 28 hours, 26 hours or less. Preferably, it is about 24 hours.

[0024] In step (3), the cells cultured in step (2) are cultured in a third differentiation medium containing only a Wnt signaling inhibitor, a TGFβ signaling inhibitor, and a BMP signaling inhibitor as inductors. The TGFβ signaling inhibitor and BMP signaling inhibitor can be the same as those used in the second differentiation medium. Examples of Wnt signaling inhibitors include Wnt-C59 (C59, CAS No. 1243243-89-1), IWR-1-endo (CAS No. 1127442-82-3), IWP-2 (CAS No. 686770-61-6), IWP-4 (CAS No. 686772-17-8), and XAV-939 (CAS No. 284028-89-3). It is preferable that the Wnt signaling inhibitor, TGFβ signaling inhibitor, and BMP signaling inhibitor are not recombinant proteins. When C59 is used as a Wnt signaling inhibitor, its concentration is usually 10 pM to 2 μM, preferably about 1 μM. When A83-01 is used as a TGFβ signaling inhibitor, its concentration is usually 0.01 μM to 10 μM, preferably about 1 μM. When LDN-193189 is used as a BMP signaling inhibitor, its concentration is usually 0.005 μM to 2 μM, preferably about 0.25 μM.

[0025] Step (3) is initiated by replacing the second differentiation medium with the third differentiation medium. Cells may be washed with PBS or similar during the medium change. Step (3) is the process of differentiating the paraxial mesoderm into somites. Somite differentiation can be confirmed by the expression of at least one of the somite markers: PARAXIS (transcription factor 15), MESP2 (mesoderm posterior protein 2), PAX3 (paired box 3), and FOXC2 (forkhead box C2). Therefore, it is preferable to continue step (3) until the expression of at least one of PARAXIS, MESP2, PAX3, and FOXC2 is confirmed. Marker expression can be confirmed by known methods such as RT-PCR and Western blotting. For example, the nucleotide and amino acid sequences of human PARAXIS, human MESP2, human PAX3, and human FOXC2 can be obtained using the following NCBI accession numbers. Human PARAXIS: nucleotide sequence NM_004609.4, amino acid sequence NP_004600.3 Human MESP2: Base sequence NM_001039958.2, amino acid sequence NP_001035047.1 Human PAX3: nucleotide sequence NM_181457.4, amino acid sequence NP_852122.1 Human FOXC2: nucleotide sequence NM_005251.3, amino acid sequence NP_005242.1

[0026] The incubation time in step (3) may be 12 hours, 14 hours, 16 hours, 18 hours, 20 hours, 22 hours or more. Alternatively, the incubation time in step (3) may be 36 hours, 34 hours, 32 hours, 30 hours, 28 hours, 26 hours or less. Preferably, it is about 24 hours.

[0027] In step (4), the cells cultured in step (3) are cultured in a fourth differentiation medium containing, as an inductive factor, at least one selected from the group consisting of a hedgehog signaling activator and a BMP signaling inhibitor and a Wnt signaling inhibitor. The inductive factors in the fourth differentiation medium may consist only of a hedgehog signaling activator and a BMP signaling inhibitor, only a hedgehog signaling activator and a Wnt signaling inhibitor, or only a hedgehog signaling activator, a BMP signaling inhibitor, and a Wnt signaling inhibitor. The BMP signaling inhibitor may be the same as that used in the second and third differentiation media, and the Wnt signaling inhibitor may be the same as that used in the third differentiation medium. Examples of hedgehog signal activators include Smoothened Agonist (SAG, CAS No. 912545-86-9), Purmorphamine (CAS No. 483367-10-8), and Hh-Ag1.5 (CAS No. 612542-14-0). It is preferable that the hedgehog signal activator, BMP signal inhibitor, and Wnt signal inhibitor are not recombinant proteins. When SAG is used as the hedgehog signal activator, its concentration is usually 0.001 μM to 1 μM, preferably about 1 μM. When LDN-193189 is used as the BMP signal inhibitor, its concentration is usually 0.005 μM to 2 μM, preferably about 0.25 μM. When C59 is used as the Wnt signal inhibitor, its concentration is usually 10 pM to 2 μM, preferably about 1 μM.

[0028] Step (4) is initiated by replacing the third differentiation medium with the fourth differentiation medium. The cells may be washed with PBS or similar during the medium change. Step (4) is the process of differentiating the somites into sclerotomes. Differentiation into sclerotomes can be confirmed by the expression of at least one of the sclerotome markers: PAX1 (paired box 1), PAX9 (paired box 9), SOX9 (SRY-box transcription factor 9), and NKX3.2 (NK3 homeobox 2). Therefore, it is preferable to continue step (3) until the expression of at least one of PAX1, PAX9, FOXC2, SOX9, and Nkx3.2 is confirmed. Marker expression can be confirmed by known methods such as RT-PCR and Western blotting. For example, the nucleotide and amino acid sequences of human PAX1, human PAX9, human SOX9, and human NKX3.2 can be obtained using the following NCBI accession numbers. Human PAX1: Base sequence NM_006192.5, amino acid sequence NP_006183.2 Human PAX9: nucleotide sequence NM_006194.4, amino acid sequence NP_006185.1 Human SOX9: nucleotide sequence NM_000346.4, amino acid sequence NP_000337.1 Human Nkx3.2: Base sequence NM_001189.4, amino acid sequence NP_001180.1

[0029] The incubation time in step (4) may be 36 hours, 38 hours, 40 hours, 42 hours, 44 hours, or 46 hours or more. The incubation time in step (2) may be 84 hours, 82 hours, 80 hours, 78 hours, 76 hours, or 74 hours or less. Preferably, it is about 48 to about 72 hours.

[0030] The manufacturing method of the present invention can be carried out in a culture environment that satisfies both xeno-free conditions, which exclude heterologous components from the culture system, and feeder-free conditions, which do not use feeder cells. Therefore, vertebral plate cells produced in xeno-free and feeder-free culture systems using the manufacturing method of the present invention are suitable for in vivo transplantation into humans.

[0031] [Method for producing cartilage tissue] The present invention provides a method for producing cartilage tissue. The method for producing cartilage tissue according to the present invention may include the step of three-dimensionally culturing vertebral plate cells produced by the production method of the present invention in a basic cartilage-forming medium that does not contain cartilage-inducing factors. Known cartilage-inducing factors include transforming growth factor-β1 (TGF-β1), bone morphogenetic protein-2 (BMP-2), bone morphogenetic protein-4 (BMP-4), growth differentiation factor-5 (GDF-5), insulin, and the cartilage-forming compound TD-198946.

[0032] The present invention's method for producing cartilage tissue can be carried out using a known three-dimensional culture method for inducing cartilage, but without the use of cartilage-inducing factors in a basic cartilage-forming culture medium. Known methods for inducing cartilage by three-dimensional culture include, for example, the method by Matsuda et al. (Nature. 2020 Apr;580(7801):124-129. doi: 10.1038 / s41586-020-2144-9. Epub 2020 Apr 1.), the method by Yamashita et al. (Stem Cell Reports. 2015 Mar 10;4(3):404-18. doi: 10.1016 / j.stemcr.2015.01.016. Epub 2015 Feb 26.), the method by Yamashita et al. (Nature. 2014 Sep 25;513(7519):507-11), the method by Makay et al. (Tissue Eng. 1998;4(4):415-28), and the method by Oldershaw et al. (Nat Examples include the method described in Biotechnol, 2010 Nov;28(11):1187-94, the method described by Nasu et al. (PLoS One. 2013; 8(1): e53771), and the method described by Hino et al. (Proc Natl Acad Sci US A. 2015 Dec 15; 112(50): 15438-15443).

[0033] The method for inducing cartilage by three-dimensional culture may be a modified version of the method described by Matsuda et al. (Nature. 2020). Specifically, for example, vertebral plate cells produced by the production method of the present invention may be suspended in a vertebral plate induction medium containing a ROCK inhibitor, seeded on a low-adhesion surface plate to form three-dimensional cell aggregates, and then cultured in a basal chondrogenesis medium that does not contain chondrogenic factors. The method for inducing cartilage by three-dimensional culture may also be a modified version of the method described by Yamashita et al. (Stem Cell Reports. 2015). Specifically, for example, the culture medium for vertebral plate cells produced by the production method of the present invention may be replaced with a basal chondrogenesis medium that does not contain chondrogenic factors, cultured until cartilage nodules are formed, the cartilage nodules may be detached from the plate and transferred to a low-adhesion surface plate for suspension culture.

[0034] The chondrogenic culture medium can be appropriately selected from known chondrogenic culture media. For example, the chondrogenic culture medium used in Example 3 of this specification, or the chondrogenic culture media described in the various documents exemplified above as known methods for inducing cartilage by three-dimensional culture, can be used.

[0035] Since the cartilage tissue production method of the present invention can be carried out in a culture environment that satisfies xeno-free and feeder-free conditions, the cartilage tissue produced by the cartilage tissue production method of the present invention is suitable for in vivo transplantation into humans.

[0036] [Method for producing endochondral ossification tissue] The present invention provides a method for producing endochondral ossification tissue. A first embodiment of the method for producing endochondral ossification tissue according to the present invention may include the steps of transplanting vertebral plate cells produced by the method of the present invention into a mammal other than a human, and excising tissue derived from the transplanted vertebral plate cells from the mammal. The mammal other than a human is not particularly limited, but when using vertebral plate cells differentiated from human pluripotent stem cells, it is preferable to use an immunodeficient animal. As an immunodeficient animal, commercially available immunodeficient mice, immunodeficient rats, or immunodeficient pigs can be used.

[0037] The transplantation site is not particularly limited, but it is preferable to choose a site where transplanted tissue is easily formed. Specifically, examples include the area under the renal capsule, within the subcutaneous tissue, and within and around bone and cartilage tissue. Transplantation of vertebral disc cells can be performed by preparing a cell suspension of vertebral disc cells produced by the manufacturing method of the present invention and injecting the cell suspension into the transplantation site using a syringe or the like. The formation of tissue derived from the transplanted vertebral disc cells can be confirmed, for example, by acquiring images over time using X-ray microcomputed tomography (X-ray micro-CT) and observing the formation and increase of calcified tissue.

[0038] The method for excising tissue derived from vertebral plate cells transplanted from mammals is not particularly limited, but it is preferable to perform the procedure using general surgical techniques under anesthesia or after euthanasia of the mammal. The timing of excision of the transplanted vertebral plate cell-derived tissue is not particularly limited. Based on the degree of calcification and growth of the calcified tissue, the endochondral ossified tissue should be excised at a time suitable for the intended use. The excised endochondral ossified tissue can be immersed in an appropriate physiological buffer or culture medium and used for various purposes.

[0039] A second embodiment of the method for producing endochondral ossification tissue of the present invention may include the steps of: three-dimensionally culturing vertebral plate cells produced by the production method of the present invention in a basic culture medium for cartilage formation with or without cartilage-inducing factors to produce cartilage tissue; and three-dimensionally culturing the cartilage tissue in a basic culture medium for bone formation with or without bone-inducing factors to produce endochondral ossification tissue.

[0040] The step of producing cartilage tissue by three-dimensionally culturing vertebral plate cells produced by the manufacturing method of the present invention in a cartilage-forming basic medium with or without cartilage-inducing factors can be carried out in the same manner as the cartilage tissue production method of the present invention, or in the cartilage tissue production method of the present invention using a cartilage-forming basic medium containing cartilage-inducing factors. Examples of cartilage-inducing factors include TGF-β1, BMP-2, BMP-4, GDF-5, insulin, and TD-198946.

[0041] The process of producing endochondral ossified tissue by three-dimensionally culturing the obtained cartilage tissue in a basic osteogenic medium with or without bone induction factors can be carried out using known methods for inducing osteogenic differentiation by three-dimensional culturing of cartilage tissue. For example, one method is to replace the basic osteogenic medium used to form the cartilage tissue with a basic osteogenic medium and continue with three-dimensional culturing.

[0042] The basal osteogenic medium can be appropriately selected from known basal osteogenic mediums. Examples include the basal osteogenic medium used in Example 3 of this specification, the basal osteogenic medium described by Buttery et al. (Tissue Eng 2001 Feb;7(1):89-99.), the basal osteogenic medium described by Kawaguchi et al. (Bone 2005 May;36(5):758-69), the basal osteogenic medium described by Ohba et al. (FASEB J. 2007 Jun;21(8):1777-87), and the basal osteogenic medium described by Kanke et al. (Stem Cell Reports. 2014 May 22;2(6):751-60). The basal osteogenic medium may contain or may not contain bone-inducing factors. Examples of bone-inducing factors include bone morphogenetic protein-2 (BMP-2), hedgehog signaling activators (e.g., smoothed agonist (SAG)), Wnt protein, fibroblast growth factor-2 (FGF-2), polyunsaturated fatty acids (PUFAs), HMG-CoA reductase inhibitors such as statins, and helioxanthin analogs.

[0043] A second embodiment of the present invention's method for producing endochondral ossification tissue is characterized by the ability to produce endochondral ossification tissue using a basal culture medium for cartilage formation that does not contain cartilage-inducing factors and a basal culture medium for bone formation that does not contain bone-inducing factors. Therefore, the second embodiment of the present invention's method for producing endochondral ossification tissue has advantages such as cost reduction, simplified method, and the ability to produce homogeneous endochondral ossification tissue.

[0044] The method for producing endochondral ossification tissue of the present invention can be carried out in a culture environment that satisfies xeno-free and feeder-free conditions, making the endochondral ossification tissue produced by the present invention suitable for in vivo transplantation into humans. Furthermore, the endochondral ossification tissue produced by the present invention can be suitably used for studying the molecular mechanisms of bone formation during development, studying the pathogenesis of bone diseases, and screening for bone disease treatments.

[0045] [Screening Method] The present invention provides a screening method for cartilage formation-regulating substances and a screening method for bone formation-regulating substances. The test substance used in the screening method of the present invention is not particularly limited and may be nucleic acid, peptide, protein, non-peptide compound, synthetic compound, fermentation product, cell extract, cell culture supernatant, plant extract, mammalian tissue extract, plasma, etc. The test substance may be a novel substance or a known substance. These test substances may form salts. As salts of the test substance, salts with physiologically acceptable acids or bases are preferred.

[0046] (1) Screening method for cartilage formation regulatory substances The present invention provides a screening method for cartilage formation controlling substances. A first embodiment of the screening method for cartilage formation controlling substances of the present invention may include the steps of: culturing vertebral plate cells produced by the production method of the present invention in three dimensions using a basic cartilage formation medium that does not contain cartilage-inducing factors, in the presence or absence of a test substance to form cartilage tissue; and selecting a test substance that increases or decreases the amount of cartilage in the cartilage tissue compared with cartilage tissue formed in the absence of the test substance.

[0047] The first step, which involves three-dimensionally culturing vertebral disc cells produced by the manufacturing method of the present invention in a cartilage-forming basal medium that does not contain cartilage-inducing factors, in the presence or absence of the test substance, to form cartilage tissue, can be carried out by adding the test substance to the cartilage-forming basal medium in the same manner as the cartilage tissue production method of the present invention. The timing of adding the test substance to the cartilage-forming basal medium may be at the same time as the start of the first step, or it may be after a certain period of time has elapsed since the start of the first step. The period during which the vertebral disc cells and the test substance are in contact may be the entire duration of the first step, or it may be a part of the duration of the first step.

[0048] In the second step (selecting a test substance that increases or decreases the amount of cartilage in cartilage tissue compared to cartilage tissue formed in the absence of the test substance), the amount of cartilage in cartilage tissue formed in the absence of the test substance is compared with the amount of cartilage in cartilage tissue formed in the presence of the test substance. The comparison of cartilage amounts can be done, for example, by preparing a tissue sample of cartilage tissue, staining it with safranin O, and comparing the area of ​​the stained region, or by using a phosphotungstic acid solution or Ruthenium Red This can be done by quantifying the cartilage volume in X-ray CT images of stained tissue.

[0049] A test substance that increases the amount of cartilage in cartilage tissue formed in the presence of the test substance compared to cartilage tissue formed in the absence of the test substance can be selected as a substance that promotes cartilage formation. The extent to which the test substance increases the amount of cartilage is not particularly limited, but for example, a test substance that increases the amount by 120% or more, 130% or more, 140% or more, 150% or more, 170% or more, 180% or more, 190% or more, or 200% or more compared to cartilage tissue formed in the absence of the test substance may be selected.

[0050] A test substance that reduces the amount of cartilage in cartilage tissue formed in the presence of the test substance compared to cartilage tissue formed in the absence of the test substance can be selected as a substance that inhibits cartilage formation. The degree to which the test substance reduces the amount of cartilage is not particularly limited, but for example, a test substance that reduces it to 90% or less, 80% or less, 70% or less, 60% or less, or 50% or less compared to cartilage tissue formed in the absence of the test substance may be selected.

[0051] A second embodiment of the screening method for cartilage formation controlling substances of the present invention may include the steps of: transplanting vertebral disc cells produced by the manufacturing method of the present invention into a mammal other than a human; administering a test substance to the mammal; excising tissue derived from the transplanted vertebral disc cells from the mammal; and selecting a test substance that increases or decreases the amount of cartilage in the transplanted tissue by comparing it with transplanted tissue excised from a mammal that has not been administered the test substance.

[0052] The first step (transplanting vertebral plate cells produced by the manufacturing method of the present invention into a mammal other than a human can be carried out in the same manner as in the first embodiment of the method for producing endochondral ossification tissue of the present invention. In the second step (administering the test substance to the mammal), the test substance is administered to the mammal to which the vertebral plate cells were transplanted in the first step. The administration may be systemic, such as oral, intravenous, or intraperitoneal administration, or it may be local administration to the transplant site or its vicinity. The dosage, timing of administration, number of administrations, duration of administration, etc., are appropriately set according to the test substance used.

[0053] The third step (excision of tissue derived from vertebral plate cells transplanted from mammals) can be performed in the same manner as in the first embodiment of the method for producing endochondral ossification tissue of the present invention. The timing of excision is not particularly limited, but it is preferable to excise the tissue when the amount of cartilage in the transplanted vertebral plate cell-derived tissue has increased to a comparable level. The timing of excision is preferably determined by conducting preliminary studies.

[0054] In the fourth step (selecting a test substance that increases or decreases the amount of cartilage in transplanted tissue compared to transplanted tissue excised from a mammal that has not been administered the test substance), the amount of cartilage in transplanted tissue excised from a mammal that has not been administered the test substance is compared with the amount of cartilage in transplanted tissue excised from a mammal that has been administered the test substance. The comparison of cartilage amounts can be performed in the same manner as in the first embodiment of the screening method for cartilage formation-controlling substances of the present invention, and test substances that increase and decrease the amount of cartilage in transplanted tissue compared to transplanted tissue excised from a mammal that has not been administered the test substance can be selected as substances that promote cartilage formation and substances that suppress cartilage formation, respectively. The same criteria as in the first embodiment of the screening method for cartilage formation-controlling substances of the present invention can also be applied to determine the degree to which the test substance increases the amount of cartilage and the degree to which the test substance decreases the amount of cartilage.

[0055] A third embodiment of the screening method for cartilage formation controlling substances of the present invention may include the steps of: transplanting vertebral disc cells produced by the manufacturing method of the present invention into a mammal other than a human; excising tissue derived from the transplanted vertebral disc cells from the mammal and transferring it to a culture system; contacting the transplanted tissue with a test substance; and selecting a test substance that increases or decreases the amount of cartilage in the transplanted tissue by comparing it with transplanted tissue that has not been in contact with the test substance.

[0056] The first step (transplanting vertebral plate cells produced by the manufacturing method of the present invention into a mammal other than a human can be carried out in the same manner as in the first embodiment of the method for producing endochondral ossification tissue of the present invention. In the second step (excision of tissue derived from vertebral plate cells transplanted from a mammal and transfer to a culture system), the excision of the transplanted vertebral plate cell-derived tissue can be carried out in the same manner as in the first embodiment of the method for producing endochondral ossification tissue of the present invention. The timing of excision is not particularly limited, but it is preferable to excise the tissue when the amount of cartilage is increasing in the transplanted vertebral plate cell-derived tissue. The timing when the amount of cartilage is increasing can be determined by conducting preliminary studies. Transfer of the excised tissue to a culture system can be carried out by culturing the excised tissue using a suitable culture medium. Examples of culture media to be used include basic cartilage formation media that contain or do not contain cartilage-inducing factors.

[0057] In the third step (contacting the transplanted tissue with the test substance), the transplanted tissue, which has been transferred to the culture system, is brought into contact with the test substance. The method of contact is not particularly limited, but one example is adding the test substance to the culture medium. The timing of adding the test substance may be immediately after the tissue is transferred to the culture system in the second step, or it may be after a certain period of time has elapsed since the tissue was transferred to the culture system. The period during which the transplanted tissue and the test substance are in contact is also not particularly limited, and may be the entire culture period or a part of the culture period.

[0058] In the fourth step (selecting a test substance that increases or decreases the amount of cartilage in transplanted tissue compared to transplanted tissue that has not been in contact with the test substance), the amount of cartilage in transplanted tissue that has not been in contact with the test substance is compared to the amount of cartilage in transplanted tissue that has been in contact with the test substance. The comparison of cartilage amounts can be performed in the same manner as in the first embodiment of the screening method for cartilage formation controlling substances of the present invention, and test substances that increase and decrease the amount of cartilage in transplanted tissue compared to transplanted tissue that has not been in contact with the test substance can be selected as substances that promote cartilage formation and substances that suppress cartilage formation, respectively. The same criteria as in the first embodiment of the screening method for cartilage formation controlling substances of the present invention can also be applied to determine the degree to which the test substance increases the amount of cartilage and the degree to which the test substance decreases the amount of cartilage.

[0059] The test substances selected by the screening method for cartilage formation controlling substances of the present invention are useful as candidate substances for pharmaceuticals for the prevention and / or treatment of cartilage diseases, or as research materials for understanding the cartilage formation mechanism. Examples of cartilage diseases include congenital diseases that show abnormalities in cartilage, such as osteoarthritis, full-thickness and partial cartilage defects, and chondrodysplasia.

[0060] (2) Screening method for bone formation regulatory substances The present invention provides a method for screening bone formation-regulating substances. A first embodiment of the bone formation-regulating substance screening method of the present invention may include the steps of: three-dimensionally culturing cartilage tissue differentiated from vertebral plate cells produced by the production method of the present invention in a basic bone formation medium in the presence or absence of a test substance to form bone tissue; and selecting a test substance that increases or decreases the amount of calcification in the bone tissue by comparing it with bone tissue formed in the absence of the test substance.

[0061] The first step, which involves three-dimensionally culturing cartilage tissue differentiated from vertebral disc cells produced by the manufacturing method of the present invention in a basic osteogenic medium, either in the presence or absence of the test substance, to form bone tissue, can be carried out by adding the test substance to the basic osteogenic medium in the same manner as in the second embodiment of the method for producing endochondral ossification tissue of the present invention. The basic osteogenic medium may contain bone-inducing factors or may not contain bone-forming factors. The timing of adding the test substance to the basic osteogenic medium may be at the same time as the start of the first step, or it may be after a certain period of time has elapsed since the start of the first step. The period during which the vertebral disc cells and the test substance are in contact may be the entire duration of the first step, or it may be a part of the duration of the first step.

[0062] In the second step (selecting a test substance that increases or decreases bone mass in bone tissue compared to bone tissue formed in the absence of the test substance), the bone mass of bone tissue formed in the absence of the test substance is compared with the bone mass of bone tissue formed in the presence of the test substance. Bone mass can be compared, for example, by preparing bone tissue specimens, staining them with Kossa stain, and comparing the area of ​​the stained region, or by quantifying bone mass in X-ray CT images, or by quantifying bone density.

[0063] A test substance that increases the bone mass of bone tissue formed in the presence of the test substance compared to bone tissue formed in the absence of the test substance can be selected as a bone formation promoting substance. The extent to which the test substance increases bone mass is not particularly limited, but for example, a test substance that increases bone mass by 120% or more, 130% or more, 140% or more, 150% or more, 170% or more, 180% or more, 190% or more, or 200% or more compared to bone tissue formed in the absence of the test substance may be selected.

[0064] A test substance that reduces the bone mass of bone tissue formed in the presence of the test substance compared to bone tissue formed in the absence of the test substance can be selected as a substance that inhibits bone formation. The degree to which the test substance reduces bone mass is not particularly limited, but for example, a test substance that reduces it to 90% or less, 80% or less, 70% or less, 60% or less, or 50% or less compared to bone tissue formed in the absence of the test substance may be selected.

[0065] A second embodiment of the bone formation control substance screening method of the present invention may include the steps of: transplanting vertebral disc cells produced by the manufacturing method of the present invention into a mammal other than a human; administering a test substance to the mammal; excising tissue derived from the transplanted vertebral disc cells from the mammal; and selecting a test substance that increases or decreases the bone mass of the transplanted tissue by comparing it with transplanted tissue excised from a mammal that has not been administered the test substance.

[0066] The first step (transplanting vertebral plate cells produced by the manufacturing method of the present invention into a mammal other than a human can be carried out in the same manner as in the first embodiment of the method for producing endochondral ossification tissue of the present invention. In the second step (administering the test substance to the mammal), the test substance is administered to the mammal to which the vertebral plate cells were transplanted in the first step. The administration may be systemic, such as oral, intravenous, or intraperitoneal administration, or it may be local administration to the transplant site or its vicinity. The dosage, timing of administration, number of administrations, duration of administration, etc., are appropriately set according to the test substance used.

[0067] The third step (excision of tissue derived from vertebral plate cells transplanted from mammals) can be performed in the same manner as in the first embodiment of the method for producing endochondral ossification tissue of the present invention. The timing of excision is not particularly limited, but it is preferable to excise the tissue when the bone mass in the transplanted vertebral plate cell-derived tissue has increased to a comparable level. The timing of excision is preferably determined by conducting preliminary studies.

[0068] In the fourth step (selecting a test substance that increases or decreases bone mass in transplant tissue compared to transplant tissue excised from a mammal that has not been administered the test substance), the bone mass of transplant tissue excised from a mammal that has not been administered the test substance is compared with the bone mass of transplant tissue excised from a mammal that has been administered the test substance. The comparison of bone mass can be performed in the same manner as in the first embodiment of the bone formation control substance screening method of the present invention, and test substances that increase and decrease bone mass in transplant tissue compared to transplant tissue excised from a mammal that has not been administered the test substance can be selected as substances that promote bone formation and substances that suppress bone formation, respectively. The same criteria as in the first embodiment of the bone formation control substance screening method of the present invention can also be applied to determine the degree to which the test substance increases bone mass and the degree to which the test substance decreases cartilage mass.

[0069] A third embodiment of the bone formation control substance screening method of the present invention may include the steps of: transplanting vertebral disc cells produced by the manufacturing method of the present invention into a mammal other than a human; excising tissue derived from the transplanted vertebral disc cells from the mammal and transferring it to a culture system; contacting the transplanted tissue with a test substance; and selecting a test substance that increases or decreases the bone mass of the transplanted tissue by comparing it with transplanted tissue that has not been in contact with the test substance.

[0070] The first step (transplanting vertebral plate cells produced by the manufacturing method of the present invention into a mammal other than a human can be carried out in the same manner as in the first embodiment of the method for producing endochondral ossification tissue of the present invention. In the second step (excision of tissue derived from vertebral plate cells transplanted from a mammal and transfer to a culture system), the excision of the transplanted vertebral plate cell-derived tissue can be carried out in the same manner as in the first embodiment of the method for producing endochondral ossification tissue of the present invention. The timing of excision is not particularly limited, but it is preferable that the tissue derived from transplanted vertebral plate cells be in the process of increasing bone mass. It is preferable to determine the timing of excision by conducting preliminary studies. The transfer of the excised tissue to a culture system can be carried out by culturing the excised tissue using a suitable culture medium. Examples of culture media to be used include basic osteogenic media containing or not containing bone induction factors.

[0071] The step of bringing the transplanted tissue into contact with the test substance (third step) can be carried out in the same manner as in the third embodiment of the screening method for cartilage formation controlling substances of the present invention. In the step of selecting a test substance that increases or decreases the bone mass of the transplanted tissue compared to transplanted tissue that has not been in contact with the test substance (fourth step), the amount of cartilage in the transplanted tissue that has not been in contact with the test substance is compared with the amount of cartilage in the transplanted tissue that has been in contact with the test substance. The comparison of bone mass can be carried out in the same manner as in the first embodiment of the screening method for bone formation controlling substances of the present invention, and test substances that increase and decrease the bone mass of the transplanted tissue compared to transplanted tissue excised from mammals that have not been administered the test substance can be selected as substances that promote bone formation and substances that suppress bone formation, respectively. The same criteria as in the first embodiment of the screening method for bone formation controlling substances of the present invention can be applied to determine the degree to which the test substance increases bone mass and the degree to which the test substance decreases cartilage mass.

[0072] A fourth embodiment of the bone formation control substance screening method of the present invention may include, in place of the second step of the first embodiment, a step of selecting a test substance that increases or decreases the expression level of ZEB2 (zinc finger E-box binding homeobox 2) in bone tissue compared to bone tissue formed in the absence of the test substance. This step may also involve selecting a test substance that simultaneously increases or decreases the expression levels of ZEB2 and RUNX2 (runt-related transcription factor 2), or ZEB2 and SP7 (Sp7 transcription factor, also known as Osterix), or ZEB2, RUNX2, and SP7. Note that RUNX2 and SP7 are known as transcription factors essential for bone formation.

[0073] Expression levels may be measured by measuring protein quantity or mRNA quantity. When measuring protein quantity, protein can be extracted from cells using a known method and quantified using a known protein quantity measurement method. Examples of known protein quantity measurement methods include Western blotting, EIA, ELISA, RIA, and methods using protein assay reagents. When measuring mRNA quantity, RNA can be extracted from cells using a known method and quantified using a known mRNA quantity measurement method. Examples of known mRNA quantity measurement methods include Northern blotting, RT-PCR, quantitative RT-PCR, and RNase protection assay.

[0074] For example, the nucleotide and amino acid sequences of human ZEB2, human RUNX2, and human SP7 can be obtained using the following NCBI accession numbers. Human ZEB2: Base sequence NM_001171653.2, amino acid sequence NP_001165124.1 Human RUNX2: Base sequence NM_001015051.4, amino acid sequence NP_001015051.3 Human SP7: Base sequence NM_001173467.3, amino acid sequence NP_001166938.1

[0075] A fifth embodiment of the bone formation control substance screening method of the present invention may include, in place of the fourth step of the second embodiment, a step of selecting a test substance that increases or decreases the ZEB2 expression level in transplanted tissue compared with transplanted tissue excised from a mammal that has not been administered the test substance. This step may be a step of selecting a test substance that simultaneously increases or decreases the expression levels of ZEB2 and RUNX2, or ZEB2 and SP7, or ZEB2, RUNX2, and SP7. The expression levels can be measured in the same manner as in the fourth embodiment.

[0076] A sixth embodiment of the bone formation control substance screening method of the present invention may include, in place of the fourth step of the third embodiment, a step of selecting a test substance that increases or decreases the ZEB2 expression level of transplanted tissue compared to transplanted tissue that has not been in contact with the test substance. This step may be a step of selecting a test substance that simultaneously increases or decreases the expression levels of ZEB2 and RUNX2, or ZEB2 and SP7, or ZEB2, RUNX2, and SP7. The expression levels can be measured in the same manner as in the fourth embodiment.

[0077] The test substances selected by the bone formation control substance screening method of the present invention are useful as candidate substances for pharmaceuticals for the prevention and / or treatment of bone diseases, or as research materials for understanding bone formation mechanisms. Examples of bone diseases include congenital diseases showing abnormalities in the bone, such as osteoporosis and osteogenesis imperfecta, and bone defects due to various causes. [Examples]

[0078] The present invention will be described in detail below with reference to examples, but the present invention is not limited to these examples.

[0079] [Example 1: Differentiation induction from human pluripotent stem cells to vertebral plate cells] 1-1 Experimental Method (1) Cells used As human iPS cells, we used the Col2.3-Cherry(COL) strain (obtained from the University of Connecticut: Zujur et al. Regen Ther 14:19-31, 2020), the 201B7 strain (obtained from RIKEN: Takahashi et al. Cell 131:861-872, 2007), and the NiPS strain (obtained from RIKEN: Ono et al. PLOS ONE 7:e42855, 2012). In addition, as human ES cells, we used the SEES3 strain (obtained from the National Center for Child Health and Development: Akutsu et al. Regen Ther 1:18-29, 2015).

[0080] (2) Culture medium used The following chemically defined medium is used: DMEM / F12 (Thermo Fisher Scientific; 11330032), 1% B27 Xeno-Free Supplement (Thermo Fisher Scientific; A148601), 1% ITS Liquid Media Supplement (Sigma-Aldrich; I3146), 1% MEM Non-Essential Amino Acids Solution (Thermo Fisher Scientific; 11140050), and 55 μM 2-Mercaptoethanol (0.1% of 55 mM 2-Mercaptoethanol in DPBS (Thermo Fisher Scientific; 21985023)). Hereafter, this chemically defined medium will be referred to as BIM.

[0081] As a control medium, we will use the CDM2 basal medium described by Loh et al. (Cell. 2016 Jul 14;166(2):451-467. doi: 10.1016 / j.cell.2016.06.011.). The composition of the CDM2 basal medium is as follows: 50% IMDM (+GlutaMAX, +HEPES, +Sodium Bicarbonate; Gibco, 31980-097), 50% F12 (+GlutaMAX; Gibco, 31765-092), 1mg / mL polyvinyl alcohol (Sigma, P8136-250G), 1% v / v concentrated lipids (Gibco, 11905-031), 450 μM monothioglycerol (Sigma, M6145), 0.7 μg / mL insulin (Roche, 1376497), 15 μg / mL transferrin (Roche, 652202), 1% v / v penicillin / streptomycin (Gibco).

[0082] (3) Preparation of cells Human iPS cells or human ES cells are cultured to 70-80% confluence, and microclamps are prepared by pipetting approximately 10 times. The prepared microclamps are diluted to approximately 1:16-1:24 using Essential 8 Medium (Thermo Fisher Scientific; A1517001) containing 1 μM thiazovivin (a ROCK inhibitor), and the cells are sparsely subcultured on new culture plates coated with vitronectin (VTN-N: Thermo Fisher Scientific; A14700) and cultured overnight.

[0083] (4) Differentiation into vertebral plate cells Differentiation induction into vertebral plate cells is performed under serum-free, xeno-free, feeder-free, monolayer culture conditions. (4-1) Differentiation into vertebral plate cells by the manufacturing method of the present invention Using the above BIM as the culture medium, differentiate the cells into vertebral plate cells in the following steps 1-4. ●Step 1: Induction of differentiation into the anterior primitive streak (Day 0) After washing the prepared human iPS cells or human ES cells with PBS(-), they are cultured for approximately 24 hours in BIM containing 5 μM CHIR (Wnt signaling activator) to differentiate them into anterior primitive streaks. ●Step 2: Induction of differentiation into paraxial mesoderm (Day 1) After washing the cells cultured in step 1 with PBS(-), they were cultured for approximately 24 hours in BIM containing 5 μM CHIR (Wnt signaling activator), 1 μM A83-01 (TGFβ inhibitor), and 0.25 μM LDN-193189 (BMP signaling inhibitor) to differentiate them into paraxial mesoderm. ●Step 3: Differentiation into somites (Day 2) After washing the cells cultured in step 2 with PBS(-), they were cultured for approximately 24 hours in BIM containing 1 μM C59 (Wnt signaling inhibitor), 1 μM A83-01 (TGFβ inhibitor), and 0.25 μM LDN-193189 (BMP signaling inhibitor) to differentiate them into somites. ●Step 4: Induction of differentiation into vertebral disc (Sclerotome) (Day 3) After washing the cells cultured in step 3 with PBS(-), they are cultured for approximately 2 days in BIM containing 1 μM SAG (Hedgehog signaling activator), 1 μM C59 (Wnt signaling inhibitor), and 0.25 μM LDN-193189 (BMP signaling inhibitor) to differentiate them into vertebral plates.

[0084] (4-2) Differentiation induction into vertebral plate cells using a control medium Using a control medium (CDM2 basal medium described by Loh et al. (Cell. 2016 Jul 14;166(2):451-467. doi: 10.1016 / j.cell.2016.06.011.)), the following inductive factors were added at each of the above steps to induce differentiation into vertebral plate cells. ● Inducing factors to be added in step 1 4 μM CHIR, 0.1 μM PIK90, 20 ng / mL FGF2, and 30 ng / mL Activin A. ● Inducing factors to be added in step 2 3 μM CHIR, 1 μM A83-01, 0.25 μM LDN-193189, and 20 ng / mL FGF2. ● Inducing factors to be added in step 3 1μM C59, 1μM A83-01, 0.25μM LDN-193189, and 0.5μM PD0325901. ● Inducing factors added in step 4 1 μM C59 and 5 nM 21 K.

[0085] (5) Confirmation of expression of vertebral plate cell markers The cells cultured in step 4 were harvested, RNA extraction was performed according to standard procedures using ISOGEN (Nippon Gene, 319-90211), and reverse transcription and cDNA synthesis were performed on a GeneAmp PCR System 9700 (Applied Biosystems) using ReverTra Ace qPCR RT Master Mix with gDNA remover (TOYOBO, FSQ-301). As vertebral plate cell markers, the mRNA expression levels of PAX1, PAX9, and Nkx3.2 were measured using FastStart Universal SYBR Green Master (Rox) (Roche, 04913850001 The expression levels of vertebral plate cell markers were measured by quantitative PCR on a 7500 Fast Real-Time PCR System (Applied Biosystems) using the following primers: hPAX1: forward, CGCTATGGAGCAGACGTATGGCGA(Sequence ID 1) hPAX1: reverse, AATGCGCAAGCGGATGGCGTTG (Sequence ID 2) hPAX9: forward, TGGTTATGTTGCTGGACATGGGTG(Sequence ID 3) hPAX9: reverse, GGAAGCCGTGACAGAATGACTACCT (Sequence ID 4) hNKX3.2: forward, GGAGGTTAAGACGTGTCGCA(Sequence ID 5) hNKX3.2: reverse, GCAGAGGGCAGAAGGTAGAC (Sequence ID 6)

[0086] 1-2 Results Figure 1 shows the results of measuring vertebral plate cell markers. In Figure 1, "Conventional Method" shows cells differentiated using a control medium, and "New Method" shows cells differentiated using the manufacturing method of the present invention. In all four cell types, the expression levels of vertebral plate cell markers in cells obtained by the manufacturing method of the present invention were higher than those of cells obtained by the conventional method for all three types.

[0087] [Example 2: Transplantation of differentiated human vertebral disc cells into the submucosal space of mouse kidneys] 2-1 Experimental Method (1) Preparation of human vertebral plate cells for transplantation Human vertebral plate cells (Day 5) differentiated from Col2.3-Cherry (COL) human iPS cell line according to steps 1-4 of Example 1(4-1) were detached with Accutase (Life Tech), centrifuged, and resuspended in a small amount of cold BIM (50-250 μL) depending on the number of cells. The vertebral plate cell suspension was diluted with an equal volume of cold Matrigel (Corning; 354234) and kept on ice until transplantation.

[0088] (2) Animals used, transplantation and kidney removal 8-12 week old male NOD SCID mice (NOD.CB17-Prkdc scid (Charles River, J.) was used. Under inhalation anesthesia (2-3% isoflurane), a 1 cm incision was made in the skin directly above the left kidney of the mouse using prosthetic scissors. Subsequently, the abdominal wall (muscle and peritoneum) was incised to a similar extent to dissect the kidney to the skin incision, and a very small incision was made in the renal capsule, excising approximately 1.5 × 10⁻⁶. 6 ~15×10 6 A 26G plastic cannula is inserted into a syringe containing several tens to hundreds of microliters of a cell suspension containing human vertebral disc cells. The cannula is advanced a few millimeters to one centimeter under the renal capsule, and the cell suspension is injected. The kidney is reduced into the abdominal cavity, the abdominal wall is sutured with 6-0 nylon, and finally the skin is sutured in the same way to complete the transplant surgery. X-ray microcomputed tomography is performed at 4, 8, 12, 18, and 26 weeks post-transplant. Mice are euthanized at 8 and 18 weeks post-transplant, the transplanted kidney is removed, and it is subjected to histological analysis.

[0089] (3) X-ray microcomputed tomography (X-ray micro-CT) Images of the kidney transplant site were acquired using an X-ray micro-CT scanner (Rigaku, R_mCT2-FX).

[0090] (4)Histological analysis Calcified tissue was collected from the transplant site and fixed by immersion in 4% paraformaldehyde / phosphate buffer at 4°C for 16 hours. Next, it was decalcified by immersion in 0.5M EDTA solution at 4°C for 1-2 weeks. Frozen sections were immersed in 30% sucrose / phosphate buffer at 4°C for 12 hours, and then embedded and frozen at -80°C using a tissue sectioning embedding medium (Sakura FineTech Japan, Tissue-Tec OCT Compound). The blocks were sectioned to a thickness of 10 μm using a cryotome. After thoroughly air-drying the sections and completely dissolving and removing the embedding medium in phosphate buffer, they were used for staining. Paraffin sections were processed for 21 hours using a sealed automatic fixation and embedding device (Sakura FineTech Japan, Tissue-Tec VIP5 Junior) before being embedded in paraffin. The blocks were sectioned to a thickness of 5 μm using a microtome. Sections were stretched in a 42°C constant temperature water bath, mounted on slides, and excess moisture was removed at 42°C before being thoroughly dried in a 37°C constant temperature bath. After being immersed in xylene, ethanol, and water in stages to thoroughly remove paraffin and hydrate, they were used for staining. Hematoxylin and eosin staining (HE staining: immersed in hematoxylin solution for 2 minutes, water for 10 minutes, 95% ethanol for a few seconds, eosin solution for 1 minute, 100% ethanol solution for 5 minutes x 3 times, and xylene for 1 minute x 3 times, in sequence, and then mounted with Marinol) was performed. In addition to HE staining, tissue sections at 18 weeks post-transplantation were also stained with safranin O (immersion in hematoxylin solution for 2 minutes, water for 10 minutes, 0.001% Fast Green solution for 5 minutes, 1% acetic acid solution for 10 seconds, safranin solution for 5 minutes, 100% ethanol solution for 5 minutes x 3 times, xylene for 1 minute x 3 times, followed by mounting with Marinol), oil red O (immersion in 60% propanol solution for 1 minute, oil red O solution for 15 minutes, 60% propanol solution for 1 minute, hematoxylin solution for a few seconds, water for 10 minutes, followed by mounting with glycerin solution), and immunohistochemistry using anti-human nuclear antibodies (Millipore, MAB1281). For comparison, the tibia of a mouse fetus (18.5 days gestational age) was collected, tissue sections of the epiphysis were prepared, and HE staining was performed.

[0091] 2-2 Results (1) X-ray micro-CT image Figure 2 shows the results of X-ray micro-CT images of the transplantation site. Radiopaque areas (white shadows) indicate calcified tissue. It was shown that transplanted human vertebral disc cells grow while forming calcified tissue under the renal capsule of mice.

[0092] (2) Observation of calcified tissue at the graft site by HE staining Figure 3 shows HE-stained images of calcified tissue at the transplant site. (A) is the tibial epiphysis of a mouse fetus, (B) is the calcified tissue 8 weeks after transplantation of vertebral disc cells differentiated from human iPS cells, (C) is the calcified tissue 18 weeks after transplantation of vertebral disc cells differentiated from human iPS cells, and (D) is the HE-stained image of calcified tissue 18 weeks after transplantation of vertebral disc cells differentiated from human ES cells. In the tibial epiphysis of a mouse fetus (A), a layer of periarticular proliferating chondrocytes was observed at the epiphysis (upper part of the figure), a layer of columnar proliferating chondrocytes below that, and a layer of hypertrophic chondrocytes below that. Similarly, layers of periarticular proliferating chondrocytes, columnar proliferating chondrocytes, and hypertrophic chondrocytes were observed in the calcified tissue at the transplant site in (B), (C), and (D). In (C), bone marrow-like tissue was also observed at the bottom of the image. These results indicate that the transplanted human vertebral disc cells grew in the mouse body in a manner that mimicked endochondral ossification.

[0093] (3) Observation of calcified tissue at the graft site by safranin O staining Figure 4 shows HE-stained and safranin O-stained images of calcified tissue at the transplant site 18 weeks post-transplant. (A) is the HE-stained image, and (B) is the safranin O-stained image. In (B), it was observed that cartilage matrix proteins were stained red by safranin O. In addition, bone marrow-like tissue was observed within the cartilage tissue.

[0094] (4) Observation of calcified tissue at the transplant site by immunohistochemical staining using anti-human nuclear antibodies Figure 5 shows immunohistochemical staining images of calcified tissue at the transplant site 18 weeks post-transplantation using anti-human nuclear antibodies. (A) is a low-magnification image, (B) is a medium-magnification image, and (C) is a high-magnification image. Since the cell nuclei of the transplant site were stained, it was clear that the calcified tissue at the transplant site differentiated from the transplanted human vertebral disc cells. In the bone marrow-like tissue, areas where the nuclei were not stained are thought to be mouse hematopoietic cells and vascular endothelial cells.

[0095] (5) Observation of calcified tissue at the graft site using oil red O staining Figure 6 shows oil red O stained images and immunostained images using anti-human nuclear antibodies of calcified tissue at the transplant site 18 weeks post-transplant. (A) is a low-magnification image of oil red O staining, (B) is a medium-magnification image of oil red O staining, (C) is a high-magnification image of oil red O staining, and (D) is an immunostained image using the corresponding anti-human nuclear antibody in (C). The presence of adipocytes stained red by oil red O was shown in the bone marrow-like tissue. Furthermore, since the nuclei of the adipocytes were stained by immunostaining using anti-human nuclear antibodies, it was shown that the adipocytes were differentiated cells from the transplanted human vertebral disc cells.

[0096] [Example 3: In vitro three-dimensional cartilage formation and endochondral ossification of differentiated human vertebral disc cells] 3-1 Experimental Method (1) Chondrogenesis induction protocol 1 (partially modified from Matsuda et al. (Nature. 2020 Apr;580(7801):124-129. doi: 10.1038 / s41586-020-2144-9. Epub 2020 Apr 1.), hereinafter referred to as "Conventional Method 1"). Human vertebral plate cells (Day 5) differentiated from the SEES3 human ES cell line by steps 1-4 of Example 1(4-1) were detached with Accutase (Life Tech), centrifuged, resuspended in vertebral plate induction medium containing 10 μM ROCK inhibitor Y-27632 (Wako; 036-24023), and seeded on a 96-well low-adhesion surface plate (2.0-10 × 10). 5(cells / well). After incubation overnight and confirmation that three-dimensional cell aggregates have formed, replace the medium with chondrogenetic basal medium (DMEM, 1% ITS, 1% FBS, 2 mM L-Glutamine (Invitrogen; 35050061), 0.1 mM MEM non-essential amino acids (Invitrogen; 11140050), 1 mM Sodium Pyruvate (Invitrogen; 11360070), 50 U of penicillin, 50 μg / mL of streptomycin, and 50 μg / mL ascorbic acid phosphate (#A4034; Sigma Aldrich)), or chondrogenetic basal medium supplemented with chondrogenic factors (10 ng / mL BMP2, 10 ng / mL TGFβ1, 10 ng / mL GDF5). Thereafter, replace the medium every 2-3 days.

[0097] (2) Chondrogenesis induction protocol 2 (modified from Yamashita et al. (Stem Cell Reports. 2015 Mar 10;4(3):404-18. doi: 10.1016 / j.stemcr.2015.01.016. Epub 2015 Feb 26.), hereinafter referred to as "Conventional Method 2"). The culture medium of human vertebral plates differentiated from the SEES3 human ES cell line by steps 1-4 of Example 1(4-1) (Day 5) is replaced with the above basal chondrogenic medium supplemented with chondrogenic factors (10 ng / mL BMP2, 10 ng / mL TGFβ1, 10 ng / mL GDF5). The medium is then changed every 2-3 days. After 9 days (Day 14), the cartilage nodules are physically detached from the plate and transferred to a Petri dish or an uncoated low-adhesion surface plate for suspension culture. The medium is then changed every 2-3 days.

[0098] (3) Bone formation induction On Day 42 (after 37 days of culture in chondrogenic medium), the culture medium is replaced with osteogenesis medium (DMEM, 10% FBS, 50 U of penicillin, 50 mg / ml of streptomycin, 50 mg / ml of ascorbic acid, 10 mM β-glycerophosphate (#G9422; Sigma Aldrich), and 0.1 μM dexamethasone (#41-18861; Wako)). Separately, the culture medium is replaced with osteogenesis medium supplemented with polyunsaturated fatty acids (10 μM linoleic acid, 15 μM α-linolenic acid, 10 μM arachidonic acid, 15 μM docosahexaenoic acid), 100 ng / mL BMP2, and 1 μM SAG, which are bone-inducing factors. Thereafter, the culture medium is changed every 2-3 days.

[0099] (4) Histological analysis of cell aggregates cultured in chondrogenic medium Cell aggregates cultured on Day 42 in chondrogenesis medium were collected and fixed by immersion in 4% paraformaldehyde / phosphate buffer at 4°C for 16 hours. After 21 hours of processing using a sealed automated fixation and embedding system (Sakura FineTech Japan, Tissue-Tech VIP5 Junior), paraffin embedding was performed. The blocks were sectioned to 5 μm using a microtome. The sections were stretched in a 42°C water bath, placed on slides, and excess moisture was removed at 42°C before being thoroughly dried in a 37°C water bath. After thorough removal of paraffin and hydration by stepwise immersion in xylene, ethanol, and water, safranin O staining was performed.

[0100] (5) Histological analysis of cell aggregates cultured in chondrogenesis medium and osteogenesis medium Cell aggregates were collected on Day 70 after culturing in chondrogenesis medium and then in osteogenic medium. These aggregates were fixed by immersion in 4% paraformaldehyde / phosphate buffer at 4°C for 16 hours. After 21 hours of processing using a sealed automated fixation and embedding system (Sakura FineTech Japan, Tissue-Tech VIP5 Junior), paraffin embedding was performed. The blocks were sectioned to 5 μm using a microtome. The sections were stretched in a 42°C water bath, placed on slides, and excess moisture was removed at 42°C before being thoroughly dried in a 37°C water bath. After thorough removal of paraffin and hydration by stepwise immersion in xylene, ethanol, and water, safranin O staining and von Kossa staining were performed.

[0101] (6) Confirmation of calcification of cell masses based on the presence or absence of cartilage-inducing factors and bone-inducing factors After culturing in chondrogenesis medium, the culture was changed to osteogenesis medium and continued until Day 100. X-ray images (Softex, M-60 type) were taken of the wells containing cell aggregates.

[0102] 3-2 Results (1) Safranin O staining of cell aggregates cultured in chondrogenesis medium Figure 7 shows images of tissue sections of cell aggregates stained with safranin O on Day 42. (A) is an image from Conventional Method 1 without cartilage-inducing factors, (B) is an image from Conventional Method 1 with cartilage-inducing factors, and (C) is an image from Conventional Method 2 with cartilage-inducing factors. All cell aggregates were stained with safranin O, confirming that they had differentiated into cartilage. This result indicates that vertebral plate cells obtained by the manufacturing method of the present invention can form cartilage even without the use of cartilage-inducing factors.

[0103] (2) Safranin O staining and Kossa staining of cell aggregates cultured in basal osteogenesis medium and then in basal osteogenesis medium without bone induction factors. Figure 8 shows images of tissue sections of cell aggregates cultured in basal osteogenesis medium supplemented with cartilage-inducing factors, and then cultured on Day 42 in basal osteogenesis medium without bone-inducing factors, at Day 70, stained with safranin O and Kossa stain. (A) is the image cultured using conventional method 1, and (B) is the image cultured using conventional method 2. Both cell aggregates were stained a darker red with safranin O compared to the stained image of the cell aggregates at Day 42 (Figure 7), indicating that cartilage differentiation was progressing (upper left, lower). However, no calcified tissue stained with Kossa stain was observed (upper right).

[0104] (3) Safranin O staining and Kossa staining of cell aggregates cultured in basal osteogenesis medium containing bone-inducing factors after culturing in basal osteogenesis medium. Figure 9 shows images of tissue sections of cell aggregates on Day 70, cultured with safranin O and Kossa staining, obtained from vertebral plate cells produced by the manufacturing method of the present invention in basal chondrogenic medium, and then in basal osteogenesis medium containing bone inductors from Day 42 onwards. (A) is an image of cell aggregates cultured in basal osteogenesis medium containing bone inductors after being cultured in basal osteogenesis medium containing bone inductors using conventional method 1; (B) is an image of cell aggregates cultured in basal osteogenesis medium containing bone inductors after being cultured in basal chondrogenic medium containing bone inductors using conventional method 1; and (C) is an image of cell aggregates cultured in basal osteogenesis medium containing bone inductors after being cultured in basal osteogenesis medium containing bone inductors using conventional method 2. All cell aggregates showed the presence of calcified tissue stained black by Kossa staining (upper right, bottom). This result indicates that endochondral ossification (endochondral ossification) is reproduced in all cell aggregates.

[0105] (4) X-ray images of cell aggregates cultured in basal osteogenesis medium, and then in basal osteogenesis medium containing or not containing bone-inducing factors. Figure 10 shows X-ray images of cell aggregates at Day 100, obtained by culturing vertebral plate cells obtained by the manufacturing method of the present invention in a basic cartilage-forming medium with or without cartilage-inducing factors, and then culturing on Day 42 in a basic osteogenic medium with or without bone-inducing factors. In the figure, dark black areas indicate calcification sites. It was shown that calcification sites were present in the cell aggregates at Day 100 under all culture conditions. This result indicates that long-term culture induces calcification of cartilage-forming cell aggregates, regardless of the presence or absence of cartilage-inducing factors and bone-inducing factors.

[0106] [Example 4: Comparison of the production method of the present invention with a method for producing (inducing differentiation of) vertebral plate cells using a culture medium containing fetal bovine serum] 4-1 Experimental Method (1) Culture medium used The manufacturing method of the present invention used the synthetic medium (BIM) described in Example 1. As the bovine fetal serum-containing medium, DMEM / F12 containing 10% bovine fetal serum was used. As the control medium, Essential 8 Medium, a pluripotent stem cell maintenance medium, was used.

[0107] (2) Cell culture (vertebral disc induction) Human ES cells H9Zn2.3GFP strain (obtained from the University of Connecticut: Xin et al. Stem Cells Transl Med 3(10):1125-1137, 2014) were seeded at a seeding density of 10-20%. Inducing factors were added in the synthetic medium (BIM) described in Example 1 or in DMEM / F12 containing 10% fetal bovine serum, according to the procedure described in (4)(4-1) of Example 1, and the cells were cultured for 5 days. After the end of culture, the absorbance reflecting the cell number was measured using Cell Counting Kit-8 (Dojindo, 341-07761) and calculated as a ratio to the value at the start of culture. Multiple comparison tests were performed using the Dunnett method. As a control, cells were cultured for 5 days in Essential 8 Medium, a pluripotent stem cell maintenance medium, without the addition of inducing factors.

[0108] 4-2 Results The results are shown in Figure 11. The cell proliferation (survival rate) when human ES cells were differentiated into vertebral plate cells using the manufacturing method of the present invention with synthetic medium (BIM) was equivalent to the cell proliferation (survival rate) when human ES cells were differentiated into vertebral plate cells using a bovine fetal serum-containing medium instead of synthetic medium (BIM).

[0109] [Example 6: Exploration and functional analysis of novel bone formation transcription factor candidates] 6-1 Searching for Novel Candidate Osteogenesis Transcription Factors In the methods described in Examples 2(1) and (2), vertebral plate cells differentiated from human iPS cell line COL or human ES cell line H9Zn2.3GFP were transplanted under the renal capsule of NOD SCID mice. At 7 and 19 weeks post-transplantation, the mice were euthanized, and human iPS cell-derived endochondral ossification tissue was collected. Single-cell gene expression analysis (single-cell RNA sequencing analysis) was performed on all cells constituting this tissue. Furthermore, at 20 weeks post-transplantation, human ES cell-derived endochondral ossification tissue was collected, and single-cell multilayer analysis (multi-ohm analysis) was performed to simultaneously analyze open chromatin regions and gene expression at the single-cell level. Subsequently, (i) genes that showed osteoblast-specific expression in single-cell gene expression analysis, (ii) genes that showed osteoblast-specific expression in multi-ohm analysis, and (iii) transcription factors whose binding motifs were significantly enriched in osteoblast-specific open chromatin regions in multi-ohm analysis were extracted.

[0110] The results are shown in Figure 12. (A) is a Venn diagram showing the relationships between (i), (ii), and (iii) above, and (B) is a transcription factor that satisfies all of the conditions of (i), (ii), and (iii) above. Among the 10 transcription factors listed in (B), ZEB2, whose function in bone tissue is unknown, was found. Therefore, ZEB2 was selected as a candidate for a novel osteogenic transcription factor.

[0111] 6-2 Functional analysis by knockdown of ZEB2 Lentiviruses expressing short hairpin RNA (shRNA) or control shRNA against ZEB2 were generated and used to infect human mesenchymal stem cells (LONZA, PT-2501). For two days after infection, the cells were cultured in DMEM containing 10% fetal bovine serum and 2 μg / ml Puromycin (Sigma-Aldrich, P9620) to select infected cells. Subsequently, the cells were cultured in DMEM containing 10% fetal bovine serum, 50 μg / mL ascorbic acid (Sigma-Aldrich, A4034), 10 mM β-glycerophosphate (Sigma-Aldrich, G9422), 0.1 μM dexamethasone (Wako, 41-18861), and 100 ng / mL Bone morphogenetic protein-2 (BMP-2: Medtronic, 7510050) to induce osteoblast differentiation. mRNA was collected from the control shRNA group (ctrl) and the ZEB2 shRNA group (ZEB2) at the start of induction (d0) and 14 days after induction (d14), and the expression levels of the ZEB2, RUNX2, and SP7 genes were analyzed by RT-qPCR.

[0112] The results are shown in Figure 13. (A) shows the results for ZEB2, (B) shows the results for RUNX2, and (C) shows the results for SP7. In all cases, the expression level of the transcription factor decreased when ZEB2 was knocked down.

[0113] 6-3 Functional analysis of ZEB2 overexpression Retroviruses expressing the ZEB2 or GFP gene were generated and used to infect human mesenchymal stem cells (LONZA, PT-2501). As described above, infected cells were cultured for 2 days post-infection in DMEM containing 10% fetal bovine serum and 2 μg / ml blasticidin (Wako, 029-18701) and selected. Subsequently, osteoblast differentiation was induced, and mRNA was collected from the GFP-introduced group (ctrl) and the ZEB2-introduced group (ZEB2) at the start of induction (d0) and 14 days post-induction (d14). The expression levels of the ZEB2, RUNX2, and SP7 genes were analyzed by RT-qPCR.

[0114] The results are shown in Figure 14. (A) shows the results for ZEB2, (B) shows the results for RUNX2, and (C) shows the results for SP7. Overexpression of ZEB2 increased the expression levels of all transcription factors. These results clearly show that ZEB2 positively regulates osteoblast differentiation.

[0115] It should be noted that the present invention is not limited to the embodiments and examples described above, and various modifications are possible within the scope of the claims. Embodiments obtained by appropriately combining the technical means disclosed in different embodiments are also included within the technical scope of the present invention. Furthermore, all academic and patent documents mentioned herein are incorporated herein by reference.

Claims

1. A method for producing vertebral plate cells from pluripotent stem cells in a xeno-free and feeder-free culture system, comprising the following steps (1) to (4), characterized in that the inducing factors contained in the culture medium are not recombinant proteins: (1) A step to produce anterior primitive streaks by culturing pluripotent stem cells for 12 to 26 hours in a first differentiation medium containing only a Wnt signaling activator as an inducing factor. (2) After the completion of step (1), the first differentiation medium is replaced with a second differentiation medium containing only Wnt signaling activator, TGFβ signaling inhibitor, and BMP signaling inhibitor as inducing factors, and cultured for 12 to 26 hours to produce paraxial mesoderm cells. (3) After step (2) is completed, the second differentiation medium is replaced with a third differentiation medium containing only Wnt signaling inhibitors, TGFβ signaling inhibitors, and BMP signaling inhibitors as inducing factors, and cultured for 12 to 26 hours to produce somite cells, and (4) After the completion of step (3), the third differentiation medium is replaced with a fourth differentiation medium containing at least one selected from the group consisting of a Hedgehog signaling activator, a BMP signaling inhibitor, and a Wnt signaling inhibitor as an inducing factor, and cultured for 36 to 74 hours to produce vertebral plate cells.

2. The method according to claim 1, wherein DMEM / F12 medium supplemented with 0% to 2% ITS supplement, 0% to 2% NEAA, 0 μM to 100 μM 2-mercaptoethanol, and 0% to 2% B27 serum-free supplement is used as the basal medium.

3. The method according to claim 1 or 2, wherein the culture period of step (1) is until it is confirmed that the cells express at least one marker selected from the group consisting of TBXT and MIXL1, the culture period of step (2) is until it is confirmed that the cells express at least one marker selected from the group consisting of TBX6 and MSGN1, the culture period of step (3) is until it is confirmed that the cells express at least one marker selected from the group consisting of PARAXIS, PAX3 and FOXC2, and the culture period of step (4) is until it is confirmed that the cells express at least one marker selected from the group consisting of PAX1, PAX9, SOX9 and NKX3.

2.

4. The method according to any one of claims 1 to 3, wherein the vertebral plate cells are for in vivo transplantation.

5. A method for producing endochondral ossification tissue, comprising the steps of: producing vertebral plate cells by the method according to any one of claims 1 to 4; transplanting the obtained vertebral plate cells into a mammal other than a human; and excising tissue derived from the transplanted vertebral plate cells from the mammal.

6. A method for producing cartilage tissue, comprising the steps of: producing vertebral plate cells by the method described in any one of claims 1 to 4; and three-dimensionally culturing the obtained vertebral plate cells in a cartilage-forming basic medium that does not contain cartilage-inducing factors.

7. A method for producing endochondral ossification tissue, comprising the steps of: producing vertebral plate cells by the method described in any one of claims 1 to 4; producing cartilage tissue by three-dimensionally culturing the obtained vertebral plate cells in a basic culture medium for cartilage formation with or without cartilage-inducing factors; and three-dimensionally culturing the cartilage tissue in a basic culture medium for bone formation with or without bone-inducing factors.

8. A method for screening chondrogenesis control substances, comprising the steps of: producing vertebral plate cells by the method according to any one of claims 1 to 4; three-dimensional culturing the obtained vertebral plate cells in a chondrogenesis basic medium that does not contain cartilage-inducing factors, in the presence or absence of a test substance to form cartilage tissue; and selecting a test substance that increases or decreases the amount of cartilage in the cartilage tissue compared with cartilage tissue formed in the absence of the test substance.

9. A method for screening chondrogenesis-regulating substances, comprising the steps of: producing vertebral disc cells by the method according to any one of claims 1 to 4; transplanting the obtained vertebral disc cells into a mammal other than a human; administering a test substance to the mammal; excising tissue derived from the transplanted vertebral disc cells from the mammal; and selecting a test substance that increases or decreases the amount of cartilage in the transplanted tissue by comparing it with transplanted tissue excised from a mammal that has not been administered the test substance.

10. A method for screening chondrogenesis-regulating substances, comprising the steps of: producing vertebral disc cells by the method according to any one of claims 1 to 4; transplanting the obtained vertebral disc cells into a mammal other than a human; excising tissue derived from the transplanted vertebral disc cells from the mammal and transferring it to a culture system; contacting the transplanted tissue with a test substance; and selecting a test substance that increases or decreases the amount of cartilage in the transplanted tissue compared with transplanted tissue that has not been in contact with the test substance.

11. A method for screening bone formation control substances, comprising the steps of: producing vertebral plate cells by the method according to any one of claims 1 to 4; three-dimensional culturing of cartilage tissue differentiated from the obtained vertebral plate cells using a basic bone formation medium in the presence or absence of a test substance to form bone tissue; and selecting a test substance that increases or decreases bone mass in bone tissue by comparing it with bone tissue formed in the absence of the test substance.

12. A method for screening bone formation-regulating substances, comprising the steps of: producing vertebral plate cells by the method according to any one of claims 1 to 4; transplanting the obtained vertebral plate cells into a mammal other than a human; administering a test substance to the mammal; excising tissue derived from the transplanted vertebral plate cells from the mammal; and selecting a test substance that increases or decreases the bone mass of the transplanted tissue by comparing it with transplanted tissue excised from a mammal that has not been administered the test substance.

13. A method for screening bone formation-regulating substances, comprising the steps of: producing vertebral disc cells by the method according to any one of claims 1 to 4; transplanting the obtained vertebral disc cells into a mammal other than a human; excising tissue derived from the transplanted vertebral disc cells from the mammal and transferring it to a culture system; contacting the transplanted tissue with a test substance; and selecting a test substance that increases or decreases the bone mass of the transplanted tissue compared with transplanted tissue that has not been in contact with the test substance.

14. A method for screening bone formation regulatory substances, comprising the steps of: producing vertebral plate cells by the method according to any one of claims 1 to 4; three-dimensional culturing of cartilage tissue differentiated from the obtained vertebral plate cells using a basic osteogenic medium in the presence or absence of a test substance to form bone tissue; and selecting a test substance that increases or decreases the ZEB2 expression level in bone tissue by comparing it with bone tissue formed in the absence of the test substance.

15. A method for screening bone formation control substances according to claim 14, comprising the step of selecting a test substance that simultaneously increases or decreases the expression levels of ZEB2 and RUNX2, or ZEB2 and SP7, or ZEB2, RUNX2, and SP7 in bone tissue formed in the presence of the test substance, compared to bone tissue formed in the absence of the test substance.

16. A method for screening bone formation regulatory substances, comprising the steps of: producing vertebral disc cells by the method according to any one of claims 1 to 4; transplanting the obtained vertebral disc cells into a mammal other than a human; administering a test substance to the mammal; excising tissue derived from the transplanted vertebral disc cells from the mammal; and selecting a test substance that increases or decreases the ZEB2 expression level of the transplanted tissue by comparing it with transplanted tissue excised from a mammal that has not been administered the test substance.

17. A method for screening bone formation-regulating substances according to claim 16, comprising the step of selecting a test substance that simultaneously increases or decreases the expression levels of ZEB2 and RUNX2, or ZEB2 and SP7, or ZEB2, RUNX2, and SP7, in transplant tissue excised from a mammal administered the test substance, compared to transplant tissue excised from a mammal not administered the test substance.

18. A method for screening bone formation regulatory substances, comprising the steps of: producing vertebral disc cells by the method according to any one of claims 1 to 4; transplanting the obtained vertebral disc cells into a mammal other than a human; excising tissue derived from the transplanted vertebral disc cells from the mammal and transferring it to a culture system; contacting the transplanted tissue with a test substance; and selecting a test substance that increases or decreases the ZEB2 expression level of the transplanted tissue compared with transplanted tissue that has not been in contact with the test substance.

19. A method for screening bone formation-regulating substances according to claim 18, comprising the step of selecting a test substance that simultaneously increases or decreases the expression levels of ZEB2 and RUNX2, or ZEB2 and SP7, or ZEB2, RUNX2, and SP7 in transplanted tissue that has come into contact with the test substance, compared to transplanted tissue that has not come into contact with the test substance.

Citation Information

Patent Citations

  • Producing mesodermal cell types and methods of using the same

    US20180030410A1

  • Stepwise method for producing various cells from pluripotent stem cells

    WO2019177118A1